Science.gov

Sample records for beta chain gene

  1. Complete sequence of an HLA-dR beta chain deduced from a cDNA clone and identification of multiple non-allelic DR beta chain genes.

    PubMed Central

    Long, E O; Wake, C T; Gorski, J; Mach, B

    1983-01-01

    At least three polymorphic class II antigens are encoded in the human major histocompatibility complex (HLA): DR, DC and SB. cDNA clones encoding beta chains of HLA-DR antigen, derived from mRNA of a heterozygous B-cell line, were isolated and could be divided into four subsets, clearly distinct from cDNA clones encoding DC beta chains. Therefore, at least two non-allelic DR beta chain genes exist. The complete sequence of one of the DR beta chain cDNA clones is presented. It defines a putative signal sequence, two extracellular domains, a trans-membrane region and a cytoplasmic tail. Comparison with a DC beta chain cDNA clone revealed a homology of 70% between the two beta chains and that the two genes diverged under relatively little selective pressure. A set of amino acids conserved in immunoglobulin molecules was found to be identical in both DR and DC beta chains. Comparison of the DR beta chain sequence with the amino acid sequence of another DR beta chain revealed a homology of 87% and that most differences are single amino acid substitutions. Allelic polymorphism in DR beta chains has probably not arisen by changes in long blocks of sequence. PMID:11894954

  2. Sequence and evolution of HLA-DR7- and -DRw53-associated. beta. -chain genes

    SciTech Connect

    Young, J.A.T.; Wilkinson, D.; Bodmer, W.F.; Trowsdale, J.

    1987-07-01

    cDNA clones representing products of the DR7 and DRw53 ..beta..-chain genes were isolated from the human B-lymphoblastoid cell line MANN (DR7, DRw53, DQw2, DPw2). The DRw53..beta.. sequence was identical to a DRw53..beta.. sequence derived from cells with a DR4 haplotype. In contrast, the DR7..beta.. sequence was as unrelated to DR4..beta.. sequence as it was to other DR..beta..-related genes, except at the 3'-untranslated region. These results suggest that the DR7 and DR4 haplotypes may have been derived relatively recently from a common ancestral haplotype and that the DR4 and DR7 ..beta..-chain genes have undergone more rapid diversification in the ..beta..1 domains, most probably as a result of natural selection, than have the DRw53..beta..-chain genes. Short tracts of sequence within the DR7 and DRw53 ..beta..1 domains were shared with other DR..beta.. sequences, indicating that exchanges of genetic information between ..beta..1 domains of DR..beta..-related genes have played a part in their evolution. Serological analysis of mouse L-cell transfectants expressing surface HLA-DR7 molecules, confirmed by antibody binding and allelic sequence comparison, identified amino acid residues that may be critical to the binding of a monomorphic DR- and CP-specific monoclonal antibody.

  3. Sp3 proteins negatively regulate beta myosin heavy chain gene expression during skeletal muscle inactivity.

    PubMed

    Tsika, Gretchen; Ji, Juan; Tsika, Richard

    2004-12-01

    In adult skeletal muscle, beta myosin heavy chain (betaMyHC) gene expression is primarily restricted to slow type I fibers; however, its expression is down-regulated in response to muscle inactivity. Little is known about the signaling pathways and transcription factors that mediate this important functional response. This study demonstrates that increased binding of Sp3 to GC-rich elements in the betaMyHC promoter is a critical event in down-regulation of betaMyHC gene expression under non-weight-bearing conditions. Conversely, binding of Sp3 to these elements decreased while Sp1 binding increased with nuclear extracts from plantaris muscle exposed to mechanical overload, a stimulus that increases betaMyHC gene expression. In addition, these experiments revealed the existence of an Sp4-DNA binding complex when using adult skeletal muscle nuclear extract was used but not when nuclear extracts from cultured myotubes were used. Sp3 proteins are competitive inhibitors of Sp1-mediated betaMyHC reporter gene transactivation in both Drosophila SL-2 and mouse C2C12 myotubes. Sp4 is a weak activator of betaMyHC gene expression in SL-2 cells, which lack endogenous Sp1 activity, but does not activate betaMyHC gene expression in C2C12 myotubes, which have high levels of Sp1. These results suggest that competitive binding of Sp family proteins regulate betaMyHC gene transcription in response to altered neuromuscular activity. PMID:15572681

  4. Physical mapping of the human T-cell antigen receptor (TCR) {beta}-chain gene complex

    SciTech Connect

    Yashim, Y.; So, A.K.

    1994-09-01

    The genetic variation of the TCR loci and their contribution to autoimmune diseases is poorly defined, in direct contrast to the clear examples of disease association with the Class I and II alleles of the major histocompatibility complex. We have therefore started to determine the gene organization and polymorphism of the TCR {beta} locus. Yeast artificial chromosomes (YACs) were used to construct a physical map of the germline human TCR {beta}-chain gene complex. Variable gene (V{beta}) sequences for the 25 known V{beta} subfamilies were amplified by PCR and were used as probes to screen a YAC library. Five positive YACs were identified. YACs designated B3, E11 and H11 of sizes 820, 400 and 600 kbp, respectively, were analyzed for their V{beta} content by pulse-field gel electrophoresis (PFGE). YAC B3 was found to contain all 25 V{beta} subfamilies, E11 for 14 and H11 for 7. B3 was also positive for the constant region genes. Restriction enzyme mapping of B3 located V{beta} and C{beta} gene regions to four Sfi I fragments of 280, 110, 90 and 125 kbp, and was in accordance with published data. The data thus showed that YAC B3 encoded a complete and unrearranged TCR {beta}-gene locus. The map was further resolved by locating restriction sites for Sal I and Bssll II on B3. Fluorescent in situ hybridization to human metaphase chromosomes localized B3 to chromosome 7q35. However, two additional signals were obtained: one attributable to V{beta} orphon cluster on chromosome 9q21; the second to the long arm of chromosome 2. PCR amplification of a chromosome 2 somatic cell hybrid using primers for all 25 V{beta} gene families revealed the signal was not attributable to a second orphon cluster. It is suggested that B3 is a chimeric YAC with an intact TCR {beta} locus flanked by chromosome 2 sequences. The determination of the TCR genomic organization will help extend studies of the role T-cells play in autoimmune diseases.

  5. Characterization of horse (Equus caballus) T-cell receptor beta chain genes

    SciTech Connect

    Schrenzel, M.D.; Watson, J.L.; Ferrick, D.A.

    1994-12-31

    Genes encoding the horse (Equus caballus) T-cell receptor beta chain (TCRB) were cloned and characterized. Of 33 cDNA clones isolated from the mesenteric lymph node, 30 had functionally rearranged gene segments, and three contained germline sequences. Sixteen unique variable segments (TCRBV), 14 joining genes (TCRBJ), and two constant region genes (TCRBC) were identified. Horse TCRBV were grouped into nine families based on similarity to human sequences. TCRBV2 and TCRBV12 were the most commonly represented horse families. Analysis of predicted protein structure revealed the presence of conserved regions similar to those seen in TCRB of other species. A decanucleotide promoter sequence homologous to those found in humans and mice was located in the 5{prime} untranslated region of one horse gene. Germline sequences included the 5{prime} region of the TCRBD2 gene with flanking heptamer/nonamer recombination signals and portions of the TCRBJ2-C2 intro. Southern blot hybridizations demonstrated restriction fragment length polymorphisms at the TCRBC locus among different horse breeds.

  6. Transcription of T cell receptor beta-chain genes is controlled by a downstream regulatory element.

    PubMed Central

    Krimpenfort, P; de Jong, R; Uematsu, Y; Dembic, Z; Ryser, S; von Boehmer, H; Steinmetz, M; Berns, A

    1988-01-01

    To characterize cis-acting elements controlling the expression of T cell receptor beta-chains we generated a number of transgenic mouse lines harboring a rearranged T cell receptor beta-chain with different extensions of 5' and 3' flanking sequences. Transcriptional analysis of transgenic mice carrying these clones showed that sequences located downstream of the polyadenylation signal of the C beta 2 region are indispensable for expression in transgenic mice. The sequences conferring enhancer activity in this fragment were further defined by transient CAT assays. Strong enhancer activity was found to reside in a 550 bp fragment located 5 kb downstream from C beta 2. The nucleotide sequence of this fragment revealed a number of oligonucleotide motifs characteristic for enhancer elements. Images PMID:3396541

  7. Prognostic implications of novel beta cardiac myosin heavy chain gene mutations that cause familial hypertrophic cardiomyopathy.

    PubMed Central

    Anan, R; Greve, G; Thierfelder, L; Watkins, H; McKenna, W J; Solomon, S; Vecchio, C; Shono, H; Nakao, S; Tanaka, H

    1994-01-01

    Three novel beta cardiac myosin heavy chain (MHC) gene missense mutations, Phe513Cys, Gly716Arg, and Arg719Trp, which cause familial hypertrophic cardiomyopathy (FHC) are described. One mutation in exon 15 (Phe513Cys) does not alter the charge of the encoded amino acid, and affected family members have a near normal life expectancy. The Gly716Arg mutation (exon 19; charge change of +1) causes FHC in three family members, one of whom underwent transplantation for heart failure. The Arg719Trp mutation (exon 19; charge change of -1) was found in four unrelated FHC families with a high incidence of premature death and an average life expectancy in affected individuals of 38 yr. A comparable high frequency of disease-related deaths in four families with the Arg719Trp mutation suggests that this specific gene defect directly accounts for the observed malignant phenotype. Further, the significantly different life expectancies associated with the Arg719Trp vs. Phe513Cys mutation (P < 0.001) support the hypothesis that mutations which alter the charge of the encoded amino acid affect survival more significantly than those that produce a conservative amino acid change. Images PMID:8282798

  8. Association study of schizophrenia and IL-2 receptor {beta} chain gene

    SciTech Connect

    Nimgaonkar, V.L.; Yang, Z.W.; Zhang, X.R.; Brar, J.S.

    1995-10-09

    A case-control association study was conducted in Caucasian patients with schizophrenia (DSM-III-R, n = 42) and unaffected controls (n = 47) matched for ethnicity and area of residence. Serum interleukin-2 receptor (IL-2R) concentrations, as well as a dinucleotide repeat polymorphism in the IL-2RP chain gene, were examined in both groups. No significant differences in IL-2R concentrations or in the distribution of the polymorphism were noted. This study does not support an association between schizophrenia and the IL-2RP gene locus, contrary to the suggestive evidence from linkage analysis in multicase families. 17 refs., 2 tabs.

  9. A homozygous nonsense mutation in the {beta}3 chain gene of laminin 5 (LAMB3) in herlitz junctional epidermolysis bullosa

    SciTech Connect

    Pulkkinen, L.; Christiano, A.M.; Uitto, J.

    1994-11-15

    Herlitz junctional epidermolysis bullosa (H-JEB) is a severe autosomal recessive disorder characterized by blister formation within the dermal-epidermal basement membrane. Based on immunofluorescence analysis recognizing laminin 5 epitopes (previously known as nicein/kalinin), the genes for this lamina lucida protein have been proposed as candidate genes in H-JEB. Amplification of mRNA by RT-PCR, followed by direct nucleotide sequencing, revealed a homozygous C-to T transition resulting in a premature termination codon (CGA{r_arrow}TGA) on both alleles. This mutation was verified at the genomic DNA level, and both parents were shown to be heterozygous carriers of the same mutation. This is the first description of a mutation in the laminin {beta}3 chain gene (LAMB3) of laminin 5 in an H-JEB patient. 15 refs., 2 figs.

  10. Rearrangement of kappa-chain and T-cell receptor beta-chain genes in malignant lymphomas of "T-cell" phenotype.

    PubMed Central

    Sheibani, K.; Wu, A.; Ben-Ezra, J.; Stroup, R.; Rappaport, H.; Winberg, C.

    1987-01-01

    Detection of immunoglobulin gene rearrangements by molecular hybridization is considered to be a highly sensitive approach to the evaluation of clonality of B-cell-derived neoplasms. Like monoclonal surface immunoglobulin in B cells, which serves as a reliable immunophenotypic marker for clonality, rearrangement of the genes encoding immunoglobulin light chains has been accepted as a reliable genotypic marker for the presence of a clonal expansion of B lymphocytes. The authors now report 3 cases of non-Hodgkin's lymphoma that were immunologically classified as having a T-cell phenotype and in which, in addition to rearrangements of the T-cell receptor beta-chain gene, a rearrangement of an immunoglobulin light-chain gene was clearly identified by Southern blot hybridization. The results demonstrate that the data obtained by molecular hybridization should be interpreted with caution when the immunogenetic findings do not correlate with immunophenotypic expression, and that the results of molecular genetics studies should be interpreted in conjunction with morphologic and immunologic findings. Images Figure 11 Figure 2 Figure 3 PMID:3118722

  11. Cloning of the {beta}3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa

    SciTech Connect

    Pulkkinen, L.; Christiano, A.M.; Uitto, J.

    1995-01-01

    Laminin 5 consists of three polypeptides, {alpha}3, {beta}3, and {gamma}2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping {lambda} phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 hp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previously characterized LAMB1 gene revealed that LAMB3 was considerably more compact. Knowledge of the exon-intron organization of the LAMB3 gene will facilitate elucidation of mutations in patients with the junctional forms of epidermolysis bullosa, some of which have been associated with mutations in the laminin 5 genes. 33 refs., 3 figs., 2 tabs.

  12. Cloning of the beta 3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa.

    PubMed

    Pulkkinen, L; Gerecke, D R; Christiano, A M; Wagman, D W; Burgeson, R E; Uitto, J

    1995-01-01

    Laminin 5 consists of three polypeptides, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping lambda phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 bp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previously characterized LAMB1 gene revealed that LAMB3 was considerably more compact. Knowledge of the exon-intron organization of the LAMB3 gene will facilitate elucidation of mutations in patients with the junctional forms of epidermolysis bullosa, some of which have been associated with mutations in the laminin 5 genes. PMID:7774918

  13. Detection of sequence variants in the gene encoding the beta 3 chain of laminin 5 (LAMB3).

    PubMed

    Pulkkinen, L; McGrath, J A; Christiano, A M; Uitto, J

    1995-01-01

    Laminin 5, a candidate gene/protein system for mutations in the junctional forms of epidermolysis bullosa (JEB), consists of three polypeptides encoded by the LAMA3, LAMB3, and LAMC2 genes. In this study, primer pairs for the amplification of the complete cDNA as well as 22 exons of the LAMB3 gene encoding the entire beta 3 chain of laminin 5, were established. The primers for amplification of individual exons from genomic DNA were placed at least 50 bp away from the exon-intron borders in the flanking intronic sequences. For amplification of cDNA generated by RT-PCR, eight primer pairs covering overlapping segments of mRNA were used. The amplified sequences were used to study sequence variations of the LAMB3 gene in patients with JEB and unrelated individuals using heteroduplex analysis. Nine out of 13 JEB patients examined showed heteroduplexes in at least one of the PCR products, indicating the existence of two variable alleles in their DNA. Sequence analyses revealed putative pathogenetic mutations in seven of the JEB patients, while four of the heteroduplexes resulted from polymorphisms, reflecting a single basepair substitution. The results demonstrate that this method is useful in the detection of JEB mutations, as well as polymorphisms in the LAMB3 gene. PMID:7550237

  14. Expression and sequences of T cell antigen receptor beta-chain genes in the thymus at an early stage after sublethal irradiation

    SciTech Connect

    Yuuki, H.; Yoshikai, Y.; Kishihara, K.; Matsuzaki, G.; Ayukawa, K.; Nomoto, K.

    1989-05-15

    The sequential appearance of the thymocyte subpopulations and TCR gene messages occurred in the thymus of AKR mice (H-2k, Mlsa) from 7 to 14 days after sublethal irradiation. The thymocytes on day 7 after irradiation were composed of a large number of CD4+CD8+ blast-like cells and a relatively high proportion of CD4-CD8- cells (15 to 25%) but few CD3highCD4+CD8-/CD4-CD8+ cells. Approximately 22% of the CD4-CD8- cells were CD3high and -27% of the CD3highCD4-CD8- cells (-6% of whole CD4-CD8- cells) were F23.1+. The thymocytes on day 7 expressed a large amount of gamma- and delta-chain gene transcripts but reduced levels of alpha- and beta-chain gene transcripts. The V gene repertoire of 18 functional beta-chain cDNA derived from the thymocytes on day 7 was compared with those of 20 functional beta-chain cDNA derived from the thymocytes on day 14 which were composed of a large number of CD3lowCD4+CD8+ small-sized cells and a small number of CD3highCD4+CD8- cells. It is noteworthy that the distribution of V beta genes expressed in the thymocytes on day 7 was much the same as that in the thymocytes on day 14 but significantly different from that in normal BALB/c thymocytes as previously described. Interestingly, neither V beta 8.1 nor V beta 6 genes, which are important for recognition of the product of the Mlsa locus, was detected in these two cDNA libraries. These results suggest that clonal selection of TCR V beta repertoire, irrespective of positive or negative selection, appears to occur at the early stage of T cell differentiation, i.e., on the blast-like CD4+CD8+ thymocytes.

  15. In vivo regulation of the beta-myosin heavy chain gene in soleus muscle of suspended and weight-bearing rats

    NASA Technical Reports Server (NTRS)

    Giger, J. M.; Haddad, F.; Qin, A. X.; Baldwin, K. M.

    2000-01-01

    In the weight-bearing hindlimb soleus muscle of the rat, approximately 90% of muscle fibers express the beta-myosin heavy chain (beta-MHC) isoform protein. Hindlimb suspension (HS) causes the MHC isoform population to shift from beta toward the fast MHC isoforms. Our aim was to establish a model to test the hypothesis that this shift in expression is transcriptionally regulated through specific cis elements of the beta-MHC promoter. With the use of a direct gene transfer approach, we determined the activity of different length beta-MHC promoter fragments, linked to a firefly luciferase reporter gene, in soleus muscle of control and HS rats. In weight-bearing rats, the relative luciferase activity of the longest beta-promoter fragment (-3500 bp) was threefold higher than the shorter promoter constructs, which suggests that an enhancer sequence is present in the upstream promoter region. After 1 wk of HS, the reporter activities of the -3500-, -914-, and -408-bp promoter constructs were significantly reduced ( approximately 40%), compared with the control muscles. However, using the -215-bp construct, no differences in promoter activity were observed between HS and control muscles, which indicates that the response to HS in the rodent appears to be regulated within the -408 and -215 bp of the promoter.

  16. The Y chromosomal fertility factor Threads in Drosophila hydei harbors a functional gene encoding an axonemal dynein beta heavy chain protein.

    PubMed Central

    Kurek, R; Reugels, A M; Glätzer, K H; Bünemann, H

    1998-01-01

    To understand the contradiction between megabase-sized lampbrush loops and putative protein encoding genes both associated with the loci of Y chromosomal fertility genes of Drosophila on the molecular level, we used PCR-mediated cloning to identify and isolate the cDNA sequence of the Y chromosomal Drosophila hydei gene DhDhc7(Y). Alignment of the sequences of the putative protein DhDhc7(Y) and the outer arm dynein beta heavy chain protein DYH2 of Tripneustes gratilla shows homology over the entire length of the protein chains. Therefore the proteins can be assumed to fulfill orthologous functions within the sperm tail axonemes of both species. Functional dynein beta heavy chain molecules, however, are necessary for the assembly and attachment of outer dynein arms within the sperm tail axoneme. Localization of DhDhc7(Y) to the fertility factor Threads, comprising at least 5.1 Mb of transcriptionally active repetitive DNA, results from an infertile Threads- mutant where large clusters of Threads specifically transcribed satellites and parts of DhDhc7(Y) encoding sequences are missing simultaneously. Consequently, the complete lack of the outer dynein arms in Threads- males most probably causes sperm immotility and hence infertility of the fly. Moreover, preliminary sequence analysis and several other features support the hypothesis that DhDhc7(Y) on the lampbrush loops Threads in D. hydei and Dhc-Yh3 on the lampbrush loops kl-5 in Drosophila melanogaster on the heterochromatic Y chromosome of both species might indeed code for orthologous dynein beta heavy chain proteins. PMID:9649526

  17. Identification of clonally rearranged T-cell receptor beta chain genes in HTLV-I carriers as a potential instrument for early detection of neoplasia.

    PubMed

    Sales, M M; Bezerra, C N A; Hiraki, Y; Melo, N B; Rebouças, N A

    2005-05-01

    We analyzed the genetic recombination pattern of the T-cell receptor beta-chain gene (TCR-beta) in order to identify clonal expansion of T-lymphocytes in 17 human T-lymphotropic virus type I (HTLV-I)-positive healthy carriers, 7 of them with abnormal features in the peripheral blood lymphocytes. Monoclonal or oligoclonal expansion of T-cells was detected in 5 of 7 HTLV-I-positive patients with abnormal lymphocytes and unconfirmed diagnosis by using PCR amplification of segments of TCR-beta gene, in a set of reactions that target 102 different variable (V) segments, covering all members of the 24 V families available in the gene bank, including the more recently identified segments of the Vbeta-5 and Vbeta-8 family and the two diversity beta segments. Southern blots, the gold standard method to detect T-lymphocyte clonality, were negative for all of these 7 patients, what highlights the low sensitivity of this method that requires a large amount of very high quality DNA. To evaluate the performance of PCR in the detection of clonality we also analyzed 18 leukemia patients, all of whom tested positive. Clonal expansion was not detected in any of the negative controls or healthy carriers without abnormal lymphocytes. In conclusion, PCR amplification of segments of rearranged TCR-beta is reliable and highly suitable for the detection of small populations of clonal T-cells in asymptomatic HTLV-I carriers who present abnormal peripheral blood lymphocytes providing an additional instrument for following up these patients with potentially higher risk of leukemia. PMID:15917950

  18. Junctional region sequences of T-cell receptor beta-chain genes expressed by pathogenic anti-DNA autoantibody-inducing helper T cells from lupus mice: possible selection by cationic autoantigens.

    PubMed Central

    Adams, S; Leblanc, P; Datta, S K

    1991-01-01

    We rescued from the spleens of 10 (SWR x NZB)F1 (SNF1) mice with lupus nephritis the T cells that were activated in vivo and cloned 268 T-cell lines and hybridomas. Only 12% of these T-cell clones had the functional ability to preferentially augment the production of pathogenic anti-DNA autoantibodies. Among these, 16 helper T-cell (Th-cell) clones that were mostly CD4+ and had the strongest autoantibody-inducing ability were analyzed for T-cell receptor (TCR) beta-chain gene usage. Seven of the 16 Th-cell clones expressed beta-chain variable region (V beta) V beta 8 (8.2 or 8.3) genes and three expressed V beta 4, whereas two clones each used a V beta 1 or V beta 2 or V beta 14 gene, suggesting some restriction in TCR gene usage. Although heterogeneous, the V-D-J junctional region sequences of TCR beta-chain genes used by these Th-cell clones invariably encoded one or more negatively charged residues (aspartic or glutamic acid) that had been generated in most cases by unspecified nucleotide (N) additions. Representative pathogenic autoantibody-inducing Th-cell clones could rapidly induce the development of lupus nephritis when injected into young prenephritic SNF1 mice. The pathogenic autoantibody-inducing Th cells expressing the anionic residues in their TCR beta-chain junctions (complementarity-determining region CDR3) were probably selected by some cationic autoantigenic peptide presented by the anti-DNA B cells they preferentially helped. These results offer a clue regarding the nature of the primary autoantigen that may drive the pathogenic autoimmune response in lupus. Images PMID:1837146

  19. Conserved structure of amphibian T-cell antigen receptor beta chain.

    PubMed

    Fellah, J S; Kerfourn, F; Guillet, F; Charlemagne, J

    1993-07-15

    All jawed vertebrates possess well-differentiated thymuses and elicit T-cell-like cell-mediated responses; however, no surface T-cell receptor (TCR) molecules or TCR genes have been identified in ectothermic vertebrate species. Here we describe cDNA clones from an amphibian species, Ambystoma mexicanum (the Mexican axolotl), that have sequences highly homologous to the avian and mammalian TCR beta chains. The cloned amphibian beta chain variable region (V beta) shares most of the structural characteristics with the more evolved vertebrate V beta and presents approximately 56% amino acid identities with the murine V beta 14 and human V beta 18 families. The two different cloned axolotl beta chain joining regions (J beta) were found to have conserved all the invariant mammalian J beta residues, and in addition, the presence of a conserved glycine at the V beta-J beta junction suggests the existence of diversity elements. The extracellular domains of the two axolotl beta chain constant region isotypes C beta 1 and C beta 2 show an impressively high degree of identity, thus suggesting that a very efficient mechanism of gene correction has been in operation to preserve this structure at least from the early tetrapod evolution. The transmembrane axolotl C beta domains have been less well conserved when compared to the mammalian C beta but they do maintain the lysine residue that is thought to be involved in the charged interaction between the TCR alpha beta heterodimer and the CD3 complex. PMID:8341702

  20. A joining-diversity-joining complex generated by inversion mechanism and a variable-diversity complex in the beta-chain gene of the human T-cell receptor.

    PubMed Central

    Ikuta, K; Ogura, T; Shimizu, A; Honjo, T

    1986-01-01

    We have analysed an inactive allele of the beta-chain gene of the T-cell receptor in a human T-cell line HPB-ALL. Comparison with germline sequences showed that HPB-ALL has a joining (J)-diversity (D)-J complex recombined in head-to-head configuration and a variable (V)-D complex in tail-to-tail configuration. These results demonstrate that the inversion mechanism functions in the beta-chain gene of the T-cell receptor. The presence of the V-D complex suggests that V-D recombination could occur prior to D-J recombination although there is no definite proof that the V-D complex is an intermediate to form the V-D-J complex. Images PMID:3487774

  1. The structure, rearrangement, and ontogenic expression of DB and JB gene segments of the Mexican axolotl T-cell antigen receptor beta chain (TCRB).

    PubMed

    Kerfourn, F; Charlemagne, J; Fellah, J S

    1996-01-01

    We sequenced a total of 189 independent rearrangements in which the VB7.1 element is associated with CB1 (99 clones) or CB2 (90 clones) isotypes of the T-cell receptor (TCR) beta chain in the Mexican axolotl. Three stages of development were analyzed: 2.5 months, 10 months, and 25 months. Three JB1 segments were associated with the VB-CB1 rearrangements and six JB2 segments with VB-CB2. As in other vertebrates, some amino acid positions were conserved in all Jbetas (e. g., Phe-108, Gly-109, Gly-111, Thr-112, and Val-116). Two 11 nucleotides DB-like sequences, differed by one (A or T) central residue and could be productively read in the three putative reading frames. Most of the DB1 and JB1 segments were in the VB-CB1 clones, and most of the DB2 and JB2 segments were in the VB-CB2 clones, suggesting that the TCRB locus is organized into independent DB-JB-CB clusters that used the same collection of VB segments. About 40% of the beta-chain VDJ junctions in 2.5-month-old larvae had N nucleotides, compared with about 73% in 10 - 25-month old animals. The beta-chain VDJ junctions had about 30% of defective rearrangements at all stages of development, which could be due to the slow rate of cell division in the axolotl lymphoid organs, and the large genome in this urodele. Many of the axolotl CDRbeta3 sequences deduced for in frame VDJ rearrangements are the same in animals of different origins. Such redundancy could be a statistical effect due to the small number of thymocytes in the developing axolotl, rather than to some bias due to junctional preferences. PMID:8753858

  2. Same. beta. -globin gene mutation is present on nine different. beta. -thalassemia chromosomes in a Sardinian population

    SciTech Connect

    Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

    1987-05-01

    The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

  3. Structure and diversity of the T cell antigen receptor beta-chain in a teleost fish.

    PubMed

    Partula, S; de Guerra, A; Fellah, J S; Charlemagne, J

    1995-07-15

    Cell-mediated immunity (e.g., allograft rejection) is found in all vertebrates, and these reactions are known to depend on thymus-derived cells in amphibian, avian, and mammalian species. The participation of peripheral T cell-like lymphocytes subpopulations to fish immunity is now well documented, but the developmental origin, migration, and peripheral tissue distribution of these cells remain practically unknown. This is mainly due to the difficulty of efficiently thymectomizing fish at an early stage of development and to the lack of Ab strictly specific for thymocytes and T cell surface Ag. One strategy for analyzing T cell biology in fish would be to characterize the genes encoding polypeptides homologous to the TCR molecules. This report describes cDNA clones from the rainbow trout (Oncorhynchus mykiss) that have sequences very similar to amphibian, avian, and mammalian TCR beta-chains. Three complete trout V beta segments belonging to different families were analyzed; one of them had limited amino acid sequence similarity to the human V beta 20 family. The 10 trout beta-chain-joining segments all retain the invariant mammalian J beta residues, and comparison of 66 V beta-J beta junctions led to the identification of a D beta-like sequence (GGACAGGG) that is shorter than but very similar to the chicken D beta and mammalian D beta 1 sequences. There is considerable diversity at the V beta-D beta and D beta-J beta junctions, suggesting the presence of N-nucleotides. The trout C beta extracellular domain is shorter than mammalian C beta, and the hinge region has no cysteine residue. The transmembrane C beta domain contains a lysine residue that in mammals is thought to be involved in charged interactions with members of the CD3 complex. PMID:7608547

  4. The proportion of hybrid heterodimers in homozygous or doubly heterozygous beta chain variant hemoglobinopathies associated with alpha chain hemoglobin variants.

    PubMed

    Krauss, J S

    2000-10-01

    Four alpha genes exist on chromosome 16, but one or more of these genes can be deleted in association with Hemoglobin (Hb)G-Philadelphia in cis to alpha-thalassemia-2 in African-Americans. Therefore, the proportion of HbG-Philadelphia in HbG heterozygotes is trimodal at about 25% for alphaGalpha/alpha alpha, 33% for alphaG-/alpha alpha, and 50% for alphaG-/alpha alpha in patients with HbA. Those who are homozygous or doubly heterozygous for beta chain variants (betaX2 or betaXbetaY) have neither HbA nor the alpha chain variant (alphaX2 betaA2), but have hybrid heterodimers (alphaX2 betaX2). The proportion of hybrid heterodimers here should also be trimodal mirroring alpha gene status. Eleven patients were identified: 4 with Hb SSG, 3 with Hb SCG, and 1 each with Hb OCG, HbSSMontgomery, HbSSChicago, and HbSSBourmedes. Heterodimer proportions were: 43.3 +/- 1.5, 33.5 +/- 2.3, and 15.8 +/- 1.1% for 2, 3, and 4 respective alpha genes which had been studied in 8/11 of the patients (r = 0.98), implying that the prime determinant of the proportion of hybrid heterodimers in this patient group is the number of functional alpha genes. PMID:11045763

  5. Energetic, Structural, and Antimicrobial Analyses of [beta]-Lactam Side Chain Recognition by [beta]-Lactamases

    SciTech Connect

    Caselli, E.; Powers, R.A.; Blaszczak, L.C.; Wu, C.Y.E.; Prati, F.; Shoichet, B.K.

    2010-03-05

    Penicillins and cephalosporins are among the most widely used and successful antibiotics. The emergence of resistance to these {beta}-lactams, most often through bacterial expression of {beta}-lactamases, threatens public health. To understand how {beta}-lactamases recognize their substrates, it would be helpful to know their binding energies. Unfortunately, these have been difficult to measure because {beta}-lactams form covalent adducts with {beta}-lactamases. This has complicated functional analyses and inhibitor design. To investigate the contribution to interaction energy of the key amide (R1) side chain of {beta}-lactam antibiotics, eight acylglycineboronic acids that bear the side chains of characteristic penicillins and cephalosporins, as well as four other analogs, were synthesized. These transition-state analogs form reversible adducts with serine {beta}-lactamases. Therefore, binding energies can be calculated directly from K{sub i} values. The K{sub i} values measured span four orders of magnitude against the Group I {beta}-lactamase AmpC and three orders of magnitude against the Group II {beta}-lactamase TEM-1. The acylglycineboronic acids have K{sub i} values as low as 20 nM against AmpC and as low as 390 nM against TEM-1. The inhibitors showed little activity against serine proteases, such as chymotrypsin. R1 side chains characteristic of {beta}-lactam inhibitors did not have better affinity for AmpC than did side chains characteristic of {beta}-lactam substrates. Two of the inhibitors reversed the resistance of pathogenic bacteria to {beta}-lactams in cell culture. Structures of two inhibitors in their complexes with AmpC were determined by X-ray crystallography to 1.90 {angstrom} and 1.75 {angstrom} resolution; these structures suggest interactions that are important to the affinity of the inhibitors. Acylglycineboronic acids allow us to begin to dissect interaction energies between {beta}-lactam side chains and {beta}-lactamases. Surprisingly

  6. Unexpectedly Low Mutation Rates in Beta-Myosin Heavy Chain and Cardiac Myosin Binding Protein Genes in Italian Patients With Hypertrophic Cardiomyopathy

    PubMed Central

    Roncarati, Roberta; Latronico, Michael VG; Musumeci, Beatrice; Aurino, Stefania; Torella, Annalaura; Bang, Marie-Louise; Jotti, Gloria Saccani; Puca, Annibale A; Volpe, Massimo; Nigro, Vincenzo; Autore, Camillo; Condorelli, Gianluigi

    2011-01-01

    Hypertrophic cardiomyopathy (HCM) is the most common genetic cardiac disease. Fourteen sarcomeric and sarcomere-related genes have been implicated in HCM etiology, those encoding β-myosin heavy chain (MYH7) and cardiac myosin binding protein C (MYBPC3) reported as the most frequently mutated: in fact, these account for around 50% of all cases related to sarcomeric gene mutations, which are collectively responsible for approximately 70% of all HCM cases. Here, we used denaturing high-performance liquid chromatography followed by bidirectional sequencing to screen the coding regions of MYH7 and MYBPC3 in a cohort (n = 125) of Italian patients presenting with HCM. We found 6 MHY7 mutations in 9/125 patients and 18 MYBPC3 mutations in 19/125 patients. Of the three novel MYH7 mutations found, two were missense, and one was a silent mutation; of the eight novel MYBPC3 mutations, one was a substitution, three were stop codons, and four were missense mutations. Thus, our cohort of Italian HCM patients did not harbor the high frequency of mutations usually found in MYH7 and MYBPC3. This finding, coupled to the clinical diversity of our cohort, emphasizes the complexity of HCM and the need for more inclusive investigative approaches in order to fully understand the pathogenesis of this disease. J. Cell. Physiol. 226: 2894–2900, 2011. © 2011 Wiley-Liss, Inc. PMID:21302287

  7. Luteal expression of cytochrome P450 side-chain cleavage, steroidogenic acute regulatory protein, 3beta-hydroxysteroid dehydrogenase, and 20alpha-hydroxysteroid dehydrogenase genes in late pregnant rats: effect of luteinizing hormone and RU486.

    PubMed

    Stocco, C O; Chedrese, J; Deis, R P

    2001-10-01

    A decrease in serum progesterone at the end of pregnancy is essential for the induction of parturition in rats. We have previously demonstrated that LH participates in this process through: 1) inhibiting 3beta-hydroxysteroid dehydrogenase (3beta-HSD) activity and 2) stimulating progesterone catabolism by inducing 20alpha-hydroxysteroid dehydrogenase (20alpha-HSD) activity. The objective of this investigation was to determine the effect of LH and progesterone on the luteal expression of the steroidogenic acute regulatory protein (StAR), cytochrome P450 side-chain cleavage (P450(scc)), 3beta-HSD, and 20alpha-HSD genes. Gene expression was analyzed by Northern blot analysis 24 and 48 h after administration of LH or vehicle on Day 19 of pregnancy. StAR and 3beta-HSD mRNA levels were lower in LH-treated rats than in rats administered with vehicle at both time points studied. P450(scc) mRNA levels were unaffected by LH. The 20alpha-HSD mRNA levels were not different between LH and control rats 24 h after treatment; however, greater expression of 20alpha-HSD, with respect to controls, was observed in LH-treated rats 48 h after treatment. Luteal progesterone content dropped in LH-treated rats at both time points studied, whereas serum progesterone decreased after 48 h only. In a second set of experiments, the anti-progesterone RU486 was injected intrabursally on Day 20 of pregnancy. RU486 had no effect on 3beta-HSD or P450(scc) expression but increased 20alpha-HSD mRNA levels after 8 h treatment. In conclusion, the luteolytic effect of LH is mediated by a drop in StAR and 3beta-HSD expression without effect on P450(scc) expression. We also provide the first in vivo evidence indicating that a decrease in luteal progesterone content may be an essential step toward the induction of 20alpha-HSD expression at the end of pregnancy in rats. PMID:11566732

  8. Characterization of human cardiac myosin heavy chain genes

    SciTech Connect

    Yamauchi-Takihara, K.; Sole, M.J.; Liew, J.; Ing, D.; Liew, C.C. )

    1989-05-01

    The authors have isolated and analyzed the structure of the genes coding for the {alpha} and {beta} forms of the human cardiac myosin heavy chain (MYHC). Detailed analysis of four overlapping MYHC genomic clones shows that the {alpha}-MYHC and {beta}-MYHC genes constitute a total length of 51 kilobases and are tandemly linked. The {beta}-MYHC-encoding gene, predominantly expressed in the normal human ventricle and also in slow-twitch skeletal muscle, is located 4.5 kilobases upstream of the {alpha}-MYHC-encoding gene, which is predominantly expressed in normal human atrium. The authors have determined the nucleotide sequences of the {beta} form of the MYHC gene, which is 100% homologous to the cardiac MYHC cDNA clone (pHMC3). It is unlikely that the divergence of a few nucleotide sequences from the cardiac {beta}-MYHC cDNA clone (pHMC3) reported in a MYHC cDNA clone (PSMHCZ) from skeletal muscle is due to a splicing mechanism. This finding suggests that the same {beta} form of the cardiac MYHC gene is expressed in both ventricular and slow-twitch skeletal muscle. The promoter regions of both {alpha}- and {beta}-MYHC genes, as well as the first four coding regions in the respective genes, have also been sequenced. The sequences in the 5{prime}-flanking region of the {alpha}- and {beta}-MYHC-encoding genes diverge extensively from one another, suggesting that expression of the {alpha}- and {beta}-MYHC genes is independently regulated.

  9. Hemoglobin Neapolis, beta 126(H4)Val----Gly: a novel beta-chain variant associated with a mild beta-thalassemia phenotype and displaying anomalous stability features.

    PubMed

    Pagano, L; Lacerra, G; Camardella, L; De Angioletti, M; Fioretti, G; Maglione, G; de Bonis, C; Guarino, E; Viola, A; Cutolo, R

    1991-12-01

    A novel beta-chain, beta 126(H4)Val----Gly, electrophoretically silent, was detected by reverse-phase high performance liquid chromatography in three unrelated families from Naples (Southern Italy) and accounted for about 30% of the total beta-chains. The amino acid substitution was detected by HPLC fingerprint. The eight heterozygous patients showed hematologic and biosynthetic alterations of mild beta-thalassemia type. The hemoglobin variant showed abnormal stability features. It was unstable in the heat stability and isopropanol precipitation tests, but did not cause a hemolytic syndrome in vivo and was stable in a time-course experiment of biosynthesis in vitro. DNA polymerase chain reaction direct sequencing of the mutated gene from 135 nt upstream of the cap site to 106 nt downstream of the polyadenylation site showed only the beta 126 GTG----GGG mutation, which was confirmed in the other patients by allele-specific oligonucleotide hybridization. The mutation was found to be associated with a type II beta-globin framework and restriction fragment length polymorphism haplotype V. The novel variant was named hemoglobin Neapolis. PMID:1954392

  10. Evolution of T cell receptor genes. Extensive diversity of V beta families in the Mexican axolotl.

    PubMed

    Fellah, J S; Kerfourn, F; Charlemagne, J

    1994-11-15

    We have cloned 36 different rearranged variable regions (V beta) genes encoding the beta-chain of the T cell receptor in an amphibian species, Ambystoma mexicanum (the Mexican axolotl). Eleven different V beta segments were identified, which can be classified into 9 families on the basis of a minimum of 75% nucleotide identity. All the cloned V beta segments have the canonical features of known mammalian and avian V beta, including conserved residues Cys23, Trp34, Arg69, Tyr90, and Cys92. There seems to be a greater genetic distance between the axolotl V beta families than between the different V beta families of any mammalian species examined to date: most of the axolotl V beta s have fewer than 35% identical nucleotides and the less related families (V beta 4 and V beta 8) have no more than 23.2% identity (13.5% at the amino acid level). Despite their great mutual divergence, several axolotl V beta are sequence-related to some mammalian V beta genes, like the human V beta 13 and V beta 20 segments and their murine V beta 8 and V beta 14 homologues. However, the axolotl V beta 8 and V beta 9 families are not significantly related to any other V beta sequence at the nucleotide level and show limited amino acid similarity to mammalian V alpha, V kappa III, or VH sequences. The detection of nine V beta families among 35 randomly cloned V beta segments suggests that the V beta gene repertoire in the axolotl is probably larger than presently estimated. PMID:7963525

  11. Modeling of polypeptide chains as C alpha chains, C alpha chains with C beta, and C alpha chains with ellipsoidal lateral chains.

    PubMed

    Fogolari, F; Esposito, G; Viglino, P; Cattarinussi, S

    1996-03-01

    In an effort to reduce the number of degrees of freedom necessary to describe a polypeptide chain we analyze the statistical behavior of polypeptide chains when represented as C alpha chains, C alpha chains with C beta atoms attached, and C alpha chains with rotational ellipsoids as models of side chains. A statistical analysis on a restricted data set of 75 unrelated protein structures is performed. The comparison of the database distributions with those obtained by model calculation on very short polypeptide stretches allows the dissection of local versus nonlocal features of the distributions. The database distribution of the bend angles of polypeptide chains of pseudo bonded C alpha atoms spans a restricted range of values and shows a bimodal structure. On the other hand, the torsion angles of the C alpha chain may assume almost all possible values. The distribution is bimodal, but with a much broader probability distribution than for bend angles. The C alpha - C beta vectors may be taken as representative of the orientation of the lateral chain, as the direction of the bond is close to the direction of the vector joining C alpha to the ad hoc defined center of the "steric mass" of the side chain. Interestingly, both the bend angle defined by C alpha i-C alpha i+1-C beta i+1 and the torsional angle offset of the pseudo-dihedral C alpha i-C alpha i+1-C alpha i+2-C beta i+2 with respect to C alpha i-C alpha i+1-C alpha i+2-C alpha i+3 span a limited range of values. The latter results show that it is possible to give a more realistic representation of polypeptide chains without introducing additional degrees of freedom, i.e., by just adding to the C alpha chain a C beta with given side-chain properties. However, a more realistic description of side chains may be attained by modeling side chains as rotational ellipsoids that have roughly the same orientation and steric hindrance. To this end, we define the steric mass of an atom as proportional to its van der

  12. Arrested rearrangement of TCR V[beta] genes in thymocytes from children with x-linked severe combined immunodeficiency disease

    SciTech Connect

    Sleasman, J.W.; Harville, T.O.; White, G.B.; Barrett, D.J. ); George, J.F. ); Goodenow, M.M. Univ. of Alabama, Birmingham, AL )

    1994-07-01

    Human X-linked severe combined immunodeficiency disease (SCID) is an immunodeficiency disorder in which T cell development is arrested in the thymic cortex. B lymphocytes in children with X-linked SCID seem to differentiate normally. X-linked SCID is associated with a mutation in the gene that encodes the IL-2R [gamma]-chain. Because TCR-[beta] gene recombination is a pivotal initial event in T lymphocyte onteogeny within the thymus, the authors hypothesized that a failure to express normal IL-2R[gamma] could lead to impaired TCR-[beta] gene recombination in early thymic development. PCR was used to determine the status of TCR-[beta] gene-segment rearrangements in thymic DNA that had been obtained from children with X-linked SCID. The initial step in TCR-[beta] gene rearrangement, that of D[beta] to J[beta] recombination, was readily detected in all thymus samples from children with X-linked SCID; in contrast, V[beta] to DJ[beta] gene rearrangements were undetectable in the same samples. Both D[beta] to J[beta] and V[beta] to DJ[beta] TCR genes were rearranged in the thymic tissues obtained from immunologically normal children. The authors conclude that TCR[beta]-chain gene rearrangement is arrested in children with X-linked SCID. The results suggest a causative relationship between the failure of TCR [beta]-chain gene arrangements to proceed beyond DJ[beta] rearrangements and the production of a nonfunctional IL-2R [gamma]-chain. 45 refs., 3 figs.

  13. Limited T-cell receptor beta-chain heterogeneity among interleukin 2 receptor-positive synovial T cells suggests a role for superantigen in rheumatoid arthritis.

    PubMed Central

    Howell, M D; Diveley, J P; Lundeen, K A; Esty, A; Winters, S T; Carlo, D J; Brostoff, S W

    1991-01-01

    Rheumatoid arthritis (RA) is a disease affecting the synovial membranes of articulating joints that is thought to result from T-cell-mediated autoimmune phenomena. T cells responsible for the pathogenesis of RA are likely present in that fraction of synovial T cells that expresses the interleukin 2 receptor (IL-2R), one marker of T-cell activation. We report herein an analysis of T-cell receptor (TCR) beta-chain gene expression by IL-2R-positive synovial T cells. These T cells were isolated from uncultured synovial tissue specimens by using IL-2R-specific monoclonal antibodies and magnetic beads, and TCR beta-chain transcription was analyzed by PCR-catalyzed amplification using a panel of primers specific for the human TCR beta-chain variable region (V beta). Multiple V beta gene families were found to be transcribed in these patients samples; however, three gene families, V beta 3, V beta 14, and V beta 17, were found in a majority of the five synovial samples analyzed, suggesting that T cells bearing these V beta s had been selectively retained in the synovial microenvironment. In many instances, the V beta 3, V beta 14, or V beta 17 repertoires amplified from an individual patient were dominated by a single rearrangement, indicative of clonal expansion in the synovium and supportive of a role for these T cells in RA. Of note is a high sequence similarity between V beta 3, V beta 14, and V beta 17 polypeptides, particularly in the fourth complementarity-determining region (CDR). Given that binding sites for superantigens have been mapped to the CDR4s of TCR beta chains, the synovial localization of T cells bearing V beta s with significant CDR4 homology indicates that V beta-specific T-cell activation by superantigen may play a role in RA. PMID:1660155

  14. Effects of increased anionic charge in the beta-globin chain on assembly of hemoglobin in vitro.

    PubMed

    Adachi, K; Yamaguchi, T; Pang, J; Surrey, S

    1998-02-15

    Studies on assembly in vitro of alpha-globin chains with recombinant beta16 Gly-->Asp, beta95 Lys-->Glu, beta120 Lys-->Glu and beta16 Gly-->Asp, 120 Lys-->Glu human beta-globin chain variants in addition to human betaA- and betaS-globin chains were performed to evaluate effects of increased anionic charge in the beta chain on hemoglobin assembly using soluble recombinant beta-globin chains expressed in bacteria. A beta112 Cys-->Asp change was also engineered to monitor effects on assembly of increased negative charge at alpha1beta1 interaction sites. Order of tetramer formation in vitro under limiting alpha-globin chain conditions showed Hb betaG16D, K120E = Hb betaK120E = Hb betaK95E > Hb betaG16D > Hb A > Hb S > Hb betaC112D. In addition, beta112 Cys-->Asp chains exist as monomers rather than beta4 tetramers in the absence of alpha chains, and the beta chain in Hb betaC112D tetramers was readily exchanged by addition of betas. These results suggest that affinity between alpha and beta chains is promoted by negatively-charged beta chains up to a maximum of two additional net negative charges and is independent of location on the surface except at the alpha1beta1 interaction site. In addition, our findings show that beta112 Cys on the G helix is critical for facilitating formation of stable alphabeta dimers, which then form functional hemoglobin tetramers, and that beta112 Cys-->Asp inhibits formation of stable alpha1beta1 and beta1beta2 interactions in alpha2beta2 and beta4 tetramers, respectively. PMID:9454775

  15. Total beta-globin gene deletion has high frequency in Filipinos

    SciTech Connect

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  16. Aspartic acid at position 57 of the HLA-DQ beta chain protects against type I diabetes: a family study.

    PubMed Central

    Morel, P A; Dorman, J S; Todd, J A; McDevitt, H O; Trucco, M

    1988-01-01

    One hundred seventy-two members from 27 randomly selected multiple case Caucasian families of patients with insulin-dependent diabetes mellitus (IDDM) were studied at the DNA level to ascertain the reliability of codon 57 of the HLA-DQ beta-chain gene as a disease protection/susceptibility marker. The analysis was carried out by polymerase chain reaction amplification of DNA encoding the first domain of the DQ beta chain and by dot blot analysis of the amplified material with allele-specific oligonucleotide probes. One hundred twenty-three randomly selected healthy Caucasian donors were also tested. The results demonstrated that haplotypes carrying an aspartic acid in position 57 (Asp-57) of their DQ beta chain were significantly increased in frequency among nondiabetic haplotypes (23/38), while non-Asp-57 haplotypes were significantly increased in frequency among diabetic haplotypes (65/69). Ninety-six percent of the diabetic probands in our study were homozygous non-Asp/non-Asp as compared to 19.5% of healthy unrelated controls. This conferred a relative risk of 107 (chi 2 = 54.97; P = 0.00003) for non-Asp-57 homozygous individuals. Even though the inheritance and genetic features of IDDM are complex and are not necessarily fully explained by DQ beta chain polymorphism, this approach is much more sensitive than HLA serolog in assessing risk for IDDM. PMID:3186714

  17. Hemoglobin Agenogi--A rare abnormal beta globin chain variant.

    PubMed

    Sharma, Sunita; Sharma, Geetika; Chandra, Jagdish; Colah, Roshan

    2016-01-01

    Haemoglobin (Hb) Agenogi is clinically asymptomatic, rare β-globin chain variant characterized by a substitution of glutamic acid by lysine at position 90 of β-chain. It elutes in the C-window on high-performance liquid chromatography (HPLC). We report a 10-year-old male with easy fatigability, lethargy, pallor, and mild splenomegaly. Hematological parameters revealed microcytic hypochromic anemia and mildly raised red blood cells count, suggestive of thalassemia trait. On HPLC, a predominant peak was observed in the C-window (82.6%) along with raised HbA 2 level (9.3%). Based on these findings, a possibility of HbC disease/β-thalassemia trait doubly heterozygous was considered. Family studies were advised. HPLC findings in father were suggestive of β-thalassemia trait, while both his mother and brother had an abnormal peak in the C-window of 42.7% and 40.8%, respectively, with elevated HbA 2 values of 5% and 4.9%, respectively. Direct DNA sequencing revealed intervening sequences 1-5 (G ; C) in father, confirming β-thalassemia trait. His mother and brother had heterozygous gene mutation at codon 90 of β-globin chain (G ; A) suggestive of Hb Agenogi. The child carried mutations for both β-thalassemia trait as well as Hb Agenogi. PMID:26960650

  18. The effects of beta2 adrenoceptor gene polymorphisms on pressor response during laryngoscopy and tracheal intubation.

    PubMed

    Kim, N-S; Lee, I-O; Lee, M-K; Lim, S-H; Choi, Y-S; Kong, M-H

    2002-03-01

    We investigated whether human beta2 adrenoceptor (beta2AR) gene polymorphisms are associated with the pressor response to laryngoscopy and tracheal intubation. Ninety-two patients undergoing elective surgery under general anaesthesia were enrolled into this study. Arterial systolic pressure, heart rate and rate pressure product were measured before induction of anaesthesia and 1 min following laryngoscopy and tracheal intubation. Genomic DNA was then used to identify the beta2AR-16 and beta2AR-27 genes using an allele-specific polymerase chain reaction method. Using multiple linear regression models, controlling for age, sex, weight, baseline blood pressure, heart rate and rate pressure product, we found that patients who possessed the glutamic acid homozygote of beta2AR-27 produced significantly greater changes in mean arterial pressure and rate pressure products than patients with the glutamine homozygote of beta2AR-27 (beta coefficient for mean blood pressure = 11.81, beta coefficient for pulse-pressure product = 8.76, both p-values = 0.023). These findings suggest that genetic variability in the human beta2AR gene polymorphisms may be associated with the pressor response to laryngoscopy and tracheal intubation. PMID:11879211

  19. Evolutionary relationships among copies of feather beta ({beta}) keratin genes from several avian orders.

    PubMed

    Glenn, Travis C; French, Jeffrey O; Heincelman, Traci J; Jones, Kenneth L; Sawyer, Roger H

    2008-10-01

    The feather beta (β) keratins of the white leghorn chicken (order Galliformes, Gallus gallus domesticus) are the products of a multigene family that includes claw, feather, feather-like, and scale genes (Presland et al. 1989a). Here we characterize the feather β-keratin genes in additional bird species. We designed primers for polymerase chain reactions (PCR) using sequences available from chicken, cloned the resulting amplicons to isolate individual copies, and sequenced multiple clones from each PCR reaction for which we obtained amplicons of the expected size. Feather β-keratins of 18 species from eight avian orders demonstrate DNA sequence variation within and among taxa, even in the protein-coding regions of the genes. Phylogenies of these data suggest that Galliformes (fowl-like birds), Psittaciformes (parrots), and possibly Falconiformes (birds of prey) existed as separate lineages before duplication of the feather β-keratin gene began in Ciconiiformes (herons, storks, and allies), Gruiformes (cranes, rails, and allies), and Piciformes (woodpeckers and allies). Sequences from single species of Coraciiformes (kingfishers) and Columbiformes (pigeons) are monophyletic and strikingly divergent, suggesting feather β-keratin genes in these birds also diverged after these species last shared a common ancestor with the other taxa investigated. Overall, these data demonstrate considerable variation in this structural protein in the relatively recent history of birds, and raise questions concerning the origin and homology of claw, feather-like, and scale β-keratins of birds and the reptilian β-keratins. PMID:21669807

  20. The primary structure of alpha A- and beta-chains from blue-and-yellow macaw (Ara ararauna, Psittaci) hemoglobin. No evidence for expression of alpha D-chains.

    PubMed

    Godovac-Zimmermann, J; Braunitzer, G

    1985-05-01

    The hemoglobin A of the Blue-and-Yellow Macaw (Ara ararauna) was isolated and characterized. The complete amino-acid sequence of alpha A- and beta-chains is presented. In contrast to some adult avian hemoglobins already investigated, Blue-and-Yellow Macaw hemoglobin is homogenous and contains only one component: HbA. The minor component, HbD, which is usually present in the hemolysate of avian erythrocytes, could not be detected. There is no evidence for the expression of the alpha D-globin gene. Comparison of alpha A- and beta-chains from Blue-and-Yellow Macaw hemoglobin with corresponding chains from Greylag Goose hemoglobin shows 19 amino-acid exchanges between alpha A-chains and 6 between beta-chains. The structure-function relationships of hemoglobin chains and the evolutionary aspects are discussed in view of these results. PMID:4005049

  1. Crystal Structures of T Cell Receptor (Beta) Chains Related to Rheumatoid Arthritis

    SciTech Connect

    Li,H.; van Vranken, S.; Zhao, Y.; Li, Z.; Guo, Y.; Eisele, L.; Li, Y.

    2005-01-01

    The crystal structures of the V{beta}17+ {beta} chains of two human T cell receptors (TCRs), originally derived from the synovial fluid (SF4) and tissue (C5-1) of a patient with rheumatoid arthritis (RA), have been determined in native (SF4) and mutant (C5-1{sub F104{yields}Y/C187{yields}S}) forms, respectively. These TCR {beta} chains form homo-dimers in solution and in crystals. Structural comparison reveals that the main-chain conformations in the CDR regions of the C5-1 and SF4 V{beta}17 closely resemble those of a V{beta}17 JM22 in a bound form; however, the CDR3 region shows different conformations among these three V{beta}17 structures. At the side-chain level, conformational differences were observed at the CDR2 regions between our two ligand-free forms and the bound JM22 form. Other significant differences were observed at the V{beta} regions 8-12, 40-44, and 82-88 between C5-1/SF4 and JM22 V{beta}17, implying that there is considerable variability in the structures of very similar {beta} chains. Structural alignments also reveal a considerable variation in the V{beta}-C{beta} associations, and this may affect ligand recognition. The crystal structures also provide insights into the structure basis of T cell recognition of Mycoplasma arthritidis mitogen (MAM), a superantigen that may be implicated in the development of human RA. Structural comparisons of the V{beta} domains of known TCR structures indicate that there are significant similarities among V{beta} regions that are MAM-reactive, whereas there appear to be significant structural differences among those V{beta} regions that lack MAM-reactivity. It further reveals that CDR2 and framework region (FR) 3 are likely to account for the binding of TCR to MAM.

  2. [Characterization of cDNA of T-cell receptor beta chain in rainbow trout].

    PubMed

    Partula, S; Fellah, J S; de Guerra, A; Charlemagne, J

    1994-08-01

    Using a two-step PCR strategy, we have cloned several cDNA segments encoding the T-cell receptor beta chain in a Teleost fish, the rainbow trout (Oncorhynchus mykiss). The nine clones analyzed encode identical N-terminal-truncated V beta regions which present limited sequence similarities with several mammalian TcR V beta chains, from residue Tyr-35 to residue Ser-95. These V beta regions are followed by V beta-D beta-J beta-like regions which are different in all the sequenced clones, and by identical C beta regions. The trout C beta domain (156 amino acids) is most related to the chicken and to amphibian (axolotl) C beta domains but no cysteine residue appears in the hinge region. Like in other vertebrate C beta s, the TM region carries a positively charged lysine residue (Lys-271). The intracytoplasmic domain is virtually absent. The possibility to analyze the structure, expression and diversity of a T-cell receptor chain in a Teleost fish model will be important for our future understanding of the evolution of specific immune recognition in vertebrates. PMID:7882160

  3. Cardiac and skeletal myopathy in beta myosin heavy-chain simian virus 40 tsA58 transgenic mice.

    PubMed Central

    De Leon, J R; Federoff, H J; Dickson, D W; Vikstrom, K L; Fishman, G I

    1994-01-01

    The mechanisms regulating cardiac muscle differentiation and development are incompletely understood. To examine the relationships between cardiocyte proliferation and differentiation, we tested the ability of a fragment from the rat beta myosin heavy-chain (MHC beta) gene to correctly target expression of a thermolabile simian virus 40 large tumor antigen allele (tsA58) in the developing mouse. Transgene expression in the heart was observed as early as 10 days postconception and was developmentally regulated in parallel with the endogenous MHC beta gene. Expression was also detected in developing skeletal muscle, although at low levels. Despite the temperature sensitivity of the mutant large tumor antigen protein, a subset of transgenic mice in several lineages developed marked cardiac and skeletal myopathies. Images Fig. 2 Fig. 3 Fig. 4 PMID:8290557

  4. Isolation and characterization of BetaM protein encoded by ATP1B4 - a unique member of the Na,K-ATPase {beta}-subunit gene family

    SciTech Connect

    Pestov, Nikolay B.; Zhao, Hao; Basrur, Venkatesha; Modyanov, Nikolai N.

    2011-09-09

    Highlights: {yields} Structural properties of BetaM and Na,K-ATPase {beta}-subunits are sharply different. {yields} BetaM protein is concentrated in nuclear membrane of skeletal myocytes. {yields} BetaM does not associate with a Na,K-ATPase {alpha}-subunit in skeletal muscle. {yields} Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. {yields} BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a {beta}-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase {beta}-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was

  5. Maple syrup urine disease: The E1{beta} gene of human branched-chain {alpha}-ketoacid dehydrogenase complex has 11 rather than 10 exons, and the 3{prime} UTR in one of the two E1{beta} mRNAs arises from intronic sequences

    SciTech Connect

    Chuang, J.L.; Chuang, D.T.; Cox, R.P.

    1996-06-01

    Maple syrup urine disease (MSUD) or branched-chain ketoaciduria is caused by a deficiency in the mitochondrial branched-chain {alpha}-ketoacid dehydrogenase (BCKAD) complex. The clinical manifestations are characterized by accumulation of branched chain amino and {alpha}-ketoacids, which leads to severe cerebral edema with seizures, ketoacidosis, and mental retardation. The BCKAD complex comprises three catalytic components, i.e., a decarboxylase (E1) consisting of two E1{alpha} (M{sub r} = 46,000) and two E1{Beta} (M{sub r} = 37,500) subunits, a transacylase (E2) that contains 24 lipoic acid-bearing subunits, and a dehydrogenase (E3), which is a homodimeric flavoprotein. MSUD is genetically heterogeneous, since mutations in the E1{alpha} subunit (type IA MSUD), the E1{Beta} subunit (type IB), the E2 subunit (type II) and the E3 subunit (type III) have been described. The functional consequences of certain mutations in the BCKAD complex have been studied. 23 refs., 3 figs.

  6. Food-chain competition influences gene's size

    NASA Astrophysics Data System (ADS)

    Dembska, Marta; Dudek, Mirosław R.; Stauffer, Dietrich

    2006-11-01

    We have analyzed an effect of the Bak-Sneppen predator-prey food-chain self-organization on nucleotide content of evolving species. In our model, genomes of the species under consideration have been represented by their nucleotide genomic fraction and we have applied two-parameter Kimura model of substitutions to include the changes of the fraction in time. The initial nucleotide fraction and substitution rates were decided with the help of random number generator. Deviation of the genomic nucleotide fraction from its equilibrium value was playing the role of the fitness parameter, B, in Bak-Sneppen model. Our finding is, that the higher is the value of the threshold fitness, during the evolution course, the more frequent are large fluctuations in number of species with strongly differentiated nucleotide content; and it is more often the case that the oldest species, which survive the food-chain competition, might have specific nucleotide fraction making possible generating long genes.

  7. Characterization of the 5'-flanking region for the human fibrinogen beta gene.

    PubMed Central

    Huber, P; Dalmon, J; Courtois, G; Laurent, M; Assouline, Z; Marguerie, G

    1987-01-01

    To identify the possible regulatory sequences in the genetic expression of fibrinogen, a human genomic DNA library raised in lambda EMBL 4 phage was screened using cDNA probes coding for the A alpha, B beta and gamma chains of human fibrinogen. The entire fibrinogen locus was characterized and its organization analysed by means of hybridization and restriction mapping. Among the clones identified, a single recombinant lambda phage contained the beta gene and its 5'- and 3'-flanking regions. A 1.5 kb fragment of the immediate 5'-flanking region was sequenced and S1 mapping experiments revealed three transcription start points. Comparison of this sequence with that previously reported for the same region upstream from the human gamma gene revealed no significant homology which suggests that the potential promoting sequences of these genes are different. In contrast, comparison of the 5'-flanking regions of human and rat beta genes revealed a 142 bp sequence of 80% homology situated 16 bp upstream from the human beta gene. This highly conserved region may well represents a potential candidate for a regulatory sequence of the human beta gene. Images PMID:3029722

  8. Genomically imposed and somatically modified human thymocyte V sub. beta. gene repertoires

    SciTech Connect

    Baccala, R.; Kono, D.H.; Balderas, R.S.; Theofilopoulos, A.N. ); Walker, S. )

    1991-04-01

    The effect of thymic selection on the expressed human T-cell antigen receptor {beta}-chain variable region (V{sub {beta}}) gene repertoire was examined by using a multiprobe RNase protection assay. The relative abundance of transcripts for 22 V{sub {beta}} genes (encompassing 17 of the 20 human V{sub {beta}} gene subfamilies) within a thymus, and among 17 thymuses, was variable. On the basis of the presence of corresponding mRNAs, no genomic deletions were detected, but several coding region polymorphisms were identified. Analysis of mature T-cell subsets revealed the absence of complete superantigen-mediated V{sub {beta}} deletions, suggesting that this phenomenon, in contrast to mouse, is uncommon or absent in humans. However, several V{sub {beta}} genes were over- or underexpressed in one or both mature single-positive (CD4{sup +}8{sup {minus}} or CD8{sup +}4{sup {minus}}) thymocyte subsets compared to syngeneic total, mostly immature thymocytes. Whether these changes are induced by relatively weak superantigens or conventional antigens and whether the downshifts are caused by negative selection or lack of positive selection remains to be determined.

  9. T-cell receptor (TCR) usage in Lewis rat experimental autoimmune encephalomyelitis: TCR beta-chain-variable-region V beta 8.2-positive T cells are not essential for induction and course of disease.

    PubMed Central

    Gold, R; Giegerich, G; Hartung, H P; Toyka, K V

    1995-01-01

    Predominant usage of V beta 8.2 gene segments, encoding a T-cell receptor (TCR) beta chain variable region, has been reported for pathogenic Lewis rat T cells reactive to myelin basic protein (MBP). However, up to 75% of the alpha/beta T cells in a panel of MBP-specific T-cell lines did not display TCR V beta 8.2, V beta 8.5, V beta 10, or V beta 16 elements. To further investigate TCR usage, we sorted the T-cell lines for V beta 8.2- and V beta 10-positive T cells or depleted the lines of cells with these TCRs. V beta 8.2-positive T cells and one of the depleted T-cell lines strongly reacted against the MBP peptide MBP-(68-88). The depleted T-cell line caused marked experimental autoimmune encephalomyelitis (EAE) even in Lewis rats in which endogenous V beta 8.2-positive T cells had been eliminated by neonatal treatment with anti-V beta 8.2 monoclonal antibodies. T-cell hybridomas generated from this line predominantly used V beta 3 TCR genes coexpressed with TCR V alpha 2 transcripts, which were also used by V beta 8.2-positive T cells. Furthermore, V beta 10-positive T cells reactive to MBP-(44-67) were encephalitogenic when injected immediately after positive selection. After induction of EAE by sorted V beta 8.2- or V beta 10-positive T-cell lines, immunocytochemical analysis of the spinal cord tissue showed a predominance of the injected TCR or of nontypable alpha/beta T cells after injection of the depleted line. Our results demonstrate heterogeneity of TCR beta-chain usage even for a single autoantigen in an inbred strain. Moreover, V beta 8.2-positive T cells are not essential for the induction and progression of adoptive-transfer EAE. Images Fig. 4 Fig. 5 PMID:7597040

  10. cDNA-derived amino-acid sequence of a land turtle (Geochelone carbonaria) beta-chain hemoglobin.

    PubMed

    Bordin, S; Meza, A N; Saad, S T; Ogo, S H; Costa, F F

    1997-06-01

    The cDNA sequence encoding the turtle Geochelone carbonaria beta-chain was determinated. The isolation of hemoglobin mRNA was based on degenerate primers' PCR in combination with 5'- and 3'-RACE protocol. The full length cDNA is 615 bp with the ATG start codon at position 53 and TGA stop codon at position 495; The AATAAA polyadenylation signal is found at position 599. The deduced polypeptyde contains 146 amino-acid residues. The predicted amino acid sequence shares 83% identity with the beta-globin of a related specie, the aquatic turtle C. p. belli. Otherwise, identity is higher when compared with chicken beta-Hb (80%) than with other reptilian orders (Squamata, 69%, and Crocodilia, 61%). Compared with human HbA, there is 67% identity, and at least three amino acid substitutions could be of some functional significance (Glu43 beta-->Ser, His116 beta-->Thr and His143 beta-->Leu). To our knowledge this represents the first cDNA sequence of a reptile globin gene described. PMID:9238523

  11. B-lymphocyte targeting of gene expression in transgenic mice with the immunoglobulin heavy-chain enhancer.

    PubMed Central

    Gerlinger, P; LeMeur, M; Irrmann, C; Renard, P; Wasylyk, C; Wasylyk, B

    1986-01-01

    A hybrid gene containing rabbit beta-globin structural sequences (-9 to +1650), and a chicken conalbumin gene promoter (+62 to -102) in the place of the beta-globin promoter (upstream from -9), was inactive in 5 different transgenic mouse line. Adding the mouse immunoglobulin heavy-chain (IgH) enhancer to this construction specifically stimulated expression in B-cells. These results show that IgH enhancer is specifically active in B-cells. Expression of the hybrid gene was low compared to the endogenous immunoglobulin heavy and light-chain genes. Substituting the mouse immunoglobulin kappa light-chain gene (Ig kappa) promoter (+4 to -800) for the heterologous conalbumin promoter was not sufficient to restore gene expression to level of the endogenous genes. In addition to the reproducible B cell expression, we also found inheritable unexpected expression in certain tissues, which varied from line to line. Images PMID:3092186

  12. Monoclonal anti-mouse laminin antibodies: AL-1 reacts with laminin alpha1 chain, AL-2 with laminin beta1 chain, and AL-4 with the coiled-coil domain of laminin beta1 chain.

    PubMed

    Schéele, Susanne; Sasaki, Takako; Arnal-Estapé, Anna; Durbeej, Madeleine; Ekblom, Peter

    2006-07-01

    We analyzed the reactivity of three different commercially available rat monoclonal antibodies raised against mouse laminin-alpha1beta1gamma1 (laminin-111), AL-1, AL-2, and AL-4. Using ELISA assays, Western blot analysis and immunostainings we present refined epitope maps for these three laminin monoclonals. AL-1 reacted, as predicted with laminin alpha1 chain. AL-4 has also been marketed as an alpha1 chain specific probe, but we show here that AL-4 detects mouse laminin beta1 chain, in the distal part of the coiled-coil region. AL-2 was predicted to react with all three chains near the cross-region, but seems to primarily react with laminin beta1 chain. PMID:16631359

  13. Pancreatic beta cells express a diverse set of homeobox genes.

    PubMed Central

    Rudnick, A; Ling, T Y; Odagiri, H; Rutter, W J; German, M S

    1994-01-01

    Homeobox genes, which are found in all eukaryotic organisms, encode transcriptional regulators involved in cell-type differentiation and development. Several homeobox genes encoding homeodomain proteins that bind and activate the insulin gene promoter have been described. In an attempt to identify additional beta-cell homeodomain proteins, we designed primers based on the sequences of beta-cell homeobox genes cdx3 and lmx1 and the Drosophila homeodomain protein Antennapedia and used these primers to amplify inserts by PCR from an insulinoma cDNA library. The resulting amplification products include sequences encoding 10 distinct homeodomain proteins; 3 of these proteins have not been described previously. In addition, an insert was obtained encoding a splice variant of engrailed-2, a homeodomain protein previously identified in the central nervous system. Northern analysis revealed a distinct pattern of expression for each homeobox gene. Interestingly, the PCR-derived clones do not represent a complete sampling of the beta-cell library because no inserts encoding cdx3 or lmx1 protein were obtained. Beta cells probably express additional homeobox genes. The abundance and diversity of homeodomain proteins found in beta cells illustrate the remarkable complexity and redundancy of the machinery controlling beta-cell development and differentiation. Images PMID:7991607

  14. Structure of the mouse calcitonin/calcitonin gene-related peptide alpha and beta genes.

    PubMed

    Thomas, P M; Nasonkin, I; Zhang, H; Gagel, R F; Cote, G J

    2001-01-01

    We report the cloning, genomic organization and sequence of the mouse alpha-CALC and beta-CALC genes. The two genes share extensive sequence homology. The transcription units of both genes contain 6 exons. Transcripts of the alpha-CALC gene were found to alternatively include exon 4 or exons 5 and 6. For the beta-CALC gene exon 4 was not detected in transcripts derived from this gene. The predicted mouse alpha-CGRP was found to be identical to rat alpha-CGRP, however, beta-CGRP predicted amino acid sequences revealed three amino acid differences suggesting these residues are not critical to CGRP function. PMID:11761712

  15. Ca2+-dependent dephosphorylation of kinesin heavy chain on beta-granules in pancreatic beta-cells. Implications for regulated beta-granule transport and insulin exocytosis

    NASA Technical Reports Server (NTRS)

    Donelan, Matthew J.; Morfini, Gerardo; Julyan, Richard; Sommers, Scott; Hays, Lori; Kajio, Hiroshi; Briaud, Isabelle; Easom, Richard A.; Molkentin, Jeffery D.; Brady, Scott T.; Rhodes, Christopher J.

    2002-01-01

    The specific biochemical steps required for glucose-regulated insulin exocytosis from beta-cells are not well defined. Elevation of glucose leads to increases in cytosolic [Ca2+]i and biphasic release of insulin from both a readily releasable and a storage pool of beta-granules. The effect of elevated [Ca2+]i on phosphorylation of isolated beta-granule membrane proteins was evaluated, and the phosphorylation of four proteins was found to be altered by [Ca2+]i. One (a 18/20-kDa doublet) was a Ca2+-dependent increase in phosphorylation, and, surprisingly, three others (138, 42, and 36 kDa) were Ca2+-dependent dephosphorylations. The 138-kDa beta-granule phosphoprotein was found to be kinesin heavy chain (KHC). At low levels of [Ca2+]i KHC was phosphorylated by casein kinase 2, but KHC was rapidly dephosphorylated by protein phosphatase 2B beta (PP2Bbeta) as [Ca2+]i increased. Inhibitors of PP2B specifically reduced the second, microtubule-dependent, phase of insulin secretion, suggesting that dephosphorylation of KHC was required for transport of beta-granules from the storage pool to replenish the readily releasable pool of beta-granules. This is distinct from synaptic vesicle exocytosis, because neurotransmitter release from synaptosomes did not require a Ca2+-dependent KHC dephosphorylation. These results suggest a novel mechanism for regulating KHC function and beta-granule transport in beta-cells that is mediated by casein kinase 2 and PP2B. They also implicate a novel regulatory role for PP2B/calcineurin in the control of insulin secretion downstream of a rise in [Ca2+]i.

  16. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  17. Cloning and sequencing of the gene for human. beta. -casein

    SciTech Connect

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O. )

    1990-02-26

    Human {beta}-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on {beta}casein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic {sup 32}p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human {beta}-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human {beta}-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human {beta}-casein gene and will facilitate studies on factors affecting its expression.

  18. Assignment of an intron-containing human heat-shock protein gene (hsp90[beta], HSPCB) to chromosome 6 near TCTE1 (6p21) and two intronless pseudogenes to chromosomes 4 and 15 by polymerase chain reaction amplification from a panel of hybrid cell lines

    SciTech Connect

    Durkin, A.S.; Nierman, W.C.; Maglott, D.R. ); Vamvakopoulos, N.C. ); Zoghbi, H.Y. )

    1993-11-01

    We report here the successful application of designing primers from intronic sequences to map a structural hsp90[beta] gene to a unique human chromosome distinct from potential pseudogenes or rodent background. Also, by designing primers that bracket an intron and detecting products from intronless genes, we localized two hsp90[beta] pseudogenes to human chromosomes 4 and 15. PCR primers were designed from the published human hsp90[beta] DNA sequence from exon 11 (nucleotides 7066-7085, 7181-7198), intron A (1659-1678, 1722-1741), intron B (8109, 8170-8187), and exons 3 and 4 to amplify across intron C (3391-3412, 3731-3752).

  19. [Hemoglobin C -- beta-thalassemia disease and homozygous beta-thalassemia in a black African family (author's transl)].

    PubMed

    Basset, P; Fall, M; Oudart, J L

    1975-01-01

    The study of a Malian family has allowed to prove existence of two types of beta-thalassemia genes: the beta0 gene which suppresses the synthesis of the beta chain into cis position and the beta+ gene which slows down only partially this synthesis. The difference between this two genes has been possible owing to the hemoglobin C found in this family and induced by the betaC mutated gene. The segregation of the four genes betaA, betaC, beta0 thal, and beta+ thal. has allowed to compare all the possible phenotypes deriving from the combinations by two of these allelic genes. PMID:128735

  20. Cloning of T-cell antigen receptor beta chain cDNAs from Atlantic salmon (Salmo salar).

    PubMed

    Hordvik, I; Jacob, A L; Charlemagne, J; Endresen, C

    1996-01-01

    Atlantic salmon (Salmo salar) cDNAs encoding the T-cell antigen receptor beta chain (TCRB) were isolated from leukocyte RNA by reverse transcription - polymerase chain reaction (RT-PCR). Twenty-five distinct cDNA fragments covering the variable (V) - diversity (D) - joining (J) junction and part of the constant (C) region were characterized; the sequences of which indicate interchangeable V/D/J usage and expression in the context of one TCRBC gene. Full-length TCRBC sequence information was derived from a leukocyte cDNA library. Key residues of the salmon TCRBC region are in good agreement with those of other species. One distinct exception is the absence of the hinge region cysteine residue which is involved in covalent bonding between the alpha and beta chain in mammalian TCRs. As in amphibian and avian species, the salmon TCRBC membrane proximal region is considerably shorter than the mammalian. An octamer sequence (GGACAGGG) very similar to amphibian, avian, and mammalian D sequences could be recognized in the VDJ junctions from salmon. The pattern of VDJ variability also indicates that mechanisms like trimming and addition occur in fish as in higher vertebrates. Compared with mammals, a relatively high frequency (32%) of the VDJ junctions in salmon were out of frame. PMID:8881032

  1. T cell receptor alpha-chain gene rearrangements in B-precursor leukemia are in contrast to the findings in T cell acute lymphoblastic leukemia. Comparative study of T cell receptor gene rearrangement in childhood leukemia.

    PubMed Central

    Hara, J; Benedict, S H; Mak, T W; Gelfand, E W

    1987-01-01

    We have analyzed T cell receptor alpha-chain gene configuration using three genomic joining (J) region probes in 64 children with acute lymphoblastic leukemia (ALL). 11 out of 18 T-ALLs were T3 positive; alpha-chain gene rearrangements were demonstrated in only two of 18, indicating that the majority of T-ALLs would have rearrangements involving J alpha segments located upstream of these probes. In contrast, 15 out of 46 B-precursor ALLs showed rearrangements of the alpha-chain gene and J alpha segments located approximately 20-30 kb upstream of the constant region were involved in 13 of these patients. Nine of 15 B-precursor ALLs with rearranged alpha-chain genes had rearrangements of both gamma- and beta-chain genes, whereas the remaining six had no rearrangements of gamma- and beta-chain genes. These findings indicated that alpha-chain gene rearrangement is not specific for T lineage cells and gamma- and/or beta-chain gene rearrangement does not appear essential for alpha-chain gene rearrangement, at least in B-precursor leukemic cells. Images PMID:3500187

  2. Molecular characterization of the gene for human interleukin-1[beta] converting enzyme (IL1BC)

    SciTech Connect

    Cerretti, D.P.; Hollingsworth, L.T.; Kozlosky, C.J.; Nelson, N. ); Valentine, M.B. ); Shapiro, D.N.; Morris, S.W. Univ. of Tennessee College of Medicine, Memphis, TN )

    1994-04-01

    Interleukin-1[beta] (IL-1[beta]) mediates a wide range of immune and inflammatory responses. The active cytokine is generated by proteolytic cleavage of an inactive precursor by a protease called the IL-1[beta] converting enzyme (ICE). A cDNA encoding this protease was recently isolated. A human genomic clone containing the ICE gene (IL1BC) was isolated using the cDNA as a probe. The gene consists of 10 exons spanning at least 10.6 kb. 5[prime]-anchored polymerase chain reaction indicated a single transcription start site [approximately]33 bp upstream of the initiator Met codon. The 5[prime]-flanking region does not have an apparent TATA box but may contain an initiator (Inr) promotor element. However, transcriptional activity could not be detected with a fusion gene containing the 5[prime]-flanking region linked to the bacterial chloramphenicol acetyltransferase gene (CAT) when transfected into the human acute monocytic leukemia cell line THP-1. Using the genomic IL1BC clone, the authors have confirmed the localization of the gene to chromosome 11 band q22.2-q22.3 by fluorescence in situ hybridization. 34 refs., 2 figs., 1 tab.

  3. Correction of human. beta. sup S -globin gene by gene targeting

    SciTech Connect

    Shesely, E.G.; Hyungsuk Kim; Shehee, W.R.; Smithies, O. ); Papayannopoulou, T. ); Popovich, B.W. )

    1991-05-15

    As a step toward using gene targeting for gene therapy, the authors have corrected a human {beta}{sup S}-globin gene to the normal {beta}{sup A} allele by homologous recombination in the mouse-human hybrid cell line BSM. BSM is derived from a mouse erythroleukemia cell line and carries a single human chromosome 11 with the {beta}{sup S}-globin allele. A {beta}{sup A}-globin targeting construct containing a unique oligomer and a neomycin-resistance gene was electroporated into the BSM cells, which were then placed under G418 selection. Then 126 resulting pools containing a total {approx}29,000 G418-resistant clones were screened by PCR for the presence of a targeted recombinant: 3 positive pools were identified. A targeted clone was isolated by replating one of the positive pools into smaller pools and rescreening by PCR, followed by dilution cloning. Southern blot analysis demonstrated that the isolated clone had been targeted as planned. The correction of the {beta}{sup S} allele to {beta}{sup A} was confirmed both by allele-specific PCR and by allele-specific antibodies. Expression studies comparing the uninduced and induced RNA levels in unmodified BSM cells and in the targeted clone showed no significant alteration in the ability of the targeted clone to undergo induction, despite the potentially disrupting presence of a transcriptionally active neomycin gene 5{prime} to the human {beta}{sup A}-globin gene. Thus gene targeting can correct a {beta}{sup S} allele to {beta}{sup A}, and the use of a selectable helper gene need not significantly interfere with the induction of the corrected gene.

  4. Asynchronous DNA replication within the human. beta. -globin gene locus

    SciTech Connect

    Epner, E.; Forrester, W.C.; Groudine, M. )

    1988-11-01

    The timing of DNA replication of the human {beta}-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human {beta}-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-{gamma}-globin gene region and approximately 20 kilobases 5' to the {epsilon}-globin gene and 20 kilobases 3' to the {beta}-globin gene, replicate later and throughout S phase. A similar area is also present in the {alpha}-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks.

  5. Haemoglobin binding with haptoglobin. Localization of the haptoglobin-binding sites on the beta-chain of human haemoglobin by synthetic overlapping peptides encompassing the entire chain.

    PubMed

    Yoshioka, N; Atassi, M Z

    1986-03-01

    A synthetic approach was employed to identify the haptoglobin-binding sites on the beta-chain of human haemoglobin. This approach consists of the synthesis of a series of consecutive overlapping peptides that, together, systematically represent the entire protein chain. Fourteen synthetic peptides (beta 1-15, beta 11-25 etc.) were examined for their ability to bind human haptoglobin by quantitative solid-phase radiometric titrations of 125I-labelled haptoglobin. Of these 14 peptides only peptides beta 11-25 and beta 131-146 bound haptoglobin significantly; peptide beta 21-35 exhibited a small binding activity as a consequence of the overlap with peptide beta 11-25. On this basis and by examination of the three-dimensional structure of haemoglobin, it was concluded that the beta-chain of haemoglobin has two binding sites for haptoglobin that reside in, but do not necessarily encompass all of, the regions beta 11-25 and beta 131-146. PMID:3718478

  6. Molecular basis of an adult form of Sandhoff disease: substitution of glutamine for arginine at position 505 of the beta-chain of beta-hexosaminidase results in a labile enzyme.

    PubMed

    Bolhuis, P A; Ponne, N J; Bikker, H; Baas, F; Vianney de Jong, J M

    1993-09-01

    Sandhoff disease is a lysosomal storage disorder characterized by accumulation of GM2 ganglioside due to mutations in the beta-chain of beta-hexosaminidase. Hexosaminidase activity is negligible in infantile Sandhoff disease whereas residual activity is present in juvenile and adult forms. Here we report the molecular basis of the first described adult form of Sandhoff disease. Southern analysis of chromosomal DNA indicated the absence of chromosomal deletions in the gene encoding the beta-chain. Northern analysis of RNA from cultured fibroblasts demonstrated that at least one of the beta-chain alleles was transcribed into normal-length mRNA. Sequence analysis of the entire cDNA prepared from poly-adenylated RNA showed that only one point mutation was present, consisting of a G-->A transition at nucleotide position 1514. This mutation changes the electric charge at amino acid position 505 by substitution of glutamine for arginine in a highly conserved part of the beta-chain, present even in the slime mold Dictyostelium discoideum. The nucleotide transition generated a new restriction site for DdeI, which was present in only one of the alleles of the patient. Reverse transcription of mRNA followed by restriction with DdeI resulted in complete digestion at the mutation site, demonstrating that the second allele was of an mRNA-negative type. Transfection of COS cells with a cDNA construct containing the mutation but otherwise the normal sequence resulted in the expression of a labile form of beta-hexosaminidase. These results show that the patient's is a genetic compound, and that the lability of beta-hexosaminidase found in this form of Sandhoff disease is based on a single nucleotide transition. PMID:8357844

  7. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    PubMed Central

    Hassan, Sabry A.; Shobrak, Mohammed Y.

    2015-01-01

    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were TEM and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets. PMID:27047051

  8. Rejection of cardiac allografts by T cells expressing a restricted repertoire of T-cell receptor V beta genes.

    PubMed Central

    Shirwan, H; Barwari, L; Cramer, D V

    1997-01-01

    We have recently shown that T cells infiltrating cardiac allografts early in graft rejection use a limited T-cell receptor (TCR) V beta repertoire. In this study we tested whether this limited repertoire of V beta genes is important for graft rejection. A cell line, AL2-L3, was established from LEW lymphocytes infiltrating ACI heart allografts 2 days after transplantation. This cell line is composed of CD4+ T cells that primarily recognize the class II RTI.B major histocompatibility complex (MHC) molecule expressed by the donor graft. This cell line precipitated acute rejection of donor hearts with a median survival time (MST) of 10.5 days following adoptive transfer to sublethally irradiated LEW recipients. This rate of graft rejection was significantly (P < 0.0007) accelerated when compared with a MST of 60 days for allografts in irradiated control recipients. The AL2-L3-mediated acceleration of graft rejection was donor specific as WF third-party heart allografts were rejected with a delayed tempo (MST = 28.5 days). The V beta repertoire of this cell line was primarily restricted to the expression of V beta 4, 15 and 19 genes. The nucleotide sequence analysis of the beta-chain cDNAs from this cell line demonstrated that the restricted use of the V gene repertoire was not shared with the N, D and J regions. A wide variety of CDR3 loops and J beta genes were used in association with selected V beta genes. These data provide evidence for the role a restricted repertoire of V beta genes plays in cardiac allograft rejection in this model. The restricted usage of the V beta repertoire in an early T-cell response to allografts may provide the opportunity to therapeutically disrupt the rejection reaction by targeting selected T-cell populations for elimination at the time of organ transplantation. Images Figure 2 PMID:9176111

  9. BetaSCPWeb: side-chain prediction for protein structures using Voronoi diagrams and geometry prioritization.

    PubMed

    Ryu, Joonghyun; Lee, Mokwon; Cha, Jehyun; Laskowski, Roman A; Ryu, Seong Eon; Kim, Deok-Soo

    2016-07-01

    Many applications, such as protein design, homology modeling, flexible docking, etc. require the prediction of a protein's optimal side-chain conformations from just its amino acid sequence and backbone structure. Side-chain prediction (SCP) is an NP-hard energy minimization problem. Here, we present BetaSCPWeb which efficiently computes a conformation close to optimal using a geometry-prioritization method based on the Voronoi diagram of spherical atoms. Its outputs are visual, textual and PDB file format. The web server is free and open to all users at http://voronoi.hanyang.ac.kr/betascpweb with no login requirement. PMID:27151195

  10. BetaSCPWeb: side-chain prediction for protein structures using Voronoi diagrams and geometry prioritization

    PubMed Central

    Ryu, Joonghyun; Lee, Mokwon; Cha, Jehyun; Laskowski, Roman A.; Ryu, Seong Eon; Kim, Deok-Soo

    2016-01-01

    Many applications, such as protein design, homology modeling, flexible docking, etc. require the prediction of a protein's optimal side-chain conformations from just its amino acid sequence and backbone structure. Side-chain prediction (SCP) is an NP-hard energy minimization problem. Here, we present BetaSCPWeb which efficiently computes a conformation close to optimal using a geometry-prioritization method based on the Voronoi diagram of spherical atoms. Its outputs are visual, textual and PDB file format. The web server is free and open to all users at http://voronoi.hanyang.ac.kr/betascpweb with no login requirement. PMID:27151195

  11. Globin chain synthesis in single erythroid bursts from cord blood: studies on gamma leads to beta and G gamma leads to A gamma switches.

    PubMed

    Comi, P; Giglioni, B; Ottolenghi, S; Gianni, A M; Polli, E; Barba, P; Covelli, A; Migliaccio, G; Condorelli, M; Peschle, C

    1980-01-01

    Erythroid bursts from cord or adult blood were grown in methylcellulose cultures (3 international units of erythropoietin per plate). On day 13, single bursts were picked up and reincubated for 16-24 hr with [3H]leucine. Radioactive globin chains [alpha,beta,G gamma, and A gamma (Ala-136)] were analyzed by either isoelectric focusing on polyacrylamide gels and fluorography or carboxymethylcellulose chromatography. In all cases, alpha to non-alpha globin radioactivity ratios were close to 1. In single cord blood bursts, the values of both gamma-to-beta and G gamma-to-A gamma ratios were spread over a large spectrum and further characterized by a continuous rather than a bimodal distribution. Morever, the G gamma-to-A gamma ratios demonstrated in single bursts appeared to be directly correlated with the respective gamma-to-beta ratios. These data suggest that both the gamma leads to beta and the G gamma leads to A gamma switches are mediated via mechanisms modulating the relative activities of the different genes in the non-alpha globin gene cluster rather than via selection of clones committed to the preferential synthesis of beta and A gamma globins. In contrast with the results obtained with cord blood, individual adult blood bursts synthesize a lower and hence relatively more uniform amount of gamma globin chains. PMID:6153796

  12. Semiflexible Chain Networks Formed via Self-Assembly of Beta-Hairpin Molecules

    NASA Astrophysics Data System (ADS)

    Ozbas, Bulent; Rajagopal, Karthikan

    2005-03-01

    We present experimental results from a de novo designed oligopeptide that intermolecularly self-assembles into rigid hydrogel networks after an intramolecular folding event. The effect of ionic strength and beta hairpin peptide strand length on beta-sheet formation, self-assembly and resultant rheological properties were studied. The peptide molecules are locally amphiphilic with two linear strands of alternating hydrophobic valine and hydrophilic lysine amino acids flanking a central turn sequence. The beta-sheet formation of 24, 20, 16 and 12 amino acid long beta-hairpin molecules were studied by CD spectroscopy. The network properties and the nanostructure of the hydrogels were studied by rheology, TEM and SANS. The hydrogel network is composed of semiflexible fibrillar assemblies with viscoelastic behavior that follows the theoretical prediction for heavily crosslinked,semi-flexible polymer networks. SANS results show that the cross-sectional diameter of the fibrils, and thus, the bending modulus of the chains can be varied by changing the number of amino acids of strands of the molecules. Rheological measurements reveal that rigidity, creep and relaxation behavior of the hydrogels vary with the magnitude of stimulus and with the cross-section diameter of the chains.

  13. Isolation of distinct cDNA clones encoding HLA-DR beta chains by use of an expression assay.

    PubMed Central

    Long, E O; Wake, C T; Strubin, M; Gross, N; Accolla, R S; Carrel, S; Mach, B

    1982-01-01

    cDNA clones encoding different human Ia antigen beta chains were isolated by use of a complementation-expression assay in Xenopus oocytes. The assay was based on two previous findings. First, oocytes injected with mRNA from a human B-cell line express HLA-DR antigen. The three intracellular DR chains are assembled in oocytes and can be immunoprecipitated with anti-DR monoclonal antibodies. Second, we have isolated cDNA clones encoding DR alpha and intermediate chains. In order to identify beta-chain cDNA clones, mRNA was hybrid-selected with pools of cDNA clones, mixed with mRNA for the alpha and intermediate chains, and injected into oocytes. We isolated two distinct clones that could select DR beta-chain mRNA as demonstrated by assembly of the translation product with DR alpha chains and immunoprecipitation with DR-specific monoclonal antibodies. One clone is specific for a beta chain of the DR locus. The other clone, much weaker in its ability to select DR mRNA, encodes another Ia-like beta chain. Full-length cDNA clones corresponding to the DR and Ia-like beta chains were isolated and compared. Cross-hybridization was detectable in the coding regions but not in the 3' untranslated regions. Distinct RNAs homologous to the DR and the Ia-like beta-chain clones were present in B cells but were undetectable in three T-cell lines. Images PMID:6818545

  14. Flow cytometric analysis of expression of interleukin-2 receptor beta chain (p70-75) on various leukemic cells

    SciTech Connect

    Hoshino, S.; Oshimi, K.; Tsudo, M.; Miyasaka, M.; Teramura, M.; Masuda, M.; Motoji, T.; Mizoguchi, H. )

    1990-08-15

    We analyzed the expression of the interleukin-2 receptor (IL-2R) beta chain (p70-75) on various leukemic cells from 44 patients by flow cytometric analysis using the IL-2R beta chain-specific monoclonal antibody, designated Mik-beta 1. Flow cytometric analysis demonstrated the expression of the IL-2R beta chain on granular lymphocytes (GLs) from all eight patients with granular lymphocyte proliferative disorders (GLPDs), on adult T-cell leukemia (ATL) cells from all three patients with ATL, and on T-cell acute lymphoblastic leukemia (T-ALL) cells from one of three patients with T-ALL. Although GLs from all the GLPD patients expressed the IL-2R beta chain alone and not the IL-2R alpha chain (Tac-antigen: p55), ATL and T-ALL cells expressing the beta chain coexpressed the alpha chain. In two of seven patients with common ALL (cALL) and in both patients with B-cell chronic lymphocytic leukemia, the leukemic cells expressed the alpha chain alone. Neither the alpha chain nor the beta chain was expressed on leukemic cells from the remaining 28 patients, including all 18 patients with acute nonlymphocytic leukemia, five of seven patients with cALL, all three patients with multiple myeloma, and two of three patients with T-ALL. These results indicate that three different forms of IL-2R chain expression exist on leukemic cells: the alpha chain alone; the beta chain alone; and both the alpha and beta chains. To examine whether the results obtained by flow cytometric analysis actually reflect functional aspects of the expressed IL-2Rs, we studied the specific binding of 125I-labeled IL-2 (125I-IL-2) to leukemic cells in 18 of the 44 patients. In addition, we performed 125I-IL-2 crosslinking studies in seven patients. The results of IL-2R expression of both 125I-IL-2 binding assay and crosslinking studies were in agreement with those obtained by flow cytometric analysis.

  15. The Internally Self-fertilizing Hermaphroditic Teleost Rivulus marmoratus (Cyprinodontiformes, Rivulidae) beta-Actin Gene: Amplification and Sequence Analysis with Conserved Primers.

    PubMed

    Lee

    2000-03-01

    To determine the ease and feasibility of amplifying the beta-actin gene in fish by the polymerase chain reaction (PCR), genomic DNAs of several fish (Rivulus, Southern top mouth minnow, common fat minnow, oily bitterling, carp, Far Eastern catfish, medaka, and European flounder) were extracted and used as a template with conserved primers, designed on the basis of high amino acid homology (approximately 98% or more). Among them, the self-fertilizing hermaphroditic fish Rivulus marmoratus was chosen for further characterization. After amplification of the Rivulus beta-actin PCR product with Taq polymerase, PCR product was subcloned to pCRII vector. After restriction enzyme mapping of Rivulus beta-actin gene, the amplified insert was sequenced using ALF Express automatic DNA sequencer with conserved internal primers. The R. marmoratus beta-actin gene consists of 1763 bp encoding 375 amino acids including 5 exons and 4 introns. The splicing and acceptance sites of the exon and intron boundaries of the Rivulus beta-actin gene were highly conserved with consensus sequences (GT/AG). The amino acid homology of R. marmoratus beta-actin to other species was high: 98.93% to human; 98.93%, Atlantic salmon; 98.93%, common carp; 98.93%, grass carp; 98.93%, zebrafish; 98.67%, medaka; and 98.40%, sea bream. To determine the expression of the R. marmoratus beta-actin gene in liver and ovary, reverse transcriptase-polymerase chain reaction was carried out with internal primers. In conclusion, these universal primers are successful in the rapid cloning of the fish beta-actin gene by PCR, based on a high homology of the beta-actin gene conserved through evolution. This approach will be applicable to the isolation of other beta-actin homologues in the investigation of phylogenetic comparisons of fish species, along with a possible application to cloning strategy in other conserved genes. PMID:10811955

  16. Synthesis of novel heterobranched beta-cyclodextrins having beta-D-N-acetylglucosaminyl-maltotriose on the side chain.

    PubMed

    Tanimoto, Toshiko; Omatsu, Mizue; Ikuta, Akiko; Nishi, Yuki; Murakami, Hiromi; Nakano, Hirofumi; Kitahata, Sumio

    2005-04-01

    From a mixture of N-acetylglucosaminyl-beta-cyclodextrin (GlcNAc-betaCD) and lactose, beta-D-galactosyl-GlcNAc-betaCD (Gal-GlcNAc-betaCD) was synthesized by the transfer action of beta-galactosidase. GlcNAc-maltotriose (Glc3) and Gal-GlcNAc-Glc3 were produced with hydrolysis of GlcNAc-betaCD by cyclodextrin glycosyltransferase, and Gal-GlcNAc-betaCD by bacterial saccharifying alpha-amylase respectively. Finally, GlcNAc-Glc3-betaCD and Gal-GlcNAc-Glc3-betaCD were synthesized in 5.2% and 3.5% yield when Klebsiella pneumoniae pullulanase was incubated with the mixture of GlcNAc-Glc(3) and betaCD, or Gal-GlcNAc-Glc3 and betaCD respectively. The structures of GlcNAc-Glc3-betaCD and Gal-GlcNAc-Glc3-betaCD were analyzed by FAB-MS and NMR spectroscopy and identified as 6-O-alpha-(6(3)-O-beta-D-N-acetylglucosaminyl-maltotriosyl)-betaCD, and 6-O-alpha-(4-O-beta-D-galactopyranosyl-6(3)-O-beta-D-N-acetylglucosaminyl-maltotriosyl)-betaCD respectively. PMID:15849411

  17. Laminin alpha1 chain mediated reduction of laminin alpha2 chain deficient muscular dystrophy involves integrin alpha7beta1 and dystroglycan.

    PubMed

    Gawlik, Kinga I; Mayer, Ulrike; Blomberg, Kristina; Sonnenberg, Arnoud; Ekblom, Peter; Durbeej, Madeleine

    2006-03-20

    Transgenically introduced laminin (LN) alpha1 chain prevents muscular dystrophy in LNalpha2 chain deficient mice. We now report increased integrin alpha7Bbeta1D synthesis in dystrophic LNalpha2 chain deficient muscle. Yet, immunofluorescence demonstrated a reduced expression of integrin alpha7B subunit at the sarcolemma. Transgenic expression of LNalpha1 chain reconstituted integrin alpha7B at the sarcolemma. Expression of alpha- and beta-dystroglycan is enhanced in LNalpha2 chain deficient muscle and normalized by transgenic expression of LNalpha1 chain. We suggest that LNalpha1 chain in part ameliorates the development of LNalpha2 chain deficient muscular dystrophy by retaining the binding sites for integrin alpha7Bbeta1D and alpha-dystroglycan, respectively. PMID:16504180

  18. Medium-chain fatty acids undergo elongation before {beta}-oxidation in fibroblasts

    SciTech Connect

    Jones, Patricia M. . E-mail: Patti.Jones@childrens.com; Butt, Yasmeen; Messmer, Bette; Boriak, Richard; Bennett, Michael J.

    2006-07-21

    Although mitochondrial fatty acid {beta}-oxidation (FAO) is considered to be well understood, further elucidation of the pathway continues through evaluation of patients with FAO defects. The FAO pathway can be examined by measuring the 3-hydroxy-fatty acid (3-OHFA) intermediates. We present a unique finding in the study of this pathway: the addition of medium-chain fatty acids to the culture media of fibroblasts results in generation of 3-OHFAs which are two carbons longer than the precursor substrate. Cultured skin fibroblasts from normal and LCHAD-deficient individuals were grown in media supplemented with various chain-length fatty acids. The cell-free medium was analyzed for 3-OHFAs by stable-isotope dilution gas-chromatography/mass-spectrometry. Our finding suggests that a novel carbon chain-length elongation process precedes the oxidation of medium-chain fatty acids. This previously undescribed metabolic step may have important implications for the metabolism of medium-chain triglycerides, components in the dietary treatment of a number of disorders.

  19. Sequence and expression of a halobacterial beta-galactosidase gene.

    PubMed

    Holmes, M L; Dyall-Smith, M L

    2000-04-01

    Studies of gene expression in haloarchaea have been greatly hindered by the lack of a convenient reporter gene. In a previous study, a beta-galactosidase from Haloferax alicantei was purified and several peptide sequences determined. The peptide sequences have now been used to clone the entire beta-galactosidase gene (designated bgaH) along with some flanking chromosomal DNA. The deduced amino acid sequence of BgaH was 665 amino acids (74 kDa) and showed greatest amino acid similarity to members of glycosyl hydrolase family 42 [classification of Henrissat, B., and Bairoch, A. (1993) New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem J 293: 781-788]. Within this family, BgaH was most similar (42-43% aa identity) to enzymes from extremely thermophilic bacteria such as Thermotoga and Thermus. Family 42 enzymes are only distantly related to the Sulfolobus LacS and Escherichia coli LacZ enzymes (families one and two respectively). Three open reading frames (ORFs) upstream of bgaH were readily identified by database searches as glucose-fructose oxidoreductase, 2-dehydro-3-deoxyphosphogluconate aldolase and 2-keto-3-deoxygluconate kinase, enzymes that are also involved in carbohydrate metabolism. Downstream of bgaH there was an ORF which contained a putative fibronectin III motif. The bgaH gene was engineered into a halobacterial plasmid vector and introduced into Haloferax volcanii, a widely used strain that lacks detectable beta-galactosidase activity. Transformants were shown to express the enzyme; colonies turned blue when sprayed with Xgal and enzyme activity could be easily quantitated using a standard ONPG assay. In an accompanying publication, Patenge et al. (2000) have demonstrated the utility of bgaH as a promoter reporter in Halobacterium salinarum. PMID:10760168

  20. A study of membrane protein defects and alpha hemoglobin chains of red blood cells in human beta thalassemia

    SciTech Connect

    Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.; Guetarni, D.; Bachir, D.; Colonna, P.; Beuzard, Y. )

    1989-11-15

    The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with ({sup 3}H)N-ethylmaleimide. This pool of soluble alpha chains was 0.067 {plus minus} 0.017% of hemoglobin in blood of normal adult, 0.11 {plus minus} 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% in the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using ({sup 3}H)N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups.

  1. Long-chain fatty acid esters of 5-androstene-3 beta, 17 beta-diol: composition and turnover in human mammary cancer cells in culture.

    PubMed

    Martyn, P; Adams, J B

    1989-08-01

    Long-chain fatty acid esters of the adrenal-derived estrogen 5-androstene-3 beta, 17 beta-diol (ADIOL) were found to accumulate in four human mammary cancer cell lines (MCF-7, ZR-75-1, MDA-MB-231 and MDA-MB-330) when explosed to 10-30 nM ADIOL for variable time periods. At each time point examined, the monoester fraction, which represented the major component of the total lipoidal fraction, contained fatty acids linked to either the 3 beta- or 17 beta-positions. However, there was considerable variation in the ratio of 3 beta- to 17 beta-monoesters in the four cell lines. By means of reverse phase HPLC and referral to authentic synthesized compounds, each monoester fraction was found to contain a number of long-chain fatty acid components whose composition resembled that previously determined for the fatty acid esters formed from 17 beta-estradiol. A specific and measurable turnover of a subfraction of ADIOL-17 beta-monoesters composed of essential fatty acids (22:6, 20:4, 18:3) occurred in MCF-7 cells, and to a lesser extent in ZR-75-1 cells. No changes were observed with time in any of the components of the 3 beta- or 17 beta-monoester fractions in MDA-MB-231 and MDA-MB-330 cells. These results, coupled with other studies, now suggest that a very rapid turnover of some components of these lipoidal derivatives may be occurring. If so, it is possible that the system of acylation-deacylation may be involved in a transport mechanism for estrogens and perhaps other steroid hormones. PMID:2588301

  2. Structural organization of the human cardiac [alpha]-myosin heavy chain gene (MYH6)

    SciTech Connect

    Epp, T.A.; Dixon, I.M.C.; Wang, H.Y.; Sole, M.J.; Liew, C.C. )

    1993-12-01

    The human myocardium expresses two cardiac myosin heavy chain (MyHC) isoforms, [alpha] and [beta], that exist in tandem array on chromosome 14q12. The authors have previously sequenced the entire human cardiac [beta]-MyHC gene and now report the complete nucleotide sequence of the human cardiac [alpha]-MyHC, encompassing 26,159 bp as well as the entire 4484-bp 5'-flanking intergenic region. The gene (MYH6) consists of 39 exons, 37 of which contain coding information. The 5'-untranslated region is split into 3 exons, with the third exon containing the AUG translocation initiation codon. With the exception of the 13th intron of the human cardiac [beta]-MyHC, which is not present within the [alpha]-isogene, all exon/intron boundaries are conserved. Conspicuous sequence motifs contained within the [alpha]-MyHC gene include four Alu repeats, a single (GT)[sub n] element, and a homopurine-homopyrimidine tract containing 23 GAA repeating units followed by 10 GAG repeating units. Comparison of the encoded amino acid sequence with a previously reported human [alpha]-MyHC cDNA sequence reveals several potential polymorphisms. 29 refs., 1 fig., 1 tab.

  3. Targeted inactivation of murine laminin gamma2-chain gene recapitulates human junctional epidermolysis bullosa.

    PubMed

    Meng, Xianmin; Klement, John F; Leperi, Dominic A; Birk, David E; Sasaki, Takako; Timpl, Rupert; Uitto, Jouni; Pulkkinen, Leena

    2003-10-01

    Junctional forms of epidermolysis bullosa (JEB) are associated with mutations in six distinct genes expressed in the cutaneous basement membrane zone; these include LAMA3, LAMB3, and LAMC2, which encode laminin 5 subunit polypeptides, the alpha3-, beta3-, and gamma2-chains, respectively. Here we generated a mouse model for JEB by inactivating the laminin gamma2-chain gene by targeted frameshift deletion of exon 8 in Lamc2. Heterozygous mice were phenotypically normal, whereas the majority of Lamc2-/- mice showed blistering phenotype on days 1 to 2 and died within 5 days of birth. The Lamc2-/- mice demonstrated absent expression of laminin gamma2-chain on the basement membrane zone as well as attenuated expression of alpha3- and beta3-chains of laminin. Transmission electron microscopy revealed rudimentary, poorly developed hemidesmosomes. The epidermis of the Lamc2-/- mice revealed induced apoptosis in the basal cells of the blistered skin, suggesting that cell-matrix adhesion provided by laminin 5 plays a role in cell survival in vivo. Cultured Lamc2-/- keratinocytes demonstrated slightly positive staining with gamma2-chain-specific antibodies, which could be explained by the presence of a transcript with partial restoration of the reading frame owing to alternative splicing in vitro. These cells proliferated in different matrices and attached to type IV collagen and Matrigel as efficiently as the wild-type keratinocytes, whereas their attachment on plastic and laminin was significantly weaker. In summary, Lamc2-/- mouse recapitulates human JEB and provides novel insight into the role of laminin 5 in keratinocyte biology. PMID:14632187

  4. Gene Prioritization by Compressive Data Fusion and Chaining.

    PubMed

    Žitnik, Marinka; Nam, Edward A; Dinh, Christopher; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaž

    2015-10-01

    Data integration procedures combine heterogeneous data sets into predictive models, but they are limited to data explicitly related to the target object type, such as genes. Collage is a new data fusion approach to gene prioritization. It considers data sets of various association levels with the prediction task, utilizes collective matrix factorization to compress the data, and chaining to relate different object types contained in a data compendium. Collage prioritizes genes based on their similarity to several seed genes. We tested Collage by prioritizing bacterial response genes in Dictyostelium as a novel model system for prokaryote-eukaryote interactions. Using 4 seed genes and 14 data sets, only one of which was directly related to the bacterial response, Collage proposed 8 candidate genes that were readily validated as necessary for the response of Dictyostelium to Gram-negative bacteria. These findings establish Collage as a method for inferring biological knowledge from the integration of heterogeneous and coarsely related data sets. PMID:26465776

  5. Gene Prioritization by Compressive Data Fusion and Chaining

    PubMed Central

    Žitnik, Marinka; Nam, Edward A.; Dinh, Christopher; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaž

    2015-01-01

    Data integration procedures combine heterogeneous data sets into predictive models, but they are limited to data explicitly related to the target object type, such as genes. Collage is a new data fusion approach to gene prioritization. It considers data sets of various association levels with the prediction task, utilizes collective matrix factorization to compress the data, and chaining to relate different object types contained in a data compendium. Collage prioritizes genes based on their similarity to several seed genes. We tested Collage by prioritizing bacterial response genes in Dictyostelium as a novel model system for prokaryote-eukaryote interactions. Using 4 seed genes and 14 data sets, only one of which was directly related to the bacterial response, Collage proposed 8 candidate genes that were readily validated as necessary for the response of Dictyostelium to Gram-negative bacteria. These findings establish Collage as a method for inferring biological knowledge from the integration of heterogeneous and coarsely related data sets. PMID:26465776

  6. Alpha globin gene analysis in a Sardinian family with interacting alpha and beta thalassaemia genes.

    PubMed

    Melis, M A; Galanello, R; Cao, A

    1983-04-01

    This paper reports the results of alpha globin gene analysis in a Sardinian family with interacting alpha and beta thalassaemia genes. The propositus, who was identified in a newborn survey as he had 26.0% Hb Bart's and 74.0% Hb F, successively developed the clinical and haematological picture of a transfusion-dependent thalassaemia major. According to the haemoglobin pattern, restriction endonuclease analysis of the DNA from this patient showed the deletion of three of the four alpha-globin structural genes. Thus beta 0-thalassaemia homozygotes with the delection of three alpha-structural genes seem to have a severe clinical phenotype similar to that of patients with a full complement of four alpha-globin structural genes. PMID:6299325

  7. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease.

    PubMed

    Khalil, S H; Siegrist, K; Akhtar, M

    1997-07-01

    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  8. Biased Immunoglobulin Light Chain Gene Usage in the Shark.

    PubMed

    Iacoangeli, Anna; Lui, Anita; Naik, Ushma; Ohta, Yuko; Flajnik, Martin; Hsu, Ellen

    2015-10-15

    This study of a large family of κ L chain clusters in nurse shark completes the characterization of its classical Ig gene content (two H chain isotypes, μ and ω, and four L chain isotypes, κ, λ, σ, and σ-2). The shark κ clusters are minigenes consisting of a simple VL-JL-CL array, where V to J recombination occurs over an ~500-bp interval, and functional clusters are widely separated by at least 100 kb. Six out of ~39 κ clusters are prerearranged in the germline (germline joined). Unlike the complex gene organization and multistep assembly process of Ig in mammals, each shark Ig rearrangement, somatic or in the germline, appears to be an independent event localized to the minigene. This study examined the expression of functional, nonproductive, and sterile transcripts of the κ clusters compared with the other three L chain isotypes. κ cluster usage was investigated in young sharks, and a skewed pattern of split gene expression was observed, one similar in functional and nonproductive rearrangements. These results show that the individual activation of the spatially distant κ clusters is nonrandom. Although both split and germline-joined κ genes are expressed, the latter are prominent in young animals and wane with age. We speculate that, in the shark, the differential activation of the multiple isotypes can be advantageously used in receptor editing. PMID:26342033

  9. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides, an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene express...

  10. A Chromosome 8 Gene-Cluster Polymorphism with Low Human Beta-Defensin 2 Gene Copy Number Predisposes to Crohn Disease of the Colon

    PubMed Central

    Fellermann, Klaus; Stange, Daniel E.; Schaeffeler, Elke; Schmalzl, Hartmut; Wehkamp, Jan; Bevins, Charles L.; Reinisch, Walter; Teml, Alexander; Schwab, Matthias; Lichter, Peter; Radlwimmer, Bernhard; Stange, Eduard F.

    2006-01-01

    Defensins are endogenous antimicrobial peptides that protect the intestinal mucosa against bacterial invasion. It has been suggested that deficient defensin expression may underlie the chronic inflammation of Crohn disease (CD). The DNA copy number of the beta-defensin gene cluster on chromosome 8p23.1 is highly polymorphic within the healthy population, which suggests that the defective beta-defensin induction in colonic CD could be due to low beta-defensin–gene copy number. Here, we tested this hypothesis, using genomewide DNA copy number profiling by array-based comparative genomic hybridization and quantitative polymerase-chain-reaction analysis of the human beta-defensin 2 (HBD-2) gene. We showed that healthy individuals, as well as patients with ulcerative colitis, have a median of 4 (range 2–10) HBD-2 gene copies per genome. In a surgical cohort with ileal or colonic CD and in a second large cohort with inflammatory bowel diseases, those with ileal resections/disease exhibited a normal median HBD-2 copy number of 4, whereas those with colonic CD had a median of only 3 copies per genome (P=.008 for the surgical cohort; P=.032 for the second cohort). Overall, the copy number distribution in colonic CD was shifted to lower numbers compared with controls (P=.002 for both the surgical cohort and the cohort with inflammatory bowel diseases). Individuals with ⩽3 copies have a significantly higher risk of developing colonic CD than did individuals with ⩾4 copies (odds ratio 3.06; 95% confidence interval 1.46–6.45). An HBD-2 gene copy number of <4 was associated with diminished mucosal HBD-2 mRNA expression (P=.033). In conclusion, a lower HBD-2 gene copy number in the beta-defensin locus predisposes to colonic CD, most likely through diminished beta-defensin expression. PMID:16909382

  11. Hepatocyte nuclear factor 3beta is involved in pancreatic beta-cell-specific transcription of the pdx-1 gene.

    PubMed Central

    Wu, K L; Gannon, M; Peshavaria, M; Offield, M F; Henderson, E; Ray, M; Marks, A; Gamer, L W; Wright, C V; Stein, R

    1997-01-01

    The mammalian homeobox gene pdx-1 is expressed in pluripotent precursor cells in the dorsal and ventral pancreatic bud and duodenal endoderm, which will produce the pancreas and the rostral duodenum. In the adult, pdr-1 is expressed principally within insulin-secreting pancreatic islet beta cells and cells of the duodenal epithelium. Our objective in this study was to localize sequences within the mouse pdx-1 gene mediating selective expression within the islet. Studies of transgenic mice in which a genomic fragment of the mouse pdx-1 gene from kb -4.5 to +8.2 was used to drive a beta-galactosidase reporter showed that the control sequences sufficient for appropriate developmental and adult specific expression were contained within this region. Three nuclease-hypersensitive sites, located between bp -2560 and -1880 (site 1), bp -1330 and -800 (site 2), and bp -260 and +180 (site 3), were identified within the 5'-flanking region of the endogenous pdx-1 gene. Pancreatic beta-cell-specific expression was shown to be controlled by sequences within site 1 from an analysis of the expression pattern of various pdr-1-herpes simplex virus thymidine kinase promoter expression constructs in transfected beta-cell and non-beta-cell lines. Furthermore, we also established that this region was important in vivo by demonstrating that expression from a site 1-driven beta-galactosidase reporter construct was directed to islet beta-cells in transgenic mice. The activity of the site 1-driven constructs was reduced substantially in beta-cell lines by mutating a hepatocyte nuclear factor 3 (HNF3)-like site located between nucleotides -2007 and -1996. Gel shift analysis indicated that HNF3beta present in islet beta cells binds to this element. Immunohistochemical studies revealed that HNF3beta was present within the nuclei of almost all islet beta cells and subsets of pancreatic acinar cells. Together, these results suggest that HNF3beta, a key regulator of endodermal cell lineage

  12. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    SciTech Connect

    Louie, E.; Dietz, L.; Shafer, F.

    1994-09-01

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  13. Immunohistochemical analysis of the skin in junctional epidermolysis bullosa using laminin 5 chain specific antibodies is of limited value in predicting the underlying gene mutation.

    PubMed

    McMillan, J R; McGrath, J A; Pulkkinen, L; Kon, A; Burgeson, R E; Ortonne, J P; Meneguzzi, G; Uitto, J; Eady, R A

    1997-06-01

    The anchoring filament protein laminin 5 is composed of three polypeptide chains (alpha 3, beta 3 and gamma 2) each encoded by separate genes (LAMA3, LAMB3 and LAMC2, respectively). Mutations in any of these three genes may give rise to the autosomal recessive blistering skin disease, junctional epidermolysis bullosa. At present, there is no easy way of predicting which of these three genes might harbour the pathogenetic laminin 5 mutations in a case of junctional epidermolysis bullosa. In this study, we assessed whether immunohistochemistry might be helpful in this regard. We performed immunohistochemical labelling of the dermal-epidermal junction using alpha 3, beta 3 and gamma 2 chain-specific antibodies in 11 patients with junctional epidermolysis bullosa, in whom the laminin 5 mutations had been previously delineated. Although, labelling for the laminin 5 chain bearing the mutations was attenuated or undetectable in all cases, a complete absence of labelling or a reduction in the staining intensity for the other two chains was also seen in all cases. The results showed that immunohistochemical labelling of the dermal-epidermal junction using alpha 3, beta 3 and gamma 2 chain-specific antibodies is not a specific indicator for which of the laminin 5 chain genes contains the pathogenetic mutations, and is therefore unreliable in screening for individual laminin 5 gene mutations in cases of junctional epidermolysis bullosa. PMID:9217810

  14. Inhibition of bacterial cell wall-induced leukocyte recruitment and hepatic granuloma formation by TGF-beta gene transfer.

    PubMed

    Song, X; Zeng, L; Pilo, C M; Zagorski, J; Wahl, S M

    1999-10-01

    Intraperitoneal injection of streptococcal cell walls (SCW) into Lewis rats results in dissemination of SCW to the liver, spleen, bone marrow, and peripheral joints. The uptake of SCW by Kupffer cells in the liver initiates a chain of events largely mediated by T lymphocytes and macrophages. Local synthesis and secretion of cytokines and growth factors in response to the persistent SCW lead to the evolution and maintenance of a chronic T cell-dependent granulomatous response and result in granuloma formation and irreversible hepatic fibrosis. In an attempt to impede the development of the chronic granulomatous lesions in the liver, we injected a plasmid DNA encoding TGF-beta 1 i.m. to the SCW animals to determine the effect of TGF-beta 1 gene transfer on the course of liver inflammation and fibrosis. A single injection of plasmid DNA encoding TGF-beta 1 resulted in virtual abolition of the development of the SCW-induced hepatic granuloma formation and matrix expansion. TGF-beta 1 DNA not only reduced key proinflammatory cytokines including TNF-alpha, IL-1 beta, IFN-gamma, and IL-18, but also inhibited both CXC and CC chemokine production, thereby blocking inflammatory cell recruitment and accumulation in the liver. Moreover, TGF-beta 1 gene delivery inhibited its own expression in the liver tissue, which is otherwise up-regulated in SCW-injected animals. Our study suggests that TGF-beta 1 gene transfer suppresses hepatic granuloma formation by blocking the recruitment of inflammatory cells to the liver, and thus may provide a new approach to the control of hepatic granulomatous and fibrotic diseases. PMID:10491005

  15. Crystal Structure of Staphylococcal Enterotoxin G (SEG) in Complex with a Mouse T-cell Receptor Beta Chain

    SciTech Connect

    Fernandez, M.M.; Robinson, H.; Cho, S.; De Marzi, M. C.; Kerzic, M. C.; Mariuzza, R. A.; Malchiodi, E. L.

    2011-01-14

    Superantigens (SAgs) are bacterial or viral toxins that bind MHC class II (MHC-II) molecules and T-cell receptor (TCR) in a nonconventional manner, inducing T-cell activation that leads to inflammatory cytokine production, which may result in acute toxic shock. In addition, the emerging threat of purpura fulminans and community-associated meticillin-resistant Staphylococcus aureus emphasizes the importance of a better characterization of SAg binding to their natural ligands that may allow the development of reagents to neutralize their action. The three-dimensional structure of the complex between a mouse TCR {beta} chain (mV{beta}8.2) and staphylococcal enterotoxin G (SEG) at 2.0 {angstrom} resolution revealed a binding site that does not conserve the 'hot spots' present in mV{beta}8.2-SEC2, mV{beta}8.2-SEC3, mV{beta}8.2-SEB, and mV{beta}8.2-SPEA complexes. Analysis of the mV{beta}8.2-SEG interface allowed us to explain the higher affinity of this complex compared with the others, which may account for the early activation of T-cells bearing mV{beta}8.2 by SEG. This mode of interaction between SEG and mV{beta}8.2 could be an adaptive advantage to bestow on the pathogen a faster rate of colonization of the host.

  16. Human T-cell receptor v{beta} gene polymorphism and multiple sclerosis

    SciTech Connect

    Wei, S.; Charmley, P.; Birchfield, R.I.; Concannon, P.

    1995-04-01

    Population-based genetic associations have been reported between RFLPs detected with probes corresponding to the genes encoding the {beta} chain of the T-cell receptor for antigen (RCRB) and a variety of autoimmune disorders. In the case of multiple sclerosis (MS), these studies have localized a putative disease-associated gene to a region of {approximately}110 kb in length, located within the TCRB locus. In the current study, all 14 known TCRBV (variable region) genes within the region of localization were mapped and identified. The nucleotide sequences of these genes were determined in a panel of six MS patients and six healthy controls, who were human-leukocyte antigen and TCRB-RFLP haplotype matched. Nine of the 14 TCRBV genes studied showed evidence of polymorphism. PCR-based assays for each of these polymorphic genes were developed, and allele and genotype frequencies were determined in a panel of DNA samples from 48 MS patients and 60 control individuals. No significant differences in allele, genotype, or phenotype frequencies were observed between the MS patients and controls for any of the 14 TCRBV-gene polymorphisms studied. In light of the extensive linkage disequilibrium across the region studied, the saturating numbers of polymorphisms examined, and the direct sequence analysis of all BV genes in the region, these results suggest that it is unlikely that germ-line polymorphism in the TCRBV locus makes a major contribution to MS susceptibility. The TCRBV coding region-specific markers generated in these studies, as well as the approach of testing for associations with specific functionally relevant polymorphic sites within individual BV genes, should be useful in the evaluation of the many reported disease associations involving the human TCRB region. 22 refs., 1 fig., 3 tabs.

  17. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  18. A chain reaction approach to modelling gene pathways

    PubMed Central

    Cheng, Gary C.; Chen, Dung-Tsa; Chen, James J.; Soong, Seng-jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-01-01

    Background Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. Results In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  19. Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

    SciTech Connect

    Calabrese, G.; Morizio, E.; Palka, G.

    1994-11-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here the authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.

  20. Isolation and characterization of the complete chicken beta-globin gene region: frequent deletion of the adult beta-globin genes in lambda.

    PubMed Central

    Villeponteau, B; Martinson, H

    1981-01-01

    A library of bacteriophage lambda clones containing chicken chromosomal DNA was screened, using the adult beta-globin cDNA plasmid pHb 1001 as a probe. Sixteen overlapping clones were isolated containing 35 kilobase pairs (kbp) of chicken DNA. Characterization of these clones revealed four beta-like globin genes, some genomically repeated sequences, but no pseudo-genes. The four beta-like genes have an average intergenic distance of less than half of that found for the mammalian beta-like globin gene clusters so far characterized. The overall features of the map were confirmed by genomic Southern analysis. Frequent deletions were shown to occur between the various beta-like globin genes during phage propagation. The presumptive hatching gene in particular was always associated with abnormal lambda clones although we were able to find one such clone that did contain a normal copy of the hatching gene itself. Probably such deletions explain the failure to recover this gene in previous attempts. Images PMID:6269092

  1. Chromosome mapping of the human arrestin (SAG), {beta}-arrestin 2 (ARRB2), and {beta}-adrenergic receptor kinase 2 (ADRBK2) genes

    SciTech Connect

    Calabrese, G.; Sallese, M.; Stornaiuolo, A.

    1994-09-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor and its functional cofactor, {beta}-arrestin. Both {beta}ARK and {beta}-arrestin are members of multigene families. The family of G-protein-coupled receptor kinases includes rhodopsin kinase, {beta}ARK1, {beta}ARK2, IT11-A (GRK4), GRK5, and GRK6. The arrestin/{beta}-arrestin gene family includes arrestin (also known as S-antigen), {beta}-arrestin 1, and {beta}-arrestin 2. Here we report the chromosome mapping of the human genes for arrestin (SAG), {beta}arrestin 2 (ARRB2), and {beta}ARK2 (ADRBK2) by fluorescence in situ hybridization (FISH). FISH results confirmed the assignment of the gene coding for arrestin (SAG) to chromosome 2 and allowed us to refine its localization to band q37. The gene coding for {beta}-arrestin 2 (ARRB2) was mapped to chromosome 17p13 and that coding for {beta}ARK2 (ADRBK2) to chromosome 22q11. 17 refs., 1 fig.

  2. Functional polymorphism of each of the two HLA-DR beta chain loci demonstrated with antigen-specific DR3- and DRw52-restricted T cell clones

    PubMed Central

    1988-01-01

    HLA-DR3- and HLA-DRw52-associated functional polymorphism was investigated with selected tetanus toxoid (TT)-specific T cell clones. We have shown earlier that HLA-DR antigens are encoded by two distinct loci, DR beta I and DR beta III. The alloantigenic determinant(s) defined by the serological HLA-DR3 specificity map to the former, while the supratypic HLA-DRw52 determinants map to DR beta III. Furthermore, we have recently recognized by DNA sequencing three alleles of HLA- DRw52 at locus DR beta III, referred to as 52 a, b, and c. Our objective was to correlate the pattern of T cell restriction with the gene products of individual DR beta chain loci and with the three newly described alleles of locus DR beta III. Among the selected T cell clones, 5 reacted exclusively when TT was presented by HLA-DR3+ APCs (TT-DR3-APC). In contrast, two T cell clones were stimulated by TT- DRw52-APC. More specifically, these two T cell clones (Clones 10 and 16) were stimulated by different subsets of TT-DRw52-APC. Clone 16 responded to some DR3 and TT-DRw6-APC, while clone 10 was stimulated by other TT-DR3 and TT-DRw6, and all TT-DR5-APC. This same pattern of DRw52 restriction was found in panel, as well as in family studies. Because this suggested a correlation with the pattern of DRw52 polymorphism observed earlier by DNA sequencing and oligonucleotide hybridization, the APC used in these experiments were typed for the 52 a, b, and c alleles of locus DR beta III by allele-specific oligonucleotide probes. This distribution overlapped exactly with the stimulation pattern defined by the T cell clones. Clone 16 responded to TT-52a-APC, clone 10 to TT-52b-APC, and both clones to a TT-52c-APC. The response of the T cell clones was inhibited differentially by mAbs to DR. Raising TT concentration, or increasing HLA-class II expression with INF-gamma both affected the magnitude of response of the TT- specific clones but did not modify their specificities. These results demonstrate that

  3. Molecular dynamics studies of side chain effect on the beta-1,3-D-glucan triple helix in aqueous solution.

    PubMed

    Okobira, Tadashi; Miyoshi, Kentaro; Uezu, Kazuya; Sakurai, Kazuo; Shinkai, Seiji

    2008-03-01

    beta-1,3-D-glucans have been isolated from fungi as right-handed 6(1) triple helices. They are categorized by the side chains bound to the main triple helix through beta-(1-->6)-D-glycosyl linkage. Indeed, since a glucose-based side chain is water soluble, the presence and frequency of glucose-based side chains give rise to significant variation in the physical properties of the glucan family. Curdlan has no side chains and self-assembles to form an water-insoluble triple helical structure, while schizophyllan, which has a 1,6-D-glucose side chain on every third glucose unit along the main chain, is completely water soluble. A thermal fluctuation in the optical rotatory dispersion is observed for the side chain, indicating probable co-operative interaction between the side chains and water molecules. This paper documents molecular dynamics simulations in aqueous solution for three models of the beta-1,3-D-glucan series: curdlan (no side chain), schizophyllan (a beta-(1-->6)-D-glycosyl side-chain at every third position), and a hypothetical triple helix with a side chain at every sixth main-chain glucose unit. A decrease was observed in the helical pitch as the population of the side chain increased. Two types of hydrogen bonding via water molecules, the side chain/main chain and the side chain/side chain hydrogen bonding, play an important role in determination of the triple helix conformation. The formation of a one-dimensional cavity of diameter about 3.5 A was observed in the schizophyllan triple helix, while curdlan showed no such cavity. The side chain/side chain hydrogen bonding in schizophyllan and the hypothetical beta-1,3-D-glucan triple helix could cause the tilt of the main-chain glucose residues to the helix. PMID:18257529

  4. Ultrasound-mediated interferon {beta} gene transfection inhibits growth of malignant melanoma

    SciTech Connect

    Yamaguchi, Kazuki; Feril, Loreto B.; Tachibana, Katsuro; Takahashi, Akira; Matsuo, Miki; Endo, Hitomi; Harada, Yoshimi; Nakayama, Juichiro

    2011-07-22

    Highlights: {yields} Successful ultrasound-mediated transfection of melanoma (C32) cells with IFN-{beta} genes both in vitro and in vivo. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited proliferation of melanoma cells in vitro. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited melanoma tumor growth in vivo. -- Abstract: We investigated the effects of ultrasound-mediated transfection (sonotransfection) of interferon {beta} (IFN-{beta}) gene on melanoma (C32) both in vitro and in vivo. C32 cells were sonotransfected with IFN-{beta} in vitro. Subcutaneous C32 tumors in mice were sonicated weekly immediately after intra-tumor injection with IFN-{beta} genes mixed with microbubbles. Successful sonotransfection with IFN-{beta} gene in vitro was confirmed by ELISA, which resulted in C32 growth inhibition. In vivo, the growth ratio of tumors transfected with IFN-{beta} gene was significantly lower than the other experimental groups. These results may lead to a new method of treatment against melanoma and other hard-to-treat cancers.

  5. Genomic organization of the human {beta}-catenin gene (CTNNB1)

    SciTech Connect

    Nollet, F.; Berx, G.; Molemans, F.; Roy, F. van

    1996-03-05

    The cytoplasmic {beta}-catenin protein is implicated in signal transduction and associates with both the cell-cell adhesion protein E-cadherin and the tumor suppressor gene product APC. We determined the primary structure of the human {beta}-catenin gene (CTNNB1) by analysis cDNA and genomic clones. The size of the complete gene was determined to be 23.2 kb. Restriction mapping and partial sequence analysis revealed 16 exons. All splice donor and acceptor sites were conformable to the GT/AG rule. The exon size ranged from 61 to 790 bp. Half of the introns were smaller than 550 bp, with the smallest being 84 pb and the longest being 6700 bp. The intron-exon boundaries did not coincide either with conserved sites in the 12 armadillo repeat sequences of {beta}-catenin or with intron-exon boundaries in the armadillo gene of Drosophila. A major site for transcription initiation was identified as an A residue 214 nucleotides upstream of the ATG initiation codon. The resulting transcript is 3362 nucleotides long. Compared to the previously published mRNA sequence, additional residues were identified, 16 at the 5{prime} end and 766 at the 3{prime} end of the mRNA. An alternative splice acceptor site within exon 16 reduced the 3{prime} UTR sequence by 159 bp. Polymerase chain reaction on cDNA from 14 human cell lines demonstrated the general occurrence of both splice variants. The 5{prime}-flanking region is highly GC-rich and lacks a CCAAT box, but contains a TATA box and potential binding sites for several transcription factors, such as NFkB, SP1, AP2, and EGR1. Both a 437-bp fragment and a 6-kb fragment, containing about 4.7 kb of the 5{prime}-flanking region in addition to the noncoding exon 1 and 1 kb of intron 1, showed clear promoter activity when these fragments were linked to a secreted alkaline phosphatase reporter gene and transfected into a mouse epithelial cell line. 53 refs., 5 figs., 2 tabs.

  6. Characterization of a new beta-lactamase gene from isolates of Vibrio spp. in Korea.

    PubMed

    Jun, Lyu Jin; Kim, Jae Hoon; Jin, Ji Woong; Jeong, Hyun Do

    2012-04-01

    PCR was performed to analyze the beta-lactamase genes carried by ampicillin-resistant Vibrio spp. strains isolated from marine environments in Korea between 2006 and 2009. All 36 strains tested showed negative results in PCR with the primers designed from the nucleotide sequences of various known beta-lactamase genes. This prompted us to screen new beta-lactamase genes. A novel beta-lactamase gene was cloned from Vibrio alginolyticus KV3 isolated from the aquaculture water of Geoje Island of Korea. The determined nucleotide sequence (VAK-3 beta-lactamase) revealed an open reading frame (ORF) of 852 bp, encoding a protein of 283 amino acids (aa), which displayed low homology to any other beta-lactamase genes reported in public databases. The deduced 283 aa sequence of VAK-3, consisting of a 19 aa signal peptide and a 264 aa mature protein, contained highly conserved peptide segments specific to class A beta-lactamases including the specific amino acid residues STFK (62-65), SDN (122-124), E (158), and RTG (226-228). Results from PCR performed with primers specific to the VAK-3 beta-lactamase gene identified 3 of the 36 isolated strains as V. alginolyticus, Vibrio cholerae, and Photobacterium damselae subsp. damselae, indicating the utilization of various beta-lactamase genes including unidentified ones in ampicillin-resistant Vibrio spp. strains from the marine environment. In a mating experiment, none of the isolates transfered the VAK-3 beta-lactamase gene to the Escherichia coli recipient. This lack of mobility, and the presence of a chromosomal acyl-CoA flanking sequence upstream of the VAK-3 beta- lactamase gene, led to the assumption that the location of this new beta-lactamase gene was in the chromosome, rather than the mobile plasmid. Antibiotic susceptibility of VAK-3 beta-lactamase was indicated by elevated levels of resistance to penicillins, but not to cephalosporins in the wild type and E. coli harboring recombinant plasmid pKV-3, compared with those of

  7. Deletion of the immunoglobulin kappa chain intron enhancer abolishes kappa chain gene rearrangement in cis but not lambda chain gene rearrangement in trans.

    PubMed Central

    Takeda, S; Zou, Y R; Bluethmann, H; Kitamura, D; Muller, U; Rajewsky, K

    1993-01-01

    Immunoglobulins (Ig) secreted from a plasma cell contain either kappa or lambda light chains, but not both. This phenomenon is termed isotypic kappa-lambda exclusion. While kappa-producing cells have their lambda chain genes in germline configuration, in most lambda-producing cells the kappa chain genes are either non-productively rearranged or deleted. To investigate the molecular mechanism for isotypic kappa-lambda exclusion, in particular the role of the Ig kappa intron enhancer, we replaced this enhancer by a neomycin resistance (neoR) gene in embryonic stem (ES) cells. B cells heterozygous for the mutation undergo V kappa-J kappa recombination exclusively in the intact Ig kappa locus but not in the mutated Ig kappa locus. Homozygous mutant mice exhibited no rearrangements in their Ig kappa loci. However, splenic B cell numbers were only slightly reduced as compared with the wild-type, and all B cells expressed lambda chain bearing surface Ig. These findings demonstrate that rearrangement in the Ig kappa locus is not essential for lambda gene rearrangement. We also generated homozygous mutant mice in which the neoR gene was inserted at the 3' end of the Ig kappa intron enhancer. Unexpectedly, mere insertion of the neoR gene showed some suppressive effect on V kappa-J kappa recombination. However, the much more pronounced inhibition of V kappa-J kappa recombination by the replacement of the Ig kappa intron enhancer suggests that this enhancer is essential for V kappa-J kappa recombination. Images PMID:8508766

  8. Identification of a putative yeast homolog of the mammalian beta chains of the clathrin-associated protein complexes.

    PubMed Central

    Kirchhausen, T

    1990-01-01

    The clathrin-associated protein complexes are heterotetrameric structures believed to interact with clathrin and with membrane components of mammalian coated pits and coated vesicles. I have identified a yeast homolog of the mammalian beta-type large chains, suggesting the existence in yeast cells of clathrin-associated protein complexes. A sequence comparison between the putative yeast beta-type chain and its mammalian counterparts shows that their amino-terminal domains are related over their entire length and that their carboxyl-terminal domains diverge completely. This observation is consistent with our earlier proposal (T. Kurchhausen et al., Proc. Natl. Acad. Sci. USA 86:2612-2616, 1989) for the bifunctional-domain organization of the large chains, in which the invariant amino-terminal region interacts with conserved proteins of the coat while the variable carboxyl-terminal domain interacts with different membrane components of coated pits and coated vesicles. PMID:2122239

  9. Subclustering of human immunoglobulin kappa light chain variable region genes

    SciTech Connect

    Kurth, J.H.; Mountain, J.L.; Cavalli-Sforza, L.L. )

    1993-04-01

    The human immunoglobulin kappa light chain (IgK) locus includes multiple variable region gene segments (V[sub k]) that can be divided into four subgroups. Oligonucleotide primers were designed to amplify specifically gene segments of the V[sub k]I, V[sub k]II, and V[sub k]III subgroups using the polymerase chain reaction (PCR). Product sequences were subcloned, sequenced, and compared. Phylogenetic analyses of sequences within each subgroup indicate that some subgroups can be subdivided further into [open quotes]sub-subgroups.[close quotes] The history of V[sub k] segment duplications apparently includes at least two separate periods, the first giving rise to the subgroups and the second generating further complexity within each subgroup. Duplications of large pieces of DNA (demonstrated by others through pulsed-field gel electrophoresis) also played a role. Rates of synonymous and nonsynonymous base changes between pairs of sequences suggest that natural selection has played a major role in the evolution of the V[sub k] variable gene segments, leading to sequence conservation in some regions and to increased diversity in others. 34 refs., 4 figs., 3 tabs.

  10. Enhanced jun gene expression is an early genomic response to transforming growth factor beta stimulation.

    PubMed Central

    Pertovaara, L; Sistonen, L; Bos, T J; Vogt, P K; Keski-Oja, J; Alitalo, K

    1989-01-01

    Transforming growth factor beta (TGF beta) is a multifunctional polypeptide that regulates proliferation, differentiation, and other functions of many cell types. The pathway of TGF beta signal transduction in cells is unknown. We report here that an early effect of TGF beta is an enhancement of the expression of two genes encoding serum- and phorbol ester tumor promoter-regulated transcription factors: the junB gene and the c-jun proto-oncogene, respectively. This stimulation was observed in human lung adenocarcinoma A549 cells which were growth inhibited by TGF beta, AKR-2B mouse embryo fibroblasts which were growth stimulated by TGF beta, and K562 human erythroleukemia cells, which were not appreciably affected in their growth by TGF beta. The increase in jun mRNA occurred with picomolar TGF beta concentrations within 1 h of TGF beta stimulation, reached a peak between 1 and 5 h in different cells, and declined gradually to base-line levels. This mRNA response was followed by a large increase in the biosynthesis of the c-jun protein (AP-1), as shown by metabolic labeling and immunoprecipitation analysis. However, differential and cell type-specific regulation appeared to determine the timing and magnitude of the response of each jun gene in a given cell. In AKR-2B and NIH 3T3 cells, only junB was induced by TGF beta, evidently in a protein synthesis-independent fashion. The junB response to TGF beta was maintained in c-Ha-ras and neu oncogene-transformed cells. Thus, one of the earliest genomic responses to TGF beta may involve nuclear signal transduction and amplification by the junB and c-jun transcription factors in concert with c-fos, which is also induced. The differential activation of the jun genes may explain some of the pleiotropic effects of TGF beta. Images PMID:2725496

  11. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB)

    PubMed Central

    Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini

    2015-01-01

    Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars. PMID:26273261

  12. Direct transfer of transforming growth factor beta 1 gene into arteries stimulates fibrocellular hyperplasia.

    PubMed Central

    Nabel, E G; Shum, L; Pompili, V J; Yang, Z Y; San, H; Shu, H B; Liptay, S; Gold, L; Gordon, D; Derynck, R

    1993-01-01

    The arterial wall responds to thrombosis or mechanical injury through the induction of specific gene products that increase cellular proliferation and connective tissue formation. These changes result in intimal hyperplasia that is observed in restenosis and the early phases of atherosclerosis. Transforming growth factor beta 1 (TGF-beta 1) is a secreted multi-functional protein that plays an important role in embryonal development and in repair following tissue injury. However, the function of TGF-beta 1 in vascular cell growth in vivo has not been defined. In this report, we have evaluated the role of TGF-beta 1 in the pathophysiology of intimal and medial hyperplasia by gene transfer of an expression plasmid encoding active TGF-beta 1 into porcine arteries. Expression of TGF-beta 1 in normal arteries resulted in substantial extracellular matrix production accompanied by intimal and medial hyperplasia. Increased procollagen, collagen, and proteoglycan synthesis in the neointima was demonstrated by immunohistochemistry relative to control transfected arteries. Expression of TGF-beta 1 induced a distinctly different program of gene expression and biologic response from the platelet-derived growth factor B (PDGF B) gene: procollagen synthesis induced by TGF-beta 1 was greater, and cellular proliferation was less prominent. These findings show that TGF-beta 1 differentially modulates extracellular matrix production and cellular proliferation in the arterial wall in vivo and could play a reparative role in the response to arterial injury. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8248168

  13. Secretion Genes as Determinants of Bacillus anthracis Chain Length

    PubMed Central

    Nguyen-Mau, Sao-Mai; Oh, So-Young; Kern, Valerie J.; Missiakas, Dominique M.

    2012-01-01

    Bacillus anthracis grows in chains of rod-shaped cells, a trait that contributes to its escape from phagocytic clearance in host tissues. Using a genetic approach to search for determinants of B. anthracis chain length, we identified mutants with insertional lesions in secA2. All isolated secA2 mutants exhibited an exaggerated chain length, whereas the dimensions of individual cells were not changed. Complementation studies revealed that slaP (S-layer assembly protein), a gene immediately downstream of secA2 on the B. anthracis chromosome, is also a determinant of chain length. Both secA2 and slaP are required for the efficient secretion of Sap and EA1 (Eag), the two S-layer proteins of B. anthracis, but not for the secretion of S-layer-associated proteins or of other secreted products. S-layer assembly via secA2 and slaP contributes to the proper positioning of BslO, the S-layer-associated protein, and murein hydrolase, which cleaves septal peptidoglycan to separate chains of bacilli. SlaP was found to be both soluble in the bacterial cytoplasm and associated with the membrane. The purification of soluble SlaP from B. anthracis-cleared lysates did not reveal a specific ligand, and the membrane association of SlaP was not dependent on SecA2, Sap, or EA1. We propose that SecA2 and SlaP promote the efficient secretion of S-layer proteins by modifying the general secretory pathway of B. anthracis to transport large amounts of Sap and EA1. PMID:22609926

  14. Structure of the three beta-tubulin-encoding genes of the unicellular alga, Polytomella agilis.

    PubMed

    Conner, T W; Thompson, M D; Silflow, C D

    1989-12-14

    The quadriflagellate, unicellular, colorless alga, Polytomella agilis, contains several distinct microtubule arrays. To study the genetic basis of microtubule heterogeneity in P. agilis, we characterized its tubulin(Tub)-encoding genes (tub). The three beta tub genes detected in blots of P. agilis DNA were isolated from a genomic library. The structure and organization of the genes were examined by restriction mapping and nucleotide (nt) sequencing. S1 nuclease protection studies showed that all three genes are expressed. The predicted amino acid (aa) sequences are more than 98% conserved with the Chlamydomonas reinhardtii and Volvox carteri beta-Tubs, underscoring the close phylogenetic relationship of these species. Evolutionary divergence among the P. agilis genes is demonstrated by differences in intron number, nt sequences in noncoding regions, and silent nt substitutions in the coding regions. However, the proteins encoded by the beta 1 and beta 3 tub genes are identical; the beta 2 gene product differs by one conservative aa substitution. These results are in striking contrast to the C-terminal aa diversity reported within beta tub gene families in animal, higher plant and fungal systems. The data support the hypothesis that those tub genes whose products assemble into axonemal microtubules are subject PMID:2533130

  15. Gene-based intramuscular interferon-beta therapy for experimental autoimmune encephalomyelitis.

    PubMed

    Jaini, Ritika; Hannaman, Drew; Johnson, Justin M; Bernard, Robert M; Altuntas, Cengiz Z; Delasalas, Maida M; Kesaraju, Pavani; Luxembourg, Alain; Evans, Claire F; Tuohy, Vincent K

    2006-09-01

    In contrast to serial injections of recombinant interferon-beta (IFN-beta) for long-term therapy of multiple sclerosis (MS), prolonged systemic delivery of proteins derived through in vivo gene transfer may provide a more clinically relevant alternative. Here we compare the therapeutic efficacies of electroporation (EP)-mediated intramuscular IFN-beta gene transfer with repeated alternate-day injections of recombinant IFN-beta after the onset of relapsing-remitting experimental autoimmune encephalomyelitis (EAE), an animal model widely used in MS research. We show for the first time that a single EP-mediated intramuscular administration of 20 microg of an IFN-beta-expressing plasmid provides long-term expression of interferon-inducible genes and is therapeutic in ongoing established EAE. The achieved therapeutic effects of IFN-beta gene delivery were comparable to an 8-week regimen of 10,000 IU rIFN-beta injected every other day and involved a significant inhibition of disease progression and a significant reduction of EAE relapses compared to untreated or null-vector-treated mice. Our results indicate the viability of a convenient and effective gene-based alternative for long-term IFN-beta protein therapy in MS. PMID:16782409

  16. Targeted disruption of the mouse beta1-adrenergic receptor gene: developmental and cardiovascular effects.

    PubMed Central

    Rohrer, D K; Desai, K H; Jasper, J R; Stevens, M E; Regula, D P; Barsh, G S; Bernstein, D; Kobilka, B K

    1996-01-01

    At least three distinct beta-adrenergic receptor (beta-AR) subtypes exist in mammals. These receptors modulate a wide variety of processes, from development and behavior, to cardiac function, metabolism, and smooth muscle tone. To understand the roles that individual beta-AR subtypes play in these processes, we have used the technique of gene targeting to create homozygous beta 1-AR null mutants (beta 1-AR -/-) in mice. The majority of beta 1-AR -/- mice die prenatally, and the penetrance of lethality shows strain dependence. Beta l-AR -/- mice that do survive to adulthood appear normal, but lack the chronotropic and inotropic responses seen in wild-type mice when beta-AR agonists such as isoproterenol are administered. Moreover, this lack of responsiveness is accompanied by markedly reduced stimulation of adenylate cyclase in cardiac membranes from beta 1-AR -/- mice. These findings occur despite persistent cardiac beta 2-AR expression, demonstrating the importance of beta 1-ARs for proper mouse development and cardiac function, while highlighting functional differences between beta-AR subtypes. Images Fig. 1 Fig. 3 PMID:8693001

  17. Tumor-produced, active Interleukin-1 {beta} regulates gene expression in carcinoma-associated fibroblasts

    SciTech Connect

    Dudas, Jozsef; Fullar, Alexandra; Bitsche, Mario; Schartinger, Volker; Kovalszky, Ilona; Sprinzl, Georg Mathias; Riechelmann, Herbert

    2011-09-10

    Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the

  18. A structural model for the nucleotide binding domains of the flavocytochrome b-245 beta-chain.

    PubMed Central

    Taylor, W. R.; Jones, D. T.; Segal, A. W.

    1993-01-01

    NADPH is a system in phagocytic cells that generates O2- and hydrogen peroxide in the endocytic vacuole, both of which are important for killing of the engulfed microbe. Dysfunction of this oxidase results in the syndrome of chronic granulomatous disease, characterized by a profound predisposition to bacterial and fungal infections. A flavocytochrome b is the site of most of the mutations causing this syndrome. The FAD and NADPH binding sites have been located on the beta subunit of this molecule, the C-terminal half of which showed weak sequence similarity to other reductases, including the ferredoxin-NADP reductase (FNR) of known structure. This enabled us to build a model of the nucleotide binding domains of the flavocytochrome using this structure as a template. The model was built initially using a novel automatic modeling method based on distance-matrix projection and then refined using energy minimization with appropriate side-chain torsional constraints. The resulting model rationalized much of the observed sequence conservation and identified a large insertion as a potential regulatory domain. It confirms the inclusion of the neutrophil flavocytochrome b-245 (Cb-245) as a member of the FNR family of reductases and strongly supports its function as the proximal electron transporting component of the NADPH oxidase. PMID:8251942

  19. Beta-lactamase genes of the penicillin-susceptible Bacillus anthracis Sterne strain.

    PubMed

    Chen, Yahua; Succi, Janice; Tenover, Fred C; Koehler, Theresa M

    2003-02-01

    Susceptibility to penicillin and other beta-lactam-containing compounds is a common trait of Bacillus anthracis. Beta-lactam agents, particularly penicillin, have been used worldwide to treat anthrax in humans. Nonetheless, surveys of clinical and soil-derived strains reveal penicillin G resistance in 2 to 16% of isolates tested. Bacterial resistance to beta-lactam agents is often mediated by production of one or more types of beta-lactamases that hydrolyze the beta-lactam ring, inactivating the antimicrobial agent. Here, we report the presence of two beta-lactamase (bla) genes in the penicillin-susceptible Sterne strain of B. anthracis. We identified bla1 by functional cloning with Escherichia coli. bla1 is a 927-nucleotide (nt) gene predicted to encode a protein with 93.8% identity to the type I beta-lactamase gene of Bacillus cereus. A second gene, bla2, was identified by searching the unfinished B. anthracis chromosome sequence database of The Institute for Genome Research for open reading frames (ORFs) predicted to encode beta-lactamases. We found a partial ORF predicted to encode a protein with significant similarity to the carboxy-terminal end of the type II beta-lactamase of B. cereus. DNA adjacent to the 5' end of the partial ORF was cloned using inverse PCR. bla2 is a 768-nt gene predicted to encode a protein with 92% identity to the B. cereus type II enzyme. The bla1 and bla2 genes confer ampicillin resistance to E. coli and Bacillus subtilis when cloned individually in these species. The MICs of various antimicrobial agents for the E. coli clones indicate that the two beta-lactamase genes confer different susceptibility profiles to E. coli; bla1 is a penicillinase, while bla2 appears to be a cephalosporinase. The beta-galactosidase activities of B. cereus group species harboring bla promoter-lacZ transcriptional fusions indicate that bla1 is poorly transcribed in B. anthracis, B. cereus, and B. thuringiensis. The bla2 gene is strongly expressed in B

  20. Role of the von Hippel-Lindau tumor suppressor gene in the formation of beta1-integrin fibrillar adhesions.

    PubMed

    Esteban-Barragán, Miguel A; Avila, Pilar; Alvarez-Tejado, Miguel; Gutiérrez, M Dolores; García-Pardo, Angeles; Sánchez-Madrid, Francisco; Landázuri, Manuel O

    2002-05-15

    The von Hippel-Lindau tumor suppressor gene (VHL) is absent or inactivated in the VHLcancer syndrome and in most sporadic renal cancers. VHL is requiredfor the assembly of a proper extracellular fibronectin matrix, although the exact mechanism remains unknown. In this report, we demonstrate that 786-O renal cancer cells are unable to organize an adequate matrix even in the presence of an excess of exogenous fibronectin. Because the formation of integrin fibrillar adhesions plays a pivotal role in the organization of extracellular fibronectin, we next examined the expression and subcellular distribution of integrins in VHL- cells and their wild-type VHL stably transfected counterparts. The levels of beta1 and alphav integrins were increased in VHL- cells when compared with VHL+ transfectants. Early after plating, both VHL+ and VHL- cells were capable of assembling classic "patch-like" alphav focal contacts. As the culture advanced and cells became confluent, alphav integrins partly relocated to the intercellular junctions in VHL+ transfectants, which then developed large beta1 fibrillar-type adhesions and anchored firmly to the substrate. In contrast, confluent VHL- cells were unable to assemble beta1 fibrillar adhesions, and alphav focal contacts remained unchanged at all stages of the culture. Exogenous activation of beta1 integrins with either divalent cations or activating antibodies partly restored the capability of VHL- cells to assemble beta1 fibrillar adhesions and fibronectin fibers. Finally, pulse-chase studies of metabolically labeled 786-O cells revealed that the maturation of the common beta1-integrin chain was delayed in VHL- cells when compared with VHL+ cells. Our results show that VHL is an important regulator of integrins and is essential for the formation of beta1 fibrillar adhesions. These findings help to explain the abnormal extracellular matrix organization and increased motility of VHL- renal cancer cells. PMID:12019174

  1. Phenotypic detection and molecular characterization of beta-lactamase genes among Citrobacter species in a tertiary care hospital

    PubMed Central

    Praharaj, Ashok Kumar; Khajuria, Atul; Kumar, Mahadevan; Grover, Naveen

    2016-01-01

    Objective: To examine the distribution, emergence, and spread of genes encoding beta-lactamase resistance in Citrobacter species isolated from hospitalized patients in a tertiary care hospital. Methods: A prospective study was conducted in a 1000-bed tertiary care center in Pune, India from October 2010 to October 2013. A total of 221 Citrobacter spp. isolates were recovered from clinical specimens from different patients (one isolate per patient) admitted to the surgical ward, medical ward and medical and surgical Intensive Care Units. Polymerase chain reaction (PCR) assays and sequencing were used to determine the presence of beta-lactamase encoding genes. Conjugation experiments were performed to determine their transferability. Isolate relatedness were determined by repetitive element based-PCR, enterobacterial repetitive intergenic consensus-PCR and randomly amplified polymorphic DNA. Results: Among 221 tested isolates of Citrobacter spp. recovered from various clinical specimens, 179 (80.9%) isolates showed minimum inhibitory concentration (MIC) >4 μg/ml against meropenem and imipenem. One hundred and forty-five isolates with increased MICs value against carbapenems were further processed for molecular characterization of beta-lactamase genes. Susceptibility profiling of the isolates indicated that 100% retained susceptibility to colistin. Conjugation experiments indicated that blaNDM-1 was transferable via a plasmid. Conclusion: The ease of NDM-1 plasmid transmissibility may help their dissemination among the Citrobacter species as well as to others in Enterobacteriaceae. Early detection, antimicrobial stewardship and adequate infection control measures will help in limiting the spread of these organisms. PMID:26952135

  2. Complete nucleotide sequence of the human corticotropin-beta-lipotropin precursor gene.

    PubMed Central

    Takahashi, H; Hakamata, Y; Watanabe, Y; Kikuno, R; Miyata, T; Numa, S

    1983-01-01

    The nucleotide sequence of an 8658-base-pair human genomic DNA segment containing the entire corticotropin-beta-lipotropin precursor gene has been determined, and some sequence features of the gene and its flanking regions have been analysed. The gene is composed of 7665 base pairs including two introns of 3708 and 2886 base pairs. Comparison of the 5'-flanking sequences of the human, bovine and mouse corticotropin-beta-lipotropin precursor genes reveals the presence of a highly conserved region, which contains sequences of 14-15 base pairs homologous with sequences located upstream of the mRNA start site of other glucocorticoid-regulated genes. PMID:6314261

  3. [Investigation of beta-lactamase genes and clonal relationship among the extended-spectrum beta-lactamase producing nosocomial Escherichia coli isolates].

    PubMed

    Görgeç, Sündüz; Kuzucu, Çiğdem; Otlu, Barış; Yetkin, Funda; Ersoy, Yasemin

    2015-01-01

    Extended-spectrum beta-lactamase (ESBL) producing microorganisms currently cause a major problem. Among theseCTX-M beta-lactamase producing Escherichia coli has also disseminated worldwide as an important cause of both nosocomial and community-acquired infections. The aims of this study were to determine the prevalence of the beta-lactamase genes, antibiotic susceptibilities and clonal relationships of ESBL-producing nosocomial E.coli isolates. A total of 76 ESBL-producing E.coli strains isolated from urine (n= 26), blood (n= 25) and wound (n= 25) specimens of hospitalized patients identified as nosocomial infection agents according to the CDC criteria between June 2010-June 2011 were included in the study. Antibiotic susceptibilities of the isolates were detected by Kirby-Bauer disc diffusion method according to CLSI recommendations. ESBL production was tested by double disc diffusion method, and cefotaxime/cefotaxime-clavulanic acid E-test strips (AB Biodisk, Sweden) were used for indeterminate results. Presence of TEM, SHV, CTX-M, OXA-2 group, 0XA-10 group, PER, VEB and GES beta-lactamase genes were investigated by polymerase chain reaction (PCR) using specific primers. Pulsed-field gel electrophoresis (PFGE) method was used for the detection of clonal relationships among the strains. Most of the ESBL-producing E.coli strains were isolated from samples of inpatients in intensive care (35%), internal medicine (16%) and general surgery (13%) units. All of the 76 strains were found susceptible to imipenem, meropenem and amikacin; however all were resistant to cefotaxime and ceftriaxone. The susceptibility rates of the isolates to cefoxitin, ertapenem, cefoperazone/sulbactam, piperacillin-tazobactam, gentamicin, ciprofloxacin, cefepime, amoxicillin-clavulanic acid, aztreonam and ceftazidime were 96%, 83%, 63%, 61%, 50%, 41%, 25%, 21%, 20% and 18%, respectively. Among E.coli isolates, the frequency of CTX-M, TEM, OXA-2 group, PER, SHV and OXA-10 group beta

  4. Influence of the route of infection on development of T-cell receptor beta-chain repertoires of reovirus-specific cytotoxic T lymphocytes.

    PubMed

    Fulton, Jonathan R; Smith, Jeremy; Cunningham, Cynthia; Cuff, Christopher F

    2004-02-01

    It is well established that the route of infection affects the nature of the adaptive immune response. However, little is known about the effects of the route of exposure on development of cytotoxic T-lymphocyte (CTL) responses. Alternative antigen-presenting cell populations, tissue-restricted expression of class I major histocompatibility complex-encoded molecules, and unique T-cell receptor (TCR)-bearing cells in mucosal tissues could influence the selection and expansion of responder T cells. This study addresses the question of whether the route of virus infection affects the selection and expansion of subpopulations of virus-specific CTLs. Mice were infected orally or in the hind footpads with reovirus, and the repertoires of TCR beta-chains expressed on virus-specific CD8(+) T cells in Peyer's patches or lymph nodes and spleens were examined. CD8(+) cells expressing the variable gene segment of the TCR beta-chain 6 (Vbeta6) expanded in the spleens of mice infected by either route and in CTL lines established from the spleens and draining lymphoid tissues. Adoptively transferred Vbeta6(+) CD8(+) T cells from orally or parenterally infected donors expanded in reovirus-infected severe combined immunodeficient recipient mice and mediated cytotoxicity ex vivo. Furthermore, recovered Vbeta6(+) cells were enriched for clones utilizing uniform complementarity-determining region 3 (CDR3) lengths. However, sequencing of CDR3beta regions from Vbeta6(+) CD8(+) cells indicated that Jbeta gene segment usage is significantly more restricted in CTLs from orally infected mice, suggesting that the route of infection affects selection and/or subsequent expansion of virus-specific CTLs. PMID:14722312

  5. Preparation and characterization of monoclonal antibodies against beta-bungarotoxin and its A- and B-chains.

    PubMed

    Danse, J M; Kempf, J

    1989-01-01

    Splenocytes from Balb/c mice immunized with beta-bungarotoxin, a protein neurotoxin that exhibits phospholipase A2 activity, were fused with SP2/0 murine myeloma cells. Eighty-seven stable hybridoma cell lines were established which secrete monoclonal antibodies of the subclass IgG1 and K light chain and react with intact neurotoxin. Some antibodies were further analyzed. These recognize at least two immuno-dominant regions located on the A- and B-chains of the toxin, and the native toxin but show no crossreactivity with a protein homologous to chain A (porcine pancreas phospholipase A2) nor to chain B (toxin 1 from Dendroaspis polylepis). Two monoclonal antibodies inhibit phospholipase A2 activity of the neurotoxin but only one partially neutralizes its biological activity when injected together with the toxin, delaying the time of death. PMID:2799834

  6. Molecular cloning and characterization of mutant and wild-type human. beta. -actin genes

    SciTech Connect

    Leavitt, J.; Gunning, P.; Porreca, P.; Ng, S.Y.; Lin, C.H.; Kedes, L.

    1984-10-01

    There are more than 20 ..beta..-actin-specific sequences in the human genome, many of which are pseudogenes. To facilitate the isolation of potentially functional ..beta..-actin genes, they used the new method of B. Seed for selecting genomic clones by homologous recombination. A derivative of the ..pi..VX miniplasmid, ..pi..AN7..beta..1, was constructed by insertion of the 600-base-pair 3' untranslated region of the ..beta..-actin mRNA expressed in human fibroblasts. Five clones containing ..beta..-actin sequences were selected from an amplified human fetal gene library by homologous recombination between library phage and the miniplasmid. One of these clones contained a complete ..beta..-actin gene with a coding sequence identical to that determined for the mRNA of human fibroblasts. A DNA fragment consisting of mostly intervening sequences from this gene was then use to identify 13 independent recombinant copies of the analogous gene from two specially constructed gene libraries, each containing one of the two types of mutant ..beta..-actin genes found in a line of neoplastic human fibroblasts. The amino acid and nucleotide sequences encoded by the unmutated gene predict that a guanine-to-adenine transition is responsible for the glycine-to-aspartic acid mutation at codon 244 and would also result in the loss of a HaeIII site. Detection of this HaeIII polymorphism among the fibroblast-derived closed verified the identity of the ..beta..-actin gene expressed in human fibroblasts.

  7. Structural gene for beta-nerve growth factor not defective in familial dysautonomia.

    PubMed Central

    Breakefield, X O; Orloff, G; Castiglione, C; Coussens, L; Axelrod, F B; Ullrich, A

    1984-01-01

    The developmental loss of neurons in sympathetic, sensory, and some parasympathetic ganglia in familial dysautonomia suggests an inherited defect in the action of beta-nerve growth factor (beta-NGF). The role of this growth factor in dysautonomia has been difficult to resolve as there is no known source of authentic human beta-NGF. The availability of a cloned DNA probe for the human beta-NGF gene has allowed identification of some copies of the gene (alleles) in six affected families. Alleles differ in the length of restriction endonuclease fragments that hybridize to DNA probes for the gene. In two families, affected children did not inherit the same two alleles at the beta-NGF locus. Since this disease is transmitted in an autosomal recessive manner, affected children must share the same alleles at the locus causing the disease. This analysis excludes the beta-NGF gene region as the cause of this neurologic disease but does not eliminate other genes involved in beta-NGF action, such as those coding for processing enzymes, receptors, or other subunits of the NGF complex. Images PMID:6330750

  8. HLA-DR, DQ and T cell antigen receptor constant beta genes in Japanese patients with ulcerative colitis.

    PubMed Central

    Kobayashi, K; Atoh, M; Konoeda, Y; Yagita, A; Inoko, H; Sekiguchi, S

    1990-01-01

    We studied the T cell antigen receptor (TcR) constant beta chain genes on HLA typed Japanese patients with ulcerative colitis (UC). A TcR constant beta EcoRI 6.0-kb fragment was present in all Japanese UC patients (n = 17) but completely absent in the controls (n = 35) (chi2 = 47.6, P less than 0.001). The frequency of HLA-DR2 antigen was significantly higher in UC patients (85% versus 28% in controls, P less than 0.001). Furthermore, HLA-DQw1 antigen was also increased in UC patients (96% versus 60% in controls, P less than 0.001). However, HLA-DR4 antigen was significantly decreased in UC patients (12% versus 37%, P = 0.02). HLA-DR1 antigen was not found in UC patients and was present in only 15% of the controls. These results suggest that TcR beta chain and HLA-DQw1 antigen may be important in the pathogenesis of Japanese UC. Images Fig. 1 PMID:1973647

  9. Beta-oxidation of very-long-chain fatty acids and their coenzyme A derivatives by human skin fibroblasts.

    PubMed

    Singh, H; Derwas, N; Poulos, A

    1987-05-01

    The beta-oxidation of lignoceric acid (C24:0), hexacosanoic acid (C26:0), and their coenzyme A derivatives was investigated in human skin fibroblast homogenates. The cofactor requirements for oxidation of lignoceric acid and hexacosanoic acid were identical but were different from their coenzyme A derivatives. For example, lignoceric acid and hexacosanoic acid oxidation was strictly ATP dependent whereas the oxidation of the corresponding coenzyme A derivatives was ATP independent. Also the rate of oxidation of coenzyme A derivatives of lignoceric acid or hexacosanoic acid was much higher compared to the free fatty acids. In patients with Zellweger's syndrome, X-linked adrenoleukodystrophy and infantile Refsum's disease, the beta-oxidation of lignoceric and hexacosanoic acids was defective whereas the oxidation of their corresponding coenzyme A derivatives was nearly normal. The results presented in this communication suggest strongly that the beta-oxidation of very-long-chain fatty acids occurs exclusively in peroxisomes. However, the coenzyme A derivatives of very-long-chain fatty acids can be oxidized in mitochondria as well as in peroxisomes. The inability of the mitochondrial system to oxidize free fatty acids may be due to its inability to convert them to their corresponding coenzyme A derivatives. Our results suggest that a specific very-long-chain fatty acyl CoA synthetase may be required for the activation of the free fatty acids and that this synthetase may be deficient in patients with Zellweger's syndrome and possibly X-linked adrenoleukodystrophy, as well. The results presented suggest that substrate specificity and the subcellular localization of the synthetase may regulate the beta-oxidation of very-long-chain fatty acids in the cell. PMID:2437859

  10. Biosynthesis of a biologically active single peptide chain containing the human common alpha and chorionic gonadotropin beta subunits in tandem.

    PubMed Central

    Sugahara, T; Pixley, M R; Minami, S; Perlas, E; Ben-Menahem, D; Hsueh, A J; Boime, I

    1995-01-01

    One of the distinguishing features of the gonadotropin and thyrotropin hormone family is their heterodimeric structure, consisting of a common alpha subunit and a hormone-specific beta subunit. Subunit assembly is vital to the function of these hormones: The conformation of the heterodimer is essential for controlling secretion, hormone-specific posttranslational modifications, and signal transduction. To address whether alpha and beta subunits can be synthesized as one chain and also maintain biological activity, a chimera composed of the human chorionic gonadotropin (hCG) beta subunit genetically fused to the alpha subunit was constructed. The resulting polypeptide hCG molecule not only was efficiently secreted but also displayed an increased biological activity in vitro and in vivo. These data show that the alpha and hCG beta subunits encoded as a single chain retain a biologically active conformation similar to that seen in the heterodimer. This approach can be used to investigate structure-function relationships of the glycoprotein hormone family that were previously not tractable because of the absolute dependence on assembly for the biological response. Moreover, other bioactive multisubunit ligands can be engineered where the combination efficiency and specificity of heterodimers and homodimers are otherwise difficult to control. Images Fig. 2 Fig. 3 PMID:7892221

  11. Reassembly and reconstitution of separate alpha and beta chains of human leukocyte antigen DR4 molecule isolated from Escherichia coli.

    PubMed

    Kang, J H; Maeng, C Y; Park, J H; Hahm, K S; Han, B D; Kim, K L

    1997-04-30

    The class II major histocompatibility complex molecules play a major role in presentation of exogenous antigenic peptides to the CD4 positive helper T cell. These are heterodimeric cell surface glycoproteins consisting of alpha- and beta-chains. In the present study, we cloned and expressed the alpha- and beta-chain of HLA-DR4 lacking the transmembrane and cytoplasmic domain separately in Escherichia coli using the pET-5a expression vector system. The expressed alpha- and beta-chains were purified in a denaturing condition by an ion exchange chromatography on Q-Sepharose and a gel filtration chromatography on Sephacryl S-200, respectively. The recombinant proteins were refolded and reassembled by removing the denaturing agent and concomitant reoxidation of the disulfide bond. The refolded heterodimeric rDR4 molecule was resolved by 12.5% SDS-PAGE in a nonreducing condition and confirmed by Western blot using polyclonal antibody against DR-alpha and the monoclonal antibody (L243) for the conformationally correct DR molecule. The rDR4 molecules were reconstituted with a 50-fold molar excess biot-HA (307-319), and the bound peptides to the heterodimer complex were determined by a microplate assay coated with L243 antibody using Extravidin-HRP conjugate. PMID:9163739

  12. Sugar-inducible expression of a gene for beta-amylase in Arabidopsis thaliana.

    PubMed Central

    Mita, S; Suzuki-Fujii, K; Nakamura, K

    1995-01-01

    The levels of beta-amylase activity and of the mRNA for beta-amylase in rosette leaves of Arabidopsis thaliana (L.) Heynh. increased significantly, with the concomitant accumulation of starch, when whole plants or excised mature leaves were supplied with sucrose. A supply of glucose or fructose, but not of mannitol or sorbitol, to plants also induced the expression of the gene for beta-amylase, and the induction occurred not only in rosette leaves but also in roots, stems, and bracts. These results suggest that the gene for beta-amylase of Arabidopsis is subject to regulation by a carbohydrate metabolic signal, and expression of the gene in various tissues may be regulated by the carbon partitioning and sink-source interactions in the whole plant. The sugar-inducible expression of the gene in Arabidopsis was severely repressed in the absence of light. The sugar-inducible expression in the light was not inhibited by 3(3,4-dichlorophenyl)-1,1-dimethylurea or by chloramphenicol, but it was inhibited by cycloheximide. These results suggest that a light-induced signal and de novo synthesis of proteins in the cytoplasm are involved in the regulation. A fusion gene composed of the 5' upstream region of the gene for beta-amylase from Arabidopsis and the coding sequence of beta-glucuronidase showed the sugar-inducible expression in a light-dependent manner in rosette leaves of transgenic Arabidopsis. PMID:7716246

  13. The expression of pregnancy-specific {beta}1-glycoprotein genes in Meckel-Gruber syndrome fibroblasts

    SciTech Connect

    Wu, Shao-Ming; Cham, Wai-Yee

    1994-09-01

    Meckel-Gruber syndrome (MS) is an autosomal recessive disorder with multiple congenital malformations. The only available prenatal diagnostic marker for this disorder is the amniotic fluid level of pregnancy-specific {beta}1-glycoprotein (PSG). PSG is a family of proteins which are expressed at high levels during pregnancy. Increasing maternal serum PSG levels correlate with the progression of pregnancy and can be used as indicators for pregnancy outcome and fetal well-being. The amniotic fluid PSG level is about one-tenth of that of the maternal serum level in normal pregnancy, but are elevated in all cases of MS examined so far. On the other hand, the maternal serum PSG level and third trimester placental PSG content are normal in most cases of MS. This study aims at comparing the expression of PSG in fibroblasts derived from a fetus afflicted with MS. Total cellular RNA was extracted from two MS cultured fibroblast lines (M3206 and GM7817) and four age- and sex-matched control fibroblast lines obtained from the Human Genetic Mutant Cell Repository, Camden, NJ. The expression of eight PSG genes namely, PSG1, PSG2, PSG3, PSG4, PSG5, PSG6, PSG9 and PSG11, were examined with reverse transcription-polymerase chain reaction (RT-PCR). All PSG transcripts present in the cell were first amplified using universal primers in a 28-cycle PCR. Specific PSG gene products were then amplified with PSG gene-specific primers. Results showed that there is no significant difference in PSG expression between control and disease fibroblasts. In both cases, the most abundant transcript was the type II transcript of PSG5 followed by the type I transcripts of PSG1 and PG4. PSG9, PSG11 and PSG 3 were expressed at very low levels or not expressed at all in MS as well as in normal control fibroblasts. These results showed that PSG gene expression was not altered in MS fibroblasts.

  14. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.

    PubMed

    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T

    2016-03-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  15. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene

    PubMed Central

    Pruthviraj, D. R.; Usha, A. P.; Venkatachalapathy, R. T.

    2016-01-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5′-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  16. Localization of two potassium channel {beta} subunit genes, KCNA1B and KCNA2B

    SciTech Connect

    Schultz, D.; Smith, L.; Thayer, M.

    1996-02-01

    The gating properties and current amplitudes of mammalian voltage-activated Shaker potassium channels are modulated by at least two associated {beta} subunits (Kv{beta}1.1 and Kv{beta}1.2). The human Kv{beta}1.1 gene (KCNA1B) resides on chromosome 3, as indicated by somatic cell hybrid mapping. More precise localization of KCNA1B to 3q26.1 was obtained with fluorescence in situ hybridization (FISH) and was corroborated by PCR screening of the CEPH YAC library. The human Kv{beta}1.2 gene (KCNA2B) resides on chromosome 1, as indicated by somatic cell hybrid mapping, and has been localized by FISH to 1p36.3. 20 refs., 2 figs.

  17. Linkage disequilibrium between the beta frequency of the human EEG and a GABAA receptor gene locus

    PubMed Central

    Porjesz, Bernice; Almasy, Laura; Edenberg, Howard J.; Wang, Kongming; Chorlian, David B.; Foroud, Tatiana; Goate, Alison; Rice, John P.; O'Connor, Sean J.; Rohrbaugh, John; Kuperman, Samuel; Bauer, Lance O.; Crowe, Raymond R.; Schuckit, Marc A.; Hesselbrock, Victor; Conneally, P. Michael; Tischfield, Jay A.; Li, Ting-Kai; Reich, Theodore; Begleiter, Henri

    2002-01-01

    Human brain oscillations represent important features of information processing and are highly heritable. A common feature of beta oscillations (13–28 Hz) is the critical involvement of networks of inhibitory interneurons as pacemakers, gated by γ-aminobutyric acid type A (GABAA) action. Advances in molecular and statistical genetics permit examination of quantitative traits such as the beta frequency of the human electroencephalogram in conjunction with DNA markers. We report a significant linkage and linkage disequilibrium between beta frequency and a set of GABAA receptor genes. Uncovering the genes influencing brain oscillations provides a better understanding of the neural function involved in information processing. PMID:11891318

  18. A Drosophila gene encoding a protein resembling the human. beta. -amyloid protein precursor

    SciTech Connect

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K. )

    1989-04-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human {beta}-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human {beta}-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development.

  19. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  20. The exon-intron organization of the human erythroid [beta]-spectrin gene

    SciTech Connect

    Amin, K.M.; Forget, B.G. ); Scarpa, A.L.; Curtis, P.J. ); Winkelmann, J.C. )

    1993-10-01

    The human erythrocyte [beta]-spectrin gene DNA has been cloned from overlapping human genomic phage and cosmid recombinants. The entire erythroid [beta]-spectrin mRNA is encoded by 32 exons that range in size from 49 to 871 bases. The exon/intron junctions have been identified and the exons mapped. There is no correlation between intron positions and the repeat units of 106 amino acids within domain II of the [beta]-spectrin gene. The scatter of the introns over the 17 repeats argues against the 106-amino-acid unit representing a minigene that underwent repeated duplication resulting in the present [beta]-spectrin gene. In fact, the two largest exons, exon 14 (871 bp) and 16 (757 bp), extend over 4 and 3 repeat units of 106 amino acids, respectively, while repeat [beta]10 is encoded by 4 exons. No single position of an intron in the [beta]-spectrin gene is conserved between any of the 17 [beta]-spectrin and 22 [alpha]-spectrin repeat units. The nucleotide sequences of the exon/intron boundaries conform to the consensus splice site sequences except for exon 20, whose 5[prime] donor splice-site sequence begins with GC. The [beta]-spectrin isoform present in the human brain, the skeletal muscle, and the cardiac muscle is an alternatively spliced product of the erythroid [beta]-spectrin gene. This splice site is located within the coding sequences of exon 32 and its utilization in nonerythroid tissues leads to the use of 4 additional downstream exons with a size range of 44 to 530 bp. 55 refs., 3 figs., 3 tabs.

  1. Mapping of the human nicotinic acetylcholine receptor [beta]3 gene (CHRNB3) within chromosome 8p11. 2

    SciTech Connect

    Koyama, Koyama; Sudo, Kazunori; Nakamura, Yusuke )

    1994-05-15

    The authors have used an exon amplification method to construct a transcriptional map for human chromosome 8. With this method, transcribed sequences from defined regions of genomic DNA can be efficiently isolated using cosmid clones mapped to human chromosome 8. Cosmid DNAs were digested with BglII and BamHI and ligated into a BamHI site of an exon trapping vector, pSPL1. Transfection of the subcloned DNAs into Cos7 cells, isolation of cytoplasmic RNA, synthesis of cDNA by reverse transcriptase, and amplification of spliced fragments were performed according to the method described by Buckler et al. Amplified fragments were subcloned into a plasmid, pBluescriptII, and sequenced by the dideoxy chain termination method. Sequence analysis to search for similarity or identity to known genes with the program FASTA detected complete identity of one (ET634-2) of these exon amplification fragments, 227 bp in length, to the nucleotide sequence at 1138-1364 of the cDNA for the human nicotinic acetylcholine receptor (nAChR) [beta]3 gene. This transcribed fragment, containing a part of the human nAChR [beta]3 gene, was isolated from cosmid clone cCI8-328, which was previously mapped to 8p11.2 by fluorescence in situ hybridization. Localization of this gene to chromosome agreed with the results of previous mapping experiments using somatic hybrid cell lines.

  2. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls

    NASA Astrophysics Data System (ADS)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T. V.; Alyethodi, Rafeeque R.; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B.

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly ( P < 0.05) higher during the thermal stress. Pearson correlation coefficient analysis revealed that the expression of ATPase Β1, ATPase B2, and ATPase B3 is highly correlated ( P < 0.01) with HSP70, representing that the change in the expression pattern of these genes is positive and synergistic. These may provide a foundation for understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in cattle.

  3. Nonsense mutations in the human. beta. -globin gene affect mRNA metabolism

    SciTech Connect

    Baserga, S.J.; Benz, E.J. Jr. )

    1988-04-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.

  4. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

    PubMed

    Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

    2015-12-01

    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. PMID:24995963

  5. Enhanced jun gene expression is an early genomic response to transforming growth factor. beta. stimulation

    SciTech Connect

    Pertovaara, L.; Sistonen, L.; Keski-Oja, J.; Alitalo, K. ); Bos, T.J.; Vogt, P.K. . Dept. of Microbiology)

    1989-03-01

    Transforming growth factor {beta} (TGF{beta}) is a multifunctional polypeptide4 that regulates proliferation, differentiation, and other functions of many cell types. The pathway of TGF{beta} signal transduction in cells is unknown. The authors report here that an early effect of TGF{beta} is an enhancement of the expression of two genes encoding serum- and phorbol ester tumor promoter-regulated transcription factors: the junB gene and the c-jun proto-oncogene, respectively. This stimulation was observed in human lung adenocarcinoma A549 cells which were growth inhibited by TGF{beta}, AKR-2B mouse embryo fibroblasts which were growth stimulated by TGF{beta}, and K562 human erythroleukemia cells, which were not appreciably affected in their growth by TFG{beta}. The increase in jun mRNA occurred with picomolar TGF{beta} concentrations within 1 h of TGF{beta} stimulation, reached a peak between 1 and 5 h in different cells, and declined gradually to base-fine levels. This mRNA response was followed by a large increase in the biosynthesis of the c-jun protein (AP-1), as shown by metabolic labeling and immunoprecipitation analysis. However, differential and cell type-specific regulation appeared to determine the timing and magnitude of the response of each jun gene in a given cell. In AKR-2B and NIH 3T3 cells, only junB was induced by TGF{beta}, evidently in a protein synthesis-independent fashion. The junB response to TGF{beta} was maintained in c-Ha-ras and neu oncogene-transformed cells. Thus, one of the earliest genomic responses to TGF{beta} may involve nuclear signal transduction and amplification by the junB and c-jun transcription factors in concert with c-fos, which is also induced. The differential activation of the jun genes may explain some of the pleiotropic effects of TGF{beta}.

  6. Transcription factor assembly on the nicotinic receptor beta4 subunit gene promoter.

    PubMed

    Scofield, Michael D; Brüschweiler-Li, Lei; Mou, Zhongming; Gardner, Paul D

    2008-04-16

    Nicotinic acetylcholine receptors are involved in a plethora of fundamental biological processes ranging from muscle contraction to formation of memories. The receptors are pentameric proteins whose subunits are encoded by distinct genes. Subunit composition of a mature nicotinic receptor is governed in part by the transcriptional regulation of each subunit gene. Here, using chromatin immunoprecipitation assays, we report the interaction of the transcription factors Sp1, Sp3, c-Jun and Sox10 with the beta4 subunit gene promoter in neuronal-like cell lines and rodent brain tissue. Our results corroborate previous in-vitro data demonstrating that these transcription factors interact with the beta4 promoter. Taken together, these data suggest that Sp1, Sp3, c-Jun and Sox10 regulate expression of the beta4 subunit gene in the mammalian brain. PMID:18382288

  7. Alternative splicing of HLA-DQB transcripts and secretion of HLA-DQ beta-chain proteins: allelic polymorphism in splicing and polyadenylylation sites.

    PubMed Central

    Briata, P; Radka, S F; Sartoris, S; Lee, J S

    1989-01-01

    HLA class II antigens are highly polymorphic cell-surface proteins involved in initiation and regulation of the immune response. Allelic sequence variation primarily affects the structure of the first external domains of alpha and beta component chains. Here we provide evidence for other types of allelic polymorphism for the genes encoding these chains. Sequences of two cDNA clones corresponding to HLA-DQB mRNAs from an HLA-homozygous cell line exhibit both alternative splicing and read-through of polyadenylylation. Furthermore, alternative splicing that deletes the transmembrane exon is associated with only a subset of HLA-DQB alleles, while the polyadenylylation-site read-through is found in a larger subset. This suggest that polymorphic cis-acting elements within the HLA-DQB gene control both processing steps. Proteins, presumably encoded by alternatively spliced mRNAs lacking transmembrane exons, are immunoprecipitated with a monomorphic monoclonal antibody directed against HLA-DQ. These proteins are found in supernatants of cultured cell lines for which secretion is predicted, but not in those of cell lines that do not contain alternatively spliced mRNAs. Images PMID:2464826

  8. Regulation of. beta. -cell glucose transporter gene expression

    SciTech Connect

    Chen, Ling; Alam, Tausif; Johnson, J.H.; Unger, R.H. Department of Veterans Affairs Medical Center, Dallas, TX ); Hughes, S.; Newgard, C.B. )

    1990-06-01

    It has been postulated that a glucose transporter of {beta} cells (GLUT-2) may be important in glucose-stimulated insulin secretion. To determine whether this transporter is constitutively expressed or regulated, the authors subjected conscious unrestrained Wistar rats to perturbations in glucose homeostasis and quantitated {beta}-cell GLUT-2 mRNA by in situ hybridization. After 3 hr of hypoglycemia, GLUT-2 and proinsulin mRNA signal densities were reduced by 25% of the level in control rats. After 4 days, GLUT-2 and proinsulin mRNA densities were reduced by 85% and 65%, respectively. After 12 days of hypoglycemia, the K{sub m} for 3-O-methyl-D-glucose transport in isolated rat islets, normally 18-20 mM, was 2.5 mM. This provides functional evidence of a profound reduction of high K{sub m} glucose transporter in {beta} cells. In contrast, GLUT-2 was only slightly reduced by hypoglycemia in liver. To determine the effect of prolonged hyperglycemia, they also infused animals with 50% (wt/vol) glucose for 5 days. Hyperglycemic clamping increased GLUT-2 mRNA by 46% whereas proinsulin mRNA doubled. They conclude that GLUT-2 expression in {beta} cells, but not liver, is subject to regulation by certain perturbations in blood glucose homeostasis.

  9. Identification of monoclonal antibodies with specificity to alpha- or beta-chains of beta 2-integrins using peripheral blood leucocytes of normal and bovine leucocyte adhesion deficient (BLAD) cattle.

    PubMed

    Rutten, V P; Hoek, A; Müller, K E

    1996-08-01

    The reactivity of monoclonal antibodies entered in the panels of the Third Workshop on Ruminant Leucocyte Antigens with lymphocytes and monocytes of normal and beta 2-integrin deficient (Bovine Leucocyte Adhesion Deficiency: BLAD) animals was determined by flow cytometry to investigate potential specificities to alpha- or beta-chains of beta 2-integrins. From the 13 monoclonal antibodies that were entered as having specificity for CD11/CD18 antigens, ten were confirmed correct, but three had reactivity with cells from BLAD animals. We conclude that our approach provides an easy way to reliably identify the majority of beta 2-integrin specific monoclonal antibodies. PMID:8896223

  10. Use of polymerase chain reaction in the quantitation of mdr-1 gene expression

    SciTech Connect

    Murphy, L.D.; Herzog, C.E.; Rudick, J.B.; Fojo, A.T.; Bates, S.E. )

    1990-11-01

    The ability of the polymerase chain reaction (PCR) to quantitate expression of mRNA was examined in the present study. The model chosen was expression of the multidrug resistance gene mdr-1/Pgp in two colon carcinoma cell lines which express mdr-1/Pgp at levels comparable to those found in many clinical samples. PCR was utilized to evaluate differences in mdr-1/Pgp expression in the two cell lines after modulation by sodium butyrate. Thus, comparisons were made across a range of mdr-1/Pgp expression as well as comparisons of small differences. The PCR was found to be both sensitive and quantitative. Accurate quantitation requires demonstration of an exponential range which varies among samples. The exponential range can be determined by carrying out the PCR for a fixed number of cycles on serial dilutions of the RNA reverse transcription product, or by performing the reaction with a varying number of cycles on a fixed quantity of cDNA. By quantitation of the difference in PCR product derived from a given amount of RNA from the sodium butyrate treated and untreated cells, the difference in mRNA expression between samples can be determined. Normalization of the results can be achieved by independent amplification of a control gene, such as {beta}{sub 2}-microglobulin, when the latter is also evaluated in the exponential range. Simultaneous amplification of the control and target genes results in lower levels of PCR products due to competition, which varies from sample to sample. The PCR is thus a labor-intensive but sensitive method of quantitating gene expression in small samples of RNA.

  11. Presence of blaPER-1 and blaVEB-1 beta-lactamase genes among isolates of Pseudomonas aeruginosa from South West of Iran.

    PubMed

    Davodian, Elham; Sadeghifard, Nourkhoda; Ghasemian, Abdolmajid; Noorbakhsh, Samileh

    2016-09-01

    Pseudomonas aeruginosa isolates have acquired resistance to antibiotics such as novel beta-lactams. The aim of this study was to investigate the blaPER-1, blaVEB-1, and blaPSE-1 genes among isolates of P. aeruginosa among intensive care unit (ICU) patients. Sixty-five isolates were collected. The antibiotic susceptibility testing and combined disk tests were performed to detect the isolates producing extended spectrum beta-lactamases (ESBLs) among ceftazidime-resistant isolates. Polymerase chain reaction (PCR) amplification of blaPER-1, blaVEB-1, and blaPSE-1 genes was conducted. Ten (15.3%) isolates were ESBL-positive, of which 40% (n=4) belonged to males and 60% (n=6) were collected from females. Moreover, two and one isolates harbored blaPER-1 and blaVEB-1 genes, respectively. PMID:26944896

  12. [Hemoglobin Boumerdès alpha 2(37) (C2) Pro----Arg beta 2: a new variant of the alpha chain associated with hemoglobin S in an Algerian family].

    PubMed

    Dahmane-Arbane, M; Blouquit, Y; Arous, N; Bardakdjian, J; Benamani, M; Riou, J; Benabadji, M; Rosa, J; Galacteros, F

    1987-01-01

    We report the first case of Hb Boumerdes, an alpha chain variant alpha 2(37) (C2) Pro----Arg beta 2, in an Algerian family. The propositus was also homozygous for the sickle cell gene. The abnormal hybrid Hb alpha 2Boum. beta 2S had an electrophoretic mobility on cellulose acetate pH 8.7 electrophoresis between those of Hb S and Hb A2. Its expression was about 16%. The alpha 2Boum. beta 2A fraction has a mobility between those of Hb F and Hb S. The effects of this mutation on Hb oxygen affinity and deoxy Hb S polymer formation were not studied. The propositus' sickle cell phenotype was benign. PMID:3438164

  13. Targeting exogenous GDNF gene to the bovine somatic cell beta-casein locus for the production of transgenic bovine animals.

    PubMed

    Zhang, X M; Luo, F H; Ding, H M; Li, B; Zhang, J J; Wu, Y J

    2015-01-01

    Considerable attention is currently being directed toward methods for producing recombinant human proteins in the mammary glands of genetically modified transgenic livestock. However, the expression of inserted genes in transgenic animals is variable and often very low because of the randomness of the site of transgene integration. One possible strategy to avoid the expression problem associated with random integration is to use site-specific integration by targeting integration to a high expression locus and, thereby, to improve expression of the transferred gene. In the present study, we focused on glial cell line-derived neurotrophic factor (GDNF), a novel type of neurotrophic factor first cloned in 1993. Research has shown that GDNF may have potential applications in the treatment of Parkinson's disease and other diseases of the central nervous system since it acts as a protective factor for central dopaminergic neurons. Here, we constructed a gene targeting vector to knock-in the human GDNF gene at the bovine beta-casein gene locus as a first step to producing transgenic animals with a high level of expression of human GDNF protein in their mammary glands. Bovine fetal fibroblast cells were transfected with linearized pNRTCNbG by electroporation. Three cell clones were identified with successful targeting to the beta-casein locus; and were confirmed using both polymerase chain reaction analysis and sequencing. Gene-targeted cells were used as nuclear donors; a total of 161 embryos were reconstructed, 23 of which developed to the blastocyst stage. These blastocysts were transferred to 8 recipient cows, but no offspring were obtained. PMID:26634460

  14. Sequence homology and immunologic cross-reactivity of human cytomegalovirus with HLA-DR beta chain: a means for graft rejection and immunosuppression.

    PubMed Central

    Fujinami, R S; Nelson, J A; Walker, L; Oldstone, M B

    1988-01-01

    A peptide (Leu-Gly-Arg-Pro-Asp-Glu-Asp-Ser-Ser-Ser-Ser-Ser-Ser-Ser-Cys) that was identical to residues 82 through 96 of a predicted protein of 208 amino acids from the immediate-early region (IE-2) nucleic acid sequence of human cytomegalovirus was chemically synthesized. By computer analysis, the first five amino acids of this peptide showed sequence homology to the beta chain of the human histocompatibility complex HLA-DR. The homologous amino acids, 53 through 57, were located in a region that is conserved between the human DR beta chain and the beta chain of the H-2 class II histocompatibility antigen for mice. The shared region between the IE-2 protein and DR beta chain were similar in both hydrophilicity and predicted beta-turn potential. The IE-2 viral peptide induced antibodies that specifically recognized the human DR beta chain. These observations describe a protein encoded by the IE-2 region of human cytomegalovirus that contains sequence homology and shows immunologic cross-reactivity with a conserved domain of HLA-DR and suggest a mechanism to explain how human cytomegalovirus infection contributes to graft rejection after transplantation. Images PMID:2446012

  15. The phylogenetic history of New World monkey beta globin reveals a platyrrhine beta to delta gene conversion in the atelid ancestry.

    PubMed

    Prychitko, Tom; Johnson, Robert M; Wildman, Derek E; Gumucio, Deborah; Goodman, Morris

    2005-04-01

    Orthologues of the beta globin gene locus from 10 New World monkey species were sequenced and aligned against available beta and delta globin sequences from rabbit and other primates. Where needed, additional primate sequencing was performed. Phylogenetic analysis identified a beta to delta conversion in the stem of the Anthropoidea, stretching from the 3' part of the proximal promotor to the 5' start of intron 2, consistent with earlier findings. No further conversion appeared to have occurred in the descent of the catarrhines. Within the New World monkey lineage that led to spider monkey and other atelids, another shorter gene conversion was found, spanning adjacent parts of exon 1 and intron 1. The analysis also confirmed that galago beta had replaced galago delta, that an earlier loriform-specific gene conversion extended over intron 2, and that gene conversion throughout the main gene conversion region occurred in the tarsiiform lineage. Platyrrhine phylogenetic relationships were investigated with beta sequences restricted to those that were not involved in gene conversions. This phylogeny generally agreed with results from other nuclear genes. The one exception was that the beta sequences did not place the callitrichine clade within the Cebidae but weakly joined the callitrichine and atelid clades. PMID:15737593

  16. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade.

    PubMed

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar

    2016-01-01

    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the "Beta type" promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening. PMID:27070417

  17. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade

    PubMed Central

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar

    2016-01-01

    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the “Beta type” promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening. PMID:27070417

  18. Sequence heterogeneity, multiplicity, and genomic organization of. cap alpha. - and. beta. -tubulin genes in Sea Urchins

    SciTech Connect

    Alexandraki, D.; Ruderman, J.V.

    1981-12-01

    The authors analyzed the multiplicity, heterogeneity, and organization of the genes encoding the ..cap alpha.. and ..beta.. tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. ..cap alpha.. and ..beta..-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The ..cap alpha.. cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of ..cap alpha.. tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The ..beta.. cDNA insertion contains the coding sequence for the 100 C-terminal amino acids of ..beta.. tubulin and 83 base pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous ..cap alpha..- and ..beta..-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of ..cap alpha..-tubulin genes with ..beta..-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered.

  19. neu protooncogene fused to an immunoglobulin heavy chain gene requires immunoglobulin light chain for cell surface expression and oncogenic transformation.

    PubMed Central

    Flanagan, J G; Leder, P

    1988-01-01

    The protein encoded by the neu protooncogene (human gene symbol NGL for neuro/glioblastoma-derived) is a member of the surface receptor/tyrosine kinase family. Though its structure suggests that it can transduce a transmembrane signal, neither its extracellular ligand nor its critical intracellular substrates are known. To explore the functional properties of the protein encoded by neu, we created a fusion gene that joins the cytoplasmic domain of neu to the extracellular portion of an immunoglobulin heavy chain. The localization of the fusion polypeptide can then be controlled by coexpression with immunoglobulin light chain. In the absence of light chain, the heavy chain-neu polypeptide is expressed intracellularly and has no transforming activity. By contrast, in the presence of light chain the fusion polypeptide is expressed at the cell surface and produces tumorigenic foci. Thus, transformation apparently requires expression at the cell surface, where the neu intracellular domain can interact with components that are localized to the plasma membrane. The fusion protein is active in cellular transformation when the transmembrane domain is derived either from neu or from immunoglobulin, indicating that the neu transmembrane domain is not specifically required for transformation, although neu activation in tumors is known to result from a point mutation in this region. The extracellular immunoglobulin heavy and light chain domains of the fusion protein form a functional binding site that allows antigen to modulate its activity, reversing the transforming effect. Images PMID:2903500

  20. Coal liquefaction model studies: free radical chain decomposition of diphenylpropane, dibenzyl ether, and phenyl ether via. beta. -scission reactions

    SciTech Connect

    Gilbert, K.E.; Gajewski, J.J.

    1982-01-01

    The thermal decompositions of 1,3-diphenylpropane (1), dibenzyl ether (2), and phenethyl phenyl ether (3) have been found to proceed by free radical chain processes. 1 gave toluene and styrene with a reaction order of 1.55, E/sub A/ = 51.4 kcal/mol, and log A = 12.5. The reaction could be initiated by benzyl phenyl ether but not by 1,2-diphenylethane. 2 gave toluene and benzaldehyde with a reaction order of 1.43, E/sub A/ = 48 kcal/mol, and log A = 12.6. The reaction could be initiated with benzyl phenyl ether. 3 gave phenol and styrene with a reaction order of 1.21, E/sub A/ = 50.3 kcal/mol, and log A = 12.3. The reaction could be initiated by benzyl phenyl ether. All of the data are consistent with free radical chain processes with the reaction order determined by the termination reaction. No evidence for concerted reactions has been found. The thermal chemistry of three-atom links is best described by free radical chain processes. The products are consistent with a free radical chain process involving a ..beta..-scission reaction, and the reaction orders range between first and three-halves order depending upon the nature of the chain termination reaction. Activation parameters are readily estimated from thermochemical kinetic data on the individual reactions with log A approx. = 12 and E/sub A/approx. = 50 kcal/mol. Unlike the one- and two-atom linkages, reactions of the three-atom linkages are promoted by free radical initiators. The potential for inhibition of free radical chains also exists and is currently being studied. 4 tables.

  1. Myosin Heavy Chain Gene Expression in Developing Neonatal Skeletal Muscle: Involvement of the Nerve, Gravity, and Thyroid State

    NASA Technical Reports Server (NTRS)

    Baldwin, K. M.; Adams, G.; Haddad, F.; Zeng, M.; Qin, A.; Qin, L.; McCue, S.; Bodell, P.

    1999-01-01

    The myosin heavy chain (MHC) gene family encodes at least six MHC proteins (herein designated as neonatal, embryonic, slow type I (beta), and fast IIa, IIx, and IIb) that are expressed in skeletal muscle in a muscle-specific and developmentally-regulated fashion. At birth, both antigravity (e.g. soleus) and locomotor (e.g., plantaris) skeletal muscles are undifferentiated relative to the adult MHC phenotype such that the neonatal and embryonic MHC isoforms account for 80 - 90% of the MHC pool in a fast locomotor muscle; whereas, the embryonic and slow, type I isoforms account for approx. 90% of the pool in a typical antigravity muscle. The goal of this study was to investigate the role of an intact nerve, gravity and thyroid hormone (T3), as well as certain interactions of these interventions, on MHC gene expression in developing neonatal skeletal muscles of rodents.

  2. Cloning and expression of the phospho-beta-galactosidase gene of Staphylococcus aureus in Escherichia coli.

    PubMed Central

    Breidt, F; Stewart, G C

    1986-01-01

    The phospho-beta-galactosidase gene of Staphylococcus aureus was cloned in Escherichia coli. This was done by first isolating a staphylococcal transposon Tn551-induced mutant which rendered phospho-beta-galactosidase synthesis partially constitutive because of an insertion nearby this lac structural gene. This allowed selection in E. coli of chimeric plasmids which expressed the erythromycin resistance determinant of Tn551. A 26-kilobase (kb) BamHI insert in plasmid pBR322 was isolated which encoded phospho-beta-galactosidase, as determined by phospho-beta-galactosidase activity measurements. Maxicell experiments showed the presence of 56-, 13.5-, and 31-kilodalton proteins encoded by the staphylococcal DNA. The presence of the 56-kilodalton protein correlated with phospho-beta-galactosidase activity and corresponded in molecular weight to the reported value for the purified enzyme. The nature of the other proteins is unknown. Phospho-beta-galactosidase was apparently expressed in E. coli by a promoter contained within a 2.1-kb EcoRI chromosomal DNA fragment. This fragment, when inserted into a chloramphenicol acetyl transferase promoter detection plasmid, was transcriptionally active in both E. coli and Bacillus subtilis but was much more active in the latter host. Images PMID:3011732

  3. Molecular analysis of the Septoria nodorum beta-tubulin gene and characterization of a benomyl-resistance mutation.

    PubMed

    Cooley, R N; Caten, C E

    1993-02-01

    The complete nucleotide sequence of a benomyl-resistant allele of the Septoria nodorum beta-tubulin gene (tubAR) has been determined including 745 and 1024 nucleotides 5' and 3' to the tubAR coding region, respectively. tubAR encodes a 447 amino acid polypeptide which shows a high degree of homology with other fungal beta-tubulins. The gene contains three introns at codons 4, 12 and 53, uses 48 of the possible 61 sense codons and has a GC content of 59.1% in its coding region. S1 nuclease mapping has identified two transcriptional start sites 80 bp and 83 bp upstream of the translation start, and a transcriptional termination site 192 bp downstream of the stop codon. The two transcriptional start sites lie just 8 bp and 5 bp downstream of a CT motif consisting of 18 pyrimidine nucleotides interrupted by a single adenine. The wild-type allele tubA+ has been cloned using the polymerase chain reaction and the mutation producing the benomyl-resistant phenotype of tubAR mapped to a C to T transition at the first position of codon 6, resulting in a histidine to tyrosine amino acid substitution. PMID:8455567

  4. Nitric oxide stimulates insulin gene transcription in pancreatic {beta}-cells

    SciTech Connect

    Campbell, S.C. . E-mail: s.c.campbell@ncl.ac.uk; Richardson, H.; Ferris, W.F.; Butler, C.S.; Macfarlane, W.M.

    2007-02-23

    Recent studies have identified a positive role for nitric oxide (NO) in the regulation of pancreatic {beta}-cell function. The aim of this study was to determine the effects of short-term exposure to NO on {beta}-cell gene expression and the activity of the transcription factor PDX-1. NO stimulated the activity of the insulin gene promoter in Min6 {beta}-cells and endogenous insulin mRNA levels in both Min6 and isolated islets of Langerhans. Addition of wortmannin prior to NO stimulation blocked the observed increases in insulin gene promoter activity. Although NO addition stimulated the phosphorylation of p38, inhibition by SB203580 did not block the effect of NO on the insulin gene promoter. NO addition also stimulated both the nuclear accumulation and the DNA binding activity of PDX-1. This study has shown that over 24 h, NO stimulates insulin gene expression, PI-3-kinase activity and the activity of the critical {beta}-cell transcription factor PDX-1.

  5. Expression of transfected mutant beta-actin genes: transitions toward the stable tumorigenic state.

    PubMed Central

    Leavitt, J; Ng, S Y; Varma, M; Latter, G; Burbeck, S; Gunning, P; Kedes, L

    1987-01-01

    Mutant human beta-actin genes were introduced into normal human (KD) fibroblasts and the derivative cell line HuT-12, which is immortalized but nontumorigenic, to test their ability to promote conversion to the tumorigenic state. Transfected substrains of HuT-12 fibroblasts that expressed abundant levels of mutant beta-actin (Gly-244----Asp-244) produced subcutaneous tumors in athymic mice after long latent periods (1.5 to 3 months). However, transfected substrains of KD fibroblasts retained their normal finite life span in culture and consequently were incapable of producing tumors. Substrains of HuT-12 cells transfected with the wild-type beta-actin gene and some transfected strains that expressed low or undetectable levels of mutant beta-actin did not produce tumors. Cell lines derived from transfectant cell tumors always exhibited elevated synthesis of the mutant beta-actin, ranging from 145 to 476% of the level expressed by the transfected cells that were inoculated to form the tumor. In general, primary transfectant cells that expressed the highest levels of mutant beta-actin were more tumorigenic than strains that expressed lower levels. The tumor-derived strains were stable in tumorigenicity and produced tumors with shortened latent periods of only 2 to 4 weeks. These findings imply that the primary transfectant strains develop subpopulations of cells that are selected to form tumors because of their elevated rate of exogenous mutant beta-actin synthesis. Actin synthesis and accumulation of gamma-actin mRNA from the endogenous beta- and gamma-actin genes were diminished in tumor-derived strains, apparently to compensate for elevated mutant beta-actin synthesis and maintain the normal cellular concentration of actin. Synthesis of the transformation-sensitive tropomyosin isoforms was decreased along with mutant beta-actin expression. Such modulations in tropomyosin synthesis are characteristically seen in transformation of avian, rodent, and human fibroblasts

  6. Pituitary tumor transforming gene-null male mice exhibit impaired pancreatic beta cell proliferation and diabetes

    PubMed Central

    Wang, Zhiyong; Moro, Enrico; Kovacs, Kalman; Yu, Run; Melmed, Shlomo

    2003-01-01

    The mammalian securin, pituitary tumor transforming gene (PTTG), regulates sister chromatid separation during mitosis. Mice or cell lines deficient in PTTG expression, however, are surprisingly viable. Here we show that PTTG disruption in mice (PTTG−/−) severely impairs glucose homeostasis leading to diabetes during late adulthood, especially in males associated with nonautoimmune insulinopenia and reversed alpha/beta cell ratio. Islet beta cell mass in PTTG−/− mice was already diminished before development of frank diabetes and only increased minimally during growth. BrdUrd incorporation of islet cells in PTTG-null mice was ≈65% lower (P < 0.005) than in the WT pancreas, whereas apoptosis rates were similar. PTTG−/− beta cells had pleiotropic nuclei, suggesting defects in cell division. The results indicated that securin is indispensable for normal pancreatic beta cell proliferation. PMID:12626748

  7. Genomic organization of the TcR beta-chain diversity (Dbeta) and joining (Jbeta) segments in the rainbow trout: presence of many repeated sequences.

    PubMed

    De Guerra, A; Charlemagne, J

    1997-06-01

    This work describes a 5.5 kb genomic sequence of the rainbow trout T-cell receptor beta-chain locus. It includes, from 5' to 3', a Dbeta gene, 10 Jbeta genes and the 5'-end of the first Cbeta exon. The trout Dbeta-Jbeta-Cbeta locus is about the same size as the mouse, rat and human homologous loci, but it is less compact and contains 10 Jbeta segments instead of the 6-7 found in mammals. The trout Dbeta coding sequence is identical to those of the mouse, rat and human Dbeta, and the Dbeta recombination signal sequences (RSS) are also very well conserved. Each trout Jbeta segment is flanked in 5' by a 7-mer RSS, which matches with the canonical conserved 7-mer sequences of all RSS. However, 6 of the 10 Jbeta segments have no characteristic 9-mer RSS, although at least some of them are well expressed (Jbeta1 and Jbeta2). The Jbeta region of the trout TcRbeta locus contains numerous micro/minisatellite repeated DNA sequences; some of these repeats contain heptamer RSS-like sequences that could interfere with Jbeta expression. Knowledge of the germline boundaries of the trout Dbeta and Jbeta ends makes it possible to evaluate precisely the exonuclease activity and N-nucleotide addition at the Dbeta-Jbeta junctions of the rearranged TcRbeta chain genes. Many (40%) of the Dbeta-Jbeta junctions in the adult trout have no N-nucleotides, compared to 26.4% in adult mice, and 37% of the adult trout TcRbeta transcripts are out of frame. Thus, there may be major differences in the T-cell developmental kinetics and selection in fish and mammals. PMID:9393968

  8. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  9. DR alpha beta dimers released from complexes with invariant chain fail to stimulate alloreactive T cell clones.

    PubMed

    Demotz, S

    1993-09-01

    To demonstrate that DR alpha beta dimers still complexed to invariant chain (Ii) have not yet acquired peptides recognized by alloreactive T cells, complexes between DR molecules and Ii isolated from Epstein-Barr-virus (EBV)-transformed B cells were analyzed by affinity chromatography and gel filtration. First, it was shown that DR/Ii complexes inserted into artificial planar membranes (PM) failed to stimulate proliferative response of five alloreactive T cell clones and a polyclonal alloreactive T cell line, while PM bearing mature DR alpha beta dimers from the same EBV-B cells were stimulatory for the T cell clones and the T cell line. These findings indicate that either Ii inhibits binding of peptides to DR molecules or Ii hinders T cells recognition of peptide/DR complexes. Second, to discriminate between these two possibilities, DR alpha beta dimers, which were artificially released from complexes between DR molecules and Ii, were inserted into PM. These DR alpha beta dimers were devoid of alloreactive stimulatory capacity while fully capable of binding and presenting a tetanus toxin synthetic peptide to a specific T cell clone, indicating that DR molecules released from complexes with Ii are empty. This study, by showing that DR molecules bound to Ii do not bear peptides recognized by alloreactive T cells, supports the notion that association of Ii with class II major histocompatibility complex (MHC) molecules prevents premature peptide loading and hence favors encounter with peptides derived from proteins of the extracellular compartment. Since allogeneic class II MHC molecules released from complexes with Ii were not stimulatory for five out of five alloreactive T cell clones and a polyclonal alloreactive T cell line, these data also indicate that, in most cases, alloreactive T cells recognize ligands constituted by complexes between allogeneic class II MHC molecules and specific peptides which derive from the antigen-presenting cells themselves or serum

  10. Recombination within and between the human insulin and beta-globin gene loci.

    PubMed Central

    Lebo, R V; Chakravarti, A; Buetow, K H; Cheung, M C; Cann, H; Cordell, B; Goodman, H

    1983-01-01

    We detected a large number of polymorphic insulin restriction fragments in black Americans. These different size fragments were probably generated by unequal recombination on both sides of the human insulin gene. Population genetic analysis indicates that recombination occurred 33 times more frequently than expected to generate this large number of polymorphic fragments. Specific properties of the unique repeated 14- to 16-base-pair sequences 5' to the insulin gene suggest that this sequence would promote increased unequal recombination. Additional pedigree analysis showed that the recombination rate between the structural insulin and beta-globin gene loci was 14% with strong evidence for linkage. Since both insulin and beta-globin have been mapped to the short arm of human chromosome 11, this study establishes that the genetic map distance between these genes is 14.2 centimorgans. PMID:6348773

  11. Epidermolysis bullosa with pyloric atresia: novel mutations in the beta4 integrin gene (ITGB4).

    PubMed Central

    Pulkkinen, L.; Kim, D. U.; Uitto, J.

    1998-01-01

    Epidermolysis bullosa with pyloric atresia (EB-PA; OMIM 226730) is a clinically and genetically heterogeneous autosomal recessive blistering disorder, including lethal and nonlethal variants. Recently, expression of alpha6beta4 integrin, a transmembrane protein of the epithelial basement membranes, has been shown to be altered in these patients. In this work, we have explored the molecular pathology of the lethal form of EB-PA, and we describe novel ITGB4 mutations in five alleles of three patients. The mutation detection strategy included polymerase chain reaction amplification of each exon of ITGB4, followed by heteroduplex analysis and direct nucleotide sequencing. The novel mutations included a homozygous 2-bp deletion in exon 34 (4501delTC), compound heterozygosity for a 2-bp deletion within the paternal allele (120delTG) within exon 3 and a cysteine substitution in the maternal allele (C245G) within exon 7, and the paternal nonsense mutation within exon 4 (Q73X). Thus, three of four distinct mutations predicted truncated polypeptide chains, whereas the missense mutation in the extracellular domain of beta4 integrin may affect ligand binding or dimerization of alpha6 and beta4 integrin subunits. These mutations emphasize the critical importance of the alpha6beta4 integrin in providing stability to the association of epidermis to the underlying dermis at the cutaneous basement membrane zone. Images Figure 1 Figure2 Figure 3 Figure 4 Figure 5 PMID:9422533

  12. Determination of gene dosage by a quantitative adaptation of the polymerase chain reaction (gd-PCR): Rapid detection of deletions and duplications of gene sequences

    SciTech Connect

    Celi, F.S.; Roth, J.; Schuldiner, A.R. Johns Hopkins Univ. School of Medicine, Baltimore, MD ); Cohen, M.M. ); Antonarakis, S.E. ); Wertheimer, E. )

    1994-05-15

    Screening methods based on the polymerase chain reaction (PCR), such as denaturing gradient gel electrophoresis, single-stranded conformational polymorphism, and heteroduplex analysis, are powerful tools for the detection of point mutations as well as small deletions and insertions, but are unable to detect heterozygous deletions or duplications of exons, genes, or chromosomes. The authors now report a PCR-based approach, designated gene dosage-PCR (gd-PCR), that allows rapid screening for heterozygous deletions and duplications of genes or exons. Gene dosage-PCR is a quantitative method in which two in vitro-synthesized DNA internal standards are coamplified with the genomic DNA sample, one corresponding to the gene of interest (test sequence) and the other to a reference (disomic) gene (reference sequence). Both internal standards are designed to be amplified with the same primer pairs and with efficiencies similar to those of their genomic DNA counterparts, yielding PCR products slightly smaller than those derived from genomic DNA. Amplification of approximately equimolar amounts of the two internal standards and genomic DNA, in the presence of [[sup 32]P]dCTP, results in four radiolabeled PCR products; after electrophoresis and quantification of the products, gene dosage is easily calculated. For validation, genomic DNA from 56 subjects, 28 with cytogenetically documented Down syndrome (trisomy 21) and 28 controls that were disomic for chromosome 21, was assayed. Using the [beta]-amyloid precursor protein gene (APP: Chromosome 21q21) as the test sequence, control subjects had an adjusted mean gene dose of 2.00 [+-] 0.29, while subjects with Down syndrome had a mean gene dose of 3.05 [+-] 0.27. There was a clear separation of all of the samples between the two groups. The authors also successfully used gd-PCR to detect allelic deletions by screening pertinent regions of the insulin receptor gene. 48 refs., 5 figs., 2 tabs.

  13. The T cell receptor beta genes of Xenopus.

    PubMed

    Chretien, I; Marcuz, A; Fellah, J; Charlemagne, J; Du Pasquier, L

    1997-03-01

    cDNA of the T cell receptor beta (TCRB) have been isolated from the anuran amphibian Xenopus and they show strong structural homology to TCRB sequences of other vertebrates. Ten BV families, two D segments, ten J segments, and a single C region have been defined so far. Each V family consists of one to two members per haploid genome. A unique feature of the Xenopus TCRB constant region is the lack of N-linked carbohydrate glycosylation sites. The recombination signal sequences suggest that the mechanism of rearrangements are identical to those of mammals. The locus is inherited in a diploid manner despite the pseudotetraploidy of the Xenopus laevis and X. gilli used in this study. PMID:9079820

  14. A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

    SciTech Connect

    Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.; Yang, Xiaojiang; Songya Pang

    1996-01-01

    We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD gene region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.

  15. Characterization and expression of the beta-N-acetylglucosaminidase gene family of Tribolium castaneum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzymes belonging to the Beta-N-acetylglucosaminidase (NAG) family cleave chitin oligosaccharides produced by the action of chitinases on chitin into the constituent N-acetylglucosamine monomer. Four genes encoding putative NAGs in the red flour beetle, Tribolium castaneum, namely TcNAG1, TcFDL, Tc...

  16. Nonblack patients with sickle cell disease have African. beta. sup s gene cluster haplotypes

    SciTech Connect

    Rogers, Z.R.; Powars, D.R.; Williams, W.D. ); Kinney, T.R. ); Schroeder, W.A. )

    1989-05-26

    Of 18 nonblack patients with sickle cell disease, 14 had sickle cell anemia, 2 had hemoglobin SC disease, and 2 had hemoglobin S-{beta}{sup o}-thalassemia. The {beta}{sup s} gene cluster haplotypes that were determined in 7 patients were of African origin and were identified as Central African Republic, Central African Republic minor II, Benin, and Senegal. The haplotype Central African Republic minor II was present on the {beta}{sup o}-thalassemia chromosome in 2 patients. None of 10 patients whose {alpha}-gene status was determined had {alpha}-thalassemia-2. These data strongly support the concept that the {beta}{sup s} gene on chromosome 11 of these individuals is of African origin and that the {alpha}-gene locus on chromosome 16 is of white or native American origin. The clinical severity of the disease in these nonblack patients is appropriate to their haplotype without {alpha}-thalassemia-2 and is comparable with that of black patients. All persons with congenital hemolytic anemia should be examined for the presence of sickle cell disease regardless of physical appearance or ethnic background.

  17. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  18. Beta-globin gene cluster haplotype frequencies in Khalkhs and Buryats of Mongolia.

    PubMed

    Shimizu, Koji; Tokimasa, Kozue; Takeuchi, Yukiko; Gereksaikhan, Tudevdagva; Tanabe, Yuichi; Omoto, Keiichi; Imanishi, Tadashi; Harihara, Shinji; Hao, Luping; Jing, Feng

    2006-12-01

    Beta-globin gene cluster haplotype frequencies of 169 Khalkhs and 145 Buryats were estimated, and their characteristics were compared with those of Evenkis, Oroqens, Koreans, Japanese, and three Colombian Amerindian groups. The present study suggests that Colombian Amerindians diverged first from Asian populations and then Buryats diverged from other Asian populations. PMID:17564253

  19. Differential Expression of Salt Stress-related Genes in Wild Beta vulgaris

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Differential display reverse transcription (DDRT) technique was used to detect differentially expressed genes for wild Beta vulgaris in response to salt stress. Two month-old seedlings were treated with 250 mM Na for 1H, 10H and untreated seedlings were used as controls. A group of differentially di...

  20. Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin

    ERIC Educational Resources Information Center

    Offner, Susan

    2010-01-01

    The beta hemoglobin protein is identical in humans and chimpanzees. In this tutorial, students see that even though the proteins are identical, the genes that code for them are not. There are many more differences in the introns than in the exons, which indicates that coding regions of DNA are more highly conserved than non-coding regions.

  1. Promoter region of the human platelet-derived growth factor A-chain gene

    SciTech Connect

    Takimoto, Yasuo; Wang, Zhao Yi; Kobler, K.; Deuel, T.F. )

    1991-03-01

    The platelet-derived growth factor (PDGF) A- and B-chain genes are widely expressed in mammalian tissues and their homodimeric gene products appear to regulate the autocrine growth of both normal and transformed cells. In this study, we analyzed the 5{prime} flanking sequences of the human PDGF A-chain gene to seek elements important to regulating its transcription. The promoter reigon was exceptionally G + C-rich and contained a TATA box but no CAAT box. The transcription start site was identified 845 base pairs 5{prime} to the translation initiation site by S1 nuclease mapping and by primer extension. Both in vitro transcription and transient expression of the chloramphenicol acetyltransferase gene linked to the PDGF A-chain 5{prime} flanking sequences established that the putative promoter region was active, and RNase H mapping established that the three characteristic mRNAs used the same transcription start site, which was used in normal endothelial cells and in two human tumor cell lines that express high levels of A-chain transcripts. The results extablished an exceptionally G + C-rich promoter region and a single transcription start site active for each of the three mRNAs of the PDGF A-chain gene. DNA sites of potential importance in mediating the activation of the PDGF A-chain gene in normal cells and in transformed cell lines expressing high levels of PDGF A-chain were identified.

  2. Shiga toxin and beta-lactamases genes in Escherichia coli phylotypes isolated from carcasses of broiler chickens slaughtered in Iran.

    PubMed

    Bagheri, Mahboube; Ghanbarpour, Reza; Alizade, Hesam

    2014-05-01

    Two hundred and four Escherichia coli strains were isolated from external and visceral cavity surfaces of 102 slaughtered broiler carcasses. The isolates were screened to determine the phylogenetic background and presence of Shiga toxins (stx1, stx2), intimin (eae) and beta-lactamase (blaTEM, blaSHV) genes. Phylotyping results revealed that the E. coli isolates segregated in four phylogenetic groups A (56.86%), B1 (19.12%), B2 (4.90%) and D (19.12%). PCR assays revealed that 13 isolates (6.37%) from 12 carcasses were positive for eae (12 isolates) and/or stx2 (2) genes. The eae positive isolates belonged to phylogenetic groups A (A0, A1), B1, B2 (B22) and D (D2). Two stx2 positive and seven eae positive isolates were recovered from visceral cavity surface, whereas only 5 eae positive isolates were from the external surface of the carcasses. On the other hand, thirty one E. coli strains isolated from visceral cavity and external surface of 26 carcasses carried the blaTEM (27) and blaSHV (4) genes and belonged to different phylo-groups. This study suggests that broiler carcasses could be considered as an important source of EPEC and STEC pathotypes in southeast of Iran; as well as the examined antibiotic resistance genes, which were carried by some isolates and could be transferred to pathogens through the food chain. PMID:24590116

  3. THE FIRST TRANSMEMBRANE REGION OF THE BETA CHAIN STABILIZES THE TETRAMERIC FcεRI COMPLEX

    PubMed Central

    Singleton, Theresa E.; Platzer, Barbara; Dehlink, Eleonora; Fiebiger, Edda

    2009-01-01

    The family of activating immune receptors stabilizes via the 3-helix assembly principle. A charged basic transmembrane residue interacts with two charged acidic transmembrane residues and forms a 3-helix interface to stabilize receptor complexes in the lipid bilayer. One family member, the high affinity receptor for IgE, FcεRI, is a key regulator of immediate allergic responses. Tetrameric FcεRI consists of the IgE-binding α-chain, the multimembrane spanning β-chain and a dimer of the γ-subunit (FcεRγ). Comparative analysis of these seven transmembrane regions indicates that FcεRI does not meet the charge requirements for the 3-helix assembly mechanism. We performed alanine mutagenesis to show that the only basic amino acid in the transmembrane regions, βK97, is not involved in FcεRI stabilization or surface up-regulation, a hallmark function of the β-chain. Even a βK97E mutant is functional despite four negatively charged acidic amino acids in the transmembrane regions. Using truncation mutants, we demonstrate that the first uncharged transmembrane domain of the β-chain contains the interface for receptor stabilization. In vitro translation experiments depict the first transmembrane region as the internal signal peptide of the β-chain. We also show that this β-chain domain can function as a cleavable signal peptide when used as a leader peptide for a Type I protein. Our results provide evidence that tetrameric FcεRI does not assemble according to the 3-helix assembly principle. We conclude that receptors formed with multispanning proteins use different mechanisms of shielding transmembrane charged amino acids. PMID:19406478

  4. CCAAT/enhancer-binding protein beta isoforms and the regulation of alpha-smooth muscle actin gene expression by IL-1 beta.

    PubMed

    Hu, Biao; Wu, Zhe; Jin, Hong; Hashimoto, Naozumi; Liu, Tianju; Phan, Sem H

    2004-10-01

    The role of IL-1beta in inflammation is amply documented, but its ability to inhibit myofibroblast differentiation and, in particular, the suppression of alpha-smooth muscle actin (alpha-SMA) gene expression is less well understood. Because IL-1beta can induce C/EBPbeta expression, the role of C/EBPbeta isoforms in IL-1beta regulation of alpha-SMA gene expression was investigated in rat lung myofibroblasts. The results showed that IL-1beta inhibited alpha-SMA expression in a dose-dependent manner, which was associated with stimulation of the expression of both C/EBPbeta isoforms, liver-enriched activating protein (LAP) and liver-enriched inhibitory protein (LIP). However, a greater increase in LIP relative to LAP expression resulted in a reduced LAP/LIP ratio after IL-1beta treatment. Transfection with an LAP-expressing plasmid stimulated, whereas an LIP-expressing plasmid inhibited, alpha-SMA expression. Cells from C/EBPbeta-deficient mice had reduced levels of alpha-SMA expression and promoter activity, which failed to respond to IL-1beta treatment. Sequence analysis identified the presence of a C/EBPbeta consensus binding sequence in the alpha-SMA promoter, which, when mutated, resulted in diminished promoter activity and abolished its responsiveness to IL-1beta treatment. EMSA revealed binding of C/EBPbeta to this C/EBPbeta consensus binding sequence from the alpha-SMA promoter. Finally, IL-1beta enhanced the expression of eukaryotic initiation factor 4E, a stimulator of LIP expression, which may account for a mechanism by which IL-1beta could alter the LAP/LIP ratio. These data taken together suggest that C/EBPbeta isoforms regulate alpha-SMA gene expression, and that its inhibition by IL-1beta was due to preferential stimulation of LIP expression. PMID:15383601

  5. Multidrug resistance mediated by co-carriage of extended-spectrum beta-lactamases, AmpC and New Delhi metallo-beta-lactamase-1 genes among carbapenem-resistant Enterobacteriaceae at five Indian medical centres.

    PubMed

    Manoharan, A; Barla, G S; Peter, R; Sugumar, M; Mathai, D

    2016-01-01

    In this study, we evaluated the coexistence of extended-spectrum beta-lactamases (ESBL), AmpC and New Delhi metallo-beta-lactamase-1 (NDM-1) genes among carbapenem-resistant Enterobacteriaceae (CRE) recovered prospectively from patients at multiple sites. The study included 285 CRE strains from 2782 Gram-negative Bacilli collected from multiple centres during 2007-2010, of which 87 were characterised. Standard and reference laboratory methods were used for resistance determination. Detection of blaNDM-1 , blaAmpC , blaTEM , blaSHV and blaCTX-M was done by polymerase chain reaction. High levels of antimicrobial resistance observed among study isolates. Co-carriage of ESBLs, AmpC and NDM-1 was 26.3%. Nosocomial origin among the co-carriage isolates was 64.3%, with 9.2% associated mortality. PMID:27514962

  6. Characterization of the human, mouse and rat PGC1 beta (peroxisome-proliferator-activated receptor-gamma co-activator 1 beta) gene in vitro and in vivo.

    PubMed Central

    Meirhaeghe, Aline; Crowley, Vivion; Lenaghan, Carol; Lelliott, Christopher; Green, Kath; Stewart, Abigail; Hart, Kevin; Schinner, Sven; Sethi, Jaswinder K; Yeo, Giles; Brand, Martin D; Cortright, Ron N; O'Rahilly, Stephen; Montague, Carl; Vidal-Puig, Antonio J

    2003-01-01

    PGC1 alpha is a co-activator involved in adaptive thermogenesis, fatty-acid oxidation and gluconeogenesis. We describe the identification of several isoforms of a new human PGC1 alpha homologue, cloned independently and named PGC1 beta. The human PGC1 beta gene is localized to chromosome 5, has 13 exons and spans more than 78 kb. Two different 5' and 3' ends due to differential splicing were identified by rapid amplification of cDNA ends PCR and screening of human cDNA libraries. We show that PGC1 beta variants in humans, mice and rats are expressed predominantly in heart, brown adipose tissue, brain and skeletal muscle. PGC1 beta expression, unlike PGC1 alpha, is not up-regulated in brown adipose tissue in response to cold or obesity. Fasting experiments showed that PGC1 alpha, but not PGC1 beta, is induced in liver and this suggests that only PGC1 alpha is involved in the hepatic gluconeogenesis. No changes in PGC1 beta gene expression were observed associated with exercise. Human PGC1 beta-1a and -2a isoforms localized to the cell nucleus and, specifically, the isoform PGC1 beta-1a co-activated peroxisome-proliferator-activated receptor-gamma, -alpha and the thyroid hormone receptor beta1. Finally, we show that ectopic expression PGC1 beta leads to increased mitochondrial number and basal oxygen consumption. These results suggest that PGC1 beta may play a role in constitutive adrenergic-independent mitochondrial biogenesis. PMID:12678921

  7. The effect of functional differences in the alpha and beta chains on the cooperativity of the osidation reduction reaction of hemoglobin.

    PubMed

    Edelstein, S J; Gibson, W H

    1975-02-10

    Partially oxidized solutions of hemoglobin have been reacted with azide to determine the extent of oxidation, of the alpha and beta chains according to the method of McQuarrie and Gibson (J. Biol. Chem. (1971) 246, 517-522) In 2, 2'2'' nitriloethanol buffer the fraction of oxidized material represented by the beta chains decreases with decreasing extent of total oxidation, of the alpha chains. Upon addition of insitol hexaphosphate, the degree of perferntial oxidation in terms of a two-state model similar to the description of oxygenation by Edelstein (nature(1971) 230, 224-227) but with the incorporation of chain heterogeneity. The results indicate that the pH-dependent cooperativity of the oxidation-reduction reaction can be described in terms of a bell curbe of n versus log l, the allosteric somewhat lower and shifted slightly to the left, due in part to an affnity of beta chains for electrons approximately twince that of alpha chains. Because the curve is shifted to the left, oxidation-reduction equilibria at l values corresponding to pH 6 to lie on the right side of the bell curve where cooperativity the preferntial affity of beta chains for electrons rises to about 4 times that of alpha chains. As a consequence, the coreesponding bell curve is lowered with the Hill coeficient falling to unity or below in the range of l encountered. Thus the principal cause of decreased cooperativity is chain heterogeneity and not stabilization in the t state as suggested by Perutz; under these conditions the molecules of methemoglobin in the t state are only a fractional part of the population. PMID:234445

  8. Analyses of alpha/beta-type gliadin genes from diploid and hexaploid wheats.

    PubMed

    Reeves, C D; Okita, T W

    1987-01-01

    The alpha/beta-gliadin genes isolated from both hexaploid wheat (cv. Yamhill) and the diploid A genome progenitor Triticum urartu had remarkably similar sequences and differ by only a few point mutations. Primer extension analysis indicated that the transcriptional start points for individual genes in the family cluster within a few nucleotides. Comparison of the promoter region of several alpha/beta-gliadin and B-hordein genes reveals two conserved regions at about -130 and -250 bp. DNA from the hexaploid cultivars, Cheyenne and Chinese Spring, and the diploid progenitors T. urartu and Aegilops squarrosa was analysed by Southern blotting. Restriction fragment lengths of the alpha/beta-gliadin genes varied only slightly between the various wheats, although the overall copy number varied significantly. A region between approx. -1700 and -700 bp upstream from the TATA box was highly repeated in all three wheat genomes. For the hexaploid-derived gene, over 1700 bp of sequence upstream from the TATA box was determined, revealing an additional open reading frame between approx. -1550 and -1250 bp relative to the gliadin TATA box. Northern blot analysis indicated that RNA homologous to this repeated sequence family was present only in developing seed and accumulated to a maximum at late stages of maturation. PMID:3038689

  9. Thalassaemia mutations within the 5'UTR of the human beta-globin gene disrupt transcription.

    PubMed

    Sgourou, Argyro; Routledge, Samantha; Antoniou, Michael; Papachatzopoulou, Adamantia; Psiouri, Lambrini; Athanassiadou, Aglaia

    2004-03-01

    The mechanisms by which mutations within the 5' untranslated region (UTR) of the human beta-globin gene (HBB) cause thalassaemia are currently not well understood. We present here the first comprehensive comparative functional analysis of four 'silent' mutations in the human beta-globin 5'UTR, namely: +10(-T), +22(G --> A), +33(C --> G) and +(40-43)(-AAAC), which are present in patients with beta-thalassaemia intermedia. Expression of these genes under the control of the beta-globin locus control region in stable transfected murine erythroleukaemia cells showed that all four mutations decreased steady state levels of mRNA to 61.6%, 68%, 85.2% and 70.6%, respectively, compared with the wildtype gene. These mutations did not interfere with either mRNA transport from the nucleus to the cytoplasm, 3' end processing or mRNA stability. Nuclear run-on experiments demonstrated that mutations +10(-T) and +33(C --> G) reduced the rate of transcription to a degree that fully accounted for the observed lower level of mRNA accumulation, suggesting a disruption of downstream promoter sequences. Interestingly, mutation +22(G --> A) decreased the rate of transcription to a low degree, indicating the existence of a mechanism that acts post-transcriptionally. Generally, our data demonstrated the significance of functionally analysing mutants of this type in the presence of a full complement of transcriptional regulatory elements within a stably integrated chromatin context in an erythroid cell environment. PMID:15009072

  10. Human and rodent MaxiK channel beta-subunit genes: cloning and characterization.

    PubMed

    Jiang, Z; Wallner, M; Meera, P; Toro, L

    1999-01-01

    Voltage- and Ca2+-sensitive K+ (MaxiK) channels play key roles in controlling neuronal excitability and vascular tone. We cloned and analyzed human and rodent genes for the modulatory beta subunit, KCNMB1. The human and mouse beta-subunit genes are approximately 11 and approximately 9 kb in length, respectively, and have a four exon-three intron structure. Primer extension assay localized the transcription initiation site at 442 (human) or 440 (mouse) bp upstream of the translation initiation codon, agreeing with the transcript size in Northern blots. Both genes have a TATA-less putative promoter region, with a transcription initiator-like region, and motifs characteristic of regulated promoters, including muscle-specific enhancing factors-1 and -2. Consistent with a tissue-specific expression of KCNMB1, regulated at the transcriptional level, beta-subunit transcripts are abundant in smooth muscle and heart, but scarce in lymphatic tissues, brain, and liver. Expressed rat and mouse beta subunits increase the apparent Ca2+ sensitivity of the human MaxiK channel alpha subunit. PMID:9888999

  11. Rapid Evolution of Beta-Keratin Genes Contribute to Phenotypic Differences That Distinguish Turtles and Birds from Other Reptiles

    PubMed Central

    Li, Yang I.; Kong, Lesheng; Ponting, Chris P.; Haerty, Wilfried

    2013-01-01

    Sequencing of vertebrate genomes permits changes in distinct protein families, including gene gains and losses, to be ascribed to lineage-specific phenotypes. A prominent example of this is the large-scale duplication of beta-keratin genes in the ancestors of birds, which was crucial to the subsequent evolution of their beaks, claws, and feathers. Evidence suggests that the shell of Pseudomys nelsoni contains at least 16 beta-keratins proteins, but it is unknown whether this is a complete set and whether their corresponding genes are orthologous to avian beak, claw, or feather beta-keratin genes. To address these issues and to better understand the evolution of the turtle shell at a molecular level, we surveyed the diversity of beta-keratin genes from the genome assemblies of three turtles, Chrysemys picta, Pelodiscus sinensis, and Chelonia mydas, which together represent over 160 Myr of chelonian evolution. For these three turtles, we found 200 beta-keratins, which indicate that, as for birds, a large expansion of beta-keratin genes in turtles occurred concomitantly with the evolution of a unique phenotype, namely, their plastron and carapace. Phylogenetic reconstruction of beta-keratin gene evolution suggests that separate waves of gene duplication within a single genomic location gave rise to scales, claws, and feathers in birds, and independently the scutes of the shell in turtles. PMID:23576313

  12. Variability in the interaction of beta-thalassemia with the alpha-chain variants Hb G-Philadelphia and Hb Rampa.

    PubMed

    Huisman, T H; Gravely, M E; Henson, J; Felice, A; Wilson, J B; Abraham, E C; Vella, F; Little, M W

    1978-08-01

    Two unrelated families are reported in which beta-thalassemia trait occurred with a heterozygosity of Hb G-Philadelphia (alpha2 68(E17)Asn leads to Lys beta2) in one family and with Hb Rampa (alpha2 95(G2)Pro leads to Ser beta2) in the other. The percentage of Hb G-Philadelphia was not influenced by the simultaneous presence of a beta-thalassemai determinant, but that of Hb Rampa was descreased from 20% in the simple heterozygote to about 6% in persons with the Hb Rampa-beta-thalassemia combination. Data from in vitro recombination experiments with isolated alpha X, alpha A, and beta A chains, with heme attached, indicated a preferential formation of Hb A over Hb Rampa but not over Hb G-Philadelphia in conditions of relative beta-chain deficiency. This suggests that the rate of assembly of monomers to form dimers or tetramers can be an important mechanism of controlling the quantity of certain hemoglobin variants with critical substitutions in heterozygotes. PMID:681817

  13. Assignment of the {beta}B1 crystallin gene (CRYBB1) to human chromosome 22 and mouse chromosome 5

    SciTech Connect

    Hulsebos, T.J.M.; Westerveld, A.; Gilbert, D.J.; Jenkins, N.A.; Copeland, N.G.

    1995-10-10

    By using primers complementary to the rat {beta}B1 crystallin gene sequence, we amplified exons 5 and 6 of the orthologous human gene (CRYBB1). The amplified human segments displayed greater than 88% sequence homology to the corresponding rat and bovine sequences. CRYBB1 was assigned to the group 5 region in 22q11.2-q12.1 by hybridizing the exon 6 PCR product to somatic cell hybrids containing defined portions of human chromosome 22. The exon 5 and exon 6 PCR products of CRYBB1 were used to localize, by interspecific backcross mapping, the mouse gene (Crybb1) to the central portion of chromosome 5. Three other {beta} crystallin genes ({beta}B2(-l), {beta}B3, and {beta}A4) have previously been mapped to the same regions in human and mouse. We demonstrate that the {beta}B1 and {beta}A4 crystallin genes are very closely linked in the two species. These assignments complete the mapping and identification of the human and mouse homologues of the major {beta} crystallins genes that are expressed in the bovine lens. 39 refs., 5 figs., 1 tab.

  14. Common mechanism of ampC beta-lactamase induction in enterobacteria: regulation of the cloned Enterobacter cloacae P99 beta-lactamase gene.

    PubMed Central

    Lindberg, F; Normark, S

    1987-01-01

    Expression of the chromosomal beta-lactamase from the ampC gene in inducible in both Enterobacter cloacae and Citrobacter freundii. Cloning of ampC as well as its regulatory gene, ampR, from E. cloacae P99 revealed a gene organization indentical to that of C. freundii in the corresponding region. Although almost no similarities could be found between the restriction maps of ampC and ampR in the two species, the genes cross-hybridize. Also, both ampR gene products have a size of about 31,000. The regulatory features of E. cloacae beta-lactamase induction are very similar to those in C. freundii, i.e., beta-lactamase synthesis is repressed by AmpR in the absence, and stimulated in the presence, of inducer. The AmpR function can be transcomplemented between the two species, but there are quantitative regulatory aberrations in such hybrids, in contrast to the total complementation obtained within each system. These results suggest that the mechanism of beta-lactamase induction is the same in E. cloacae, C. freundii, and other gram-negative bacteria with inducible chromosomal beta-lactamase expression. Images PMID:3027046

  15. Sequence and diversity of rabbit T-cell receptor gamma chain genes

    SciTech Connect

    Isono, T.; Kim, C.J.; Seto, A.

    1995-03-01

    The nucleotide sequences of one constant (C), six variable (V), and two joining (J) gene segments coding for the rabbit T-cell receptor gamma chain (Tcrg) were determined by directly sequencing fragments amplified by the cassette-ligation mediated polymerase chain reaction. The Tcrg-C gene segment did not encode a cysteine residue for connection to the Tcr delta chain in the connecting region, and two variant forms of the Tcrg-C gene segment were generated by alternative splicing, like the human Tcrg-C2 gene. Five of six rabbit Tcrg-V gene segments belonged to the same family and displayed similarity to five productive human Tcrg-V1 family genes as well as the mouse Tcrg-V5 gene. The remaining rabbit Tcrg-V gene segment displayed similarity to the human Tcrg-V3 gene. Both rabbit Tcrg-J gene segments displayed similarity to the human Tcrg-J2.1 and 2.3, respectively. These findings suggested that the genomic organization of rabbit Tcrg genes is more similar to that of human than of mouse Tcrg genes. 18 refs., 4 figs., 1 tab.

  16. Interindividual concordance of methylation profiles in human genes for tumor necrosis factors alpha and beta.

    PubMed Central

    Kochanek, S; Toth, M; Dehmel, A; Renz, D; Doerfler, W

    1990-01-01

    The DNA in mammalian genomes is characterized by complex patterns of DNA methylation that reflect the states of all genetic activities of that genome. The modified nucleotide 5-methyldeoxycytidine (5mdC) can affect the interactions of specific proteins with DNA sequence motifs. The most extensively studied effect of sequence-specific methylations is that of the long-term silencing of eukaryotic (mammalian) promoters. We have initiated studies on the methylation status of parts of the human genome to view patterns of DNA methylation as indicators for genetic activities. In this report, analyses using both restriction enzyme--Southern blotting and the very precise genomic sequencing technique have been done. The genes for tumor necrosis factors (TNF) alpha and beta--in particular, their 5'-upstream and promoter regions--have been investigated in DNA isolated from human lymphocytes, granulocytes, and sperm. The results are characterized by a remarkable interindividual concordance of DNA methylation in specific human cell types. The patterns are identical in the DNA from one cell type for different individuals even of different genetic origins but different in the DNA from different cell types. As an example, in the DNA from human granulocytes of 15 different individuals (ages 20-48 yr, both sexes), 5mdC residues have been localized by the genomic sequencing technique in three identical sequence positions in the 5'-upstream region and in one downstream position of the gene encoding TNF-alpha. The promoter of this gene is free of 5mdC, and TNF-alpha is expressed in human granulocytes. The TNF-beta promoter is methylated in granulocytes from 9 different individuals, and TNF-beta is not expressed. In human lymphocytes, the main source of TNF-beta, the TNF-beta promoter is free of 5mdC residues. All 5'-CG-3' sites studied in the TNF-alpha and -beta genes are methylated in DNA from human sperm. In human cell lines HL-60, Jurkat, and RPMI 1788, the extent of DNA methylation

  17. Increased Stability and DNA Site Discrimination of Single Chain Variants of the Dimeric beta-Barrel DNA Binding Domain of the Human Papillomavirus E2 Transcriptional Regulator

    SciTech Connect

    Dellarole,M.; Sanchez, I.; Freire, E.; de Prat-Gay, G.

    2007-01-01

    Human papillomavirus infects millions of people worldwide and is a causal agent of cervical cancer in women. The HPV E2 protein controls the expression of all viral genes through binding of its dimeric C-terminal domain (E2C) to its target DNA site. We engineered monomeric versions of the HPV16 E2C, in order to probe the link of the dimeric {beta}-barrel fold to stability, dimerization, and DNA binding. Two single-chain variants, with 6 and 12 residue linkers (scE2C-6 and scE2C-12), were purified and characterized. Spectroscopy and crystallography show that the native structure is unperturbed in scE2C-12. The single chain variants are stabilized with respect to E2C, with effective concentrations of 0.6 to 6 mM. The early folding events of the E2C dimer and scE2C-12 are very similar and include formation of a compact species in the submillisecond time scale and a non-native monomeric intermediate with a half-life of 25 ms. However, monomerization changes the unfolding mechanism of the linked species from two-state to three-state, with a high-energy intermediate. Binding to the specific target site is up to 5-fold tighter in the single chain variants. Nonspecific DNA binding is up to 7-fold weaker in the single chain variants, leading to an overall 10-fold increased site discrimination capacity, the largest described so far for linked DNA binding domains. Titration calorimetric binding analysis, however, shows almost identical behavior for dimer and single-chain species, suggesting very subtle changes behind the increased specificity. Global analysis of the mechanisms probed suggests that the dynamics of the E2C domain, rather than the structure, are responsible for the differential properties. Thus, the plastic and dimeric nature of the domain did not evolve for a maximum affinity, specificity, and stability of the quaternary structure, likely because of regulatory reasons and for roles other than DNA binding played by partly folded dimeric or monomeric conformers.

  18. Inhibition of serine palmitoyltransferase in vitro and long-chain base biosynthesis in intact Chinese hamster ovary cells by. beta. -chloroalanine

    SciTech Connect

    Medlock, K.A.; Merrill, A.H. Jr.

    1988-09-06

    The effects of ..beta..-chloroalanine (..beta..-Cl-alanine) on the serine palmitoyltransferase activity and the de novo biosynthesis of sphinganine and sphingenine were investigated in vitro with rat liver microsomes and in vivo with intact Chinese hamster ovary (CHO) cells. The inhibition in vitro was rapid, irreversible, and concentration and time dependent and apparently involved the active site because inactivation only occurred with ..beta..-Cl-L-alanine and was blocked by L-serine. These are characteristics of mechanism-based (suicide) inhibition. Serine palmitoyltransferase (SPT) was also inhibited when intact CHO cells were incubated with ..beta..-Cl-alanine and this treatment inhibited (/sup 14/C)serine incorporation into long-chain bases by intact cells. The concentration dependence of the loss of SPT activity and of long-chain base synthesis was identical. The effects of ..beta..-Cl-alanine appeared to occur with little perturbation of other cell functions: the cells exhibited no loss in cell viability, (/sup 14/C)serine uptake was not blocked, total lipid biosynthesis from (/sup 14/C)acetic acid was not decreased (nor was the appearance of radiolabel in cholesterol and phosphatidylcholine), and (/sup 3/H)thymidine incorporation into DNA was not affected. There appeared to be little effect on protein synthesis based on the incorporation of (/sup 3/H)leucine, which was only decreased by 14%. Although ..beta..-Cl-L-alanine is known to inhibit other pyridoxal 5'-phosphate dependent enzymes, alanine and aspartate transaminases were not inhibited under these conditions. These results establish the close association between the activity of serine palmitoyltransferase and the cellular rate of long-chain base formation and indicate that ..beta..-Cl-alanine and other mechanism-based inhibitors might be useful to study alterations in cellular long-chain base synthesis.

  19. Mutations in the SUP-PF-1 locus of Chlamydomonas reinhardtii identify a regulatory domain in the beta-dynein heavy chain.

    PubMed

    Porter, M E; Knott, J A; Gardner, L C; Mitchell, D R; Dutcher, S K

    1994-09-01

    We have characterized a group of regulatory mutations that alter the activity of the outer dynein arms. Three mutations were obtained as suppressors of the paralyzed central pair mutant pf6 (Luck, D.J.L., and G. Piperno. 1989. Cell Movement. pp. 49-60), whereas two others were obtained as suppressors of the central pair mutant pfl6. Recombination analysis and complementation tests indicate that all five mutations are alleles at the SUP-PF-1/ODA4 locus and that each allele can restore motility to radial spoke and central pair defective strains. Restriction fragment length polymorphism analysis with a genomic probe for the beta-dynein heavy chain (DHC) gene confirms that this locus is tightly linked to the beta-DHC gene. Although all five mutant sup-pf-1 alleles alter the activity of the outer dynein arm as assayed by measurements of flagellar motility, only two alleles have a discernable polypeptide defect by SDS-PAGE. We have used photolytic and proteolytic cleavage procedures to localize the polypeptide defect to an approximately 100-kD domain downstream from the last putative nucleotide binding site. This region is encoded by approximately 5 kb of genomic DNA (Mitchell, D.R., and K. Brown. 1994. J. Cell Sci. 107:653-644). PCR amplification of wild-type and mutant DNA across this region identified one PCR product that was consistently smaller in the sup-pf-1 DNA. Direct DNA sequencing of the PCR products revealed that two of the sup-pf-1 mutations are distinct, in-frame deletions. These deletions occur within a region that is predicted to encode a small alpha-helical coiled-coil domain of the beta-DHC. This domain may play a role in protein-protein interactions within the outer dynein arm. Since both the size and location of this domain have been conserved in all axonemal and cytoplasmic DHCs sequenced to date, it presumably performs a common function in all dynein isoforms. PMID:8089181

  20. Interleukin-1beta-induced type IIA secreted phospholipase A2 gene expression and extracellular activity in rat vascular endothelial cells.

    PubMed

    Schwemmer, M; Aho, H; Michel, J B

    2001-06-01

    Two phospholipase A2 (PLA2) isoforms, secretory and cytosolic, have been implicated in inflammation. Secretory type IIA PLA2 (sPLA2-IIA), which hydrolyzes fatty acids bound at the sn-2 position of glycerophospholipids, has been detected universally in a variety of mammalian tissues and cells. The expression of the sPLA2-IIA gene and its extracellular activity were shown to be regulated by different factors such as hypoxia, cytokines and phorbol esters. In the present study, we examined the effects of interleukin-1beta (IL-1beta) on the expression of the 14kDa sPLA2-IIA, determined using reverse transcription polymerase chain reaction and radiometric Escherichia coli enzyme assay in primary cultures of rat endothelial cells and in two different rat endothelial cell lines (SVAREC and RBE4). These experiments revealed that IL-1beta induces sPLA2-IIa gene expression and secretion of the enzyme in endothelial cells in a dose- and time-dependent manner. The cAMP-elevator forskolin did not augment the cytokine-induced elevation of sPLA2-IIa enzyme activity but significantly increased the IL-1beta-stimulated sPLA2-IIa mRNA contents in endothelial cells. PMID:11469536

  1. Cloning and expression in Saccharomyces cerevisiae of a Trichoderma reesei beta-mannanase gene containing a cellulose binding domain.

    PubMed Central

    Stålbrand, H; Saloheimo, A; Vehmaanperä, J; Henrissat, B; Penttilä, M

    1995-01-01

    beta-Mannanase (endo-1,4-beta-mannanase; mannan endo-1,4-beta-mannosidase; EC 3.2.1.78) catalyzes endo-wise hydrolysis of the backbone of mannan and heteromannans, including hemicellulose polysaccharides, which are among the major components of plant cell walls. The gene man1, which encodes beta-mannanase, of the filamentous fungus Trichoderma reesei was isolated from an expression library by using antiserum raised towards the earlier-purified beta-mannanase protein. The deduced beta-mannanase consists of 410 amino acids. On the basis of hydrophobic cluster analysis, the beta-mannanase was assigned to family 5 of glycosyl hydrolases (cellulase family A). The C terminus of the beta-mannanase has strong amino acid sequence similarity to the cellulose binding domains of fungal cellulases and is preceded by a serine-, threonine-, and proline-rich region. Consequently, the beta-mannanase is probably organized similarly to the T. reesei cellulases, having a catalytic core domain separated from the substrate-binding domain by an O-glycosylated linker. Active beta-mannanase was expressed and secreted by using the yeast Saccharomyces cerevisiae as the host. The results indicate that the man1 gene encodes the two beta-mannanases with different isoelectric points (pIs 4.6 and 5.4) purified earlier from T. reesei. PMID:7793911

  2. New Codanin-1 Gene Mutations in a Italian Patient with Congenital Dyserythropoietic Anemia Type I and Heterozygous Beta-Thalassemia.

    PubMed

    D'Alcamo, Elena; Agrigento, V; Pitrolo, L; Sclafani, S; Barone, R; Calvaruso, G; Buffa, V; Maggio, A

    2016-06-01

    Congenital dyserythropoietic anemia type I is an autosomal recessive disorder associated with macrocytic anemia, ineffective erythropoiesis, iron overloading and characterized by abnormal chromatin ultrastructure in erythroblasts such as internuclear chromatin bridges, spongy heterochromatin and invagination of the nuclear membrane. A 58-year-old Causasian man with chronic hemolytic anemia, heterozygous for β (+) -globin IVS1, nt110 G>A mutation (causing abnormal alpha:beta globin chain ratio) showed clinical, laboratory and hematological features suggesting diagnosis of CDA1. Sequence analysis of CDA-related genes revealed compound heterozygosity for two novel mutations in the CDAN1 gene: a frameshift mutation 3367 del 4 (TTAG) in exon 25 and a missense mutation c.1811 G>T in exon 11 causing an aminoacid change from glycine to valine at codon 565 (G565V). One of the propositus' brothers showed the same gene mutations. As the CDA1 can mimic thalassemia, a frequent misdiagnosis is possible especially in countries where the prevalence of thalassemia is high. A strong clinical suspicion in patients who do not reveal a clear genetic basis for presumed thalassemia may help clinch the correct diagnosis. PMID:27408412

  3. Promoter activity of the 5'-flanking regions of medaka fish soluble guanylate cyclase alpha1 and beta1 subunit genes.

    PubMed Central

    Yamamoto, Takehiro; Suzuki, Norio

    2002-01-01

    We examined the spatial expression pattern of medaka fish (Oryzias latipes) soluble guanylate cyclase alpha(1) and beta(1) subunit genes, OlGCS-alpha(1) and OlGCS-beta(1), and characterized the 5'-flanking region required for expression of both genes by introducing various promoter-luciferase fusion-gene constructs into COS-1 cells and medaka fish embryos. The OlGCS-alpha(1) and OlGCS-beta(1) gene transcripts were detected in whole brain and kidney in 7-day and 9-day embryos. Primer-extension analysis demonstrated that there were no differences among various adult organs (brain, eye, kidney, ovary and testis) in the transcription start site of the OlGCS-alpha(1) and OlGCS-beta(1) genes. Neither gene contained the functional TATA box within its 5'-flanking region, and the basal promoter activity was found between nucleotides +33 and +42 in the OlGCS-alpha(1) gene and between nucleotides +146 and +155 in the OlGCS-beta(1) gene. In the assay of medaka fish embryos, the 5'-flanking region of the OlGCS-beta(1) gene exhibited lower promoter activity than that of the OlGCS-alpha(1) gene. In the experiments on dual-luciferase fusion-gene constructs, the 5'-flanking region of the OlGCS-alpha(1) gene connected to the 5'-flanking region of the OlGCS-beta(1) gene was introduced into medaka fish embryos, and the 5'-flanking regions of both subunit genes were shown to mutually influence each other's promoter activity. PMID:11772405

  4. MHC evolution in three salmonid species: a comparison between class II alpha and beta genes.

    PubMed

    Gómez, Daniela; Conejeros, Pablo; Marshall, Sergio H; Consuegra, Sofia

    2010-08-01

    The genes of the major histocompatibility complex (MHC) are amongst the most variable in vertebrates and represent some of the best candidates to study processes of adaptive evolution. However, despite the number of studies available, most of the information on the structure and function of these genes come from studies in mammals and birds in which the MHC class I and II genes are tightly linked and class II alpha exhibits low variability in many cases. Teleost fishes are among the most primitive vertebrates with MHC and represent good organisms for the study of MHC evolution because their class I and class II loci are not physically linked, allowing for independent evolution of both classes of genes. We have compared the diversity and molecular mechanisms of evolution of classical MH class II alpha and class II beta loci in farm populations of three salmonid species: Oncorhynchus kisutch, Oncorhynchus mykiss and Salmo salar. We found single classical class II loci and high polymorphism at both class II alpha and beta genes in the three species. Mechanisms of evolution were common for both class II genes, with recombination and point mutation involved in generating diversity and positive selection acting on the peptide-binding residues. These results suggest that the maintenance of variability at the class IIalpha gene could be a mechanism to increase diversity in the MHC class II in salmonids in order to compensate for the expression of one single classical locus and to respond to a wider array of parasites. PMID:20521040

  5. Tissue-Specific Methylation of Human Insulin Gene and PCR Assay for Monitoring Beta Cell Death

    PubMed Central

    Husseiny, Mohamed I.; Kaye, Alexander; Zebadua, Emily; Kandeel, Fouad; Ferreri, Kevin

    2014-01-01

    The onset of metabolic dysregulation in type 1 diabetes (T1D) occurs after autoimmune destruction of the majority of pancreatic insulin-producing beta cells. We previously demonstrated that the DNA encoding the insulin gene is uniquely unmethylated in these cells and then developed a methylation-specific PCR (MSP) assay to identify circulating beta cell DNA in streptozotocin-treated mice prior to the rise in blood glucose. The current study extends to autoimmune non-obese diabetic (NOD) mice and humans, showing in NOD mice that beta cell death occurs six weeks before the rise in blood sugar and coincides with the onset of islet infiltration by immune cells, demonstrating the utility of MSP for monitoring T1D. We previously reported unique patterns of methylation of the human insulin gene, and now extend this to other human tissues. The methylation patterns of the human insulin promoter, intron 1, exon 2, and intron 2 were determined in several normal human tissues. Similar to our previous report, the human insulin promoter was unmethylated in beta cells, but methylated in all other tissues tested. In contrast, intron 1, exon 2 and intron 2 did not exhibit any tissue-specific DNA methylation pattern. Subsequently, a human MSP assay was developed based on the methylation pattern of the insulin promoter and human islet DNA was successfully detected in circulation of T1D patients after islet transplantation therapy. Signal levels of normal controls and pre-transplant samples were shown to be similar, but increased dramatically after islet transplantation. In plasma the signal declines with time but in whole blood remains elevated for at least two weeks, indicating that association of beta cell DNA with blood cells prolongs the signal. This assay provides an effective method to monitor beta cell destruction in early T1D and in islet transplantation therapy. PMID:24722187

  6. Effects of endocrine disruptors on genes associated with 17beta-estradiol metabolism and excretion.

    PubMed

    Hanet, Nathalie; Lancon, Allan; Delmas, Dominique; Jannin, Brigitte; Chagnon, Marie-Christine; Cherkaoui-Malki, Moustapha; Latruffe, Norbert; Artur, Yves; Heydel, Jean-Marie

    2008-11-01

    In order to provide a global analysis of the effects of endocrine disruptors on the hormone cellular bioavailability, we combined 17beta-estradiol (E2) cellular flow studies with real-time PCR and Western blot expression measurements of genes involved in the hormone metabolism and excretion. Three endocrine disruptors commonly found in food were chosen for this study, which was conducted in the estrogen receptor (ER) negative hepatoblastoma HepG2 cell line: bisphenol A (BPA), genistein (GEN) and resveratrol (RES). We showed that 24 h after a single dose treatment with genistein, resveratrol or bisphenol A, the expression of ATP-binding cassette transporters (the multidrug resistance or MDR, and the multidrug resistance associated proteins or MRP) uridine diphosphate-glucuronosyltransferases (UGT) and/or sulfotransferases (ST) involved in 17beta-estradiol elimination process were significantly modulated and that 17beta-estradiol cellular flow was modified. Resveratrol induced MDR1 and MRP3 expressions, bisphenol A induced MRP2 and MRP3 expressions, and both enhanced 17beta-estradiol efflux. Genistein, on the other hand, inhibited ST1E1 and UGT1A1 expressions, and led to 17beta-estradiol cellular retention. Thus, we demonstrate that bisphenol A, genistein and resveratrol modulate 17beta-estradiol cellular bioavailability in HepG2 and that these modulations most probably involve regulations of 17beta-estradiol phase II and III metabolism proteins. Up to now, the estrogenicity of environmental estrogenic pollutants has been based on the property of these compounds to bind to ERs. Our results obtained with ER negative cells provide strong evidence for the existence of ER-independent pathways leading to endocrine disruption. PMID:18634814

  7. Expression of Caveolin-1 reduces cellular responses to TGF-{beta}1 through down-regulating the expression of TGF-{beta} type II receptor gene in NIH3T3 fibroblast cells

    SciTech Connect

    Lee, Eun Kyung; Lee, Youn Sook; Han, In-Oc; Park, Seok Hee . E-mail: parks@skku.edu

    2007-07-27

    Transcriptional repression of Transforming Growth Factor-{beta} type II receptor (T{beta}RII) gene has been proposed to be one of the major mechanisms leading to TGF-{beta} resistance. In this study, we demonstrate that expression of Caveolin-1 (Cav-1) gene in NIH3T3 fibroblast cells down-regulates the expression of T{beta}RII gene in the transcriptional level, eventually resulting in the decreased responses to TGF-{beta}. The reduced expression of T{beta}RII gene by Cav-1 appeared to be due to the changes of the sequence-specific DNA binding proteins to either Positive Regulatory Element 1 (PRE1) or PRE2 of the T{beta}RII promoter. In addition, Cav-1 expression inhibited TGF-{beta}-mediated cellular proliferation and Plasminogen Activator Inhibitor (PAI)-1 gene expression as well as TGF-{beta}-induced luciferase activity. Furthermore, the inhibition of endogeneous Cav-1 by small interfering RNA increased the expression of T{beta}RII gene. These findings strongly suggest that expression of Cav-1 leads to the decreased cellular responsiveness to TGF-{beta} through down-regulating T{beta}RII gene expression.

  8. Construction of bioactive chimeric MHC class I tetramer by expression and purification of human-murine chimeric MHC heavy chain and beta(2)m as a fusion protein in Escherichia coli.

    PubMed

    Ren, Ding; Wang, Fang; He, Xiaowen; Jiang, Lei; Li, Dean; Ying, He; Sun, Shuhan

    2006-12-01

    Major histocompatibility (MHC) class I tetramers are used in the quantitative analysis of epitope peptide-specific CD8+ T-cells. An MHC class I tetramer was composed of 4 MHC class I complexes and a fluorescently labeled streptavidin (SA) molecule. Each MHC class I complex consists of an MHC heavy chain, a beta(2)-microglobulin (beta(2)m) molecule and a synthetic epitope peptide. In most previous studies, an MHC class I complex was formed in the refolding buffer with an expressed MHC heavy chain molecule and beta(2)m, respectively. This procedure inevitably resulted in the disadvantages of forming unwanted multimers and self-refolding products, and the purification of each kind of monomer was time-consuming. In the present study, the genes of a human/murine chimeric MHC heavy chain (HLA-A2 alpha1, HLA-A2 alpha2 and MHC-H2D alpha3) and beta(2)m were tandem-cloned into plasmid pET17b and expressed as a fusion protein. The recombinant fusion protein was refolded with each of the three HLA-A2 restricted peptides (HBc18-27 FLPSDFFPSI, HBx52-60 HLSLRGLPV, and HBx92-100 VLHKRTLGL) and thus three chimeric MHC class I complexes were obtained. Biotinylation was performed, and its level of efficiency was observed via a band-shift assay in non-reducing polyacrylamide gel electrophoresis (PAGE). Such chimeric MHC class I tetramers showed a sensitive binding activity in monitoring HLA/A2 restrictive cytotoxic T lymphocytes (CTLs) in immunized HLA/A*0201 transgenic mice. PMID:17046278

  9. Analysis and expression of the alpha-expansin and beta-expansin gene families in maize

    NASA Technical Reports Server (NTRS)

    Wu, Y.; Meeley, R. B.; Cosgrove, D. J.

    2001-01-01

    Expansins comprise a multigene family of proteins in maize (Zea mays). We isolated and characterized 13 different maize expansin cDNAs, five of which are alpha-expansins and eight of which are beta-expansins. This paper presents an analysis of these 13 expansins, as well as an expression analysis by northern blotting with materials from young and mature maize plants. Some expansins were expressed in restricted regions, such as the beta-expansins ExpB1 (specifically expressed in maize pollen) and ExpB4 (expressed principally in young husks). Other expansins such as alpha-expansin Exp1 and beta-expansin ExpB2 were expressed in several organs. The expression of yet a third group was not detected in the selected organs and tissues. An analysis of expansin sequences from the maize expressed sequence tag collection is also presented. Our results indicate that expansin genes may have general, overlapping expression in some instances, whereas in other cases the expression may be highly specific and limited to a single organ or cell type. In contrast to the situation in Arabidopsis, beta-expansins in maize seem to be more numerous and more highly expressed than are alpha-expansins. The results support the concept that beta-expansins multiplied and evolved special functions in the grasses.

  10. Localisation of Neuregulin 1-{beta}3 to different sub-nuclear structures alters gene expression

    SciTech Connect

    Wang, Ming; Trim, Carol M.; Gullick, William J.

    2011-02-15

    Neuregulins are growth factors that signal via the ErbB3 and ErbB4 receptors. Here we show using immunohistochemistry that they are often expressed in the nucleus of a range of tumour types including soft tissue and breast. The Neuregulin 1 type I-{beta}3 (NRG1-{beta}3) isoform localises to two sub-nuclear compartments in animal cells, nucleoli and spliceosomes. We used NRG1-{beta}3 tagged with photoactivatable GFP and demonstrated that this re-localised from nucleoli to spliceosomes over 90 min. Tyrosine kinase activity was not required for retaining the NRG1-{beta}3 within the nucleus. Mutation of the lysines 14 and 16 or 15 and 16 together prevented nucleolar uptake while four positively charged residues were identified which were required for spliceosome uptake. Molecular modelling suggests that three of these may form a binding site. We showed using a kinome array that NRG1-{beta}3 and a mutant exclusively localising to spliceosomes increased phosphorylation and/or expression of the HER4 and HER2 receptors. Using a transcriptomic analysis the same two constructs induced expression of several messenger RNAs and we confirmed the increased expression at the protein level of the most highly induced, Heat Shock Protein 70B'. These results suggest that Neuregulin activates receptor signalling in spliceosomes leading to altered gene expression.

  11. Cell and Gene Therapy for the Beta-Thalassemias: Advances and Prospects.

    PubMed

    Mansilla-Soto, Jorge; Riviere, Isabelle; Boulad, Farid; Sadelain, Michel

    2016-04-01

    The beta-thalassemias are inherited anemias caused by mutations that severely reduce or abolish expression of the beta-globin gene. Like sickle cell disease, a related beta-globin gene disorder, they are ideal candidates for performing a genetic correction in patient hematopoietic stem cells (HSCs). The most advanced approach utilizes complex lentiviral vectors encoding the human β-globin gene, as first reported by May et al. in 2000. Considerable progress toward the clinical implementation of this approach has been made in the past five years, based on effective CD34+ cell mobilization and improved lentiviral vector manufacturing. Four trials have been initiated in the United States and Europe. Of 16 evaluable subjects, 6 have achieved transfusion independence. One of them developed a durable clonal expansion, which regressed after several years without transformation. Although globin lentiviral vectors have so far proven to be safe, this occurrence suggests that powerful insulators with robust enhancer-blocking activity will further enhance this approach. The combined discovery of Bcl11a-mediated γ-globin gene silencing and advances in gene editing are the foundations for another gene therapy approach, which aims to reactivate fetal hemoglobin (HbF) production. Its clinical translation will hinge on the safety and efficiency of gene targeting in true HSCs and the induction of sufficient levels of HbF to achieve transfusion independence. Altogether, the progress achieved over the past 15 years bodes well for finding a genetic cure for severe globin disorders in the next decade. PMID:27021486

  12. beta 3-Adrenergic-mediated suppression of leptin gene expression in rats.

    PubMed

    Li, H; Matheny, M; Scarpace, P J

    1997-06-01

    To investigate the role of beta 3-adrenergic receptors in the suppression of leptin gene expression, we fasted F-344 rats to decrease leptin mRNA levels, refed the rats to stimulate leptin mRNA production, and examined the ability of the beta 3-adrenergic agonist CGP-12177 to prevent the rise in leptin mRNA levels. In the initial 2 h after CGP-12177 (0.75 mg/kg), there were significant reductions in both food consumption and leptin mRNA levels in epididymal, perirenal, and interscapular white adipose tissue. We were unable to detect leptin mRNA in interscapular brown adipose tissue (IBAT), whereas there was a significant increase in uncoupling protein mRNA levels in IBAT after CGP-12177. The suppression of leptin mRNA and food intake by CGP-12177 was confirmed in a second experiment using another rat strain, the F-344 x BN. Furthermore, refeeding after a period of fasting increased leptin mRNA, which was prevented by CGP-12177. These data indicate a role for beta 3-adrenergic-mediated regulation of leptin gene expression in nonmutant rodents and are consistent with other reports suggesting that beta 3-adrenergic agonists suppress food intake. PMID:9227448

  13. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.

    PubMed

    Kefalas, P; Gray, F C; Allan, J

    1988-01-25

    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. PMID:3340546

  14. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.

    PubMed Central

    Kefalas, P; Gray, F C; Allan, J

    1988-01-01

    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. Images PMID:3340546

  15. Shared idiotypes and restricted immunoglobulin variable region heavy chain genes characterize murine autoantibodies of various specificities.

    PubMed Central

    Monestier, M; Manheimer-Lory, A; Bellon, B; Painter, C; Dang, H; Talal, N; Zanetti, M; Schwartz, R; Pisetsky, D; Kuppers, R

    1986-01-01

    The study of the Ig variable region heavy chain (VH) genes used to encode antibodies specific for self-epitopes from murine hybridomas showed that three VH families are primarily utilized: VH J558, the largest family, and VH QPC52 and VH 7183, the families most proximal to the Ig joining region heavy chain genes. These monoclonal autoantibodies express cross-reactive idiotopes shared by rheumatoid factors and antibodies specific for Sm. The expression of these idiotypes is independent of major histocompatibility complex and Ig constant region heavy chain haplotypes, self-antigen specificity, and even the VH gene family utilized. Though the experiments described here are limited to murine autoantibodies, similarities exist between murine and human autoimmune diseases. Studies that aim to investigate the relationship between VH gene expression and the presence of cross-reactive idiotypes among human autoantibodies should enable us to better understand the mechanisms of autoimmunity and self-tolerance. Images PMID:2427543

  16. Involvement of the RAR{beta}1 and dlk genes in small cell lung carcinogenesis and in human development

    SciTech Connect

    Toulouse, A.; Pelletier, M.; Morin, J.

    1994-09-01

    Lung cancer is the most lethal malignant disease in western societies. It encompasses four major histological types: squamous carcinoma, adenocarcinoma, and large cell carcinoma (known together as non-small-cell lung cancers) and a fourth type which is small cell carcinoma. This last histological class is a particularly aggressive malignant disease; it is characterized by an early development of metastasis so that upon time of diagnosis these are already widespread throughout the body. Our group is interested in defining and understanding the role of the retinoic acid receptor {beta}(RAR{beta}) gene in human lung cancer. This gene encodes nuclear transcription factors which are part of the thyroid and steroid hormone receptor superfamily. Four isoforms are known in mouse, which are generated by alternative splicing from two promoters, P{sub 1} (isoforms {beta}1 and {beta}3) and P{sub 2} (isoforms {beta}2 and {beta}4). In human only the isoforms {beta}2 (a tumor suppressor gene) and {beta}4 were known until recently when our group cloned the sequences encoding the 5{prime} end of the mRNA for RAR{beta}1. Expression studies have shown that this isoform is expressed during development in almost all tissues tested and that it is also expressed in a particular subset of human small cell carcinoma lines. It is not expressed in any adult tissue examined so far. Recently, Laborda et al. have cloned a human gene (dlk for delta-like) similar to the drosophila neurogenic gene Delta. We have found striking similarities in the expression pattern of dlk and RAR{beta}1 since the two genes are coexpressed in all fetal tissues examined and are also coexpressed in virtually identical subsets of SCLC lines. These results have implications for human embryogenesis and tumorigenesis.

  17. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  18. Characterization of the human beta4 nAChR gene and polymorphisms in CHRNA3 and CHRNB4.

    PubMed

    Lev-Lehman, E; Bercovich, D; Xu, W; Stockton, D W; Beaudet, A L

    2001-01-01

    Most neuronal nicotinic acetylcholine receptors are heteropentamers, composed of alpha and beta subunits. Mice lacking the alpha3 subunit and mice lacking both the beta2 and beta4 subunits, but not mice lacking the beta2 or beta4 subunits alone, have a severe phenotype characterized by megacystis, failure of bladder strips to contract in response to nicotine, widely dilated ocular pupils, growth failure, and perinatal mortality. The deficit in bladder contraction was also found in mice lacking only the beta4 subunit, although they did not develop megacystis. The major bladder phenotype resembles the human autosomal recessive disorder of megacystis-microcolon-hypoperistalsis syndrome (MMIHS). Based on the similarity of the mouse and human phenotypes, we initiated mutation analyses in the alpha3 and beta4 genes in MMIHS families. The human gene encoding the beta4 subunit was fully characterized, including refinement of its mapping. Analysis of disease families and controls identified numerous genetic variants, including high-frequency polymorphisms in both CHRNA3 and CHRNB4. Although no loss-of-function mutations have been identified to date, these genes remain strong candidates for involvement in MMIHS, because various mutations might be obscured within the complex cluster of genes. Some of the markers presented here are valuable tools for analysis of the role of genetic variation in responses to nicotine and for characterization of various dysautonomic abnormalities. PMID:11450844

  19. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: prenatal exclusion in a fetus at risk.

    PubMed

    McGrath, J A; Kivirikko, S; Ciatti, S; Moss, C; Dunnill, G S; Eady, R A; Rodeck, C H; Christiano, A M; Uitto, J

    1995-09-01

    Mutations in the three genes (LAMA3, LAMB3, and LAMC2) that encode the three chains (alpha 3, beta 3, and gamma 2, respectively) of laminin 5, a protein involved in epidermal-dermal adhesion, have been established as the genetic basis for the inherited blistering skin disorder, Herlitz junctional epidermolysis bullosa (H-JEB). In this study, we performed mutational analysis on genomic DNA from a child with H-JEB and identified a nonsense mutation in the alpha 3 chain gene (LAMA3) consisting of a homozygous C-to-T transition resulting in a premature termination codon (CGA-->TGA) on both alleles. The parents were shown to be heterozygous carriers of the same mutation. Direct mutation analysis was used to perform DNA-based prenatal diagnosis from a chorionic villus biopsy at 10 weeks' gestation in a subsequent pregnancy. The fetus was predicted to be genotypically normal with respect to the LAMA3 mutation. PMID:8530087

  20. beta. amyloid gene duplication in Alzheimer's disease and karyotypically normal Down syndrome

    SciTech Connect

    Delabar, J.; Goldgaber, D.; Lamour, Y.; Nicole, A.; Huret, J.; De Groucy, J.; Brown, P.; Gajdusek, D.C.; Sinet, P.

    1987-03-13

    With the recently cloned complementary DNA probe, lambdaAm4 for the chromosome 21 gene encoding brain amyloid polypeptide (..beta.. amyloid protein) of Alzheimer's disease, leukocyte DNA from three patients with sporadic Alzheimer's disease and two patients with karyotypically normal Down syndrome was found to contain three copies of this bene. Because a small region of chromosome 21 containing the ets-2 gene is duplicated in patients with Alzheimer's disease, as well as in karyotypically normal Down syndrome, duplication of a subsection of the critical segment of chromosome 21 that is duplicated in Down syndrome may be the genetic defect in Alzeimer's disease.

  1. Targets for dioxin: Genes for plasminogen activator inhibitor-2 and interleukin-1. beta

    SciTech Connect

    Sutter, T.R.; Guzman, K.; Dold, K.M. ); Greenlee, W.F. )

    1991-10-18

    Dioxin (2,3,7,8-tetrachlorodibenzo-p-dioxin, TCDD), a widespread environmental contaminant, may elicit its effects by altering gene expression in susceptible cells. Five TCDD-responsive complementary DNA clones were isolated from a human keratinocyte cell line. One of these clones encodes plasminogen activator inhibitor-2, a factor that influences growth and differentiation by regulating proteolysis of the extracellular matrix. Another encodes the cytokine interleukin-1{beta}. Thus, TCDD alters the expression of growth regulator genes and has effects similar to those of other tumor-promoting agents that affect both inflammation and differentiation.

  2. Thyrotropin releasing hormone (TRH) affects gene expression in pancreatic beta-cells.

    PubMed

    Luo, LuGuang; Yano, Naohiro

    2005-01-01

    Thyrotropin-releasing hormone (TRH), originally identified as a hypothalamic hormone, is expressed in the pancreas. The peptide has been shown to control glycemia, although the role of TRH in the pancreas has not yet been clarified. In quiescent INS-1 cells (rat immortalized beta-cell line), 200 nM of TRH for 24 hours significantly increased insulin levels in the culture medium and in cell extracts. In studies with gene array technology where about 60% to 75% of the 1081 genes were detected, TRH significantly stimulated multiple groups of gene expressions, including G-protein-coupled receptor and related signaling, such as insulin secretion, endoplasmic reticulum traffic mechanisms, cell-cycle regulators, protein turnover factors, DNA recombination, and growth factors. Noticeably, TRH suppressed the genes of proapoptotic Bcl-2-associated protein X, Bcl-xL/ Bcl-2-associated death promoter, and Fas. The multiple gene expressions in response to TRH in pancreatic cells suggest that the changed microenvironment brought about by TRH may influence beta-cellfunction. PMID:16392621

  3. Sickle cell disorder, beta-globin gene cluster haplotypes and alpha-thalassemia in neonates and adults from Guadeloupe.

    PubMed

    Kéclard, L; Romana, M; Lavocat, E; Saint-Martin, C; Berchel, C; Mérault, G

    1997-05-01

    We have studied haplotype of beta(S) chromosome and alpha-globin gene status in 534 patients (255 adults and 279 children of whom 159 neonates) from Guadeloupe with various sickle cell-related conditions, namely SS (n = 298), SC (n = 170), S-beta-thal (n = 56), and other rare forms (n = 10). Haplotype data on beta(S) chromosomes confirm our previous observation that Benin type is the most prevalent (75%) beta(S) chromosome in Guadeloupe, in disagreement with the historical records. Comparison of the frequency of distribution of various beta(S) haplotypes between neonates and adults on the one hand and between SS and SC cases on the other shows that the current beta(S) haplotype distribution in this island is not distorted by haplotype-related differential survival. We also show that the frequency of alpha-thalassemia (-3.7 kb) in Guadeloupe is one of the highest recorded in this region involved in Atlantic slave trade and also failed to reveal any age-dependent increase in frequency. We conclude that the African component of Guadeloupe is distinct from that of Brazil and Cuba but is close to that of Jamaica. PMID:9136913

  4. Identification of cellular target genes of the Epstein-Barr virus transactivator Zta: activation of transforming growth factor beta igh3 (TGF-beta igh3) and TGF-beta 1.

    PubMed Central

    Cayrol, C; Flemington, E K

    1995-01-01

    The lytic switch transactivator Zta initiates the ordered cascade of Epstein-Barr virus gene expression that culminates in virus production. Zta is a sequence-specific DNA-binding protein that transactivates early viral promotes via cis-acting sequences. Activation of some of these genes is mediated through binding to consensus AP-1 promoter elements. This observation suggests that Zta may also regulate the expression of cellular genes. While many targets of Zta have been identified in the Epstein-Barr virus genome, putative host cell targets remain largely unknown. To address this issue, a tetracycline-regulated Zta expression system was generated, and differential hybridization screening was used to isolate Zta-responsive cellular genes. The major target identified by this analysis is a gene encoding a fasciclin-like secreted factor, transforming growth factor beta igh3 (TGF-beta igh3), that was originally identified as a gene that is responsive to the potent immunosuppressor TGF-beta 1. Northern (RNA) blot analysis demonstrated that induction of Zta expression results in a 10-fold increase in TGF-beta igh3 mRNA levels. Zta was also found to increase TGF-beta 1 mRNA levels as well as the amount of active TGF-beta 1 secreted into the medium. Interestingly, alpha 1-collagen IV, which has been shown to potentiate the effects of TGF-beta 1, is also a cellular target of Zta. These results suggest that Zta could play a role in modulating the host cell environment through activating the expression of secreted factors. PMID:7769680

  5. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta-lactamase genes.

    PubMed Central

    Bauernfeind, A; Stemplinger, I; Jungwirth, R; Wilhelm, R; Chong, Y

    1996-01-01

    A plasmidic beta-lactamase which hydrolyzed cephamycins was first detected and reported in 1989. At that time its description was restricted to phenotypic characteristics. We analyzed nucleotide sequence of its gene and explored it genetic relationship with other bla genes. The deduced amino acid sequence of the blaCMY-1 product was compared with those of other known plasmidic cephamycinases and of chromosomal AmpC beta-lactamases. The results indicate that the relationship of CMY-1 is closest to MOX-1 among the plasmidic cephamycinases and to AmpC of Pseudomonas aeruginosa among the chromosomal cephalosporinases. We conclude that the plasmidic cephamycinases described up to now may be classified into three families, as follows: CMY-1, MOX-1, and FOX-1 with AmpC of P. aeruginosa; CMY-2, BIL-1 and LAT-1 with AmpC of Citrobacter freundii; and MIR-1 with AmpC of Enterobacter cloacae. Plasmidic cephamycinases are now recognized as clinically relevant class C beta-lactamases. PMID:8843306

  6. Polymorphic variation in the 11beta-hydroxylase gene associates with reduced 11-hydroxylase efficiency.

    PubMed

    Barr, Marianne; MacKenzie, Scott M; Friel, Elaine C; Holloway, Christine D; Wilkinson, Donna M; Brain, Nick J R; Ingram, Mary C; Fraser, Robert; Brown, Morris; Samani, Nilesh J; Caulfield, Mark; Munroe, Patricia B; Farrall, Martin; Webster, John; Clayton, David; Dominiczak, Anna F; Connell, John M C; Davies, Eleanor

    2007-01-01

    The -344 C/T and intron 2 conversion variants in the CYP11B2 gene, encoding aldosterone synthase, have been associated with markers of impaired 11beta-hydroxylase activity. We hypothesize that this association is because of variations in the adjacent 11beta-hydroxylase gene (CYP11B1) and arises through linkage disequilibrium between CYP11B1 and CYP11B2. The pattern of variation across the entire CYP11B locus was determined by sequencing 26 normotensive subjects stratified by and homozygous for the -344 and intron conversion variants. Eighty-three variants associated with -344 and intron conversion were identified. Haplotype analysis revealed 4 common haplotypes, accounting for 68% of chromosomes, confirming strong linkage disequilibrium across the region. Two novel CYP11B1 polymorphisms upstream of the coding region (-1889 G/T and -1859 A/G) were identified as contributing to the common haplotypes. Given the potential for such mutations to affect transcriptional regulation of CYP11B1, these were analyzed further. A total of 512 hypertensive subjects from the British Genetics of Hypertension Study population were genotyped for these polymorphisms. A significant association was identified between the -1889 polymorphism and urinary tetrahydrodeoxycortisol/total cortisol metabolite ratio, indicating reduced 11beta-hydroxylase efficiency. A similar pattern was observed for the -1859 polymorphism, but this did not achieve statistical significance. Functional studies in vitro using luciferase reporter gene constructs show that these polymorphisms significantly alter the transcriptional response of CYP11B1 to stimulation by adrenocorticotropic hormone or forskolin. This study strongly suggests that the impaired 11beta-hydroxylase efficiency associated previously with the CYP11B2 -344 and intron conversion variants is because of linkage with these newly identified polymorphisms in CYP11B1. PMID:17075029

  7. Effects of different activity and inactivity paradigms on myosin heavy chain gene expression in striated muscle

    NASA Technical Reports Server (NTRS)

    Baldwin, K. M.; Haddad, F.

    2001-01-01

    The goal of this mini-review is to summarize findings concerning the role that different models of muscular activity and inactivity play in altering gene expression of the myosin heavy chain (MHC) family of motor proteins in mammalian cardiac and skeletal muscle. This was done in the context of examining parallel findings concerning the role that thyroid hormone (T(3), 3,5,3'-triiodothyronine) plays in MHC expression. Findings show that both cardiac and skeletal muscles of experimental animals are initially undifferentiated at birth and then undergo a marked level of growth and differentiation in attaining the adult MHC phenotype in a T(3)/activity level-dependent fashion. Cardiac MHC expression in small mammals is highly sensitive to thyroid deficiency, diabetes, energy deprivation, and hypertension; each of these interventions induces upregulation of the beta-MHC isoform, which functions to economize circulatory function in the face of altered energy demand. In skeletal muscle, hyperthyroidism, as well as interventions that unload or reduce the weight-bearing activity of the muscle, causes slow to fast MHC conversions. Fast to slow conversions, however, are seen under hypothyroidism or when the muscles either become chronically overloaded or subjected to intermittent loading as occurs during resistance training and endurance exercise. The regulation of MHC gene expression by T(3) or mechanical stimuli appears to be strongly regulated by transcriptional events, based on recent findings on transgenic models and animals transfected with promoter-reporter constructs. However, the mechanisms by which T(3) and mechanical stimuli exert their control on transcriptional processes appear to be different. Additional findings show that individual skeletal muscle fibers have the genetic machinery to express simultaneously all of the adult MHCs, e.g., slow type I and fast IIa, IIx, and IIb, in unique combinations under certain experimental conditions. This degree of

  8. Molecular Characterization and Expression Analysis of Adrenergic Receptor Beta 2 (ADRB2) Gene before and after Exercise in the Horse

    PubMed Central

    Cho, Hyun-Woo; Shin, Sangsu; Song, Ki-Duk; Park, Jeong-Woong; Choi, Jae-Young; Lee, Hak-Kyo; Cho, Byung-Wook

    2015-01-01

    The adrenergic receptor beta 2 (ADRB2) plays a role in various physiological responses of the muscle to exercise, such as contraction and relaxation. Given its important role in muscle function, we investigated the structure of the horse ADRB2 gene and its expression pattern after exercise to determine if it can serve as a putative biomarker for recovery. Evolutionary analyses using synonymous and non-synonymous mutation ratios, were compared with other species (human, chimpanzee, mouse, rat, cow, pig, chicken, dog, and cat), and revealed the occurrence of positive selection in the horse ADRB2 gene. In addition, expression analyses by quantitative polymerase chain reaction exhibited ubiquitous distribution of horse ADRB2 in various tissues including lung, skeletal muscle, kidney, thyroid, appendix, colon, spinal cord and heart, with the highest expression observed in the lung. The expression of ADRB2 in skeletal muscle was significantly up-regulated about four folds 30 minutes post-exercise compared to pre-exercise. The expression level of ADRB2 in leukocytes, which could be collected with convenience compared with other tissues in horse, increased until 60 min after exercise but decreased afterward until 120 min, suggesting the ADRB2 expression levels in leukocytes could be a useful biomarker to check the early recovery status of horse after exercise. In conclusion, we identified horse ADRB2 gene and analyzed expression profiles in various tissues. Additionally, analysis of ADBR2 gene expression in leukocytes could be a useful biomarker useful for evaluation of early recovery status after exercise in racing horses. PMID:25924960

  9. Molecular Characterization and Expression Analysis of Adrenergic Receptor Beta 2 (ADRB2) Gene before and after Exercise in the Horse.

    PubMed

    Cho, Hyun-Woo; Shin, Sangsu; Song, Ki-Duk; Park, Jeong-Woong; Choi, Jae-Young; Lee, Hak-Kyo; Cho, Byung-Wook

    2015-05-01

    The adrenergic receptor beta 2 (ADRB2) plays a role in various physiological responses of the muscle to exercise, such as contraction and relaxation. Given its important role in muscle function, we investigated the structure of the horse ADRB2 gene and its expression pattern after exercise to determine if it can serve as a putative biomarker for recovery. Evolutionary analyses using synonymous and non-synonymous mutation ratios, were compared with other species (human, chimpanzee, mouse, rat, cow, pig, chicken, dog, and cat), and revealed the occurrence of positive selection in the horse ADRB2 gene. In addition, expression analyses by quantitative polymerase chain reaction exhibited ubiquitous distribution of horse ADRB2 in various tissues including lung, skeletal muscle, kidney, thyroid, appendix, colon, spinal cord and heart, with the highest expression observed in the lung. The expression of ADRB2 in skeletal muscle was significantly up-regulated about four folds 30 minutes post-exercise compared to pre-exercise. The expression level of ADRB2 in leukocytes, which could be collected with convenience compared with other tissues in horse, increased until 60 min after exercise but decreased afterward until 120 min, suggesting the ADRB2 expression levels in leukocytes could be a useful biomarker to check the early recovery status of horse after exercise. In conclusion, we identified horse ADRB2 gene and analyzed expression profiles in various tissues. Additionally, analysis of ADBR2 gene expression in leukocytes could be a useful biomarker useful for evaluation of early recovery status after exercise in racing horses. PMID:25924960

  10. [The association between beta-adrenergic receptor gene polymorphisms and personality traits].

    PubMed

    Numajiri, Maki; Aoki, Jun; Nishizawa, Daisuke; Kasai, Shinya; Ogai, Yasukazu; Ikeda, Kazutaka; Iwahashi, Kazuhiko

    2012-08-01

    The relationship between the polymorphisms (SNPs) of the beta-adrenergic receptor (beta-AR) gene and personality assessed by TCI (Temperament and Character Inventory), was studied among 192 healthy Japanese subjects (121 male subjects and 71 female subjects). In this study, the statistical analyses were performed overall and separately for each sex. As a result, it was shown that there were significant relationships between SD (self-directedness) and 49Ser/Gly (rs1801252) in ADRB1, P (persistence) and 389Arg/Gly (rs1801253) in ADRB1, and ST (self-transcendence) and 27Gln/Glu (rs1042714) in ADRB2 overall. Among the male subjects, there were further significant relationships between ST and 49Ser/Gly in ADRB1, NS (novelty-seeking), HA (harm avoidance) and P and 389Arg/Gly in ADRB1, and P and 64Arg/Trp(rsrs4994) in ADRB3. Among the female subjects, there were also significant relationships between SD and 49Ser/Gly in ADRB1, and C (cooperativeness) and 389Arg/Gly in ADRB1. Thus it was shown that there were correlations between beta-AR gene polymorphisms and several subscales of TCI. PMID:23012891

  11. Ocular gene transfer of active TGF-beta induces changes in anterior segment morphology and elevated IOP in rats.

    PubMed

    Robertson, Jennifer V; Golesic, Elizabeth; Gauldie, Jack; West-Mays, Judith A

    2010-01-01

    Purpose. Transforming growth factor beta (TGF-beta) is known to play a crucial role in wound healing and fibrotic tissue remodeling. A large body of evidence suggests a role for this cytokine in the pathogenesis of glaucoma; however, the mechanisms by which it affects anterior segment morphology are not well understood. Therefore, the purpose of this study was to examine the effects of TGF-beta overexpression on anterior segment morphology and subsequent effects on intraocular pressure. Methods. Adenoviral gene transfer was used to deliver active TGF-beta1 to the rat eye. Measurements of intraocular pressure were taken with a tonometer on days 0, 14, 21, and 29. Histologic analysis was undertaken to examine anterior segment morphology, and markers of matrix deposition and fibrosis were used. Results. Gene transfer of TGF-beta in the anterior segment resulted in the formation of peripheral anterior synechiae (PAS), which consisted of a fibroproliferative region of corneal endothelial cells, matrix accumulation, and decrease in trabecular meshwork expression of alpha-smooth muscle actin. These features were accompanied by ocular hypertension. Conclusions. Gene transfer of TGF-beta into the anterior segment induces aberrant PAS associated with the transition of corneal endothelial cells and subsequent matrix deposition. These features are highly reminiscent of human iridocorneal endothelial (ICE) syndrome. Gene transfer of TGF-beta can, therefore, be used to induce anatomic changes in the anterior segment in a rodent model that result in ocular hypertension. PMID:19696167

  12. Immunoglobulin kappa light chain variable region gene complex organization and immunoglobulin genes encoding anti-DNA autoantibodies in lupus mice.

    PubMed Central

    Kofler, R; Strohal, R; Balderas, R S; Johnson, M E; Noonan, D J; Duchosal, M A; Dixon, F J; Theofilopoulos, A N

    1988-01-01

    We have investigated the genetic origin of autoantibody production in several strains of mice that spontaneously develop a systemic lupus erythematosus-like disease. Restriction fragment length polymorphism analyses of gene loci encoding kappa light chain variable regions (Igk-V) demonstrated, as shown previously for the Ig heavy chain locus, that autoantibody production and disease occur in different Igk-V haplotypes. Moreover, autoimmune mice with known genetic derivation inherited their Igk-V loci essentially unaltered from their nonautoimmune ancestors. New Zealand black lupus mice, with unknown genetic derivation, had a possibly recombinant Igk-V haplotype, composed of V kappa loci that were primarily indistinguishable from those of nonautoimmune strains from either of the two potential donor haplotypes. The heavy and light chain gene segments (variable, diversity, joining) encoding anti-DNA antibodies were diverse and often closely related, or even identical, to those found in antibodies to foreign antigens in normal mice. Only 1 of 11 sequenced variable region genes could not be assigned to existing variable region gene families; however, corresponding germline genes were present in the genome of normal mice as well. These data argue against abnormalities in the genes and mechanisms generating antibody diversity in lupus mice and suggest a remarkable genetic and structural diversity in the generation of anti-DNA binding sites. Images PMID:3138286

  13. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  14. A Putatively Functional Haplotype in the Gene Encoding Transforming Growth Factor Beta-1 as a Potential Biomarker for Radiosensitivity

    SciTech Connect

    Schirmer, Markus A.; Brockmoeller, Juergen; Rave-Fraenk, Margret; Virsik, Patricia; Wilken, Barbara; Kuehnle, Elna; Campean, Radu; Hoffmann, Arne O.; Mueller, Katarina; Goetze, Robert G.; Neumann, Michael; Janke, Joerg H.; Nasser, Fatima; Wolff, Hendrik A.; Ghadimi, B. Michael; Schmidberger, Heinz; Hess, Clemens F.; Christiansen, Hans; Hille, Andrea

    2011-03-01

    Purpose: To determine whether genetic variability in TGFB1 is related to circulating transforming growth factor-{beta}1 (TGF-{beta}1) plasma concentrations after radiotherapy and to radiosensitivity of lymphoid cells. Patients and Methods: Transforming growth factor-{beta}1 plasma concentrations (n = 79) were measured in patients 1 year after radiotherapy and chromosomal aberrations (n = 71) ex vivo before therapy start. Furthermore, TGF-{beta}1 secretion and apoptosis were measured in isolated peripheral blood mononuclear cells of 55 healthy volunteers. These phenotypes were analyzed in relation to five germline polymorphisms in the 5' region of the TGFB1 gene. Because of high linkage disequilibrium, these five polymorphisms reflect frequent genetic variation in this region. A presumed impact of TGF-{beta}1 on DNA damage or repair was measured as micronucleus formation in 30 lymphoblastoid cell lines. Results: We identified a hypofunctional genetic haplotype termed H3 tagging the 5' region of the TGFB1 gene encoding TGF-{beta}1. H3 was associated with lower TGF-{beta}1 plasma concentrations in patients (p = 0.01) and reduced TGF-{beta}1 secretion in irradiated peripheral blood mononuclear cells (p = 0.003). Furthermore, cells with H3 were less prone to induction of chromosomal aberrations (p = 0.001) and apoptosis (p = 0.003) by irradiation. The hypothesis that high TGF-{beta}1 could sensitize cells to DNA damage was further supported by increased micronuclei formation in 30 lymphoblastoid cell lines when preincubated with TGF-{beta}1 before irradiation (p = 0.04). Conclusions: On the basis of TGF-{beta}1 plasma levels and radiation sensitivity of lymphoid cells, this study revealed a putatively hypofunctional TGFB1 haplotype. The significance of this haplotype and the suggested link between TGF-{beta}1 function and DNA integrity should be further explored in other cell types, as well as other experimental and clinical conditions.

  15. Assignment of human {alpha}-synuclein (SNCA) and {beta}-synuclein (SNCB) genes to chromosomes 4q21 and 5q35

    SciTech Connect

    Spillantini, M.G.; Goedert, M.; Divane, A.

    1995-05-20

    The authors previously identified two human brain proteins of 140 and 134 amino acids by virtue of their reactivity with a monoclonal antibody raised against a tangle preparation from Alzheimer disease brain. The 140-amino-acid protein is homologous to synuclein from Torpedo electroplaques and rat brain and identical to the precursor of the non-A{beta} component of Alzheimer disease amyloid plaques. The 134-amino-acid protein is homologous to bovine phosphoneuroprotein 14. In view fo the fact that both proteins are 61% identical in sequence, they have called them {alpha}-synuclein and {beta}-synuclein, respectively. Both proteins are present in nerve terminals, where they may be involved in the events mediating exocytosis of synaptic vesicles following nerve stimulation. They have now determined the chromosomal localizations of the {alpha}-synuclein and {beta}-synuclein genes. To map the two genes analyzed a panel of monochromosomal human-rodent somatic cell hybride by polymerase chain reaction and performed fluorescence in situ hybridization on metaphase spreads f human chromosomes.

  16. Cap disease due to mutation of the beta-tropomyosin gene (TPM2).

    PubMed

    Clarke, Nigel F; Domazetovska, Ana; Waddell, Leigh; Kornberg, Andrew; McLean, Catriona; North, Kathryn N

    2009-05-01

    Cap disease or cap myopathy is a form of congenital myopathy in which peripheral, well-demarcated 'caps' of disorganised thin filaments are seen in muscle fibres. Mutation of the TPM2 gene, that encodes beta-tropomyosin, is the first reported genetic cause. In this paper, we describe a further case of cap disease due to a mutation in TPM2, confirming the importance of this genetic association. This is the first report of cardiac dysfunction due to a mutation in TPM2. Our patient has an identical TPM2 mutation to the first genetically diagnosed cap disease patient, a denovo heterozygous three base pair deletion that removes glutamic acid 139 from the centre of beta-tropomyosin (p.E139del). 2D-gel electrophoresis studies show that the shortened mutant protein incorporates into sarcomeric structures, where it likely imposes a dominant-negative effect to cause muscle weakness. PMID:19345583

  17. A pseudodeficiency allele (D152N) of the human {beta}-glucuronidase gene

    SciTech Connect

    Vervoort, R.; Liebaers, I.; Lissens, W.

    1995-10-01

    We present evidence that a 480G{r_arrow}A transition in the coding region of the {Beta}glucuronidase gene, which results in an aspartic-acid-to-asparagine substitution at amino acid position 152 (D152N), produces a pseudodeficiency allele (GUSBp) that leads to greatly reduced levels of {Beta}-glucuronidase activity without apparent deleterious consequences. The 48OG{r_arrow}A mutation was found initially in the pseudodeficient mother of a child with mucopolysaccharidosis VII (MPSVII), but it was not on her disease-causing allele, which carried the L176F mutation. The 480G{r_arrow}A change was also present in an unrelated individual with another MPSVII allele who had unusually low {Beta}-glucuronidase activity, but whose clinical symptoms were probably unrelated to {Beta}-glucuronidase deficiency. This individual also had an R357X mutation, probably on his second allele. We screened 100 unrelated normal individuals for the 480G{r_arrow}A mutation with a PCR method and detected one carrier. Reduced {Beta}-glucuronidase activity following transfection of COS cells with the D152N cDNA supported the causal relationship between the D152N allele and pseudodeficiency. The mutation reduced the fraction of expressed enzyme that was secreted. Pulse-chase experiments indicated that the reduced activity in COS cells was due to accelerated intracellular turnover of the D152N enzyme. They also suggested that a potential glycosylation site created by the mutation is utilized in {approximately}50% of the enzyme expressed. 25 refs., 3 figs., 3 tabs.

  18. Quantitative study of effects of free cationic chains on gene transfection in different intracellular stages.

    PubMed

    Cai, Jinge; Yue, Yanan; Wang, Yanjing; Jin, Zhenyu; Jin, Fan; Wu, Chi

    2016-09-28

    Previously, we revealed that in the application of using cationic polymer chains, polyethylenimine (PEI), to condense anionic plasmid DNA chains (pDNA) to form the DNA/polymer polyplexes, after all the pDNAs are complexed with PEI, further added PEIs exist individual chains and free in the solution mixture. It is those uncomplexed polycation chains that dramatically promote the gene transfection. In the current study, we studied how those free cationic chains with different lengths and topologies affect the intracellular trafficking of the polyplexes, the translocation of pDNA through the nuclear membrane, the transcription of pDNA to mRNA and the translocation of mRNA from nucleus to cytosol in HepG2 cells by using a combination of the three-dimensional confocal microscope and TaqMan real-time PCR. We found that free branched PEI chains with a molar mass of 25,000g/mol and a total concentration of 1.8×10(-6)g/mL promote the overall gene transfection efficiency by a factor of ~500 times. Our results quantitatively reveal that free chains help little in the cellular uptake, but clearly reduce the lysosomal entrapment of those internalized polyplexes (2-3 folds); assist the translocation of pDNA through nuclear membrane after it is released from the polyplexes in the cytosol (~5 folds); enhance the pDNA-to-mRNA transcription efficiency (~4 folds); and facilitate the nucleus-to-cytosol translocation of mRNA (7-8 folds). The total enhancement of those steps agrees well with the overall efficiency, demonstrating, for the first time, how free cationic polymer chains quantitatively promote the gene transfection in each step in the intracellular space. PMID:27448443

  19. A second gene for cerulean cataracts maps to the {beta} crystallin region on chromosome 22

    SciTech Connect

    Kramer, P.; Yount, J.; Lovrien, E.

    1996-08-01

    Cogenital cataracts are one of the most common major eye abnormalities and often lead to blindness in infants. At least a third of all cases are familial. Within this group, highly penetrant, autosomal dominant forms of congenital cataracts (ADCC) are most common. ADCC is a genetically heterogeneous group of disorders, in which at least eight different loci have been identified for nine clinically distinct forms. Among these, Armitage et al. mapped a gene for cerulean blue cataracts to chromosome 17q24. Bodker et al. described a large family with cerulean blue cataracts, in which the affected daughter of affected first cousins was presumed to be homozygous for the purported gene. We report linkage in this family to the region on chromosome 22q that includes two {beta} crystallin genes (CRYBB2, CRYBB3) and one pseudogene (CRYBB2P1). The affected female in question is homozygous at all markers. 25 refs., 1 fig., 1 tab.

  20. Thyroid hormone resistance: a novel mutation in thyroid hormone receptor beta (THRB) gene - case report.

    PubMed

    Işık, Emregül; Beck Peccoz, Paolo; Campi, Irene; Özön, Alev; Alikaşifoğlu, Ayfer; Gönç, Nazlı; Kandemir, Nurgün

    2013-01-01

    Thyroid hormone resistance (THR) is a dominantly inherited syndrome characterized by reduced sensitivity to thyroid hormones. It is usually caused by mutations in the thyroid hormone receptor beta (THRB) gene. In the present report, we describe the clinical and laboratory characteristics and genetic analysis of patients with a novel THRB gene mutation. The index patient had been misdiagnosed as hyperthyroidism and treated with antithyroid drugs since eight days of age. Thyroid hormone results showed that thyrotropin (thyroid-stimulating hormone, TSH) was never suppressed despite elevated thyroid hormone levels, and there was no symptom suggesting hyperthyroidism. A heterozygous mutation at codon 350 located in exon 9 of the THRB gene was detected in all the affected members of the family. It is important to consider thyroid hormone levels in association with TSH levels to prevent inappropriate treatment and the potential complications, such as clinical hypothyroidism or an increase in goiter size. PMID:24217081

  1. Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 Genes Among Clinical Pseudomonas aeruginosa Species Isolated in Zahedan, Iran

    PubMed Central

    Ghamgosha, Mehdi; Shahrekizahedani, Shahram; Kafilzadeh, Farshid; Bameri, Zakaria; Taheri, Ramezan Ali; Farnoosh, Gholamreza

    2015-01-01

    Background: One of the major clinical problems regarding Pseudomonas aeruginosa is attributed to metallo-beta-lactamases (MBL). This group of enzymes is a subset of beta lactamases which belong to group B of Ambler classification and cause hydrolysis of carbapenems. Based on epidemiological studies conducted worldwide, it is proved that prevalence of genes coding MBLs in P. aeruginosa species are different in various geographic zones and even in various hospitals. Therefore, according to the clinical importance of organisms generating MBLs, it is necessary to identify and control these bacteria in hospitals for therapeutic purposes. Objectives: The current study aimed to investigate the Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 genes among clinical P. aeruginosa species isolated in Zahedan, Iran. Materials and Methods: The current study investigated the presence of MBL through phenotypic and genotypic methods and also the pattern of antibiotic resistance in P. aeruginosa species isolated in hospitals. The Minimum Inhibitory Concentration (MIC) against imipeneme was measured for 191 P. aeruginosa species isolated from Zahedan hospitals after identification through biochemical methods and determination of the antibiotic resistance pattern. Strains with MIC > 4 µg/mL were studied by phenotypic and genotypic methods. Results: The rate of resistance against imipeneme was 5.7% and after carrying out the phenotypic experiments, nine species were identified as of MBL producer. Seven species were confirmed by Polymerase Chain Reaction (PCR) method. Gene VIM-1 was the predominant gene among the positive (antibiotic resistant) species. Conclusions: The study results showed that MBL genes were present in some of the species isolated from Zahedan hospitals. Regarding the importance of MBL producer bacteria in hospitals, quick identification and evaluation of these clinical species can be considered as an important and basic step for treatment and control of pseudomonad

  2. Two common single nucleotide polymorphisms in the gene encoding beta-carotene 15,15'-monoxygenase alter beta-carotene metabolism in female volunteers.

    PubMed

    Leung, W C; Hessel, S; Méplan, C; Flint, J; Oberhauser, V; Tourniaire, F; Hesketh, J E; von Lintig, J; Lietz, G

    2009-04-01

    The key enzyme responsible for beta-carotene conversion into retinal is beta-carotene 15,15'-monoxygenase (BCMO1). Since it has been reported that the conversion of beta-carotene into vitamin A is highly variable in up to 45% of healthy individuals, we hypothesized that genetic polymorphisms in the BCMO1 gene could contribute to the occurrence of the poor converter phenotype. Here we describe the screening of the total open reading frame of the BCMO1 coding region that led to the identification of two common nonsynonymous single nucleotide polymorphisms (R267S: rs12934922; A379V: rs7501331) with variant allele frequencies of 42 and 24%, respectively. In vitro biochemical characterization of the recombinant 267S + 379V double mutant revealed a reduced catalytic activity of BCMO1 by 57% (P<0.001). Assessment of the responsiveness to a pharmacological dose of beta-carotene in female volunteers confirmed that carriers of both the 379V and 267S + 379V variant alleles had a reduced ability to convert beta-carotene, as indicated through reduced retinyl palmitate:beta-carotene ratios in the triglyceride-rich lipoprotein fraction [-32% (P=0.005) and -69% (P=0.001), respectively] and increased fasting beta-carotene concentrations [+160% (P=0.025) and +240% (P=0.041), respectively]. Our data show that there is genetic variability in beta-carotene metabolism and may provide an explanation for the molecular basis of the poor converter phenotype within the population. PMID:19103647

  3. Generation of a high-titer retroviral vector capable of expressing high levels of the human beta-globin gene.

    PubMed Central

    Sadelain, M; Wang, C H; Antoniou, M; Grosveld, F; Mulligan, R C

    1995-01-01

    Retrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and sickle cell anemia), however, has been hampered by the inability to generate recombinant viruses able to efficiently and faithfully transmit the necessary sequences for appropriate gene expression. We have addressed this problem by carefully examining the interactions between retroviral and beta-globin gene sequences which affect vector transmission, stability, and expression. First, we examined the transmission properties of a large number of different recombinant proviral genomes which vary both in the precise nature of vector, beta-globin structural gene, and locus control region (LCR) core sequences incorporated and in the placement and orientation of those sequences. Through this analysis, we identified one specific vector, termed M beta 6L, which carries both the human beta-globin gene and core elements HS2, HS3, and HS4 from the LCR and faithfully transmits recombinant proviral sequences to cells with titers greater than 10(6) per ml. Populations of murine erythroleukemia (MEL) cells transduced by this virus expressed levels of human beta-globin transcript which, on a per gene copy basis, were 78% of the levels detected in an MEL-derived cell line, Hu11, which carries human chromosome 11, the site of the beta-globin locus. Analysis of individual transduced MEL cell clones, however, indicated that, while expression was detected in every clone tested (n = 17), the levels of human beta-globin treatment varied between 4% and 146% of the levels in Hu11. This clonal variation in expression levels suggests that small beta-globin LCR sequences may not provide for as strict chromosomal position-independent expression of beta-globin as previously suspected, at least in the context of

  4. Specific Silencing of the REST Target Genes in Insulin-Secreting Cells Uncovers Their Participation in Beta Cell Survival

    PubMed Central

    Gesina, Emilie; Caille, Dorothee; Gjinovci, Asllan; Waeber, Gerard; Meda, Paolo; Haefliger, Jacques-Antoine

    2012-01-01

    The absence of the transcriptional repressor RE-1 Silencing Transcription Factor (REST) in insulin-secreting beta cells is a major cue for the specific expression of a large number of genes. These REST target genes were largely ascribed to a function of neurotransmission in a neuronal context, whereas their role in pancreatic beta cells has been poorly explored. To identify their functional significance, we have generated transgenic mice expressing REST in beta cells (RIP-REST mice), and previously discovered that REST target genes are essential to insulin exocytosis. Herein we characterized a novel line of RIP-REST mice featuring diabetes. In diabetic RIP-REST mice, high levels of REST were associated with postnatal beta cell apoptosis, which resulted in gradual beta cell loss and sustained hyperglycemia in adults. Moreover, adenoviral REST transduction in INS-1E cells led to increased cell death under control conditions, and sensitized cells to death induced by cytokines. Screening for REST target genes identified several anti-apoptotic genes bearing the binding motif RE-1 that were downregulated upon REST expression in INS-1E cells, including Gjd2, Mapk8ip1, Irs2, Ptprn, and Cdk5r2. Decreased levels of Cdk5r2 in beta cells of RIP-REST mice further confirmed that it is controlled by REST, in vivo. Using siRNA-mediated knock-down in INS-1E cells, we showed that Cdk5r2 protects beta cells against cytokines and palmitate-induced apoptosis. Together, these data document that a set of REST target genes, including Cdk5r2, is important for beta cell survival. PMID:23029270

  5. Specific silencing of the REST target genes in insulin-secreting cells uncovers their participation in beta cell survival.

    PubMed

    Martin, David; Allagnat, Florent; Gesina, Emilie; Caille, Dorothee; Gjinovci, Asllan; Waeber, Gerard; Meda, Paolo; Haefliger, Jacques-Antoine

    2012-01-01

    The absence of the transcriptional repressor RE-1 Silencing Transcription Factor (REST) in insulin-secreting beta cells is a major cue for the specific expression of a large number of genes. These REST target genes were largely ascribed to a function of neurotransmission in a neuronal context, whereas their role in pancreatic beta cells has been poorly explored. To identify their functional significance, we have generated transgenic mice expressing REST in beta cells (RIP-REST mice), and previously discovered that REST target genes are essential to insulin exocytosis. Herein we characterized a novel line of RIP-REST mice featuring diabetes. In diabetic RIP-REST mice, high levels of REST were associated with postnatal beta cell apoptosis, which resulted in gradual beta cell loss and sustained hyperglycemia in adults. Moreover, adenoviral REST transduction in INS-1E cells led to increased cell death under control conditions, and sensitized cells to death induced by cytokines. Screening for REST target genes identified several anti-apoptotic genes bearing the binding motif RE-1 that were downregulated upon REST expression in INS-1E cells, including Gjd2, Mapk8ip1, Irs2, Ptprn, and Cdk5r2. Decreased levels of Cdk5r2 in beta cells of RIP-REST mice further confirmed that it is controlled by REST, in vivo. Using siRNA-mediated knock-down in INS-1E cells, we showed that Cdk5r2 protects beta cells against cytokines and palmitate-induced apoptosis. Together, these data document that a set of REST target genes, including Cdk5r2, is important for beta cell survival. PMID:23029270

  6. Glucocorticoids down-regulate beta 1-adrenergic-receptor expression by suppressing transcription of the receptor gene.

    PubMed Central

    Kiely, J; Hadcock, J R; Bahouth, S W; Malbon, C C

    1994-01-01

    The expression of beta 2-adrenergic receptors is up-regulated by glucocorticoids. In contrast, beta 1-adrenergic receptors display glucocorticoid-induced down-regulation. In rat C6 glioma cells, which express both of these subtypes of beta-adrenergic receptors, the synthetic glucocorticoid dexamethasone stimulates no change in the total beta-adrenergic receptor content, but rather shifts the beta 1:beta 2 ratio from 80:20 to 50:50. Radioligand binding and immunoblotting demonstrate a sharp decline in beta 1-adrenergic receptor expression. Metabolic labelling of cells with [35S]-methionine in tandem with immunoprecipitation by beta 1-adrenergic-receptor-specific antibodies reveals a sharp decline in the synthesis of the receptor within 48 h for cells challenged with glucocorticoid. Steady-state levels of beta 1-adrenergic-receptor mRNA declined from 0.47 to 0.26 amol/microgram of total cellular RNA within 2 h of dexamethasone challenge, as measured by DNA-excess solution hybridization. The stability of receptor mRNA was not influenced by glucocorticoid; the half-lives of the beta 1- and beta 2-subtype mRNAs were 1.7 and 1.5 h respectively. Nuclear run-on assays revealed the basis for the down-regulation of receptor expression, i.e. a sharp decline in the relative rate of transcription for the beta 1-adrenergic-receptor gene in nuclei from dexamethasone-treated as compared with vehicle-treated cells. These data demonstrate transcriptional suppression as a molecular explanation for glucocorticoid-induced down-regulation of beta 1-adrenergic receptors. Images Figure 1 Figure 2 Figure 6 PMID:8092990

  7. Quantitation of beta-thalassemia genes in Quebec immigrants of Mediterranean, southeast Asian, and Asian Indian origins.

    PubMed

    Kaplan, F; Kokotsis, G; Capua, A; Scriver, C R

    1991-08-01

    Beta-thalassemia minor occurs at 5% frequency (on average) in populations migrant (since 1945) from Mediterranean countries to the province of Quebec. Individuals of Southeast Asian/Chinese and Asian Indian origin now living in the province also carry beta-thalassemia genes at similar frequencies. We characterized beta-thalassemia genes on 68 chromosomes (19 patients and 30 carriers identified by screening) to describe heterogeneity of beta-thalassemia alleles and to evaluate desirability of DNA tests in carrier screening. Thirteen different mutations account for 74% of the 68 beta-thalassemia chromosomes: seven occur on Mediterranean chromosomes (IVS I,nt110, Non 39, IVS I,nt6, IVS I,nt1G----A, IVS II,nt1, Fr8, IVS II,nt745) another three on SE Asian chromosomes (Fr 41-42, IVS II,nt654, HbE) and yet another three on Asian Indian chromosomes (IVS I,nt5, 619 bp del, IVS I,nt1G----T). Twenty-six percent (18/68) of the chromosomes carried none of 17 alleles accounting for 92-96% of beta-thalassemia molecular pathology in reference populations. The Italian beta-thalassemia chromosomes in the Quebec sample least resembled those in the corresponding source population. Until the spectrum of mutations in Quebec populations is fully defined, phenotype assay remains the most reliable and efficient method for beta-thalassemia carrier screening. PMID:1782730

  8. Transfer of beta-amyloid precursor protein gene using adenovirus vector causes mitochondrial abnormalities in cultured normal human muscle.

    PubMed Central

    Askanas, V; McFerrin, J; Baqué, S; Alvarez, R B; Sarkozi, E; Engel, W K

    1996-01-01

    As in Alzheimer-disease (AD) brain, vacuolated muscle fibers of inclusion-body myositis (IBM) contain abnormally accumulated beta-amyloid precursor protein (beta APP), including its beta-amyloid protein epitope, and increased beta APP-751 mRNA. Other similarities between IBM muscle and AD brain phenotypes include paired helical filaments, hyperphosphorylated tau protein, apolipoprotein E, and mitochondrial abnormalities, including decreased cytochrome-c oxidase (COX) activity. The pathogenesis of these abnormalities in IBM muscle and AD brain is not known. We now report that direct transfer of the beta APP gene, using adenovirus vector, into cultured normal human muscle fibers causes structural abnormalities of mitochondria and decreased COX activity. In this adenovirus-mediated beta APP gene transfer, we demonstrated that beta APP overproduction can induce mitochondrial abnormalities. The data suggest that excessive beta APP may be responsible for mitochondrial and COX abnormalities in IBM muscle and perhaps AD brain. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8577761

  9. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

    PubMed

    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen

    2004-02-13

    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  10. Specific expression of a beta-tubulin gene (GhTub1) in developing cotton fibers.

    PubMed

    Li, Yuanli; Sun, Jie; Li, Chunhong; Zhu, Yongqing; Xia, Guixian

    2003-06-01

    A cDNA library was constructed using poly (A)(+) RNA isolated from -1-15 DPA fibers of upland cotton (Gossypium hirsutum). The cDNA encoding a beta-tubulin isoform (designated as GhTub1) was identified through EST search. Northern blot analysis using 3'-UTR of the cDNA as a gene-specific probe was performed to investigate the expression levels of GhTub1 in various organs and in the developing fibers. The results showed that GhTub1 gene was specifically expressed in cotton fiber cells. During fiber development, GhTub1 transcripts accumulated highly at the stage of cell rapid elongation with the highest expression appearing at the time when fiber expansion reaches the peak rate. To probe the in vivo function of GhTub1, its cDNA was cloned in the yeast expression vector pREP1 and transformed into the fission yeast Schizosaccharomyces pombe. Overexpression of GhTub1 in yeast cells caused severe changes in the cell morphology. These results suggest that GhTub1 may play a role in the polar elongation of cotton fibers. To our knowledge, this is the first report on the fiber-specific transcript accumulation of a cotton beta-tubulin gene. PMID:18763138

  11. Molecular cloning and analysis of zebrafish voltage-gated sodium channel beta subunit genes: implications for the evolution of electrical signaling in vertebrates

    PubMed Central

    Chopra, Sameer S; Watanabe, Hiroshi; Zhong, Tao P; Roden, Dan M

    2007-01-01

    Background Action potential generation in excitable cells such as myocytes and neurons critically depends on voltage-gated sodium channels. In mammals, sodium channels exist as macromolecular complexes that include a pore-forming alpha subunit and 1 or more modulatory beta subunits. Although alpha subunit genes have been cloned from diverse metazoans including flies, jellyfish, and humans, beta subunits have not previously been identified in any non-mammalian species. To gain further insight into the evolution of electrical signaling in vertebrates, we investigated beta subunit genes in the teleost Danio rerio (zebrafish). Results We identified and cloned single zebrafish gene homologs for beta1-beta3 (zbeta1-zbeta3) and duplicate genes for beta4 (zbeta4.1, zbeta4.2). Sodium channel beta subunit loci are similarly organized in fish and mammalian genomes. Unlike their mammalian counterparts, zbeta1 and zbeta2 subunit genes display extensive alternative splicing. Zebrafish beta subunit genes and their splice variants are differentially-expressed in excitable tissues, indicating tissue-specific regulation of zbeta1-4 expression and splicing. Co-expression of the genes encoding zbeta1 and the zebrafish sodium channel alpha subunit Nav1.5 in Chinese Hamster Ovary cells increased sodium current and altered channel gating, demonstrating functional interactions between zebrafish alpha and beta subunits. Analysis of the synteny and phylogeny of mammalian, teleost, amphibian, and avian beta subunit and related genes indicated that all extant vertebrate beta subunits are orthologous, that beta2/beta4 and beta1/beta3 share common ancestry, and that beta subunits are closely related to other proteins sharing the V-type immunoglobulin domain structure. Vertebrate sodium channel beta subunit genes were not identified in the genomes of invertebrate chordates and are unrelated to known subunits of the para sodium channel in Drosophila. Conclusion The identification of conserved

  12. Nkx6.1 controls a gene regulatory network required for establishing and maintaining pancreatic Beta cell identity.

    PubMed

    Schaffer, Ashleigh E; Taylor, Brandon L; Benthuysen, Jacqueline R; Liu, Jingxuan; Thorel, Fabrizio; Yuan, Weiping; Jiao, Yang; Kaestner, Klaus H; Herrera, Pedro L; Magnuson, Mark A; May, Catherine Lee; Sander, Maike

    2013-01-01

    All pancreatic endocrine cell types arise from a common endocrine precursor cell population, yet the molecular mechanisms that establish and maintain the unique gene expression programs of each endocrine cell lineage have remained largely elusive. Such knowledge would improve our ability to correctly program or reprogram cells to adopt specific endocrine fates. Here, we show that the transcription factor Nkx6.1 is both necessary and sufficient to specify insulin-producing beta cells. Heritable expression of Nkx6.1 in endocrine precursors of mice is sufficient to respecify non-beta endocrine precursors towards the beta cell lineage, while endocrine precursor- or beta cell-specific inactivation of Nkx6.1 converts beta cells to alternative endocrine lineages. Remaining insulin(+) cells in conditional Nkx6.1 mutants fail to express the beta cell transcription factors Pdx1 and MafA and ectopically express genes found in non-beta endocrine cells. By showing that Nkx6.1 binds to and represses the alpha cell determinant Arx, we identify Arx as a direct target of Nkx6.1. Moreover, we demonstrate that Nkx6.1 and the Arx activator Isl1 regulate Arx transcription antagonistically, thus establishing competition between Isl1 and Nkx6.1 as a critical mechanism for determining alpha versus beta cell identity. Our findings establish Nkx6.1 as a beta cell programming factor and demonstrate that repression of alternative lineage programs is a fundamental principle by which beta cells are specified and maintained. Given the lack of Nkx6.1 expression and aberrant activation of non-beta endocrine hormones in human embryonic stem cell (hESC)-derived insulin(+) cells, our study has significant implications for developing cell replacement therapies. PMID:23382704

  13. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E.; Desplanches, D.; Pequignot, J.; Bordier, B.; Desvergne, B. . E-mail: beatrice.desvergne@unil.ch

    2007-06-15

    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  14. Extraocular muscle is spared upon complete laminin alpha2 chain deficiency: comparative expression of laminin and integrin isoforms.

    PubMed

    Nyström, Alexander; Holmblad, Johanna; Pedrosa-Domellöf, Fatima; Sasaki, Takako; Durbeej, Madeleine

    2006-08-01

    Mutations in the gene encoding laminin (LM) alpha2 chain cause congenital muscular dystrophy. Here, we show that extraocular muscle (EOM) is spared upon complete LMalpha2 chain absence. The major LM chains in limb muscle basement membranes are alpha2, beta1, beta2 and gamma1 whereas alpha2, alpha4, beta1, beta2 and gamma1 chains are expressed in EOM. Expression of LMalpha4 chain mRNA is further increased in LMalpha2 chain deficient EOM. Mainly integrin alpha7X1 subunit, which binds to laminin-411, is expressed in EOM and in contrast to dystrophic limb muscle, sustained integrin alpha7B expression is seen in LMalpha2 chain deficient EOM. We propose that LMalpha4 chain, possibly by binding to integrin alpha7BX1beta1D, protects EOM in LMalpha2 chain deficient muscular dystrophy. PMID:16782317

  15. Stress Induced Expression of a Beta vulgaris L. Gene for a Chloroplast-Targeted Signal Calmodulin-Binding Protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In sugarbeet, Beta vulgaris L., Medicago truncatula Gaertn and Populus trichocarpa Torr & Gray, a cluster of orthologous genes includes NPR1, a disease resistance-controlling gene, CaMP, encoding a calmodulin-binding protein and CK1PK, determining a dual-specificity casein kinase 1-class protein kin...

  16. Coel is a LTR retrotransopson-like element, in Beta vulgaris L., and contains a Tnp2-domain transposase gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We describe herein the discovery of Coe1, a LTR retrotransposon-like element in Beta vulgaris, that carries a Tnp2-type transposase gene, Tbv1, and is flanked by the 8-mer sequence motif CACTATAA in or near inverted repeats. The Tbv1 transposase gene within Coe1 consists of eight exons, and the pre...

  17. Carbachol ameliorates lipopolysaccharide-induced intestinal epithelial tight junction damage by down-regulating NF-{kappa}{beta} and myosin light-chain kinase pathways

    SciTech Connect

    Zhang, Ying; Li, Jianguo

    2012-11-16

    Highlights: Black-Right-Pointing-Pointer Carbachol reduced the lipopolysaccharide-induced intestinal barrier breakdown. Black-Right-Pointing-Pointer Carbachol ameliorated the lipopolysaccharide-induced ileal tight junction damage. Black-Right-Pointing-Pointer Carbachol prevented the LPS-induced NF-{kappa}{beta} and myosin light-chain kinase activation. Black-Right-Pointing-Pointer Carbachol exerted its beneficial effects in an {alpha}7 nicotinic receptor-dependent manner. -- Abstract: Carbachol is a cholinergic agonist that protects the intestines after trauma or burn injury. The present study determines the beneficial effects of carbachol and the mechanisms by which it ameliorates the lipopolysaccharide (LPS)-induced intestinal barrier breakdown. Rats were injected intraperitoneally with 10 mg/kg LPS. Results showed that the gut barrier permeability was reduced, the ultrastructural disruption of tight junctions (TJs) was prevented, the redistribution of zonula occludens-1 and claudin-2 proteins was partially reversed, and the nuclear factor-kappa beta (NF-{kappa}{beta}) and myosin light-chain kinase (MLCK) activation in the intestinal epithelium were suppressed after carbachol administration in LPS-exposed rats. Pretreatment with the {alpha}7 nicotinic acetylcholine receptor ({alpha}7nAchR) antagonist {alpha}-bungarotoxin blocked the protective action of carbachol. These results suggested that carbachol treatment can protect LPS-induced intestinal barrier dysfunction. Carbachol exerts its beneficial effect on the amelioration of the TJ damage by inhibiting the NF-{kappa}{beta} and MLCK pathways in an {alpha}7nAchR-dependent manner.

  18. At5g50600 encodes a member of the short-chain dehydrogenase reductase superfamily with 11beta- and 17beta-hydroxysteroid dehydrogenase activities associated with Arabidopsis thaliana seed oil bodies.

    PubMed

    d'Andréa, S; Canonge, M; Beopoulos, A; Jolivet, P; Hartmann, M A; Miquel, M; Lepiniec, L; Chardot, T

    2007-02-01

    In a previous work, we presented evidence for the presence of a protein encoded by At5g50600 in oil bodies (OBs) from Arabidopsis thaliana [P. Jolivet, E. Roux, S. D'Andrea, M. Davanture, L. Negroni, M. Zivy, T. Chardot, Protein composition of oil bodies in Arabidopsis thaliana ecotype WS, Plant Physiol. Biochem. 42 (2004) 501-509]. Using specific antibodies and proteomic techniques, we presently confirm the existence of this protein, which is a member of the short-chain steroid dehydrogenase reductase superfamily. We have measured its activity toward various steroids (cholesterol, dehydroepiandrosterone, cortisol, corticosterone, estradiol, estrone) and NAD(P)(H), either within purified OBs or as a purified bacterially expressed chimera. Both enzymatic systems (OBs purified from A. thaliana seeds as well as the chimeric enzyme) exhibited hydroxysteroid dehydrogenase (HSD) activity toward estradiol (17beta-hydroxysteroid) with NAD+ or NADP+, NADP+ being the preferred cofactor. Low levels of activity were observed with cortisol or corticosterone (11beta-hydroxysteroids), but neither cholesterol nor DHEA (3beta-hydroxysteroids) were substrates, whatever the cofactor used. Similar activity profiles were found for both enzyme sources. Purified OBs were found to be also able to catalyze estrone reduction (17beta-ketosteroid reductase activity) with NADPH. The enzyme occurring in A. thaliana OBs can be classified as a NADP+-dependent 11beta-,17beta-hydroxysteroid dehydrogenase/17beta-ketosteroid reductase. This enzyme probably corresponds to AtHSD1, which is encoded by At5g50600. However, its physiological role and substrates still remain to be determined. PMID:17074428

  19. Developmental regulation of {beta}-hexosaminidase {alpha}- and {beta}-subunit gene expression in the rat reproductive system

    SciTech Connect

    Trasler, J.M.; Wakamatsu, N.; Gravel, R.A.; Benoit, G.

    1994-09-01

    {beta}-Hexosaminidase is an essential lysosomal enzyme whose absence in man results in a group of disorders, the G{sub M2} gangliosidoses. Enzyme activity for {beta}-hexosaminidase is many fold higher in the epididymis than in other tissues, is present in sperm and is postulated to be required for mammalian fertilization. To better understand how {beta}-hexosaminidase is regulated in the reproductive system, we quantitated the mRNA expression of the {alpha}- and {beta}-subunits (Hex {alpha} and Hex {beta}) of the enzyme in the developing rat testis and epididymis. Hex {alpha} mRNA was differentially expressed and abundant in adult rat testis and epididymis, 13- and 2-fold brain levels, respectively. In contrast, Hex {beta} mRNA levels in the testis and epididymis were .3- and 5-fold brain levels. Within the epididymis both Hex {alpha} and Hex {beta} mRNA concentrations were highest in the corpus, 1.5-fold and 9-fold initial segment values, respectively. During testis development from 7-91 days of age, testis levels of Hex {alpha} mRNA increased 10-fold and coincided with the appearance of spermatocytes and spermatids in the epithelium. In isolated male germ cells, Hex {alpha} expression was most abundant in haploid round spermatids. Hex {alpha} mRNA was undetectable after hypophysectomy and returned to normal after testosterone administration and the return of advanced germ cells to the testis. Hex {beta} mRNA was expressed at constant low levels throughout testis development. In the caput-corpus and cauda regions of the epididymis Hex {alpha} mRNA levels increased 2-fold between 14 and 91 days; during the same developmental period epididymal Hex {beta} mRNA levels increased dramatically, by 10-20 fold. In summary, Hex {alpha} and Hex {beta} mRNAs are differentially and developmentally expressed at high levels in the rat testis and epididymis and augur for an important role for {beta}-hexosaminidase in normal male reproductive function.

  20. Cloning of genes related to exo-beta-glucanase production in Saccharomyces cerevisiae: characterization of an exo-beta-glucanase structural gene.

    PubMed

    Nebreda, A R; Villa, T G; Villanueva, J R; del Rey, F

    1986-01-01

    The EXG1 gene of Saccharomyces cerevisiae was cloned and identified by complementation of a mutant strain (exg1-2) with highly reduced extracellular exo-beta-1,3-glucanase (EXG) activity. Two recombinant plasmids containing an overlapping region of 5.2 kb were isolated from a genomic DNA library and characterized by restriction mapping. The coding region was located by subcloning the original DNA inserts in a 2.7-kb HindIII-XhoI fragment. Exg+ strains and Exg- mutants transformed with yeast multicopy plasmids containing this DNA fragment showed an EXG activity 5- to 20-fold higher than for the untransformed Exg+ wild-type (wt) strains. The overproduced EXG had the same enzymic activity on different substrates, and showed the same electrophoretic behaviour on polyacrylamide gels and identical properties upon filtration through Sephacryl S-200 as those of the main EXG from Exg+ wt strains. The EXG1 gene transformed Schizosaccharomyces pombe, yielding extracellular EXG activity which showed cross-reactivity with anti-S. cervisiae EXG antibodies. A fragment including only a part of the EXG1 region was subcloned into the integrating vector YIp5, and the resulting plasmid was used to transform an Exg+ strain. Genetic and Southern analysis of several stable Exg- transformants showed that the fragment integrated by homology with the EXG1 locus. The chromosomal DNA fragment into which the plasmid integrated has a restriction pattern identical to that of the fragment on which we had previously identified the putative EXG1 gene. Only one copy of the EXG1 gene per genome was found in several strains tested by Southern analysis. Furthermore, two additional recombinant plasmids sharing a yeast DNA fragment of about 4.1 kb, which partially complements the exg1-2 mutation but which shows no homology with the 2.7-kb fragment containing the EXG1 gene, were also identified in this study. This 4.1-kb DNA fragment does not appear to contain an extragenic suppressor and could be related

  1. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in lethal (Herlitz) junctional epidermolysis bullosa.

    PubMed

    Kivirikko, S; McGrath, J A; Baudoin, C; Aberdam, D; Ciatti, S; Dunnill, M G; McMillan, J R; Eady, R A; Ortonne, J P; Meneguzzi, G

    1995-05-01

    The inherited mechanobullous disorder, junctional epidermolysis bullosa (JEB), is characterized by extensive blistering and erosions of the skin and mucous membranes. The diagnostic hallmarks of JEB include ultrastructural abnormalities in the hemidesmosomes of the cutaneous basement membrane zone, as well as an absence of staining with antibodies against the anchoring filament protein, laminin 5. Therefore, the three genes encoding alpha 3, beta 3 and gamma 2 chains of laminin 5, known as LAMA3, LAMB3 and LAMC2, are candidate genes for JEB. We have previously demonstrated mutations in the LAMB3 and LAMC2 genes in several families with JEB. We initiated mutation analysis from an affected child by PCR amplification of individual LAMA3 exons, followed by heteroduplex analysis. Nucleotide sequencing of heteroduplexes identified a homozygous nonsense mutation within domain I/II of the alpha 3 chain. These findings provide the first evidence that nonsense mutations within the LAMA3 gene are also involved in the pathogenesis of JEB, and indicate that mutations of all three genes of laminin 5 can result in the JEB phenotype. PMID:7633458

  2. CTNNB1 mutations and overexpression of Wnt/beta-catenin target genes in WT1-mutant Wilms' tumors.

    PubMed

    Li, Chi-Ming; Kim, Connie E; Margolin, Adam A; Guo, Meirong; Zhu, Jimmy; Mason, Jacqueline M; Hensle, Terrence W; Murty, Vundavalli V V S; Grundy, Paul E; Fearon, Eric R; D'Agati, Vivette; Licht, Jonathan D; Tycko, Benjamin

    2004-12-01

    Gain-of-function mutations in exon 3 of beta-catenin (CTNNB1) are specific for Wilms' tumors that have lost WT1, but 50% of WT1-mutant cases lack such "hot spot" mutations. To ask whether stabilization of beta-catenin might be essential after WT1 loss, and to identify downstream target genes, we compared expression profiles in WT1-mutant versus WT1 wild-type Wilms' tumors. Supervised and nonsupervised hierarchical clustering of the expression data separated these two classes of Wilms' tumor. The WT1-mutant tumors overexpressed genes encoding myogenic and other transcription factors (MOX2, LBX1, SIM2), signaling molecules (TGFB2, FST, BMP2A), extracellular Wnt inhibitors (WIF1, SFRP4), and known beta-catenin/TCF targets (FST, CSPG2, CMYC). Beta-Catenin/TCF target genes were overexpressed in the WT1-mutant tumors even in the absence of CTNNB1 exon 3 mutations, and complete sequencing revealed gain-of-function mutations elsewhere in the CTNNB1 gene in some of these tumors, increasing the overall mutation frequency to 75%. Lastly, we identified and validated a novel direct beta-catenin target gene, GAD1, among the WT1-mutant signature genes. These data highlight two molecular classes of Wilms' tumor, and indicate strong selection for stabilization of beta-catenin in the WT1-mutant class. Beta-Catenin stabilization can initiate tumorigenesis in other systems, and this mechanism is likely critical in tumor formation after loss of WT1. PMID:15579438

  3. Isolation, characterization, and expression of the gene encoding the beta subunit of the mitochondrial processing peptidase from Blastocladiella emersonii.

    PubMed

    Costa Rocha, C R; Lopes Gomes, S

    1998-08-01

    A 2.3-kb BamHI-KpnI fragment was isolated from a partial genomic library and shown by nucleotide sequence analysis to contain the entire coding region of the gene encoding the beta subunit of the Blastocladiella mitochondrial processing peptidase (beta-MPP). The predicted beta-MPP protein has 465 amino acids and a calculated molecular mass of 50.8 kDa. S1 nuclease protection assays revealed an intron, 209 bp in size, interrupting the coding region between the putative signal sequence and the mature protein. Northern blot analysis showed that beta-MPP mRNA levels decrease significantly during B. emersonii sporulation, reaching basal levels in the zoospore stage. The amount of beta-MPP protein, determined in Western blots, unlike its mRNA, does not vary significantly throughout the fungal life cycle. PMID:9683495

  4. Impact of melatonin and molecular clockwork components on the expression of thyrotropin beta-chain (Tshb) and the Tsh receptor in the mouse pars tuberalis.

    PubMed

    Unfried, Claudia; Ansari, Nariman; Yasuo, Shinobu; Korf, Horst-Werner; von Gall, Charlotte

    2009-10-01

    Photoperiodic regulation of reproduction in birds and mammals involves thyrotropin beta-chain (TSHb), which is secreted from the pars tuberalis (PT) and controls the expression of deiodinase type 2 and 3 in the ependymal cell layer of the infundibular recess (EC) via TSH receptors (TSHRs). To analyze the impact of melatonin and the molecular clockwork on the expression of Tshb and Tshr, we investigated melatonin-proficient C3H wild-type (WT), melatonin receptor 1-deficient (MT1-/-) or clockprotein PERIOD1-deficient (mPER1-/-) mice. Expression of Tshb and TSHb immunoreactivity in PT were low during day and high during the night in WT, high during the day and low during the night in mPER1-deficient, and equally high during the day and night in MT1-deficient mice. Melatonin injections into WT acutely suppressed Tshb expression. Transcription assays showed that the 5' upstream region of the Tshb gene could be controlled by clockproteins. Tshr levels in PT were low during the day and high during the night in WT and mPER1-deficient mice and equally low in MT1-deficient mice. Tshr expression in the EC did not show a day/night variation. Melatonin injections into WT acutely induced Tshr expression in PT but not in EC. TSH stimulation of hypothalamic slice cultures of WT induced phosphorylated cAMP response element-binding protein in PT and EC and deiodinase type 2 in the EC. Our data suggest that Tshb expression in PT is controlled by melatonin and the molecular clockwork and that melatonin activates Tshr expression in PT but not in EC. They also confirm the functional importance of TSHR in the PT and EC. PMID:19589858

  5. Exploring Functional Redundancy in the Immunoglobulin μ Heavy-Chain Gene Enhancer

    PubMed Central

    Dang, Wei; Nikolajczyk, Barbara S.; Sen, Ranjan

    1998-01-01

    Immunoglobulin (Ig) μ heavy-chain gene enhancer activity is mediated by multiple DNA binding proteins. Mutations of several protein binding sites in the enhancer do not affect enhancer activity significantly. This feature, termed redundancy, is thought to be due to functional compensation of the mutated sites by other elements within the enhancer. In this study, we identified the elements that make the basic helix-loop-helix (bHLH) protein binding sites, μE2 and μE3, redundant. The major compensatory element is a binding site for interferon regulatory factors (IRFs) and not one of several other bHLH protein binding sites. These studies also provide the first evidence for a role of IRF proteins in Ig heavy-chain gene expression. In addition, we reconstituted the activity of a monomeric μ enhancer in nonlymphoid cells and defined the domains of the ETS gene required for function. PMID:9774700

  6. Variant translocation of the bcl-2 gene to immunoglobulin. lambda. light chain gene in chronic lymphocytic leukemia

    SciTech Connect

    Adachi, M.; Cossman, J.; Longo, D.; Croce, C.M.; Tsujimoto, Y. )

    1989-04-01

    The bcl-2 gene has been identified as a gene directly involved in the consistent chromosome translocation t(14;18), which is found in {approx} 90% of human follicular lymphoma cases, and is a prime candidate for the oncogene playing a crucial role in follicular lymphomagenesis. In this paper, the authors describe a case of chronic lymphocytic leukemia showing the juxtaposition of the bcl-2 gene on chromosome 18 to immunoglobulin {lambda} light chain (Ig{lambda}) gene on chromosome 22 in a head-to-head configuration. Sequencing analysis of the joining site of the bcl-2 gene and Ig{lambda} gene has shown that the breakpoint is within the 5{prime} flanking region of the bcl-2 gene and about 2.2 kilobases 5{prime} to the joining segment of Ig{lambda} locus in a germ-line configuration. The extranucleotide, commonly appearing at the joining site of the t(14;18) translocation involving the IgH locus, is absent from the joining site of bcl-2 and Ig{lambda}. The lack of extranucleotide suggests that the juxtaposition of the bcl-2 and Ig{lambda} genes occurred during physiological rearrangement of the Ig{lambda} gene since it has been shown that the rearrangement of the Ig{lambda} locus is not accompanied by extranucleotides.

  7. Enantioselective Degradation Mechanism of Beta-Cypermethrin in Soil From the Perspective of Functional Genes.

    PubMed

    Yang, Zhong-Hua; Ji, Guo-Dong

    2015-12-01

    The behavior and mechanisms of the enantioselective degradation of beta-cypermethrin were studied in soil. The four isomers were degraded at different rates, and the enantiomer fractions of alpha-cypermethrin and theta-cypermethrin exceeded 0.5. Moreover, 3-phenoxybenzoic acid, phenol, and protocatechuic acid were detected; based on the presence of these metabolites, we predicted the degradation pathway and identified the functional genes that are related to this degradation process. We established quantitative relationships between the data on degradation kinetics and functional genes; we found that the quantitative relationships between different enantiomers differed even under the same conditions, and the genes pobA and pytH played key roles in limiting the degradation rate. Data obtained using path analysis revealed that the same gene had different direct and indirect effects on the degradation of different isomers. A mechanism was successfully proposed to explain the selective degradation of chiral compounds based on the perspective of functional genes. PMID:26403376

  8. Haplotype analysis of beta-actin gene for its association with sperm quality and boar fertility.

    PubMed

    Lin, C-L; Jennen, D G J; Ponsuksili, S; Tholen, E; Tesfaye, D; Schellander, K; Wimmers, K

    2006-12-01

    beta-actin (ACTB) was examined as a direct functional candidate gene for the possible association with sperm concentration, motility (MOT), semen volume per ejaculate, plasma droplet rate, abnormal sperm rate (ASR) and the fertility traits, non-return rate and number of piglets born alive (NBA). Three polymorphisms in intron 3 (T>C) and one polymorphism in exon 4 (T>C) of porcine ACTB gene were identified by comparative sequencing of animals of the breeds Pietrain and Hampshire. Association analysis revealed that haplotypes affected the variation of the traits MOT, ASR and NBA. The beneficial haplotypes may provide considerable improvement of sperm quality and fertility in the tested commercial boar population. PMID:17177693

  9. Characteristic beta-globin gene cluster haplotypes of Evenkis and Oroqens in north China.

    PubMed

    Shimizu, Koji; Marubayashi, Azusa; Tokimasa, Kozue; Harihara, Shinji; Omoto, Keiichi; Imanishi, Tadashi; Hao, Luping; Jin, Feng

    2004-10-01

    Haplotype frequencies of the beta-globin gene cluster were estimated for 114 Evenkis and 81 Oroqens from northeast China, and their characteristics were compared with those in Japanese, Koreans, and three Colombian Amerindian groups of South America (Wayuu, Kamsa, and Inga tribes). A major 5' subhaplotype (5' to the delta-globin gene) was + - - - - in Evenkis, whereas + - - - -, - + + - +, and - + - + + were the major subhaplotypes in Oroqens. One possible candidate for an ancestral 5' subhaplotype, - - - - -, was found in one Evenki (0.5%) and three Oroqen chromosomes (2.0%). They were observed as heterozygous forms for + ---- and -----. Major haplotypes were +-----+, + -----+-, and + - - - - + + in Evenkis, whereas they were +-----+,-++-+-+, +----+-, and -+-++-+ in Oroqens. The lowest Nei's genetic distance values of Evenkis or Oroqens based on the 5' subhaplotype frequency distributions were observed in relation to the Wayuu or Koreans, respectively, but those of Evenkis and Oroqens based on the haplotype frequency distributions were found in relation to Koreans. PMID:15757246

  10. Expression of the human T-cell receptor V beta 5.3 in Escherichia coli by thermal induction of the trc promoter: nucleotide sequence of the lacIts gene.

    PubMed

    Adari, H; Andrews, B; Ford, P J; Hannig, G; Brosius, J; Makrides, S C

    1995-11-01

    We have constructed a vector, pKBi, for the high-level expression of the variable beta chain 5.3 (V beta 5.3) of the human T-cell receptor in Escherichia coli. This vector incorporates the trc promoter, a polylinker, two transcription terminators, and the tetracycline resistance gene. Furthermore, the vector contains the lacIts gene that encodes a temperature-sensitive (ts) lac repressor, thus obviating both the need to use IPTG as a transcriptional inducer, and bacterial strains that harbor either the lacI or lacIq genes. The sequence of the lacIts gene shows an open reading frame of 1,080 nucleotides encoding 360 amino acids, and differs from the lacI gene at nucleotide 559 (with reference to the first nucleotide of the start codon). This nucleotide changes from G to A, causing amino acid residue 187 to change from glycine (GGC) to serine (AGC). This mutation imparts thermal sensitivity to the lac repressor protein. This is the first time that a TCR V beta region has been expressed at high levels (up to 28 mg/liter of culture) without fusion partners. The availability of the lacIts gene for thermal induction of the trc promoter, and the presence of the tetracycline resistance gene should make the expression vector pKBi particularly attractive for the efficient production of human therapeutic proteins in bacteria. PMID:7576181

  11. Obesity-related phenotypes and the beta3-adrenoceptor gene variant in postmenopausal women.

    PubMed

    Tchernof, A; Starling, R D; Walston, J D; Shuldiner, A R; Dvorak, R V; Silver, K; Matthews, D E; Poehlman, E T

    1999-07-01

    We examined the hypothesis that postmenopausal women with the beta3-adrenoceptor gene variant (Trp64Arg) have reduced total daily energy expenditure (TEE), altered free fatty acid kinetics, and increased intra-abdominal fat. A secondary objective was to examine whether the obese state masks the effect of the variant on resting metabolic rate (RMR). There were 23 obese heterozygous women with the genetic variant (age 58 +/- 6 years; BMI 36 +/- 7 kg/m2) who were compared with 19 homozygous obese women with the normal allele (age 56 +/- 4 years; BMI 36 +/- 3 kg/m2). Daily energy expenditure was determined from doubly labeled water and indirect calorimetry, lipolysis from infusion of [1-13C]palmitate, and body fat distribution from computed tomography. No significant differences were found in TEE, RMR, energy expenditure of physical activity, the thermic effect of a meal, fat oxidation as estimated by fasting and postprandial respiratory quotients (RQs), or rate of lipolysis. Similarly, no difference was found in visceral adipose tissue and abdominal subcutaneous fat areas. When RMR was compared between obese (n = 23) and never-obese women with the Trp64Arg variant (n = 16), we found a 317 kcal/day lower RMR in never-obese women after controlling for fat mass, fat-free mass, and age (P < 0.0017). These results do not support the hypothesis that already obese women with the Trp64Arg polymorphism of the beta3-adrenergic receptor gene have lower daily energy expenditure, altered lipolysis, and increased abdominal obesity. On the other hand, the lower RMR in never-obese women suggests that the obese state may mask a moderate effect of the Trp64Arg variant on energy expenditure. Although these results need to be confirmed in other populations, the obese state may have been a confounding factor in previous studies of the beta3-adrenoceptor Trp64Arg variant and energy expenditure. PMID:10389848

  12. Estrogen Receptor beta binds Sp1 and recruits a Corepressor Complex to the Estrogen Receptor alpha Gene Promoter

    PubMed Central

    Bartella, V; Rizza, P; Barone, I; Zito, D; Giordano, F; Giordano, C; Catalano, S; Mauro, L; Sisci, D; Panno, ML; Fuqua, SA; Andò, Sebastiano

    2015-01-01

    Human estrogen receptors (ERs) alpha and beta are crucially involved in the regulation of mammary growth and development. Normal breast tissues display a prevalently expression of ER beta than ER alpha, which drastically increases during breast tumorogenesis. So, it is reasonable to assume how a dysregulation of the two estrogen receptor subtypes may induce breast cancer development. However, the molecular mechanism underlying the opposite role played by the two estrogen receptors on tumor cell growth remains to be elucidated. In the present study, we have demonstrated that ER beta overexpression in breast cancer cells decreases cell proliferation and down-regulates ER alpha mRNA and protein content along with a concomitant repression of estrogen-regulated genes. Transient transfection experiments, using a vector containing the human ER alpha promoter region, showed that elevated levels of the ER beta down-regulated basal ER alpha promoter activity. Furthermore, side-directed mutagenesis and deletion analysis have revealed that the proximal GC-rich motifs at −223 and −214 is crucial for the ER beta-induced ER alpha down-regulation in breast cancer cells. This occurred through ER beta-Sp1 protein-protein interaction within the ER alpha promoter region and the recruitment of a corepressor complex containing NCoR/SMRT (nuclear receptor corepressor/silencing mediator of retinoic acid and thyroid hormone receptor), accompanied by hypoacetylation of histone H4 and displacement of RNA polymerase II. Silencing of NCoR gene expression by RNA interference reversed the down-regulatory effect of ER beta on ER alpha gene expression and cell proliferation. Our results provide evidence for a novel mechanism by which overexpression of ER beta through NCoR is able to down regulate ER alpha gene expression, thus inhibiting ER alpha’s driving role on breast cancer cell growth. PMID:22622808

  13. Nucleotide sequence analysis of beta tubulin gene in a wide range of dermatophytes.

    PubMed

    Rezaei-Matehkolaei, Ali; Mirhendi, Hossein; Makimura, Koichi; de Hoog, G Sybren; Satoh, Kazuo; Najafzadeh, Mohammad Javad; Shidfar, Mohammad Reza

    2014-10-01

    We investigated the resolving power of the beta tubulin protein-coding gene (BT2) for systematic study of dermatophyte fungi. Initially, 144 standard and clinical strains belonging to 26 species in the genera Trichophyton, Microsporum, and Epidermophyton were identified by internal transcribe spacer (ITS) sequencing. Subsequently, BT2 was partially amplified in all strains, and sequence analysis performed after construction of a BT2 database that showed length ranged from approximately 723 (T. ajelloi) to 808 nucleotides (M. persicolor) in different species. Intraspecific sequence variation was found in some species, but T. tonsurans, T. equinum, T. concentricum, T. verrucosum, T. rubrum, T. violaceum, T. eriotrephon, E. floccosum, M. canis, M. ferrugineum, and M. audouinii were invariant. The sequences were found to be relatively conserved among different strains of the same species. The species with the closest resemblance were Arthroderma benhamiae and T. concentricum and T. tonsurans and T. equinum with 100% and 99.8% identity, respectively; the most distant species were M. persicolor and M. amazonicum. The dendrogram obtained from BT2 topology was almost compatible with the species concept based on ITS sequencing, and similar clades and species were distinguished in the BT2 tree. Here, beta tubulin was characterized in a wide range of dermatophytes in order to assess intra- and interspecies variation and resolution and was found to be a taxonomically valuable gene. PMID:25079222

  14. Cloning and sequencing of the metallothioprotein beta-lactamase II gene of Bacillus cereus 569/H in Escherichia coli.

    PubMed Central

    Hussain, M; Carlino, A; Madonna, M J; Lampen, J O

    1985-01-01

    The structural gene for beta-lactamase II (EC 3.5.2.6), a metallothioenzyme, from Bacillus cereus 569/H (constitutive for high production of the enzyme) was cloned in Escherichia coli, and the nucleotide sequence was determined. This is the first class B beta-lactamase whose primary structure has been reported. The amino acid sequence of the exoenzyme form, deduced from the DNA, indicates that beta-lactamase II, like other secreted proteins, is synthesized as a precursor with a 30-amino acid N-terminal signal peptide. The pre-beta-lactamase II (Mr, 28,060) is processed in E. coli and in B. cereus to a single mature protein (Mr, 24,932) which is totally secreted by B. cereus but in E. coli remains intracellular, probably in the periplasm. The expression of the gene in E. coli RR1 on the multicopy plasmid pRWHO12 was comparable to that in B. cereus, where it is presumably present as a single copy. The three histidine residues that are involved (along with the sole cysteine of the mature protein) in Zn(II) binding and hence in enzymatic activity against beta-lactams were identified. These findings will help to define the secondary structure, mechanism of action, and evolutionary lineage of B. cereus beta-lactamase II and other class B beta-lactamases. Images PMID:3930467

  15. Adenoviral delivery of the beta2-adrenoceptor gene in sepsis: a subcutaneous approach in rat for kidney protection.

    PubMed

    Nakamura, Akio; Imaizumi, Akira; Niimi, Ryo; Yanagawa, Yukishige; Kohsaka, Takao; Johns, Edward J

    2005-12-01

    Successful gene therapy requires gene delivery that is efficient, has an optimal route of administration and has biosafety. The aims of the present study were to evaluate the safety and applicability of the subcutaneous delivery route for adenoviral transgenes containing the human beta(2)-adrenoceptor (adeno-beta(2)-AR) and to investigate whether this approach prevented renal dysfunction in a rat model of endotoxaemic shock induced by LPS (lipopolysaccharide). Subcutaneous administration of adeno-beta(2)-AR (a total of 10(10) viral particles) significantly increased beta-AR density in the kidney, lung and liver, but was without effect on physiological and plasma biochemical parameters. Moreover, this dose of virus did not cause any of the potential toxic responses of viral administration, such as inflammation and tissue TNF (tumour necrosis factor)-alpha expression. Although the LPS challenge caused a decrease in glomerular filtration rate, fractional excretion of sodium and renal beta-AR density in all groups, the reduction in renal function was significantly less in the rats given adeno-beta(2)-AR compared with non-treated rats. Thus, although further evaluation will be required, this initial study demonstrated that the subcutaneous injection of adeno-beta(2)-AR was efficient, comparatively non-pathogenic and potentially therapeutic to deal with acute renal failure associated with sepsis. PMID:16076286

  16. Molecular cloning and characterization analysis of immunoglobulin M heavy chain gene in European eel (Anguilla anguilla).

    PubMed

    Feng, Jianjun; Guan, Ruizhang; Lin, Peng; Guo, Songlin

    2009-01-15

    In this study, the immunoglobulin M heavy chain gene of European eel (Anguilla anguilla) was cloned and analyzed. The full-length cDNA of the IgM heavy chain gene (GenBank accession no. EF062515) has 2089 nucleotides encoding a putative protein of 581 amino acids. The IgM heavy chain was composed of leader peptide (L), variable domain (VH), CH1, CH2, Hinge, CH3, CH4, and C-terminus and two novel continuous putative N-glycosylation sites were found close to the second cysteine of CH3 in A. anguilla-H1 and A. anguilla-H2. The deduced amino acid sequence of the European eel IgM heavy chain constant region shared similarities to that of the Ladyfish (Elops saurus), Atlantic salmon (Salmo salar), rainbow trout (Oncorhynchus mykiss), Grass carp (Ctenopharingodon idella), Common carp (Cyprinus carpio), Channel catfish (Ictalurus punctatus), and the orange-spotted grouper (Epinephelus coioides) with the identity of 46.1%, 39.7%, 38.9%, 32.4%, 32.3%, 31.7%, and 30.7%, respectively. The highest level of IgM gene expression was observed in the kidney, followed by the spleen, gills, liver, muscle and heart in the apparently healthy European eels. PMID:19013650

  17. The Inference of Phased Haplotypes for the Immunoglobulin H Chain V Region Gene Loci by Analysis of VDJ Gene Rearrangements

    PubMed Central

    Kidd, Marie J.; Chen, Zhiliang; Wang, Yan; Jackson, Katherine J.; Zhang, Lyndon; Boyd, Scott D.; Fire, Andrew Z.; Tanaka, Mark M.; Gaëta, Bruno A.; Collins, Andrew M.

    2014-01-01

    The existence of many highly similar genes in the lymphocyte receptor gene loci makes them difficult to investigate, and the determination of phased “haplotypes” has been particularly problematic. However, V(D)J gene rearrangements provide an opportunity to infer the association of Ig genes along the chromosomes. The chromosomal distribution of H chain genes in an Ig genotype can be inferred through analysis of VDJ rearrangements in individuals who are heterozygous at points within the IGH locus. We analyzed VDJ rearrangements from 44 individuals for whom sufficient unique rearrangements were available to allow comprehensive genotyping. Nine individuals were identified who were heterozygous at the IGHJ6 locus and for whom sufficient suitable VDJ rearrangements were available to allow comprehensive haplotyping. Each of the 18 resulting IGHV|IGHD|IGHJ haplotypes was unique. Apparent deletion polymorphisms were seen that involved as many as four contiguous, functional IGHV genes. Two deletion polymorphisms involving multiple contiguous IGHD genes were also inferred. Three previously unidentified gene duplications were detected, where two sequences recognized as allelic variants of a single gene were both inferred to be on a single chromosome. Phased genomic data brings clarity to the study of the contribution of each gene to the available repertoire of rearranged VDJ genes. Analysis of rearrangement frequencies suggests that particular genes may have substantially different yet predictable propensities for rearrangement within different haplotypes. Together with data highlighting the extent of haplotypic variation within the population, this suggests that there may be substantial variability in the available Ab repertoires of different individuals. PMID:22205028

  18. Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris

    PubMed Central

    Abou-Elwafa, Salah F.; Büttner, Bianca; Chia, Tansy; Schulze-Buxloh, Gretel; Hohmann, Uwe; Mutasa-Göttgens, Effie; Jung, Christian; Müller, Andreas E.

    2011-01-01

    The transition from vegetative growth to reproductive development is a complex process that requires an integrated response to multiple environmental cues and endogenous signals. In Arabidopsis thaliana, which has a facultative requirement for vernalization and long days, the genes of the autonomous pathway function as floral promoters by repressing the central repressor and vernalization-regulatory gene FLC. Environmental regulation by seasonal changes in daylength is under control of the photoperiod pathway and its key gene CO. The root and leaf crop species Beta vulgaris in the caryophyllid clade of core eudicots, which is only very distantly related to Arabidopsis, is an obligate long-day plant and includes forms with or without vernalization requirement. FLC and CO homologues with related functions in beet have been identified, but the presence of autonomous pathway genes which function in parallel to the vernalization and photoperiod pathways has not yet been reported. Here, this begins to be addressed by the identification and genetic mapping of full-length homologues of the RNA-regulatory gene FLK and the chromatin-regulatory genes FVE, LD, and LDL1. When overexpressed in A. thaliana, BvFLK accelerates bolting in the Col-0 background and fully complements the late-bolting phenotype of an flk mutant through repression of FLC. In contrast, complementation analysis of BvFVE1 and the presence of a putative paralogue in beet suggest evolutionary divergence of FVE homologues. It is further shown that BvFVE1, unlike FVE in Arabidopsis, is under circadian clock control. Together, the data provide first evidence for evolutionary conservation of components of the autonomous pathway in B. vulgaris, while also suggesting divergence or subfunctionalization of one gene. The results are likely to be of broader relevance because B. vulgaris expands the spectrum of evolutionarily diverse species which are subject to differential developmental and/or environmental regulation

  19. Clinical Significance of a Point Mutation in DNA Polymerase Beta (POLB) Gene in Gastric Cancer

    PubMed Central

    Tan, Xiaohui; Wang, Hongyi; Luo, Guangbin; Ren, Shuyang; Li, Wenmei; Cui, Jiantao; Gill, Harindarpal S.; Fu, Sidney W.; Lu, Youyong

    2015-01-01

    Gastric cancer (GC) is a major cause of global cancer mortality. Genetic variations in DNA repair genes can modulate DNA repair capability and, consequently, have been associated with risk of developing cancer. We have previously identified a T to C point mutation at nucleotide 889 (T889C) in DNA polymerase beta (POLB) gene, a key enzyme involved in base excision repair in primary GCs. The purpose of this study was to evaluate the mutation and expression of POLB in a larger cohort and to identify possible prognostic roles of the POLB alterations in GC. Primary GC specimens and their matched normal adjacent tissues were collected at the time of surgery. DNA, RNA and protein samples were isolated from GC specimens and cell lines. Mutations were detected by PCR-RFLP/DHPLC and sequencing analysis. POLB gene expression was examined by RT-PCR, tissue microarray, Western blotting and immunofluorescence assays. The function of the mutation was evaluated by chemosensitivity, MTT, Transwell matrigel invasion and host cell reactivation assays. The T889C mutation was detected in 18 (10.17%) of 177 GC patients. And the T889C mutation was associated with POLB overexpression, lymph nodes metastases and poor tumor differentiation. In addition, patients with- the mutation had significantly shorter survival time than those without-, following postoperative chemotherapy. Furthermore, cell lines with T889C mutation in POLB gene were more resistant to the treatment of 5-fluorouracil, cisplatin and epirubicin than those with wild type POLB. Forced expression of POLB gene with T889C mutation resulted in enhanced cell proliferation, invasion and resistance to anticancer drugs, along with increased DNA repair capability. These results suggest that POLB gene with T889C mutation in surgically resected primary gastric tissues may be clinically useful for predicting responsiveness to chemotherapy in patients with GC. The POLB gene alteration may serve as a prognostic biomarker for GC. PMID

  20. [Molecular cloning of the DNA sequence of activin beta A subunit gene mature peptides from panda and related species and its application in the research of phylogeny and taxonomy].

    PubMed

    Wang, Xiao-Jing; Wang, Xiao-Xing; Wang, Ya-Jun; Wang, Xi-Zhong; He, Guang-Xin; Chen, Hong-Wei; Fei, Li-Song

    2002-09-01

    Activin, which is included in the transforming growth factor-beta (TGF beta) superfamily of proteins and receptors, is known to have broad-ranging effects in the creatures. The mature peptide of beta A subunit of this gene, one of the most highly conserved sequence, can elevate the basal secretion of follicle-stimulating hormone (FSH) in the pituitary and FSH is pivotal to organism's reproduction. Reproduction block is one of the main reasons which cause giant panda to extinct. The sequence of Activin beta A subunit gene mature peptides has been successfully amplified from giant panda, red panda and malayan sun bear's genomic DNA by using polymerase chain reaction (PCR) with a pair of degenerate primers. The PCR products were cloned into the vector pBlueScript+ of Esherichia coli. Sequence analysis of Activin beta A subunit gene mature peptides shows that the length of this gene segment is the same (359 bp) and there is no intron in all three species. The sequence encodes a peptide of 119 amino acid residues. The homology comparison demonstrates 93.9% DNA homology and 99% homology in amino acid among these three species. Both GenBank blast search result and restriction enzyme map reveal that the sequences of Activin beta A subunit gene mature peptides of different species are highly conserved during the evolution process. Phylogeny analysis is performed with PHYLIP software package. A consistent phylogeny tree has been drawn with three different methods. The software analysis outcome accords with the academic view that giant panda has a closer relationship to the malayan sun bear than the red panda. Giant panda should be grouped into the bear family (Uersidae) with the malayan sun bear. As to the red panda, it would be better that this animal be grouped into the unique family (red panda family) because of great difference between the red panda and the bears (Uersidae). PMID:12561224

  1. Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout

    PubMed Central

    Eya, Jonathan C.; Ukwuaba, Vitalis O.; Yossa, Rodrigue; Gannam, Ann L.

    2015-01-01

    A 2 × 3 factorial study was conducted to evaluate the effects of dietary lipid level on the expression of mitochondrial and nuclear genes involved in electron transport chain in all-female rainbow trout Oncorhynchus mykiss. Three practical diets with a fixed crude protein content of 40%, formulated to contain 10% (40/10), 20% (40/20) and 30% (40/30) dietary lipid, were fed to apparent satiety to triplicate groups of either low-feed efficient (F120; 217.66 ± 2.24 g initial average mass) or high-feed efficient (F136; 205.47 ± 1.27 g) full-sib families of fish, twice per day, for 90 days. At the end of the experiment, the results showed that there is an interactive effect of the dietary lipid levels and the phenotypic feed efficiency (growth rate and feed efficiency) on the expression of the mitochondrial genes nd1 (NADH dehydrogenase subunit 1), cytb (Cytochrome b), cox1 (Cytochrome c oxidase subunits 1), cox2 (Cytochrome c oxidase subunits 2) and atp6 (ATP synthase subunit 6) and nuclear genes ucp2α (uncoupling proteins 2 alpha), ucp2β (uncoupling proteins 2 beta), pparα (peroxisome proliferator-activated receptor alpha), pparβ (peroxisome proliferatoractivated receptor beta) and ppargc1α (proliferator-activated receptor gamma coactivator 1 alpha) in fish liver, intestine and muscle, except on ppargc1α in the muscle which was affected by the diet and the family separately. Also, the results revealed that the expression of mitochondrial genes is associated with that of nuclear genes involved in electron transport chain in fish liver, intestine and muscle. Furthermore, this work showed that the expression of mitochondrial genes parallels with the expression of genes encoding uncoupling proteins (UCP) in the liver and the intestine of rainbow trout. This study for the first time presents the molecular basis of the effects of dietary lipid level on mitochondrial and nuclear genes involved in mitochondrial electron transport chain in fish. PMID:25853266

  2. Negative regulation in the expression of a sugar-inducible gene in Arabidopsis thaliana. A recessive mutation causing enhanced expression of a gene for beta-amylase.

    PubMed Central

    Mita, S; Hirano, H; Nakamura, K

    1997-01-01

    Expression of a beta-amylase gene of Arabidopsis thaliana (AT beta-Amy) is regulated by sugars. We identified a mutant, hba1, in which the level of expression of AT beta-Amy in leaves of plants that had been grown in a medium with 2% sucrose was significantly higher than that in wild-type plants. Higher that wild-type levels of beta-amylase in hba1 plants depended on the presence of 1 to 2% sucrose or 1% glucose in the medium, whereas leaves of mutant plants grown with higher levels of sugars had beta-amylase activities similar to those in leaves of wild-type plants. The hba1 phenotype was recessive and did not affect levels of sugars and starch in leaves. It is proposed that expression of AT beta-Amy is regulated by a combination of both positive and negative factors, dependent on the level of sugars, and that HBA1 might function to maintain low-level expression of AT beta-Amy until the level of sugars reaches some high level. Results of crosses of hba1 plants with transgenic plants that harbored an AT beta-Amy:GUS transgene with 1587 bp of the 5'-upstream region suggested that HBA1 affects expressions of AT beta-Amy in trans. The hba1 plants also had growth defects and elevated levels of anthocyanin in their petioles. However, sugar-related changes in levels of several mRNAs other than beta-amylase mRNA were unaffected in hba1 plants, suggesting that only a subset of sugar-regulated genes is under the control HBA1. PMID:9193090

  3. Candidate Gene Study of TRAIL and TRAIL Receptors: Association with Response to Interferon Beta Therapy in Multiple Sclerosis Patients

    PubMed Central

    Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca

    2013-01-01

    TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636

  4. The Chlamydomonas Dhc1 gene encodes a dynein heavy chain subunit required for assembly of the I1 inner arm complex.

    PubMed Central

    Myster, S H; Knott, J A; O'Toole, E; Porter, M E

    1997-01-01

    Multiple members of the dynein heavy chain (Dhc) gene family have been recovered in several organisms, but the relationships between these sequences and the Dhc isoforms that they encode are largely unknown. To identify Dhc loci and determine the specific functions of the individual Dhc isoforms, we have screened a collection of motility mutants generated by insertional mutagenesis in Chlamydomonas. In this report, we characterize one strain, pf9-3, in which the insertion event was accompanied by a deletion of approximately 13 kb of genomic DNA within the transcription unit of the Dhc1 gene. Northern blot analysis confirms that pf9-3 is a null mutation. Biochemical and structural studies of isolated axonemes demonstrate that the pf9-3 mutant fails to assemble the I1 inner arm complex, a two-headed dynein isoform composed of two Dhcs (1 alpha and 1 beta) and three intermediate chains. To determine if the Dhc1 gene product corresponds to one of the Dhcs of the I1 complex, antibodies were generated against a Dhc1-specific peptide sequence. Immunoblot analysis reveals that the Dhc1 gene encodes the 1 alpha Dhc subunit. These studies thus, identify the first inner arm Dhc locus to be described in any organism and further demonstrate that the 1 alpha Dhc subunit plays an essential role in the assembly of the I1 inner arm complex. Images PMID:9247642

  5. Differential cytokine modulation of the genes LAMA3, LAMB3, and LAMC2, encoding the constitutive polypeptides, alpha 3, beta 3, and gamma 2, of human laminin 5 in epidermal keratinocytes.

    PubMed

    Korang, K; Christiano, A M; Uitto, J; Mauviel, A

    1995-07-24

    Laminin 5, an anchoring filament protein previously known as nicein/kalinin/epiligrin, consists of three polypeptide chains, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. The expression of laminin 5 was detected by Northern hybridization with specific cDNA probes in various epidermal keratinocyte cultures, whereas no expression of any of the three genes could be detected in foreskin fibroblast cultures. Transforming growth factor-beta (TGF-beta) enhanced LAMA3, LAMB3, and LAMC2 gene expression in human epidermal keratinocytes, as well as in HaCaT and Balb/K cells in culture, although the extent of enhancement was greater for LAMA3 and LAMC2 genes than for LAMB3. Interestingly, tumor necrosis factor-alpha, (TNF-alpha) alone did not alter the expression of LAMB3 and LAMC2 genes in human epidermal keratinocytes, whereas it inhibited the expression of LAMA3. These results suggest that the expression of the three genes encoding the laminin 5 subunits is not coordinately regulated by the cytokines tested. PMID:7635220

  6. Genomic organization of the murine G protein beta subunit genes and related processed pseudogenes.

    PubMed

    Kitanaka, J; Wang, X B; Kitanaka, N; Hembree, C M; Uhl, G R

    2001-12-01

    The functional significance of heterotrimeric guanine nucleotide binding protein (G protein) for the many physiological processes including the molecular mechanisms of drug addiction have been described. In investigating the changes of mRNA expression after acute psychostimulant administration, we previously identified a cDNA encoding a G protein beta1 subunit (Gbeta1) that was increased up to four-fold in certain brain regions after administration of psychostimulants. The mouse Gbeta1 gene (the mouse genetic symbol, GNB1) was mapped to chromosome 4, but little was known of its genetic features. To characterize the GNB1 gene further, we have cloned and analyzed the genomic structures of the mouse GNBI gene and its homologous sequences. The GNBI gene spans at least 50 kb, and consists of 12 exons and 11 introns. The exon/intron boundaries were determined and found to follow the GT/AG rule. Exons 3-11 encode the Gbeta1 protein, and the exon 2 is an alternative, resulting in putative two splicing variants. Although intron 11 is additional for GNBI compared with GNB2 and GNB3, the intron positions within the protein coding region of GNB1, GNB2 and GNB3 are identical, suggesting that GNB1 should have diverged from the ancestral gene family earlier than the genes for GNB2 and GNB3. We also found the 5'-truncated processed pseudogenes with 71-89% similarities to GNBI mRNA sequence, suggesting that the truncated cDNA copies, which have been reverse-transcribed from a processed mRNA for GNB1, might have been integrated into several new locations in the mouse genome. PMID:11913780

  7. GeneSpeed Beta Cell: An Online Genomics Data Repository and Analysis Resource Tailored for the Islet Cell Biologist

    PubMed Central

    Quayum, Nayeem; Kutchma, Alecksandr; Sarkar, Suparna A.; Juhl, Kirstine; Gradwohl, Gerard; Mellitzer, Georg; Hutton, John C.; Jensen, Jan

    2008-01-01

    Objective. We here describe the development of a freely available online database resource, GeneSpeed Beta Cell, which has been created for the pancreatic islet and pancreatic developmental biology investigator community. Research Design and Methods. We have developed GeneSpeed Beta Cell as a separate component of the GeneSpeed database, providing a genomics-type data repository of pancreas and islet-relevant datasets interlinked with the domain-oriented GeneSpeed database. Results. GeneSpeed Beta Cell allows the query of multiple published and unpublished select genomics datasets in a simultaneous fashion (multiexperiment viewing) and is capable of defining intersection results from precomputed analysis of such datasets (multidimensional querying). Combined with the protein-domain categorization/assembly toolbox provided by the GeneSpeed database, the user is able to define spatial expression constraints of select gene lists in a relatively rigid fashion within the pancreatic expression space. We provide several demonstration case studies of relevance to islet cell biology and development of the pancreas that provide novel insight into islet biology. Conclusions. The combination of an exhaustive domain-based compilation of the transcriptome with gene array data of interest to the islet biologist affords novel methods for multidimensional querying between individual datasets in a rapid fashion, presently not available elsewhere. PMID:18795106

  8. Characterization of the 5'-flanking region of the gene for the alpha chain of human fibrinogen.

    PubMed

    Hu, C H; Harris, J E; Davie, E W; Chung, D W

    1995-11-24

    The 5'-flanking region of the gene coding for the alpha chain of human fibrinogen was isolated, sequenced, and characterized. The principal site of transcription initiation was determined by primer extension analysis and the RNase protection assay and shown to be at an adenine residue located 55 nucleotides upstream from the initiator methionine codon, or 13,399 nucleotides down-stream from the polyadenylation site of the gene coding for the gamma chain. Transient expression of constructs containing sequentially deleted 5'-flanking sequences of the alpha chain gene fused to the chloramphenicol acetyltransferase reporter gene showed that the promoter was liver-specific and inducible by interleukin 6 (IL-6). The shortest DNA fragment with significant promoter activity and full response to IL-6 stimulation encompassed the region from -217 to +1 base pairs (bp). Although six potential IL-6 responsive sequences homologous to the type II IL-6 responsive element were present, a single sequence of CTGGGA localized from -122 to -127 bp was shown to be a functional element in IL-6 induction. A hepatocyte nuclear factor 1 (HNF-1) binding site, present from -47 to -59 bp, in combination with other upstream elements, was essential for liver-specific expression of the gene. A functional CCAAT/enhancer binding protein site (C/EBP, -134 to -142 bp) was also identified within 217 bp from the transcription initiation site. An additional positive element (-1393 to -1133 bp) and a negative element (-1133 to -749 bp) were also found in the upstream region of the alpha-fibrinogen gene. PMID:7499335

  9. Multiprotein complex formation at the beta myosin heavy chain distal muscle CAT element correlates with slow muscle expression but not mechanical overload responsiveness.

    PubMed

    Vyas, D R; McCarthy, J J; Tsika, G L; Tsika, R W

    2001-01-12

    To examine the role of the beta-myosin heavy chain (betaMyHC) distal muscle CAT (MCAT) element in muscle fiber type-specific expression and mechanical overload (MOV) responsiveness, we conducted transgenic and in vitro experiments. In adult transgenic mice, mutation of the distal MCAT element led to significant reductions in chloramphenicol acetyltransferase (CAT) specific activity measured in control soleus and plantaris muscles when compared with wild type transgene beta293WT but did not abolish MOV-induced CAT specific activity. Electrophoretic mobility shift assay revealed the formation of a specific low migrating nuclear protein complex (LMC) at the betaMyHC MCAT element that was highly enriched only when using either MOV plantaris or control soleus nuclear extract. Scanning mutagenesis of the betaMyHC distal MCAT element revealed that only the nucleotides comprising the core MCAT element were essential for LMC formation. The proteins within the LMC when using either MOV plantaris or control soleus nuclear extracts were antigenically related to nominal transcription enhancer factor 1 (NTEF-1), poly(ADP-ribose) polymerase (PARP), and Max. Only in vitro translated TEF-1 protein bound to the distal MCAT element, suggesting that this multiprotein complex is tethered to the DNA via TEF-1. Protein-protein interaction assays revealed interactions between nominal TEF-1, PARP, and Max. Our studies show that for transgene beta293 the distal MCAT element is not required for MOV responsiveness but suggest that a multiprotein complex likely comprised of nominal TEF-1, PARP, and Max forms at this element to contribute to basal slow fiber expression. PMID:11010974

  10. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction.

    PubMed

    Bell, D A

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  11. Evolution of the Iga Heavy Chain Gene in the Genus Mus

    PubMed Central

    Osborne, B. A.; Golde, T. E.; Schwartz, R. L.; Rudikoff, S.

    1988-01-01

    To examine questions of immunoglobulin gene evolution, the IgA α heavy chain gene from Mus pahari, an evolutionarily distant relative to Mus musculus domesticus, was cloned and sequenced. The sequence, when compared to the IgA gene of BALB/c or human, demonstrated that the IgA gene is evolving in a mosaic fashion with the hinge region accumulating mutations most rapidly and the third domain at a considerably lower frequency. In spite of this pronounced accumulation of mutations, the hinge region appears to maintain the conformation of a random coil. A marked propensity to accumulate replacement over silent site changes in the coding regions was noted, as was a definite codon bias. The possibility that these two phenomena are interrelated is discussed. PMID:2842228

  12. Gene structure and molecular phylogeny of the linker chains from the giant annelid hexagonal bilayer hemoglobins.

    PubMed

    Chabasse, Christine; Bailly, Xavier; Sanchez, Sophie; Rousselot, Morgane; Zal, Franck

    2006-09-01

    Giant extracellular hexagonal bilayer hemoglobin (HBL-Hb), found only in annelids, is an approximately 3500-kDa heteropolymeric structure involved in oxygen transport. The HBL-Hbs are comprised of globin and linker chains, the latter being required for the assembly of the quaternary structure. The linker chains, varying in size from 225 to 283 amino acids, have a conserved cysteine-rich domain within their N-terminal moiety that is homologous to the cysteine-rich modules constituting the ligand binding domain of the low-density lipoprotein receptor (LDLR) protein family found in many metazoans. We have investigated the gene structure of linkers from Arenicola marina, Alvinella pompejana, Nereis diversicolor, Lumbricus terrestris, and Riftia pachyptila. We found, contrary to the results obtained earlier with linker genes from N. diversicolor and L. terrestris, that in all of the foregoing cases, the linker LDL-A module is flanked by two phase 1 introns, as in the human LDLR gene, with two more introns in the 3' side whose positions varied with the species. In addition, we obtained 13 linker cDNAs that have been determined experimentally or found in the EST database LumbriBASE. A molecular phylogenetic analysis of the linker primary sequences demonstrated that they cluster into two distinct families of linker proteins. We propose that the common gene ancestor to annelid linker genes exhibited a four-intron and five-exon structure and gave rise to the two families subsequent to a duplication event. PMID:16838215

  13. Gene structure and chromosomal localization of the human HSD11K gene encoding the kidney (type 2) isozyme of 11{beta}-hydroxysteroid dehydrogenase

    SciTech Connect

    Agarwal, A.K.; Rogerson, F.M.; Mune, T.; White, P.C.

    1995-09-01

    11{beta}-hydroxysteroid dehydrogenase (11{beta}HSD) converts glucocorticoids to inactive products and is thus thought to confer specificity for aldosterone on the type I mineralocorticoid receptor in the kidney. Recent studies indicate the presence of at least two isozymes of 11{beta}HSD. In vitro, the NAD{sup +}-dependent kidney (type 2) isozyme catalyzes 11{beta}-dehydrogenase but not reductase reactions, whereas the NADP{sup +}-dependent liver (type 1) isozyme catalyzes both reactions. We have now characterized the human gene encoding kidney 11{beta}HSD (HSD11K). A bacteriophage P1 clone was isolated after screening a human genomic library by hybridization with sheep HSD11K cDNA. The gene consists of 5 exons spread over 6 kb. The nucleotide binding domain lies in the first exon are GC-rich (80%), suggesting that the gene may be transcriptionally regulated by factors that recognize GC-rich sequences. Fluorescence in situ hybridization of metaphase chromosomes with a positive P1 clone localized the gene to chromosome 16q22. In contrast, the HSD11L (liver isozyme) gene is located on chromosome 1 and contains 6 exons; the coding sequences of these genes are only 21% identical. HSD11K is expressed at high levels in the placenta and kidney of midgestation human fetuses and at lower levels in lung and testes. Different transcriptional start sites are utilized in kidney and placenta. These data should be applicable to genetic analysis of the syndrome of apparent mineralocorticoid excess, which may represent a deficiency of 11{beta}HSD. 25 refs., 5 figs.

  14. A gene encoding the major beta tubulin of the mitotic spindle in Physarum polycephalum plasmodia

    SciTech Connect

    Burland, T.G.; Paul, E.C.A.; Oetliker, M.; Dove, W.F.

    1988-03-01

    The multinucleate plasmodium of Physarum polycephalum is unusual among eucaryotic cells in that it uses tubulins only in mitotic-spindle microtubules; cytoskeletal, flagellar, and centriolar microtubules are absent in this cell type. The authors identified a ..beta..-tubulin cDNA clone, ..beta..105, which is shown to correspond to the transcript of the betC ..beta..-tubulin locus and to encode ..beta..2 tubulin, the ..beta.. tubulin expressed specifically in the plasmodium and used exclusively in the mitotic spindle. Physarum amoebae utilize tubulins in the cytoskeleton, centrioles, and flagella, in addition to the mitotic spindle. Sequence analysis shows that ..beta..2 tubulin is only 83% identical to the two ..beta.. tubulins expressed in amoebae. This compares with 70 to 83% identity between Physarum ..beta..2 tubulin and the ..beta.. tubulins of yeasts, fungi, alga, trypanosome, fruit fly, chicken, and mouse. On the other hand, Physarum ..beta..2 tubulin is no more similar to, for example, Aspergillus ..beta.. tubulins than it is to those of Drosophila melanogaster or mammals. Several eucaryotes express at least one widely diverged ..beta.. tubulin as well as one or more ..beta.. tubulins that conform more closely to a consensus ..beta..-tubulin sequence. The authors suggest that ..beta..-tubulins diverge more when their expression pattern is restricted, especially when this restriction results in their use in fewer functions. This divergence among ..beta.. tubulins could have resulted through neutral drift. For example, exclusive use of Physarum ..beta..2 tubulin in the spindle may have allowed more amino acid substitutions than would be functionally tolerable in the ..beta.. tubulins that are utilized in multiple microtubular organelles. Alternatively, restricted use of ..beta.. tubulins may allow positive selection to operate more freely to refine ..beta..-tubulin function.

  15. Cap disease caused by heterozygous deletion of the beta-tropomyosin gene TPM2.

    PubMed

    Lehtokari, Vilma-Lotta; Ceuterick-de Groote, Chantal; de Jonghe, Peter; Marttila, Minttu; Laing, Nigel G; Pelin, Katarina; Wallgren-Pettersson, Carina

    2007-06-01

    "Cap myopathy" or "cap disease" is a congenital myopathy characterised by cap-like structures at the periphery of muscle fibres, consisting of disarranged thin filaments with enlarged Z discs. Here we report a deletion in the beta-tropomyosin (TPM2) gene causing cap disease in a 36-year-old male patient with congenital muscle weakness, myopathic facies and respiratory insufficiency. The mutation identified in this patient is an in-frame deletion (c.415_417delGAG) of one codon in exon 4 of TPM2 removing a single glutamate residue (p.Glu139del) from the beta-tropomyosin protein. This is expected to disrupt the seven-amino acid repeat essential for making a coiled coil, and thus to impair tropomyosin-actin interaction. Missense mutations in TPM2 have previously been found to cause rare cases of nemaline myopathy and distal arthrogryposis. This mutation is one not previously described and the first genetic cause identified for cap disease. PMID:17434307

  16. A missense mutation in the beta-2 integrin gene (ITGB2) causes canine leukocyte adhesion deficiency.

    PubMed

    Kijas, J M; Bauer, T R; Gäfvert, S; Marklund, S; Trowald-Wigh, G; Johannisson, A; Hedhammar, A; Binns, M; Juneja, R K; Hickstein, D D; Andersson, L

    1999-10-01

    Canine leukocyte adhesion deficiency (CLAD) is a fatal immunodeficiency disease found in Irish setters. The clinical manifestations of CLAD are very similar to LAD in humans and BLAD in cattle, which are both caused by mutations in ITGB2 encoding the leukocyte integrin beta-2 subunit (CD18). Sequence analysis of the ITGB2 coding sequence from a CLAD dog and a healthy control revealed a single missense mutation, Cys36Ser. This cysteine residue is conserved among all beta integrins, and the mutation most likely disrupts a disulfide bond. The mutation showed a complete association with CLAD in Irish setters and was not found in a sample of dogs from other breeds. The causative nature of this mutation was confirmed by transduction experiments using retroviral vectors and human LAD EBV B-cells. The normal canine CD18 formed heterodimers with the human CD11 subunit, whereas gene transfer of the mutant CD18 resulted in very low levels of CD11/CD18 expression. The identification of the causative mutation for CLAD now makes it possible to identify carrier animals with a simple diagnostic DNA test, and it forms the basis for using CLAD as a large animal model for the development and evaluation of clinical treatments for human LAD. PMID:10512685

  17. Identification of the beta-glucosidase gene from Bifidobacterium animalis subsp. lactis and its expression in B. bifidum BGN4.

    PubMed

    Youn, So Youn; Park, Myeong Soo; Ji, Geun Eog

    2012-12-01

    beta-Glucosidase is necessary for the bioconversion of glycosidic phytochemicals in food. Two Bifidobacterium strains (Bifidobacterium animalis subsp. lactis SH5 and B. animalis subsp. lactis RD68) with relatively high beta- glucosidase activities were selected among 46 lactic acid bacteria. A beta-glucosidase gene (bbg572) from B. lactis was shotgun cloned, fully sequenced, and analyzed for its transcription start site, structural gene, and deduced transcriptional terminator. The structural gene of bbg572 was 1,383 bp. Based on amino sequence similarities, bbg572 was assigned to family 1 of the glycosyl hydrolases. To overexpress bbg572 in Bifidobacterium, several bifidobacteria expression vectors were constructed by combining several promoters and a terminator sequence from different bifidobacteria. The maximum activity of recombinant Bbg572 was achieved when it was expressed under its own promoter and terminator. Its enzyme activity increased 31-fold compared with those of its parental strains. The optimal pH for Bbg572 was pH 6.0. Bbg572 was stable at 37-40 degrees C. It hydrolyzed isoflavones, quercetins, and disaccharides with various beta-glucoside linkages. Bbg572 also converted the ginsenosides Rb1 and Rb2. These results suggest that this new beta-glucosidase-positive Bifidobacterium transformant can be utilized for the production of specific aglycone products. PMID:23221535

  18. Molecular cloning and characterization of beta-expansin gene related to root hair formation in barley.

    PubMed

    Kwasniewski, Miroslaw; Szarejko, Iwona

    2006-07-01

    Root hairs are specialized epidermal cells that play a role in the uptake of water and nutrients from the rhizosphere and serve as a site of interaction with soil microorganisms. The process of root hair formation is well characterized in Arabidopsis (Arabidopsis thaliana); however, there is a very little information about the genetic and molecular basis of root hair development in monocots. Here, we report on isolation and cloning of the beta-expansin (EXPB) gene HvEXPB1, tightly related to root hair initiation in barley (Hordeum vulgare). Using root transcriptome differentiation in the wild-type/root-hairless mutant system, a cDNA fragment present in roots of wild-type plants only was identified. After cloning of full-length cDNA and genomic sequences flanking the identified fragment, the subsequent bioinformatics analyses revealed homology of the protein coded by the identified gene to the EXPB family. Reverse transcription-PCR showed that expression of HvEXPB1 cosegregated with the root hair phenotype in F2 progeny of the cross between the hairless mutant rhl1.a and the wild-type Karat parent variety. Expression of the HvEXPB1 gene was root specific; it was expressed in roots of wild-type forms, but not in coleoptiles, leaves, tillers, and spikes. The identified gene was active in roots of two other analyzed root hair mutants: rhp1.a developing root hair primordia only and rhs1.a with very short root hairs. Contrary to this, a complete lack of HvEXPB1 expression was observed in roots of the spontaneous root-hairless mutant bald root barley. All these observations suggest a role of the HvEXPB1 gene in the process of root hair formation in barley. PMID:16679418

  19. The alpha/beta fold family of proteins database and the cholinesterase gene server ESTHER.

    PubMed Central

    Cousin, X; Hotelier, T; Giles, K; Lievin, P; Toutant, J P; Chatonnet, A

    1997-01-01

    ESTHER (for esterases, alpha/betahydrolase enzyme and relatives) is a database of sequences phylogenetically related to cholinesterases. These sequences define a homogeneous group of enzymes (carboxylesterases, lipases and hormone-sensitive lipases) sharing a similar structure of a central beta-sheet surrounded by alpha-helices. Among these proteins a wide range of functions can be found (hydrolases, adhesion molecules, hormone precursors). The purpose of ESTHER is to help comparison of structures and functions of members of the family. Since the last release, new features have been added to the server. A BLAST comparison tool allows sequence homology searches within the database sequences. New sections are available: kinetics and inhibitors of cholinesterases, fasciculin-acetylcholinesterase interaction and a gene structure review. The mutation analysis compilation has been improved with three-dimensional images. A mailing list has been created. PMID:9016525

  20. Single-cell TCRseq: paired recovery of entire T-cell alpha and beta chain transcripts in T-cell receptors from single-cell RNAseq.

    PubMed

    Redmond, David; Poran, Asaf; Elemento, Olivier

    2016-01-01

    Accurate characterization of the repertoire of the T-cell receptor (TCR) alpha and beta chains is critical to understanding adaptive immunity. Such characterization has many applications across such fields as vaccine development and response, clone-tracking in cancer, and immunotherapy. Here we present a new methodology called single-cell TCRseq (scTCRseq) for the identification and assembly of full-length rearranged V(D)J T-cell receptor sequences from paired-end single-cell RNA sequencing reads. The method allows accurate identification of the V(D)J rearrangements for each individual T-cell and has the novel ability to recover paired alpha and beta segments. Source code is available at https://github.com/ElementoLab/scTCRseq . PMID:27460926

  1. Human von Willebrand factor gene and pseudogene: Structural analysis and differentiation by polymerase chain reaction

    SciTech Connect

    Mancuso, D.J.; Tuley, E.A.; Westfield, L.A.; Lester-Mancuso, T.L.; Sorace, J.M.; Sadler, J.E. ); Le Beau, M.M. )

    1991-01-01

    Structural analysis of the von Willebrand factor gene located on chromosome 12 is complicated by the presence of a partial unprocessed pseudogene on chromosome 22q11-13. The structures of the von Willebrand factor pseudogene and corresponding segment of the gene were determined, and methods were developed for the rapid differentiation of von Willebrand factor gene and pseudogene sequences. The pseudogene is 21-29 kilobases in length and corresponds to 12 exons (exons 23-34) of the von Willebrand factor gene. Approximately 21 kilobases of the gene and pseudogene were sequenced, including the 5{prime} boundary of the pseudogene. The 3{prime} boundary of the pseudogene lies within an 8-kb region corresponding to intron 34 of the gene. The presence of splice site and nonsense mutations suggests that the pseudogene cannot yield functional transcripts. The pseudogene has diverged {approximately}3.1{percent} in nucleotide sequence from the gene. This suggests a recent evolutionary origin {approximately}19-29 million years ago, near the time of divergence of humans and apes from monkeys. Several repetitive sequences were identified, including 4 Alu, one Line-1, and several short simple sequence repeats. Several of these simple repeats differ in length between the gene and pseudogene and provide useful markers for distinguishing these loci. Sequence differences between the gene and pseudogene were exploited to design oligonucleotide primers for use in the polymerase chain reaction to selectivity amplify sequences corresponding to exons 23-34 from either the von Willebrand factor gene or the pseudogene. This method is useful for the analysis of gene defects in patients with von Willebrand disease, without interference from homologous sequences in the pseudogene.

  2. Clathrin light chain B: gene structure and neuron-specific splicing.

    PubMed Central

    Stamm, S; Casper, D; Dinsmore, J; Kaufmann, C A; Brosius, J; Helfman, D M

    1992-01-01

    The clathrin light chains are components of clathrin coated vesicles, structural constituents involved in endocytosis and membrane recycling. The clathrin light chain B (LCB) gene encodes two isoforms, termed LCB2 and LCB3, via an alternative RNA splicing mechanism. We have determined the structure of the rat clathrin light chain B gene. The gene consists of six exons that extend over 11.9 kb. The first four exons and the last exon are common to the LCB2 and LCB3 isoforms. The fifth exon, termed EN, is included in the mRNA in brain, giving rise to the brain specific form LCB2 but is excluded in other tissues, generating the LCB3 isoform. Primary rat neuronal cell cultures express predominantly the brain specific LCB2 isoform, whereas primary rat cultures of glia express only the LCB3 isoform, suggesting that expression of the brain-specific LCB2 form is limited to neurons. Further evidence for neuronal localization of the LCB2 form is provided using a teratocarcinoma cell line, P19, which can be induced by retinoic acid to express a neuronal phenotype, concomitant with the induction of the LCB2 form. In order to determine the sequences involved in alternative splice site selection, we constructed a minigene containing the alternative spliced exon EN and its flanking intron and exon sequences. This minigene reflects the splicing pattern of the endogenous gene upon transfection in HeLa cell and primary neuronal cell cultures, indicating that this region of the LCB gene contains all the necessary information for neuron-specific splicing. Images PMID:1408826

  3. Influence of beta-blockers on the myocardial mRNA expressions of circadian clock- and metabolism-related genes.

    PubMed

    Ushijima, Kentarou; Maekawa, Tomohiro; Ishikawa-Kobayashi, Eiko; Ando, Hitoshi; Shiga, Tsuyoshi; Fujimura, Akio

    2013-01-01

    Daily rhythms are regulated by a master clock-system in the suprachiasmatic nucleus and by a peripheral clock-system in each organ. Because norepinephrine is one of the timekeepers for the myocardial circadian clock that influences cardiac metabolism, it is speculated that a beta-blocker may affect the circadian clock and metabolism in heart tissue. In this study, thirty mg/kg/day of propranolol (a lipophilic beta-blocker) or atenolol (a hydrophilic beta-blocker) was given orally to Wistar rats for 4 weeks. The mRNA expressions of Bmal1 and E4BP4 in heart tissue were suppressed by the beta-blockers. However, the mRNA expressions of these clock genes in the suprachiasmatic nucleus were unchanged. Myocardial mRNA expressions of lactate dehydrogenase a and pyruvate dehydrogenase kinase 4 were also suppressed by the beta-blockers. In addition, ATP content in heart tissue was significantly elevated by the beta-blockers throughout 24 hours. The effects of propranolol and atenolol did not differ significantly. This study showed for the first time that a beta-blocker affects myocardial clock gene expression. Propranolol and atenolol increased ATP content in heart tissue throughout 24 hours. The influences of beta-blockers may be negligible on the SCN, and may be independent of lipid solubility on heart tissue. It is well known that these drugs exert a protective effect against myocardial ischemia, which may be mediated by an increase in the preservation of myocardial ATP. PMID:23394803

  4. Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

    PubMed Central

    Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

    1995-01-01

    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible. Images Figure 2 Figure 3 PMID:8533755

  5. Analyzing the CDR3 Repertoire with respect to TCR—Beta Chain V-D-J and V-J Rearrangements in Peripheral T Cells using HTS

    PubMed Central

    Ma, Long; Yang, Liwen; Bin Shi; He, Xiaoyan; Peng, Aihua; Li, Yuehong; Zhang, Teng; Sun, Suhong; Ma, Rui; Yao, Xinsheng

    2016-01-01

    V-D-J rearrangement of the TCR—beta chain follows the 12/23 rule and the beyond 12/23 restriction. Currently, the proportion and characteristics of TCR—beta chain V—J rearrangement is unclear. We used high-throughput sequencing to compare and analyze TCR—beta chain V-J rearrangement and V-D-J rearrangement in the CDR3 repertoires of T cells from the PBMCs of six volunteers and six BALB/c mice. The results showed that the percentage of V-J rearrangement of the volunteers was approximately 0.7%, whereas that of the mice was 2.2%. The clonality of mice V-J rearrangement was significantly reduced compared with the V-D-J rearrangement, whereas the clonality of human V-J rearrangement was slightly reduced compared with the V-D-J rearrangement. V-J rearrangement in CDR3 involved the significant usage of N, S, F and L, whereas V-D-J rearrangement in CDR3 involved the significant usage of R and G. The levels of V deletion and J deletion in V-J rearrangement were significantly reduced compared with V-D-J rearrangement. TRBD and TRBJ usage in V-J rearrangement differed from that of V-D-J rearrangement, including dominant usage of TRBV and TRBJ and their pairing. Taken together, these results provide new ideas and technology for studies of V-D-J rearrangement and V-J rearrangement in the CDR3 repertoire. PMID:27404392

  6. Expression of two CYP1A genes in {beta}NF and TCDD-treated rainbow trout primary hepatocyte culture

    SciTech Connect

    Rabergh, C.M.; Lipsky, M.M.; Vroliijk, N.H.; Chen, T.T.

    1995-12-31

    In mammalian systems, it is well known that two CYP1A genes are expressed in response to environmental toxicants such as polycyclic aromatic hydrocarbons (PAHs) and TCDD (2,3,7,3-tetrachlorodibenzo-p-dioxin). The presence of two CYP1A genes in fish has been previously reported, though expression of these two genes has not been characterized. In this study, the authors examined the expression of these two genes in primary culture of rainbow trout hepatocytes treated with {beta}NF and TCDD. Hepatocytes were isolated by a modified two-step collagenase perfusion of the liver and cultured on polylysine coated dishes. The optimum time and concentration of induction was determined for both chemicals. The expression of the genes was also studied in long-term cultures up to 20 days. RNA was isolated by the method of Chomzynski and Sacchi and the RNase protection assay was used to detect the expression of the CYP1A genes by using antisense riboprobes specific for the MRNA of each gene. A differential concentration- and time-dependent expression of the two genes was observed in cells treated with {beta}NF and TCDD. Whether these two genes are paralogous, i.e., produced by gene duplication within the species, or whether one of them may in fact be an orthologue to a mammalian counterpart within the CYP1A family, remains to be determined.

  7. Regulation of T cell receptor beta gene rearrangements and allelic exclusion by the helix-loop-helix protein, E47.

    PubMed

    Agata, Yasutoshi; Tamaki, Nobuyuki; Sakamoto, Shuji; Ikawa, Tomokatsu; Masuda, Kyoko; Kawamoto, Hiroshi; Murre, Cornelis

    2007-12-01

    Allelic exclusion of antigen-receptor genes is ensured primarily by monoallelic locus activation upon rearrangement and subsequently by feedback inhibition of continued rearrangement. Here, we demonstrated that the basic helix-loop-helix protein, E47, promoted T cell receptor beta (TCRbeta) gene rearrangement by directly binding to target gene segments to increase chromatin accessibility in a dosage-sensitive manner. Feedback signaling abrogated E47 binding, leading to a decline in accessibility. Conversely, enforced expression of E47 induced TCRbeta gene rearrangement by antagonizing feedback inhibition. Thus, the abundance of E47 is rate limiting in locus activation, and feedback signaling downregulates E47 activity to ensure allelic exclusion. PMID:18093539

  8. Detection of tetracycline resistance genes in bacteria isolated from fish farms using polymerase chain reaction

    PubMed Central

    Hedayatianfard, Keshvad; Akhlaghi, Mostafa; Sharifiyazdi, Hassan

    2014-01-01

    Five common tetracycline resistance genes tet(A), tet(B), tet(M), tet(O) and tet(S) were studied by polymerase chain reaction in 100 bacteria isolated from Iranian fish farms. In the antibiogram test most of the bacteria were either intermediately or completely resistant to tetracycline. Nine isolates out of 46 Aeromonas spp. contained either tet(A/M/S) resistant genes as follows: tet(A) in A. veronii/sobria (n = 1), A. media (n = 2), A. aquariorum (n = 1), and A. veronii (n = 3); tet(M) in one isolate of A. sobria and tet(S) in 1 isolate of A. jandaei. In other bacteria, tet(A) gene was detected in Citrobacter freundi (n = 1), Pseudomonas putida (n = 1); tet(S) was also identified in Yersinia ruckeri (n = 1), Arthrobacter arilaitensis (n = 1) and P. putida (n = 1). In total, 31 isolates (31.00%) contained the tetracycline resistance genes in which 21 bacteria (21.00%) showed the tet(S), nine bacteria (9.00%) contained the tet(A) and 1 bacteria (1.00%) was positive for tet(M). All of the L. garvieae isolates contained tet(S) in this study. The most widely distributed resistance gene was gene tet(A) and the least known resistance genes was tet(M) among the studied bacteria of the genus Aeromonas in this study. PMID:25610578

  9. Regulatory elements and structural features of Beta vulgaris polygalacturonase-inhibiting protein gene for fungal and pest control

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase-inhibiting proteins (PGIPs) are involved in plant defense. PGIPs are cell wall leucine-rich repeat (LRR) proteins that are known to inhibit pathogen and pest polygalacturonases (PGs) during the infection process. Several sugar beet (Beta vulgaris L.) PGIP genes (BvPGIP) were clon...

  10. Understanding the links among neuromedin U gene, beta2-adrenoceptor gene and bone health: an observational study in European children.

    PubMed

    Gianfagna, Francesco; Cugino, Daniela; Ahrens, Wolfgang; Bailey, Mark E S; Bammann, Karin; Herrmann, Diana; Koni, Anna C; Kourides, Yiannis; Marild, Staffan; Molnár, Dénes; Moreno, Luis A; Pitsiladis, Yannis P; Russo, Paola; Siani, Alfonso; Sieri, Sabina; Sioen, Isabelle; Veidebaum, Toomas; Iacoviello, Licia

    2013-01-01

    Neuromedin U, encoded by the NMU gene, is a hypothalamic neuropeptide that regulates both energy metabolism and bone mass. The beta-2 adrenergic receptor, encoded by the ADRB2 gene, mediates several effects of catecholamine hormones and neurotransmitters in bone. We investigated whether NMU single nucleotide polymorphisms (SNPs) and haplotypes, as well as functional ADRB2 SNPs, are associated with bone stiffness in children from the IDEFICS cohort, also evaluating whether NMU and ADRB2 interact to affect this trait. A sample of 2,274 subjects (52.5% boys, age 6.2 ± 1.8 years) from eight European countries, having data on calcaneus bone stiffness index (SI, mean of both feet) and genotyping (NMU gene: rs6827359, rs12500837, rs9999653; ADRB2 gene: rs1042713, rs1042714), was studied. After false discovery rate adjustment, SI was significantly associated with all NMU SNPs. rs6827359 CC homozygotes showed the strongest association (recessive model, Δ= -1.8, p=0.006). Among the five retrieved haplotypes with frequencies higher than 1% (range 2.0-43.9%), the CCT haplotype (frequency=39.7%) was associated with lower SI values (dominant model, Δ= -1.0, p=0.04) as compared to the most prevalent haplotype. A non-significant decrease in SI was observed in in ADRB2 rs1042713 GG homozygotes, while subjects carrying SI-lowering genotypes at both SNPs (frequency = 8.4%) showed much lower SI than non-carriers (Δ= -3.9, p<0.0001; p for interaction=0.025). The association was more evident in preschool girls, in whom SI showed a curvilinear trend across ages. In subgroup analyses, rs9999653 CC NMU or both GG ADRB2 genotypes were associated with either lower serum calcium or β-CrossLaps levels (p=0.01). This study in European children shows, for the first time in humans, a role for NMU gene through interaction with ADRB2 gene in bone strength regulation, more evident in preschool girls. PMID:23936460

  11. Understanding the Links among neuromedin U Gene, beta2-adrenoceptor Gene and Bone Health: An Observational Study in European Children

    PubMed Central

    Gianfagna, Francesco; Cugino, Daniela; Ahrens, Wolfgang; Bailey, Mark E. S.; Bammann, Karin; Herrmann, Diana; Koni, Anna C.; Kourides, Yiannis; Marild, Staffan; Molnár, Dénes; Moreno, Luis A.; Pitsiladis, Yannis P.; Russo, Paola; Siani, Alfonso; Sieri, Sabina; Sioen, Isabelle; Veidebaum, Toomas; Iacoviello, Licia

    2013-01-01

    Neuromedin U, encoded by the NMU gene, is a hypothalamic neuropeptide that regulates both energy metabolism and bone mass. The beta-2 adrenergic receptor, encoded by the ADRB2 gene, mediates several effects of catecholamine hormones and neurotransmitters in bone. We investigated whether NMU single nucleotide polymorphisms (SNPs) and haplotypes, as well as functional ADRB2 SNPs, are associated with bone stiffness in children from the IDEFICS cohort, also evaluating whether NMU and ADRB2 interact to affect this trait. A sample of 2,274 subjects (52.5% boys, age 6.2±1.8 years) from eight European countries, having data on calcaneus bone stiffness index (SI, mean of both feet) and genotyping (NMU gene: rs6827359, rs12500837, rs9999653; ADRB2 gene: rs1042713, rs1042714), was studied. After false discovery rate adjustment, SI was significantly associated with all NMU SNPs. rs6827359 CC homozygotes showed the strongest association (recessive model, Δ = −1.8, p = 0.006). Among the five retrieved haplotypes with frequencies higher than 1% (range 2.0–43.9%), the CCT haplotype (frequency = 39.7%) was associated with lower SI values (dominant model, Δ = −1.0, p = 0.04) as compared to the most prevalent haplotype. A non-significant decrease in SI was observed in in ADRB2 rs1042713 GG homozygotes, while subjects carrying SI-lowering genotypes at both SNPs (frequency = 8.4%) showed much lower SI than non-carriers (Δ = −3.9, p<0.0001; p for interaction = 0.025). The association was more evident in preschool girls, in whom SI showed a curvilinear trend across ages. In subgroup analyses, rs9999653 CC NMU or both GG ADRB2 genotypes were associated with either lower serum calcium or β-CrossLaps levels (p = 0.01). This study in European children shows, for the first time in humans, a role for NMU gene through interaction with ADRB2 gene in bone strength regulation, more evident in preschool girls. PMID:23936460

  12. Asthma: Gln27Glu and Arg16Gly polymorphisms of the beta2-adrenergic receptor gene as risk factors

    PubMed Central

    2014-01-01

    Background Asthma is caused by both environmental and genetic factors. The ADRB2 gene, which encodes the beta 2-adrenergic receptor, is one of the most extensively studied genes with respect to asthma prevalence and severity. The Arg16Gly (+46A > G) and Gln27Glu (+79C > G) polymorphisms in the ADRB2 gene cause changes in the amino acids flanking the receptor ligand site, altering the response to bronchodilators and the risk of asthma through complex pathways. The ADRB2 polymorphisms affect beta-adrenergic bronchodilator action and are a tool to identify at-risk populations. Objective To determine the frequency of these two polymorphisms in allergic asthma patients and healthy subjects and to correlate these data with the occurrence and severity of asthma. Methods Eighty-eight allergic asthma patients and 141 healthy subjects were included in this study. The ADRB2 polymorphisms were analyzed using the amplification-refractory mutation system – polymerase chain reaction (ARMS-PCR) technique. The statistical analysis was performed with the SPSS 21.0 software using the Fisher’s Exact and χ2 tests. Results The ADRB2 polymorphisms were associated with asthma occurrence. The Arg16Arg, Gln27Gln and Gln27Glu genotypes were risk factors; the odds ratios were 6.782 (CI = 3.07 to 16.03), 2.120 (CI = 1.22 to 3.71) and 8.096 (CI = 3.90 to 17.77), respectively. For the Gly16Gly and Glu27Glu genotypes, the odds ratios were 0.312 (CI = 0.17 to 0.56) and 0.084 (CI = 0.04 to 0.17), respectively. The haplotype analysis showed that there were associations between the following groups: Arg16Arg-Gln27Gln (OR = 5.108, CI = 1.82 to 16.37), Gly16Gly-Glu27Glu (OR = 2.816, CI = 1.25 to 6.54), Arg16Gly-Gln27Glu (OR = 0.048, CI = 0.01 to 0.14) and Gly16Gly-Gln27Glu (OR = 0.1036, CI = 0.02 to 0.39). The polymorphism Gln27Glu was associated with asthma severity, as the Gln27Gln genotype was a risk factor for severe asthma (OR

  13. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carrying IMP-1 metallo-beta-lactamase gene in a University Hospital in Turkey.

    PubMed

    Ozgumus, Osman Birol; Caylan, Rahmet; Tosun, Ilknur; Sandalli, Cemal; Aydin, Kemalettin; Koksal, Iftihar

    2007-01-01

    Pseudomonas aeruginosa isolates carrying IMP- or VIM-type metallo-beta-lactamase (MBL) have been increasingly reported in hospitals worldwide. One hundred P. aeruginosa clinical isolates from unrelated inpatients hospitalized at a Turkish university hospital were screened for the presence of bla(IMP) and bla(VIM) genes by polymerase chain reaction (PCR). One (1%) isolate was found to carry a VIM-type MBL gene, whereas nine (9%) carried an IMP-1 MBL gene carried on a cassette inserted into a class 1 integron. Only four of the IMP producers were detected as MBL producers according to E-test MBL. Minimum inhibitory concentrations (MICs) of imipenem for the IMP-1 and VIM-type MBL-producers were highly variable (MIC values, 8-128 mug/ml). Imipenem resistance was not plasmid-mediated according to the transformation assays. Piperacillin/tazobactam was the only effective drug in antimicrobial susceptibility testing. No aztreonam-resistant IMP and VIM producers were detected to produce an extended-spectrum beta-lactamase (ESBL). Three class 1 integrons of approximately 2,300 bp, 1,800 bp, and 1,500 bp in size were detected in each of the nine IMP-positive isolates. Sequencing revealed three novel gene cassette arrays, aac(3)-1c-cmlA5, bla(IMP-1)-aadA7-like, and aacA7-smr-2-orfD. Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) indicated that a clonal spread of IMP-1-producers had occurred in this hospital. PMID:17949306

  14. Defects in the HSD11 gene encoding 11[beta]-hydroxysteriod dehydrogenase are not found in patients with apparent mineralocorticoid excess or 11-oxoreductase deficiency

    SciTech Connect

    Nikkila, H.; White, P.C. ); Tannin, G.M. ); New, M.I.; Taylor, N.F. ); Kalaitzoglou, G.; Monder, C. )

    1993-09-01

    The syndrome of apparent mineralocorticoid excess (AME) is a form of low renin hypertension that is thought to be caused by congenital deficiency of 11[beta]-hydroxysteroid dehydrogenase (11HSD) activity. This enzyme converts cortisol to cortisone and apparently prevents cortisol from acting as a ligand for the mineralocorticoid (type I) receptor. It also catalyzes the reverse oxoreductase (cortisone to cortisol) reaction. Four patients with AME and the parents of the first patient described (now deceased) were analyzed for mutations in the cloned HSD11 gene encoding an 11HSD enzyme. A patient with suspected cortisone reductase deficiency was also studied. No gross deletions or rearrangements in the HSD11 gene were apparent on hybridizations of blot of genomic DNA. Direct sequencing of polymerase chain reaction-amplified fragments corresponding to the coding sequences, intronexon junctions, and proximal untranslated regions of this gene revealed no mutations. AME may involve mutations in a gene for another enzyme with 11HSD activity or perhaps another cortisol metabolizing enzyme. 48 refs., 2 figs., 2 tabs.

  15. Use of polymerase chain reaction-amplified Helicobacter pylori urease structural genes for differentiation of isolates.

    PubMed Central

    Foxall, P A; Hu, L T; Mobley, H L

    1992-01-01

    Helicobacter pylori has been demonstrated as an etiologic agent of human gastritis and peptic ulcer formation. However, there is no straightforward basis to distinguish different isolates. We used the polymerase chain reaction (PCR) to amplify the urease structural subunit genes, ureA and ureB, which, when digested with appropriate restriction endonucleases, allow the differentiation of patterns on agarose gels. PCR amplification was possible with DNA rapidly extracted from H. pylori by alkaline lysis and phenol-chloroform. The 2.4-kb PCR products amplified from 22 clinical isolates and subjected to HaeII restriction endonuclease digestion produced 10 distinct patterns on agarose gels, with two patterns being shared between five and six strains. PCR amplification of the urease genes may enable the differentiation of closely related H. pylori strains by restriction digest analysis of PCR-amplified ureA and ureB genes. Images PMID:1313051

  16. Polymerase chain reaction comparison of the gene for strictosidine synthase from ten Rauvolfia species.

    PubMed

    Bracher, D; Kutchan, T M

    1992-05-01

    The gene for strictosidine synthase, str1, has been analyzed by the polymerase chain reaction in ten species of Rauvolfia, the origins of which span the tropical belt: R. cambodiana (Indochina), R. canescens (India), R. chinensis (China), R. heterophylla (Central America), R. mannii (West Africa), R. nitida (West Indies), R. praecox (Brasil), R. serpentina (India), R. sumatrana (Indonesia) and R. verticillata (Indochina). Restriction endonuclease analysis of the gene fragments produced with genomic DNA from each of the ten species as template revealed that str1 is highly conserved in the Rauvolfia species investigated. These results suggest that there is a stringent selection pressure on the gene for this key enzyme of indole alkaloid biosynthesis. PMID:24202981

  17. Possible deletion of a developmentally regulated heavy-chain variable region gene in autoimmune diseases

    SciTech Connect

    Yang, Pei-Ming; Olee, Tsaiwei; Kozin, F.; Carson, D.A.; Chen, P.P. ); Olsen, N.J. ); Siminovitch, K.A. )

    1990-10-01

    Several autoantibody-associated variable region (V) genes are preferentially expressed during early ontogenic development, suggesting strongly that they are of developmental and physiological importance. As such, it is possible that polymorphisms in one or more of these genes may alter susceptibility to autoimmune disease. The authors have searched extensively for a probe related to a developmentally regulated V gene that has the power to differentiate among highly homologous V genes in human populations. Using such a probe (i.e., Humhv3005/P1) related to both anti-DNA and anti-IgG autoantibodies, they studied restriction fragment length polymorphisms in patients with rheumatoid arthritis and systemic lupus erythematosus and found an apparent heavy-chain V (V{sub H}) gene deletion that was nearly restricted to the autoimmune patients. These data suggest that deletions of physiologically important V{sub H} genes may increase the risk of autoimmunity through indirect effects on the development and homeostasis of the B-cell repertoire.

  18. Organization and genomic complexity of sheep immunoglobulin light chain gene loci.

    PubMed

    Qin, Tong; Liu, Zhihong; Zhao, Huijing

    2015-12-01

    Sheep is the representative of the artiodactyla and is an agriculturally important animal, but limited knowledge is available with regard to its immunoglobulin genes and their expression mechanisms in the sheep. Based on the recently released sheep genome, we have characterized the genomic organization of the sheep immunoglobulin light gene loci. The sheep Igλ locus, located on chromosome 17, contains 2Cλ segments each preceded by a Jλ, but the Cλ2 appears to be a pseudogene. A total of 42 Vλ segments (14 potentially functional genes, 1 ORF and 27 pseudogenes) were identified. In contrast, the Igκ locus on chromosome 3 contains only a single Cκ gene, 3 Jk segments and 13 Vκ segments (8 potentially functional genes and 5 pseudogenes). Analysis of junctions of the recombined VJ transcripts revealed a restricted Vλ4-Jλ1-Cλ1 recombination and Vk6-Jk3-Cκ recombination, respectively encode most of λ and κ chain antibody repertoire in the sheep despite more potential germline encoded combinatorial diversity. Therefore, the sheep may use gene conversion in combination with somatic hypermutation for antibody repertoire formation. PMID:26499865

  19. Arsenite oxidase aox genes from a metal-resistant beta-proteobacterium.

    PubMed

    Muller, Daniel; Lièvremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire

    2003-01-01

    The beta-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  20. NeuroD1/beta2 contributes to cell-specific transcription of the proopiomelanocortin gene.

    PubMed Central

    Poulin, G; Turgeon, B; Drouin, J

    1997-01-01

    NeuroD1/beta2 is a basic helix-loop-helix (bHLH) factor expressed in the endocrine cells of the pancreas and in a subset of neurons as they undergo terminal differentiation. We now show that NeuroD1 is expressed in corticotroph cells of the pituitary gland and that it is involved in cell-specific transcription of the proopiomelanocortin (POMC) gene. It was previously shown that corticotroph-specific POMC transcription depends in part on the action of cell-restricted bHLH factors that were characterized as the CUTE (corticotroph upstream transcription element) (M. Therrien and J. Drouin, Mol. Cell. Biol. 13:2342-2353, 1993) complexes. We now demonstrate that these complexes contain NeuroD1 in association with various ubiquitous bHLH dimerization partners. The NeuroD1-containing heterodimers specifically recognize and activate transcription from the POMC promoter E box that confers transcriptional specificity. Interestingly, the NeuroD1 heterodimers activate transcription in synergy with Ptx1, a Bicoid-related homeodomain protein, which also contributes to corticotroph specificity of POMC transcription. In the adult pituitary gland, NeuroD1 transcripts are detected in POMC-expressing corticotroph cells. Taken together with the restricted pattern of Ptx1 expression, these results suggest that these two factors establish the basis of a combinatorial code for the program of corticotroph-specific gene expression. PMID:9343431

  1. Automated two-column purification of iminobiotin and BrdU-labeled PCR products for rapid cloning: application to genes synthesized by polymerase chain assembly.

    PubMed

    TerMaat, Joel R; Mamedov, Tarlan G; Pienaar, Elsje; Whitney, Scott E; Subramanian, Anuradha

    2010-02-01

    Polymerase chain assembly (PCA) is a powerful tool for basic biological research and biotechnology applications. During the last several years, major advances have been made in de novo gene synthesis. However, there is still a need for fast and reproducible methods to automatically purify the synthesized genes. Upon completion of PCA, the subsequent PCR-amplified product mixture still contains undesired shorter DNA fragments that hinder cloning efforts. To avoid tedious gel purification, an automated two-column purification has been developed and used in conjunction with rapid PCA. The system enables fast synthesis and isolation of the full-length DNA of interest, important for facile cloning of desired DNA fragments. During the PCR amplification step, forward and reverse primers tagged with iminobiotin and bromodeoxyuridine labels, respectively, were used. The automated purification was then performed on the PCR mixture using two affinity/immunocapture columns in series to isolate only the desired full-length product. The procedure has been applied to the pUC19 beta-lactamase gene (929 bp). Follow-up PCR of the purified product, cloning, and sequencing demonstrated the technique's effectiveness in obtaining the pure full-length gene. The purification has also been performed on other synthesized genes, indicating its utility as a general approach. PMID:20109289

  2. beta-Glucosidase as a reporter for the gene expression studies in Thermus thermophilus and constitutive expression of DNA repair genes.

    PubMed

    Ohta, Toshihiro; Tokishita, Shin-Ichi; Imazuka, Reiko; Mori, Ichiro; Okamura, Jin; Yamagata, Hideo

    2006-07-01

    Thermus thermophilus is an extremely thermophilic eubacterium that grows optimally at 70-75 degrees C. Because the frequency of DNA damage, such as deamination, depurination and single-strand breaks, increases as the temperature rises, the regulation of expression as well as the specificities and activities of T.thermophilus DNA repair systems are of particular interest. To study those systems, we developed a gene expression vector using the T.thermophilus beta-glucosidase gene (bgl) with host strain JOS9 (Deltabgl) derived from the T.thermophilus wild-type strain HB27. Since HB27 has two putative beta-galactosidase genes, the use of a single bgl gene as a reporter in combination with a Deltabgl host strain permits the study of gene expression against a low background level. We assayed Bgl activity with 2-nitrophenyl-beta-d-glucopyranoside as the substrate at 80 degrees C. We measured the expression of seven genes involved in DNA repair--three nucleotide excision repair genes (uvrA, uvrB and uvrC) and four recombinational repair genes (recA, ruvA, ruvB and ruvC). Expression levels of uvrA and uvrB were about three times those of uvrC, while those of ruvA, ruvB and ruvC were almost equal. Both ruvA and ruvC formed an operon with their adjacent 5'-upstream gene paaG and ftsQAZ, respectively. recA was transcribed as an operon of four genes, amt-cinA-ligT-recA. All seven DNA repair genes were expressed constitutively, and the DNA damaging agent mitomycin C did not increase their expression. PMID:16777922

  3. Shared Gene Structures and Clusters of Mutually Exclusive Spliced Exons within the Metazoan Muscle Myosin Heavy Chain Genes

    PubMed Central

    Kollmar, Martin; Hatje, Klas

    2014-01-01

    Multicellular animals possess two to three different types of muscle tissues. Striated muscles have considerable ultrastructural similarity and contain a core set of proteins including the muscle myosin heavy chain (Mhc) protein. The ATPase activity of this myosin motor protein largely dictates muscle performance at the molecular level. Two different solutions to adjusting myosin properties to different muscle subtypes have been identified so far: Vertebrates and nematodes contain many independent differentially expressed Mhc genes while arthropods have single Mhc genes with clusters of mutually exclusive spliced exons (MXEs). The availability of hundreds of metazoan genomes now allowed us to study whether the ancient bilateria already contained MXEs, how MXE complexity subsequently evolved, and whether additional scenarios to control contractile properties in different muscles could be proposed, By reconstructing the Mhc genes from 116 metazoans we showed that all intron positions within the motor domain coding regions are conserved in all bilateria analysed. The last common ancestor of the bilateria already contained a cluster of MXEs coding for part of the loop-2 actin-binding sequence. Subsequently the protostomes and later the arthropods gained many further clusters while MXEs got completely lost independently in several branches (vertebrates and nematodes) and species (for example the annelid Helobdella robusta and the salmon louse Lepeophtheirus salmonis). Several bilateria have been found to encode multiple Mhc genes that might all or in part contain clusters of MXEs. Notable examples are a cluster of six tandemly arrayed Mhc genes, of which two contain MXEs, in the owl limpet Lottia gigantea and four Mhc genes with three encoding MXEs in the predatory mite Metaseiulus occidentalis. Our analysis showed that similar solutions to provide different myosin isoforms (multiple genes or clusters of MXEs or both) have independently been developed several times

  4. Structure of the human laminin {gamma}2 chain gene (LAMC2): Alternative splicing with different tissue distribution of two transcripts

    SciTech Connect

    Airenne, T.; Haakana, H.; Kallunki, T.

    1996-02-15

    This article discusses the exon-intron structure and tissue distribution of the laminin {gamma}2 chain (LAMC2) gene, which is mutated in some cases of junctional epidermolysis bullosa. The article also discusses the transcription and splicing of this gene, which result in alternative uses of the last two exons of the gene. The different tissue distributions of the transcripts indicate different functions for the gene in vivo. 36 refs., 8 figs., 3 tabs.

  5. Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease

    PubMed Central

    Grizot, Sylvestre; Smith, Julianne; Daboussi, Fayza; Prieto, Jesús; Redondo, Pilar; Merino, Nekane; Villate, Maider; Thomas, Séverine; Lemaire, Laetitia; Montoya, Guillermo; Blanco, Francisco J.; Pâques, Frédéric; Duchateau, Philippe

    2009-01-01

    Sequence-specific endonucleases recognizing long target sequences are emerging as powerful tools for genome engineering. These endonucleases could be used to correct deleterious mutations or to inactivate viruses, in a new approach to molecular medicine. However, such applications are highly demanding in terms of safety. Mutations in the human RAG1 gene cause severe combined immunodeficiency (SCID). Using the I-CreI dimeric LAGLIDADG meganuclease as a scaffold, we describe here the engineering of a series of endonucleases cleaving the human RAG1 gene, including obligate heterodimers and single-chain molecules. We show that a novel single-chain design, in which two different monomers are linked to form a single molecule, can induce high levels of recombination while safeguarding more effectively against potential genotoxicity. We provide here the first demonstration that an engineered meganuclease can induce targeted recombination at an endogenous locus in up to 6% of transfected human cells. These properties rank this new generation of endonucleases among the best molecular scissors available for genome surgery strategies, potentially avoiding the deleterious effects of previous gene therapy approaches. PMID:19584299

  6. Genes involved in long-chain alkene biosynthesis in Micrococcus luteus

    SciTech Connect

    Beller, Harry R.; Goh, Ee-Been; Keasling, Jay D.

    2010-01-07

    Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which four decades ago was reported to biosynthesize iso- and anteiso branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty-acid overproducing E. coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3 (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-CoA produced the same C27 monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or -ACP) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (?-ketoacyl-ACP synthase III), which catalyzes decarboxylative Claisen condensation during

  7. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    PubMed Central

    Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S

    1989-01-01

    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other alpha-amylases, such as Taka-amylase A. The 48-kilodalton (kDa) amylase isolated from B. polymyxa was proven to have alpha-amylase activity. The amino acid sequences of the peptides generated from the 48-kDa amylase showed complete agreement with the predicted amino acid sequence of the C-terminal portion. The B. polymyxa amylase gene was therefore concluded to contain in-phase beta- and alpha-amylase-coding sequences in the 5' and 3' regions, respectively. A precursor protein, a 130-kDa amylase, directed by a plasmid, pYN520, carrying the entire amylase gene, had both beta- and alpha-amylase activities. This represents the first report of a single protein precursor in procaryotes that gives rise to two enzymes. Images PMID:2464578

  8. A second glutamine synthetase gene with expression in the gills of the gulf toadfish (opsanus beta)

    SciTech Connect

    Walsh, Patrick J.; Mayer, Gregory D.; Medina, Monica; Bernstein, Matthew L.; Barimo, John F.; Mommsen, Thomas P.

    2003-05-08

    Enzyme and molecular biology approaches were used to more completely characterize the expression of the nitrogen metabolism enzyme glutamine synthetase [GSase; L-glutamate: ammonia ligase (ADP-forming), E.C. 6.3.1.2] in a variety of tissues of the gulf toadfish (Opsanus beta) subjected to unconfined (ammonotelic) and confined (ureotelic) conditions. Enzymological results demonstrate that while weight-specific GSase activities rank in the order of brain > liver > stomach {approx} kidney > intestine > gill> heart/spleen > muscle, when tissue mass is used to calculate a glutamine synthetic potential, the liver has the greatest, followed by muscle > stomach and intestine with minor contributions from the remaining tissues. Additionally, during confinement stress, GSase activity only increases significantly in liver (5-fold) and muscle (2-fold), tissues which previously showed significant expression of the other enzymes of urea synthesis. RT PCR and RACE PCR revealed the presence of a second GSas e cDNA from gill tissue that appears to share relatively low nucleotide and amino acid sequence similarity ({approx}73 percent) with the original GSase cloned from liver, and furthermore lacks a mitochondrial leader targeting sequence. RT PCR and restriction digestion experiments demonstrated that mRNA from the original ''liver'' GSase is expressed in all tissues examined (liver, gill, stomach, intestine, kidney, brain and muscle), whereas the new ''gill'' form shows expression primarily in the gill. Enzyme activities of gill GSase also exhibit a different subcellular compartmentation with apparent exclusive expression in the soluble compartment, whereas other tissues expressing the ''liver'' form show both cytoplasmic and mitochondrial activities. Finally, phylogenetic analysis of a number of GSases demonstrates that the toadfish gill GSase has a greater affinity for a clade that includes the Xenopus GSase genes and one of two Fugu GSase genes, than it has for a clade

  9. Baseline Gene Expression Signatures in Monocytes from Multiple Sclerosis Patients Treated with Interferon-beta

    PubMed Central

    Bustamante, Marta F.; Nurtdinov, Ramil N.; Río, Jordi; Montalban, Xavier; Comabella, Manuel

    2013-01-01

    Background A relatively large proportion of relapsing-remitting multiple sclerosis (RRMS) patients do not respond to interferon-beta (IFNb) treatment. In previous studies with peripheral blood mononuclear cells (PBMC), we identified a subgroup of IFNb non-responders that was characterized by a baseline over-expression of type I IFN inducible genes. Additional mechanistic experiments carried out in IFNb non-responders suggested a selective alteration of the type I IFN signaling pathway in the population of blood monocytes. Here, we aimed (i) to investigate whether the type I IFN signaling pathway is up-regulated in isolated monocytes from IFNb non-responders at baseline; and (ii) to search for additional biological pathways in this cell population that may be implicated in the response to IFNb treatment. Methods Twenty RRMS patients classified according to their clinical response to IFNb treatment and 10 healthy controls were included in the study. Monocytes were purified from PBMC obtained before treatment by cell sorting and the gene expression profiling was determined with oligonucleotide microarrays. Results and discussion Purified monocytes from IFNb non-responders were characterized by an over-expression of type I IFN responsive genes, which confirms the type I IFN signature in monocytes suggested from previous studies. Other relevant signaling pathways that were up-regulated in IFNb non-responders were related with the mitochondrial function and processes such as protein synthesis and antigen presentation, and together with the type I IFN signaling pathway, may also be playing roles in the response to IFNb. PMID:23637780

  10. The PPFLMLLKGSTR motif in globular domain 3 of the human laminin-5 {alpha}3 chain is crucial for integrin {alpha}3{beta}1 binding and cell adhesion

    SciTech Connect

    Kim, Jin-Man; Park, Won Ho; Min, Byung-Moo . E-mail: bmmin@snu.ac.kr

    2005-03-10

    Laminin-5 regulates various cellular functions, including cell adhesion, spreading, and motility. Here, we expressed the five human laminin {alpha}3 chain globular (LG) domains as monomeric, soluble fusion proteins, and examined their biological functions and signaling. Recombinant LG3 (rLG3) protein, unlike rLG1, rLG2, rLG4, and rLG5, played roles in cell adhesion, spreading, and integrin {alpha}3{beta}1 binding. More significantly, we identified a novel motif (PPFLMLLKGSTR) in the LG3 domain that is crucial for these responses. Studies with the synthetic peptides delineated the PPFLMLLKGSTR peptide within LG3 domain as a major site for both integrin {alpha}3{beta}1 binding and cell adhesion. Substitution mutation experiments suggest that the Arg residue is important for these activities. rLG3 protein- and PPFLMLLKGSTR peptide-induced keratinocyte adhesion triggered cell signaling through FAK phosphorylation at tyrosine-397 and -577. To our knowledge, this is the first report demonstrating that the PPFLMLLKGSTR peptide within the LG3 domain is a novel motif that is capable of supporting integrin {alpha}3{beta}1-dependent cell adhesion and spreading.

  11. Assignment of the gene for the. beta. subunit of thyroid-stimulating hormone to the short arm of human chromosome 1

    SciTech Connect

    Dracopoli, N.C.; Rettig, W.J.; Whitfield, G.K.; Darlington, G.J.; Spengler, B.A.; Biedler, J.L.; Old, L.J.; Kourides, I.A.

    1986-03-01

    The chromosomal locations of the genes for the ..beta.. subunit of human thyroid-stimulating hormone (TSH) and the glycoprotein hormone ..cap alpha.. subunit have been determined by restriction enzyme analysis of DNA extracted from rodent-human somatic cell hybrids. Human chorionic gonadotropin (CG) ..cap alpha..-subunit cDNA and a cloned 0.9-kilobase (kb) fragment of the human TSH ..beta..-subunit gene were used as hybridization probes in the analysis of Southern blots of DNA extracted from rodent-human hybrid clones. Analysis of the segregation of 5- and 10-kb EcoRI fragments hybridizing to CG ..cap alpha..-subunit cDNA confirmed the previous assignment of this gene to chromosome 6. Analysis of the patterns of segregation of a 2.3-kb EcoRI fragment containing human TSH ..beta..-subunit sequences permitted the assignment of the TSH ..beta..-subunit gene to human chromosome 1. The subregional assignment of TSH ..beta.. subunit to chromosome 1p22 was made possible by the additional analysis of a set of hybrids containing partially overlapping segments of this chromosome. Human TSH ..beta.. subunit is not syntenic with genes encoding the ..beta.. subunits of CG, luteinizing hormone, or follicle-stimulating hormone and is assigned to a conserved linkage group that also contains the structural genes for the ..beta.. subunit of nerve growth factor (NGFB) and the proto-oncogene N-ras (NRAS).

  12. Influence of beta(2)-integrin adhesion molecule expression and pulmonary infection with Pasteurella haemolytica on cytokine gene expression in cattle.

    PubMed

    Lee, H Y; Kehrli, M E; Brogden, K A; Gallup, J M; Ackermann, M R

    2000-07-01

    beta(2)-Integrins are leukocyte adhesion molecules composed of alpha (CD11a, -b, -c, or -d) and beta (CD18) subunit heterodimers. Genetic CD18 deficiency results in impaired neutrophil egress into tissues that varies between conducting airways and alveoli of the lung. In this study, we investigated whether CD18 deficiency in cattle affects proinflammatory cytokine (PIC) expression in pulmonary tissue after respiratory infection with Pasteurella haemolytica. Cattle were infected with P. haemolytica via fiberoptic deposition of organisms into the posterior part of the right cranial lung lobe. Animals were euthanized at 2 or 4 h postinoculation (p.i.), and tissues were collected to assess PIC gene expression using antisense RNA probes specific for bovine interleukin-1alpha (IL-1alpha), IL-1beta, IL-6, gamma interferon (IFN-gamma), and tumor necrosis factor alpha (TNF-alpha) along with the beta-actin (beta-Act) housekeeping gene. Expression of PIC was induced at 2 h p.i. in P. haemolytica-infected cattle and continued to 4 h p.i. At 2 h p.i., induction of gene expression and increase of cells that expressed PIC were observed both in CD18(+) and CD18(-) cattle after inoculation of P. haemolytica. The induction of gene expression with P. haemolytica inoculation was more prominent in CD18(-) cattle than in CD18(+) cattle by comparison to pyrogen-free saline (PFS)-inoculated control animals. At 4 h p.i., however, the induction of PIC, especially IL-1alpha, IL-6, and IFN-gamma, in the lungs of CD18(+) cattle inoculated with P. haemolytica was greater than that in lungs of the CD18(-) cattle. IFN-gamma and TNF-alpha genes were not increased in P. haemolytica-inoculated CD18(-) cattle lungs compared to the PFS-inoculated control lungs at 4 h p.i. In PFS-inoculated lungs, we generally observed a higher percentage of cells and higher level of gene expression in the lungs of CD18(-) cattle than in the lungs of CD18(+) cattle, especially at 4 h p.i. The rate of neutrophil

  13. Linkage of two human pregnancy-specific. beta. sub 1 -glycoprotein genes: One is associated with hydatidiform mole

    SciTech Connect

    Leslie, K.K.; Watanabe, Shuichiro; Lei, Kejian; Chou, D.Y.; Plouzek, C.A.; Deng, Hweichuang; Torres, J.; Chou, J.Y. )

    1990-08-01

    A genomic clone containing two linked human pregnancy-specific {beta}{sub 1}-glycoprotein (PS{beta}G) genes has been isolated and characterized. The two genes are arranged in the same 5{prime} {yields} 3{prime} orientation; the 3{prime} region (including the A2 and B-C exons) of the upstream gene, PSGGA, is linked to the 5{prime} region (including the 5{prime}/L and L/N exons) of PSGGB, the downstream gene. Depending upon the domains compared, PSGGA and PSGGB share 92-98% nucleotide and 86-95% amino acid sequence identity with PSG93, the most abundant PS{beta}G transcript. Northern blot hybridization performed with a PSGGB-specific oligonucleotide probe to the N domain revealed that PSGGB or a PSGGB-like gene encodes a major 1.7-kilobase mRNA in hydatidiform mole tissues and a major 2.0-kilobase mRNA in term placenta tissues. Moreover, the PSGGB-specific probe hybridized most strongly with mRNA from molar trophoblastic tissue, suggesting that the PSGGB-like species may be the gene preferentially expressed in gestational trophoblastic disease. Additionally, the sequence of a 2,315-base-pair PS{beta}G cDNA (PSG95) that contains an N-A1-A2-B2-C domain arrangement is reported. The coding region of PSG95 is identical to the previously reported cDNA clones PSG1d and FL-NCA, but PSG95 contains an additional 518 and 523 base pairs in the 3{prime} end as compared with PSG1d and FL-NCA, respectively.

  14. Mapping of Heavy Chain Genes for Mouse Immunoglobulins M and D

    NASA Astrophysics Data System (ADS)

    Liu, Chih-Ping; Tucker, Philip W.; Mushinski, J. Frederic; Blattner, Frederick R.

    1980-09-01

    A single DNA fragment containing both μ and δ immunoglobulin heavy chain genes has been cloned from normal BALB/c mouse liver DNA with a new λ phage vector Charon 28. The physical distance between the membrane terminal exon of μ and the first domain of δ is 2466 base pairs, with δ on the 3' side of μ . A single transcript could contain a variable region and both μ and δ constant regions. The dual expression of immunoglobulins M and D on spleen B cells may be due to alternate splicing of this transcript.

  15. Promoter for the human ferritin heavy chain-encoding gene (FERH): structural and functional characterization.

    PubMed

    Bevilacqua, M A; Giordano, M; D'Agostino, P; Santoro, C; Cimino, F; Costanzo, F

    1992-02-15

    We conducted a functional analysis of the promoter for the human ferritin heavy chain-encoding gene (pFERH) in HepG2 and HeLa cells. The activity of pFERH is equivalent in both cell types, despite their different ferritin (Fer) isotypes. Transfections of a series of 5'-deletion mutants indicate that pFERH activity is essentially dependent on two motifs. One of them, accounting for about 50% of the total transcriptional activity, is recognized by the RNA polymerase II transcription factor, Sp1, and the other by a low-affinity factor present in both the cell types analyzed. PMID:1541403

  16. Membrane type-1-matrix metalloproteinase expressed by prostate carcinoma cells cleaves human laminin-5 beta3 chain and induces cell migration.

    PubMed

    Udayakumar, Thirupandiyur S; Chen, Man Ling; Bair, Elisabeth L; Von Bredow, Dorothea C; Cress, Anne E; Nagle, Raymond B; Bowden, G Timothy

    2003-05-01

    Degradation of the extracellular matrix by proteolytic enzymes is a central aspect of physiological and pathologic tissue-remodeling processes such as trophoblastic implantation, wound healing, and tumor invasion. We have hypothesized that prostate adenocarcinoma cell invasion through the normal basal lamina is attributable in part to metalloproteinase-induced cleavage of laminin-5 (Ln-5) and enhanced motility of the cancer cells. We studied the role of membrane type-1-matrix metalloproteinase (MT1-MMP) expressed on the surface of prostate tumor cells in cleaving Ln-5 and enhancing the migration of prostate tumor cells. We also determined the nature of the MT1-MMP cleavage of human Ln-5 and how this altered Ln-5 changes the migration of prostate carcinoma cells. We found that human MT1-MMP cleaves purified human Ln-5 to an 80-kDa fragment. Mass spectrometry analyses of the 80-kDa cleaved product by trypsin and chymotrypsin gave 14 and 9 different peptide sequences, respectively, that were identical to the expected amino acid sequence of the Ln-5-beta3 chain. The recovered peptides represent 14.4% (trypsin) and 10.3% (chymotrypsin) of Ln-5-beta3 chain by amino acid count. Both trypsin and chymotrypsin digestion of MT1-MMP-cleaved product of Ln-5 did not show any other peptides that were identical to the other chains of Ln-5. Using a linear migration assay we found that the Ln-5 cleaved by MT1-MMP enhanced the migration of DU-145 prostate carcinoma cells by 2-fold compared with uncleaved Ln-5. The use of blocked antisense MT1-MMP oligonucleotides inhibited the migration of DU-145 cells on Ln-5. We also found that the prostate carcinoma cells expressing high levels of MT1-MMP, such as PC3N and PPC, demonstrated enhanced migration on human Ln-5-coated substrate, and this migration was inhibited using blocked antisense MT1-MMP oligonucleotides. In conclusion, this is a novel and important finding where we have shown that beta3-chain is cleaved by MT1-MMP, and this

  17. The Arabidopsis MUM2 gene encodes a beta-galactosidase required for the production of seed coat mucilage with correct hydration properties.

    PubMed

    Dean, Gillian H; Zheng, Huanquan; Tewari, Jagdish; Huang, Jun; Young, Diana S; Hwang, Yeen Ting; Western, Tamara L; Carpita, Nicholas C; McCann, Maureen C; Mansfield, Shawn D; Haughn, George W

    2007-12-01

    Seed coat development in Arabidopsis thaliana involves a complex pathway where cells of the outer integument differentiate into a highly specialized cell type after fertilization. One aspect of this developmental process involves the secretion of a large amount of pectinaceous mucilage into the apoplast. When the mature seed coat is exposed to water, this mucilage expands to break the primary cell wall and encapsulate the seed. The mucilage-modified2 (mum2) mutant is characterized by a failure to extrude mucilage on hydration, although mucilage is produced as normal during development. The defect in mum2 appears to reside in the mucilage itself, as mucilage fails to expand even when the barrier of the primary cell wall is removed. We have cloned the MUM2 gene and expressed recombinant MUM2 protein, which has beta-galactosidase activity. Biochemical analysis of the mum2 mucilage reveals alterations in pectins that are consistent with a defect in beta-galactosidase activity, and we have demonstrated that MUM2 is localized to the cell wall. We propose that MUM2 is involved in modifying mucilage to allow it to expand upon hydration, establishing a link between the galactosyl side-chain structure of pectin and its physical properties. PMID:18165329

  18. Stimulation of kappa light-chain gene rearrangement by the immunoglobulin mu heavy chain in a pre-B-cell line.

    PubMed Central

    Shapiro, A M; Schlissel, M S; Baltimore, D; DeFranco, A L

    1993-01-01

    B-lymphocyte development exhibits a characteristic order of immunoglobulin gene rearrangements. Previous work has led to the hypothesis that expression of the immunoglobulin mu heavy chain induces rearrangement activity at the kappa light-chain locus. To examine this issue in more detail, we isolated five matched pairs of mu- and endogenously rearranged mu+ cell lines from the Abelson murine leukemia virus-transformed pro-B-cell line K.40. In four of the five mu+ cell lines, substantial expression of mu protein on the cell surface was observed, and this correlated with an enhanced frequency of kappa immunoglobulin gene rearrangement compared with that in the matched mu- cell lines. This increased kappa gene rearrangement frequency was not due to a general increase in the amount of V(D)J recombinase activity in the mu+ cells. Consistently, introduction of a functionally rearranged mu gene into one of the mu- pre-B-cell lines resulted in a fivefold increase in kappa gene rearrangements. In three of the four clonally matched pairs with increased kappa gene rearrangements, the increase in rearrangement frequency was not accompanied by a significant increase in germ line transcripts from the C kappa locus. However, in the fourth pair, K.40D, we observed an increase in germ line transcription of the kappa locus after expression of mu protein encoded by either an endogenously rearranged or a transfected functional heavy-chain allele. In these cells, the amount of the germ line C kappa transcript correlated with the measured frequency of rearranged kappa genes. These results support a regulated model of B-cell development in which mu protein expression in some way targets the V(D)J recombinase to the kappa gene locus. Images PMID:8355709

  19. Involvement of activator protein 1 complexes in the epithelium-specific activation of the laminin gamma2-chain gene promoter by hepatocyte growth factor (scatter factor).

    PubMed Central

    Olsen, J; Lefebvre, O; Fritsch, C; Troelsen, J T; Orian-Rousseau, V; Kedinger, M; Simon-Assmann, P

    2000-01-01

    Laminin-5 is a trimer of laminin alpha3, beta3 and gamma2 chains that is found in the intestinal basement membrane. Deposition of the laminin gamma2 chain at the basement membrane is of great interest because it undergoes a developmental shift in its cellular expression. Here we study the regulatory elements that control basal and cytokine-activated transcriptional expression of the LAMC2 gene, which encodes the laminin gamma2 chain. By using transient transfection experiments we demonstrated the presence of constitutive and cytokine-responsive cis-elements. Comparison of the transcriptional activity of the LAMC2 promoter in the epithelial HT29mtx cells with that in small-intestinal fibroblastic cells (C20 cells) led us to conclude that two regions with constitutive epithelium-specific activity are present between positions -1.2 and -0.12 kb. This was further validated by transfections of primary foetal intestinal endoderm and mesenchyme. A 2.5 kb portion of the LAMC2 5' flanking region was equally responsive to PMA and hepatocyte growth factor (HGF), whereas it was less responsive to transforming growth factor beta1. A minimal promoter limited to the initial 120 bp upstream of the transcriptional start site maintained inducibility by PMA and HGF. This short promoter fragment contains two activator protein 1 (AP-1) elements and the 5'-most of these is a composite AP-1/Sp1 element. The 5'AP-1 element is crucial to the HGF-mediated activity of the promoter; analysis of interacting nuclear proteins demonstrated that AP-1 proteins containing JunD mediate the response to HGF. PMID:10749670

  20. Evolutionary diversification of the BetaM interactome acquired through co-option of the ATP1B4 gene in placental mammals

    PubMed Central

    Korneenko, Tatyana V.; Pestov, Nikolay B.; Ahmad, Nisar; Okkelman, Irina A.; Dmitriev, Ruslan I.; Shakhparonov, Mikhail I.; Modyanov, Nikolai N.

    2016-01-01

    ATP1B4 genes represent a rare instance of orthologous vertebrate gene co-option that radically changed properties of the encoded BetaM proteins, which function as Na,K-ATPase subunits in lower vertebrates and birds. Eutherian BetaM has lost its ancestral function and became a muscle-specific resident of the inner nuclear membrane. Our earlier work implicated BetaM in regulation of gene expression through direct interaction with the transcriptional co-regulator SKIP. To gain insight into evolution of BetaM interactome we performed expanded screening of eutherian and avian cDNA libraries using yeast-two-hybrid and split-ubiquitin systems. The inventory of identified BetaM interactors includes lamina-associated protein LAP-1, myocyte nuclear envelope protein Syne1, BetaM itself, heme oxidases HMOX1 and HMOX2; transcription factor LZIP/CREB3, ERGIC3, PHF3, reticulocalbin-3, and β-sarcoglycan. No new interactions were found for chicken BetaM and human Na,K-ATPase β1, β2 and β3 isoforms, indicating the uniqueness of eutherian BetaM interactome. Analysis of truncated forms of BetaM indicates that residues 72-98 adjacent to the membrane in nucleoplasmic domain are important for the interaction with SKIP. These findings demonstrate that evolutionary alterations in structural and functional properties of eutherian BetaM proteins are associated with the increase in its interactome complexity. PMID:26939788

  1. Evolutionary diversification of the BetaM interactome acquired through co-option of the ATP1B4 gene in placental mammals.

    PubMed

    Korneenko, Tatyana V; Pestov, Nikolay B; Ahmad, Nisar; Okkelman, Irina A; Dmitriev, Ruslan I; Shakhparonov, Mikhail I; Modyanov, Nikolai N

    2016-01-01

    ATP1B4 genes represent a rare instance of orthologous vertebrate gene co-option that radically changed properties of the encoded BetaM proteins, which function as Na,K-ATPase subunits in lower vertebrates and birds. Eutherian BetaM has lost its ancestral function and became a muscle-specific resident of the inner nuclear membrane. Our earlier work implicated BetaM in regulation of gene expression through direct interaction with the transcriptional co-regulator SKIP. To gain insight into evolution of BetaM interactome we performed expanded screening of eutherian and avian cDNA libraries using yeast-two-hybrid and split-ubiquitin systems. The inventory of identified BetaM interactors includes lamina-associated protein LAP-1, myocyte nuclear envelope protein Syne1, BetaM itself, heme oxidases HMOX1 and HMOX2; transcription factor LZIP/CREB3, ERGIC3, PHF3, reticulocalbin-3, and β-sarcoglycan. No new interactions were found for chicken BetaM and human Na,K-ATPase β1, β2 and β3 isoforms, indicating the uniqueness of eutherian BetaM interactome. Analysis of truncated forms of BetaM indicates that residues 72-98 adjacent to the membrane in nucleoplasmic domain are important for the interaction with SKIP. These findings demonstrate that evolutionary alterations in structural and functional properties of eutherian BetaM proteins are associated with the increase in its interactome complexity. PMID:26939788

  2. Molecular cloning and sequencing of two phospho-beta-galactosidase I and II genes of Lactobacillus gasseri JCM1031 isolated from human intestine.

    PubMed

    Saito, T; Suzuki, M; Konno, K; Kitazawa, H; Kawai, Y; Itoh, T; Kamio, Y

    1998-12-01

    Lactobacillus (Lb.) gasseri JCM1031, which is classified into the B1 subgroup of the Lb. acidophilus group of lactic acid bacteria, characteristically produces two different phospho-beta-galactosidases (P-beta-gal) I and II in the same cytosol as reported in our previous papers [Biosci. Biotech. Biochem., 60, 139-141, 708-710 (1996)]. To clarify the functional and genetic properties of the two enzymes, the structural genes of P-beta-gal I and II were cloned and sequenced. The structural gene of P-beta-gal I had 1,446 bp, encoding a polypeptide of 482 amino acid residues. The structural gene of P-beta-gal II had 1,473 bp, encoding a polypeptide of 491 amino acid residues. The deduced relative molecular masses of 55,188 and 56,243 agreed well with the previous value obtained from the purified P-beta-gal I and II protein, respectively. Multiple alignment of the protein sequence of P-beta-gal I and II with those of P-beta-gals from 5 microorganisms had 30-35% identity on the amino acid level, but those with phospho-beta-glucosidases from 5 microorganisms had the relatively high identity of about 50%. Considering that this strain grows on lactose medium and shows no beta-galactosidase activity, and that purified P-beta-gal I and II can obviously hydrolyze o-nitrophenyl-beta-D-galactopyranoside 6-phosphate (substrate), and also the conservation of a cysteine residue in the molecule, the P-beta-gal I and II were each confirmed as a novel P-beta-gal enzyme. PMID:9972258

  3. Interleukin-1 beta, interferon-gamma, and tumor necrosis factor-alpha gene expression in peripheral blood mononuclear cells of patients with coronary artery disease

    PubMed Central

    Enayati, Samaneh; Seifirad, Soroush; Amiri, Parvin; Abolhalaj, Milad; Mohammad -Amoli, Mahsa

    2015-01-01

    BACKGROUND Several inflammatory mediators have been proposed to contribute to the pathogenesis of atherosclerosis. The aim of this study was to evaluate the quantitative expression of pro-inflammatory cytokines in un-stimulated peripheral blood mononuclear cell of patients with coronary artery disease (CAD). METHODS Interleukin-1 beta (IL-1β), tumor necrosis factor-alpha, and interferon-gamma (IFN-γ) gene expression were evaluated in angiography confirmed patients with and without CAD in a case-control study using quantitative real-time polymerase chain reaction. RESULTS A significant increase (P = 0.030) in IL-1β gene expression was found in patients with CAD [median interquartile range (IQR) = 4.890 (6.084)] compared to patients without CAD [median (IQR) = 1.792 (3.172)]. Despite the increase in IFN-γ gene expression in patients with CAD [median (IQR) = 1.298 (3.896)] versus patients without CAD [median (IQR) = 0.841 (2.79)], there was not statistically significant difference (P = 0.990). CONCLUSION Our results provide evidence for possible association between IL-1β and development of atherosclerosis as a crucial cytokine that induce a network of signaling pathways. This finding if proved in future would suggest IL-1β as a potent therapeutic target in CAD. PMID:26715931

  4. Diacyltransferase Activity and Chain Length Specificity of Mycobacterium tuberculosis PapA5 in the Synthesis of Alkyl Beta-Diol Lipids

    PubMed Central

    Touchette, Megan H.; Bommineni, Gopal R.; Delle Bovi, Richard J.; Gadbery, John E.; Nicora, Carrie D.; Shukla, Anil K.; Kyle, Jennifer E.; Metz, Thomas O.; Martin, Dwight W.; Sampson, Nicole S.; Miller, W. Todd; Tonge, Peter J.; Seeliger, Jessica C.

    2015-01-01

    Although classified as Gram-positive bacteria, Corynebacterineae possess an asymmetric outer membrane that imparts structural and thereby physiological similarity to more distantly related Gram-negative bacteria. Like lipopolysaccharide in Gram-negative bacteria, lipids in the outer membrane of Corynebacterineae have been associated with the virulence of pathogenic species such as Mycobacterium tuberculosis (Mtb). For example, Mtb strains that lack long, branched-chain alkyl esters known as dimycocerosates (DIMs) are significantly attenuated in model infections. The resultant interest in the biosynthetic pathway of these unusual virulence factors has led to the elucidation of many of the steps leading to the final esterification of the alkyl beta-diol, phthiocerol, with branched-chain fatty acids known as mycocerosates. PapA5 is an acyltransferase implicated in these final reactions. We here show that PapA5 is indeed the terminal enzyme in DIM biosynthesis by demonstrating its dual esterification activity and chain-length preference using synthetic alkyl beta-diol substrate analogues. Applying these analogues to a series of PapA5 mutants, we also revise a model for the substrate binding within PapA5. Finally, we demonstrate that the Mtb Ser/Thr kinases PknB and PknE modify PapA5 on three overlapping Thr residues and a fourth Thr is unique to PknE phosphorylation. These results clarify the DIM biosynthetic pathway and indicate post-translational modifications that warrant further elucidation for their roles in regulation DIM biosynthesis. PMID:26271001

  5. Localization of the human {beta}-catenin gene (CTNNB1) to 3p21: A region implicated in tumor development

    SciTech Connect

    Kraus, C.; Liehr, T.; Ballhausen, G.

    1994-09-01

    The human {beta}-catenin locus (CTNNB1) was mapped by in situ fluorescence analysis to band p21 on the short arm of chromosome 3, a region frequently affected by somatic alterations in a variety of tumors. PCR primers for the genomic amplification of {beta}-catenin sequences were selected on the basis of homology to exon 4 of the Drosophila armadillo gene. Analysis of a panel of somatic cell hybrids confirmed the localization of {beta}-catenin on human chromosome 3. Furthermore, exclusion mapping of three hybrids carrying defined fragments of the short arm of human chromosome 3 allowed us to determine the position of the CTNNB1 locus close to the marker D3S2 in 3p21. 22 refs., 3 figs.

  6. Two forms of loops generate the chromatin conformation of the immunoglobulin heavy chain gene locus

    PubMed Central

    Guo, Changying; Gerasimova, Tatiana; Hao, Haiping; Ivanova, Irina; Chakraborty, Tirtha; Selimyan, Roza; Oltz, Eugene M.; Sen, Ranjan

    2013-01-01

    SUMMARY The immunoglobulin heavy chain (IgH) gene locus undergoes radial re-positioning within the nucleus and locus contraction in preparation for gene recombination. We demonstrate that IgH locus conformation involves two levels of chromosomal compaction. At the first level the locus folds into several multi-looped domains. One such domain at the 3′ end of the locus requires an enhancer, Eμ; two other domains at the 5′ end are Eμ-independent. At the second level, these domains are brought into spatial proximity by Eμ-dependent interactions with specific sites within the VH region. Eμ is also required for radial re-positioning of IgH alleles indicating its essential role in large scale chromosomal movements in developing lymphocytes. Our observations provide a comprehensive view of the conformation of IgH alleles in pro-B cells and the mechanisms by which it is established. PMID:21982154

  7. Short Chain Fatty Acids (SCFA) Reprogram Gene Expression in Human Malignant Epithelial and Lymphoid Cells.

    PubMed

    Astakhova, Lidiia; Ngara, Mtakai; Babich, Olga; Prosekov, Aleksandr; Asyakina, Lyudmila; Dyshlyuk, Lyubov; Midtvedt, Tore; Zhou, Xiaoying; Ernberg, Ingemar; Matskova, Liudmila

    2016-01-01

    The effect of short chain fatty acids (SCFAs) on gene expression in human, malignant cell lines was investigated, with a focus on signaling pathways. The commensal microbial flora produce high levels of SCFAs with established physiologic effects in humans. The most abundant SCFA metabolite in the human microflora is n-butyric acid. It is well known to activate endogenous latent Epstein-Barr virus (EBV), that was used as a reference read out system and extended to EBV+ epithelial cancer cell lines. N-butyric acid and its salt induced inflammatory and apoptotic responses in tumor cells of epithelial and lymphoid origin. Epithelial cell migration was inhibited. The n-butyric gene activation was reduced by knock-down of the cell membrane transporters MCT-1 and -4 by siRNA. N-butyric acid show biologically significant effects on several important cellular functions, also with relevance for tumor cell phenotype. PMID:27441625

  8. Short Chain Fatty Acids (SCFA) Reprogram Gene Expression in Human Malignant Epithelial and Lymphoid Cells

    PubMed Central

    Astakhova, Lidiia; Ngara, Mtakai; Babich, Olga; Prosekov, Aleksandr; Asyakina, Lyudmila; Dyshlyuk, Lyubov; Midtvedt, Tore; Zhou, Xiaoying; Ernberg, Ingemar; Matskova, Liudmila

    2016-01-01

    The effect of short chain fatty acids (SCFAs) on gene expression in human, malignant cell lines was investigated, with a focus on signaling pathways. The commensal microbial flora produce high levels of SCFAs with established physiologic effects in humans. The most abundant SCFA metabolite in the human microflora is n-butyric acid. It is well known to activate endogenous latent Epstein-Barr virus (EBV), that was used as a reference read out system and extended to EBV+ epithelial cancer cell lines. N-butyric acid and its salt induced inflammatory and apoptotic responses in tumor cells of epithelial and lymphoid origin. Epithelial cell migration was inhibited. The n-butyric gene activation was reduced by knock-down of the cell membrane transporters MCT-1 and -4 by siRNA. N-butyric acid show biologically significant effects on several important cellular functions, also with relevance for tumor cell phenotype. PMID:27441625

  9. Muscle fiber type specific induction of slow myosin heavy chain 2 gene expression by electrical stimulation

    SciTech Connect

    Crew, Jennifer R.; Falzari, Kanakeshwari; DiMario, Joseph X.

    2010-04-01

    Vertebrate skeletal muscle fiber types are defined by a broad array of differentially expressed contractile and metabolic protein genes. The mechanisms that establish and maintain these different fiber types vary throughout development and with changing functional demand. Chicken skeletal muscle fibers can be generally categorized as fast and fast/slow based on expression of the slow myosin heavy chain 2 (MyHC2) gene in fast/slow muscle fibers. To investigate the cellular and molecular mechanisms that control fiber type formation in secondary or fetal muscle fibers, myoblasts from the fast pectoralis major (PM) and fast/slow medial adductor (MA) muscles were isolated, allowed to differentiate in vitro, and electrically stimulated. MA muscle fibers were induced to express the slow MyHC2 gene by electrical stimulation, whereas PM muscle fibers did not express the slow MyHC2 gene under identical stimulation conditions. However, PM muscle fibers did express the slow MyHC2 gene when electrical stimulation was combined with inhibition of inositol triphosphate receptor (IP3R) activity. Electrical stimulation was sufficient to increase nuclear localization of expressed nuclear-factor-of-activated-T-cells (NFAT), NFAT-mediated transcription, and slow MyHC2 promoter activity in MA muscle fibers. In contrast, both electrical stimulation and inhibitors of IP3R activity were required for these effects in PM muscle fibers. Electrical stimulation also increased levels of peroxisome-proliferator-activated receptor-{gamma} co-activator-1 (PGC-1{alpha}) protein in PM and MA muscle fibers. These results indicate that MA muscle fibers can be induced by electrical stimulation to express the slow MyHC2 gene and that fast PM muscle fibers are refractory to stimulation-induced slow MyHC2 gene expression due to fast PM muscle fiber specific cellular mechanisms involving IP3R activity.

  10. Analysis of structure and expression of the Xenopus thyroid hormone receptor-beta gene to explain its autoinduction.

    PubMed

    Machuca, I; Esslemont, G; Fairclough, L; Tata, J R

    1995-01-01

    Transcription of both Xenopus thyroid hormone receptor (TR) genes, xTR alpha and -beta, is strongly up-regulated by their own ligand T3 during natural or T3-induced metamorphosis of tadpoles and in some Xenopus cell lines. To explain this autoinduction, we analyzed the sequence of 1.6 kilobases of xTR beta promoter for putative T3-responsive elements. Two direct repeat +4 AGGTCA hexamer motifs (DR+4), an imperfect distal (-793/-778) and a perfect proximal (-5/11) site, a DR+1 site, and some possible half-sites were located in the 1.6-kilobase promoter. Transfection of Xenopus XTC-2 cells (which express xTR alpha and -beta) and XL-2 cells (which predominantly express TR alpha) with chloramphenicol acetyltransferase reporter constructs of deletion mutants and promoter fragments showed that the distal and proximal DR+4 sites responded to T3, although other flanking sequences may also play a role. The thyroid hormone-responsive element half-site present as DR+1 in the up-stream sequence at -1260/-950, when cloned in front of a heterologous promoter, functions independently. T3 enhanced transcription from the two DR+4-containing fragments when present together by only 2- to 3-fold due to a high basal activity. Overexpression of unliganded xTR alpha and xTR beta in XTC-2 cells repressed basal activity, which was then enhanced 7- to 4-fold by T3, respectively; with XL-2 cells cotransfected with xTR beta, T3 inducibility increased to 16-fold. Electrophoretic mobility shift assays with recombinant Xenopus TR alpha, TR beta, retinoid-X receptor-alpha (RXR alpha) and RXR gamma proteins showed that TR-RXR heterodimers, but not TR or RXR monomers or homodimers, strongly bound the natural and synthetic distal and proximal DR+4 elements in a ligand-independent manner. TR/RXR heterodimers exhibited the highest binding affinity for a 28-mer oligonucleotide probe for the -5/11 proximal DR+4 site, with only slight binding to DR+1 (retinoid-X-responsive element-like) site. The x

  11. A homozygous nonsense mutation in the {alpha}3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: Prenatal exclusion in a fetus at risk

    SciTech Connect

    McGrath, J.A.; Ciatti, S.; Christiano, A.M.

    1995-09-01

    Mutations in the three genes (LAMA3, LAMB3, and LAMC2) that encode the three chains ({alpha}3, {Beta}3, and {gamma}2, respectively) of laminin 5, a protein involved in epidermal-dermal adhesion, have been established as the genetic basis for the inherited blistering skin disorder, Herlitz junctional epidermolysis bullosa (H-JEB). In this study, we performed mutational analysis on genomic DNA from a child with H-JEB and identified a nonsense mutation in the {alpha}3 chain gene (LAMA3) consisting of a homozygous C-to-T transition resulting in a premature termination codon (CGA {r_arrow} TGA) on both alleles. The parents were shown to be heterozygous carriers of the same mutation. Direct mutation analysis was used to perform DNA-based prenatal diagnosis from a chorionic villus biopsy at 10 weeks` gestation in a subsequent pregnancy. The fetus was predicted to be genotypically normal with respect to the LAMA3 mutation. 15 refs., 1 fig.

  12. Atherosclerosis Susceptibility in Mice Is Independent of the V1 Immunoglobulin Heavy Chain Gene

    PubMed Central

    Centa, Monica; Gruber, Sabrina; Nilsson, Daniel; Polyzos, Konstantinos A.; Johansson, Daniel K.; Hansson, Göran K.; Ketelhuth, Daniel F.J.; Binder, Christoph J.

    2016-01-01

    Objective— The V1 (VHS107.1.42) immunoglobulin heavy chain gene is thought to be critical in producing IgM natural antibodies of the T15-idiotype that protect against both atherosclerosis and infection from Streptococcus pneumoniae. Our aim was to determine whether genetic loss of the V1 gene increased atherosclerotic plaque burden in vivo because of a reduction in the T15-idiotype or other atheroprotective antibodies. Approach and Results— We crossed VHS107.1.42-deficient mice with the atherosclerosis-prone Apoe−/− and Ldlr−/− strains. Although these double knockout strains manifested no defects in B-cell development, we did observe a substantial reduction in early immune responses against phosphocholine after immunization. However, the titers of plasma antibodies reacting against defined atherosclerotic antigens such as oxidized low-density lipoprotein, as well as the T15-idiotype, were unaffected by loss of the VHS107.1.42 gene in hypercholesterolemic mice. Furthermore, we observed no increase in atherosclerotic lesion formation, either within the aortic arch or aortic root. Robust deposition of IgM within atherosclerotic plaques could also be readily observed in both control and experimental mice. Conclusions— Our data indicate that IgM-dependent protection against atherosclerosis is unlikely to be dependent on antibodies that use the VHS107.1.42 gene, in contrast to the acute immune response conferred by this heavy chain in the response to phosphocholine and in providing resistance against lethal S pneumoniae infection. PMID:26564818

  13. Cloning of genes encoding alpha-L-arabinofuranosidase and beta-xylosidase from Trichoderma reesei by expression in Saccharomyces cerevisiae.

    PubMed Central

    Margolles-Clark, E; Tenkanen, M; Nakari-Setälä, T; Penttilä, M

    1996-01-01

    A cDNA expression library of Trichoderma reesei RutC-30 was constructed in the yeast Saccharomyces cerevisiae. Two genes, abf1 and bxl1, were isolated by screening the yeast library for extracellular alpha-L-arabinofuranosidase activity with the substrate p-nitrophenyl-alpha-L-arabinofuranoside. The genes abf1 and bxl1 encode 500 and 758 amino acids, respectively, including the signal sequences. The deduced amino acid sequence of ABFI displays high-level similarity to the alpha-L-arabinofuranosidase B of Aspergillus niger, and the two can form a new family of glycosyl hydrolases. The deduced amino acid sequence of BXLI shows similarities to the beta-glucosidases grouped in family 3. The yeast-produced enzymes were tested for enzymatic activities against different substrates. ABFI released L-arabinose from p-nitrophenyl-alpha-L-arabinofuranoside and arabinoxylans and showed some beta-xylosidase activity toward p-nitrophenyl-beta-D-xylopyranoside. BXLI did not release L-arabinose from arabinoxylan. It showed alpha-L-arabinofuranosidase, alpha-L-arabinopyranosidase, and beta-xylosidase activities against p-nitrophenyl-alpha-L-arabinofuranosidase, p-nitrophenyl-alpha-L-arabinopyranoside, and p-nitrophenyl-beta-D- xylopyranoside, respectively, with the last activity being the highest. It was also able to hydrolyze xylobiose and slowly release xylose from polymeric xylan. ABFI and BXLI correspond to a previously purified alpha-L-arabinofuranosidase and a beta-xylosidase from T. reesei, respectively, as confirmed by partial amino acid sequencing of the Trichoderma-produced enzymes. Both enzymes produced in yeasts displayed hydrolytic properties similar to those of the corresponding enzymes purified from T. reesei. PMID:8837440

  14. Effect of heat stress and feeding phosphorus levels on pig electron transport chain gene expression.

    PubMed

    Weller, M M D C A; Alebrante, L; Campos, P H R F; Saraiva, A; Silva, B A N; Donzele, J L; Oliveira, R F M; Silva, F F; Gasparino, E; Lopes, P S; Guimarães, S E F

    2013-12-01

    The purpose of this study was to evaluate the effect of temperature and different levels of available phosphorus (aP) on the expression of nine genes encoding electron transport chain proteins in the Longissimus dorsi (LD) muscle of pigs. Two trials were carried out using 48 high-lean growth pigs from two different growth phases: from 15 to 30 kg (phase 1) and from 30 to 60 kg (phase 2). Pigs from growth phase 1 were fed with three different levels of dietary aP (0.107%, 0.321% or 0.535%) and submitted either to a thermoneutral (24°C and RH at 76%) or to a heat stress (34°C and RH at 70%) environment. Pigs from growth phase 2 were fed with three different levels of dietary aP (0.116%, 0.306% or 0.496%) and submitted either to a thermoneutral (22ºC and RH at 77%) or to a heat stress (32ºC and RH at 73%) environment. Heat stress decreased (P<0.001) average daily feed intake at both growth phases. At 24°C, pigs in phase 1 fed the 0.321% aP diet had greater average daily gain and feed conversion (P<0.05) than those fed the 0.107% or 0.535% while, at 34°C pigs fed the 0.535% aP had the best performance (P<0.05). Pigs from phase 2 fed the 0.306% aP had best performance in both thermal environments. Gene expression profile was analyzed by quantitative real-time polymerase chain reaction. Irrespective of growing phase, the expression of six genes was lower (P<0.05) at high temperature than at thermoneutrality. The lower expression of these genes under high temperatures evidences the effects of heat stress by decreasing oxidative metabolism, through adaptive physiological mechanisms in order to reduce heat production. In pigs from phase 1, six genes were differentially expressed across aP levels (P<0.05) in the thermoneutral and one gene in the heat stress. In pigs from phase 2, two genes were differentially expressed across aP levels (P<0.05) in both thermal environments. These data revealed strong evidence that phosphorus and thermal environments are key factors to

  15. Effects of Ghrelin on Sexual Behavior and Luteinizing Hormone Beta-subunit Gene Expression in Male Rats

    PubMed Central

    Babaei-Balderlou, Farrin; Khazali, Homayoun

    2016-01-01

    Background: The hormones of hypothalamo-pituitary-gonadal (HPG) axis have facilitative effects on reproductive behavior in mammals. Ghrelin as a starvation hormone has an inhibitory effect on HPG axis’ function. Hence, it is postulated that ghrelin may reduce the sexual behavior through inhibiting of HPG axis. The aim of this study was to examine the effects of ghrelin and its antagonist, [D-Lys3 ]-GHRP-6, on sexual behavior and LH beta-subunit gene expression in male rats. Methods: In this experimental study, 128 male Wistar rats were divided into two groups. Each group was further subdivided into eight subgroups (n=8 rats/subgroup) including the animals that received saline, ghrelin (2, 4 or 8 nmol), [D-Lys3 ]-GHRP-6 (5 or 10 nmol) or co-administration of ghrelin (4 nmol) and [D-Lys3 ]-GHRP-6 (5 or 10 nmol) through the stereotaxically implanted cannula into the third cerebral ventricle. The sexual behavior of male rats encountering with females and the hypo-physeal LH beta-subunit gene expression were evaluated at two different groups. Data were analyzed by ANOVA and p<0.05 was considered statistically significant. Results: Ghrelin injection (4 and 8 nmol) significantly (p<0.01) increased the latencies to the first mount, intromission and ejaculation as well as the post-ejaculatory interval. Also, 4 and 8 nmol ghrelin significantly (p<0.05) increased the number of mount and decreased the number of ejaculation. In co-administrated groups, [D-Lys3 ]-GHRP-6 antagonized the effects of ghrelin. Ghrelin injection (4 and 8 nmol) reduced the LH beta-subunit gene expression while pretreatment with [D-Lys3 ]-GHRP-6 improved the gene expression. Conclusion: Ghrelin decreased the sexual behavior and LH beta-subunit gene expression in male rats, whereas [D-Lys3 ]-GHRP-6 antagonizes these effects. PMID:27141463

  16. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  17. No detectable reiteration of genes coding for mouse MOPC 41 immunoglobulin light-chain mRNA.

    PubMed Central

    Farace, M G; Aellen, M F; Briand, P A; Faust, C H; Vassalli, P; Mach, B

    1976-01-01

    RNA fractions rich in immunoglobulin light (L)-chain mRNA were isolated from mouse myeloma MOPC 41 by procedures previously described, and chemically labeled with 125I. These RNA fractions were hybridized with MOPC 41 DNA under conditions of DNA excess. Hybridization conditions were chosen under which the entire sequence of the L-chain mRNA probe, thus including the variable region, remains available for hybridization throughout the reaction. The hybridization (C0t) curve showed double transition kinetics, with one component corresponding to about 250 gene copies and the other to about two to four copies. In contrast, when MOPC 41 L-chain mRNA was further purified as a single band by gel elecptrophoresis in 99% formamide, the hybridization curve showed only a single transition, corresponding to about two to four genes, with the disappearance of the "reiterated" component. That component resulted therefore from contaminating RNA species. The data indicate that no reiteration can be detected by RNase or by hydroxylapatite for the genes corresponding to the entire sequence of MOPC 41 L-chain mRNA, including the untranslated segments, within the limits of detectability of short reiterated segments. It thus appears that there is only one or very few genes corresponding to the 41 L-chain variable region "subgroup" in MOPC 41 DNA. The possibility that the variable genes of plasmocytes might result frm a combination of several nonreiterated germline genes is discussed. Images PMID:815907

  18. Mutations in the dopamine beta-hydroxylase gene are associated with human norepinephrine deficiency

    NASA Technical Reports Server (NTRS)

    Kim, Chun-Hyung; Zabetian, Cyrus P.; Cubells, Joseph F.; Cho, Sonhae; Biaggioni, Italo; Cohen, Bruce M.; Robertson, David; Kim, Kwang-Soo

    2002-01-01

    Norepinephrine (NE), a key neurotransmitter of the central and peripheral nervous systems, is synthesized by dopamine beta-hydroxylase (DBH) that catalyzes oxidation of dopamine (DA) to NE. NE deficiency is a congenital disorder of unknown etiology, in which affected patients suffer profound autonomic failure. Biochemical features of the syndrome include undetectable tissue and circulating levels of NE and epinephrine, elevated levels of DA, and undetectable levels of DBH. Here, we report identification of seven novel variants including four potentially pathogenic mutations in the human DBH gene (OMIM 223360) from analysis of two unrelated patients and their families. Both patients are compound heterozygotes for variants affecting expression of DBH protein. Each carries one copy of a T-->C transversion in the splice donor site of DBH intron 1, creating a premature stop codon. In patient 1, there is a missense mutation in DBH exon 2. Patient 2 carries missense mutations in exons 1 and 6 residing in cis. We propose that NE deficiency is an autosomal recessive disorder resulting from heterogeneous molecular lesions at DBH. Copyright 2002 Wiley-Liss, Inc.

  19. Generation of Mice With a Conditional Allele for the Transforming Growth Factor Beta3 Gene

    PubMed Central

    Doetschman, Thomas; Georgieva, Teodora; Li, Hongqi; Reed, Thomas D.; Grisham, Christina; Friel, Jacqueline; Estabrook, Mark A.; Gard, Connie; Sanford, L.P.; Azhar, Mohamad

    2013-01-01

    Summary The transforming growth factor beta (TGFβ) pathway is involved in embryonic development and several inherited and acquired human diseases. The gene for TGFβ3 (Tgfb3) encodes one of the three ligands for TGF b receptors. It is widely expressed in the embryo and its mutation or misexpression is found in human diseases. Tgfb3−/− mice die at birth from cleft palate, precluding functional studies in adults. Here, we generated mice in which exon 6 of Tgfb3 was flanked with LoxP sites (Tgfb3flox/flox). The adult mice were normal and fertile. EIIa-Cre-mediated deletion of exon 6 in Tgfb3flox/flox mice efficiently generated Tgfb3 conditional knockout (Tgfb3cko/cko) mice which died at birth from the same cleft palate defect as Tgfb3−/− mice, indicating that the conditional and knockout alleles are functionally equivalent. This Tgfb3cko allele will now enable studies of TGFβ3 function in different cell or tissue types in embryonic development and during adulthood. genesis 50:59-66, 2012. PMID:22223248

  20. Use of an Activated Beta-Catenin to Identify Wnt Pathway Target Genes in Caenorhabditis elegans, Including a Subset of Collagen Genes Expressed in Late Larval Development

    PubMed Central

    Jackson, Belinda M.; Abete-Luzi, Patricia; Krause, Michael W.; Eisenmann, David M.

    2014-01-01

    The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin−dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle. PMID:24569038

  1. Improvement of cellulase activity in Trichoderma reesei by heterologous expression of a beta-glucosidase gene from Penicillium decumbens.

    PubMed

    Ma, Liang; Zhang, Jun; Zou, Gen; Wang, Chengshu; Zhou, Zhihua

    2011-09-10

    Trichoderma reesei is a well-known cellulase producer and widely applied in enzyme industry. To increase its ability to efficiently decompose cellulose, the beta-glucosidase activity of its enzyme cocktail needs to be enhanced. In this study, a beta-glucosidase I coding sequence from Penicillium decumbens was ligated with the cellobiohydrolase I (cbh1) promoter of T. reesei and introduced into the genome of T. reesei strain Rut-C30 by Agrobacterium-mediated transformation. In comparison to that from the parent strain, the beta-glucosidase activity of the enzyme complexes from two selected transformants increased 6- to 8-fold and their filter paper activity (FPAs) was enhanced by 30% on average. The transformant's saccharifying ability towards pretreated cornstalk was also significantly enhanced. To further confirm the effect of heterologous beta-glucosidase on the cellulase activity of T. reesei, the heterologously expressed pBGL1 was purified and added to the enzyme complex produced by T. reesei Rut-C30. Supplementation of the Rut-C30 enzyme complex with pBGL1 brought about 80% increase of glucose yield during the saccharification of pretreated cornstalk. Our results indicated that the heterologous expression of a beta-glucosidase gene in T. reesei might produce balanced cellulase preparation. PMID:22112562

  2. Transforming growth factor. beta. sub 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis

    SciTech Connect

    Broekelmann, T.J.; Limper, A.H.; McDonald, J.A. ); Colby, T.V. )

    1991-08-01

    Idiopathic pulmonary fibrosis is an inexorably fatal disorder characterized by connective tissue deposition within the terminal air spaces resulting in loss of lung function and eventual respiratory failure. Previously, the authors demonstrated that foci of activated fibroblasts expressing high levels of fibronectin, procollagen, and smooth muscle actin and thus resembling those found in healing wounds are responsible for the connective tissue deposition and scarring in idiopathic pulmonary fibrosis. Using in situ hybridization and immunohistochemistry, they now demonstrate the presence of transforming growth factor {beta}{sub 1} (TGF-{beta}{sub 1}), a potent profibrotic cytokine, in the foci containing these activated fibroblasts. These results suggest that matrix-associated TGF-{beta}{sub 1} may serve as a stimulus for the persistent expression of connective tissue genes. One potential source of the TGF-{beta}{sub 1} is the alveolar macrophage, and they demonstrate the expression of abundant TGF-{beta}{sub 1} mRNA in alveolar macrophages in lung tissue from patients with idiopathic pulmonary fibrosis.

  3. Bacterial Long-Chain Polyunsaturated Fatty Acids: Their Biosynthetic Genes, Functions, and Practical Use.

    PubMed

    Yoshida, Kiyohito; Hashimoto, Mikako; Hori, Ryuji; Adachi, Takumi; Okuyama, Hidetoshi; Orikasa, Yoshitake; Nagamine, Tadashi; Shimizu, Satoru; Ueno, Akio; Morita, Naoki

    2016-01-01

    The nutritional and pharmaceutical values of long-chain polyunsaturated fatty acids (LC-PUFAs) such as arachidonic, eicosapentaenoic and docosahexaenoic acids have been well recognized. These LC-PUFAs are physiologically important compounds in bacteria and eukaryotes. Although little is known about the biosynthetic mechanisms and functions of LC-PUFAs in bacteria compared to those in higher organisms, a combination of genetic, bioinformatic, and molecular biological approaches to LC-PUFA-producing bacteria and some eukaryotes have revealed the notably diverse organization of the pfa genes encoding a polyunsaturated fatty acid synthase complex (PUFA synthase), the LC-PUFA biosynthetic processes, and tertiary structures of the domains of this enzyme. In bacteria, LC-PUFAs appear to take part in specific functions facilitating individual membrane proteins rather than in the adjustment of the physical fluidity of the whole cell membrane. Very long chain polyunsaturated hydrocarbons (LC-HCs) such as hentriacontanonaene are considered to be closely related to LC-PUFAs in their biosynthesis and function. The possible role of LC-HCs in strictly anaerobic bacteria under aerobic and anaerobic environments and the evolutionary relationships of anaerobic and aerobic bacteria carrying pfa-like genes are also discussed. PMID:27187420

  4. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    SciTech Connect

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. ); Wunder, J.S.; Andrulis, I.L. ); Gazdar, A.F. ); Willman, C.L.; Griffith, B. ); Von Hoff, D.D. )

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  5. Bacterial Long-Chain Polyunsaturated Fatty Acids: Their Biosynthetic Genes, Functions, and Practical Use

    PubMed Central

    Yoshida, Kiyohito; Hashimoto, Mikako; Hori, Ryuji; Adachi, Takumi; Okuyama, Hidetoshi; Orikasa, Yoshitake; Nagamine, Tadashi; Shimizu, Satoru; Ueno, Akio; Morita, Naoki

    2016-01-01

    The nutritional and pharmaceutical values of long-chain polyunsaturated fatty acids (LC-PUFAs) such as arachidonic, eicosapentaenoic and docosahexaenoic acids have been well recognized. These LC-PUFAs are physiologically important compounds in bacteria and eukaryotes. Although little is known about the biosynthetic mechanisms and functions of LC-PUFAs in bacteria compared to those in higher organisms, a combination of genetic, bioinformatic, and molecular biological approaches to LC-PUFA-producing bacteria and some eukaryotes have revealed the notably diverse organization of the pfa genes encoding a polyunsaturated fatty acid synthase complex (PUFA synthase), the LC-PUFA biosynthetic processes, and tertiary structures of the domains of this enzyme. In bacteria, LC-PUFAs appear to take part in specific functions facilitating individual membrane proteins rather than in the adjustment of the physical fluidity of the whole cell membrane. Very long chain polyunsaturated hydrocarbons (LC-HCs) such as hentriacontanonaene are considered to be closely related to LC-PUFAs in their biosynthesis and function. The possible role of LC-HCs in strictly anaerobic bacteria under aerobic and anaerobic environments and the evolutionary relationships of anaerobic and aerobic bacteria carrying pfa-like genes are also discussed. PMID:27187420

  6. Screening of nineteen unrelated families with generalized resistance to thyroid hormone for known point mutations in the thyroid hormone receptor beta gene and the detection of a new mutation.

    PubMed Central

    Takeda, K; Balzano, S; Sakurai, A; DeGroot, L J; Refetoff, S

    1991-01-01

    Generalized resistance to thyroid hormone (GRTH) is a syndrome characterized by impaired tissue responsiveness to thyroid hormone. Two distinct point mutations in the hormone binding domain of the thyroid hormone receptor (TR) beta have recently been identified in two unrelated families with GRTH. One, Mf, involves a replacement of the normal glycine-345 for arginine in exon 7 and another, Mh, replaces the normal proline-453 for histidine in exon 8. To probe for the presence of the Mf and Mh defect in 19 unrelated families with GRTH, we applied separate polymerase chain reactions using allele-specific oligonucleotide primers containing the normal and each of the two mutant nucleotides at the 3'-position. A total of 24 affected subjects and 13 normal family members were studied. The mode of inheritance was dominant in 13 families, was unknown in 5 families, and was clearly recessive in 1 family in which only the consanguineous subjects were affected. Primers containing the substitutions specific for Mf and Mh amplified exons 7 and 8, respectively, only in affected members of each of the two index families. Primers containing the normal sequences amplified exons 7 and 8 of the TR beta gene in all subjects except affected members of one family. In this family with recessively inherited GRTH, neither exon could be amplified using any combinations of primers and DNA blot revealed absence of all coding exons. These results indicate a major deletion of the TR beta gene, including both DNA and hormone binding domains. Since heterozygous members of this family are not affected, the presence of a single normal allele is sufficient for normal function of the TR beta. These data also support the hypothesis that in the dominant mode of GRTH inheritance the presence of an abnormal TR beta interferes with the function of the normal TR beta. Distinct mutations are probably responsible for GRTH in unrelated families. Images PMID:1991834

  7. Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

    SciTech Connect

    Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. )

    1988-11-01

    The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

  8. Effects of Long Chain Fatty Acid Synthesis and Associated Gene Expression in Microalga Tetraselmis sp

    PubMed Central

    Adarme-Vega, T. Catalina; Thomas-Hall, Skye R.; Lim, David K. Y.; Schenk, Peer M.

    2014-01-01

    With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA) to C20:4 eicosatetraenoic acid (ETA), correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4), but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA) increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt. PMID:24901700

  9. Functional analysis of a proline to serine mutation in codon 453 of the thyroid hormone receptor {beta}1 gene

    SciTech Connect

    Ozata, M.; Suzuki, Satoru; Takeda, Teiji

    1995-10-01

    Mutations in the gene encoding human thyroid hormone receptor {beta}(hTR{beta}) have been associated with generalized resistance to thyroid hormone (GRTH). This disorder is associated with significant behavoral abnormalities. We examined the hTR{beta} gene in a family with members who manifest inappropriately normal TSH, elevated free T{sub 4}, and free and total T{sub 3}. Sequence analysis showed a cytosine to thymine transition at nucleotide 1642 in one allele of the index patient`s genomic DNA. This altered proline to serine at codon 453. The resulting mutant receptor when expressed in vitro bound DNA with high affinity, but the T{sub 3} affinity of the receptor was impaired. The mutant TR demonstrated a dominant negative effect when cotransfected with two isoforms of wild-type receptor and also in the presence of TR variant {alpha}2 in COS-1 cells. Mutations of codon 453 occur more frequently than at other sites, and four different amino acid substitutions have been reported. Significant differences in phenotype occur among affected individuals, varying from normality to moderately severe GRTH. There is no clear correlation between K{sub a} or in vitro function of the mutant receptor, and phenotype. This study extends the association between GRTH and illness, and indicates that early diagnosis and counseling are needed in families with TR{beta}1 abnormalities. 34 refs., 5 figs., 2 tabs.

  10. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample. PMID:27196551

  11. No Effect of the Transforming Growth Factor {beta}1 Promoter Polymorphism C-509T on TGFB1 Gene Expression, Protein Secretion, or Cellular Radiosensitivity

    SciTech Connect

    Reuther, Sebastian; Metzke, Elisabeth; Bonin, Michael; Petersen, Cordula; Dikomey, Ekkehard; Raabe, Annette

    2013-02-01

    Purpose: To study whether the promoter polymorphism (C-509T) affects transforming growth factor {beta}1 gene (TGFB1) expression, protein secretion, and/or cellular radiosensitivity for both human lymphocytes and fibroblasts. Methods and Materials: Experiments were performed with lymphocytes taken either from 124 breast cancer patients or 59 pairs of normal monozygotic twins. We used 15 normal human primary fibroblast strains as controls. The C-509T genotype was determined by polymerase chain reaction-restriction fragment length polymorphism or TaqMan single nucleotide polymorphism (SNP) genotyping assay. The cellular radiosensitivity of lymphocytes was measured by G0/1 assay and that of fibroblasts by colony assay. The amount of extracellular TGFB1 protein was determined by enzyme-linked immunosorbent assay, and TGFB1 expression was assessed via microarray analysis or reverse transcription-polymerase chain reaction. Results: The C-509T genotype was found not to be associated with cellular radiosensitivity, neither for lymphocytes (breast cancer patients, P=.811; healthy donors, P=.181) nor for fibroblasts (P=.589). Both TGFB1 expression and TGFB1 protein secretion showed considerable variation, which, however, did not depend on the C-509T genotype (protein secretion: P=.879; gene expression: lymphocytes, P=.134, fibroblasts, P=.605). There was also no general correlation between TGFB1 expression and cellular radiosensitivity (lymphocytes, P=.632; fibroblasts, P=.573). Conclusion: Our data indicate that any association between the SNP C-509T of TGFB1 and risk of normal tissue toxicity cannot be ascribed to a functional consequence of this SNP, either on the level of gene expression, protein secretion, or cellular radiosensitivity.

  12. Human-Specific SNP in Obesity Genes, Adrenergic Receptor Beta2 (ADRB2), Beta3 (ADRB3), and PPAR γ2 (PPARG), during Primate Evolution

    PubMed Central

    Takenaka, Akiko; Nakamura, Shin; Mitsunaga, Fusako; Inoue-Murayama, Miho; Udono, Toshifumi; Suryobroto, Bambang

    2012-01-01

    Adrenergic-receptor beta2 (ADRB2) and beta3 (ADRB3) are obesity genes that play a key role in the regulation of energy balance by increasing lipolysis and thermogenesis. The Glu27 allele in ADRB2 and the Arg64 allele in ADRB3 are associated with abdominal obesity and early onset of non-insulin-dependent diabetes mellitus (NIDDM) in many ethnic groups. Peroxisome proliferator-activated receptor γ (PPARG) is required for adipocyte differentiation. Pro12Ala mutation decreases PPARG activity and resistance to NIDDM. In humans, energy-expense alleles, Gln27 in ADRB2 and Trp64 in ADRB3, are at higher frequencies than Glu27 and Arg64, respectively, but Ala12 in PPARG is at lower frequency than Pro12. Adaptation of humans for lipolysis, thermogenesis, and reduction of fat accumulation could be considered by examining which alleles in these genes are dominant in non-human primates (NHP). All NHP (P. troglodytes, G. gorilla, P. pygmaeus, H. agilis and macaques) had energy-thrifty alleles, Gly16 and Glu27 in ADRB2, and Arg64 in ADRB3, but did not have energy-expense alleles, Arg16, Gln27 and Trp64 alleles. In PPARG gene, all NHP had large adipocyte accumulating type, the Pro12 allele. Conclusions These results indicate that a tendency to produce much more heat through the energy-expense alleles developed only in humans, who left tropical rainforests for savanna and developed new features in their heat-regulation systems, such as reduction of body hair and increased evaporation of water, and might have helped the protection of entrails from cold at night, especially in glacial periods. PMID:22937051

  13. Correction of a splice-site mutation in the beta-globin gene stimulated by triplex-forming peptide nucleic acids.

    PubMed

    Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S; Krause, Diane S; Seidman, Michael M; Peterson, Kenneth R; Nielsen, Peter E; Kole, Ryszard; Glazer, Peter M

    2008-09-01

    Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian cells via site-specific binding and creation of altered helical structures that provoke DNA repair. We have designed a series of triplex-forming PNAs that can specifically bind to sequences in the human beta-globin gene. We demonstrate here that these PNAs, when cotransfected with recombinatory donor DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent protein-beta-globin fusion gene. The ability of these PNAs to induce recombination was dependent on dose, sequence, cell-cycle stage, and the presence of a homologous donor DNA molecule. Enhanced recombination, with frequencies up to 0.4%, was observed with use of the lysomotropic agent chloroquine. Finally, we demonstrate that these PNAs were effective in stimulating the modification of the endogenous beta-globin locus in human cells, including primary hematopoietic progenitor cells. This work suggests that PNAs can be effective tools to induce heritable, site-specific modification of disease-related genes in human cells. PMID:18757759

  14. Herpes simplex virus infection selectively stimulates accumulation of beta interferon reporter gene mRNA by a posttranscriptional mechanism.

    PubMed Central

    Mosca, J D; Pitha, P M; Hayward, G S

    1992-01-01

    To study the mechanism of a novel herpes simplex virus (HSV) activity that stimulates expression of reporter genes containing beta interferon (IFN-beta)-coding sequences, we have established permanent DNA-transfected cell lines that each contain two distinct hybrid genes encoding mRNA species with different half-lives. These reporter genes comprised either the human IFN-beta- or bacterial chloramphenicol acetyltransferase (CAT)-coding and 3' untranslated regions placed under the transcriptional control of the powerful major immediate-early promoter-enhancer region (IE94) from simian cytomegalovirus. Most of the dual-transfected cell lines yielded significant levels of steady-state IE94-CAT mRNA and abundant constitutive synthesis of CAT enzyme activity, whereas no accumulation of IE94-IFN mRNA could be detected. However, infection with HSV type 1 resulted in a 300-fold increase in IE94-IFN-specific mRNA transcripts, compared with no more than 3- to 5-fold stimulation of IE94-CAT-specific mRNA. In contrast, cycloheximide treatment increased stable mRNA levels and transcription initiation rates from both the IE94-IFN and IE94-CAT hybrid genes. Run-on transcription assays in isolated nuclei suggested that induction of IE94-IFN gene expression by HSV type 1 occurred predominantly at the posttranscriptional level. Enhancement of the unstable IFN mRNA species after HSV infection was also observed in cell lines containing a simian virus 40 enhancer-driven IFN gene (SV2-IFN). Similarly, in transient-transfection assays, both SV2-IFN and IE94-IFN gave only low basal mRNA synthesis, but superinfection with HSV again led to high-level accumulation of IFN mRNA. Finally, substitution of the SV2-IFN gene 3' region with poly(A) and splicing signals from the SV2-CAT gene cassette led to stabilization of the IFN mRNA even in the absence of HSV. Therefore, we conclude that HSV infection leads to selective accumulation of IFN-beta mRNA by a posttranscriptional mechanism that is

  15. Phylogenetic comparisons suggest that distance from the locus control region guides developmental expression of primate beta-type globin genes.

    PubMed

    Johnson, Robert M; Prychitko, Tom; Gumucio, Deborah; Wildman, Derek E; Uddin, Monica; Goodman, Morris

    2006-02-28

    Phylogenetic inferences drawn from comparative data on mammalian beta-globin gene clusters indicate that the ancestral primate cluster contained a locus control region (LCR) and five paralogously related beta-type globin loci (5'-LCR-epsilon-gamma-psieta-delta-beta-3'), with epsilon and gamma expressed solely during embryonic life. A gamma locus tandem duplication (5'-gamma(1)-gamma(2)-3') triggered gamma's evolution toward fetal expression but by a different trajectory in platyrrhines (New World monkeys) than in catarrhines (Old World monkeys and apes, including humans). In platyrrhine (e.g., Cebus) fetuses, gamma(1) at the ancestral distance from epsilon is down-regulated, whereas gamma(2) at increased distance is up-regulated. Catarrhine gamma(1) and gamma(2) acquired longer distances from epsilon (14 and 19 kb, respectively), and both are up-regulated throughout fetal life with gamma(1)'s expression predominating over gamma(2)'s. On enlarging the platyrrhine expression data, we find Aotus gamma is embryonic, Alouatta gamma is inactive at term, and in Callithrix, gamma(1) is down-regulated fetally, whereas gamma(2) is up-regulated. Of eight mammalian taxa now represented per taxon by embryonic, fetal, and postnatal beta-type globin gene expression data, four taxa are primates, and data for three of these primates are from this laboratory. Our results support a model in which a short distance (<10 kb) between epsilon and the adjacent gamma is a plesiomorphic character that allows the LCR to drive embryonic expression of both genes, whereas a longer distance (>10 kb) impedes embryonic activation of the downstream gene. PMID:16488971

  16. Characterization of cultivar differences in beta-1,3 glucanase gene expression, glucanase activity and fruit pulp softening rates during fruit ripening in three naturally occurring banana cultivars.

    PubMed

    Roy Choudhury, Swarup; Roy, Sujit; Sengupta, Dibyendu N

    2009-11-01

    beta-1,3 glucanase (E.C.3.2.1.39) is the key enzyme involved in the hydrolytic cleavage of 1,3 beta-D glucosidic linkages in beta-1,3 glucans. This work describes a comparative analysis of expression patterns of beta-1,3 glucanase gene in relation to changes in fruit pulp softening rates in three banana cultivars, Rasthali (AAB), Kanthali (AB), and Monthan (ABB). Analysis of transcript and protein levels of beta-1,3 glucanase gene during ripening revealed differential timing in expression of the gene which correlated well with the variation in enzymatic activity of glucanase and fruit pulp softening rates in the three cultivars. Exogenously applied ethylene strongly induced beta-1,3 glucanase expression during the early ripening days in Rasthali, while the expression of the gene was marginally stimulated following ethylene treatment in preclimacteric Kanthali fruit. Conversely, in Monthan, beta-1,3 glucanase expression was very low throughout the ripening stages, and ethylene treatment did not induce the expression of the gene in this cultivar. Analysis of glucanase activity using protein extracts from unripe and ripe fruit of Monthan with crude cell wall polysaccharide fractions (used as substrate) indicated that the natural substrate for glucanase remained almost unutilized in this cultivar due to low in vivo glucanase activity. Furthermore, the recombinant beta-1,3 glucanase protein, overexpressed in E. coli, showed requirement for substrates with contiguous beta-1,3 linkages for optimal activity. Overall, our results provide new information on the expression profile of beta-1,3 glucanase gene in connection with the pattern of changes in fruit firmness at the physiological and molecular levels during ripening in three banana cultivars. PMID:19697038

  17. Identification of Novel Genes Involved in Long-Chain n-Alkane Degradation by Acinetobacter sp. Strain DSM 17874▿

    PubMed Central

    Throne-Holst, Mimmi; Wentzel, Alexander; Ellingsen, Trond E.; Kotlar, Hans-Kristian; Zotchev, Sergey B.

    2007-01-01

    Acinetobacter sp. strain DSM 17874 is capable of utilizing n-alkanes with chain lengths ranging from that of decane (C10H22) to that of tetracontane (C40H82) as a sole carbon source. Two genes encoding AlkB-type alkane hydroxylase homologues, designated alkMa and alkMb, have been shown to be involved in the degradation of n-alkanes with chain lengths of from 10 to 20 C atoms in this strain. Here, we describe a novel high-throughput screening method and the screening of a transposon mutant library to identify genes involved in the degradation of n-alkanes with C chain lengths longer than 20, which are solid at 30°C, the optimal growth temperature for Acinetobacter sp. strain DSM 17874. A library consisting of approximately 6,800 Acinetobacter sp. strain DSM 17874 transposon mutants was constructed and screened for mutants unable to grow on dotriacontane (C32H66) while simultaneously showing wild-type growth characteristics on shorter-chain n-alkanes. For 23 such mutants isolated, the genes inactivated by transposon insertion were identified. Targeted inactivation and complementation studies of one of these genes, designated almA and encoding a putative flavin-binding monooxygenase, confirmed its involvement in the strain's metabolism of long-chain n-alkanes. To our knowledge, almA represents the first cloned gene shown to be involved in the bacterial degradation of long-chain n-alkanes of 32 C's and longer. Genes encoding AlmA homologues were also identified in other long-chain n-alkane-degrading Acinetobacter strains. PMID:17400787

  18. Cloning and characterization of the endogenous cephalosporinase gene, cepA, from Bacteroides fragilis reveals a new subgroup of Ambler class A beta-lactamases.

    PubMed Central

    Rogers, M B; Parker, A C; Smith, C J

    1993-01-01

    Bacteroides fragilis CS30 is a clinical isolate resistant to high concentrations of benzylpenicillin and cephaloridine but not to cephamycin or penem antibiotics. beta-Lactam resistance is mediated by a chromosomally encoded cephalosporinase produced at a high level. The gene encoding this beta-lactamase was cloned from genomic libraries constructed in Escherichia coli and then mated with B. fragilis 638 for identification of ampicillin-resistant (Apr) strains. Apr transconjugants contained a nitrocefin-reactive protein with the physical and enzymatic properties of the original CS30 isolate. The beta-lactamase gene (cepA) was localized by deletion analysis and subcloned, and its nucleotide sequence was determined. The 903-bp cepA open reading frame encoded a 300-amino-acid precursor protein (predicted molecular mass, 34,070 Da). A beta-lactamase-deficient mutant strain of B. fragilis 638 was constructed by insertional inactivation with the cepA gene of CS30, demonstrating strict functional homology between these chromosomal beta-lactamase genes. An extensive comparison of the CepA protein sequence by alignment with other beta-lactamases revealed the strict conservation of at least four elements common to Ambler class A. A further comparison of the CepA protein sequence with protein sequences of beta-lactamases from two other Bacteroides species indicated that they constitute their own distinct subgroup of class A beta-lactamases. Images PMID:8285623

  19. Genes Involved in Long-Chain Alkene Biosynthesis in Micrococcus luteus▿

    PubMed Central

    Beller, Harry R.; Goh, Ee-Been; Keasling, Jay D.

    2010-01-01

    Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which 4 decades ago was reported to biosynthesize iso- and anteiso-branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty acid-overproducing Escherichia coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3 (no. carbon atoms: no. C 000000000000 000000000000 000000000000 111111111111 000000000000 111111111111 000000000000 000000000000 000000000000 C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-coenzyme A (CoA) produced the same C27 monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or-ACP [acyl carrier protein]) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the

  20. Direct Reprogramming for Pancreatic Beta-Cells Using Key Developmental Genes

    PubMed Central

    Cavelti-Weder, Claudia; Li, Weida; Zumsteg, Adrian; Stemann, Marianne; Yamada, Takatsugu; Bonner-Weir, Susan; Weir, Gordon

    2015-01-01

    Direct reprogramming is a promising approach for regenerative medicine whereby one cell type is directly converted into another without going through a multipotent or pluripotent stage. This reprogramming approach has been extensively explored for the generation of functional insulin-secreting cells from non-beta-cells with the aim of developing novel cell therapies for the treatment of people with diabetes lacking sufficient endogenous beta-cells. A common approach for such conversion studies is the introduction of key regulators that are important in controlling beta-cell development and maintenance. In this review, we will summarize the recent advances in the field of beta-cell reprogramming and discuss the challenges of creating functional and long-lasting beta-cells. PMID:26998407

  1. The Drosophila Clathrin Heavy Chain Gene: Clathrin Function Is Essential in a Multicellular Organism

    PubMed Central

    Bazinet, C.; Katzen, A. L.; Morgan, M.; Mahowald, A. P.; Lemmon, S. K.

    1993-01-01

    The clathrin heavy chain (HC) is the major structural polypeptide of the cytoplasmic surface lattice of clathrin-coated pits and vesicles. As a genetic approach to understanding the role of clathrin in cellular morphogenesis and developmental signal transduction, a clathrin heavy chain (Chc) gene of Drosophila melanogaster has been identified by a combination of molecular and classical genetic approaches. Using degenerate primers based on mammalian and yeast clathrin HC sequences, a small fragment of the HC gene was amplified from genomic Drosophila DNA by the polymerase chain reaction. Genomic and cDNA clones from phage libraries were isolated and analyzed using this fragment as a probe. The amino acid sequence of the Drosophila clathrin HC deduced from cDNA sequences is 80%, 57% and 49% identical, respectively, with the mammalian, Dictyostelium and yeast HCs. Hybridization in situ to larval polytene chromosomes revealed a single Chc locus at position 13F2 on the X chromosome. A 13-kb genomic Drosophila fragment including the Chc transcription unit was reintroduced into the Drosophila genome via P element-mediated germline transformation. This DNA complemented a group of EMS-induced lethal mutations mapping to the same region of the X chromosome, thus identifying the Chc complementation group. Mutant individuals homozygous or hemizygous for the Chc(1), Chc(2) or Chc(3) alleles developed to a late stage of embryogenesis, but failed to hatch to the first larval stage. A fourth allele, Chc(4), exhibited polyphasic lethality, with a significant number of homozygous and hemizygous offspring surviving to adulthood. Germline clonal analysis of Chc mutant alleles indicated that the three tight lethal alleles were autonomous cell-lethal mutations in the female germline. In contrast, Chc(4) germline clones were viable at a rate comparable to wild type, giving rise to viable adult progeny. However, hemizygous Chc(4) males were invariably sterile. The sterility was

  2. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  3. Detection of coliform bacteria in water by polymerase chain reaction and gene probes.

    PubMed Central

    Bej, A K; Steffan, R J; DiCesare, J; Haff, L; Atlas, R M

    1990-01-01

    Polymerase chain reaction (PCR) amplification and gene probe detection of regions of two genes, lacZ and lamB, were tested for their abilities to detect coliform bacteria. Amplification of a segment of the coding region of Escherichia coli lacZ by using a PCR primer annealing temperature of 50 degrees C detected E. coli and other coliform bacteria (including Shigella spp.) but not Salmonella spp. and noncoliform bacteria. Amplification of a region of E. coli lamB by using a primer annealing temperature of 50 degrees C selectively detected E. coli and Salmonella and Shigella spp. PCR amplification and radiolabeled gene probes detected as little as 1 to 10 fg of genomic E. coli DNA and as a few as 1 to 5 viable E. coli cells in 100 ml of water. PCR amplification of lacZ and lamB provides a basis for a method to detect indicators of fecal contamination of water, and amplification of lamB in particular permits detection of E. coli and enteric pathogens (Salmonella and Shigella spp.) with the necessary specificity and sensitivity for monitoring the bacteriological quality of water so as to ensure the safety of water supplies. Images PMID:2306085

  4. MegaTevs: single-chain dual nucleases for efficient gene disruption.

    PubMed

    Wolfs, Jason M; DaSilva, Matthew; Meister, Sarah E; Wang, Xu; Schild-Poulter, Caroline; Edgell, David R

    2014-07-01

    Targeting gene disruptions in complex genomes relies on imprecise repair by the non-homologous end-joining DNA pathway, creating mutagenic insertions or deletions (indels) at the break point. DNA end-processing enzymes are often co-expressed with genome-editing nucleases to enhance the frequency of indels, as the compatible cohesive ends generated by the nucleases can be precisely repaired, leading to a cycle of cleavage and non-mutagenic repair. Here, we present an alternative strategy to bias repair toward gene disruption by fusing two different nuclease active sites from I-TevI (a GIY-YIG enzyme) and I-OnuI E2 (an engineered meganuclease) into a single polypeptide chain. In vitro, the MegaTev enzyme generates two double-strand breaks to excise an intervening 30-bp fragment. In HEK 293 cells, we observe a high frequency of gene disruption without co-expression of DNA end-processing enzymes. Deep sequencing of disrupted target sites revealed minimal processing, consistent with the MegaTev sequestering the double-strand breaks from the DNA repair machinery. Off-target profiling revealed no detectable cleavage at sites where the I-TevI CNNNG cleavage motif is not appropriately spaced from the I-OnuI binding site. The MegaTev enzyme represents a small, programmable nuclease platform for extremely specific genome-engineering applications. PMID:25013171

  5. MegaTevs: single-chain dual nucleases for efficient gene disruption

    PubMed Central

    Wolfs, Jason M.; DaSilva, Matthew; Meister, Sarah E.; Wang, Xu; Schild-Poulter, Caroline; Edgell, David R.

    2014-01-01

    Targeting gene disruptions in complex genomes relies on imprecise repair by the non-homologous end-joining DNA pathway, creating mutagenic insertions or deletions (indels) at the break point. DNA end-processing enzymes are often co-expressed with genome-editing nucleases to enhance the frequency of indels, as the compatible cohesive ends generated by the nucleases can be precisely repaired, leading to a cycle of cleavage and non-mutagenic repair. Here, we present an alternative strategy to bias repair toward gene disruption by fusing two different nuclease active sites from I-TevI (a GIY-YIG enzyme) and I-OnuI E2 (an engineered meganuclease) into a single polypeptide chain. In vitro, the MegaTev enzyme generates two double-strand breaks to excise an intervening 30-bp fragment. In HEK 293 cells, we observe a high frequency of gene disruption without co-expression of DNA end-processing enzymes. Deep sequencing of disrupted target sites revealed minimal processing, consistent with the MegaTev sequestering the double-strand breaks from the DNA repair machinery. Off-target profiling revealed no detectable cleavage at sites where the I-TevI CNNNG cleavage motif is not appropriately spaced from the I-OnuI binding site. The MegaTev enzyme represents a small, programmable nuclease platform for extremely specific genome-engineering applications. PMID:25013171

  6. Detection of avian group D rotavirus using the polymerase chain reaction for the VP6 gene.

    PubMed

    Bezerra, Delana Andreza Melo; da Silva, René Ribeiro; Kaiano, Jane Haruko Lima; Silvestre, Rodrigo Vellasco Duarte; de Souza Oliveira, Darleise; Linhares, Alexandre C; Gabbay, Yvone Benchimol; Mascarenhas, Joana D'Arc Pereira

    2012-11-01

    Group D rotaviruses (RVs-D) have been documented in birds and, while they may be common in these animals, few molecular studies are available for this specific group. In this study, specific primers for the gene that encodes for the RVs-D VP6 protein were designed and used in a reverse transcription polymerase chain reaction (RT-PCR). Thirty pools of samples were tested by polyacrylamide gel electrophoresis (PAGE) yielding a 30% (9/30) positivity. These pools were subjected subsequently to RT-PCR, with a 53% (16/30) positivity rate. The sensitivity of the PCR assay was demonstrated up to a dilution of 5 × 10(-4)ng/μL (0.5 pg/μL) of the cloned VP6 gene. The four samples were sequenced and showed 90.8-91.1% similarity with regards to the RVs-D VP6 gene. To assess for specificity our RT-PCR was applied to nine samples known to contain enteric viral agents other than group D rotaviruses including picobirnavirus, rotavirus group A, and reovirus with negative results. Overall, the data confirm the specificity of the primers used for detecting the RVs-D by RT-PCR, suggesting that this assay can be used for diagnostic purposes. PMID:22820073

  7. Worldwide differences in the incidence of type I diabetes are associated with amino acid variation at position 57 of the HLA-DQ. beta. chain

    SciTech Connect

    Dorman, J.S.; LaPorte, R.E.; Trucco, M. ); Stone, R.A. )

    1990-10-01

    The presence of an amino acid other than aspartic acid at position 57 of the HLA-DQ {beta} chain (non-Asp-57) is highly associated with susceptibility to insulin-dependent diabetes mellitus (IDDM), whereas an aspartic acid at this position (Asp-57) appears to confer resistance to the disease. The authors hypothesize that the 30-fold difference in IDDM incidence across racial groups and countries is related to variability in the frequency of these alleles. Diabetic and nondiabetic individuals were evaluated in five populations, including those at low, moderate, and high risk. HLA-DQ {beta} genotype distributions among the IDDM case groups were markedly different as were those among nondiabetic controls. Non-Asp-57 alleles were significantly associated with IDDM in all areas; population-specific odds ratios for non-Asp-57 homozygotes relative to Asp-57 homozygotes ranged from 14 to 111. Relative risk information from the case-control study and population incidence data were combined to estimate genotype-specific incidence rates for the Allegheny county, PA, Caucasians. These rates were used to predict the overall incidence rates in the remaining populations, which were within the 95% confidence intervals of the actual rates established from incidence registries. These results are consistent with the hypothesis that population variation in the distribution of non-Asp-57 alleles may explain much of the geographic variation in IDDM incidence.

  8. Specific collapse followed by slow hydrogen-bond formation of beta-sheet in the folding of single-chain monellin.

    PubMed

    Kimura, Tetsunari; Uzawa, Takanori; Ishimori, Koichiro; Morishima, Isao; Takahashi, Satoshi; Konno, Takashi; Akiyama, Shuji; Fujisawa, Tetsuro

    2005-02-22

    Characterization of the conformational landscapes for proteins with different secondary structures is important in elucidating the mechanism of protein folding. The folding trajectory of single-chain monellin composed of a five-stranded beta-sheet and a helix was investigated by using a pH-jump from the alkaline unfolded to native state. The kinetic changes in the secondary structures and in the overall size and shape were measured by circular dichroism spectroscopy and small-angle x-ray scattering, respectively. The formation of the tertiary structure was monitored by intrinsic and extrinsic fluorescence. A significant collapse was observed within 300 micros after the pH-jump, leading to the intermediate with a small amount of secondary and tertiary structures but with an overall oblate shape. Subsequently, the stepwise formation of secondary and tertiary structures was detected. The current observation was consistent with the theoretical prediction that a more significant collapse precedes the formation of secondary structures in the folding of beta-sheet proteins than that of helical proteins [Shea, J. E., Onuchic, J. N. & Brooks, C. L., III (2002) Proc. Natl. Acad. Sci. USA 99, 16064-16068]. Furthermore, it was implied that the initial collapse was promoted by the formation of some specific structural elements, such as tight turns, to form the oblate shape. PMID:15710881

  9. Inhibition of serine palmitoyltransferase in vitro and long-chain base biosynthesis in intact Chinese hamster ovary cells by. beta. -Cl-alanine

    SciTech Connect

    Medlock, K.A.; Merrill, A.H. Jr.

    1987-05-01

    Serine palmitoyltransferase (SPT) is a pyridoxal-5'-phosphate dependent enzyme that catalyzes the first committed step of long-chain base (LCB) synthesis. Inhibition of SPT activity and de novo biosynthesis of sphinganine and sphingosine was observed in vitro and in intact Chinese hamster ovary cells (CHO). In vitro studies revealed that inhibition was irreversible and concentration- and time-dependent, which are characteristics of suicide inhibition. Incubation of intact CHO cells with 5 mM ..beta..-Cl-alanine for 15 min completely inhibited SPT activity and LCB synthesis from (/sup 14/C)serine. The concentration dependences of inhibition of SPT activity and LCB formation were identical. There was no loss of viability of recovery of SPT activity over the 2 hour time course of these experiments. The synthesis of several other lipids was not affected by the same treatment. These results establish the association between the activity of SPT and the cellular rate of LCB formation and indicate that ..beta..-Cl-alanine can be used to study alterations in cellular LCB synthesis.

  10. Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

    SciTech Connect

    Gu Ning; Adachi, Tetsuya; Matsunaga, Tetsuro; Takeda, Jun; Tsujimoto, Gozoh; Ishihara, Akihiko; Yasuda, Koichiro; Tsuda, Kinsuke . E-mail: jinkan@tom.life.h.kyoto-u.ac.jp

    2006-08-04

    Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2 mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.

  11. Active macrophage-associated TGF-beta co-localizes with type I procollagen gene expression in atherosclerotic human pulmonary arteries.

    PubMed Central

    Bahadori, L.; Milder, J.; Gold, L.; Botney, M.

    1995-01-01

    Vascular remodeling in adult atherosclerotic pulmonary arteries is characterized by discrete areas of neointimal smooth muscle cell extracellular matrix gene expression in close proximity to non-foamy macrophages, suggesting regulation by local macrophage-associated factors. The purpose of these studies was to begin addressing the role of putative macrophage-associated factors such as transforming growth factor-beta (TGF-beta), by determining the spatial relationship between TGF-beta and neointimal matrix gene expression in human atherosclerotic pulmonary arteries. For example, the participation of TGF-beta in vascular remodeling could be inferred by its colocalization with non-foamy macrophages in areas of active matrix synthesis. In situ hybridization and immunohistochemistry demonstrated focal neointimal procollagen gene expression in close association with non-foamy but not foamy macrophages. Immunohistochemistry with isoform-specific anti-TGF-beta antibodies demonstrated all three isoforms of TGF-beta associated with non-foamy macrophages, but foamy macrophages were not immunoreactive. Neointimal and medial smooth muscle cells stained lightly. In contrast, intense TGF-beta immunoreactivity was also associated with medial smooth muscle cells in normal nonremodeling vessels. Immunohistochemistry with antibodies specific for latent TGF-beta was similar to immunohistochemistry for mature TGF-beta in both remodeling and nonremodeling vessels. Finally, using an antibody specific for active TGF-beta 1, immunoreactivity was only seen in non-foamy neointimal macrophages but not in foamy macrophages or medial smooth muscle cells from hypertensive or normal vessels. These observations suggest non-foamy macrophages may participate in modulating matrix gene expression in atherosclerotic remodeling via a TGF-beta-dependent mechanism. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:7747808

  12. Genetic mapping of the beta 1 GABA receptor gene to human chromosome 4, using a tetranucleotide repeat polymorphism.

    PubMed Central

    Dean, M; Lucas-Derse, S; Bolos, A; O'Brien, S J; Kirkness, E F; Fraser, C M; Goldman, D

    1991-01-01

    As more coding loci for functional human genes are described, there is a growing need to identify DNA polymorphisms in specific genes. By examining DNA sequences within the introns of the beta 1 subunit of the gamma-aminobutyric acid receptor gene, GABARB1, we found a tetranucleotide repeat sequence (GATA). Amplification of this region by using PCR revealed seven alleles and a high degree of polymorphism (PIC = .75) in human populations. DNAs from the CEPH families were typed for the GABARB1 intron polymorphism and were analyzed with respect to 20 linked markers on chromosome 4. The results permit placement of GABARB1 on the linkage map of chromosome 4, between D4S104 and ALB. These results affirm that sequence analysis of noncoding segments included within or adjacent to functional genes has value as a strategy to detect highly informative polymorphisms. Images Figure 2 PMID:1652891

  13. Regulatory elements necessary for termination of transcription within the immunoglobulin heavy chain gene locus

    SciTech Connect

    Moore, B.B.

    1992-01-01

    Previous experimentation demonstrated that regulation of the IgM only phenotype in both pre-B and immature B cells was primarily at the transcriptional level. Expression of IgD mRNA involves transcription of the entire 29 kilobase rearranged [mu]-[delta] locus. Mature B cells transcribe the [beta] exons at approximately half the level that they transcribe the [delta] gene. Early B cells however, transcribe the [mu] gene with approximately 90% more efficiency than they do the [delta] gene. Specifically, early B cells show a transcription termination event occurring within a 1 kilobase region of the [mu]-[delta] intron. This dissertation analyzes the sequence elements necessary to encode the transcription termination event within the [mu]-[delta] intron. This work shows that the termination motif consists of specific sequences within the [mu]m poly(A) site as well as a region of the [mu]-[delta] intron contained within a 1200 base pair fragment. The 1200 base pair fragment extends from the Pst I site within the intron and ends just prior to the C[delta]1 exon. This fragment contains a 162 base pair unique sequence inverted repeat (USIR). Furthermore, the [mu]m site is specifically required because the [mu]s site was unable to substitute, despite extensive usage. In addition, the USIR-containing intron functions in an orientation-dependent manner. Analysis of this termination motif in a variety of lymphoid and non-lymphoid cells suggests that this motif is an intrinsic polymerase II termination motif. This implies that transcription termination in early B cells is by a default model and that active regulation of this motif involves an anti-termination event in mature B cells.

  14. Rat 17 beta-hydroxysteroid dehydrogenase type IV is a novel peroxisome proliferator-inducible gene.

    PubMed

    Corton, J C; Bocos, C; Moreno, E S; Merritt, A; Marsman, D S; Sausen, P J; Cattley, R C; Gustafsson, J A

    1996-11-01

    To better understand the molecular mechanisms of the pleiotropic responses induced by exposure to peroxisome proliferator chemicals (PPCs), we conducted a systematic search for genes whose mRNA levels are modulated by the PPC WY-14,643 (WY) in rat liver. The sequence of one up-regulated cDNA (2480 bp) was predicted to encode a protein of 735 aa with 82% identity to the porcine 17 beta-hydroxysteroid dehydrogenase type IV (HSD IV). Like the porcine enzyme, the rat HSD IV contains' a region homologous to yeast hydratase-dehydrogenase-epimerases and to sterol carrier proteins, indicating that the rat HSD IV has broad substrate specificity and contributes to cholesterol metabolism. The rat HSD IV was regulated by diverse PPCs via two distinct mechanisms. Induction of HSD IV and acyl-CoA oxidase (ACO) proteins in rat liver at different treatment times and concentrations of gemfibrozil and di-n-butyl phthalate were almost identical, indicating that HSD IV mRNA induction involves the peroxisome proliferator-activated receptor alpha, a regulator of ACO. In contrast, HSD IV protein levels were only weakly induced by WY, a strong inducer of ACO protein, even though the levels of HSD IV and ACO mRNA were strongly stimulated by WY and gemfibrozil. Thus, HSD IV protein levels were uniquely regulated pretranslationally by WY via a novel mechanism. Increased conversion of estradiol to the less-active estrone by HSD IV induction may explain how phthalate exposure leads to decreases in serum estradiol levels and suppression of ovulation. PMID:8913347

  15. Polymorphisms of cystathionine beta-synthase gene are associated with susceptibility to sepsis.

    PubMed

    Sponholz, Christoph; Kramer, Marcel; Schöneweck, Franziska; Menzel, Uwe; Inanloo Rahatloo, Kolsoum; Giamarellos-Bourboulis, Evangelos J; Papavassileiou, Vassileios; Lymberopoulou, Korina; Pavlaki, Maria; Koutelidakis, Ioannis; Perdios, Ioannis; Scherag, André; Bauer, Michael; Platzer, Matthias; Huse, Klaus

    2016-07-01

    Sepsis is the systemic inflammatory host response to infection. Cystathionine beta-synthase (CBS)-dependent homocysteine (Hcy) pathway was demonstrated to affect disease severity and mortality in patients with severe sepsis/septic shock. Independent studies identified a single-nucleotide polymorphism (SNP, rs6586282, hg19 chr21:g.44478497C>T) in intron 14 of the CBS-coding gene (CBS) associated with Hcy plasma levels. We aimed to describe the association of this SNP and variants of a splice donor-affecting variable-number tandem repeat (VNTR, NG_008938.1:g.22763_22793[16_22]) 243 bp downstream of rs6586282 with severe human sepsis. We analyzed the VNTR structure and genotyped variants of rs6586282 and a neighboring SNP (rs34758144, hg19 chr21:g.44478582G>A) in two case-control studies including patients with severe sepsis/septic shock from Germany (n=168) and Greece (n=237). In both studies, we consistently observed an association of CBS VNTR alleles with sepsis susceptibility. Risk linearly increased with number of tandem repeats (per allele odds ratio in the adjusted analysis 1.34; 95% confidence interval (CI)=1.17-1.55; P<0.001). Association had also been shown for rs34758144 whose risk allele is in linkage disequilibrium with one long VNTR allele (19 repeat). In contrast, we observed no evidence for an effect on 28-day survival in patients with severe sepsis/septic shock (per allele hazard ratio in the adjusted analysis for VNTR 1.10; 95% CI=0.95-1.28; P=0.20). In a minigene approach, we demonstrated alternative splicing in distinct VNTR alleles, which, however, was independent of the number of tandem units. In conclusion, there is no ordinary conjunction between human CBS and severe sepsis/septic shock, but CBS genotypes are involved in disease susceptibility. PMID:26508567

  16. Validation of Internal Reference Genes for Real-Time Quantitative Polymerase Chain Reaction Studies in the Tick, Ixodes scapularis (Acari: Ixodidae)

    PubMed Central

    Koči, Juraj; Šimo, Ladislav; Park, Yoonseong

    2013-01-01

    Obtaining reliable gene expression data using real-time quantitative polymerase chain reaction(qPCR)is highly dependent on the choice of normalization method. We tested the expression stability of multiple candidate genes in the salivary glands (SG) and synganglia (SYN) of female Ixodes scapularis (Say) ticks in multiple blood-feeding phases. We found that the amount of total RNA in both the SG and SYN increases dramatically during tick feeding, with 34× and 5.8× increases from 62 and 7.1 ng of unfed tick, respectively. We tested candidate genes that were predicted from I. scapularis genome data to encode glyceraldehyde 3-phosphate dehydrogenase (gapdh), ribosomal protein L13A (l13a), TATA box-binding protein (tbp), ribosomal protein S4 (rps4), glucose 6-phosphate dehydrogenase (gpdh), and beta-glucuronidase (gusb). The geNorm and NormFinder algorithms were used to analyze data from different feeding phases (i.e., daily samples from unfed to fully engorged females over a 7-d period in three replicate experiments). We found that the rps4 and l13a genes showed highly stable expression patterns over the feeding duration in both the SG and SYN. Furthermore, the highly expressed rps4 gene makes it useful as a normalization factor when we perform studies using minute amounts of dissected tissue for qPCR. We conclude that rps4 and l13a, whether individually or as a pair, serve as suitable internal reference genes for qRT-PCR studies in the SG and SYN of I. scapularis. PMID:23427655

  17. Cloning and nucleotide sequencing of a novel 7 beta-(4-carboxybutanamido)cephalosporanic acid acylase gene of Bacillus laterosporus and its expression in Escherichia coli and Bacillus subtilis.

    PubMed

    Aramori, I; Fukagawa, M; Tsumura, M; Iwami, M; Ono, H; Kojo, H; Kohsaka, M; Ueda, Y; Imanaka, H

    1991-12-01

    A strain of Bacillus species which produced an enzyme named glutaryl 7-ACA acylase which converts 7 beta-(4-carboxybutanamido)cephalosporanic acid (glutaryl 7-ACA) to 7-amino cephalosporanic acid (7-ACA) was isolated from soil. The gene for the glutaryl 7-ACA acylase was cloned with pHSG298 in Escherichia coli JM109, and the nucleotide sequence was determined by the M13 dideoxy chain termination method. The DNA sequence revealed only one large open reading frame composed of 1,902 bp corresponding to 634 amino acid residues. The deduced amino acid sequence contained a potential signal sequence in its amino-terminal region. Expression of the gene for glutaryl 7-ACA acylase was performed in both E. coli and Bacillus subtilis. The enzyme preparations purified from either recombinant strain of E. coli or B. subtilis were shown to be identical with each other as regards the profile of sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were composed of a single peptide with the molecular size of 70 kDa. Determination of the amino-terminal sequence of the two enzyme preparations revealed that both amino-terminal sequences (the first nine amino acids) were identical and completely coincided with residues 28 to 36 of the open reading frame. Extracellular excretion of the enzyme was observed in a recombinant strain of B. subtilis. PMID:1744041

  18. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  19. [Characterization of aldehyde dehydrogenase gene fragment from mung bean Vigna radiata using the polymerase chain reaction].

    PubMed

    Ponomarev, A G; Bubiakina, V V; Tatarinova, T D; Zelenin, S M

    1998-01-01

    Two degenerate oligonucleotide sequence primers and polymerase chain reactions on total DNA have been utilized to clone on 651--bp gene fragment coding the central part of amino acid sequence of an earlier unknown aldehyde dehydrogenase (ALDH) from mung bean. The deduced partial amino acid sequence for this aldehyde dehydrogenase shows about 65% sequence identity to ALDHs of Vibrio cholerae Rhodococcus sp., Alcaligenes eutrophus and about 45% sequence identity to mammalian ALDHs 1 and 2, ALDHs of Aspergillus niger and A, nidulans, the betain aldehyde dehydrogenase from spinach. Alignment of the mung bean aldehyde dehydrogenase partial amino acid sequence with the sequence of 16 NAD(P)(+)-dependent aldehyde dehydrogenases has demonstrated that all strictly conserved amino acid residues and all three conservative regions are identical. PMID:9778740

  20. Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II {beta} subunit (CSNK2B)

    SciTech Connect

    Albertella, M.R.; Jones, H.; Thomson, W.

    1996-09-01

    A wide range of autoimmune and other diseases are known to be associated with the major histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility antigens in the class I and class II regions, but some appear to be more strongly associated with genes in the central 1100-kb class III region, making it important to characterize this region fully for the presence of novel genes. An {approximately}220-kb segment of DNA in the class III region separating the Hsp70 (HSPA1L) and BAT1 (D6S8IE) genes, which was previously known to contain 14 genes. Genomic DNA fragments spanning the gaps between the known genes were used as probes to isolate cDNAs corresponding to five new genes within this region. Evidence from Northern blot analysis and exon trapping experiments that suggested the presence of at least two more new genes was also obtained. Partial cDNA and complete exonic genomic sequencing of one of the new genes has identified it as the casein kinase II{beta} subunit (CSNK2B). Two of the other novel genes lie within a region syntenic to that implicated in susceptibility to experimental allergic orchitis in the mouse, an autoimmune disease of the testis, and represent additional candidates for the Orch-1 locus associated with this disease. In addition, characterization of the 13-kb intergenic gap separating the RD (D6545) and G11 (D6S60E) genes has revealed the presence of a gene encoding a 1246-amino-acid polypeptide that shows significant sequence similarity to the yeast anti-viral Ski2p gene product. 49 refs., 8 figs.

  1. A Gene Controlling Variation in Arabidopsis Glucosinolate Composition Is Part of the Methionine Chain Elongation Pathway1

    PubMed Central

    Kroymann, Juergen; Textor, Susanne; Tokuhisa, Jim G.; Falk, Kimberly L.; Bartram, Stefan; Gershenzon, Jonathan; Mitchell-Olds, Thomas

    2001-01-01

    Arabidopsis and other Brassicaceae produce an enormous diversity of aliphatic glucosinolates, a group of methionine (Met)-derived plant secondary compounds containing a β-thio-glucose moiety, a sulfonated oxime, and a variable side chain. We fine-scale mapped GSL-ELONG, a locus controlling variation in the side-chain length of aliphatic glucosinolates. Within this locus, a polymorphic gene was identified that determines whether Met is extended predominantly by either one or by two methylene groups to produce aliphatic glucosinolates with either three- or four-carbon side chains. Two allelic mutants deficient in four-carbon side-chain glucosinolates were shown to contain independent missense mutations within this gene. In cell-free enzyme assays, a heterologously expressed cDNA from this locus was capable of condensing 2-oxo-4-methylthiobutanoic acid with acetyl-coenzyme A, the initial reaction in Met chain elongation. The gene methylthioalkylmalate synthase1 (MAM1) is a member of a gene family sharing approximately 60% amino acid sequence similarity with 2-isopropylmalate synthase, an enzyme of leucine biosynthesis that condenses 2-oxo-3-methylbutanoate with acetyl-coenzyme A. PMID:11706188

  2. SNP analyses of growth factor genes EGF, TGF{beta}-1, and HGF reveal haplotypic association of EGF with autism

    SciTech Connect

    Toyoda, Takao; Thanseem, Ismail; Kawai, Masayoshi; Sekine, Yoshimoto; Nakamura, Kazuhiko; Anitha, Ayyappan; Suda, Shiro . E-mail: nakamura@hama-med.ac.jp; Yamada, Kazuo; Tsujii, Masatsugu |; Iwayama, Yoshimi; Hattori, Eiji; Toyota, Tomoko; Yoshikawa, Takeo; Miyachi, Taishi; Tsuchiya, Kenji; Sugihara, Gen-ichi; Matsuzaki, Hideo; Iwata, Yasuhide; Suzuki, Katsuaki; Mori, Norio |; Ouchi, Yasuomi |; Sugiyama, Toshiro; Takei, Nori

    2007-09-07

    Autism is a pervasive neurodevelopmental disorder diagnosed in early childhood. Growth factors have been found to play a key role in the cellular differentiation and proliferation of the central and peripheral nervous systems. Epidermal growth factor (EGF) is detected in several regions of the developing and adult brain, where, it enhances the differentiation, maturation, and survival of a variety of neurons. Transforming growth factor-{beta} (TGF{beta}) isoforms play an important role in neuronal survival, and the hepatocyte growth factor (HGF) has been shown to exhibit neurotrophic activity. We examined the association of EGF, TGF{beta}1, and HGF genes with autism, in a trio association study, using DNA samples from families recruited to the Autism Genetic Resource Exchange; 252 trios with a male offspring scored for autism were selected for the study. Transmission disequilibrium test revealed significant haplotypic association of EGF with autism. No significant SNP or haplotypic associations were observed for TGF{beta}1 or HGF. Given the role of EGF in brain and neuronal development, we suggest a possible role of EGF in the pathogenesis of autism.

  3. Knockdown of prolactin receptors in a pancreatic beta cell line: effects on DNA synthesis, apoptosis, and gene expression.

    PubMed

    Arumugam, Ramamani; Fleenor, Don; Freemark, Michael

    2014-08-01

    Prolactin (PRL) and placental lactogen stimulate beta cell replication and insulin production in vitro and in vivo. The molecular mechanisms by which lactogens promote beta cell expansion are unclear. We treated rat insulinoma cells with a PRL receptor (PRLR) siRNA to determine if PRLR signaling is required for beta cell DNA synthesis and cell survival and to identify beta cell cycle genes whose expression depends upon lactogen action. Effects of PRLR knockdown were compared with those of PRL treatment. PRLR knockdown (-80 %) reduced DNA synthesis, increased apoptosis, and inhibited expression of cyclins D2 and B2, IRS-2, Tph1, and the anti-apoptotic protein PTTG1; p21 and BCL6 mRNAs increased. Conversely, PRL treatment increased DNA synthesis, reduced apoptosis, and enhanced expression of A, B and D2 cyclins, CDK1, IRS-2, FoxM1, BCLxL, and PTTG1; BCL6 declined. PRLR signaling is required for DNA synthesis and survival of rat insulinoma cells. The effects of lactogens are mediated by down-regulation of cell cycle inhibitors (BCL6, p21) and induction of A, B, and D2 cyclins, IRS-2, Tph1, FoxM1, and the anti-apoptotic proteins BCLxL and PTTG1. PMID:24114406

  4. Roles of fetal G gamma-globin promoter elements and the adult beta-globin 3' enhancer in the stage-specific expression of globin genes.

    PubMed

    Perez-Stable, C; Costantini, F

    1990-03-01

    The human fetal G gamma-globin and adult beta-globin genes are expressed in a tissue- and developmental stage-specific pattern in transgenic mice: the G gamma gene in embryonic cells and the beta gene in fetal and adult erythroid cells. Several of the cis-acting DNA sequences thought to be responsible for these patterns of expression are located 5' to the G gamma-globin gene and 3' to the beta-globin gene. To further define the locations and functional roles of these elements, we examined the effects of 5' truncations on the expression of the G gamma-globin gene, as well as the ability of G gamma-globin upstream sequences to alter the developmental regulation of a beta-globin gene, as well as the ability of G gamma-globin upstream sequences to alter the developmental regulation of a beta-globin gene. We found that sequences between -201 and -136 are essential for expression of the G gamma-globin gene, whereas those upstream of -201 have little effect on the level or tissue or stage specificity of G gamma-globin expression. The G gamma-globin upstream sequences from -201 to -136 were, furthermore, capable of activating a linked beta-globin gene in embryonic blood cells; however, a G gamma-globin fragment from -383 to -206 was similarly active in this assay, and the complete fragment from -383 to -136 was considerably more active than either of the smaller fragments, suggesting the presence of multiple cis-acting elements for embryonic blood cells. Our data also suggested the possibility of a negative regulatory element between -201 and -136. These results are discussed in relation to several DNA elements in the G gamma-globin upstream region, which have been shown to bind nuclear factors in erythroid cells. Finally, we observed that removal of the beta-globin 3'-flanking sequences, including the 3' enhancer, from the G gamma-globin upstream-beta-globin hybrid gene resulted in a 25-fold reduction in expression in embryonic blood cells. This suggests that the beta

  5. Nutritional regulation of long-chain PUFA biosynthetic genes in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Gregory, Melissa K; Collins, Robert O; Tocher, Douglas R; James, Michael J; Turchini, Giovanni M

    2016-05-28

    Most studies on dietary vegetable oil in rainbow trout (Oncorhynchus mykiss) have been conducted on a background of dietary EPA (20 : 5n-3) and DHA (22 : 6n-3) contained in the fishmeal used as a protein source in aquaculture feed. If dietary EPA and DHA repress their endogenous synthesis from α-linolenic acid (ALA, 18 : 3n-3), then the potential of ALA-containing vegetable oils to maintain tissue EPA and DHA has been underestimated. We examined the effect of individual dietary n-3 PUFA on the expression of the biosynthetic genes required for metabolism of ALA to DHA in rainbow trout. A total of 720 juvenile rainbow trout were allocated to twenty-four experimental tanks and assigned one of eight diets. The effect of dietary ALA, EPA or DHA, in isolation or in combination, on hepatic expression of fatty acyl desaturase (FADS)2a(Δ6), FADS2b(Δ5), elongation of very long-chain fatty acid (ELOVL)5 and ELOVL2 was examined after 3 weeks of dietary intervention. The effect of these diets on liver and muscle phospholipid PUFA composition was also examined. The expression levels of FADS2a(Δ6), ELOVL5 and ELOVL2 were highest when diets were high in ALA, with no added EPA or DHA. Under these conditions ALA was readily converted to tissue DHA. Dietary DHA had the largest and most consistent effect in down-regulating the gene expression of all four genes. The ELOVL5 expression was the least responsive of the four genes to dietary n-3 PUFA changes. These findings should be considered when optimising aquaculture feeds containing vegetable oils and/or fish oil or fishmeal to achieve maximum DHA synthesis. PMID:26987422

  6. Organization of the antiseptic resistance gene qacA and Tn552-related beta-lactamase genes in multidrug- resistant Staphylococcus haemolyticus strains of animal and human origins.

    PubMed

    Anthonisen, I-L; Sunde, M; Steinum, T M; Sidhu, M S; Sørum, H

    2002-11-01

    A part (12 kb) of a plasmid containing the beta-lactamase genes of Tn552, the disinfectant resistance gene qacA, and flanking DNA has been cloned from a Staphylococcus haemolyticus isolate and sequenced. This region was used to map the corresponding regions in six other multiresistant S. haemolyticus isolates of human and animal origin. The organizations of the genetic structures were almost identical in all isolates studied. The beta-lactamase and qacA genes from S. haemolyticus have >99.9% identities at the nucleotide level with the same genes from S. aureus, demonstrating that various staphylococcal species able to colonize animal and human hosts can exchange the genetic elements involved in resistance to antibiotics and disinfectants. The use of antibiotics and disinfectants in veterinary practice and animal husbandry may also contribute to the selection and maintenance of resistance factors among the staphylococcal species. Different parts of the 12-kb section analyzed had high degrees of nucleotide identity with regions from several other different Staphylococcus aureus plasmids. This suggests the contribution of interplasmid recombination in the evolutionary makeup of this 12-kb section involving plasmids that can intermingle between various staphylococcal species. The lateral spread of resistance genes between various staphylococcal species is probably facilitated by the generation of large multiresistance plasmids and the subsequent interspecies exchange of them. PMID:12384372

  7. Isolation and overexpression of a gene encoding an extracellular beta-(1,3-1,4)-glucanase from Streptococcus bovis JB1.

    PubMed Central

    Ekinci, M S; McCrae, S I; Flint, H J

    1997-01-01

    Streptococcus bovis JB1 was found to produce a 25-kDa extracellular enzyme active against beta-(1,3-1,4)-glucans. A gene was isolated encoding a specific beta-(1,3-1,4)-glucanase that corresponds to this size and belongs to glycoside hydrolase family 16. A 4- to 10-fold increase in supernatant beta-glucanase activity was obtained when the cloned beta-glucanase gene was reintroduced into S. bovis JB1 by use of constructs based on the plasmid vector pTRW10 or pIL253. The beta-(1,3-1,4)-glucanase gene was also expressed upon introduction of the pTRW10 construct pTRWL1R into Lactococcus lactis IL2661 and Enterococcus faecalis JH2-SS, although extracellular activity was 8- to 50-fold lower than that in S. bovis JB1. The beta-(1,3-1,4)-glucanase purified from the culture supernatant of S. bovis JB1 carrying pTRWL1R showed a K(m) of 2.8 mg per ml and a Vmax of 338 mumol of glucose equivalents per min per mg of protein with barley beta-glucan as the substrate. The S. bovis beta-(1,3-1,4)-glucanase may contribute to the ability of this bacterium to utilize starch by degrading structural polysaccharides present in endosperm cell walls. PMID:9327538

  8. Differences in Extended-Spectrum Beta-Lactamase Producing Escherichia coli Virulence Factor Genes in the Baltic Sea Region

    PubMed Central

    Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp

    2014-01-01

    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  9. Differences in extended-spectrum beta-lactamase producing Escherichia coli virulence factor genes in the Baltic Sea region.

    PubMed

    Lillo, Jana; Pai, Kristiine; Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Ivanova, Marina; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Parv, Kristel; Pavelkovich, Anastasia; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp

    2014-01-01

    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  10. IL-1beta, but not BMP-7 leads to a dramatic change in the gene expression pattern of human adult articular chondrocytes--portraying the gene expression pattern in two donors.

    PubMed

    Saas, J; Haag, J; Rueger, D; Chubinskaya, S; Sohler, F; Zimmer, R; Bartnik, E; Aigner, T

    2006-10-01

    Anabolic and catabolic cytokines and growth factors such as BMP-7 and IL-1beta play a central role in controlling the balance between degradation and repair of normal and (osteo)arthritic articular cartilage matrix. In this report, we investigated the response of articular chondrocytes to these factors IL-1beta and BMP-7 in terms of changes in gene expression levels. Large scale analysis was performed on primary human adult articular chondrocytes isolated from two human, independent donors cultured in alginate beads (non-stimulated and stimulated with IL-1beta and BMP-7 for 48 h) using Affymetrix gene chips (oligo-arrays). Biostatistical and bioinformatic evaluation of gene expression pattern was performed using the Resolver software (Rosetta). Part of the results were confirmed using real-time PCR. IL-1beta modulated significantly 909 out of 3459 genes detectable, whereas BMP-7 influenced only 36 out of 3440. BMP-7 induced mainly anabolic activation of chondrocytes including classical target genes such as collagen type II and aggrecan, while IL-1beta, both, significantly modulated the gene expression levels of numerous genes; namely, IL-1beta down-regulated the expression of anabolic genes and induced catabolic genes and mediators. Our data indicate that BMP-7 has only a limited effect on differentiated cells, whereas IL-1beta causes a dramatic change in gene expression pattern, i.e. induced or repressed much more genes. This presumably reflects the fact that BMP-7 signaling is effected via one pathway only (i.e. Smad-pathway) whereas IL-1beta is able to signal via a broad variety of intracellular signaling cascades involving the JNK, p38, NFkB and Erk pathways and even influencing BMP signaling. PMID:17161615

  11. Amplification of the rat m2 muscarinic receptor gene by the polymerase chain reaction: Functional expression of the M sub 2 muscarinic receptor

    SciTech Connect

    Lai, J.; Bloom, J.W.; Yamamura, H.I.; Roeske, W.R. )

    1990-01-01

    A selective amplification of the coding sequence of the rat M{sub 2} muscarinic receptor gene was achieved by the polymerase chain reaction. The error rate of this amplification system under conditions specified was 1 nucleotide substitution in 841 base pairs. In vitro expression of this gene in murine fibroblasts (B82) via the eukaryotic expression vector, pH{beta}APr-1-neo, resulted in high level expression of specific ({sup 3}H)(-)MQNB binding in transfected B82 cell lines. One of these clones, M2LKB2-2, showed a stable expression of ({sup 3}H)(-)MQNB binding with a K{sub d} value of 265 pM and a B{sub max} value of 411{plus minus}50 fmol/10{sup 6} cells. Cardiac selective muscarinic antagonists such as himbacine and AF-DX 116 show high affinities for this binding site in the M2LKB2-2 cells. The rank order of potency of several antagonists in inhibiting ({sup 3}H)(-)MQNB binding in these cells conformed to the characteristics of an M{sub 2} type muscarinic receptor. Carbachol showed a single affinity state for the receptors in the M2LKB2-2 cells with a K{sub i} value of 2.0 {mu}M. This receptor appeared to be inversely coupled to adenylate cyclase via a pertussis toxin sensitive G-protein. Carbachol also had a slight stimulatory effect on the hydrolysis of inositol lipids. The polymerase chain reaction proves highly effective in cloning genes from genomic material, as demonstrated by the first in vitro functional expression of the rat M{sub 2} type muscarinic receptor.

  12. Expression of human membrane skeleton protein genes for protein 4.1 and betaIISigma2-spectrin assayed by real-time RT-PCR.

    PubMed

    Taylor-Harris, Pamela M; Felkin, Leanne E; Birks, Emma J; Franklin, Rodney C G; Yacoub, Magdi H; Baines, Anthony J; Barton, Paul J R; Pinder, Jennifer C

    2005-01-01

    The proteins, spectrin and 4.1 confer support and resilience to animal cell membranes, and promote assembly of multimeric, membrane-bound signalling complexes. Protein 4.1 also plays important roles in tumour suppression and the regulation of cell proliferation. To assess relative tissue expression of the four genes encoding human protein 4.1, we measured mRNA levels using quantitative real-time polymerase chain reaction. We compared 4.1 expression with that of a major splice variant of spectrin, betaIISigma2 that has a shortened C-terminus lacking a pleckstrin homology domain. mRNA for 4.1R is four-fold higher in bone marrow than in tissues with the next highest prevalence: cerebellum, lung, testis and thymus. 4.1G mRNA is highly expressed in brain, spinal cord and testis; 4.1N in brain, spinal cord and adrenal gland; 4.1B in testis, brain, spinal cord, and kidney. Thus, 4.1N, 4.1B and 4.1G all show high accumulation in nervous tissues. mRNA for betaIISigma2-spectrin is ubiquitous, but most abundant in cardiac and nervous tissues. Comparative transcript abundance was analysed in heart and brain. betaIISigma2-spectrin was the most abundant transcript in heart with levels 5 fold greater than 4.1G or 4.1N and at least 9 fold greater than 4.1B. In brain, 4.1N was the most abundant transcript, with levels 2.4 fold greater than 4.1B and at least 4 fold greater than 4.1G or betaIISigma2-spectrin. 4.1R abundance was very low in both tissues. Whilst we expected that 4.1 mRNAs would feature highly in muscle and nerve, we note their high abundance in testis, indicating previously unsuspected functions in reproduction. PMID:15809685

  13. Cloning and characterization of KNR4, a yeast gene involved in (1,3)-beta-glucan synthesis.

    PubMed Central

    Hong, Z; Mann, P; Brown, N H; Tran, L E; Shaw, K J; Hare, R S; DiDomenico, B

    1994-01-01

    k9 killer toxin from Hansenula mrakii was used to select a number of resistant mutants from Saccharomyces cerevisiae. Preliminary biochemical and genetic studies showed that some of them acquired structural defects in the cell wall. One of these mutants, the knr4-1 mutant, displays a number of cell wall defects, including osmotic sensitivity; sensitivity to cercosporamide, a known antifungal agent; and resistance to Zymolyase, a (1,3)-beta-glucanase. We report here the isolation and analysis of the KNR4 gene. DNA sequence analysis revealed an uninterrupted open reading frame which contains five potential start codons. The longest coding template encodes a protein of 505 amino acids with a calculated molecular mass of 57,044 Da. A data base search revealed 100% identity with a nuclear protein, SMI1p. Disruption of the KNR4 locus does not result in cell death; however, it leads to reduced levels of both (1,3)-beta-glucan synthase activity and (1,3)-beta-glucan content in the cell wall. The gene was mapped to the right arm of chromosome VII. Images PMID:8289782

  14. Gene clusters for beta-lactam antibiotics and control of their expression: why have clusters evolved, and from where did they originate?

    PubMed

    Liras, Paloma; Martín, Juan F

    2006-03-01

    While beta-lactam compounds were discovered in filamentous fungi, actinomycetes and gram-negative bacteria are also known to produce different types of beta-lactams. All beta-lactam compounds contain a four-membered beta-lactam ring. The structure of their second ring allows these compounds to be classified into penicillins, cephalosporins, clavams, carbapenens or monobactams. Most beta-lactams inhibits bacterial cell wall biosynthesis but others behave as beta-lactamase inhibitors (e.g., clavulanic acid) and even as antifungal agents (e.g., some clavams). Due to the nature of the second ring in beta-lactam molecules, the precursors and biosynthetic pathways of clavams, carbapenems and monobactams differ from those of penicillins and cephalosporins. These last two groups, including cephamycins and cephabacins, are formed from three precursor amino acids that are linked into the alpha-aminoadipyl-L-cysteinyl-D-valine tripeptide. The first two steps of their biosynthetic pathways are common. The intermediates of these pathways, the characteristics of the enzymes involved, the lack of introns in the genes and bioinformatic analysis suggest that all of them should have evolved from an ancestral gene cluster of bacterial origin, which was surely transferred horizontally in the soil from producer to non-producer microorganisms. The receptor strains acquired fragments of the original bacterial cluster and occasionally inserted new genes into the clusters, which once modified, acquired new functions and gave rise to the final compounds that we know. When the order of genes in the Streptomyces genome is analyzed, the antibiotic gene clusters are highlighted as gene islands in the genome. Nonetheless, the assemblage of the ancestral beta-lactam gene cluster remains a matter of speculation. PMID:16636985

  15. Genomic organization and differential signature of positive selection in the alpha and beta globin gene clusters in two cetacean species.

    PubMed

    Nery, Mariana F; Arroyo, José Ignacio; Opazo, Juan C

    2013-01-01

    The hemoglobin of jawed vertebrates is a heterotetramer protein that contains two α- and two β-chains, which are encoded by members of α- and β-globin gene families. Given the hemoglobin role in mediating an adaptive response to chronic hypoxia, it is likely that this molecule may have experienced a selective pressure during the evolution of cetaceans, which have to deal with hypoxia tolerance during prolonged diving. This selective pressure could have generated a complex history of gene turnover in these clusters and/or changes in protein structure themselves. Accordingly, we aimed to characterize the genomic organization of α- and β-globin gene clusters in two cetacean species and to detect a possible role of positive selection on them using a phylogenetic framework. Maximum likelihood and Bayesian phylogeny reconstructions revealed that both cetacean species had retained a similar complement of putatively functional genes. For the α-globin gene cluster, the killer whale presents a complement of genes composed of HBZ, HBK, and two functional copies of HBA and HBQ genes, whereas the dolphin possesses HBZ, HBK, HBA and HBQ genes, and one HBA pseudogene. For the β-globin gene cluster, both species retained a complement of four genes, two early expressed genes-HBE and HBH-and two adult expressed genes-HBD and HBB. Our natural selection analysis detected two positively selected sites in the HBB gene (56 and 62) and four in HBA (15, 21, 49, 120). Interestingly, only the genes that are expressed during the adulthood showed the signature of positive selection. PMID:24259315

  16. Poly(Amido Amine)s Containing Agmatine and Butanol Side Chains as Efficient Gene Carriers.

    PubMed

    Won, Young-Wook; Ankoné, Marc; Engbersen, Johan F J; Feijen, Jan; Kim, Sung Wan

    2016-04-01

    A new type of bioreducible poly(amido amine) copolymer is synthesized by the Michael addition polymerization of cystamine bisacrylamide (CBA) with 4-aminobutylguanidine (agmatine, AGM) and 4-aminobutanol (ABOL). Since the positively charged guanidinium groups of AGM and the hydroxybutyl groups of ABOL in the side chains have shown to improve the overall transfection efficiency of poly(amido amine)s, it is hypothesized that poly(CBA-ABOL/AGM) synthesized at the optimal ratio of both components would result in high transfection efficiency and minimal toxicity. In this study, a series of the poly(CBA-ABOL/AGM) copolymers is synthesized as gene carriers. The polymers are characterized and luciferase transfection efficiencies of the polymers in various cell lines are investigated to select the ideal ratio between AGM and ABOL. The poly(CBA-ABOL/AGM) containing 80% AGM and 20% ABOL has shown the best transfection efficiency with the lowest cytotoxicity, indicating that this polymer is very promising as a potent and nontoxic gene carrier. PMID:26663734

  17. Variable regions of Ig heavy chain genes encoding antithyrotropin receptor antibodies of patients with Graves' disease

    SciTech Connect

    Shin, Euy Kyun; Akamizu, Takashi; Matsuda, Fumihiko; Sugawa, Hideo; Fujikura, Junji; Mori, Toru; Honjo, Tasuku )

    1994-02-01

    The authors have established EBV-transformed human B cell clones producing monoclonal antithyrotropin receptor antibodies from two patients with Graves' disease. They then isolated and characterized Ig H chain genes of 5 B cell clones with thyrotropin-binding inhibitor Ig (TBII) activity and 4 B cell clones with thyroid-stimulating antibody (TSAb) activity. They found that V[sub H] gene families used in the 5 TBII clones were diverse, including V[sub H-II, -III, -IV,] and [sub -V]. Most of V[sub H] segments used in TBII and TSAb are commonly used in other autoantibodies and fetal liver repertoire. The frequency of somatic mutations in TBII was higher than that in TSAb. In as much as the same germline V[sub H] segment (V3-23) was used for both TBII and TSAb, the frequency and position of somatic mutations may be important for generation of TBII and TSAb. 56 refs., 2 figs., 2 tabs.

  18. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hygridization and polymerase chain reaction

    SciTech Connect

    Palmer, L.M.; Colwell, R.R. )

    1991-05-01

    Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates. We have demonstrated that not only do some strains of V. cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V. cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe. Comparisons of the amino acid sequences of luciferase regions of amino acid identity. The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V. cholerae strains. The nucleotide sequence of this region was determined and reveals that nonluminescent V. cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V. cholerae by albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

  19. Similarities and Differences Between the Light and Heavy Chain Ig Variable Region Gene Repertoires in Chronic Lymphocytic Leukemia

    PubMed Central

    Ghiotto, Fabio; Fais, Franco; Albesiano, Emilia; Sison, Cristina; Valetto, Angelo; Gaidano, Gianluca; Reinhardt, Janine; Kolitz, Jonathan E; Rai, Kanti; Allen, Steven L; Ferrarini, Manlio; Chiorazzi, Nicholas

    2006-01-01

    Analyses of Ig VHDJH rearrangements expressed by B-CLL cells have provided insights into the antigen receptor repertoire of B-CLL cells and the maturation stages of B-lymphocytes that give rise to this disease. However, less information is available about the L chain V gene segments utilized by B-CLL cells and to what extent their characteristics resemble those of the H chain. We analyzed the VL and JL gene segments of 206 B-CLL patients, paying particular attention to frequency of use and association, mutation status, and LCDR3 characteristics. Approximately 40% of B-CLL cases express VL genes that differ significantly from their germline counterparts. Certain genes were virtually always mutated and others virtually never. In addition, preferential pairing of specific VL and JL segments was found. These findings are reminiscent of the expressed VH repertoire in B-CLL. However unlike the VH repertoire, VL gene use was not significantly different than that of normal B-lymphocytes. In addition, Vκ genes that lie more upstream on the germline locus were less frequently mutated than those at the 3′ end of the locus; this was not the case for Vλ genes and is not for VH genes. These similarities and differences between the IgH and IgL V gene repertoires expressed in B-CLL suggest some novel features while also reinforcing concepts derived from studies of the IgH repertoire. PMID:17380195

  20. Gene networks modified by sulphonylureas in beta cells: a pathway-based analysis of insulin secretion and cell death.

    PubMed

    Magnusson, Nils E; Dyrskjøt, Lars; Grimm, Daniela; Wehland, Markus; Pietsch, Jessica; Rungby, Jørgen

    2012-10-01

    Sulphonylureas (SUs) used in the treatment for type 2 diabetes have been shown to result in different clinical outcome. This study hypothesized that three widely used SUs, glibenclamide, glimepiride and gliclazide, may affect function and survival of insulin-producing cells differently. To evaluate differences between SUs, insulin secretion and cell death were measured, and genome-wide gene expression patterns were compared using a bioinformatics approach focusing on functional relationships between molecules. Insulin-producing INS-1E cells exposed to SUs for 6 and 24 hr were assayed using GeneChip. Cluster and pathway analyses were used to identify differentially expressed genes and patterns of potential biological functions associated with SU treatment. Cell death was measured using acridine orange/Hoechst 33342 staining. Short-term treatment (6 hr) yielded up-regulation of insulin secretion and genes associated with insulin secretion for all three SUs applied. While long-term treatment (24-72 hr) with gliclazide did not change gene expression or cell survival, treatment with glibenclamide or glimepiride up-regulated genes associated with oxidative stress and hypoxia, but did not induce cell death. Short-term treatment with SUs initiates gene regulation that can be attributed to insulin secretion with few differences between individual SUs. This regulation was temporal and returned to baseline after 24 hr. Individual differences observed after 24-72 hr indicate that glibenclamide and glimepiride induce potentially harmful cell signalling insufficient for triggering beta cell death. PMID:22642398

  1. Autogenous production of interferon-beta switches on HLA genes during differentiation of histiocytic lymphoma U937 cells.

    PubMed Central

    Yarden, A; Shure-Gottlieb, H; Chebath, J; Revel, M; Kimchi, A

    1984-01-01

    The expression of class I HLA genes was measured during the in vitro differentiation of human U937 lymphoma cells towards macrophages. Following the onset of differentiation by phorbol myristate acetate the levels of cytoplasmic mRNA that hybridized with a [32P]HLA-B cDNA probe increased by a factor of nine. Elevation in HLA mRNA accumulation was followed by an increase in the rate of synthesis of HLA proteins and also by a dramatic increase in class I HLA cell surface antigen expression, as shown by cytofluorimetric analysis. The elevation in HLA mRNA and surface antigens could be prevented by adding antibodies against human interferon-beta (IFN-beta) to the culture medium at the onset of differentiation. Interferon antiviral activity was detected in the medium of differentiated U937 cells. The same anti-IFN-beta antibodies prevented the increase in (2'-5')oligo(A) synthetase activity which also takes place in differentiating U937 cells. Accumulation of the IFN-induced (2'-5')oligo(A) synthetase in U937 cells is preceded by an increase in its specific 1.6-kb mRNA as shown by hybridization to cloned (2'-5')-oligo(A) synthetase cDNA. The enzyme was preferentially found in the nuclear fraction of differentiating U937 cells. We suggest that an autogenous production of interferon-beta by the differentiating cells, switches on expression of the class I HLA genes as well as that of the (2'-5')oligo(A) synthetase. Images Fig. 2. Fig. 3. PMID:6376119

  2. Mutations in the latent TGF-beta binding protein 3 (LTBP3) gene cause brachyolmia with amelogenesis imperfecta.

    PubMed

    Huckert, Mathilde; Stoetzel, Corinne; Morkmued, Supawich; Laugel-Haushalter, Virginie; Geoffroy, Véronique; Muller, Jean; Clauss, François; Prasad, Megana K; Obry, Frédéric; Raymond, Jean Louis; Switala, Marzena; Alembik, Yves; Soskin, Sylvie; Mathieu, Eric; Hemmerlé, Joseph; Weickert, Jean-Luc; Dabovic, Branka Brukner; Rifkin, Daniel B; Dheedene, Annelies; Boudin, Eveline; Caluseriu, Oana; Cholette, Marie-Claude; Mcleod, Ross; Antequera, Reynaldo; Gellé, Marie-Paule; Coeuriot, Jean-Louis; Jacquelin, Louis-Frédéric; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Van Hul, Wim; Bertola, Debora; Dollé, Pascal; Verloes, Alain; Mortier, Geert; Dollfus, Hélène; Bloch-Zupan, Agnès

    2015-06-01

    Inherited dental malformations constitute a clinically and genetically heterogeneous group of disorders. Here, we report on four families, three of them consanguineous, with an identical phenotype, characterized by significant short stature with brachyolmia and hypoplastic amelogenesis imperfecta (AI) with almost absent enamel. This phenotype was first described in 1996 by Verloes et al. as an autosomal recessive form of brachyolmia associated with AI. Whole-exome sequencing resulted in the identification of recessive hypomorphic mutations including deletion, nonsense and splice mutations, in the LTBP3 gene, which is involved in the TGF-beta signaling pathway. We further investigated gene expression during mouse development and tooth formation. Differentiated ameloblasts synthesizing enamel matrix proteins and odontoblasts expressed the gene. Study of an available knockout mouse model showed that the mutant mice displayed very thin to absent enamel in both incisors and molars, hereby recapitulating the AI phenotype in the human disorder. PMID:25669657

  3. Mutations in the latent TGF-beta binding protein 3 (LTBP3) gene cause brachyolmia with amelogenesis imperfecta

    PubMed Central

    Huckert, Mathilde; Stoetzel, Corinne; Morkmued, Supawich; Laugel-Haushalter, Virginie; Geoffroy, Véronique; Muller, Jean; Clauss, François; Prasad, Megana K.; Obry, Frédéric; Raymond, Jean Louis; Switala, Marzena; Alembik, Yves; Soskin, Sylvie; Mathieu, Eric; Hemmerlé, Joseph; Weickert, Jean-Luc; Dabovic, Branka Brukner; Rifkin, Daniel B.; Dheedene, Annelies; Boudin, Eveline; Caluseriu, Oana; Cholette, Marie-Claude; Mcleod, Ross; Antequera, Reynaldo; Gellé, Marie-Paule; Coeuriot, Jean-Louis; Jacquelin, Louis-Frédéric; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Van Hul, Wim; Bertola, Debora; Dollé, Pascal; Verloes, Alain; Mortier, Geert; Dollfus, Hélène; Bloch-Zupan, Agnès

    2015-01-01

    Inherited dental malformations constitute a clinically and genetically heterogeneous group of disorders. Here, we report on four families, three of them consanguineous, with an identical phenotype, characterized by significant short stature with brachyolmia and hypoplastic amelogenesis imperfecta (AI) with almost absent enamel. This phenotype was first described in 1996 by Verloes et al. as an autosomal recessive form of brachyolmia associated with AI. Whole-exome sequencing resulted in the identification of recessive hypomorphic mutations including deletion, nonsense and splice mutations, in the LTBP3 gene, which is involved in the TGF-beta signaling pathway. We further investigated gene expression during mouse development and tooth formation. Differentiated ameloblasts synthesizing enamel matrix proteins and odontoblasts expressed the gene. Study of an available knockout mouse model showed that the mutant mice displayed very thin to absent enamel in both incisors and molars, hereby recapitulating the AI phenotype in the human disorder. PMID:25669657

  4. Beta-carotene suppression of benzophenone-sensitized lipid peroxidation in hexane through additional chain-breaking activities

    NASA Astrophysics Data System (ADS)

    Cvetković, Dragan; Marković, Dejan

    2011-01-01

    The aim of this work is to estimate the antioxidant activity of β-carotene in the presence of two different mixtures of phospholipids in hexane solution, under continuous UV-irradiation from three different ranges (UV-A, UV-B, and UV-C). β-Carotene is employed to control lipid peroxidation process generated by UV-irradiation, in the presence and in the absence of selected photosensitizer, benzophenone, by scavenging the involved, created free radicals. The results show that β-carotene undergoes to a substantial, probably structural dependent destruction (bleaching), highly dependent on UV-photons energy input, more expressed in the presence than in the absence of benzophenone. The additional bleaching is synchronized with the further increase in β-carotene antioxidant activity in the presence of benzophenone, implying the same cause: increase in (phospholipids peroxidation) chain-breaking activities.

  5. Constraints on intron evolution in the gene encoding the myosin alkali light chain in Drosophila

    SciTech Connect

    Leicht, B.G.; Muse, S.V.; Hanczyc, M.

    1995-01-01

    Interspecific comparisons of intron sequences reveal conserved blocks of invariant nucleotides and several other departures from the strictly neutral model of molecular evolution. To distinguish the past action of evolutionary forces in introns known to have regulatory information, we examined nucleotide sequence variation at 991 sites in a random sample of 16 Drosophila melanogaster alleles of the gene encoding the myosin alkali light chain (Mlc1). The Mlc1 gene of D. melanogaster encodes two Mlc1 isoforms via developmentally regulated alternative pre-mRNA splicing. Analyses of these data reveal that introns 4 and 5, which flank the alternatively spliced exon 5, have reduced levels of both intraspecific polymorphism and interspecific divergence relative to intron 3. No polymorphism was observed in any of the exons examined in D. melanogaster. A genealogical analysis clearly demonstrates the occurrence of intragenic recombination in the ancestral history of Mlc1. Recombination events are estimated to be 13 times more likely than mutation events over the span of the sequenced region. Although there is little evidence for pairwise linkage disequilibrium in the Mlc1 region, higher order disequilibrium. does seem to be present in the 5{prime} half of the portion of the gene that was examined. Predictions of the folding free energy of the pre-mRNA reveal that sampled alleles have a significantly higher (less stable) free energy than do randomly permuted sequences. These results are consistent with the hypothesis that introns surrounding an alternatively spliced exon are subjected to additional constraints, perhaps due to specific aspects of secondary structure required for appropriate splicing of the pre-mRNA molecule. 48 refs., 5 figs., 3 tabs.

  6. Interactions between beta-2 adrenoceptor gene variation, cardiovascular control and dietary sodium in healthy young adults

    PubMed Central

    Eisenach, John H; Schroeder, Darrell R; Pavey, Emily S; Penheiter, Alan R; Knutson, Jean N; Turner, Stephen T; Joyner, Michael J

    2014-01-01

    Dietary sodium affects function of the beta-2 adrenoceptor (ADRB2). We tested the hypothesis that haplotype variation in the ADRB2 gene would influence the cardiovascular and regional vasodilator responses to sympathoexcitatory manoeuvres following low, normal and high sodium diets, and ADRB2-mediated forearm vasodilation in the high sodium condition. Seventy-one healthy young adults were grouped by double homozygous haplotypes: Arg16+Gln27 (n = 31), the rare Gly16+Gln27 (n = 10) and Gly16+Glu27 (n = 30). Using a randomized cross-over design, subjects were studied following 5 days of controlled low, normal and high sodium with 1 month or longer between diets (and low hormone phase of the menstrual cycle). All three visits utilized ECG and finger plethysmography for haemodynamic measures, and the high sodium visit included a brachial arterial catheter for forearm vasodilator responses to isoprenaline with plethysmography. Lymphocytes were sampled for ex vivo analysis of ADRB2 density and binding conformation. We found a main effect of haplotype on ADRB2 density (P = 0.03) with the Gly16+Glu27 haplotype having the greatest density (low, normal, high sodium: 12.9 ± 0.9, 13.5 ± 0.9 and 13.6 ± 0.8 fmol mg−1 protein, respectively) and Arg16+Gln27 having the least (9.3 ± 0.6, 10.1 ± 0.5 and 10.3 ± 0.6  fmol mg−1 protein, respectively), but there were no sodium or haplotype effects on receptor binding conformation. In the mental stress trial, there was a main effect of haplotype on cardiac output (P = 0.04), as Arg16+Gln27 had the lowest responses. Handgrip and forearm vasodilation yielded no haplotype differences, and no correlations were present for ADRB2 density and haemodynamics. Our findings support cell-based evidence that ADRB2 haplotype influences ADRB2 protein expression independent of dietary sodium, yet the haemodynamic consequences appear modest in healthy humans. PMID:25260632

  7. Role of Flightless-I (Drosophila) homolog in the transcription activation of type I collagen gene mediated by transforming growth factor beta

    SciTech Connect

    Lim, Mi-Sun; Jeong, Kwang Won

    2014-11-21

    Highlights: • FLII activates TGFβ-mediated expression of COL1A2 gene. • TGFβ induces the association of FLII with SMAD3 and BRG1 in A549 cells. • FLII is required for the recruitment of SWI/SNF complex and chromatin accessibility to COL1A2 promoter. - Abstract: Flightless-I (Drosophila) homolog (FLII) is a nuclear receptor coactivator that is known to interact with other transcriptional regulators such as the SWI/SNF complex, an ATP-dependent chromatin-remodeling complex, at the promoter or enhancer region of estrogen receptor (ER)-α target genes. However, little is known about the role of FLII during transcription initiation in the transforming growth factor beta (TGFβ)/SMAD-dependent signaling pathway. Here, we demonstrate that FLII functions as a coactivator in the expression of type I collagen gene induced by TGFβ in A549 cells. FLII activates the reporter gene driven by COL1A2 promoter in a dose-dependent manner. Co-expression of GRIP1, CARM1, or p300 did not show any synergistic activation of transcription. Furthermore, the level of COL1A2 expression correlated with the endogenous level of FLII mRNA level. Depletion of FLII resulted in a reduction of TGFβ-induced expression of COL1A2 gene. In contrast, over-expression of FLII caused an increase in the endogenous expression of COL1A2. We also showed that FLII is associated with Brahma-related gene 1 (BRG1) as well as SMAD in A549 cells. Notably, the recruitment of BRG1 to the COL1A2 promoter region was decreased in FLII-depleted A549 cells, suggesting that FLII is required for TGFβ-induced chromatin remodeling, which is carried out by the SWI/SNF complex. Furthermore, formaldehyde-assisted isolation of regulatory elements (FAIRE)-quantitative polymerase chain reaction (qPCR) experiments revealed that depletion of FLII caused a reduction in chromatin accessibility at the COL1A2 promoter. These results suggest that FLII plays a critical role in TGFβ/SMAD-mediated transcription of the COL1A2 gene

  8. Identification of the human {beta}A2 crystallin gene (CRYBA2): Localization of the gene on human chromosome 2 and of the homologous gene on mouse chromosome 1

    SciTech Connect

    Hulsebos, T.J.M.; Cerosaletti, K.M.; Fournier, R.E.K.

    1995-08-10

    By using primers synthesized on the basis of the bovine {beta}A2 crystalline gene sequence, we amplified exons 5 and 6 of the human gene (CRYBA2). CRYBA2 was assigned to human chromosome 2 by concordance analysis in human x rodent somatic cell hybrids using the amplified PCR products as probe. Regional localization to 2q34-q36 was established by hybridizing the CRYBA2 probe to microcell and radiation hybrids containing defined fragments of chromosome 2 as the only human contribution. The CRYBA2 probe was also used to localize, by interspecific backcross mapping, the mouse gene (Cryba2) to the central portion of chromosome 1 in a region of known human chromosome 2 homology. Finally, we demonstrate that in both species the {beta}A2 crystallin gene is linked but separable from the {gamma}A crystallin gene. The {beta}A2 crystallin gene is a candidate gene for human and mouse hereditary cataract. 32 refs., 4 figs.

  9. Interleukin-1 alpha, interleukin-1 beta and interleukin-8 gene expression in human aural cholesteatomas.

    PubMed

    Kim, C S; Lee, C H; Chung, J W; Kim, C D

    1996-03-01

    Bone destruction is a common characteristic feature of chronic otitis media, especially aural cholesteatoma. A number of immunohistochemical studies have suggested that interleukin-1 (IL-1) may be responsible for cholesteatomatous bone destruction. We designed this study to present the mRNA expression patterns of IL-1 alpha, IL-1 beta, and IL-8, which can induce and activate the leukocyte, the major reservoir of potent proteolytic enzymes. Total RNAs were extracted from aural cholesteatomas, external auditory canal skin (EACS), postauricular skin (PAS), and granulation tissues and transcribed into cDNAs. cDNAs were amplified by using PCR technique with primers for IL-1 alpha, IL-1 beta, IL-8, and beta-actin. Amplified products were hybridized with each internal probe and the relative density was measured. In granulation tissues, the relative density of IL-1 alpha was greater than that of other tissues. The ratio of IL-1 beta and IL-8 of aural cholesteatoma was significantly higher than that of EACS and PAS. We suggest that both of IL-1 alpha and IL-1 beta may play a role in the pathological changes, and that IL-8, which is mainly produced from cholesteatomatous epithelium, may have an important role in the pathological changes of cholesteatomas. PMID:8725537

  10. CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

    NASA Technical Reports Server (NTRS)

    Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid

    2003-01-01

    Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

  11. The investigation of oxacillinase/metallo-beta-lactamase genes and clonal analysis in carbapenem-resistant Klebsiella pneumoniae.

    PubMed

    Cetinkol, Yeliz; Yildirim, Arzu Altunçekiç; Telli, Murat; Calgin, Mustafa Kerem

    2016-03-01

    Infections due to carbapenem-resistant Klebsiella pneumoniae represent a growing problem nationally. In our study, we aimed to examine carbapenem-resistant K. pneumoniae with multiple resistance isolated in the intensive care unit of our hospital. Isolates were investigated for the presence of oxacillinase and metallo-beta lactamase genes with a view to determining the clonal relationship between the strains intensely over a short period. Strain identification was completed with conventional methods and automated identification kit. OXA-58, OXA-23, OXA-51, OXA-24 and OXA-48 and metallo-beta lactamase genes IPM, VIM, SPM, SIM, GIM and NDM-1 were investigated with PCR. For clonal relationships of carbapenem-resistant strains, the PFGE experiment was performed. While all of these carbapenem-resistant strains were positive for OXA-48, the resistant genes NDM-1, VIM, KPC, IPM, SPM, GIM, SIM, OXA-23, OXA-24, OXA-58 and OXA-51 were not observed. When molecular typing results were investigated, PFGE determined clonal distribution of three pulsotypes. However, it was observed that the strains intensified in a single clone and this was assessed as the outbreak isolate. The results of this study showed the primary enzyme responsible for carbapenem resistance in K. pneumoniae strains in our hospital is still OXA-48. To prevent the spread of carbapenem-resistant K. pneumoniae isolates, with epidemic potential, national-level monitoring and effective infection control precautions should be enforced. PMID:27031897

  12. Purification and characterization of beta 2-tomatinase, an enzyme involved in the degradation of alpha-tomatine and isolation of the gene encoding beta 2-tomatinase from Septoria lycopersici.

    PubMed

    Sandrock, R W; DellaPenna, D; VanEtten, H D

    1995-01-01

    Lycopersicon species often contain the toxic glycoalkaloid alpha-tomatine, which is proposed to protect these plants from general microbial infection. however, fungal pathogens of tomato often are tolerant to alpha-tomatine and detoxification of alpha-tomatine may be how these pathogens avoid this potential barrier. As an initial step to evaluate this possibility, we have purfied to homogeneity a beta-1,2-D glucosidase from the tomato pathogen Septoria lycopersici that hydrolyzes the beta-1,2-D glucosyl bond on the tetrasaccharide moiety of alpha-tomatine to produce beta2-tomatine. The enzyme is a 110-kDa protein with a pI of 4.5 and a Km for alpha-tomatine of 62 microM. Little or no activity was detected on a variety of other glycosides. The gene encoding this protein was isolated and contains an open reading frame of 803 amino acids that shares sequence homology with several other beta-D-glucosidases. When S. lycopersici was incubated with alpha-tomatine, beta2-tomatinase mRNA accumulated, suggesting that the enzyme is substrate inducible. Aspergillus nidulans expressed ¿beta2-tomatinase¿ activity when transformed with this gene but transformants were still sensitive to alpha-tomatine. PMID:8664504

  13. Dynamic changes in the expression of relaxin-like factor (INSL3), cholesterol side-chain cleavage cytochrome p450, and 3beta-hydroxysteroid dehydrogenase in bovine ovarian follicles during growth and atresia.

    PubMed

    Irving-Rodgers, Helen F; Bathgate, Ross A D; Ivell, Richard; Domagalski, Roger; Rodgers, Raymond J

    2002-04-01

    Relaxin-like factor (RLF) is a new member of the insulin-relaxin gene family known to be expressed in the ovarian follicular thecal cells of ruminants. To investigate the pattern of RLF expression in development and atresia of bovine follicles, antisera were raised in rats and rabbits to recombinantly expressed bovine pro-RLF and to chemically synthesized ovine RLF B chain, respectively. On dot blotting analysis, the rat antiserum bound to pro-RLF and less strongly to a synthetic mature ovine RLF lacking the C-domain, whereas the rabbit antiserum bound the mature form of ovine RLF. These antisera were used to immunostain bovine ovarian follicles of differing sizes and stages of health and atresia. 3beta-Hydroxysteroid dehydrogenase was colocalized with pro-RLF (n = 86 follicles), and cholesterol side-chain cleavage cytochrome P450 was localized in another section of many of the same follicles (n = 66). Not all follicles expressed pro-RLF in the theca interna, so the results are presented as the proportion of follicles expressing pro-RLF. Both mature and pro-RLF were immunolocalized to steroidogenic thecal cells of healthy follicles. As follicles enlarged to >5 mm, the proportion expressing pro-RLF declined (19/19 for <5 mm and 18/26 for >6 mm). Atresia was divided into antral (antral granulosa cells dying first) or basal (basal cells dying first) and further divided into early, middle, and late. For antral atresia of small follicles (2-5 mm), no decline in the proportion expressing pro-RLF was observed (early 6/6, middle 2/2) until the late stages (1/4). For basal atresia, which only occurs in small follicles (2-5 mm), the proportion expressing pro-RLF declined in the middle (2/5) and late (0/8) stages. In larger follicles (>6 to <10 mm), the proportion expressing pro-RLF also declined with atresia (1/13). These declines in RLF expression with atresia or increasing size were not accompanied by a decline in the expression of steroidogenic enzymes in the theca

  14. Beta vulgaris root genes and their potential role in insect resistance: functional genomics analysis of a serine proteinase inhibitor gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To gain knowledge of root defense response mechanisms, an area of plant defense research that lacks much information, more than 150 sugar beet (Beta vulgaris L.) root ESTs responding to infestations by the sugar beet root maggot (SBRM, Tetanops myopaeformis von Röder) were identified using suppressi...

  15. The GUS gene fusion system (Escherichia coli beta-D-glucuronidase gene), a useful tool in studies of root colonization by Fusarium oxysporum.

    PubMed Central

    Couteaudier, Y; Daboussi, M J; Eparvier, A; Langin, T; Orcival, J

    1993-01-01

    The plant-pathogenic fungus Fusarium oxysporum was successfully transformed with the beta-D-glucuronidase gene from Escherichia coli (gusA) (GUS system) in combination with the gene for nitrate reductase (niaD) as the selectable marker. The frequency of cotransformation, as determined by GUS expression on plates containing medium supplemented with 5-bromo-4-chloro-3-indolyl glucuronide (GUS+), was very high (up to 75%). Southern hybridization analyses of GUS+ transformants revealed that single or multiple copies of the gusA gene were integrated into the genomes. High levels of GUS activity are expressed in some transformants, but activity in F. oxysporum does not appear to be correlated with the copy number of the gusA gene. Since the highest activity was found in a transformant with a single copy, it can be assumed that sequence elements of F. oxysporum integrated upstream of the gene can act as a promoter or enhancer. Expression of the gusA gene was also detected during growth of the fungus in plants, indicating that the GUS system can be used as a sensitive and easy reporter gene assay in F. oxysporum. Images PMID:8328800

  16. The flow cytometry-defined light chain cytoplasmic immunoglobulin index and an associated 12-gene expression signature are independent prognostic factors in multiple myeloma.

    PubMed

    Papanikolaou, X; Alapat, D; Rosenthal, A; Stein, C; Epstein, J; Owens, R; Yaccoby, S; Johnson, S; Bailey, C; Heuck, C; Tian, E; Joiner, A; van Rhee, F; Khan, R; Zangari, M; Jethava, Y; Waheed, S; Davies, F; Morgan, G; Barlogie, B

    2015-08-01

    As part of Total Therapy (TT) 3b, baseline marrow aspirates were subjected to two-color flow cytometry of nuclear DNA content and cytoplasmic immunoglobulin (DNA/CIG) as well as plasma cell gene expression profiling (GEP). DNA/CIG-derived parameters, GEP and standard clinical variables were examined for their effects on overall survival (OS) and progression-free survival (PFS). Among DNA/CIG parameters, the percentage of the light chain-restricted (LCR) cells and their cytoplasmic immunoglobulin index (CIg) were linked to poor outcome. In the absence of GEP data, low CIg <2.8, albumin <3.5 g/dl and age ⩾65 years were significantly associated with inferior OS and PFS. When GEP information was included, low CIg survived the model along with GEP70-defined high risk and low albumin. Low CIg was linked to beta-2-microglobulin >5.5 mg/l, a percentage of LCR cells exceeding 50%, C-reactive protein ⩾8 mg/l and GEP-derived high centrosome index. Further analysis revealed an association of low CIg with 12 gene probes implicated in cell cycle regulation, differentiation and drug transportation from which a risk score was developed in TT3b that held prognostic significance also in TT3a, TT2 and HOVON trials, thus validating its general applicability. Low CIg is a powerful new prognostic variable and has identified potentially drug-able targets. PMID:25753926

  17. The flow cytometry-defined light chain cytoplasmic immunoglobulin index and an associated 12-gene expression signature are independent prognostic factors in multiple myeloma

    PubMed Central

    Papanikolaou, X; Alapat, D; Rosenthal, A; Stein, C; Epstein, J; Owens, R; Yaccoby, S; Johnson, S; Bailey, C; Heuck, C; Tian, E; Joiner, A; van Rhee, F; Khan, R; Zangari, M; Jethava, Y; Waheed, S; Davies, F; Morgan, G; Barlogie, B

    2015-01-01

    As part of Total Therapy (TT) 3b, baseline marrow aspirates were subjected to two-color flow cytometry of nuclear DNA content and cytoplasmic immunoglobulin (DNA/CIG) as well as plasma cell gene expression profiling (GEP). DNA/CIG-derived parameters, GEP and standard clinical variables were examined for their effects on overall survival (OS) and progression-free survival (PFS). Among DNA/CIG parameters, the percentage of the light chain-restricted (LCR) cells and their cytoplasmic immunoglobulin index (CIg) were linked to poor outcome. In the absence of GEP data, low CIg <2.8, albumin <3.5 g/dl and age ⩾65 years were significantly associated with inferior OS and PFS. When GEP information was included, low CIg survived the model along with GEP70-defined high risk and low albumin. Low CIg was linked to beta-2-microglobulin >5.5 mg/l, a percentage of LCR cells exceeding 50%, C-reactive protein ⩾8 mg/l and GEP-derived high centrosome index. Further analysis revealed an association of low CIg with 12 gene probes implicated in cell cycle regulation, differentiation and drug transportation from which a risk score was developed in TT3b that held prognostic significance also in TT3a, TT2 and HOVON trials, thus validating its general applicability. Low CIg is a powerful new prognostic variable and has identified potentially drug-able targets. PMID:25753926

  18. The dopamine beta-hydroxylase gene polymorphism rs1611114 is associated with schizophrenia in the Chinese Zhuang but not Chinese Han population.

    PubMed

    Long, Jianxiong; Huang, Guifeng; Liang, Baoyun; Ling, Weijun; Guo, Xiaojing; Jiang, Juan; Su, Li

    2016-10-01

    Schizophrenia (SCZ) is a devastating neurodevelopmental disorder. However, the mechanism underlying this highly heritable disorder remains unclear. The dopamine beta-hydroxylase (DBH) gene encodes a key metabolic enzyme of dopamine. Consequently, DBH is considered a candidate gene for SCZ. However, previous studies on its association with SCZ susceptibility have shown conflicting results. Here, we examined association between the rs1611114 polymorphism of DBH and SCZ susceptibility and related clinical symptoms. A total of 691 SCZ patients and 698 age- and gender-matched healthy controls were examined. mRNA expression levels of DBH were measured by quantitative real-time polymerase chain reaction, and the rs1611114 polymorphism was genotyped using the Sequenom MassARRAY platform. Also, the Positive and Negative Syndrome Scale (PANSS) was used to assess SCZ clinical symptoms. Our results show lower DBH mRNA expression levels in SCZ patients than healthy controls (Zhuang: p = 0.000; Han: p = 0.037). Interestingly, the rs1611114 polymorphism was significantly associated with SCZ susceptibility (overdominant model: p = 0.010) in only the Chinese Zhuang population. Furthermore, the rs1611114 polymorphism was associated with PANSS total score (allele T/C: p = 0.015) and general psychopathology score (allele T/C: p = 0.027) in Chinese Zhuang SCZ patients. These results suggest that the DBH gene may play an important role in the occurrence of SCZ. Also, rs1611114 may be associated with SCZ susceptibility and related clinical symptoms in the Chinese Zhuang but not Han Chinese population. Further studies with larger samples of different ethnicities are needed to confirm the role of DBH in SCZ. PMID:27236774

  19. Human laminin B2 chain

    SciTech Connect

    Pikkarainen, T.; Kallunki, T.; Tryggvason, K.

    1988-05-15

    The complete amino acid sequence of the human laminin B2 chains has been determined by sequencing of cDNA clones. The six overlapping clones studied cover approximately 7.5 kilobases of which 5312 nucleotides were sequenced from the 5' end. The open reading frame codes for a 33-residue signal peptide and a 1576-residue B2 chain proper, which is 189 residues less than in the highly homologous B1 chain. Computer analysis revealed that the B2 chain consists of distinct domains that contain helical structures, cysteine-rich repeats, and globular regions, as does the B1 chain. However, domain ..cap alpha.. and domain ..beta.. of the B1 chain have no counterpart in B2, and the number of cysteine-rich repeats is 12, or 1 less than in the B1 chain. The degree of homology between the two chains is highest in the cysteine repeat-containing domains III and V where 40% of the residues match. However, in helical domains I/II only 16% of residues match. The results demonstrate that the B1 and B2 chains of laminin are highly homologous proteins that are probably the products of related genes.

  20. Genomic Organization and Differential Signature of Positive Selection in the Alpha and Beta Globin Gene Clusters in Two Cetacean Species

    PubMed Central

    Nery, Mariana F.; Arroyo, José Ignacio; Opazo, Juan C.

    2013-01-01

    The hemoglobin of jawed vertebrates is a heterotetramer protein that contains two α- and two β-chains, which are encoded by members of α- and β-globin gene families. Given the hemoglobin role in mediating an adaptive response to chronic hypoxia, it is likely that this molecule may have experienced a selective pressure during the evolution of cetaceans, which have to deal with hypoxia tolerance during prolonged diving. This selective pressure could have generated a complex history of gene turnover in these clusters and/or changes in protein structure themselves. Accordingly, we aimed to characterize the genomic organization of α- and β-globin gene clusters in two cetacean species and to detect a possible role of positive selection on them using a phylogenetic framework. Maximum likelihood and Bayesian phylogeny reconstructions revealed that both cetacean species had retained a similar complement of putatively functional genes. For the α-globin gene cluster, the killer whale presents a complement of genes composed of HBZ, HBK, and two functional copies of HBA and HBQ genes, whereas the dolphin possesses HBZ, HBK, HBA and HBQ genes, and one HBA pseudogene. For the β-globin gene cluster, both species retained a complement of four genes, two early expressed genes—HBE and HBH—and two adult expressed genes—HBD and HBB. Our natural selection analysis detected two positively selected sites in the HBB gene (56 and 62) and four in HBA (15, 21, 49, 120). Interestingly, only the genes that are expressed during the adulthood showed the signature of positive selection. PMID:24259315

  1. New splicing mutation in the choline kinase beta (CHKB) gene causing a muscular dystrophy detected by whole-exome sequencing.

    PubMed

    Oliveira, Jorge; Negrão, Luís; Fineza, Isabel; Taipa, Ricardo; Melo-Pires, Manuel; Fortuna, Ana Maria; Gonçalves, Ana Rita; Froufe, Hugo; Egas, Conceição; Santos, Rosário; Sousa, Mário

    2015-06-01

    Muscular dystrophies (MDs) are a group of hereditary muscle disorders that include two particularly heterogeneous subgroups: limb-girdle MD and congenital MD, linked to 52 different genes (seven common to both subgroups). Massive parallel sequencing technology may avoid the usual stepwise gene-by-gene analysis. We report the whole-exome sequencing (WES) analysis of a patient with childhood-onset progressive MD, also presenting mental retardation and dilated cardiomyopathy. Conventional sequencing had excluded eight candidate genes. WES of the trio (patient and parents) was performed using the ion proton sequencing system. Data analysis resorted to filtering steps using the GEMINI software revealed a novel silent variant in the choline kinase beta (CHKB) gene. Inspection of sequence alignments ultimately identified the causal variant (CHKB:c.1031+3G>C). This splice site mutation was confirmed using Sanger sequencing and its effect was further evaluated with gene expression analysis. On reassessment of the muscle biopsy, typical abnormal mitochondrial oxidative changes were observed. Mutations in CHKB have been shown to cause phosphatidylcholine deficiency in myofibers, causing a rare form of CMD (only 21 patients reported). Notwithstanding interpretative difficulties that need to be overcome before the integration of WES in the diagnostic workflow, this work corroborates its utility in solving cases from highly heterogeneous groups of diseases, in which conventional diagnostic approaches fail to provide a definitive diagnosis. PMID:25740612

  2. Isolation and sequencing of a putative promoter region of the murine G protein beta 1 subunit (GNB1) gene.

    PubMed

    Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko; Wang, Xiao-Bing; Hembree, Cambria M; Goodman, Nancy L; Uhl, George R

    2002-02-01

    The expression of the heterotrimeric GTP-binding protein beta 1 subunit gene (GNB1) is regulated by psychostimulants such as cocaine and amphetamines. Since the up-regulation appears to be one of the candidate processes of sensitization, it is necessary to elucidate the cellular and molecular mechanism of the GNB1 gene regulation for a better understanding the establishment of sensitization. In the present study, we describe the isolation and nucleotide sequence analysis of the GNB1 gene promoter region. We have isolated approximately 10 kb of the 5'-flanking region of the mouse of GNB1 gene and found potential elements involved in putative transcriptional control of the GNB1, such as AP1, AP2, Sp1, cyclic AMP response element, and nuclear factor kappa B recognition sites, within the sequences 0.3 kb upstream from the putative transcription start site. This region was highly rich in G + C content, but lacked TATA or CATT boxes. Comparing the nucleotide sequence of the cDNA clone with the human genome databases using the BLAST program a region containing putative exon 1 and promoter of the human GNB1 gene in chromosome 1 was found. The cloning and sequence analysis of an extensive portion of the 5'-flanking regulatory region of the GNB1 gene provides new insights into the factors involved in the regulation by psychostimulants of GNB1 expression. PMID:12180136

  3. Coal liquefaction model studies: free radical chain decomposition of diphenylpropane, dibenzyl ether, and phenyl ether via. beta. -scission reactions

    SciTech Connect

    Gillert, K.E.; Gojewski, J.J.

    1982-12-03

    The thermal decompositions to 1,3-diphenylpropane (1), dibenzyl ether (2), and phenethyl phenyl ether (3) have been found to proceed by free radical chain processes. 1 gave toluene and styrene with a reaction order of 1.55, E/sub A/ = 51.4 kcal/mol, and log A = 12.5. The reaction could be initiated by benzyl phenyl ether but not by 1,2-diphenylethane. 2 gave toluene and benzaldehyde with a reaction order of 1.43,E/sub A/ = 48 kcal/mol, and log A = 12.6. The reaction could be initiated with benzyl phenyl ether. 3 gave phenol and styrene with a reaction order of 1.21, E/sub A/ = 50.3 kcal/mol, and log A =12.3. The reaction could be initiated by benzyl phenyl ether. All of the data are consistent with free radical processes with the reaction order determined by the termination reaction. No evidence for concerted reactions has been found.

  4. The expression of the TGF beta 1 gene in the first trimester human eye and other embryonic organs.

    PubMed

    Hyldahl, L; Engström, W; Schofield, P

    1990-09-01

    We have examined the expression of the transforming growth factor beta 1 gene in a variety of tissues in the developing human embryo. Northern blot analysis revealed the presence of TGF B1 mRNA in the 10-12 week old eye as well as in most first trimester organs with the notable exception of the yolk sack. In an attempt to determine the topographical distribution of TGF B1 transcripts within the eye, we found that messenger RNA levels were higher in the posterior regions of the eye globe. PMID:2279276

  5. Isolation, characterization, and expression of a second {beta}-tubulin-encoding gene from Colletotrichum gloeosporioides f. sp. aeschynomene

    SciTech Connect

    Buhr, T.L.; Dickman, M.B.

    1994-11-01

    Colletotrichum gloeosporioides (Penz.) Sacc. F. sp. aeschynomene incites anthracnose on Aeschynomene virgininica (northern jointvetch). Northern jointvetch is a leguminous weed in rice and soybean fields. Contaminating northern jointvetch seeds greatly reduce the market value of rice. C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomene has been commercially marketed as a mycoherbicide to decrease populations of northern jointvetch. Development of a transformation system would be extremely useful for investigating the molecular biology of C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomen. This paper reports the nucleotide sequence of a second gene for {beta} Tub (TUB2) in C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomene and identifies a molecular lesion which likely confers BEN (systemic fungicide) resistance.

  6. Myosin Light Chain Kinase (MLCK) Gene Influences Exercise Induced Muscle Damage during a Competitive Marathon.

    PubMed

    Del Coso, Juan; Valero, Marjorie; Lara, Beatriz; Salinero, Juan José; Gallo-Salazar, César; Areces, Francisco

    2016-01-01

    Myosin light chain kinase (MLCK) phosphorylates the regulatory light chain (RLC) of myosin producing increases in force development during skeletal muscle contraction. It has been suggested that MLCK gene polymorphisms might alter RLC phosphorylation thereby decreasing the ability to produce force and to resist strain during voluntary muscle contractions. Thus, the genetic variations in the MLCK gene might predispose some individuals to higher values of muscle damage during exercise, especially during endurance competitions. The aim of this investigation was to determine the influence of MLCK genetic variants on exercise-induced muscle damage produced during a marathon. Sixty-seven experienced runners competed in a marathon race. The MLCK genotype (C37885A) of these marathoners was determined. Before and after the race, a sample of venous blood was obtained to assess changes in serum myoglobin concentrations and leg muscle powe