Science.gov

Sample records for beta-lactamase resistance genes

  1. [Mechanisms of resistance in Enterobacteriaceae towards beta-lactamase antibiotics].

    PubMed

    Susić, Edita

    2004-01-01

    cefepime, aztreonam, as well as penicillins and other cephalosporins, except for cephamycin (cefoxitin and cefotetan). They are inhibited by beta-lactamase inhibitors. AmpC beta-lactamases are chromosomal and inducible in most Enterobacter spp., C. freundii, Serratia spp., M. morganii and Providentia spp. They are resistant to almost all penicillins and cephalosporins, to beta-lactamase inhibitors and aztreonam, and are susceptible to cefepime and carbapenems as well. Plasmid-mediated AmpC beta-lactamases have arisen through the transfer of chromosomal genes for the inducible AmpC beta-lactamase onto plasmids. All plasmid-mediated AmpC beta-lactamases have similar substrate profiles to the parental enzymes from which they appear to be derived. With one exception, plasmid-mediated AmpCs differ from chromosomal AmpCs in being uninducible. The National Committee for Clinical Laboratory Standards (NCCLS) has issued recommendations for ESBL screening and confirmation for isolates of E. coli, K. pneumoniae and K. oxytoca. No NCCLS recommendations exist for ESBLs detection and reporting for other organisms or for detecting plasmid-mediated AmpC beta-lactamases. High-level expression of AmpC may prevent recognition of an ESBL in species that produce a chromosomally encoded inducible AmpC beta-lactamase. AmpC-inducible species (e. g. Enterobacter spp. and C. freundii) can be recognized by cefoxitin/cefotaxime disk antagonism tests. Since clinical laboratories are first to encounter bacteria with new forms of antibiotic resistance, they need appropriate tools to recognize these bacteria, including trained staff with sufficient time and equipment to follow up important observations. Because bacterial pathogenes are constantly changing, training must be an ongoing process. PMID:15700687

  2. Multidrug resistance mediated by co-carriage of extended-spectrum beta-lactamases, AmpC and New Delhi metallo-beta-lactamase-1 genes among carbapenem-resistant Enterobacteriaceae at five Indian medical centres.

    PubMed

    Manoharan, A; Barla, G S; Peter, R; Sugumar, M; Mathai, D

    2016-01-01

    In this study, we evaluated the coexistence of extended-spectrum beta-lactamases (ESBL), AmpC and New Delhi metallo-beta-lactamase-1 (NDM-1) genes among carbapenem-resistant Enterobacteriaceae (CRE) recovered prospectively from patients at multiple sites. The study included 285 CRE strains from 2782 Gram-negative Bacilli collected from multiple centres during 2007-2010, of which 87 were characterised. Standard and reference laboratory methods were used for resistance determination. Detection of blaNDM-1 , blaAmpC , blaTEM , blaSHV and blaCTX-M was done by polymerase chain reaction. High levels of antimicrobial resistance observed among study isolates. Co-carriage of ESBLs, AmpC and NDM-1 was 26.3%. Nosocomial origin among the co-carriage isolates was 64.3%, with 9.2% associated mortality. PMID:27514962

  3. The investigation of oxacillinase/metallo-beta-lactamase genes and clonal analysis in carbapenem-resistant Klebsiella pneumoniae.

    PubMed

    Cetinkol, Yeliz; Yildirim, Arzu Altunçekiç; Telli, Murat; Calgin, Mustafa Kerem

    2016-03-01

    Infections due to carbapenem-resistant Klebsiella pneumoniae represent a growing problem nationally. In our study, we aimed to examine carbapenem-resistant K. pneumoniae with multiple resistance isolated in the intensive care unit of our hospital. Isolates were investigated for the presence of oxacillinase and metallo-beta lactamase genes with a view to determining the clonal relationship between the strains intensely over a short period. Strain identification was completed with conventional methods and automated identification kit. OXA-58, OXA-23, OXA-51, OXA-24 and OXA-48 and metallo-beta lactamase genes IPM, VIM, SPM, SIM, GIM and NDM-1 were investigated with PCR. For clonal relationships of carbapenem-resistant strains, the PFGE experiment was performed. While all of these carbapenem-resistant strains were positive for OXA-48, the resistant genes NDM-1, VIM, KPC, IPM, SPM, GIM, SIM, OXA-23, OXA-24, OXA-58 and OXA-51 were not observed. When molecular typing results were investigated, PFGE determined clonal distribution of three pulsotypes. However, it was observed that the strains intensified in a single clone and this was assessed as the outbreak isolate. The results of this study showed the primary enzyme responsible for carbapenem resistance in K. pneumoniae strains in our hospital is still OXA-48. To prevent the spread of carbapenem-resistant K. pneumoniae isolates, with epidemic potential, national-level monitoring and effective infection control precautions should be enforced. PMID:27031897

  4. Characterization of a new beta-lactamase gene from isolates of Vibrio spp. in Korea.

    PubMed

    Jun, Lyu Jin; Kim, Jae Hoon; Jin, Ji Woong; Jeong, Hyun Do

    2012-04-01

    PCR was performed to analyze the beta-lactamase genes carried by ampicillin-resistant Vibrio spp. strains isolated from marine environments in Korea between 2006 and 2009. All 36 strains tested showed negative results in PCR with the primers designed from the nucleotide sequences of various known beta-lactamase genes. This prompted us to screen new beta-lactamase genes. A novel beta-lactamase gene was cloned from Vibrio alginolyticus KV3 isolated from the aquaculture water of Geoje Island of Korea. The determined nucleotide sequence (VAK-3 beta-lactamase) revealed an open reading frame (ORF) of 852 bp, encoding a protein of 283 amino acids (aa), which displayed low homology to any other beta-lactamase genes reported in public databases. The deduced 283 aa sequence of VAK-3, consisting of a 19 aa signal peptide and a 264 aa mature protein, contained highly conserved peptide segments specific to class A beta-lactamases including the specific amino acid residues STFK (62-65), SDN (122-124), E (158), and RTG (226-228). Results from PCR performed with primers specific to the VAK-3 beta-lactamase gene identified 3 of the 36 isolated strains as V. alginolyticus, Vibrio cholerae, and Photobacterium damselae subsp. damselae, indicating the utilization of various beta-lactamase genes including unidentified ones in ampicillin-resistant Vibrio spp. strains from the marine environment. In a mating experiment, none of the isolates transfered the VAK-3 beta-lactamase gene to the Escherichia coli recipient. This lack of mobility, and the presence of a chromosomal acyl-CoA flanking sequence upstream of the VAK-3 beta- lactamase gene, led to the assumption that the location of this new beta-lactamase gene was in the chromosome, rather than the mobile plasmid. Antibiotic susceptibility of VAK-3 beta-lactamase was indicated by elevated levels of resistance to penicillins, but not to cephalosporins in the wild type and E. coli harboring recombinant plasmid pKV-3, compared with those of

  5. Extended spectrum beta-lactamase and fluoroquinolone resistance genes and plasmids among Escherichia coli isolates from zoo animals, Czech Republic.

    PubMed

    Dobiasova, Hana; Dolejska, Monika; Jamborova, Ivana; Brhelova, Eva; Blazkova, Lucie; Papousek, Ivo; Kozlova, Marketa; Klimes, Jiri; Cizek, Alois; Literak, Ivan

    2013-09-01

    Commensal Escherichia coli isolates from healthy zoo animals kept in Ostrava Zoological Garden, Czech Republic, were investigated to evaluate the dissemination of extended-spectrum beta-lactamase (ESBL) and plasmid-mediated quinolone resistance (PMQR) genes. A total of 160 faecal samples of various animal species were inoculated onto MacConkey agar with cefotaxime (2 mg L(-1)) or ciprofloxacin (0.05 mg L(-1)) to obtain ESBL- or PMQR-positive E. coli isolates. Clonality of E. coli isolates was investigated by multilocus sequence typing and pulsed-field gel electrophoresis. Plasmids carrying ESBL or PMQR genes were typed by PCR-based replicon typing, plasmid multilocus sequence typing and restriction fragment length polymorphism. Forty-nine (71%, n = 69) cefotaxime-resistant and 15 (16%, n = 94) ciprofloxacin-resistant E. coli isolates harboured ESBL or PMQR genes. Isolates were assigned to 18 sequence types (ST) and 20 clusters according to their macrorestriction patterns by pulsed-field gel electrophoresis. The genes blaCTX -M-1 and qnrS1 were detected on highly related IncI1 plasmids assigned to clonal complex 3 (ST3, ST38) and on non-related IncN plasmids of ST1 and ST3, respectively. The gene qnrS1 was located on related IncX1 plasmids. Dissemination of antibiotic resistance is associated with spreading of particular E. coli clones and plasmids of specific incompatibility groups among various animal species. PMID:23679004

  6. Organization of the antiseptic resistance gene qacA and Tn552-related beta-lactamase genes in multidrug- resistant Staphylococcus haemolyticus strains of animal and human origins.

    PubMed

    Anthonisen, I-L; Sunde, M; Steinum, T M; Sidhu, M S; Sørum, H

    2002-11-01

    A part (12 kb) of a plasmid containing the beta-lactamase genes of Tn552, the disinfectant resistance gene qacA, and flanking DNA has been cloned from a Staphylococcus haemolyticus isolate and sequenced. This region was used to map the corresponding regions in six other multiresistant S. haemolyticus isolates of human and animal origin. The organizations of the genetic structures were almost identical in all isolates studied. The beta-lactamase and qacA genes from S. haemolyticus have >99.9% identities at the nucleotide level with the same genes from S. aureus, demonstrating that various staphylococcal species able to colonize animal and human hosts can exchange the genetic elements involved in resistance to antibiotics and disinfectants. The use of antibiotics and disinfectants in veterinary practice and animal husbandry may also contribute to the selection and maintenance of resistance factors among the staphylococcal species. Different parts of the 12-kb section analyzed had high degrees of nucleotide identity with regions from several other different Staphylococcus aureus plasmids. This suggests the contribution of interplasmid recombination in the evolutionary makeup of this 12-kb section involving plasmids that can intermingle between various staphylococcal species. The lateral spread of resistance genes between various staphylococcal species is probably facilitated by the generation of large multiresistance plasmids and the subsequent interspecies exchange of them. PMID:12384372

  7. beta-Lactamases in laboratory and clinical resistance.

    PubMed Central

    Livermore, D M

    1995-01-01

    beta-Lactamases are the commonest single cause of bacterial resistance to beta-lactam antibiotics. Numerous chromosomal and plasmid-mediated types are known and may be classified by their sequences or phenotypic properties. The ability of a beta-lactamase to cause resistance varies with its activity, quantity, and cellular location and, for gram-negative organisms, the permeability of the producer strain. beta-Lactamases sometimes cause obvious resistance to substrate drugs in routine tests; often, however, these enzymes reduce susceptibility without causing resistance at current, pharmacologically chosen breakpoints. This review considers the ability of the prevalent beta-lactamases to cause resistance to widely used beta-lactams, whether resistance is accurately reflected in routine tests, and the extent to which the antibiogram for an organism can be used to predict the type of beta-lactamase that it produces. PMID:8665470

  8. Beta-lactamase gene expression in a penicillin-resistant Bacillus anthracis strain.

    PubMed

    Chen, Yahua; Tenover, Fred C; Koehler, Theresa M

    2004-12-01

    Expression of the bla1 and bla2 genes in an archetypal Bacillus anthracis strain is insufficient for penicillin resistance. In a penicillin-resistant clinical isolate, both genes are highly transcribed, but bla1 is the major contributor to high-level resistance to ampicillin. Differential expression of the bla genes is dependent upon strain background. PMID:15561870

  9. A nosocomial outbreak of Serratia marcescens producing inducible Amp C-type beta-lactamase enzyme and carrying antimicrobial resistance genes within a class 1 integron.

    PubMed

    Bagattini, M; Crispino, M; Gentile, F; Barretta, E; Schiavone, D; Boccia, M C; Triassi, M; Zarrilli, R

    2004-01-01

    We investigated an outbreak of Serratia marcescens in the adult intensive care unit of the University Hospital of Napoli. The outbreak involved 13 cases of infection by S. marcescens over a nine-month period and was caused by a single pulsed-field gel electrophoresis clone. The epidemic strain was multiply antibiotic resistant, producing an inducible Amp C-type beta-lactamase enzyme and carrying the trimethoprim-resistance gene and the adenyltransferase gene, which confers resistance to streptomycin and spectinomycin, within a class 1 integron. Antimicrobial therapy with beta-lactams was associated with S. marcescens acquisition in the intensive care unit. PMID:14706268

  10. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  11. Multifocal outbreaks of metallo-beta-lactamase-producing Pseudomonas aeruginosa resistant to broad-spectrum beta-lactams, including carbapenems.

    PubMed Central

    Senda, K; Arakawa, Y; Nakashima, K; Ito, H; Ichiyama, S; Shimokata, K; Kato, N; Ohta, M

    1996-01-01

    A total of 3,700 Pseudomonas aeruginosa isolates were collected from 17 general hospitals in Japan from 1992 to 1994. Of these isolates, 132 carbapenem-resistant strains were subjected to DNA hybridization analysis with the metallo-beta-lactamase gene (blaIMP)-specific probe. Fifteen strains carrying the metallo-beta-lactamase gene were identified in five hospitals in different geographical areas. Three strains of P. aeruginosa demonstrated high-level imipenem resistance (MIC, > or = 128 micrograms/ml), two strains exhibited low-level imipenem resistance (MIC, < or = 4 micrograms/ml), and the rest of the strains were in between. These results revealed that the acquisition of a metallo-beta-lactamase gene alone does not necessarily confer elevated resistance to carbapenems. In several strains, the metallo-beta-lactamase gene was carried by large plasmids, and carbapenem resistance was transferred from P. aeruginosa to Escherichia coli by electroporation in association with the acquisition of the large plasmid. Southern hybridization analysis and genomic DNA fingerprinting profiles revealed different genetic backgrounds for these 15 isolates, although considerable similarity was observed for the strains isolated from the same hospital. These findings suggest that the metallo-beta-lactamase-producing P. aeruginosa strains are not confined to a unique clonal lineage but proliferated multifocally by plasmid-mediated dissemination of the metallo-beta-lactamase gene in strains of different genetic backgrounds. Thus, further proliferation of metallo-beta-lactamase-producing strains with resistance to various beta-lactams may well be inevitable in the future, which emphasizes the need for early recognition of metallo-beta-lactamase-producing strains, rigorous infection control, and restricted clinical use of broad-spectrum beta-lactams including carbapenems. PMID:8834878

  12. Detection of Extended Spectrum Beta-Lactamases Resistance Genes among Bacteria Isolated from Selected Drinking Water Distribution Channels in Southwestern Nigeria.

    PubMed

    Adesoji, Ayodele T; Ogunjobi, Adeniyi A

    2016-01-01

    Extended Spectrum Beta-Lactamases (ESBL) provide high level resistance to beta-lactam antibiotics among bacteria. In this study, previously described multidrug resistant bacteria from raw, treated, and municipal taps of DWDS from selected dams in southwestern Nigeria were assessed for the presence of ESBL resistance genes which include bla TEM, bla SHV, and bla CTX by PCR amplification. A total of 164 bacteria spread across treated (33), raw (66), and municipal taps (68), belonging to α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Flavobacteriia, Bacilli, and Actinobacteria group, were selected for this study. Among these bacteria, the most commonly observed resistance was for ampicillin and amoxicillin/clavulanic acid (61 isolates). Sixty-one isolates carried at least one of the targeted ESBL genes with bla TEM being the most abundant (50/61) and bla CTX being detected least (3/61). Klebsiella was the most frequently identified genus (18.03%) to harbour ESBL gene followed by Proteus (14.75%). Moreover, combinations of two ESBL genes, bla SHV + bla TEM or bla CTX + bla TEM, were observed in 11 and 1 isolate, respectively. In conclusion, classic bla TEM ESBL gene was present in multiple bacterial strains that were isolated from DWDS sources in Nigeria. These environments may serve as foci exchange of genetic traits in a diversity of Gram-negative bacteria. PMID:27563674

  13. Detection of Extended Spectrum Beta-Lactamases Resistance Genes among Bacteria Isolated from Selected Drinking Water Distribution Channels in Southwestern Nigeria

    PubMed Central

    Ogunjobi, Adeniyi A.

    2016-01-01

    Extended Spectrum Beta-Lactamases (ESBL) provide high level resistance to beta-lactam antibiotics among bacteria. In this study, previously described multidrug resistant bacteria from raw, treated, and municipal taps of DWDS from selected dams in southwestern Nigeria were assessed for the presence of ESBL resistance genes which include blaTEM, blaSHV, and blaCTX by PCR amplification. A total of 164 bacteria spread across treated (33), raw (66), and municipal taps (68), belonging to α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Flavobacteriia, Bacilli, and Actinobacteria group, were selected for this study. Among these bacteria, the most commonly observed resistance was for ampicillin and amoxicillin/clavulanic acid (61 isolates). Sixty-one isolates carried at least one of the targeted ESBL genes with blaTEM being the most abundant (50/61) and blaCTX being detected least (3/61). Klebsiella was the most frequently identified genus (18.03%) to harbour ESBL gene followed by Proteus (14.75%). Moreover, combinations of two ESBL genes, blaSHV + blaTEM or blaCTX + blaTEM, were observed in 11 and 1 isolate, respectively. In conclusion, classic blaTEM ESBL gene was present in multiple bacterial strains that were isolated from DWDS sources in Nigeria. These environments may serve as foci exchange of genetic traits in a diversity of Gram-negative bacteria. PMID:27563674

  14. Beta-lactamase genes of the penicillin-susceptible Bacillus anthracis Sterne strain.

    PubMed

    Chen, Yahua; Succi, Janice; Tenover, Fred C; Koehler, Theresa M

    2003-02-01

    Susceptibility to penicillin and other beta-lactam-containing compounds is a common trait of Bacillus anthracis. Beta-lactam agents, particularly penicillin, have been used worldwide to treat anthrax in humans. Nonetheless, surveys of clinical and soil-derived strains reveal penicillin G resistance in 2 to 16% of isolates tested. Bacterial resistance to beta-lactam agents is often mediated by production of one or more types of beta-lactamases that hydrolyze the beta-lactam ring, inactivating the antimicrobial agent. Here, we report the presence of two beta-lactamase (bla) genes in the penicillin-susceptible Sterne strain of B. anthracis. We identified bla1 by functional cloning with Escherichia coli. bla1 is a 927-nucleotide (nt) gene predicted to encode a protein with 93.8% identity to the type I beta-lactamase gene of Bacillus cereus. A second gene, bla2, was identified by searching the unfinished B. anthracis chromosome sequence database of The Institute for Genome Research for open reading frames (ORFs) predicted to encode beta-lactamases. We found a partial ORF predicted to encode a protein with significant similarity to the carboxy-terminal end of the type II beta-lactamase of B. cereus. DNA adjacent to the 5' end of the partial ORF was cloned using inverse PCR. bla2 is a 768-nt gene predicted to encode a protein with 92% identity to the B. cereus type II enzyme. The bla1 and bla2 genes confer ampicillin resistance to E. coli and Bacillus subtilis when cloned individually in these species. The MICs of various antimicrobial agents for the E. coli clones indicate that the two beta-lactamase genes confer different susceptibility profiles to E. coli; bla1 is a penicillinase, while bla2 appears to be a cephalosporinase. The beta-galactosidase activities of B. cereus group species harboring bla promoter-lacZ transcriptional fusions indicate that bla1 is poorly transcribed in B. anthracis, B. cereus, and B. thuringiensis. The bla2 gene is strongly expressed in B

  15. Tn5393d, a complex Tn5393 derivative carrying the PER-1 extended-spectrum beta-lactamase gene and other resistance determinants.

    PubMed

    Mantengoli, Elisabetta; Rossolini, Gian Maria

    2005-08-01

    In Alcaligenes faecalis FL-424/98, a clinical isolate that produces the PER-1 extended-spectrum beta-lactamase, the bla(PER-1) gene was found to be carried on a 44-kb nonconjugative plasmid, named pFL424, that was transferred to Escherichia coli by electroporation. Investigation of the genetic context of the bla(PER-1) gene in pFL424 by means of a combined cloning and PCR mapping approach revealed that the gene is associated with a transposonlike element of the Tn3 family. This 14-kb element is a Tn5393 derivative of original structure, named Tn5393d, which contains the transposition module and the strAB genes typical of other members of the Tn5393 lineage plus additional resistance determinants, including the bla(PER-1) gene and a new allelic variant of the aphA6 aminoglycoside phosphotransferase gene, named aphA6b, whose product is active against kanamycin, streptomycin, and amikacin. Tn5393d apparently originated from the consecutive insertion of two composite transposons into a Tn5393 backbone carrying the aphA6b and the bla(PER-1) genes, respectively. The putative composite transposon carrying bla(PER-1), named Tn4176, is made of two original and nonidentical insertion sequences of the IS4 family, named IS1387a and IS1387b, of which one is interrupted by the insertion of an original insertion sequence of the IS30 family, named IS1066. In pFL424, Tn5393d is inserted into a Tn501-like mercury resistance transposon. Transposition of Tn5393d or modules thereof containing the bla(PER-1) gene from pFL424 to small multicopy plasmids or to a bacterial artificial chromosome was not detected in an E. coli host harboring both replicons. PMID:16048938

  16. Endemic carbapenem-resistant Pseudomonas aeruginosa with acquired metallo-beta-lactamase determinants in European hospital.

    PubMed

    Lagatolla, Cristina; Tonin, Enrico A; Monti-Bragadin, Carlo; Dolzani, Lucilla; Gombac, Francesca; Bearzi, Claudia; Edalucci, Elisabetta; Gionechetti, Fabrizia; Rossolini, Gian Maria

    2004-03-01

    Acquired metallo-beta-lactamases (MBLs) can confer broad-spectrum beta-lactam resistance (including carbapenems) not reversible by conventional beta-lactamase inhibitors and are emerging resistance determinants of remarkable clinical importance. In 2001, multidrug-resistant Pseudomonas aeruginosa carrying bla(VIM) MBL genes were found to be widespread (approximately 20% of all P. aeruginosa isolates and 70% of the carbapenem-resistant isolates) at Trieste University Hospital. Clonal diversity and heterogeneity of resistance determinants (either bla(VIM-1)-like or bla(VIM-2)-like) were detected among MBL producers. This evidence is the first that acquired MBLs can rapidly emerge and establish a condition of endemicity in certain epidemiologic settings. PMID:15109432

  17. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

    PubMed

    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen

    2004-02-13

    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  18. Cloning and characterization of the endogenous cephalosporinase gene, cepA, from Bacteroides fragilis reveals a new subgroup of Ambler class A beta-lactamases.

    PubMed Central

    Rogers, M B; Parker, A C; Smith, C J

    1993-01-01

    Bacteroides fragilis CS30 is a clinical isolate resistant to high concentrations of benzylpenicillin and cephaloridine but not to cephamycin or penem antibiotics. beta-Lactam resistance is mediated by a chromosomally encoded cephalosporinase produced at a high level. The gene encoding this beta-lactamase was cloned from genomic libraries constructed in Escherichia coli and then mated with B. fragilis 638 for identification of ampicillin-resistant (Apr) strains. Apr transconjugants contained a nitrocefin-reactive protein with the physical and enzymatic properties of the original CS30 isolate. The beta-lactamase gene (cepA) was localized by deletion analysis and subcloned, and its nucleotide sequence was determined. The 903-bp cepA open reading frame encoded a 300-amino-acid precursor protein (predicted molecular mass, 34,070 Da). A beta-lactamase-deficient mutant strain of B. fragilis 638 was constructed by insertional inactivation with the cepA gene of CS30, demonstrating strict functional homology between these chromosomal beta-lactamase genes. An extensive comparison of the CepA protein sequence by alignment with other beta-lactamases revealed the strict conservation of at least four elements common to Ambler class A. A further comparison of the CepA protein sequence with protein sequences of beta-lactamases from two other Bacteroides species indicated that they constitute their own distinct subgroup of class A beta-lactamases. Images PMID:8285623

  19. Antibiotic Resistance Pattern and Evaluation of Metallo-Beta Lactamase Genes Including bla-IMP and bla-VIM Types in Pseudomonas aeruginosa Isolated from Patients in Tehran Hospitals

    PubMed Central

    Aghamiri, Samira; Amirmozafari, Nour; Fallah Mehrabadi, Jalil; Fouladtan, Babak; Samadi Kafil, Hossein

    2014-01-01

    Beta-lactamase producing strains of Pseudomonas aeruginosa are important etiological agents of hospital infections. Carbapenems are among the most effective antibiotics used against Pseudomonas infections, but they can be rendered infective by group B β-lactamase, commonly called metallo-beta lactamase. In this study, the antimicrobial sensitivity patterns of P. aeruginosa strains isolated from 9 different hospitals in Tehran, Iran, as well as the prevalence of MBLs genes (bla-VIM and bla-IMP) were determined. A total of 212 strains of P. aeruginosa recovered from patients in hospitals in Tehran were confirmed by both biochemical methods and PCR. Their antimicrobial sensitivity patterns were determined by Kirby-Bauer disk diffusion method. Following MIC determination, imipenem resistant strains were selected by DDST method which was followed by PCR tests for determination of MBLs genes: bla-IMP and bla-VIM. The results indicated that, in the DDST phenotypic method, among the 100 imipenem resistant isolates, 75 strains were MBLs positive. The PCR test indicated that 70 strains (33%) carried bla-VIM gene and 20 strains (9%) harbored bla-IMP. The results indicated that the extent of antibiotic resistance among Pseudomonas aeruginosa is on the rise. This may be due to production of MBLs enzymes. Therefore, determination of antibiotic sensitivity patterns and MBLs production by these bacteria, can be important in control of clinical Pseudomonas infection. PMID:24944839

  20. [Investigation of beta-lactamase genes and clonal relationship among the extended-spectrum beta-lactamase producing nosocomial Escherichia coli isolates].

    PubMed

    Görgeç, Sündüz; Kuzucu, Çiğdem; Otlu, Barış; Yetkin, Funda; Ersoy, Yasemin

    2015-01-01

    Extended-spectrum beta-lactamase (ESBL) producing microorganisms currently cause a major problem. Among theseCTX-M beta-lactamase producing Escherichia coli has also disseminated worldwide as an important cause of both nosocomial and community-acquired infections. The aims of this study were to determine the prevalence of the beta-lactamase genes, antibiotic susceptibilities and clonal relationships of ESBL-producing nosocomial E.coli isolates. A total of 76 ESBL-producing E.coli strains isolated from urine (n= 26), blood (n= 25) and wound (n= 25) specimens of hospitalized patients identified as nosocomial infection agents according to the CDC criteria between June 2010-June 2011 were included in the study. Antibiotic susceptibilities of the isolates were detected by Kirby-Bauer disc diffusion method according to CLSI recommendations. ESBL production was tested by double disc diffusion method, and cefotaxime/cefotaxime-clavulanic acid E-test strips (AB Biodisk, Sweden) were used for indeterminate results. Presence of TEM, SHV, CTX-M, OXA-2 group, 0XA-10 group, PER, VEB and GES beta-lactamase genes were investigated by polymerase chain reaction (PCR) using specific primers. Pulsed-field gel electrophoresis (PFGE) method was used for the detection of clonal relationships among the strains. Most of the ESBL-producing E.coli strains were isolated from samples of inpatients in intensive care (35%), internal medicine (16%) and general surgery (13%) units. All of the 76 strains were found susceptible to imipenem, meropenem and amikacin; however all were resistant to cefotaxime and ceftriaxone. The susceptibility rates of the isolates to cefoxitin, ertapenem, cefoperazone/sulbactam, piperacillin-tazobactam, gentamicin, ciprofloxacin, cefepime, amoxicillin-clavulanic acid, aztreonam and ceftazidime were 96%, 83%, 63%, 61%, 50%, 41%, 25%, 21%, 20% and 18%, respectively. Among E.coli isolates, the frequency of CTX-M, TEM, OXA-2 group, PER, SHV and OXA-10 group beta-lactamase

  1. Recognition and Resistance in TEM [superscript beta]-Lactamase

    SciTech Connect

    Wang, Xiaojun; Minasov, George; Blazquez, Jesus; Caselli, Emilia; Prati, Fabio; Shoichet, Brian K.

    2010-03-08

    Developing antimicrobials that are less likely to engender resistance has become an important design criterion as more and more drugs fall victim to resistance mutations. One hypothesis is that the more closely an inhibitor resembles a substrate, the more difficult it will be to develop resistant mutations that can at once disfavor the inhibitor and still recognize the substrate. To investigate this hypothesis, 10 transition-state analogues, of greater or lesser similarity to substrates, were tested for inhibition of TEM-1 beta-lactamase, the most widespread resistance enzyme to penicillin antibiotics. The inhibitors were also tested against four characteristic mutant enzymes: TEM-30, TEM-32, TEM-52, and TEM-64. The inhibitor most similar to the substrate, compound 10, was the most potent inhibitor of the WT enzyme, with a K(i) value of 64 nM. Conversely, compound 10 was the most susceptible to the TEM-30 (R244S) mutant, for which inhibition dropped by over 100-fold. The other inhibitors were relatively impervious to the TEM-30 mutant enzyme. To understand recognition and resistance to these transition-state analogues, the structures of four of these inhibitors in complex with TEM-1 were determined by X-ray crystallography. These structures suggest a structural basis for distinguishing inhibitors that mimic the acylation transition state and those that mimic the deacylation transition state; they also suggest how TEM-30 reduces the affinity of compound 10. In cell culture, this inhibitor reversed the resistance of bacteria to ampicillin, reducing minimum inhibitory concentrations of this penicillin by between 4- and 64-fold, depending on the strain of bacteria. Notwithstanding this activity, the resistance of TEM-30, which is already extant in the clinic, suggests that there can be resistance liabilities with substrate-based design.

  2. Common mechanism of ampC beta-lactamase induction in enterobacteria: regulation of the cloned Enterobacter cloacae P99 beta-lactamase gene.

    PubMed Central

    Lindberg, F; Normark, S

    1987-01-01

    Expression of the chromosomal beta-lactamase from the ampC gene in inducible in both Enterobacter cloacae and Citrobacter freundii. Cloning of ampC as well as its regulatory gene, ampR, from E. cloacae P99 revealed a gene organization indentical to that of C. freundii in the corresponding region. Although almost no similarities could be found between the restriction maps of ampC and ampR in the two species, the genes cross-hybridize. Also, both ampR gene products have a size of about 31,000. The regulatory features of E. cloacae beta-lactamase induction are very similar to those in C. freundii, i.e., beta-lactamase synthesis is repressed by AmpR in the absence, and stimulated in the presence, of inducer. The AmpR function can be transcomplemented between the two species, but there are quantitative regulatory aberrations in such hybrids, in contrast to the total complementation obtained within each system. These results suggest that the mechanism of beta-lactamase induction is the same in E. cloacae, C. freundii, and other gram-negative bacteria with inducible chromosomal beta-lactamase expression. Images PMID:3027046

  3. Analysis of the beta-lactamase plasmid of borderline methicillin-susceptible Staphylococcus aureus: focus on bla complex genes and cadmium resistance determinants cadD and cadX.

    PubMed

    Massidda, Orietta; Mingoia, Marina; Fadda, Daniela; Whalen, Michael B; Montanari, Maria Pia; Varaldo, Pietro E

    2006-03-01

    Borderline methicillin-susceptible Staphylococcus aureus strains are a rather homogeneous group, characterized by MICs of penicillinase-resistant penicillins (PRPs) at or just below the susceptibility breakpoint. Other features unique to this group include the presence of a pBW15-like beta-lactamase plasmid, the association with phage complex 94/96, and the production of a PRP-hydrolyzing beta-lactamase activity in addition to the classical penicillinase activity. The four HindIII fragments of pBORa53, a pBW15-like plasmid from the well-studied borderline S. aureus strain a53, were cloned in Escherichia coli, sequenced and analyzed. The plasmid (17,334 bp in size) contains 14 open reading frames (ORFs) and a complete copy of transposon Tn552, which harbors the three genes of the bla complex (blaZ, blaR1, and blaI) necessary for penicillinase production. Among the other 11 ORFs identified, two were homologous to cadmium resistance determinants of Staphylococcus lugdunensis and to the cadD and cadX genes recently detected in S. aureus. Consistent with this, strain a53 was found to be cadmium resistant. From a collection of 30 S. aureus isolates with borderline PRP MIC levels, 27 matched strain a53 in the positive amplification reactions with all of the four primer pairs targeting the cadD-cadX region, the presence of the 17.3-kb plasmid, and the level of cadmium resistance. The well-established S. aureus laboratory strain ATCC 29213 was also found to express cadD-cadX-mediated cadmium resistance. pBORa53 could be re-isolated from transformants obtained by transferring it into a PRP-susceptible recipient. However, while the transformants demonstrated levels of cadmium and penicillin resistance similar to those of strain a53, they remained fully susceptible to PRPs. PMID:16229889

  4. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample. PMID:27196551

  5. Chromosomal beta-lactamase genes of Klebsiella oxytoca are divided into two main groups, blaOXY-1 and blaOXY-2.

    PubMed Central

    Fournier, B; Roy, P H; Lagrange, P H; Philippon, A

    1996-01-01

    The chromosomally encoded beta-lactamase gene (blaOXY-2) of the wild-type Klebsiella oxytoca SL911 was cloned and sequenced. Its nucleotide sequence similarity with the previously sequenced K. oxytoca beta-lactamase gene (blaOXY-1) (Y. Arakawa, M. Ohta, N. Kido, M. Mori, H. Ito, T. Komatsu, Y. Fujii, and N. Kato, Antimicrob. Agents Chemother. 33:63-70, 1989) is 87.3%, and its amino acid similarity is 89.7%. This group of K. oxytoca beta-lactamases is related to chromosomal beta-lactamases of Citrobacter diversus, Proteus vulgaris, and Yersinia enterocolitica and to the plasmid-mediated extended-spectrum beta-lactamases MEN-1 and Toho-1. By colony hybridization with 86 strains susceptible and resistant to aztreonam, isolated in six countries, K. oxytoca beta-lactamase genes hybridized with either a specific blaOXY-1 DNA probe (668 bp) or a blaOXY-2 DNA probe (723 bp). Thus, beta-lactamase genes could be divided into two groups: blaOXY-1 (47% of the strains) and blaOXY-2 (53% of the strains). A study of isoelectric points confirmed the great variability reported in the literature. However, the two beta-lactamase groups were each represented by four different pIs: for OXY-2, 5.2, 5.7, 6.4, and 6.8, with the 5.2 form representing 59% of all OXY-2 enzymes, and for OXY-1, 7.1, 7.5, 8.2, and 8.8, with the 7.5 form representing 88% of all OXY-1 enzymes. PMID:8834897

  6. Next-Generation Sequencing for Typing and Detection of Resistance Genes: Performance of a New Commercial Method during an Outbreak of Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli

    PubMed Central

    Overdevest, I. T.; Snelders, E.; Willemsen, I.; Hendriks, Y.; Adesokan, A.; Doran, G.; Bruso, S.; Rolfe, A.; Pettersson, A.; Kluytmans, J. A. J. W.

    2014-01-01

    Next-generation sequencing (NGS) has the potential to provide typing results and detect resistance genes in a single assay, thus guiding timely treatment decisions and allowing rapid tracking of transmission of resistant clones. We evaluated the performance of a new NGS assay (Hospital Acquired Infection BioDetection System; Pathogenica) during an outbreak of sequence type 131 (ST131) Escherichia coli infections in a nursing home in The Netherlands. The assay was performed on 56 extended-spectrum-beta-lactamase (ESBL) E. coli isolates collected during 2 prevalence surveys (March and May 2013). Typing results were compared to those of amplified fragment length polymorphism (AFLP), whereby we visually assessed the agreement of the BioDetection phylogenetic tree with clusters defined by AFLP. A microarray was considered the gold standard for detection of resistance genes. AFLP identified a large cluster of 31 indistinguishable isolates on adjacent departments, indicating clonal spread. The BioDetection phylogenetic tree showed that all isolates of this outbreak cluster were strongly related, while the further arrangement of the tree also largely agreed with other clusters defined by AFLP. The BioDetection assay detected ESBL genes in all but 1 isolate (sensitivity, 98%) but was unable to discriminate between ESBL and non-ESBL TEM and SHV beta-lactamases or to specify CTX-M genes by group. The performance of the hospital-acquired infection (HAI) BioDetection System for typing of E. coli isolates compared well with the results of AFLP. Its performance with larger collections from different locations, and for typing of other species, was not evaluated and needs further study. PMID:24789184

  7. A novel class C beta-lactamase (FOX-2) in Escherichia coli conferring resistance to cephamycins.

    PubMed Central

    Bauernfeind, A; Wagner, S; Jungwirth, R; Schneider, I; Meyer, D

    1997-01-01

    An Escherichia coli strain resistant to a broad spectrum of beta-lactams, including cephamycins, was isolated from a patient suffering from urinary tract infection. A resistance plasmid (pMVP-7) was transferred from the clinical isolate to an Escherichia coli recipient. Both strains produce a cefoxitin-hydrolyzing beta-lactamase focusing at pI 6.7. The phenotype was similar to that of a Klebsiella pneumoniae strain producing cephamycinase FOX-1, so primers were selected from the FOX-1 sequence to amplify the bla gene of the transconjugant. The PCR product obtained was sequenced. The percentage of identity of the deduced amino acid sequence with sequences of other AmpC-type beta-lactamases was 96.9% with FOX-1, 74.9% with CMY-1, and 67.7% with MOX-1. This new plasmid-mediated enzyme is most closely related to FOX-1 (11 amino acid exchanges). We therefore propose the designation FOX-2. PMID:9303413

  8. Hospital outbreak of carbapenem-resistant Pseudomonas aeruginosa producing VIM-1, a novel transferable metallo-beta-lactamase.

    PubMed

    Cornaglia, G; Mazzariol, A; Lauretti, L; Rossolini, G M; Fontana, R

    2000-11-01

    A total of 8 Pseudomonas aeruginosa isolates was collected from 7 different patients in different wards of the University Hospital of Verona, Italy, from February 1997 to February 1998. The high level of resistance to carbapenems (imipenem minimum inhibitory concentration was always >128 microg/mL) and other broad-spectrum beta-lactams and the rate of imipenem hydrolysis and its inhibition by ethylenediamine-tetra-acetic acid were all suggestive of production of a carbapenem-hydrolyzing metallo-beta-lactamase. A specific DNA probe derived from the recently cloned bla(VIM-1) gene hybridized to all the isolates. A genomic DNA fingerprinting profile revealed clonal relatedness for 7 of 8 isolates. A description of this hospital outbreak is reported, the occurrence of which confirms that proliferation of metallo-beta-lactamase-producing strains multiply resistant to beta-lactams is already a reality outside Japan. These findings emphasize the need for early recognition of similar isolates. PMID:11073738

  9. Phenotypic detection and molecular characterization of beta-lactamase genes among Citrobacter species in a tertiary care hospital

    PubMed Central

    Praharaj, Ashok Kumar; Khajuria, Atul; Kumar, Mahadevan; Grover, Naveen

    2016-01-01

    Objective: To examine the distribution, emergence, and spread of genes encoding beta-lactamase resistance in Citrobacter species isolated from hospitalized patients in a tertiary care hospital. Methods: A prospective study was conducted in a 1000-bed tertiary care center in Pune, India from October 2010 to October 2013. A total of 221 Citrobacter spp. isolates were recovered from clinical specimens from different patients (one isolate per patient) admitted to the surgical ward, medical ward and medical and surgical Intensive Care Units. Polymerase chain reaction (PCR) assays and sequencing were used to determine the presence of beta-lactamase encoding genes. Conjugation experiments were performed to determine their transferability. Isolate relatedness were determined by repetitive element based-PCR, enterobacterial repetitive intergenic consensus-PCR and randomly amplified polymorphic DNA. Results: Among 221 tested isolates of Citrobacter spp. recovered from various clinical specimens, 179 (80.9%) isolates showed minimum inhibitory concentration (MIC) >4 μg/ml against meropenem and imipenem. One hundred and forty-five isolates with increased MICs value against carbapenems were further processed for molecular characterization of beta-lactamase genes. Susceptibility profiling of the isolates indicated that 100% retained susceptibility to colistin. Conjugation experiments indicated that blaNDM-1 was transferable via a plasmid. Conclusion: The ease of NDM-1 plasmid transmissibility may help their dissemination among the Citrobacter species as well as to others in Enterobacteriaceae. Early detection, antimicrobial stewardship and adequate infection control measures will help in limiting the spread of these organisms. PMID:26952135

  10. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes

    PubMed Central

    Alves, Marta S.; Pereira, Anabela; Araújo, Susana M.; Castro, Bruno B.; Correia, António C. M.; Henriques, Isabel

    2014-01-01

    The aim of this study was to examine antibiotic resistance (AR) dissemination in coastal water, considering the contribution of different sources of fecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of fecal contamination: human-derived sewage and seagull feces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin, and amoxicillin were the most frequent. Higher rates of AR were found among seawater and feces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull feces (29 and 32%) were lower than in isolates from seawater (39%). Seawater AR profiles were similar to those from seagull feces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes blaTEM, sul1, sul2, tet(A), and tet(B), were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (blaCTX-M-1 and blaSHV-12) and seagull feces (blaCMY-2). Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull feces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived fecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health. PMID:25191308

  11. Antibiotic-Resistant Escherichia coli Bacteria, Including Strains with Genes Encoding the Extended-Spectrum Beta-Lactamase and QnrS, in Waterbirds on the Baltic Sea Coast of Poland▿

    PubMed Central

    Literak, Ivan; Dolejska, Monika; Janoszowska, Dagmar; Hrusakova, Jolana; Meissner, Wlodzimierz; Rzyska, Hanna; Bzoma, Szymon; Cizek, Alois

    2010-01-01

    Individual cloacal swabs of mallards (Anas platyrhynchos) and of herring gulls (Larus argentatus), as well as samples of waterbird feces obtained in 2008 and 2009, were cultivated for Escherichia coli. Isolates of E. coli were tested for susceptibilities to 12 antimicrobial agents by the disk diffusion method. Moreover, the samples were subcultivated on MacConkey agar (MCA) containing cefotaxime (2 mg liter−1) to detect E. coli with extended-spectrum beta-lactamase (ESBL) and subsequently on MCA supplemented with ciprofloxacin (0.05 mg liter−1) and MCA with nalidixic acid (20 mg liter−1) to isolate fluoroquinolone-resistant E. coli. PCR was used to detect specific antibiotic resistance genes. We found 9 E. coli isolates producing ESBL with bla genes: blaCTX-M-1 (6 isolates), blaCTX-M-9 plus blaTEM-1b (1 isolate), blaCTX-M-15 plus blaOXA-1 (1 isolate), and blaSHV-12 (1 isolate). In the isolate with blaCTX-M-15, the gene aac(6)-Ib-cr was also detected. The bla genes were harbored by transferable plasmids of the IncN and IncI1 groups. Nine quinolone-resistant E. coli isolates with qnrS genes were found and characterized. The gene qnrS was associated with a Tn3-like transposon on the IncX1 plasmid together with blaTEM-1 in two isolates. The gene qnrS was also harbored by conjugative plasmids of the IncN and IncX2 groups. Even if populations of wild birds are not directly influenced by antibiotic practice, we have demonstrated that antibiotic-resistant E. coli strains, including strains with various ESBL and qnrS genes, are found in the feces of wild birds on the coast of the Baltic Sea in Poland. PMID:20952638

  12. Antibiotic-resistant Escherichia coli bacteria, including strains with genes encoding the extended-spectrum beta-lactamase and QnrS, in waterbirds on the Baltic Sea Coast of Poland.

    PubMed

    Literak, Ivan; Dolejska, Monika; Janoszowska, Dagmar; Hrusakova, Jolana; Meissner, Wlodzimierz; Rzyska, Hanna; Bzoma, Szymon; Cizek, Alois

    2010-12-01

    Individual cloacal swabs of mallards (Anas platyrhynchos) and of herring gulls (Larus argentatus), as well as samples of waterbird feces obtained in 2008 and 2009, were cultivated for Escherichia coli. Isolates of E. coli were tested for susceptibilities to 12 antimicrobial agents by the disk diffusion method. Moreover, the samples were subcultivated on MacConkey agar (MCA) containing cefotaxime (2 mg liter(-1)) to detect E. coli with extended-spectrum beta-lactamase (ESBL) and subsequently on MCA supplemented with ciprofloxacin (0.05 mg liter(-1)) and MCA with nalidixic acid (20 mg liter(-1)) to isolate fluoroquinolone-resistant E. coli. PCR was used to detect specific antibiotic resistance genes. We found 9 E. coli isolates producing ESBL with bla genes: bla(CTX-M-1) (6 isolates), bla(CTX-M-9) plus bla(TEM-1b) (1 isolate), bla(CTX-M-15) plus bla(OXA-1) (1 isolate), and bla(SHV-12) (1 isolate). In the isolate with bla(CTX-M-15), the gene aac(6)-Ib-cr was also detected. The bla genes were harbored by transferable plasmids of the IncN and IncI1 groups. Nine quinolone-resistant E. coli isolates with qnrS genes were found and characterized. The gene qnrS was associated with a Tn3-like transposon on the IncX1 plasmid together with bla(TEM-1) in two isolates. The gene qnrS was also harbored by conjugative plasmids of the IncN and IncX2 groups. Even if populations of wild birds are not directly influenced by antibiotic practice, we have demonstrated that antibiotic-resistant E. coli strains, including strains with various ESBL and qnrS genes, are found in the feces of wild birds on the coast of the Baltic Sea in Poland. PMID:20952638

  13. Gene Network Analysis of Metallo Beta Lactamase Family Proteins Indicates the Role of Gene Partners in Antibiotic Resistance and Reveals Important Drug Targets.

    PubMed

    Parimelzaghan, Anitha; Anbarasu, Anand; Ramaiah, Sudha

    2016-06-01

    Metallo Beta (β) Lactamases (MBL) are metal dependent bacterial enzymes that hydrolyze the β-lactam antibiotics. In recent years, MBL have received considerable attention because it inactivates most of the β-lactam antibiotics. Increase in dissemination of MBL encoding antibiotic resistance genes in pathogenic bacteria often results in unsuccessful treatments. Gene interaction network of MBL provides a complete understanding on the molecular basis of MBL mediated antibiotic resistance. In our present study, we have constructed the MBL network of 37 proteins with 751 functional partners from pathogenic bacterial spp. We found 12 highly interconnecting clusters. Among the 37 MBL proteins considered in the present study, 22 MBL proteins are from B3 subclass, 14 are from B1 subclass and only one is from B2 subclass. Global topological parameters are used to calculate and compare the probability of interactions in MBL proteins. Our results indicate that the proteins associated within the network have a strong influence in antibiotic resistance mechanism. Interestingly, several drug targets are identified from the constructed network. We believe that our results would be helpful for researchers exploring MBL-mediated antibiotic resistant mechanisms. J. Cell. Biochem. 117: 1330-1339, 2016. © 2015 Wiley Periodicals, Inc. PMID:26517410

  14. Experimental prediction of the evolution of cefepime resistance from the CMY-2 AmpC beta-lactamase.

    PubMed Central

    Barlow, Miriam; Hall, Barry G

    2003-01-01

    Understanding of the evolutionary histories of many genes has not yet allowed us to predict the evolutionary potential of those genes. Intuition suggests that current biochemical activity of gene products should be a good predictor of the potential to evolve related activities; however, we have little evidence to support that intuition. Here we use our in vitro evolution method to evaluate biochemical activity as a predictor of future evolutionary potential. Neither the class C Citrobacter freundii CMY-2 AmpC beta-lactamase nor the class A TEM-1 beta-lactamase confer resistance to the beta-lactam antibiotic cefepime, nor do any of the naturally occurring alleles descended from them. However, the CMY-2 AmpC enzyme and some alleles descended from TEM-1 confer high-level resistance to the structurally similar ceftazidime. On the basis of the comparison of TEM-1 and CMY-2, we asked whether biochemical activity is a good predictor of the evolutionary potential of an enzyme. If it is, then CMY-2 should be more able than the TEMs to evolve the ability to confer higher levels of cefepime resistance. Although we generated CMY-2 evolvants that conferred increased cefepime resistance, we did not recover any CMY-2 evolvants that conferred resistance levels as high as the best cefepime-resistant TEM alleles. PMID:12750318

  15. Imipenem resistance in Klebsiella pneumoniae is associated with the combination of ACT-1, a plasmid-mediated AmpC beta-lactamase, and the foss of an outer membrane protein.

    PubMed Central

    Bradford, P A; Urban, C; Mariano, N; Projan, S J; Rahal, J J; Bush, K

    1997-01-01

    Six Escherichia coli and 12 Klebsiella pneumoniae isolates from a single hospital expressed a common beta-lactamase with a pI of approximately 9.0 and were resistant to cefoxitin and cefotetan (MIC ranges, 64 to > 128 and 16 to > 128 micrograms/ml, respectively). Seventeen of the 18 strains produced multiple beta-lactamases. Most significantly, three K. pneumoniae strains were also resistant to imipenem (MICs, 8 to 32 micrograms/ml). Spectrophotometric beta-lactamase assays with purified enzyme indicated hydrolysis of cephamycins, in addition to cephaloridine and benzylpenicillin. The 4ene encoding the pI 9.0 beta-lactamase (designated ACT-1 for AmpC type) was cloned and sequenced, which revealed an ampC-type beta-lactamase gene that originated from Enterobacter cloacae and that had 86% sequence homology to the P99 beta-lactamase and 94% homology to the partial sequence of MIR-1. Southern blotting revealed that the gene encoding ACT-1 was on a large plasmid in some of the K. pneumoniae strains as well as on the chromosomes of all of the strains, suggesting that the gene is located on an easily mobilized element. Outer membrane protein profiles of the K. pneumoniae strains revealed that the three imipenem-resistant strains were lacking a major outer membrane protein of approximately 42 kDa which was present in the imipenem-susceptible strains. ACT-1 is the first plasmid-mediated AmpC-type beta-lactamase derived from Enterobacter which has been completely sequenced. This work demonstrates that in addition to resistance to cephamycins, imipenem resistance can occur in K. pneumoniae when a high level of the ACT-1 beta-lactamase is produced in combination with the loss of a major outer membrane protein. PMID:9055993

  16. Resistance of Xanthomonas maltophilia to antibiotics and the effect of beta-lactamase inhibitors.

    PubMed

    Neu, H C; Saha, G; Chin, N X

    1989-01-01

    We examined the susceptibility of 50 isolates of Xanthomonas maltophilia and the effect of beta-lactamase inhibitors upon the susceptibility. The majority of isolates were resistant to azlocillin, piperacillin, mezlocillin, ticarcillin, cefotaxime, ceftizoxime, ceftriaxone, cefoperazone, and ceftazidime. All isolates were resistant to imipenem, CGP 31608, aztreonam, and carumonam. Although disk susceptibility tests showed that the combination of clavulanate with ticarcillin inhibited many isolates, at a ratio of 1:20 few isolates were susceptible to the combination. Addition of clavulanate to aztreonam and to imipenem failed to make organisms susceptible. Sulbactam combined with cefoperazone made some organisms susceptible, but ampicillin-sulbactam was ineffective, whereas tazobactam combined with piperacillin at a ratio of 1:4 made half the isolates have MICs of 32 micrograms/ml or less. The beta-lactamases from the isolates hydrolyzed all of the beta-lactams. PMID:2791491

  17. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  18. Extended-Spectrum-Beta-Lactamases, AmpC Beta-Lactamases and Plasmid Mediated Quinolone Resistance in Klebsiella spp. from Companion Animals in Italy

    PubMed Central

    Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S.; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

    2014-01-01

    We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6′)-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6′)-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6′)-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission

  19. Antibiotic resistance pattern and evaluation of metallo-beta lactamase genes (VIM and IMP) in Pseudomonas aeruginosa strains producing MBL enzyme, isolated from patients with secondary immunodeficiency

    PubMed Central

    Shirani, Kiana; Ataei, Behrouz; Roshandel, Fardad

    2016-01-01

    Background: One of the most common causes of hospital-acquired secondary infections in hospitalized patients is Pseudomonas aeruginosa. The aim of this study is to evaluate the expression of IMP and VIM in Pseudomonas aeruginosa strains (carbapenem resistant and producer MBL enzyme) in patients with secondary immunodeficiency. Materials and Methods: In a cross sectional study, 96 patients with secondary immunodeficiency hospitalized in the Al-Zahra hospital were selected. Carbapenem resistant strains isolated and modified Hodge test was performed in order to confirm the presence of the metallo carbapenemase enzyme. Under the standard conditions they were sent to the central laboratory for investigating nosocomial infection Multiplex PCR. Results: Of 96 samples 28.1% were IMP positive, 5.2% VIM positive and 3.1% both VIM and IMP positive. The prevalence of multidrug resistance in the IMP and/or VIM negative samples was 29%, while all 5 VIM positive samples have had multidrug resistance. Also the prevalence of multi-drug resistance in IMP positive samples were 96.3% and in IMP and VIM positive samples were 100%. According to Fisher’s test, the prevalence of multi-drug resistance based on gene expression has significant difference (P < 0.001). Conclusion: Based on the results of this study it can be concluded that, a significant percentage of patients with secondary immunodeficiency that suffer nosocomial infections with multidrug resistance, especially Pseudomonas aeruginosa, are probably MBL-producing gene positive. Therefore the cause of infection should be considered in the hospital care system to identify their features, the presence of genes involved in the development of multi-drug resistance and antibiotic therapy. PMID:27563634

  20. Antibacterial activities of multi drug resistant Myroides odoratimimus bacteria isolated from adult flesh flies (Diptera: sarcophagidae) are independent of metallo beta-lactamase gene

    PubMed Central

    Dharne, M.S.; Gupta, A.K.; Rangrez, A.Y.; Ghate, H.V.; Patole, M.S.; Shouche, Y.S.

    2008-01-01

    Flesh flies (Diptera: Sarcophagidae) are well known cause of myiasis and their gut bacteria have never been studied for antimicrobial activity against bacteria. Antimicrobial studies of Myroides spp. are restricted to nosocomial strains. A Gram-negative bacterium, Myroides sp., was isolated from the gut of adult flesh flies (Sarcophaga sp.) and submitted to evaluation of nutritional parameters using Biolog GN, 16S rRNA gene sequencing, susceptibility to various antimicrobials by disc diffusion method and detection of metallo β-lactamase genes (TUS/MUS). The antagonistic effects were tested on Gram-negative and Gram-positive bacteria isolated from human clinical specimens, environmental samples and insect mid gut. Bacterial species included were Aeromonas hydrophila, A. culicicola, Morganella morganii subsp. sibonii, Ochrobactrum anthropi, Weissella confusa, Escherichia coli, Ochrobactrum sp., Serratia sp., Kestersia sp., Ignatzschineria sp., Bacillus sp. The Myroides sp. strain was resistant to penicillin-G, erythromycin, streptomycin, amikacin, kanamycin, gentamycin, ampicillin, trimethoprim and tobramycin. These strain showed antibacterial action against all bacterial strains except W. confusa, Ignatzschineria sp., A. hydrophila and M. morganii subsp. sibonii. The multidrug resistance of the strain was similar to the resistance of clinical isolates, inhibiting growth of bacteria from clinical, environmental and insect gut samples. The metallo β-lactamase (TUS/MUS) genes were absent, and resistance due to these genes was ruled out, indicating involvement of other secretion machinery. PMID:24031236

  1. Cloning and sequencing of the metallothioprotein beta-lactamase II gene of Bacillus cereus 569/H in Escherichia coli.

    PubMed Central

    Hussain, M; Carlino, A; Madonna, M J; Lampen, J O

    1985-01-01

    The structural gene for beta-lactamase II (EC 3.5.2.6), a metallothioenzyme, from Bacillus cereus 569/H (constitutive for high production of the enzyme) was cloned in Escherichia coli, and the nucleotide sequence was determined. This is the first class B beta-lactamase whose primary structure has been reported. The amino acid sequence of the exoenzyme form, deduced from the DNA, indicates that beta-lactamase II, like other secreted proteins, is synthesized as a precursor with a 30-amino acid N-terminal signal peptide. The pre-beta-lactamase II (Mr, 28,060) is processed in E. coli and in B. cereus to a single mature protein (Mr, 24,932) which is totally secreted by B. cereus but in E. coli remains intracellular, probably in the periplasm. The expression of the gene in E. coli RR1 on the multicopy plasmid pRWHO12 was comparable to that in B. cereus, where it is presumably present as a single copy. The three histidine residues that are involved (along with the sole cysteine of the mature protein) in Zn(II) binding and hence in enzymatic activity against beta-lactams were identified. These findings will help to define the secondary structure, mechanism of action, and evolutionary lineage of B. cereus beta-lactamase II and other class B beta-lactamases. Images PMID:3930467

  2. Investigation of Metallo Beta Lactamases and Oxacilinases in Carbapenem Resistant Acinetobacter baumannii Strains Isolated from Inpatients

    PubMed Central

    Aksoy, M. Duygu; Çavuşlu, Şaban; Tuğrul, H. Murat

    2015-01-01

    Background: Resistance to beta-lactam antibiotics is widespread among Acinetobacter strains. Plasmid-mediated metallo beta lactamases (MBL) are responsible for carbapenem resistance, as are oxacillinases (OXA). In recent years, MBL producing carbapenem-resistant strains have been reported in the world and in Turkey in increasing rates. In our country, besides the OXA 51-like enzyme which is inherent in A. baumannii strains, OXA 58-like and OXA 23-like carbapenemases producing strains have also been widely detected. In addition, Verona Imipenemase (VIM) and (IMP)-type MBL have been reported in some centers. Aims: The aim of our study was to investigate the presence of carbapenemases in Acinetobacter strains isolated from hospitalized patients in Edirne. Study Design: Cross-sectional study. Methods: A total of 52 imipenem-resistant A. baumannii strains isolated between January and March 2013 were investigated. The presence of MBL was described phenotypically by the combined disk diffusion test (CDDT), double disk synergy test (DDST), MBL E-test (only performed in 28 strains) and modified Hodge test. blaIMP, blaVIM, blaGIM, blaSIM, blaSPM genes and blaOXA-23, blaOXA-51, blaOXA-40, blaOXA-58 genes were investigated by multiplex polymerase chain reaction (PCR). The blaNDM-1 gene was determined by PCR. Results: By modified Hodge test, 50 strains (96%) were found to be MBL positive. Positivity of MBL was 21% by both CDDT (0.1 M EDTA) and DDST. Twenty-four of 28 strains (85.7%) were positive by MBL E-test. OXA 23-like and OXA 51-like carbapenemases were detected in all strains, but OXA 58-like and OXA 40-like carbapenemases-producing A. baumannii were not detected. Also, MBL genes were not detected by genotypic methods. Conclusion: Only OXA 23-like carbapenemase was responsible for carbapenem resistance in carbapenem-resistant Acinetobacter strains in Edirne. The MBL-producing Acinetobacter strain is not yet a problem in our hospital. MBL resistance was found by

  3. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    PubMed Central

    Hassan, Sabry A.; Shobrak, Mohammed Y.

    2015-01-01

    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were TEM and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets. PMID:27047051

  4. [A new method for evaluation of beta-lactamase production of resistant enterobacteriaceae strains (author's transl)].

    PubMed

    Schassan, H H

    1978-01-01

    Resistant strains of Enterobacteriaceae were investigated with a chemical and microbiological test on beta-lactamase activity. The chemical method was needed as screening-test basing on the enzymatic hydrolysis of the chromogenic cephalosporin compound 87/312. The microbiological test is a modified cup plate method using Staph. aureus SG 511 as sensitive test strain for penicillins and cephalosporins. In one of the two cups of the blood agar plate 20 microliter of the beta-lactam antibiotic, in the other cup 20 microliter of the supernatant of the 24 h broth of the bacterial strain was pipettet. If the lactamase in the supernatant neutralises the antibiotic, a halfemoonlike blank is forming on the left site of the inhibition zone. An unchangeable inhibition zone demonstrates stability of the antibiotic to the enzyme. Each of 10 ampicillin- and/or cephalothin-resistant strains of E. coli, Klebsiella, Enterobacter and Serratia were investigated against 6 penicillins (penicillin G, ampicillin, ticarcillin, mezlocillin, azlocillin, bay k 4999) and 6 cephalosporins (cefoxitin, cefuroxime, cefamandol, cephalothin, cefazolin, cefradine). The microbiological method allows the statement, against which beta-lactam antibiotic the enzyme is effective. A correlation between the beta-lactamase activity and the MIC values in Enterobacteriaceae was not found. PMID:371259

  5. Studies of Antibiotic Resistance of Beta-Lactamase Bacteria under Different Nutrition Limitations at the Single-Cell Level

    PubMed Central

    Wang, Ying; Ran, Min; Wang, Jun; Ouyang, Qi; Luo, Chunxiong

    2015-01-01

    Drug resistance involves many biological processes, including cell growth, cell communication, and cell cooperation. In the last few decades, bacterial drug resistance studies have made substantial progress. However, a major limitation of the traditional resistance study still exists: most of the studies have concentrated on the average behavior of enormous amounts of cells rather than surveying single cells with different phenotypes or genotypes. Here, we report our study of beta-lactamase bacterial drug resistance in a well-designed microfluidic device, which allows us to conduct more controllable experiments, such as controlling the nutrient concentration, switching the culture media, performing parallel experiments, observing single cells, and acquiring time-lapse images. By using GFP as a beta-lactamase indicator and acquiring time-lapse images at the single-cell level, we observed correlations between the bacterial heterogeneous phenotypes and their behavior in different culture media. The feedback loop between the growth rate and the beta-lactamase production suggests that the beta-lactamase bacteria are more resistant in a rich medium than in a relatively poor medium. In the poorest medium, the proportion of dormant cells may increase, which causes a lower death rate in the same generation. Our work may contribute to assaying the antibiotic resistance of pathogenic bacteria in heterogeneous complex media. PMID:25993008

  6. Beta-Lactamase Repressor BlaI Modulates Staphylococcus aureus Cathelicidin Antimicrobial Peptide Resistance and Virulence

    PubMed Central

    Pence, Morgan A.; Haste, Nina M.; Meharena, Hiruy S.; Olson, Joshua; Gallo, Richard L.; Nizet, Victor; Kristian, Sascha A.

    2015-01-01

    BlaI is a repressor of BlaZ, the beta-lactamase responsible for penicillin resistance in Staphylococcus aureus. Through screening a transposon library in S. aureus Newman for susceptibility to cathelicidin antimicrobial peptide, we discovered BlaI as a novel cathelicidin resistance factor. Additionally, through integrational mutagenesis in S. aureus Newman and MRSA Sanger 252 strains, we confirmed the role of BlaI in resistance to human and murine cathelidicin and showed that it contributes to virulence in human whole blood and murine infection models. We further demonstrated that BlaI could be a target for innate immune-based antimicrobial therapies; by removing BlaI through subinhibitory concentrations of 6-aminopenicillanic acid, we were able to sensitize S. aureus to LL-37 killing. PMID:26305782

  7. Effect of the inoculum size on carbapenem susceptibilities of beta-lactamase-negative, ampicillin-resistant Haemophilus influenzae.

    PubMed

    Miyazaki, Hiroo; Horii, Toshinobu; Nagura, Osanori; Suda, Takafumi; Chida, Kingo; Nakamura, Hirotoshi

    2009-01-01

    A higher inoculum size of beta-lactamase-positive Haemophilus influenzae is reported to increase minimum inhibitory concentrations (MICs) for beta-lactams. However, the effect of inoculum size of beta-lactamase-negative, ampicillin-resistant H. influenzae (BLNAR) on MICs for carbapenems has not been investigated. This study evaluated the effect of inoculum size on MICs for carbapenems and other beta-lactams in nine clinical isolates of BLNAR. The MICs were determined by both the standard method described by the Clinical and Laboratory Standards Institute (final inoculum size of 5 x 10(5) colony-forming units [CFU]/ml) and a modified method (final inoculum size of 5 x 10(6) CFU/ml) using viable cell counts. The findings showed that the higher inoculum size increased MICs for imipenem, meropenem, panipenem, biapenem, ampicillin, ceftazidime, and ceftriaxone. The inoculum effect (4 log(2) dilution or a greater increase in the MIC) with imipenem, meropenem, panipenem, and biapenem was found in three, five, two, and two isolates, respectively. The magnitude of the inoculum effect for panipenem significantly increased with the levels of MICs, but correlation between them for the others was not statistically significant. The mutations of penicillin-binding protein genes had little relevance to the reduced susceptibility to carbapenems or to the magnitude of the inoculum effect. These results suggest that MIC determination using turbidity can produce interpretive errors in the antimicrobial susceptibility testing of BLNAR for carbapenems because of their inoculum effect. Thus, accurate adjustment of inoculum size, such as viable cell count, is helpful for confirming the true MICs when the isolates are interpreted as "resistant" by turbidity-based MIC determination. PMID:18815831

  8. Occurrence of Multidrug Resistant Extended Spectrum Beta-Lactamase-Producing Bacteria on Iceberg Lettuce Retailed for Human Consumption

    PubMed Central

    Talreja, Deepa; Rana, Sonia Walia; Walia, Sandeep; Walia, Satish K.

    2015-01-01

    Antibiotic resistance in bacteria is a global problem exacerbated by the dissemination of resistant bacteria via uncooked food, such as green leafy vegetables. New strains of bacteria are emerging on a daily basis with novel expanded antibiotic resistance profiles. In this pilot study, we examined the occurrence of antibiotic resistant bacteria against five classes of antibiotics on iceberg lettuce retailed in local convenience stores in Rochester, Michigan. In this study, 138 morphologically distinct bacterial colonies from 9 iceberg lettuce samples were randomly picked and tested for antibiotic resistance. Among these isolates, the vast majority (86%) demonstrated resistance to cefotaxime, and among the resistant bacteria, the majority showed multiple drug resistance, particularly against cefotaxime, chloramphenicol, and tetracycline. Three bacterial isolates (2.17%) out of 138 were extended spectrum beta-lactamase (ESBL) producers. Two ESBL producers (T1 and T5) were identified as Klebsiella pneumoniae, an opportunistic pathogen with transferable sulfhydryl variable- (SHV-) and TEM-type ESBLs, respectively. The DNA sequence analysis of the blaSHV detected in K. pneumoniae isolate T1 revealed 99% relatedness to blaSHV genes found in clinical isolates. This implies that iceberg lettuce is a potential reservoir of newly emerging and evolving antibiotic resistant bacteria and its consumption poses serious threat to human health. PMID:26064922

  9. Emergence of carbapenem-resistant Klebsiella species possessing the class A carbapenem-hydrolyzing KPC-2 and inhibitor-resistant TEM-30 beta-lactamases in New York City.

    PubMed

    Bradford, Patricia A; Bratu, Simona; Urban, Carl; Visalli, Melissa; Mariano, Noriel; Landman, David; Rahal, James J; Brooks, Steven; Cebular, Sanda; Quale, John

    2004-07-01

    Nineteen isolates of carbapenem-resistant Klebsiella species were recovered from 7 hospitals in New York City. Most K. pneumoniae belonged to a single ribotype. Nucleotide sequencing identified KPC-2, a carbapenem-hydrolyzing beta -lactamase. In 3 strains, TEM-30, an inhibitor-resistant beta -lactamase, was detected. Carbapenem-resistant Klebsiella species possessing KPC-2 are endemic in New York City. This study documents the identification of an inhibitor-resistant TEM beta -lactamase in the United States. PMID:15206053

  10. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-beta-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France.

    PubMed

    Poirel, L; Naas, T; Nicolas, D; Collet, L; Bellais, S; Cavallo, J D; Nordmann, P

    2000-04-01

    Pseudomonas aeruginosa COL-1 was identified in a blood culture of a 39-year-old-woman treated with imipenem in Marseilles, France, in 1996. This strain was resistant to beta-lactams, including ureidopenicillins, ticarcillin-clavulanic acid, cefepime, ceftazidime, imipenem, and meropenem, but remained susceptible to the monobactam aztreonam. The carbapenem-hydrolyzing beta-lactamase gene of P. aeruginosa COL-1 was cloned, sequenced, and expressed in Escherichia coli DH10B. The deduced 266-amino-acid protein was an Ambler class B beta-lactamase, with amino acid identities of 32% with B-II from Bacillus cereus; 31% with IMP-1 from several gram-negative rods in Japan, including P. aeruginosa; 27% with CcrA from Bacteroides fragilis; 24% with BlaB from Chryseobacterium meningosepticum; 24% with IND-1 from Chryseobacterium indologenes; 21% with CphA-1 from Aeromonas hydrophila; and 11% with L-1 from Stenotrophomonas maltophilia. It was most closely related to VIM-1 beta-lactamase recently reported from Italian P. aeruginosa clinical isolates (90% amino acid identity). Purified VIM-2 beta-lactamase had a pI of 5.6, a relative molecular mass of 29.7 kDa, and a broad substrate hydrolysis range, including penicillins, cephalosporins, cephamycins, oxacephamycins, and carbapenems, but not monobactams. As a metallo-beta-lactamase, its activity was zinc dependent and inhibited by EDTA (50% inhibitory concentration, 50 microM). VIM-2 conferred a resistance pattern to beta-lactams in E. coli DH10B that paralleled its in vitro hydrolytic properties, except for susceptibility to ureidopenicillins, carbapenems, and cefepime. bla(VIM-2) was located on a ca. 45-kb plasmid that in addition conferred resistance to sulfamides and that was not self-transmissible either from P. aeruginosa to E. coli or from E. coli to E. coli. bla(VIM-2) was the only gene cassette located within the variable region of a novel class 1 integron, In56, that was weakly related to the bla(VIM-1)-containing

  11. Characterization of Multidrug Resistant Extended-Spectrum Beta-Lactamase-Producing Escherichia coli among Uropathogens of Pediatrics in North of Iran.

    PubMed

    Rezai, Mohammad Sadegh; Salehifar, Ebrahim; Rafiei, Alireza; Langaee, Taimour; Rafati, Mohammadreza; Shafahi, Kheironesa; Eslami, Gohar

    2015-01-01

    Escherichia coli remains as one of the most important bacteria causing infections in pediatrics and producing extended-spectrum beta-lactamases (ESBLs) making them resistant to beta-lactam antibiotics. In this study we aimed to genotype ESBL-producing E. coli isolates from pediatric patients for ESBL genes and determine their association with antimicrobial resistance. One hundred of the E. coli isolates were initially considered ESBL producing based on their MIC results. These isolates were then tested by polymerase chain reaction (PCR) for the presence or absence of CTX, TEM, SHV, GES, and VEB beta-lactamase genes. About 30.5% of isolated E. coli was ESBL-producing strain. The TEM gene was the most prevalent (49%) followed by SHV (44%), CTX (28%), VEB (8%), and GES (0%) genes. The ESBL-producing E. coli isolates were susceptible to carbapenems (66%) and amikacin (58%) and showed high resistance to cefixime (99%), colistin (82%), and ciprofloxacin (76%). In conclusion, carbapenems were the most effective antibiotics against ESBl-producing E. coli in urinary tract infection in North of Iran. The most prevalent gene is the TEM-type, but the other resistant genes and their antimicrobial resistance are on the rise. PMID:26064896

  12. Increase in isolation of extended spectrum beta lactamase producing multidrug resistant non typhoidal Salmonellae in Pakistan

    PubMed Central

    2010-01-01

    Background Increasing resistance to quinolones and ceftriaxone in non typhoidal Salmonellae is a global concern. Resistance to quinolone and 3rd generation cephalosporin amongst non typhoidal Salmonellae (NTS) from Pakistan has been reported in this study. Methods Retrospective analysis of laboratory data was conducted (1990-2006). NTS were isolated and identified from clinical samples using standard microbiological techniques. Antimicrobial susceptibility testing was performed by Kirby Bauer. Extended spectrum beta lactamase production (ESBL) was detected using combined disc method. Ciprofloxacin sensitivity was detected by nalidixic acid screening method. Minimum inhibitory concentration (MIC) of ciprofloxacin was determined by agar dilution method. Statistical analysis was performed using SPSS version 13. Results Analysis of 1967 NTS isolates showed a significant increase in ciprofloxacin resistance from 23% in 2002 to 50.5% in 2006, with increased mean MIC values from 0.6 to 1.3 ug/mL. Ceftriaxone resistant NTS also increased and ESBL production was seen in 98.7% isolates. These isolates exhibited high resistance against amoxicillin clavulanic acid (57%), gentamicin (69%), amikacin (44%) and piperacillin tazobactam (30%). No resistance to carbapenem was seen. Ceftriaxone resistance was significantly higher in children <1 year, in invasive isolates and in Salmonella Typhimurium. Conclusions Increase in quinolone and ceftriaxone NTS is a serious threat to public health requiring continuous surveillance and use of appropriate screening tests for laboratory detection. PMID:20409348

  13. Coexistence of plasmid-mediated quinolone resistance determinants and AmpC-Beta-Lactamases in Escherichia coli strains in Egypt.

    PubMed

    Abd El-Aziz, N K; Gharib, A A

    2015-01-01

    Three kinds of plasmid—mediated quinolone resistance (PMQR) determinants (qnr genes, qepA and aac(6')—Ib—cr) have been discovered and shown to be widely distributed among clinical isolates. To characterize the prevalence of PMQR determinants among AmpC—producing E. coli strains in food—producing animals and animal by—products in Egypt, twenty—nine E. coli strains were tested for their susceptibilities to antimicrobials and screened for PMQR determinants and AmpC Beta lactamases using PCR and plasmid profiling. It was found that qnr genes being detected alone or in combination with qepA or aac(6')—Ib—cr genes in 11 (37.9%) strains comprising 9 for qnrA and only one for both qnrB and qnrS. Moreover, qepA and aac(6')—Ib—cr were detected in 41.38% and 3.45% of E. coli strains, respectively. The ampC β—lactamase genes were detected in 75.86 % of all strains and in 100% and 53.3% of the PMQR determinant—positive and negative strains, respectively. In several cases, plasmid profiling of E. coli strains exhibiting the coexistence of both PMQR determinants and ampC genes on a single plasmid as a first report in Egypt that may contribute to rapid spread and increase in bacterial resistance, which is important to public health concern. PMID:26475385

  14. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta-lactamase genes.

    PubMed Central

    Bauernfeind, A; Stemplinger, I; Jungwirth, R; Wilhelm, R; Chong, Y

    1996-01-01

    A plasmidic beta-lactamase which hydrolyzed cephamycins was first detected and reported in 1989. At that time its description was restricted to phenotypic characteristics. We analyzed nucleotide sequence of its gene and explored it genetic relationship with other bla genes. The deduced amino acid sequence of the blaCMY-1 product was compared with those of other known plasmidic cephamycinases and of chromosomal AmpC beta-lactamases. The results indicate that the relationship of CMY-1 is closest to MOX-1 among the plasmidic cephamycinases and to AmpC of Pseudomonas aeruginosa among the chromosomal cephalosporinases. We conclude that the plasmidic cephamycinases described up to now may be classified into three families, as follows: CMY-1, MOX-1, and FOX-1 with AmpC of P. aeruginosa; CMY-2, BIL-1 and LAT-1 with AmpC of Citrobacter freundii; and MIR-1 with AmpC of Enterobacter cloacae. Plasmidic cephamycinases are now recognized as clinically relevant class C beta-lactamases. PMID:8843306

  15. Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 Genes Among Clinical Pseudomonas aeruginosa Species Isolated in Zahedan, Iran

    PubMed Central

    Ghamgosha, Mehdi; Shahrekizahedani, Shahram; Kafilzadeh, Farshid; Bameri, Zakaria; Taheri, Ramezan Ali; Farnoosh, Gholamreza

    2015-01-01

    Background: One of the major clinical problems regarding Pseudomonas aeruginosa is attributed to metallo-beta-lactamases (MBL). This group of enzymes is a subset of beta lactamases which belong to group B of Ambler classification and cause hydrolysis of carbapenems. Based on epidemiological studies conducted worldwide, it is proved that prevalence of genes coding MBLs in P. aeruginosa species are different in various geographic zones and even in various hospitals. Therefore, according to the clinical importance of organisms generating MBLs, it is necessary to identify and control these bacteria in hospitals for therapeutic purposes. Objectives: The current study aimed to investigate the Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 genes among clinical P. aeruginosa species isolated in Zahedan, Iran. Materials and Methods: The current study investigated the presence of MBL through phenotypic and genotypic methods and also the pattern of antibiotic resistance in P. aeruginosa species isolated in hospitals. The Minimum Inhibitory Concentration (MIC) against imipeneme was measured for 191 P. aeruginosa species isolated from Zahedan hospitals after identification through biochemical methods and determination of the antibiotic resistance pattern. Strains with MIC > 4 µg/mL were studied by phenotypic and genotypic methods. Results: The rate of resistance against imipeneme was 5.7% and after carrying out the phenotypic experiments, nine species were identified as of MBL producer. Seven species were confirmed by Polymerase Chain Reaction (PCR) method. Gene VIM-1 was the predominant gene among the positive (antibiotic resistant) species. Conclusions: The study results showed that MBL genes were present in some of the species isolated from Zahedan hospitals. Regarding the importance of MBL producer bacteria in hospitals, quick identification and evaluation of these clinical species can be considered as an important and basic step for treatment and control of pseudomonad

  16. Differences in Extended-Spectrum Beta-Lactamase Producing Escherichia coli Virulence Factor Genes in the Baltic Sea Region

    PubMed Central

    Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp

    2014-01-01

    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  17. Differences in extended-spectrum beta-lactamase producing Escherichia coli virulence factor genes in the Baltic Sea region.

    PubMed

    Lillo, Jana; Pai, Kristiine; Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Ivanova, Marina; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Parv, Kristel; Pavelkovich, Anastasia; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp

    2014-01-01

    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  18. Nosocomial infections caused by multidrug-resistant isolates of pseudomonas putida producing VIM-1 metallo-beta-lactamase.

    PubMed

    Lombardi, Gianluigi; Luzzaro, Francesco; Docquier, Jean-Denis; Riccio, Maria Letizia; Perilli, Mariagrazia; Colì, Alessandra; Amicosante, Gianfranco; Rossolini, Gian Maria; Toniolo, Antonio

    2002-11-01

    Successful carbapenem-based chemotherapy for the treatment of Pseudomonas infections has been seriously hindered by the recent appearance of IMP- and VIM-type metallo-beta-lactamases, which confer high-level resistance to carbapenems and most other beta-lactams. Recently, multidrug-resistant Pseudomonas putida isolates for which carbapenem MICs were >/=32 micro g/ml were recovered from cultures of urine from three inpatients in the general intensive care unit of the Ospedale di Circolo, Varese, Italy. Enzyme assays revealed production of a metallo-beta-lactamase activity, while molecular analysis detected in each isolate a bla(VIM-1) determinant carried by an apparently identical medium-sized plasmid. Conjugation experiments were unsuccessful in transferring the beta-lactamase determinant to Escherichia coli or Pseudomonas aeruginosa. Macrorestriction analysis by pulsed-field gel electrophoresis demonstrated that the isolates were of clonal origin. PCR mapping and sequencing of the variable region of the plasmid-borne class 1 integron carrying the bla(VIM-1) determinant (named In110) showed that the bla(VIM-1)-containing cassette was identical to that previously found in strains of different species from other Italian hospitals and that the cassette array of In110 was not identical but clearly related to that of In70 (a bla(VIM-1)-containing plasmid-borne integron from an Achromobacter xylosoxidans isolate), pointing to a common origin of this cassette and to a related evolutionary history of their cognate integrons. PMID:12409373

  19. Combination of IMP-4 metallo-beta-lactamase production and porin deficiency causes carbapenem resistance in a Klebsiella oxytoca clinical isolate.

    PubMed

    Chen, Li-Rong; Zhou, Hong-Wei; Cai, Jia-Chang; Zhang, Rong; Chen, Gong-Xiang

    2009-10-01

    This study shows for the first time the mechanism of carbapenem resistance of a Klebsiella oxytoca clinical isolate ZC101 recovered from a Zhejiang University Hospital in Hangzhou, China. MIC values of imipenem, meropenem, and ertapenem for K. oxytoca ZC101 were 16, 16, and 128 microg/mL, respectively. Conjugation experiments demonstrated the transferability of a resistance determinant from K. oxytoca ZC101 to Escherichia coli EC600. Results from isoelectric focusing, polymerase chain reactions, and DNA sequencing confirmed that K. oxytoca ZC101 produced IMP-4 metallo-beta-lactamase (MBL) and CTX-M-14 extended-spectrum beta-lactamase, whereas E. coli transconjugant only produced the IMP-4. Amplification of integron revealed that bla(IMP-4) gene is located within a class I integron that was carried in a plasmid approximately 55 kb in size. Sodium dodecyl sulfate polyacrylamide gel electrophoresis profiling of outer membrane proteins of K. oxytoca ZC101 indicated lack of expression of the OmpK36 porin. DNA sequence analysis of ompK36 gene of K. oxytoca ZC101 showed the gene was disrupted by an insertion sequence IS5. In all, the results show that plasmid-mediated IMP-4 MBL production combined with the loss of OmpK36 porin caused the resistance in K. oxytoca ZC101 to carbapenems. PMID:19748427

  20. Shiga toxin and beta-lactamases genes in Escherichia coli phylotypes isolated from carcasses of broiler chickens slaughtered in Iran.

    PubMed

    Bagheri, Mahboube; Ghanbarpour, Reza; Alizade, Hesam

    2014-05-01

    Two hundred and four Escherichia coli strains were isolated from external and visceral cavity surfaces of 102 slaughtered broiler carcasses. The isolates were screened to determine the phylogenetic background and presence of Shiga toxins (stx1, stx2), intimin (eae) and beta-lactamase (blaTEM, blaSHV) genes. Phylotyping results revealed that the E. coli isolates segregated in four phylogenetic groups A (56.86%), B1 (19.12%), B2 (4.90%) and D (19.12%). PCR assays revealed that 13 isolates (6.37%) from 12 carcasses were positive for eae (12 isolates) and/or stx2 (2) genes. The eae positive isolates belonged to phylogenetic groups A (A0, A1), B1, B2 (B22) and D (D2). Two stx2 positive and seven eae positive isolates were recovered from visceral cavity surface, whereas only 5 eae positive isolates were from the external surface of the carcasses. On the other hand, thirty one E. coli strains isolated from visceral cavity and external surface of 26 carcasses carried the blaTEM (27) and blaSHV (4) genes and belonged to different phylo-groups. This study suggests that broiler carcasses could be considered as an important source of EPEC and STEC pathotypes in southeast of Iran; as well as the examined antibiotic resistance genes, which were carried by some isolates and could be transferred to pathogens through the food chain. PMID:24590116

  1. Emergence of Multidrug Resistance and Metallo-beta-lactamase Producing Acinetobacter baumannii Isolated from Patients in Shiraz, Iran

    PubMed Central

    Moghadam, MN; Motamedifar, M; Sarvari, J; Sedigh, Ebrahim-Saraie H; Mousavi, Same M; Moghadam, FN

    2016-01-01

    Background: Metallo-beta-lactamase (MβL) enzymes production is one of the most important resistance mechanisms against carbapenems in some bacteria including Acinetobacter baumannii. Aims: This study was aimed to determine the antimicrobial susceptibility and the prevalence of MβL among carbapenem-resistant isolates of A. baumannii. Materials and Methods: In this cross-sectional study from October 2012 to April 2013, 98 isolates were identified as A. baumannii using Microgen™ kits and confirmed by molecular method. These isolates were tested for antimicrobial susceptibilities by disk diffusion method according to the Clinical and Laboratory Standards Institute guidelines. Carbapenem-resistant isolates were further detected phenotypically by MβL minimal inhibitory concentration (MIC)-test strips, and subsequently positive MβL isolates were confirmed by polymerase chain reaction (PCR). Results: Overall, 98% (96/98) of A. baumannii isolates were detected as carbapenem-resistant by MIC test. Highest sensitivity to the tested antibiotic with 42.9% (42/98) was observed to colistin. Of 96 carbapenem-resistant isolates, 43 were phenotypically positive for MβL; out of 43 isolates, 37 were confirmed for the presence of MβL genes by PCR. Conclusion: The frequency of drug resistance among the clinical samples of A. baumannii isolated in our study against most of the antibiotics was very high. Moreover, all MβL producing isolates were multidrug resistance. Therefore, systematic surveillance to detect MβL producing bacteria and rational prescription and use of carbapenems could be helpful to prevent the spread of carbapenem resistance. PMID:27398247

  2. Activity of cephalosporins against methicillin-susceptible and methicillin-resistant, coagulase-negative staphylococci: minimal effect of beta-lactamase.

    PubMed Central

    John, J F; McNeill, W F

    1980-01-01

    Eight cephalosporins were tested for their activity against methicillin-susceptible and methicillin-resistant, coagulase-negative staphylococci and for their resistance to beta-lactamase from methicillin-resistant, coagulase-negative staphylococci. Susceptibility testing by the agar plate method was evaluated for the effect of inoculum size and duration of incubation. Methicillin-susceptible, coagulase-negative staphylococci were highly susceptible to the cephalosporins, with cephapirin and cepahlothin showing the greatest activity, followed by cefazolin and cefamandole. Methicillin-resistant, coagulase-negative staphylococci displayed nearly total cross-resistance to the cephalosporins. Resistance increased with increasing inoculum size. Beta-Lactamases produced by methicillin-resistant, coagulase-negative staphylococci had a minimal hydrolytic effect on cepahlothin, cephapirin, cefazolin, and cefamandole and no measurable effect on cefoxitin. There was no correlation between the anti-staphylococcal activity and resistance to beta-lactamases. PMID:6966906

  3. High prevalence of extensively drug-resistant and metallo beta-lactamase-producing clinical Acinetobacter baumannii in Iran.

    PubMed

    Maspi, Hossein; Mahmoodzadeh Hosseini, Hamideh; Amin, Mohsen; Imani Fooladi, Abbas Ali

    2016-09-01

    Acinetobacter species particularly Acinetobacter baumannii (A. baumannii) have been widely reported as broad-spectrum antibiotic resistant pathogens. Expression of various types of metallo beta-lactamases (MBL), classified as Ambler class B, has been associated with carbapenem resistance. Here, we attempted to assess the frequency of extensively drug-resistant (XDR) and MBL-producing A. baumannii among clinical isolates. 86 clinical A. baumannii strains were collected from 2014 to 2015 and their susceptibility to meropenem (10 μg), imipenem (10 μg), azteronem (30 μg), pipracillin (100 μg) tazobactam (110 μg), tobramycin (10 μg), fosfomycin (200 μg), rifampicin (5 μg), colistin (10 μg), tigecycline (15 μg), sulbactam/ampicillin (10 μg + 10 μg) and polymixin B (300 U) was evaluated using disk diffusion method. The MBL-producing isolates were screened using combined disc diffusion method. Furthermore, the presence of blaVIM, blaIMP, blaSPM, blaGIM, blaSIM and blaNDM was detected by PCR. 34.9% of isolates were recovered from bronchoalveolar lavage (BAL). 81 (94.2%) and 62 (71.2%) isolates were multidrug resistance (MDR) and XDR, respectively. 44 (51.2%) and 65 (75.6%) isolates were MBL-producing strains with resistance to imipenem and meropenem, respectively. 2 (2.3%), 13 (15.1%), 2 (2.3%), 4 (4.7%) and 2 (2.3%) isolates carried blaVIM, blaIMP, blaSPM, blaGIM and blaSIM genes, respectively. Our data showed that the rate of XDR and MBL A. baumannii is on the rise. PMID:27448835

  4. Presence of blaPER-1 and blaVEB-1 beta-lactamase genes among isolates of Pseudomonas aeruginosa from South West of Iran.

    PubMed

    Davodian, Elham; Sadeghifard, Nourkhoda; Ghasemian, Abdolmajid; Noorbakhsh, Samileh

    2016-09-01

    Pseudomonas aeruginosa isolates have acquired resistance to antibiotics such as novel beta-lactams. The aim of this study was to investigate the blaPER-1, blaVEB-1, and blaPSE-1 genes among isolates of P. aeruginosa among intensive care unit (ICU) patients. Sixty-five isolates were collected. The antibiotic susceptibility testing and combined disk tests were performed to detect the isolates producing extended spectrum beta-lactamases (ESBLs) among ceftazidime-resistant isolates. Polymerase chain reaction (PCR) amplification of blaPER-1, blaVEB-1, and blaPSE-1 genes was conducted. Ten (15.3%) isolates were ESBL-positive, of which 40% (n=4) belonged to males and 60% (n=6) were collected from females. Moreover, two and one isolates harbored blaPER-1 and blaVEB-1 genes, respectively. PMID:26944896

  5. Beta-lactamases in Enterobacteriaceae infections in children.

    PubMed

    Moxon, Christopher Alan; Paulus, Stéphane

    2016-07-01

    Multi-drug resistance in Gram negative bacteria, particularly in Enterobacteriaceae, is a major clinical and public health challenge. The main mechanism of resistance in Enterobacteriaceae is linked to the production of beta-lactamase hydrolysing enzymes such as extended spectrum beta-lactamases (ESBL), AmpC beta-lactamases and carbapenemases (Carbapenemase Producing Enterobacteriaceae (CPE)). ESBL and CPE resistance genes are located on plasmids, which can be transmitted between Enterobacteriaceae, facilitating their spread in hospitals and communities. These plasmids usually harbour multiple additional co-resistance genes, including to trimethoprim-sulfamethoxazole, aminoglycosides, and fluoroquinolones, making these infections challenging to treat. Asymptomatic carriage in healthy children as well as community acquired infections are increasingly reported, particularly with ESBL. Therapeutic options are limited and previously little used antimicrobials such as fosfomycin and colistin have been re-introduced in clinical practice. Paediatric experience with these agents is limited hence there is a need to further examine their clinical efficacy, dosage and toxicity in children. Antimicrobial stewardship along with strict infection prevention and control practices need to be adopted widely in order to preserve currently available antimicrobials. The future development of novel agents effective against beta-lactamases producers and their applicability in children is urgently needed to address the challenge of multi-resistant Gram negative infections. PMID:27180312

  6. Emergence of co-production of plasmid-mediated AmpC beta-lactamase and ESBL in cefoxitin-resistant uropathogenic Escherichia coli.

    PubMed

    Ghosh, B; Mukherjee, M

    2016-09-01

    Plasmid-mediated AmpC (pAmpC) and ESBL co-production was detected in Escherichia coli a major etiologic agent of urinary tract infection. Isolates resistant to cefoxitin by CLSI methodology were tested for pAmpC beta-lactamase using phenylboronic acid and ESBLs by combined disk diffusion method. pAmpC/ESBL genes were characterized by PCR and sequencing. Transconjugation experiments were done to study the transfer of pAmpC and ESBL production from clinical isolates as donor to E. coli J53 AziR as recipient. Incompatibility groups of transmissible plasmids were classified by PCR-based replicon typing (PBRT). Among 148 urine culture positive isolates, E. coli was reported in 39.86 % (59/148), with 93.22 % (55/59) of cefoxitin resistance. pAmpC production was detected in 25, with varied distribution of blaCMY-2 and blaDHA-1type genes alone (n = 13 and 7 respectively) or in combination (n = 5). ESBL co-production was observed in 88 % (22/25) of pAmpC producing isolates with predominance of blaTEM (n = 20). Twenty-three transconjugants showed transmission of pAmpC-and ESBL-resistant genes with co-carriage of blaCMY-2 and blaTEM (n = 15) in plasmids of IncF type (n = 9) being predominant, followed by IncI1 (n = 4) and IncH1 (n = 2) in combination. All clinical isolates were clonally diverse. Resistance against different beta-lactams in uropathogenic E. coli has been an emerging concern in resource- poor countries such as India. Knowledge on the occurrence of AmpC beta-lactamases and ESBL amongst this pathogen and its transmission dynamics may aid in hospital infection control. PMID:27250633

  7. Detection of New Delhi Metallo-Beta-Lactamase-1 (NDM-1) in carbapenem- resistant Klebsiella pneumoniae isolated from a university hospital in Iran

    PubMed Central

    Fazeli, H; Norouzi-Barough, M; Ahadi, A M; Shokri, D; Solgi, H

    2015-01-01

    Background New Delhi metallo-beta-lactamase-1(NDM-1) is a novel type of metallo-beta-lactamase (MBL) which inactivates all β-lactam antibiotics except aztreonam. Enterobacteriaceae expressing NDM-1 have been identified worldwide. The aim of this study was to detect MBLs in carbapenem-resistant K. pneumoniae isolates obtained from patients hospitalized in one of the university hospitals in Isfahan, Iran. Methods Of the 112 isolates obtained from various clinical samples, 49 were selected for carbapenemase detection based on their reduced susceptibility to imipenem or meropenem according to the disc diffusion method. These isolates were screened for carbapenemase and MBL production using the Modified Hodge Test (MHT) and Epsilometer test (E-test) MBL strips. Polymerase chain reaction was performed on all 49 isolates using specific primers to detect genes encoding IMP (active on imipenem), VIM (Verona integron-encoded metallo-β-lactamase), SPM-1 (Sao Paulo metallo-β-lactamase) and NDM-1. Results Among 49 carbapenem-resistant isolates, 32 (65.3 %) were positive for MHT and 6 (12.2 %) were found positive for blaNDM-1. Other MBL genes were not detected. Conclusion This is the second report on the detection of blaNDM-1 in Iran since it was first reported by Shahcheraghi and colleagues in 2012. This study indicated that resistance to carbapenems and isolation of bacteria producing NDM-1 is increasing. Therefore, the rapid detection of isolates expressing NDM-1 is essential to control their spread. Hippokratia 2015; 19 (3): 205-209. PMID:27418777

  8. Commensal Enterobacteriaceae as reservoirs of extended-spectrum beta-lactamases, integrons, and sul genes in Portugal

    PubMed Central

    Machado, Elisabete; Coque, Teresa M.; Cantón, Rafael; Sousa, João C.; Peixe, Luísa

    2013-01-01

    Bacteria colonizing the human intestine have a relevant role in the spread of antimicrobial resistance. We investigated the faecal carriage of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in healthy humans from Portugal and analyzed the distribution of sul genes and class 1 and 2 integrons. Faecal samples (n = 113) were recovered from healthy persons (North/Centre of Portugal, 2001–2004) and plated on MacConkey agar with and without ceftazidime (1 mg/L) or cefotaxime (1 mg/L). Isolates representing different morphotypes/plate and antibiotic susceptibility patterns (n = 201) were selected. Isolates resistant to sulfonamides and/or streptomycin, gentamicin, and trimethoprim were screened (PCR and sequencing) for sul genes (sul1, sul2, sul3) and class 1 and 2 integrons. Presence of ESBLs was inferred using the double disk synergy test (DDST) and further confirmed by PCR and sequencing. ESBL producers were selected for clonal analysis, plasmid characterization and conjugation assays by standard methods. ESBL-producing isolates were found in 1.8% (2/113) of samples, corresponding to Escherichia coli of phylogroups A (n = 1) and B1 (n = 1) carrying transferable blaCTX-M-14 and the new blaTEM-153, respectively. A 80kb IncK plasmid bearing blaCTX-M-14 was found, being highly related to that widely spread among CTX-M-14 producers of humans and animals from Portugal and other European countries. sul genes were found in 88% (22/25; sul2-60%, sul1-48%, sul3-4%) of the sulfonamide resistant isolates. Class 1 integrons were more frequently found than class 2 (7%, 14/201 vs. 3%, 6/201). Interestingly, gene cassette arrangements within these platforms were identical to those commonly observed among Enterobacteriaceae from Portuguese food-producing animals, although aadA13 is here firstly described in Morganella morganii. These results reinforce the relevance of human commensal flora as reservoir of clinically relevant antibiotic resistance genes including

  9. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carrying IMP-1 metallo-beta-lactamase gene in a University Hospital in Turkey.

    PubMed

    Ozgumus, Osman Birol; Caylan, Rahmet; Tosun, Ilknur; Sandalli, Cemal; Aydin, Kemalettin; Koksal, Iftihar

    2007-01-01

    Pseudomonas aeruginosa isolates carrying IMP- or VIM-type metallo-beta-lactamase (MBL) have been increasingly reported in hospitals worldwide. One hundred P. aeruginosa clinical isolates from unrelated inpatients hospitalized at a Turkish university hospital were screened for the presence of bla(IMP) and bla(VIM) genes by polymerase chain reaction (PCR). One (1%) isolate was found to carry a VIM-type MBL gene, whereas nine (9%) carried an IMP-1 MBL gene carried on a cassette inserted into a class 1 integron. Only four of the IMP producers were detected as MBL producers according to E-test MBL. Minimum inhibitory concentrations (MICs) of imipenem for the IMP-1 and VIM-type MBL-producers were highly variable (MIC values, 8-128 mug/ml). Imipenem resistance was not plasmid-mediated according to the transformation assays. Piperacillin/tazobactam was the only effective drug in antimicrobial susceptibility testing. No aztreonam-resistant IMP and VIM producers were detected to produce an extended-spectrum beta-lactamase (ESBL). Three class 1 integrons of approximately 2,300 bp, 1,800 bp, and 1,500 bp in size were detected in each of the nine IMP-positive isolates. Sequencing revealed three novel gene cassette arrays, aac(3)-1c-cmlA5, bla(IMP-1)-aadA7-like, and aacA7-smr-2-orfD. Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) indicated that a clonal spread of IMP-1-producers had occurred in this hospital. PMID:17949306

  10. An update on newer beta-lactamases.

    PubMed

    Gupta, Varsha

    2007-11-01

    The resistance to beta-lactam antibiotics is an increasing problem worldwide and beta lactamases production is the most common mechanism of drug resistance. Both global and Indian figures showed a marked increase in the number of beta-lactamases producing organisms. These enzymes extended spectrum beta-lactamases (ESBLs) are numerous and continuous mutation has led to the development of enzymes having expanded substrate profile. To date, there are more than 130 TEM type and more than 50 sulphydryl variable (SHV) type beta-lactamases found in Gram negative bacilli. ESBL producing Enterobacteriaceae are, as a rule, resistant to all cephalosporins and extended spectrum penicillins including the monobactam, aztreonam, while resistance to trimethoprim - sulphamethaxazole and aminoglycosides is frequently co-transferred on the same plasmid. Many ESBL producing organisms also express Amp C beta-lactamases. Amp C- beta-lactamases are clinically significant, as these confer resistance to cephalosporins in the oxyimino group, 7 alpha-methoxy cephalosporins, and are poorly inhibited by clavulanic acid. Carbepenems are the drugs of choice for the treatment of infections caused by ESBL producing organisms but carbapenemases (MBLs) have emerged and have spread from Pseudomonas aeruginosa to Enterobacteriaceae. The routine clinical microbiology laboratories should employ simple methods to recognize these enzymes using various substrates and inhibitors. These organisms may lead to therapeutic dead ends. Presently, the therapy relies on beta-lactam/ beta-lactamases inhibitor combinations, carbepenems and piperacillin - tazobactam plus aminoglycoside combination. Proper infection control practices and barrier precautions are essential to contain the organisms producing beta-lactamases. PMID:18160745

  11. Effect of certain bioactive plant extracts on clinical isolates of beta-lactamase producing methicillin resistant Staphylococcus aureus.

    PubMed

    Aqil, Farrukh; Khan, M Sajjad A; Owais, Mohd; Ahmad, Iqbal

    2005-01-01

    Ethanolic extracts and some fractions from 10 Indian medicinal plants, known for antibacterial activity, were investigated for their ability to inhibit clinical isolates of beta-lactamase producing methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-sensitive S. aureus (MSSA). Synergistic interaction of plant extracts with certain antibiotics was also evaluated. The MRSA test strains were found to be multi-drug resistant and also exhibited high level of resistance to common beta-lactam antibiotics. These strains produced beta-lactamases, which hydrolyze one or other beta-lactam antibiotics, tested. The extract of the plants from Camellia sinensis (leaves), Delonix regia (flowers), Holarrhena antidysenterica (bark), Lawsonia inermis (leaves), Punica granatum (rind), Terminalia chebula (fruits) and Terminalia belerica (fruits) showed a broad-spectrum of antibacterial activity with an inhibition zone size of 11 mm to 27 mm, against all the test bacteria. The extracts from the leaves of Ocimum sanctum showed better activity against the three MRSA strains. On the other hand, extracts from Allium sativum (bulb) and Citrus sinensis (rind) exhibited little or no activity, against MRSA strains. The antibacterial potency of crude extracts was determined in terms of minimum inhibitory concentration (MIC) by the tube dilution method. MIC values, of the plant extracts, ranged from 1.3 to 8.2 mg/ml, against the test bacteria. Further, the extracts from Punica granatum and Delonix regia were fractionated in benzene, acetone and methanol. Antibacterial activity was observed in acetone as well as in the methanol fractions. In vitro synergistic interaction of crude extracts from Camellia sinensis, Lawsonia inermis, Punica granatum, Terminalia chebula and Terminalia belerica was detected with tetracycline. Moreover, the extract from Camellia sinensis also showed synergism with ampicillin.TLC of the above extracts revealed the presence of major phytocompounds, like

  12. beta -Lactamases: which ones are clinically important?

    PubMed

    Rice, Louis B.; Bonomo, Robert A.

    2000-06-01

    The introduction of a large array of beta-lactam antibiotics has spawned the emergence of an even larger variety of beta-lactamases designed to confer resistance to these agents. beta-lactamases are produced by both gram-positive and gram-negative bacteria, but their clinical importance is far greater among the gram-negatives. The virtual explosion in our knowledge about the variety of these enzymes can often create confusion and frustration among those not well versed in the field. In this paper, we attempt to focus the discussion of beta-lactamases on those enzymes that are of the greatest clinical importance, the Ambler Class A and C enzymes. We also discuss the growing importance of the Ambler Class B metallo beta-lactamases, which hydrolyze carbapenems and are increasing in prevalence in areas of significant carbapenem usage. Copyright 2000 Harcourt Publishers Ltd. PMID:11498383

  13. Prevalence of 16S rRNA methylase, modifying enzyme, and extended-spectrum beta-lactamase genes among Acinetobacter baumannii isolates.

    PubMed

    Liu, Zhenru; Ling, Baodong; Zhou, Liming

    2015-08-01

    Multidrug-resistant Acinetobacter baumannii has become a worldwide problem, and methylation of 16S rRNA has recently emerged as a new mechanism of resistance to aminoglycosides, which is mediated by a newly recognized group of 16S rRNA methylases. 16S rRNA methylase confers a high-level resistance to all 4,6-substituted deoxystreptamine aminoglycosides that are currently used in clinical practice. Some of the A. baumannii isolates have been found to coproduce extended-spectrum beta-lactamases (ESBLs), contributing to their multidrug resistance. The aim of this study was to detect the determinants of the 16S rRNA methylase genes armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA, the modifying enzyme genes aac(6')-Ib, ant(3″)-Ia, aph(3')-I, and the extended-spectrum beta-lactamase genes bla(TEM), bla(SHV), and bla(CTX-M-3) among A. baumannii isolates in northeastern Sichuan, China. Minimum inhibitory concentrations (MICs) of 21 different antimicrobial agents against the A. baumannii isolates were determined. The clinical isolates showed a high level of resistance (MIC≧256 μg/ml) to aminoglycosides, which ranged from 50·1 to 83·8%. The resistances to meropenem and imipenem, two of the beta-lactam antibiotics and the most active antibiotics against A. baumannii, were 9·1 and 8·2%, respectively. Among 60 amikacin-resistant isolates, only the 16S rRNA methylase gene armA was found to be prevalent (66·7%), but the other 16S rRNA methylase genes rmtA, rmtB, rmtC, rmtD, rmtE, and npmA were not detected. The prevalences of the modifying enzyme genes aac (6')-Ib, ant (3″)-Ia, and aph (3')-I were 51·7, 81·7, and 58·3%, respectively, which are different from a previous study in which the occurrences of these genes were 3, 64, and 72%, respectively. Among the 40 isolates that were armA-positive, the prevalences of bla(TEM), bla(SHV), and bla(CTX-M-3) genes were detected for the first time in China, and their occurrences were 45, 65, and 52·5%, respectively. In all, A

  14. Phenotypic Detection of Metallo-Beta-Lactamases in Carbapenem Resistant Acinetobacter baumannii Isolated from Pediatric Patients in Pakistan.

    PubMed

    Anwar, Muneeza; Ejaz, Hassan; Zafar, Aizza; Hamid, Hamdan

    2016-01-01

    Multidrug resistant A. baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections especially in neonates and immunocompromised patients because they have least capacity to fight against infections. Carbapenems are used as last resort antibiotics for treating these infections but currently resistance against carbapenems due to MBL production is on the rise. The objective of this study was to determine the frequency of antibiotic resistance in A. baumannii and also to compare the efficacy of combined disk test and double disk synergy test for detection of metallo-beta-lactamases. A total of 112 A. baumannii were identified from various clinical samples and antibiotic susceptibility profile was determined by Kirby-Bauer Disk Diffusion method. Out of 112, 66 (58.9%) isolates were resistant to both imipenem and meropenem (OXOID). These resistant isolates were tested for carbapenemase production, and 55 (83.3%) were carbapenemase producers by Modified Hodge Test. These isolates were further tested for MBL production by combined disk test and double disk synergy test. Out of 66, 49 isolates were positive by both methods, CDT and DDST, and only one isolate was detected as negative (with kappa value = 0.038). All MBL producing strains showed remarkable resistance to cephalosporins, fluoroquinolones, aminoglycosides, and piperacillin/tazobactam (OXOID). The antibiotic resistance was very high in A. baumannii which were isolated from children in Pakistan specially attending a nephrology unit. PMID:27123345

  15. Phenotypic Detection of Metallo-Beta-Lactamases in Carbapenem Resistant Acinetobacter baumannii Isolated from Pediatric Patients in Pakistan

    PubMed Central

    Anwar, Muneeza; Ejaz, Hassan; Zafar, Aizza; Hamid, Hamdan

    2016-01-01

    Multidrug resistant A. baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections especially in neonates and immunocompromised patients because they have least capacity to fight against infections. Carbapenems are used as last resort antibiotics for treating these infections but currently resistance against carbapenems due to MBL production is on the rise. The objective of this study was to determine the frequency of antibiotic resistance in A. baumannii and also to compare the efficacy of combined disk test and double disk synergy test for detection of metallo-beta-lactamases. A total of 112 A. baumannii were identified from various clinical samples and antibiotic susceptibility profile was determined by Kirby-Bauer Disk Diffusion method. Out of 112, 66 (58.9%) isolates were resistant to both imipenem and meropenem (OXOID). These resistant isolates were tested for carbapenemase production, and 55 (83.3%) were carbapenemase producers by Modified Hodge Test. These isolates were further tested for MBL production by combined disk test and double disk synergy test. Out of 66, 49 isolates were positive by both methods, CDT and DDST, and only one isolate was detected as negative (with kappa value = 0.038). All MBL producing strains showed remarkable resistance to cephalosporins, fluoroquinolones, aminoglycosides, and piperacillin/tazobactam (OXOID). The antibiotic resistance was very high in A. baumannii which were isolated from children in Pakistan specially attending a nephrology unit. PMID:27123345

  16. Increasing prevalence of imipenem-resistant Pseudomonas aeruginosa and molecular typing of metallo-beta-lactamase producers in a Korean hospital.

    PubMed

    Kim, In-Suk; Lee, Nam Yong; Ki, Chang-Seok; Oh, Won Sup; Peck, Kyong Ran; Song, Jae-Hoon

    2005-01-01

    The types of metallo-beta-lactamases (MBLs), integrons, and genetic relatedness among Pseudomonas aeruginosa were investigated with a recent high prevalence of imipenem resistance in a Korean hospital. During 2000-2003, a total of 116 non-duplicate imipenem-resistant P. aeruginosa isolates were analyzed by PCR and DNA sequencing to detect of bla (IMP-1), bla (VIM-1), bla (VIM-2), bla (SPM-1), intI 1, intI 2, and intI 3 genes. Among them, MBL-producing isolates were evaluated for genetic relatedness using pulsed-field gel electrophoresis (PFGE) profiles. Of 116 isolates, 21 (18.1%) carried bla (VIM-2) gene with the intI 1 gene. Analysis of VIM-2 procuders by PFGE grouped 21 isolates into eight different clusters. Six of eight cluster I strains, all of four cluster II strains, and all of three cluster III strains were isolated in 2000, 2002, and 2003, respectively. Data concluded that P. aeruginosa carrying bla (VIM-2) with a class 1 integron was the only type among MBLs. A hospital outbreak by VIM-2 producers occurred annually, which could be at least a part of a recent high prevalence of imipenem resistance. PMID:16359195

  17. Prevalence and antibacterial resistance patterns of extended-spectrum beta-lactamase producing Gram-negative bacteria isolated from ocular infections

    PubMed Central

    Rameshkumar, G; Ramakrishnan, R; Shivkumar, C; Meenakshi, R; Anitha, V; Venugopal Reddy, Y C; Maneksha, V

    2016-01-01

    Purpose: Extended-spectrum beta-lactamases (ESBLs) mediated resistance is more prevalent worldwide, especially among Gram-negative bacterial isolates, conferring resistance to the expanded spectrum cephalosporins. As limited data were available on the prevalence of ESBLs in this area, the current study was undertaken to determine the prevalence, antibacterial resistance patterns, and molecular detection and characterization of ESBL encoding resistance genes among ocular Gram-negative bacterial isolates from ocular infections. Materials and Methods: A prospective study was done on 252 ocular Gram-negative bacterial isolates recovered from ocular infections during a study period from February 2011 to January 2014. All isolates were subjected to detection of ESBLs by cephalosporin/clavulanate combination disc test and their antibacterial resistance pattern was studied. Molecular detection and characterization of ESBL encoding blaTEM-, blaSHV, blaOXA-, and blaCTX-M (phylogenetic groups 1, 2, 9, and 8/25) resistance genes by multiplex polymerase chain reaction and DNA sequence analysis. Results: Of all Gram-negative bacteria, Pseudomonas aeruginosa (44%) was the most common strain, followed by Enterobacter agglomerans and Klebsiella pneumoniae each (10%). Among the 252, 42 (17%) were ESBL producers. The major source of ESBL producers were corneal scraping specimens, highest ESBL production was observed in P. aeruginosa 16 (38%) and Escherichia coli 7 (16.6%). Among ESBL-producing genes, the prevalence of blaTEM-gene was the highest (83%) followed by blaOXA-gene (35%), blaSHV-gene (18.5%), and blaCTX-M-1-gene (18.5%) alone or together. Conclusion: The higher rate of prevalence of ESBLs-encoding genes among ocular Gram-negative bacteria is of great concern, as it causes limitation to therapeutic options. This regional knowledge will help in guiding appropriate antibiotic use which is highly warranted. PMID:27221683

  18. Prevalence of Class 1 Integrons and Extended Spectrum Beta Lactamases among Multi-Drug Resistant Escherichia coli Isolates from North of Iran

    PubMed Central

    Mehdipour Moghaddam, Mohammad Javad; Mirbagheri, Adeleh Alsadat; Salehi, Zivar; Habibzade, Seyyed Mahmood

    2015-01-01

    Background: Extended spectrum beta lactamases (ESBLs) are an important cause of transferable multidrug resistance (MDR) in gram-negative bacteria. The most described ESBL genes are generally found within integron-like structures as mobile genetic elements. The aim of this study was to identify the accompanying of class 1 integrons and ESBLs in the MDR E. coli isolates. Methods: Susceptibility to antimicrobial agents was determined for 33 E. coli strains by the disk diffusion method. Double-disk synergy test was applied for screening ESBL. To identify the strains carrying integrons, the conserved regions of integron-encoded integrase gene intI1 were amplified. For detection of gene cassettes, 5′CS and 3′CS primers were used. Results: All E. coli isolates were identified as multi-drug resistant. More than 50% of the isolates were resistant to tetracycline, cephalothin, cefuroxime, amoxicillin-clavulanic acid, and third generation cephalosporines. Nearly all of the isolates displayed sensitivity to piperacillin. There was a significant correlation between production of ESBL and resistance to all antibiotics except for ciprofloxacin and piperacillin (P < 0.01). Thirty two MDR strains (97%) included class 1 integron, and some isolates that included integrons were similar in the size of gene cassettes. The isolates were different in the resistance profiles; however, some others had similar resistance profiles. Of eight ESBL positive isolates, seven (87.5%) carried class 1 integrons. Conclusion: Class 1 integrons were frequent in MDR and also ESBL-producing E. coli isolates. High prevalence of class 1 integrons confirms that integron-mediated antimicrobial gene cassettes are important in E. coli resistance profile. PMID:26220727

  19. Prevalence of multidrug resistant and extended spectrum beta-lactamase producing Pseudomonas aeruginosa in a tertiary care hospital

    PubMed Central

    Shaikh, Sibhghatulla; Fatima, Jamale; Shakil, Shazi; Danish Rizvi, Syed Mohd.; Kamal, Mohammad Amjad

    2014-01-01

    Resistance to broad-spectrum beta-lactams, mediated by extended-spectrum beta-lactamase enzymes (ESBL), is an increasing problem worldwide. The present study was undertaken to determine the incidence of ESBL-production among the clinical isolates of Pseudomonas aeruginosa and their susceptibility to selected antimicrobials. A total of one eighty-seven clinical specimens were tested for the presence of ESBL production using the double-disc synergy test. Of these, 25.13% (n = 47) isolates of P. aeruginosa were observed as ESBL positive. The maximum number of ESBL-producing strains were found in sputum (41.67%; n = 24) followed by pus (28.36%; n = 19), cerebrospinal fluid and other body fluids (21.74%; n = 5), urine (20.45%; n = 9) and blood (13.79%; n = 4). ESBL producing isolates exhibited co-resistance to an array of antibiotics tested. Imipenem and meropenem can be suggested as the drugs of choice in our study. PMID:25561885

  20. The Structural Bases of Antibiotic Resistance in the Clinically Derived Mutant beta-Lactamases TEM-30, TEM-32, and TEM-34

    SciTech Connect

    Wang, Xiaojun; Minasov, George; Shoichet, Brian K.

    2010-03-08

    Widespread use of {beta}-lactam antibiotics has promoted the evolution of {beta}-lactamase mutant enzymes that can hydrolyze ever newer classes of these drugs. Among the most pernicious mutants are the inhibitor-resistant TEM {beta}-lactamases (IRTs), which elude mechanism-based inhibitors, such as clavulanate. Despite much research on these IRTs, little is known about the structural bases of their action. This has made it difficult to understand how many of the resistance substitutions act as they often occur far from Ser-130. Here, three IRT structures, TEM-30 (R244S), TEM-32 (M69I/M182T), and TEM-34 (M69V), are determined by x-ray crystallography at 2.00, 1.61, and 1.52 {angstrom}, respectively. In TEM-30, the Arg-244 {yields} Ser substitution (7.8 {angstrom} from Ser-130) displaces a conserved water molecule that usually interacts with the {beta}-lactam C3 carboxylate. In TEM-32, the substitution Met-69 {yields} Ile (10 {angstrom} from Ser-130) appears to distort Ser-70, which in turn causes Ser-130 to adopt a new conformation, moving its O{gamma} further away, 2.3 {angstrom} from where the inhibitor would bind. This substitution also destabilizes the enzyme by 1.3 kcal/mol. The Met-182 {yields} Thr substitution (20 {angstrom} from Ser-130) has no effect on enzyme activity but rather restabilizes the enzyme by 2.9 kcal/mol. In TEM-34, the Met-69 {yields} Val substitution similarly leads to a conformational change in Ser-130, this time causing it to hydrogen bond with Lys-73 and Lys-234. This masks the lone pair electrons of Ser-130 O{gamma}, reducing its nucleophilicity for cross-linking. In these three structures, distant substitutions result in accommodations that converge on the same point of action, the local environment of Ser-130. TEM-1 {beta}-lactamase is the predominant source of resistance to {beta}-lactams, such as the penicillins. TEM-1 and related class A {beta}-lactamases confer resistance by hydrolyzing the {beta}-lactam ring of these antibiotics

  1. Resistance to cefepime and cefpirome due to a 4-amino-acid deletion in the chromosome-encoded AmpC beta-lactamase of a Serratia marcescens clinical isolate.

    PubMed

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-03-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The bla(AmpC) gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the bla(AmpC) gene from S. marcescens HD had a 12-nucleotide deletion compared to the bla(AmpC) gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the beta-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type beta-lactamases. PMID:14982755

  2. Isolation and characterization of a beta-lactamase-inhibitory protein from Streptomyces clavuligerus and cloning and analysis of the corresponding gene.

    PubMed Central

    Doran, J L; Leskiw, B K; Aippersbach, S; Jensen, S E

    1990-01-01

    Culture filtrates of Streptomyces clavuligerus contain a proteinaceous beta-lactamase inhibitor (BLIP) in addition to a variety of beta-lactam compounds. BLIP was first detected by its ability to inhibit Bactopenase, a penicillinase derived from Bacillus cereus, but it has also been shown to inhibit the plasmid pUC- and chromosomally mediated beta-lactamases of Escherichia coli. BLIP showed no inhibitory effect against Enterobacter cloacae beta-lactamase, and it also showed no activity against an alternative source of B. cereus penicillinase. BLIP was purified to homogeneity, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis gave a size estimate for BLIP of 16,900 to 18,000. The interaction between purified BLIP and the E. coli(pUC) beta-lactamase was investigated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and determined to be noncovalent, with an estimated 1:1 molar stoichiometry. The BLIP gene was isolated on a 13.5-kilobase fragment of S. clavuligerus chromosomal DNA which did not overlap a 40-kilobase region of DNA known to contain genes for beta-lactam antibiotic biosynthesis. The gene encoded a mature protein with a deduced amino acid sequence of 165 residues (calculated molecular weight of 17,523) and also encoded a 36-amino-acid signal sequence. No significant sequence similarity to BLIP was found by pairwise comparisons using various protein and nucleotide sequence data banks or by hybridization experiments, and no BLIP activity was detected in the culture supernatants of other Streptomyces spp. Images PMID:2203736

  3. [Investigation of the presence of New Delhi metallo-beta-lactamase-1 (NDM-1) by PCR in carbapenem-resistant gram-negative isolates].

    PubMed

    Yanık, Keramettin; Emir, Dilek; Eroğlu, Cafer; Karadağ, Adil; Güney, Akif Koray; Günaydın, Murat

    2013-04-01

    Bacteria producing New Delhi metallo-beta-lactamase-1 (NDM-1) exhibit high level resistance to beta-lactams including carbapenems. This broad-spectrum resistance limits treatment options for infections caused by NDM-1 producers. NDM-1 was first isolated from an Indian patient in Sweden; since then, NDM-1 producing isolates have been identified in many countries including Turkey. In this study, we investigated the presence of NDM-1 by PCR method in various gram-negative isolates recovered from clinical specimens in tertiary care hospitals in Samsun, Turkey. A total of 210 carbapenem-resistant gram-negative isolates (132 Acinetobacter baumannii, 54 Pseudomonas aeruginosa, 5 Pseudomonas putida, 8 Enterobacter cloacae, 3 Enterobacter aerogenes, 3 Klebsiella pneumoniae, 2 Providencia rettgeri, 2 Escherichia coli and 1 Citrobacter freundii) were included in the study. Identification and antibiotic susceptibility testing of the isolates were performed by using Vitek-2 Compact (bioMerieux, France) and BD Phoenix (BD Diagnostic Systems, MD) automated systems. The results of antibiotic susceptibility testing were interpreted according to the CLSI recommendations. In our study, NDM-1 gene was not detected in any of the clinical isolates by PCR. There was only one case study that reported the presence of NDM-1 in clinical isolates from Turkey [Poirel L et al. Antimicrob Agents Chemother 2012;56:2784]. Our data, together with the others, indicated that the existence of NDM-1 in clinical isolates is not common in Turkey. However, since NDM-1 is a plasmid-encoded enzyme, there is always a risk of spread of this resistance through the bacterial strains in our country. Therefore, continuous surveillance and investigation of carbapenem-resistant isolates with resistance patterns suggestive of NDM-1 may enable to identify NDM-1 producing isolates. Meanwhile special care should be given on rational antibiotic use and establishment of appropriate infection control policies to prevent

  4. The prevalence of extended-spectrum beta-lactamase in environmental isolates of Enterobacter.

    PubMed

    Sharma, Anjana; Dour, Prashant; Singh, Thakur Nirbhay

    2008-01-01

    The incidence of extended-spectrum beta-lactamase (ESBL)-producing strains and multidrug-resistant strains of Enterobacter spp. isolated from the 1312 km long river Narmada was investigated. Out of the 57 isolates of Enterobacter, 73.68% were found to be ESBL producers including the isolates of E. taylorae and isolates of E. agglomerans, which have been characterized for the first time. All the isolates were found susceptible to the antibiotic imipenem. AmpC gene was found in all the Enterobacter strains tested. AmpC beta-lactamase-producing bacterial pathogens may cause major therapeutic failure if not detected and reported in time. It was seen that these enzymes are mainly chromosomally mediated along with several non-AmpC beta-lactamase. PMID:18417885

  5. Carbapenem-resistant Pseudomonas aeruginosa strains from a Spanish hospital: characterization of metallo-beta-lactamases, porin OprD and integrons.

    PubMed

    Rojo-Bezares, Beatriz; Estepa, Vanesa; Cebollada, Rocío; de Toro, María; Somalo, Sergio; Seral, Cristina; Castillo, Francisco Javier; Torres, Carmen; Sáenz, Yolanda

    2014-05-01

    Molecular typing and mechanisms of carbapenem resistance such as alterations in porin OprD and presence of metallo-beta-lactamases (MBLs), as well as integrons have been studied in a collection of carbapenem-resistant Pseudomonas aeruginosa (CRPA) isolates from a Spanish hospital. One hundred and twenty-three CRPA isolates were recovered from different samples of 80 patients. Clonal relationship among CRPA was analyzed by SpeI-PFGE. Susceptibility testing to 11 antibiotics and MBL phenotype was determined by microdilution, IP/IPI E-test and double disc method. The oprD gene was studied by PCR and sequencing, and mutations were determined comparing with P. aeruginosa PAO1 sequence. Characterization of MBLs, and class 1 and 2 integrons were studied by PCR and sequencing. SDS-PAGE analysis of outer membrane proteins of selected strains was performed. Seventy-four-per-cent of patients with CRPA were hospitalised in the ICU setting and 50% had long hospitalization stays. Sixty-four different PFGE patterns were detected, and 87 CRPA strains were further analyzed. MBL phenotype was detected in 43 of 87 strains (49.4%), which contained blaVIM-2 gene inside class 1 integrons. VIM-2-producing strains belonged to lineages ST175, ST235, and ST973. A great diversity of nucleotide insertions, deletions, and mutations in oprD gene, and the presence of a new insertion sequence (ISPa45) truncating oprD were identified among CRPA strains. Class 1 integrons were detected in 75% of CRPA strains, blaVIM-2 and the new arrangement aac(3)-Ia+ISPa34+aadA1 (named as In661) being the most frequent gene-cassette arrays detected. Other gene cassettes detected in integrons were: aadB, aadA6, aadA7, aac(6')-Ib', and blaOXA-46. PMID:24594145

  6. Determinants of the activity of beta-lactamase inhibitor combinations.

    PubMed

    Livermore, D M

    1993-01-01

    Inhibitor combinations provide one strategy to overcome beta-lactamase-mediated resistance. Their success depends, obviously, on the inhibitor being able to bind and inactivate the beta-lactamase molecules. Clavulanate, sulbactam and tazobactam are irreversible inactivators of many beta-lactamases, forming covalent complexes which resist hydrolysis. 'Suicide' kinetics are seen with some, but not all, enzymes. All three compounds inactivate staphylococcal penicillinase, the chromosomal beta-lactamases of Proteus vulgaris and Bacteroides spp., and the Class IV beta-lactamases present in some klebsiellae. Tazobactam, but not the other compounds, has moderate activity against some Class I (AmpC) chromosomal beta-lactamases, notably that of Morganella morganii, but not that of Enterobacter cloacae. Both clavulanate and tazobactam are strong inhibitors of the widely distributed TEM and SHV plasmid-mediated beta-lactamases; sulbactam is a weaker inhibitor. Other factors, aside from the affinity of the inhibitor for the enzyme, co-determine the success or failure of inhibition. Potentiation is most readily achieved if little enzyme is produced, and if the organism is very permeable to the inhibitor. Thus, resistance to inhibitor combinations is rare in strains of Haemophilus influenzae and Neisseria gonorrhoeae that produce TEM-beta-lactamase, but is commoner in enterobacteria that produce this enzyme, since these are less permeable and sometimes manufacture very large amounts of enzyme. The partner beta-lactam agent is also important. Irrespective of the inhibitor used, piperacillin is easier to protect against TEM beta-lactamases and the M. morganii Class I enzyme than are ampicillin, amoxycillin or ticarcillin. This may relate to the lower affinity of piperacillin for these enzymes, or to its greater affinity for the bacterial penicillin-binding proteins. Finally, pH can affect the degree of inhibition achieved with sulphones for some beta-lactamases, notably TEM-1

  7. Effective treatment of cephalosporin-rifampin combinations against cryptic methicillin-resistant beta-lactamase-producing coagulase-negative staphylococcal experimental endocarditis.

    PubMed Central

    Brandt, C M; Rouse, M S; Tallan, B M; Laue, N W; Wilson, W R; Steckelberg, J M

    1995-01-01

    The efficacy of cefazolin or cefpirome alone or combined with rifampin was compared with that of vancomycin alone or combined with rifampin in an experimental model of methicillin-resistant, beta-lactamase-producing, coagulase-negative staphylococcal endocarditis. Phenotypically, the mecA gene-positive strain used in vivo did not exhibit methicillin resistance by the agar dilution or disk susceptibility method but was resistant in vitro (oxacillin MIC, 64 micrograms/ml) by the microtiter dilution method with 2% NaCl supplementation. Macrodilution broth susceptibilities of standard inocula failed to demonstrate cross-resistance of staphylococci to cefazolin (MIC, 8 micrograms/ml) or cefpirome (MIC, 4 micrograms/ml). In vivo, vancomycin and cefpirome had similar activities, and both regimens were more effective than was cefazolin alone. While the MIC of rifampin was low (0.031 micrograms/ml), monotherapy with rifampin resulted in a bimodal distribution of outcomes due to the expected emergence of resistant mutants. The results in vitro of time-kill synergy studies using rifampin in combination with cefazolin or cefpirome varied with the antimicrobial concentrations tested and did not reliably predict activities in vivo of rifampin-beta-lactam combination therapies. Cefpirome, but not cefazolin or vancomycin, in combination with rifampin was synergistic in vivo. Cefpirome in combination with rifampin was more effective than was cefazolin in combination with rifampin. Both cephalosporin-rifampin regimens were significantly more effective than was cephalosporin or vancomycin monotherapy and were as effective as vancomycin combined with rifampin. These data support further evaluation of rifampin-beta-lactam combinations as possible alternative therapies to vancomycin-containing regimens for selected methicillin-resistant coagulase-negative staphylococcal infections. PMID:7486924

  8. Sequence analysis and enzyme kinetics of the L2 serine beta-lactamase from Stenotrophomonas maltophilia.

    PubMed Central

    Walsh, T R; MacGowan, A P; Bennett, P M

    1997-01-01

    The L2 serine active-site beta-lactamase from Stenotrophomonas maltophilia has been classified as a clavulanic acid-sensitive cephalosporinase. The gene encoding this enzyme from S. maltophilia 1275 IID has been cloned on a 3.3-kb fragment into pK18 under the control of a Ptac promoter to generate recombinant plasmid pUB5840; when expressed in Escherichia coli, this gene confers resistance to cephalosporins and penicillins. Sequence analysis has revealed an open reading frame (ORF) of 909 bp with a GC content of 71.6%, comparable to that of the L1 metallo-beta-lactamase gene (68.4%) from the same bacterium. The ORF encodes an unmodified protein of 303 amino acids with a predicted molecular mass of 31.5 kDa, accommodating a putative leader peptide of 27 amino acids. Comparison of the amino acid sequence with those of other beta-lactamases showed it to be most closely related (54% identity) to the BLA-A beta-lactamase from Yersinia enterocolitica. Sequence identity is most obvious near the STXK active-site motif and the SDN loop motif common to all serine active-site penicillinases. Sequences outside the conserved regions display low homology with comparable regions of other class A penicillinases. Kinetics of the enzyme from the cloned gene demonstrated an increase in activity with cefotaxime but markedly less activity with imipenem than previously reported. Hence, the S. maltophilia L2 beta-lactamase is an inducible Ambler class A beta-lactamase which would account for the sensitivity to clavulanic acid. PMID:9210666

  9. PER-1 extended-spectrum beta-lactamase production in an Alcaligenes faecalis clinical isolate resistant to expanded-spectrum cephalosporins and monobactams from a hospital in Northern Italy.

    PubMed

    Pereira, M; Perilli, M; Mantengoli, E; Luzzaro, F; Toniolo, A; Rossolini, G M; Amicosante, G

    2000-01-01

    An Alicaligenes faecalis (FL-424/98) resistant to expanded-spectrum cephalosporins and aztreonam was isolated from the urine of an inpatient at the Intensive Care Unit of the Varese Hospital (Northern Italy) after antimicrobial chemotherapy with cefazolin, vancomycin, and amikacin. Clavulanic acid restored the activity of expanded-spectrum cephalosporins, suggesting the production of an extended-spectrum beta-lactamase (ESbetaL). A crude extract of FL-424/98 showed the presence of two beta-lactamase activities focusing at pH 5.3 and 7.6, respectively. The ESbetaL activity, purified by means of three chromatographic steps, was found to correspond to the pI 5.3 enzyme. Determination of kinetic parameters confirmed that the enzyme efficiently hydrolyzed expanded-spectrum cephalosporins and aztreonam. A colony-blot hybridization revealed the presence of blaPER-related sequences in FL-424/98, and sequencing confirmed the identity of this determinant with blaPER-1, previously detected in Pseudomonas aeruginosa, Acinetobacter, and Salmonella clinical isolates from Turkey. Finding of blaPER-1 in a species that can be part of the resident human microbiota raises the possibility that it could be an efficient shuttle for spreading of this resistance gene among other opportunistic pathogens that are normally members of the resident microbiota. Kinetic parameters determined for the PER-1 enzyme with some cephalosporin substrates were somewhat different from those previously reported. PMID:10868812

  10. Haemophilus influenzae with Non-Beta-Lactamase-Mediated Beta-Lactam Resistance: Easy To Find but Hard To Categorize

    PubMed Central

    Lia, Astrid; Hannisdal, Anja; Tveten, Yngvar; Matuschek, Erika; Kahlmeter, Gunnar; Kristiansen, Bjørn-Erik

    2015-01-01

    Haemophilus influenzae is a major pathogen, and beta-lactams are first-line drugs. Resistance due to altered penicillin-binding protein 3 (rPBP3) is frequent, and susceptibility testing of such strains is challenging. A collection of 154 beta-lactamase-negative isolates with a large proportion of rPBP3 (67.5%) was used to evaluate and compare Etest (Haemophilus test medium [HTM]) and disk diffusion (EUCAST method) for categorization of susceptibility to aminopenicillins and cefuroxime, using MICs generated with broth (HTM) microdilution and clinical breakpoints from CLSI and EUCAST as the gold standards. In addition, the proficiency of nine disks in screening for the rPBP3 genotype (N526K positive) was evaluated. By Etest, both essential and categorical agreement were generally poor (<70%), with high very major errors (VME) (CLSI, 13.0%; EUCAST, 34.3%) and falsely susceptible rates (FSR) (CLSI, 87.0%; EUCAST, 88.3%) for ampicillin. Ampicillin (2 μg) with adjusted (+2 mm) zone breakpoints was superior to Etest for categorization of susceptibility to ampicillin (agreement, 74.0%; VME, 11.0%; FSR, 28.3%). Conversely, Etest was superior to 30 μg cefuroxime for categorization of susceptibility to cefuroxime (agreement, 57.1% versus 60.4%; VME, 2.6% versus 9.7%; FSR, 7.1% versus 26.8%). Benzylpenicillin (1 unit) (EUCAST screening disk) and cefuroxime (5 μg) identified rPBP3 isolates with highest accuracies (95.5% and 92.2%, respectively). In conclusion, disk screening reliably detects rPBP3 H. influenzae, but false ampicillin susceptibility is frequent with routine methods. We suggest adding a comment recommending high-dose aminopenicillin therapy or the use of other agents for severe infections with screening-positive isolates that are susceptible to aminopenicillins by gradient or disk diffusion. PMID:26354813

  11. Haemophilus influenzae with Non-Beta-Lactamase-Mediated Beta-Lactam Resistance: Easy To Find but Hard To Categorize.

    PubMed

    Skaare, Dagfinn; Lia, Astrid; Hannisdal, Anja; Tveten, Yngvar; Matuschek, Erika; Kahlmeter, Gunnar; Kristiansen, Bjørn-Erik

    2015-11-01

    Haemophilus influenzae is a major pathogen, and beta-lactams are first-line drugs. Resistance due to altered penicillin-binding protein 3 (rPBP3) is frequent, and susceptibility testing of such strains is challenging. A collection of 154 beta-lactamase-negative isolates with a large proportion of rPBP3 (67.5%) was used to evaluate and compare Etest (Haemophilus test medium [HTM]) and disk diffusion (EUCAST method) for categorization of susceptibility to aminopenicillins and cefuroxime, using MICs generated with broth (HTM) microdilution and clinical breakpoints from CLSI and EUCAST as the gold standards. In addition, the proficiency of nine disks in screening for the rPBP3 genotype (N526K positive) was evaluated. By Etest, both essential and categorical agreement were generally poor (<70%), with high very major errors (VME) (CLSI, 13.0%; EUCAST, 34.3%) and falsely susceptible rates (FSR) (CLSI, 87.0%; EUCAST, 88.3%) for ampicillin. Ampicillin (2 μg) with adjusted (+2 mm) zone breakpoints was superior to Etest for categorization of susceptibility to ampicillin (agreement, 74.0%; VME, 11.0%; FSR, 28.3%). Conversely, Etest was superior to 30 μg cefuroxime for categorization of susceptibility to cefuroxime (agreement, 57.1% versus 60.4%; VME, 2.6% versus 9.7%; FSR, 7.1% versus 26.8%). Benzylpenicillin (1 unit) (EUCAST screening disk) and cefuroxime (5 μg) identified rPBP3 isolates with highest accuracies (95.5% and 92.2%, respectively). In conclusion, disk screening reliably detects rPBP3 H. influenzae, but false ampicillin susceptibility is frequent with routine methods. We suggest adding a comment recommending high-dose aminopenicillin therapy or the use of other agents for severe infections with screening-positive isolates that are susceptible to aminopenicillins by gradient or disk diffusion. PMID:26354813

  12. Characterization of the new metallo-beta-lactamase VIM-13 and its integron-borne gene from a Pseudomonas aeruginosa clinical isolate in Spain.

    PubMed

    Juan, Carlos; Beceiro, Alejandro; Gutiérrez, Olivia; Albertí, Sebastián; Garau, Margalida; Pérez, José L; Bou, Germán; Oliver, Antonio

    2008-10-01

    During a survey conducted to evaluate the incidence of class B carbapenemase (metallo-beta-lactamase [MBL])-producing Pseudomonas aeruginosa strains from hospitals in Majorca, Spain, five clinical isolates showed a positive Etest MBL screening test result. In one of them, strain PA-SL2, the presence of a new bla(VIM) derivative (bla(VIM-13)) was detected by PCR amplification with bla(VIM-1)-specific primers followed by sequencing. The bla(VIM-13)-producing isolate showed resistance to all beta-lactams (except aztreonam), gentamicin, tobramycin, and ciprofloxacin. VIM-13 exhibited 93% and 88% amino acid sequence identities with VIM-1 and VIM-2, respectively. bla(VIM-13) was cloned in parallel with bla(VIM-1), and the resistance profile conferred was analyzed both in Escherichia coli and in P. aeruginosa backgrounds. Compared to VIM-1, VIM-13 conferred slightly higher levels of resistance to piperacillin and lower levels of resistance to ceftazidime and cefepime. VIM-13 and VIM-1 were purified in parallel as well, and their kinetic parameters were compared. The k(cat)/K(m) ratios for the antibiotics mentioned above were in good agreement with the MIC data. Furthermore, EDTA inhibited the activity of VIM-13 approximately 25 times less than it inhibited the activity of VIM-1. VIM-13 was harbored in a class 1 integron, along with a new variant (Ala108Thr) of the aminoglycoside-modifying enzyme encoding gene aacA4, which confers resistance to gentamicin and tobramycin. Finally, the VIM-13 integron was apparently located in the chromosome, since transformation and conjugation experiments consistently yielded negative results and the bla(VIM-13) probe hybridized only with the genomic DNA. PMID:18644957

  13. The influence of Imipenem resistant metallo-beta-lactamase positive and negative Pseudomonas aeruginosa nosocomial infections on mortality and morbidity

    PubMed Central

    Babu, Kolhal Veerappa Yogeesha; Visweswaraiah, Divakara Siddanakatte; Kumar, Arun

    2014-01-01

    Background: Metallo-beta-lactamase (MBL) mediated resistance to carbapenems is an emerging threat in Pseudomonas aeruginosa (PA) nosocomial infections. Limited data on role of Imipenem resistant MBL positive PA (IR-MBLP-PA) and IR-MBL negative-PA (IR-MBLN-PA) infections on mortality and morbidity initiated the present study. Objectives: The aim of this study is to determine the role of IR-MBLP-PA and IR-MBLN-PA infections on mortality and morbidity. Materials and Methods: Prospective observational study of 1 year with 110 PA nosocomial infections was conducted with Imipenem + ethylene-diamine-tetra-acetic acid combined disc test for MBL detection. Role of IR-MBLP-PA and IR-MBLN-PA infections on the outcome and morbidity were assessed in terms of crude mortality rate, Charlson's comorbidity score and mean duration of stay in intensive care unit (ICU) until cure and until death, number of episodes of complications and underlying disease. Results were analyzed by z test for proportions and Student t-test. Results: Relatively high crude mortality was observed among IR-MBLP-PA infections than IR-MBLN-PA (42.86% [6/14] vs. 20% [2/10], Z = 0.69, P = 0.49 NS). Ventilator-associated pneumonia was the underlying disease and a confounding factor in all deaths due to IR-MBLP-PA infections. IR-MBLP-PA infections resulted in rapid downhill course to death with short mean duration of stay in ICU until death than IR-MBLN-PA infections (3.167 ± 0.98 days vs. 16 ± 2.82, P < 0.001 highly significant [HS]) with more number of complications (5.85 ± 1.65 vs. 3.7 ± 1.31, P < 0.001 HS). With the exception of previous Imipenem therapy, association of higher Charlson's comorbidity score, severe underlying diseases, multidrug and pandrug resistance and pre-disposing risk factors with IR-MBLP-PA infections was not statistically significant. Conclusions: Higher mortality in IR-MBLP-PA than in IR-MBLN-PA was not significant indicating IR as an important predictor of mortality than MBL

  14. Extended Spectrum Beta Lactamase producing Cephalosporin resistant Salmonella Typhi, reported from Rawalpindi, Pakistan.

    PubMed

    Munir, Tehmina; Lodhi, Munir; Ansari, Jawad Khaliq; Andleeb, Saadia; Ahmed, Mushtaq

    2016-08-01

    Typhoid is endemic in many parts of southeast Asia. Due to the resistance of the organism to first line of antibiotics (ampicillin, chloramphenicol, cotrimoxazole) as well as to fluoroquinolones, third generation cephalosporins have been in use for the empiric treatment of typhoid for years. However an increasing incidence of Salmonella Typhi is being reported sporadically from various regions. We report a case of typhoid due to Salmonella Typhi which was non-responsive to treatment with a cephalosporin, was found to be multidrug resistant and resistant to ciprofloxacin and third generation cephalosporin as well. The patient was finally treated successfully with intravenous administration of a carbapenem. PMID:27524545

  15. Spread of integron-associated VIM-type metallo-beta-lactamase genes among imipenem-nonsusceptible Pseudomonas aeruginosa strains in Greek hospitals.

    PubMed

    Giakkoupi, P; Petrikkos, G; Tzouvelekis, L S; Tsonas, S; Legakis, N J; Vatopoulos, A C

    2003-02-01

    Fifty-eight imipenem-nonsusceptible (MIC >or= 8 microg/ml) Pseudomonas aeruginosa strains isolated during May 2001 in 15 Greek hospitals were studied. Thirty-six isolates derived from nine hospitals carried VIM-type metallo-beta-lactamase genes, as found by PCR. In 34 isolates, bla(VIM) was associated with class 1 integrons of various sizes. DNA sequencing indicated the presence of bla(VIM-2) gene cassettes in a variety of integron structures. Random amplified polymorphic DNA typing suggested diversity of the bla(VIM)-positive strains. Synergy between 2-mercaptoacetic acid and imipenem indicated carbapenemase activity in 26 bla(VIM)-positive strains. PMID:12574292

  16. Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment

    PubMed Central

    Shaikh, Sibhghatulla; Fatima, Jamale; Shakil, Shazi; Rizvi, Syed Mohd. Danish; Kamal, Mohammad Amjad

    2014-01-01

    Antibiotic resistance is a problem of deep scientific concern both in hospital and community settings. Rapid detection in clinical laboratories is essential for the judicious recognition of antimicrobial resistant organisms. Production of extended-spectrum β-lactamases (ESBLs) is a significant resistance-mechanism that impedes the antimicrobial treatment of infections caused by Enterobacteriaceae and is a serious threat to the currently available antibiotic armory. ESBLs are classified into several groups according to their amino acid sequence homology. Proper infection control practices and barriers are essential to prevent spread and outbreaks of ESBL producing bacteria. As bacteria have developed different strategies to counter the effects of antibiotics, the identification of the resistance mechanism may help in the discovery and design of new antimicrobial agents. The carbapenems are widely regarded as the drugs of choice for the treatment of severe infections caused by ESBL-producing Enterobacteriaceae, although comparative clinical trials are scarce. Hence, more expeditious diagnostic testing of ESBL-producing bacteria and the feasible modification of guidelines for community-onset bacteremia associated with different infections are prescribed. PMID:25561890

  17. Beta-Lactamase Encoded Genes blaTEM and blaCTX Among Acinetobacter baumannii Species Isolated From Medical Devices of Intensive Care Units in Tehran Hospitals

    PubMed Central

    Khalilzadegan, Sara; Sade, Mojtaba; Godarzi, Hussein; Eslami, Gita; Hallajzade, Masoumeh; Fallah, Fatemeh; Yadegarnia, Davood

    2016-01-01

    Background Excessive consumption of antimicrobial materials in hospitals is considered as the main encoder leading to the emergence, development and acquisition of new bacterial resistance to beta-lactamase. Objectives Owing to the lack of proper information regarding the mechanism of the bacterial resistance to antibiotics and responsible genes in the country, the current study aimed to consider the resistance or sensitivity of the Acinetobacter baumannii multi drug resistant (MDR) isolates facing 2% glutaraldehyde. The study was conducted in the selected intensive care units in Tehran hospitals, Iran, in 2013. Materials and Methods In this study conducted over a period of 10 months, A. baumannii species were isolated by bacterial culture following biochemical tests from intensive care units (ICUs) of some hospitals in Tehran, Iran (Fayazbaksh, Taleghani, Imam Khomeini, Valiasr, Labafinejad). The resistance and sensitivity of the isolates to antibiotics were considered according to the clinical and laboratory standard institute CLSI (2012) guidelines. By multiplex PCR method, blaCTX and blaTEM genes were detected and finally, MDR strains were treated with 2% glutaraldehyde. PCR was used for each strain of MDR using specific primers. Results In the current study, 131 A. baumannii isolates (22.3%) out of 588 were studied. The level of resistance to various antibiotics was in the range of 69.4% to 100%. The frequencies of blaTEM and blaCTX genes were 3.2% and 19.4%, respectively. MIC50% and MIC90% of imipenem and meropenem antibiotics were 32 ± 1 µg/mL and 64 ± 1 µg/mL, respectively (P < 0.9). However no resistance to glutaraldehyde was observed. Different bands of MDR strains were observed in the PCR product by electrophoresis. Conclusions It seems that besides the variety and prevalence of blaTEM and blaCTX, enormous mechanisms such as porin and leaking systems (efflux pumps) are responsible for the information of the A. baumannii resistance to disinfectants

  18. Mosaic structure of p1658/97, a 125-kilobase plasmid harboring an active amplicon with the extended-spectrum beta-lactamase gene blaSHV-5.

    PubMed

    Zienkiewicz, M; Kern-Zdanowicz, I; Gołebiewski, M; Zyliñska, J; Mieczkowski, P; Gniadkowski, M; Bardowski, J; Cegłowski, P

    2007-04-01

    Escherichia coli isolates recovered from patients during a clonal outbreak in a Warsaw, Poland, hospital in 1997 produced different levels of an extended-spectrum beta-lactamase (ESBL) of the SHV type. The beta-lactamase hyperproduction correlated with the multiplication of ESBL gene copies within a plasmid. Here, we present the complete nucleotide sequence of plasmid p1658/97 carried by the isolates recovered during the outbreak. The plasmid is 125,491 bp and shows a mosaic structure in which all modules constituting the plasmid core are homologous to those found in plasmids F and R100 and are separated by segments of homology to other known regions (plasmid R64, Providencia rettgeri genomic island R391, Vibrio cholerae STX transposon, Klebsiella pneumoniae or E. coli chromosomes). Plasmid p1658/97 bears two replication systems, IncFII and IncFIB; we demonstrated that both are active in E. coli. The presence of an active partition system (sopABC locus) and two postsegregational killing systems (pemIK and hok/sok) indicates that the plasmid should be stably maintained in E. coli populations. The conjugative transfer is ensured by the operons of the tra and trb genes. We also demonstrate that the plasmidic segment undergoing amplification contains the blaSHV-5 gene and is homologous to a 7.9-kb fragment of the K. pneumoniae chromosome. The amplicon displays the structure of a composite transposon of type I. PMID:17220406

  19. AmpC-BETA Lactamases among Enterobacteriaceae Isolated at a Tertiary Hospital, South Western Uganda

    PubMed Central

    Nakaye, Martha; Bwanga, Freddie; Itabangi, Herbert; Stanley, Iramiot J.; Bashir, Mwambi; Bazira, Joel

    2015-01-01

    Aim To characterize AmpC-beta lactamases among Enterobacteriaceae isolates from clinical samples at Mbarara Regional Referral Hospital. Study Design Laboratory-based descriptive cross-sectional study Place and Duration of Study Microbiology Department, Mbarara Regional Referral Hospital and MBN clinical Laboratories, between May to September 2013. Methodology This study included 293 Enterobacteriaceae isolates recovered from clinical specimens that included blood, urine, stool and aspirates. AmpC Beta lactamase production was determined using disc placement method for cefoxitin at a break point of <18mm. Common AmpC plasmid mediated genes were EBC, ACC, FOX, DHA, CIT and MOX were; was determined by Multiplex PCR as described by Hanson and Perez-Perez. Results Plasmid mediated AmpC phenotype was confirmed in 107 of the 293 (36.5%) cefoxitin resistant isolates with 30 isolates having more than one gene coding for resistance. The commonest source that harbored AmpC beta lactamases was urine and E. coli was the most common AmpC producer (59.5%). The genotypes detected in this study, included EBC (n=36), FOX (n=18), ACC (n=11), CIT (n=10), DHA (n=07) and MOX (n=1). Conclusion Our findings showed that prevalence of AmpC beta-lactamase at MRRH was high (39.6), with EBC as the commonest genotype among Enterobacteriaceae Urine and E. coli were the commonest source and organism respectively that harbored AmpC beta-lactamases. There‘s rational antimicrobial therapy and antibiotic susceptibility tests should be requested by health workers especially patients presenting with urinary tract infections and bacteraemias. PMID:26078920

  20. Expression, purification, crystallization, and preliminary X-ray crystallographic analysis of OXA-17, an extended-spectrum {beta}-lactamase conferring severe antibiotic resistance

    SciTech Connect

    Lee, J. H. Sohn, S. G. Jung, H. I. An, Y. J. Lee, S. H.

    2013-07-15

    OXA-17, an extended-spectrum {beta}-lactamase (ESBL) conferring severe antibiotic resistance, hydrolytically inactivates {beta}-lactam antibiotics, inducing a lack of eradication of pathogenic bacteria by oxyimino {beta}-lactams and not helping hospital infection control. Thus, the enzyme is a potential target for developing antimicrobial agents against pathogens producing ESBLs. OXA-17 was purified and crystallized at 298 K. X-ray diffraction data from OXA-17 crystal have been collected to 1.85 A resolution using synchrotron radiation. The crystal of OXA-17 belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.37, b = 101.12, and c = 126.07 A. Analysis of the packing density shows that the asymmetric unit probably contains two molecules with a solvent content of 54.6%.

  1. X-ray structure of the Asn276Asp variant of the Escherichia coli TEM-1 beta-lactamase: direct observation of electrostatic modulation in resistance to inactivation by clavulanic acid.

    PubMed

    Swarén, P; Golemi, D; Cabantous, S; Bulychev, A; Maveyraud, L; Mobashery, S; Samama, J P

    1999-07-27

    The clinical use of beta-lactam antibiotics combined with beta-lactamase inactivators, such as clavulanate, has resulted in selection of beta-lactamases that are insensitive to inactivation by these molecules. Therefore, therapeutic combinations of an enzyme inactivator and a penicillin are harmless for bacteria harboring such an enzyme. The TEM beta-lactamase variants are the most frequently encountered enzymes of this type, and presently, 20 variants are designated as inhibitor-resistant TEM ("IRT") enzymes. Three mutations appear to account for the phenotype of the majority of IRT enzymes, one of them being the Asn276Asp substitution. In this study, we have characterized the kinetic properties of the inhibition process of the wild-type TEM-1 beta-lactamase and of its Asn276Asp variant with the three clinically used inactivators, clavulanic acid (clavulanate), sulbactam, and tazobactam, and we report the X-ray structure for the mutant variant at 2.3 A resolution. The changes in kinetic parameters for the interactions of the inhibitors with the wild-type and the mutant enzymes were more pronounced for clavulanate, and relatively inconsequential for sulbactam and tazobactam. The structure of the Asn276Asp mutant enzyme revealed a significant movement of Asp276 and the formation of a salt bridge of its side chain with the guanidinium group of Arg244, the counterion of the inhibitor carboxylate. A water molecule critical for the inactivation chemistry by clavulanate, which is observed in the wild-type enzyme structure, is not present in the crystal structure of the mutant variant. Such structural changes favor the turnover process over the inactivation chemistry for clavulanate, with profound phenotypic consequences. The report herein represents the best studied example of inhibitor-resistant beta-lactamases. PMID:10423234

  2. Study on imipenem resistance and prevalence of blaVIM1 and blaVIM2 metallo-beta lactamases among clinical isolates of Pseudomonas aeruginosa from Mashhad, Northeast of Iran

    PubMed Central

    Mirbagheri, Seyedeh Zohreh; Meshkat, Zahra; Naderinasab, Mahboubeh; Rostami, Sina; Nabavinia, Maryam Sadat; Rahmati, Mehdi

    2015-01-01

    Background and Objectives: The main cause of serious nosocomial infections is a Gram-negative pathogen known as Pseudomonas aeruginosa (P. aeruginosa). Carbapenems are widely used as an appropriate treatment for these infections, however resistance to these agents has been observed and is increasing. Metallo beta-lactamase (MBLs) enzyme is one of the main causes of resistance to carbapenem. In the current study the frequency and production of VIM1 and VIM2 by imipenem-resistant P. aeruginosa isolates of patients hospitalized in Imam Reza hospital were evaluated. Materials and Methods: In this study, 131 clinical samples were collected from patients hospitalized in Imam Reza hospital in Mashhad during a 15-month period from May 2011 to November 2012. After verification of P. aeruginosa isolates, antibiotic resistance patterns of isolates were determined for 14 antibiotics by Kirby-Bauer standard disk diffusion according to the CLSI guidelines. Combined-disk test was used for phenotypic determination of MBLs-producing isolates and after DNA extraction, genotypic determination of VIM1 and VIM2 metallo beta-lactamase genes was carried out using Multiplex-PCR. Results: Of 63 imipenem-resistant isolates (48.5%), 56 (88.8%) were MBL-producing in phenotypic assessments. Also amongst imipenem-resistant isolates, the frequency of VIM1 and VIM2 genes were 58.7 and 3.17%, respectively. Conclusion: The results of the current study along with the results of the other conducted studies in Iran in recent years demonstrate that the average resistance to imipenem in P. aeruginosa isolates was 51.3% which has increased in comparison with the results in 2006 (32.9%). It was also determined that the frequency of VIM1 gene was more than VIM2 gene. In phenotypic assessment by using CD method, 49.6% of isolates were determined as MBLs-producing. The sensitivity and specificity of this method were verified in comparison with the results of PCR test. PMID:26622967

  3. Genetic and biochemical characterization of TRU-1, the endogenous class C beta-lactamase from Aeromonas enteropelogenes.

    PubMed

    De Luca, Filomena; Giraud-Morin, Chantal; Rossolini, Gian Maria; Docquier, Jean-Denis; Fosse, Thierry

    2010-04-01

    Aeromonas enteropelogenes (formerly A. tructi) was described to be an ampicillin-susceptible and cephalothin-resistant Aeromonas species, which suggests the production of a cephalosporinase. Strain ATCC 49803 was susceptible to amoxicillin, cefotaxime, and imipenem but resistant to cefazolin (MICs of 2, 0.032, 0.125, and >256 microg/ml, respectively) and produced an inducible beta-lactamase. Cefotaxime-resistant mutants (MIC, 32 microg/ml) that showed constitutive beta-lactamase production could be selected in vitro. The gene coding for the cephalosporinase of A. enteropelogenes ATCC 49803 was cloned, and its biochemical properties were investigated. Escherichia coli transformants showing resistance to various beta-lactams carried a 3.5-kb plasmid insert whose sequence revealed a 1,146-bp open reading frame (ORF) encoding a class C beta-lactamase, named TRU-1, showing the highest identity scores with A. punctata CAV-1 (75%), A. salmonicida AmpC (75%), and A. hydrophila CepH (71%). The bla(TRU-1) locus includes open reading frames (ORFs) showing significant homology with genes found in the genomes of other Aeromonas species, although it exhibits a different organization, as reflected by the presence of additional ORFs located downstream of the beta-lactamase gene in the A. hydrophila and A. salmonicida genomes. Specific PCR assays were negative for cphA-like and bla(OXA-12)-like genes in three A. enteropelogenes ATCC strains. Purified TRU-1 showed a broad substrate profile, efficiently hydrolyzing benzylpenicillin, cephalothin, cefoxitin, and, although with significantly lower turnover rates, oxyiminocephalosporins. Cephaloridine and cefepime were poorly recognized by the enzyme, as reflected by the high K(m) values observed with these substrates. Thus far, A. enteropelogenes represents the only known example of an Aeromonas species that produces only one beta-lactamase belonging to molecular class C. PMID:20124004

  4. [Transfer of plasmid beta-lactamases in enterobacteria].

    PubMed

    Umaran, A; Garaizar, J; Gallego, L; Colom, K; Cisterna, R

    1989-04-01

    The aim of the present study was to determine which types of beta-lactamases codified by plasmids are transferred by conjugation from several species of enterobacteria. To this end, 352 strains of ampicillin-resistant enterobacteria from clinical samples from the Hospital Civil of Bilbao were evaluated. Their beta-lactamase activity and their capacity to transfer this capacity by conjugation were evaluated. The several types of plasmidic beta-lactamases in the strains that conjugated and in their respective transconjugants were characterized by analytic isoelectric approach, and also the sensitivity of these stains to 20 beta-lactamic antibiotics and the size of their plasmids. Twenty different types were detected, with a clear predominance of TEM 1. Type TEM 2 was found in 19% of the strains which conjugated, and much less commonly the types SHV 1, HMS 1 and a beta-lactamase of an approximate pl of 4.9 were found. The transfer of these beta-lactamases is mediated by a great variety of plasmids and is associated with variable levels of resistance to penicillins and unstable cephalosporins. The presence of betalactamases with activity on the more stable cephalosporins has not been detected. PMID:2490696

  5. Antimicrobial susceptibilities and beta-lactamase characterization of Capnocytophaga species.

    PubMed Central

    Roscoe, D L; Zemcov, S J; Thornber, D; Wise, R; Clarke, A M

    1992-01-01

    Capnocytophaga species have been associated with a wide variety of infections in both immunocompetent and immunocompromised patients. On the basis of data from antimicrobial susceptibility studies, beta-lactam antibiotics have been considered efficacious therapy. Six of 19 isolates from primarily clinical sources across Canada demonstrated beta-lactamase production, and agar dilution susceptibility testing showed broad resistance to beta-lactam antibiotics. For the beta-lactamase producing isolates, clavulanate reduced the MIC of amoxicillin for 90% of the strains tested by 64-fold. Isolates were highly susceptible to clindamycin, imipenem, and ciprofloxacin. Characterization of the beta-lactamases produced by two of these isolates (Van1 and Van2) was performed. Isoelectric focusing revealed an identical isoelectric point of 5.6 for both enzymes, but they had markedly different relative hydrolysis efficiencies, and different conditions were required to extract the enzymes. This study demonstrates the production of different types of beta-lactamases by Capnocytophaga spp. and suggests the need to screen all clinical isolates of Capnocytophaga spp. for the presence of beta-lactamases. PMID:1444299

  6. [Screening methods for detection of metallo-beta-lactamase producing gram negative rods].

    PubMed

    Mereuţă, Ana-Irina; Poiati, Antonia; Tuchiluş, Cristina; Dorneanu, Olivia; Nistor, Silvia; Copăcianu, Brînduşa

    2005-01-01

    Modified Hodge test and a method using a disk with imipenem plus 1000 mg of EDTA were used to determine the presence of metallo-beta-lactamase producing gram-negative rods among 166 clinical isolates from hospitals in Iaşi and Galaţi. Of 9 imipenem resistant strains found, only one Pseudomonas aeruginosa gave positive results with both tests and other two P. aeruginosa clinical isolates gave negative results with both tests. The rest of the strains (2 P. aeruginosa, 2 Acinetobacter baumanii, 1 Sphingomonas paucimobilis) did not give conclusive results. These screening methods are useful, simple and accessible to clinical laboratories. PCR is needed to confirm the presence of metallo-beta-lactamase gene in bacteria and to determine the type of the enzymes. PMID:16607806

  7. Transcriptional induction of Streptomyces cacaoi beta-lactamase by a beta-lactam compound.

    PubMed

    Forsman, M; Lindgren, L; Häggström, B; Jaurin, B

    1989-10-01

    The soil bacterium Streptomyces cacaoi produces an extracellular beta-lactamase. The beta-lactamase expression could be induced by the beta-lactam compound 6-amino penicillinoic acid (6-APA). In liquid cultures, a 50-fold increase in beta-lactamase expression was observed within the first three hours after addition of 6-APA. Using the cloned beta-lactamase gene as a probe, it was shown that this increase was mediated at the level of transcriptional initiation. The start point of the induced beta-lactamase transcript was determined, and the nucleotide sequence of the promoter region was analysed. No noticeable homology was found to control regions of inducible beta-lactamase genes of other bacteria. A striking feature was the presence of six direct repeats (ten base pairs each) upstream of the promoter region. Thus, an example of an inducible regulatory gene system in this Gram-positive microorganism is presented. Also, the primary structure of the beta-lactamase was deduced, showing a high degree of homology with class A beta-lactamases. PMID:2559297

  8. An altered zinc-binding site confers resistance to a covalent inactivator of New Delhi metallo-beta-lactamase-1 (NDM-1) discovered by high-throughput screening

    PubMed Central

    Thomas, Pei W.; Spicer, Timothy; Cammarata, Michael; Brodbelt, Jennifer S.; Hodder, Peter; Fast, Walter

    2013-01-01

    Due to the global threat of antibiotic resistance mediated by New Delhi metallo-beta-lactamase-1 (NDM-1) and the lack of structurally diverse inhibitors reported for this enzyme, we developed screening and counter-screening assays for manual and automated formats. The manual assay is a trans-well absorbance-based endpoint assay in 96-well plates and has a Z’ factor of 0.8. The automated assay is an epi-absorbance endpoint assay in 384-well plates, has a Z’ factor of ≥ 0.8, good signal / baseline ratios (> 3.8), and is likely scalable for high-throughput screening (HTS). A TEM-1-based counter-screen is also presented to eliminate false positives due to assay interference or off-target activities. A pilot screen of a pharmacologically characterized compound library identified two thiol-modifying compounds as authentic NDM-1 inhibitors: p-hloromecuribenzoate (p-CMB) and nitroprusside. Recombinant NDM-1 has one Cys residue that serves as a conserved active-site primary zinc ligand and is selectively modified by p-CMB as confirmed by LC-MS/MS. However a C208D mutation results in an enzyme that maintains almost full lactamase activity, yet is completely resistant to the inhibitor. These results predict that covalent targeting of the conserved active-site Cys residue may have drawbacks as a drug design strategy. PMID:23591260

  9. Suspected nosocomial infections with multi-drug resistant E. coli, including extended-spectrum beta-lactamase (ESBL)-producing strains, in an equine clinic.

    PubMed

    Walther, Birgit; Lübke-Becker, Antina; Stamm, Ivonne; Gehlen, Heidrun; Barton, Ann Kristin; Janssen, Traute; Wieler, Lothar H; Guenther, Sebastian

    2014-01-01

    Enterobacteriaceae such as Escherichia coli are common commensals as well as opportunistic and obligate pathogens. They cause a broad spectrum of infectious diseases in various hosts, including hospital-associated infections. In recent years, the rise of extended spectrum beta-lactamase (ESBL)-producing E. coli in companion animals (dogs, cats and horses) has been striking. However, reports on nosocomial infections are mostly anecdotic. Here we report on the suspected nosocomial spread of both ESBL-producing and non-ESBL-producing multi-drug resistant E. coli isolates in three equine patients within an equine clinic. Unlike easy-to-clean hospitalization opportunities available for small animal settings like boxes and cages made of ceramic floor tiles or stainless steel, clinical settings for horses are challenging environments for infection control programs due to unavoidable extraneous material including at least hay and materials used for horse bedding. The development of practice-orientated recommendations is needed to improve the possibilities for infection control to prevent nosocomial infections with multi-drug resistant and other transmissible pathogens in equine clinical settings. PMID:25872251

  10. Identification of a metagenomic gene cluster containing a new class A beta-lactamase and toxin-antitoxin systems.

    PubMed

    Vercammen, Ken; Garcia-Armisen, Tamara; Goeders, Nathalie; Van Melderen, Laurence; Bodilis, Josselin; Cornelis, Pierre

    2013-08-01

    Several reports mention the presence of antibiotic resistance genes in natural and polluted environments, but many studies are based on their detection via polymerase chain reaction (PCR amplification of known genes and not on an activity screening. We constructed a metagenomic fosmid bank from DNA isolated from a polluted river in Brussels, Belgium, the Zenne. A total of 120,000 clones were pooled and plated directly on solid media containing different antibiotics. Several clones were isolated which could grow in the presence of ampicillin. The DNA from several clones was extracted and subjected to restriction analysis and, based on their restriction pattern, two different clones were found. One of the clones was selected for further study as it showed a higher level of resistance to different β-lactams antibiotics (ticarcilline and ceftazidime). To find out which gene is responsible for the resistance, an in vitro transposon mutagenesis was performed and clones having lost the resistance phenotype were analyzed via inverse PCR amplification. Several clones had an insert in a gene encoding a new type of β-lactamase. The amplified fosmid DNA was fully sequenced revealing an insert of 41 kb containing 39 open reading frames (ORFs). Transposon insertions inactivating the resistance to β-lactams were also found in the ORF upstream of the blaA gene, encoding an aminotransferase, suggesting a polar effect on the transcription of the gene downstream. In addition, other genes were found such as histidine biosynthesis genes, which were found to be scattered on the insert, a relA/spoT gene, and genes belonging to type II toxin-antitoxin system. This predicted system was experimentally validated in Escherichia coli using an inducible expression system. PMID:23873667

  11. Identification of a metagenomic gene cluster containing a new class A beta-lactamase and toxin-antitoxin systems

    PubMed Central

    Vercammen, Ken; Garcia-Armisen, Tamara; Goeders, Nathalie; Melderen, Laurence; Bodilis, Josselin; Cornelis, Pierre

    2013-01-01

    Abstract Several reports mention the presence of antibiotic resistance genes in natural and polluted environments, but many studies are based on their detection via polymerase chain reaction (PCR amplification of known genes and not on an activity screening. We constructed a metagenomic fosmid bank from DNA isolated from a polluted river in Brussels, Belgium, the Zenne. A total of 120,000 clones were pooled and plated directly on solid media containing different antibiotics. Several clones were isolated which could grow in the presence of ampicillin. The DNA from several clones was extracted and subjected to restriction analysis and, based on their restriction pattern, two different clones were found. One of the clones was selected for further study as it showed a higher level of resistance to different β-lactams antibiotics (ticarcilline and ceftazidime). To find out which gene is responsible for the resistance, an in vitro transposon mutagenesis was performed and clones having lost the resistance phenotype were analyzed via inverse PCR amplification. Several clones had an insert in a gene encoding a new type of β-lactamase. The amplified fosmid DNA was fully sequenced revealing an insert of 41 kb containing 39 open reading frames (ORFs). Transposon insertions inactivating the resistance to β-lactams were also found in the ORF upstream of the blaA gene, encoding an aminotransferase, suggesting a polar effect on the transcription of the gene downstream. In addition, other genes were found such as histidine biosynthesis genes, which were found to be scattered on the insert, a relA/spoT gene, and genes belonging to type II toxin–antitoxin system. This predicted system was experimentally validated in Escherichia coli using an inducible expression system. PMID:23873667

  12. Validation of the VITEK2 and the Advance Expert System with a collection of Enterobacteriaceae harboring extended spectrum or inhibitor resistant beta-lactamases.

    PubMed

    Cantón, R; Pérez-Vázquez, M; Oliver, A; Coque, T M; Loza, E; Ponz, F; Baquero, F

    2001-01-01

    The susceptibility testing accuracy of the VITEK2 system and the ability of the Advance Expert System (AES) to provide interpretive readings were evaluated against 86 extended spectrum (ESBL) and 6 inhibitor-resistant-TEM (IRT) beta-lactamases producing Enterobacteriaceae clinical isolates. VITEK2 MICs of 12 beta-lactams were compared with those obtained by the standard NCCLS microdilution technique. The overall essential agreement ( +/- 1 log dilution) was 87.8%. Discrepancies were mainly observed with cefepime (30.3% of total number of discrepancies), ceftazidime (21.2%), and cefotaxime (15.1%). MIC discrepancies were slightly higher in CTX-M- (14.4%) than in TEM- (12.5%) or SHV- (11.9%) type ESBL producers and were rare in IRT producers (1.4%). Overall interpretive agreement was 92.5% and minor, major, and very major errors were 5.4%, 1.7%, and 2.1%, respectively. The AES was able to identify an ESBL phenotype in 85 out of 86 isolates (98.8%) and an IRT phenotype in all 6 isolates harboring these enzymes, thus reducing very major errors to 0.9%. The VITEK2 system, in conjunction with the AES software, is a reliable tool for detection of ESBL or IRT producing Enterobacteriaceae isolates. PMID:11687316

  13. Coexistence of Extended Spectrum Beta-Lactamases, AmpC Beta-Lactamases and Metallo-Beta-Lactamases in Acinetobacter baumannii from burns patients: a report from a tertiary care centre of India

    PubMed Central

    Gupta, V.; Garg, R.; Garg, S.; Chander, J.; Attri, A.K.

    2013-01-01

    Summary Multidrug-resistant Acinetobacter baumanii is a major pathogen encountered in pyogenic infections, especially from burns patients in hospital settings. Often there is also coexistence of multiple beta-lactamase enzymes responsible for beta-lactam resistance in a single isolate, which further complicates treatment options. We conducted a study on burn wound pus samples obtained from the burns unit of our hospital. Phenotypic tests were used to determine the Extended Spectrum Beta-Lactamase, AmpC Beta-Lactamase and Metallo-Beta-Lactamase producing status of the isolates. Almost half of the samples from the burn wounds yielded Acinetobacter baumanii as the predominant pathogen (54.05%). Coexistence of the three resistance mechanisms was seen in 25 of the 100 (25%) isolates of Acinetobacter baumanii. This study emphasizes the need for the detection of isolates that produce these enzymes to avoid therapeutic failures and nosocomial outbreaks. PMID:24799848

  14. Coexistence of Extended Spectrum Beta-Lactamases, AmpC Beta-Lactamases and Metallo-Beta-Lactamases in Acinetobacter baumannii from burns patients: a report from a tertiary care centre of India.

    PubMed

    Gupta, V; Garg, R; Garg, S; Chander, J; Attri, A K

    2013-12-31

    Multidrug-resistant Acinetobacter baumanii is a major pathogen encountered in pyogenic infections, especially from burns patients in hospital settings. Often there is also coexistence of multiple beta-lactamase enzymes responsible for beta-lactam resistance in a single isolate, which further complicates treatment options. We conducted a study on burn wound pus samples obtained from the burns unit of our hospital. Phenotypic tests were used to determine the Extended Spectrum Beta-Lactamase, AmpC Beta-Lactamase and Metallo-Beta-Lactamase producing status of the isolates. Almost half of the samples from the burn wounds yielded Acinetobacter baumanii as the predominant pathogen (54.05%). Coexistence of the three resistance mechanisms was seen in 25 of the 100 (25%) isolates of Acinetobacter baumanii. This study emphasizes the need for the detection of isolates that produce these enzymes to avoid therapeutic failures and nosocomial outbreaks. PMID:24799848

  15. Strategic Design of an Effective beta-Lactamase Inhibitor

    SciTech Connect

    Pattanaik, P.; Bethel, C; Hujer, A; Hujer, K; Distler, A; Taracila, M; Anderson, V; Fritsche, T; Jones, R; et. al.

    2009-01-01

    In an effort to devise strategies for overcoming bacterial beta-lactamases, we studied LN-1-255, a 6-alkylidene-2'-substituted penicillin sulfone inhibitor. By possessing a catecholic functionality that resembles a natural bacterial siderophore, LN-1-255 is unique among beta-lactamase inhibitors. LN-1-255 combined with piperacillin was more potent against Escherichia coli DH10B strains bearing bla(SHV) extended-spectrum and inhibitor-resistant beta-lactamases than an equivalent amount of tazobactam and piperacillin. In addition, LN-1-255 significantly enhanced the activity of ceftazidime and cefpirome against extended-spectrum cephalosporin and Sme-1 containing carbapenem-resistant clinical strains. LN-1-255 inhibited SHV-1 and SHV-2 beta-lactamases with nm affinity (K(I) = 110 +/- 10 and 100 +/- 10 nm, respectively). When LN-1-255 inactivated SHV beta-lactamases, a single intermediate was detected by mass spectrometry. The crystal structure of LN-1-255 in complex with SHV-1 was determined at 1.55A resolution. Interestingly, this novel inhibitor forms a bicyclic aromatic intermediate with its carbonyl oxygen pointing out of the oxyanion hole and forming hydrogen bonds with Lys-234 and Ser-130 in the active site. Electron density for the 'tail' of LN-1-255 is less ordered and modeled in two conformations. Both conformations have the LN-1-255 carboxyl group interacting with Arg-244, yet the remaining tails of the two conformations diverge. The observed presence of the bicyclic aromatic intermediate with its carbonyl oxygen positioned outside of the oxyanion hole provides a rationale for the stability of this inhibitory intermediate. The 2'-substituted penicillin sulfone, LN-1-255, is proving to be an important lead compound for novel beta-lactamase inhibitor design.

  16. Antimicrobial susceptibility patterns, beta-lactamases, and biochemical identification of Yokenella regensburgei strains.

    PubMed

    Stock, Ingo; Sherwood, Kimberley J; Wiedemann, Bernd

    2004-01-01

    Yokenella regensburgei is an opportunistic human pathogen that phenotypically resembles Hafnia alvei. The susceptibility of 10 Y. regensburgei strains to 75 antimicrobial agents was examined, applying a microdilution procedure in cation-adjusted Mueller-Hinton broth (CAMHB) and IsoSensitest broth (ISB). beta-Lactamases were characterized phenotypically with beta-lactamase activity and induction assays. Genotypically, PCR experiments applying degenerated primer pairs for the detection of AmpC beta-lactamase genes were performed. Examining the phenotypic properties of Yokenella and 76 H. alvei strains with commercial identification systems and conventional tests, a database for an accurate biochemical separation of Y. regensburgei from H. alvei was established. In CAMHB, all tested yokenellae were resistant or at least of intermediate susceptibility to penicillin G, oxacillin, amoxicillin, amoxicillin-clavulanate, cefaclor, cefazoline, loracarbef, cefoxitin, all tested macrolides, lincosamides, streptogramins, ketolides, fusidic acid, glycopeptides, linezolid, and rifampicin. All Yokenella strains were sensitive to several beta-lactams, all tested aminoglycosides, chloramphenicol, folate-pathway inhibitors, fosfomycin, nitrofurantion, quinolones, and tetracyclines. In ISB, the minimum inhibitory concentration (MIC) values of several beta-lactams were one to four MIC doubling dilution steps lower than those found in CAMHB (depending on the beta-lactam). All yokenellae yielded specific amplification products for ampC, and all of these strains expressed beta-lactamases that were strongly inducible. Hydroxyproline amidase, maltosidase, tri-peptidase, proline deaminase, catalase reaction, Voges-Proskauer test, and fermentation of glycerol, melibiose and myo-inositol were suitable parameters to separate Y. regensburgei from H. alvei. PMID:14761716

  17. [Identification of SHV-type extended spectrum beta-lactamase genes in Pseudomonas aeruginosa by PCR-restriction fragment length polymorphism and insertion site restriction-PCR].

    PubMed

    Kalai Blagui, S; Achour, W; Abdeladhim, A; Ben Hassen, A

    2009-07-01

    We propose a simple and rapid method to discriminate SHV-type extended spectrum beta-lactamase (ESBL) genes in P. aeruginosa based on PCR techniques (PCR-RFLP and RSI-PCR). We studied 22 producing ESBL P. aeruginosa strains isolated from seven immunocompromised patients (19 isolates) and from environmental swabs (three isolates) at the Bone Marrow Transplantation Center of Tunis. Screening PCR with primer pairs designed to detect gene encoding TEM, SHV, OXA group I, OXA group II, OXA-18 and PER-1 ESBL was positive for bla(OXA18) and bla(SHV) genes in all isolates. Pulsed field gel electrophoresis using SpeI endonuclease defined five genotypic groups. For at least one isolate corresponding to each genotype observed, restriction of PCR products by DdeI and BsrI revealed the same restriction pattern that the bla(SHV-1) negative control; in the same way, RSI-PCR products digestion by NruI, thus excluding 35, 238 and 240 mutations characterizing reported ESBL in P. aeruginosa (SHV-2a, SHV5 et SHV12), and suggesting that studied bla(SHV) genes were not ESBL ones. Genomic DNA hybridization by southern blot with probe consisting in bla(SHV-1) gene was positive in these isolates. Sequencing the full-length open reading frame revealed nucleotide sequence of the bla(SHV-1). PCR-RFLP and RSI-PCR results were then confirmed. This approach is effective for screening P. aeruginosa for ESBL genes carriage in epidemiological studies and for detecting new variants. PMID:18838231

  18. Use of microdilution panels with and without beta-lactamase inhibitors as a phenotypic test for beta-lactamase production among Escherichia coli, Klebsiella spp., Enterobacter spp., Citrobacter freundii, and Serratia marcescens.

    PubMed

    Thomson, K S; Sanders, C C; Moland, E S

    1999-06-01

    Over the past decade, a number of new beta-lactamases have appeared in clinical isolates of Enterobacteriaceae that, unlike their predecessors, do not confer beta-lactam resistance that is readily detected in routine antibiotic susceptibility tests. Because optimal methodologies are needed to detect these important new beta-lactamases, a study was designed to evaluate the ability of a panel of various beta-lactam antibiotics tested alone and in combination with beta-lactamase inhibitors to discriminate between the production of extended-spectrum beta-lactamases, AmpC beta-lactamases, high levels of K1 beta-lactamase, and other beta-lactamases in 141 isolates of Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Enterobacter aerogenes, Citrobacter freundii, and Serratia marcescens possessing well-characterized beta-lactamases. The microdilution panels studied contained aztreonam, cefpodoxime, ceftazidime, cefotaxime, and ceftriaxone, with and without 1, 2, and 4 microg of clavulanate per ml or 8 microg of sulbactam per ml and cefoxitin and cefotetan with and without 8 microg of sulbactam per ml. The results indicated that a minimum panel of five tests would provide maximum separation of extended-spectrum beta-lactamase high AmpC, high K1, and other beta-lactamase production in Enterobacteriaceae. These included cefpodoxime, cefpodoxime plus 4 microg of clavulanate per ml, ceftazidime, ceftriaxone, and ceftriaxone plus 8 microg of sulbactam per ml. Ceftriaxone plus 2 microg of clavulanate per ml could be substituted for cefpodoxime plus 4 microg of clavulanate per ml without altering the accuracy of the tests. This study indicated that tests with key beta-lactam drugs, alone and in combination with beta-lactamase inhibitors, could provide a convenient approach to the detection of a variety of beta-lactamases in members of the family Enterobacteriaceae. PMID:10348759

  19. Molecular and biochemical characterization of the chromosome-encoded class A beta-lactamase BCL-1 from Bacillus clausii.

    PubMed

    Girlich, Delphine; Leclercq, Roland; Naas, Thierry; Nordmann, Patrice

    2007-11-01

    A chromosomal beta-lactamase gene from Bacillus clausii NR, which is used as a probiotic, was cloned and expressed in Escherichia coli. It encodes a clavulanic acid-susceptible Ambler class A beta-lactamase, BCL-1, with a pI of 5.5 and a molecular mass of ca. 32 kDa. It shares 91% and 62% amino acid identity with the chromosomally encoded PenP penicillinases from B. clausii KSM-K16 and Bacillus licheniformis, respectively. The hydrolytic profile of this beta-lactamase includes penicillins, narrow-spectrum cephalosporins, and cefpirome. This chromosome-encoded enzyme was inducible in B. clausii, and its gene is likely related to upstream-located regulatory genes that share significant identity with those reported to be upstream of the penicillinase gene of B. licheniformis. The bla(BCL-1) gene was located next to the known chromosomal aadD2 gene and the erm34 gene, which encode resistance to aminoglycosides and macrolides, respectively. Similar genes were found in a collection of B. clausii reference strains. PMID:17846134

  20. Characterization of extended-spectrum beta-lactamases and antimicrobial resistance of Klebsiella pneumoniae in intra-abdominal infection isolates in Latin America, 2008-2012. Results of the Study for Monitoring Antimicrobial Resistance Trends.

    PubMed

    Kazmierczak, Krystyna M; Lob, Sibylle H; Hoban, Daryl J; Hackel, Meredith A; Badal, Robert E; Bouchillon, Samuel K

    2015-07-01

    The Study for Monitoring Antimicrobial Resistance Trends has monitored the in vitro activity of several recommended antimicrobials used in the management of intra-abdominal infections (IAIs) globally since 2002. In this report, we document the changing susceptibility patterns to recommended antimicrobials in Klebsiella pneumoniae isolates from patients with IAIs in 11 Latin American countries between 2008 and 2012 and describe the beta-lactamases encoded by phenotypically extended-spectrum beta-lactamase (ESBL)-positive and ertapenem-nonsusceptible isolates. Overall, the incidence of phenotypically ESBL-positive K. pneumoniae did not change significantly from 2008 (40.4%) to 2012 (41.2%) (P > 0.05). However, trend analysis documented an increase in isolates encoding K. pneumoniae carbapenemase (KPC) or both KPC and an ESBL. Decreasing susceptibility (P < 0.05) was noted for cefepime, ceftazidime, ceftriaxone, ertapenem, and imipenem among all K. pneumoniae, as well as for cefepime, cefotaxime, cefoxitin, ceftriaxone, ertapenem, and imipenem among ESBL-positive isolates, while susceptibility of ESBL-negative isolates to ampicillin-sulbactam actually increased (P < 0.05). PMID:25956930

  1. Cloning and sequence analysis of a class A beta-lactamase from Mycobacterium tuberculosis H37Ra.

    PubMed Central

    Hackbarth, C J; Unsal, I; Chambers, H F

    1997-01-01

    A cosmid library from Mycobacterium tuberculosis H37Ra was introduced into Mycobacterium smegmatis, and eight recombinant clones with increased resistance to cefoxitin were identified. Isoelectric focusing detected an M. tuberculosis-derived beta-lactamase in one of these recombinant clones. A sequence analysis identified it as a class A beta-lactamase whose expression correlated with the increased resistance phenotype. PMID:9145897

  2. Beta-lactamase inhibitors from laboratory to clinic.

    PubMed Central

    Bush, K

    1988-01-01

    beta-Lactamases constitute the major defense mechanism of pathogenic bacteria against beta-lactam antibiotics. When the beta-lactam ring of this antibiotic class is hydrolyzed, antimicrobial activity is destroyed. Although beta-lactamases have been identified with clinical failures for over 40 years, enzymes with various abilities to hydrolyze specific penicillins or cephalosporins are appearing more frequently in clinical isolates. One approach to counteracting this resistance mechanism has been through the development of beta-lactamase inactivators. beta-Lactamase inhibitors include clavulanic acid and sulbactam, molecules with minimal antibiotic activity. However, when combined with safe and efficacious penicillins or cephalosporins, these inhibitors can serve to protect the familiar beta-lactam antibiotics from hydrolysis by penicillinases or broad-spectrum beta-lactamases. Both of these molecules eventually inactivate the target enzymes permanently. Although clavulanic acid exhibits more potent inhibitory activity than sulbactam, especially against the TEM-type broad-spectrum beta-lactamases, the spectrum of inhibitory activities are very similar. Neither of these inhibitors acts as a good inhibitor of the cephalosporinases. Clavulanic acid has been most frequently combined with amoxicillin in the orally active Augmentin and with ticarcillin in the parenteral beta-lactam combination Timentin. Sulbactam has been used primarily to protect ampicillin from enzymatic hydrolysis. Sulbactam has been used either in the orally absorbed prodrug form as sultamicillin or as the injectable combination ampicillin-sulbactam. Synergy has been demonstrated for these combinations for most members of the Enterobacteriaceae, although those organisms that produce cephalosporinases are not well inhibited. Synergy has also been observed for Neisseria gonorrhoeae, Haemophilus influenzae, penicillinase-producing Staphylococcus aureus, and anaerobic organisms. These antibiotic

  3. Antimicrobial resistance among producers and non-producers of extended spectrum beta-lactamases in urinary isolates at a tertiary Hospital in Tanzania

    PubMed Central

    2010-01-01

    Background Published data on the existence and magnitude of extended spectrum beta-lactamase (ESBL) production in urinary pathogens in local setting is limited. The aim of the present study was to determine the prevalence of antimicrobial resistance and ESBL production among Escherichia coli and Klebsiella spp from urine samples in a tertiary hospital. This was a cross sectional study conducted at Muhimbili National Hospital in Dar es Salaam, Tanzania. Findings A total of 270 E.coli and Klebsiella spp urinary pathogens from children and adults isolated from January to March 2010 were included in the study. E. coli and Klebsiella spp isolates were tested for antimicrobial susceptibility by the Clinical and Laboratory Standard Institute's disc diffusion method. These isolates were further screened for ESBL phenotype using cefotaxime and ceftazidime discs. Isolates with reduced sensitivity were confirmed using ESBL E-test strips. Of 270 isolates, 138 (51.1%) were E. coli and 132 (48.9%) were Klebsiella spp. ESBL was detected in 122 (45.2%) of all the isolates. ESBL- producing E. coli strains were significantly more resistance to cotrimoxazole (90.7%), ciprofloxacin (46.3%) and nalidixic acid (61.6%) than strains that did not produce ESBL (p < 0.05). Similarly, ESBL- producing Klebsiella spp strains were significantly more resistance to cotrimoxazole (92.6%), ciprofloxacin (25.0%), nalidixic acid (66.2%), and gentamicin (38.2%) than strains that did not produce ESBL (P < 0.05). Multi-drug resistance was found to be significantly (P < 0.05) more in ESBL producing isolates (90.5%) than non ESBL producers (68.9%). The occurrence of ESBL was significantly higher among isolates from inpatients than outpatients [95 (50.5%) vs. 27(32.9%)] (p = 0.008). The occurrence of ESBL was significantly higher among isolates from children than in adults [84 (54.9%) vs. 38(32.5%)] (p < 0.001). Conclusions High prevalence of ESBL-producing E. coli and Klebsiella spp strains was found among

  4. Crystallographic Studies of Two Bacterial AntibioticResistance Enzymes: Aminoglycoside Phosphotransferase (2')-Ic and GES-1\\beta-lactamase

    SciTech Connect

    Brynes, Laura; /Rensselaer Poly.

    2007-10-31

    Guiana Extended-Spectrum-1 (GES-1) and Aminoglycoside phosphotransferase (2')-Ic (APH(2')-Ic) are two bacteria-produced enzymes that essentially perform the same task: they provide resistance to an array of antibiotics. Both enzymes are part of a growing resistance problem in the medical world. In order to overcome the ever-growing arsenal of antibiotic-resistance enzymes, it is necessary to understand the molecular basis of their action. Accurate structures of these proteins have become an invaluable tool to do this. Using protein crystallography techniques and X-ray diffraction, the protein structure of GES-1 bound to imipenem (an inhibitor) has been solved. Also, APH(2')-Ic has been successfully crystallized, but its structure was unable to be solved using molecular replacement using APH(2')-Ib as a search model. The structure of GES-1, with bound imipenem was solved to a resolution of 1.89A, and though the inhibitor is bound with only moderate occupancy, the structure shows crucial interactions inside the active site that render the enzyme unable to complete the hydrolysis of the {beta}-lactam ring. The APH(2')-Ic dataset could not be matched to the model, APH(2')-Ib, with which it shares 25% sequence identity. The structural information gained from GES-1, and future studies using isomorphous replacement to solve the APH(2')-Ic structure can aid directly to the creation of novel drugs to combat both of these classes of resistance enzymes.

  5. Multidrug-Resistant and Extended Spectrum Beta-Lactamase-Producing Escherichia coli in Dutch Surface Water and Wastewater

    PubMed Central

    Blaak, Hetty; Lynch, Gretta; Italiaander, Ronald; Hamidjaja, Raditijo A.; Schets, Franciska M.; de Roda Husman, Ana Maria

    2015-01-01

    Objective The goal of the current study was to gain insight into the prevalence and concentrations of antimicrobial resistant (AMR) Escherichia coli in Dutch surface water, and to explore the role of wastewater as AMR contamination source. Methods The prevalence of AMR E. coli was determined in 113 surface water samples obtained from 30 different water bodies, and in 33 wastewater samples obtained at five health care institutions (HCIs), seven municipal wastewater treatment plants (mWWTPs), and an airport WWTP. Overall, 846 surface water and 313 wastewater E. coli isolates were analysed with respect to susceptibility to eight antimicrobials (representing seven different classes): ampicillin, cefotaxime, tetracycline, ciprofloxacin, streptomycin, sulfamethoxazole, trimethoprim, and chloramphenicol. Results Among surface water isolates, 26% were resistant to at least one class of antimicrobials, and 11% were multidrug-resistant (MDR). In wastewater, the proportions of AMR/MDR E. coli were 76%/62% at HCIs, 69%/19% at the airport WWTP, and 37%/27% and 31%/20% in mWWTP influents and effluents, respectively. Median concentrations of MDR E. coli were 2.2×102, 4.0×104, 1.8×107, and 4.1×107 cfu/l in surface water, WWTP effluents, WWTP influents and HCI wastewater, respectively. The different resistance types occurred with similar frequencies among E. coli from surface water and E. coli from municipal wastewater. By contrast, among E. coli from HCI wastewater, resistance to cefotaxime and resistance to ciprofloxacin were significantly overrepresented compared to E. coli from municipal wastewater and surface water. Most cefotaxime-resistant E. coliisolates produced ESBL. In two of the mWWTP, ESBL-producing variants were detected that were identical with respect to phylogenetic group, sequence type, AMR-profile, and ESBL-genotype to variants from HCI wastewater discharged onto the same sewer and sampled on the same day (A1/ST23/CTX-M-1, B23/ST131/CTX-M-15, D2/ST405/CTX

  6. Antimicrobial resistance status and prevalence rates of extended spectrum beta-lactamase producers isolated from a mixed human population

    PubMed Central

    Afunwa, Ruth A.; Odimegwu, Damian C.; Iroha, Romanus I.; Esimone, Charles O.

    2011-01-01

    Owing to the increasing epidemiological and therapeutic challenges associated with infections due to ESBL producers, ESBL prevalence rate among some bacteria isolates from healthy and non-healthy human population in a metropolitan Nigerian setting was evaluated. A total of one hundred and forty-five (145) bacteria strains were isolated from a total of four hundred and sixty (460) samples collected from urine, wound, throat and anal swabs of 220 healthy volunteers in the community and from 240 patients in 2 secondary and 2 tertiary hospitals (altogether, 4) in Enugu metropolis. The presumptive confirmatory test used for ESBL detection was the Double Disc Synergy Test (DDST) method. Conjugation and plasmid curing studies were also done for resistance factor determination. Of the 145 isolates, 20 were ESBL producers with 35% of these ESBL producers being of community origin and 65% from hospitals. This translates to 4.8% and 9% incidences (comparably higher than established prevalence of 4.4% and 7.5 respectively) for community and hospital infections respectively. The ESBL isolates showed high resistance to tetracycline, gentamicin, pefloxacin, ceftriaxone, cefuroxime, ciprofloxacin and Augmentin® (Amoxicilin and clavulanic acid combination). Conjugation studies for Resistance plasmid transfer showed non-transference of resistance determinants between the ESBL transconjugants and recipient strains. Correspondingly, the plasmid curing studies revealed that the acridine orange could not effect a cure on the isolates as they still retained high resistance to the antibiotics after the treatment. This study confirms the growing incidences/pool of ESBL strains in Nigeria and call for widespread and continuous monitoring towards an effective management of the potential therapeutic hurdle posed by this trend. PMID:21619555

  7. Beta-Lactamase Producing Escherichia coli Isolates in Imported and Locally Produced Chicken Meat from Ghana

    PubMed Central

    Rasmussen, Mette Marie; Opintan, Japheth A.; Frimodt-Møller, Niels; Styrishave, Bjarne

    2015-01-01

    The use of antibiotics in food animals is of public health concern, because resistant zoonotic pathogens can be transmitted to humans. Furthermore, global trade with food may rapidly spread multi-resistant pathogens between countries and even continents. The purpose of the study was to investigate whether imported chicken meat and meat from locally reared chicken are potential sources for human exposure to multi resistant Escherichia coli isolates. 188 samples from imported and locally produced chicken meat were sampled and analyzed. 153 bacteria isolates were successfully cultured and identified as E. coli using MALDI-ToF. Of these 109 isolates were from meat whereas the remaining 44 were isolated from the cloaca of locally reared live chickens. Antimicrobial susceptibility test was done on the identified E. coli isolates. Additionally, beta-lactamases production (ESBL and/or AmpC) were phenotypically confirmed on all isolates showing resistance to cefpodoxime. Beta-lactamase producing (BLP) E. coli meat isolates were further genotyped. Antimicrobial resistance to four antibiotic markers with highest resistance was detected more frequently in isolates from local chickens compared to imported chickens (tetracycline 88.9% vs. 57.5%, sulphonamide 75.0% vs. 46.6%, ampicillin 69.4% vs. 61.6% and trimethoprim 66.7% vs. 38.4%). Beta-lactamase production was found in 29 E. coli meat isolates, with 56.9% of them being multiple drug resistant (≥ 3). The predominant phylogroup identified was B1 followed by A and D, with similar distribution among the isolates from meat of locally reared chickens and imported chickens. Beta-lactamase producing genotype blaCTX-M-15 (50%; 10/20) was the most frequently drug resistant gene detected. More BLP E. coli isolates were found in imported chicken meat compared to locally reared chickens, demonstrating that these isolates may be spreading through food trade. In conclusion, both imported and locally produced chicken meats are potential

  8. Heat resistance in extended-spectrum beta-lactamase-producing Escherichia coli may favor environmental survival in a hospital setting.

    PubMed

    Boll, Erik J; Frimodt-Møller, Jakob; Olesen, Bente; Krogfelt, Karen A; Struve, Carsten

    2016-06-01

    Nosocomial infections caused by extended-spectrum β-lactamase (ESBL)-producing Escherichia coli are a major concern worldwide. There is an urgent need to identify bacterial factors promoting survival and persistence of these organisms in the nosocomial environment. Here, we describe the presence of a gene cluster, containing the Clp ATPase ClpK, within a collection of Danish ESBL-producing E. coli isolates. The cluster conferred thermoprotection upon the isolates, and thus might facilitate survival on medical devices exposed to semi-high temperatures in a hospital setting. PMID:26946311

  9. Beta-lactamase Escherichia coli and Staphylococcus aureus isolated from chickens in Nigeria.

    PubMed

    Mamza, Sunday Akidarju; Egwu, Godwin Onyemaechi; Mshelia, Gideon Dauda

    2010-01-01

    The occurrence of beta-lactamase-producing Escherichia coli and Staphylococcus aureus in chickens was investigated. Specimens (n = 1,300) were collected from 400 chickens and were streaked on MacConkey agar plates. From each plate, presumptive growths of organisms were picked and streaked on eosin methylene blue and Baird-Parker agars, respectively. Typical colonies of E. coli and S. aureus with similar morphologies were identified by biochemical tests. Isolates were tested for beta-lactamase production and antimicrobial susceptibilities. Results indicated that 805 E. coli isolates from which 89 (11%) were beta-lactamase-positive and 660 S. aureus from which 58 (8.8%) were beta-lactamase-positive. Both isolates showed a high level of resistance to all twelve antibiotics screened. The increased prevalence of antibiotic resistance amongst bacterial organisms is undoubtedly correlated with the discovery and characterisation of multiple, transferrable resistance determinants, such as beta-lactamases, corresponding to their respective phenotypes. The implications of this for humans when handling and/or consuming chickens and chicken products contaminated with strains of such isolates, is a risk of transferrable multi-drug resistance and a failure of treatment. The results of our study indicated that beta-lactamase-producing E. coli and S. aureus are prevalent in chickens in Nigeria. PMID:20560125

  10. Non-inducible, mainly cell-associated beta-lactamase from Nocardia asteroides strain 108.

    PubMed

    Scopetti, F; Fattorini, L; Franceschini, N; Amicosante, G; Orefici, G

    1997-07-01

    The beta-lactamase of the soil-borne strain 108 (parental strain) of Nocardia asteroides is a non-inducible enzyme mainly associated with the cells; it can be efficiently extracted by ultrasonication and SDS treatment. Crude enzyme preparations showed penicillinase and cephalosporinase activity. The kinetics of beta-lactamase production and in-vitro susceptibility to combinations of beta-lactam antibiotics plus beta-lactamase inhibitors have been studied in two stable overproducer mutants (A14 and B1) obtained by mutagenization of the parental strain with nitrosoguanidine. The cell-associated enzyme increased with bacterial growth in parental and mutant strains and was particularly abundant in stationary phase cells. The beta-lactamase inhibitors sulbactam and clavulanic acid decreased MIC values of penicillins more efficiently in the parental strain than in mutants, thus indicating some involvement of the enzyme in the resistance of N. asteroides strain 108 to beta-lactam antibiotics. PMID:9249198

  11. Characterization of SFO-1, a plasmid-mediated inducible class A beta-lactamase from Enterobacter cloacae.

    PubMed

    Matsumoto, Y; Inoue, M

    1999-02-01

    Enterobacter cloacae 8009 produced an inducible class A beta-lactamase which hydrolyzed cefotaxime efficiently. It also hydrolyzed other beta-lactams except cephamycins and carbapenems. The activity was inhibited by clavulanic acid and imipenem. The bla gene was transferable to Escherichia coli by electroporation of plasmid DNA. The molecular mass of the beta-lactamase was 29 kDa and its pI was 7.3. All of these phenotypic characteristics of the enzyme except for inducible production resemble those of some extended-spectrum class A beta-lactamases like FEC-1. The gene encoding this beta-lactamase was cloned and sequenced. The deduced amino acid sequence of the beta-lactamase was homologous to the AmpA sequences of the Serratia fonticola chromosomal enzyme (96%), MEN-1 (78%), Klebsiella oxytoca chromosomal enzymes (77%), TOHO-1 (75%), and FEC-1 (72%). The conserved sequences of class A beta-lactamases, including the S-X(T)-X(S)-K motif, in the active site were all conserved in this enzyme. On the basis of the high degree of homology to the beta-lactamase of S. fonticola, the enzyme was named SFO-1. The ampR gene was located upstream of the ampA gene, and the AmpR sequence of SFO-1 had homology with the AmpR sequences of the chromosomal beta-lactamases from Citrobacter diversus (80%), Proteus vulgaris (68%), and Pseudomonas aeruginosa (60%). SFO-1 was also inducible in E. coli. However, a transformant harboring plasmid without intact ampR produced a small amount of beta-lactamase constitutively, suggesting that AmpR works as an activator of ampA of SFO-1. This is the first report from Japan describing an inducible plasmid-mediated class A beta-lactamase in gram-negative bacteria. PMID:9925524

  12. Beta-lactamase targeted enzyme activatable photosensitizers for antimicrobial PDT

    NASA Astrophysics Data System (ADS)

    Zheng, Xiang; Verma, Sarika; Sallum, Ulysses W.; Hasan, Tayyaba

    2009-06-01

    Photodynamic therapy (PDT) as a treatment modality for infectious disease has shown promise. However, most of the antimicrobial photosensitizers (PS) non-preferentially accumulate in both bacteria and host tissues, causing host tissue phototoxicity during treatment. We have developed a new antimicrobial PDT strategy which exploits beta-lactam resistance mechanism, one of the major drug-resistance bacteria evolved, to achieve enhanced target specificity with limited host damage. Our strategy comprises a prodrug construct with a PS and a quencher linked by beta-lactam ring, resulting in a diminished phototoxicity. This construct, beta-lactamase enzyme-activated-photosensitizer (beta-LEAP), can only be activated in the presence of both light and bacteria, and remains inactive elsewhere such as mammalian tissue. Beta-LEAP construct had shown specific cleavage by purified beta-lactamase and by beta-lactamase over-expressing methicillin resistant Staphylococcus aureus (MRSA). Specific photodynamic toxicity was observed towards MRSA, while dark and light toxicity were equivalent to reference strains. The prodrug design, synthesis and photophysical properties will be discussed.

  13. Detection of Resistance to Beta-Lactamase Inhibitors in Strains with CTX-M Beta-Lactamases: a Multicenter External Proficiency Study Using a Well-Defined Collection of Escherichia coli Strains

    PubMed Central

    Ripoll, Aida; Rodríguez, Cristina; Tormo, Nuria; Gimeno, Concepción; Baquero, Fernando; Martínez-Martínez, Luis; Cantón, Rafael

    2014-01-01

    Under the auspices of the Spanish Society for Infectious Diseases and Clinical Microbiology Quality Control program, 14 Escherichia coli strains masked as blood culture isolates were sent to 68 clinical microbiology laboratories for antimicrobial susceptibility testing to β-lactam antibiotics. This collection included three control strains (E. coli ATCC 25922, an IRT-2 producer, and a CMY-2 producer), six isogenic strains with or without the OmpF porin and expressing CTX-M β-lactamases (CTX-M-1, CTX-M-15, and CTX-M-14), one strain carrying a double mechanism for β-lactam resistance (i.e., carrying CTX-M-15 and OXA-1 enzymes), and four strains carrying CTX-M variants with different levels of resistance to β-lactams and β-lactam–β-lactamase inhibitor (BLBLI) combinations. The main objective of the study was to ascertain how these variants with reduced susceptibilities to BLBLIs are identified in clinical microbiology laboratories. CTX-M variants with high resistance to BLBLIs were mainly identified as inhibitor-resistant TEM (IRT) enzymes (68.0%); however, isogenic CTX-M mutant strains with reduced susceptibilities to BLBLIs and cephalosporins were mainly associated with extended-spectrum β-lactamase production alone (51 to 80%) or in combination with other mechanisms (14 to 31%). Concerning all β-lactams tested, the overall interpretative discrepancy rate was 11.5%, of which 38.1% were the consequence of postreading changes in the clinical categories when a resistance mechanism was inferred. Therefore, failure to recognize these complex phenotypes might contribute to an explanation of their apparent absence in the clinical setting and might lead to inadequate drug treatment selection. A proposal for improving recognition is to adhere strictly to the current CLSI or EUCAST guidelines for detecting reduced susceptibility to BLBLI combinations, without any interpretative modification. PMID:24153133

  14. Purification and biochemical characterization of the VIM-1 metallo-beta-lactamase.

    PubMed

    Franceschini, N; Caravelli, B; Docquier, J D; Galleni, M; Frère, J M; Amicosante, G; Rossolini, G M

    2000-11-01

    VIM-1 is a new group 3 metallo-beta-lactamase recently detected in carbapenem-resistant nosocomial isolates of Pseudomonas aeruginosa from the Mediterranean area. In this work, VIM-1 was purified from an Escherichia coli strain carrying the cloned bla(VIM-1) gene by means of an anion-exchange chromatography step followed by a gel permeation chromatography step. The purified enzyme exhibited a molecular mass of 26 kDa in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and an acidic pI of 5.1 in analytical isoelectric focusing. Amino-terminal sequencing showed that mature VIM-1 results from the removal of a 26-amino-acid signal peptide from the precursor. VIM-1 hydrolyzes a broad array of beta-lactam compounds, including penicillins, narrow- to expanded-spectrum cephalosporins, carbapenems, and mechanism-based serine-beta-lactamase inactivators. Only monobactams escape hydrolysis. The highest catalytic constant/K(m) ratios (>10(6) M(-1). s(-1)) were observed with carbenicillin, azlocillin, some cephalosporins (cephaloridine, cephalothin, cefuroxime, cefepime, and cefpirome), imipenem, and biapenem. Kinetic parameters showed remarkable variability with different beta-lactams and also within the various penam, cephem, and carbapenem compounds, resulting in no clear preference of the enzyme for any of these beta-lactam subfamilies. Significant differences were observed with some substrates between the kinetic parameters of VIM-1 and those of other metallo-beta-lactamases. Inactivation assays carried out with various chelating agents (EDTA, 1,10-o-phenanthroline, and pyridine-2,6-dicarboxylic acid) indicated that formation of a ternary enzyme-metal-chelator complex precedes metal removal from the zinc center of the protein and revealed notable differences in the inactivation parameters of VIM-1 with different agents. PMID:11036013

  15. Reduced susceptibility to chlorhexidine disinfectant among New Delhi metallo-beta-lactamase-1 positive Enterobacteriaceae and other multidrug-resistant organisms: Report from a tertiary care hospital in Karachi, Pakistan.

    PubMed

    Mal, P B; Farooqi, J; Irfan, S; Hughes, M A; Khan, E

    2016-01-01

    We analysed susceptibility of multidrug-resistant organisms (MDROs) including New Delhi metallo-beta-lactamase-1 positive Enterobacteriaceae to chlorhexidine and compared results to their susceptible counterparts. Susceptibilities of chlorhexidine digluconate in a standard (CHX-S) preparation and two commercial disinfectants containing different CHX concentrations (2% w/v and 4% w/w) were performed. MDROs had narrower range of higher CHX-S minimum inhibitory concentrations (MICs) as compared to pan-sensitive organisms. The MIC values for commercial disinfectants products for MDROs were many folds higher (20-600 times), than CHX-S for in vitro use. Increasing antibiotic resistance among bacterial isolates can be an indirect marker of reduced susceptibility to chlorhexidine in hospital setting. PMID:27514958

  16. Detection of SHV-1 beta-lactamase in Pseudomonas aeruginosa strains by genetic methods.

    PubMed

    Kalai Blagui, S; Achour, W; Bejaoui, M; Abdeladhim, A; Ben Hassen, A

    2009-05-01

    Twelve multidrug-resistant Pseudomonas aeruginosa (MDRPA) isolates were recovered over a period of two years in the National Bone Marrow Transplant Centre of Tunisia. MDRPA isolates were isolated from seven patients and from three environmental samples. Isoelectric focusing revealed pIs of 8.2, 5.5 and 7.6 in all MDRPA isolates. These strains produced the OXA-18 extended spectrum beta-lactamase and an SHV type beta-lactamase as shown by screening PCR analysis. DNA hybridization confirmed this inference, detecting bla(SHV) gene in these isolates. Pulsed-field gel electrophoresis (PFGE) defined one predominant genomic group; group A (seven isolates) and four different genotypes containing one to two isolates. Clonally related isolates were recovered from three patients and from two washbasins. Sequencing DNA of cluster representative strains identified the classical bla(SHV-1) gene. For these strains, the nucleotide sequence of the structural bla(SHV-1) gene was nearly identical to those previously described. Such enzyme has not been reported from P. aeruginosa. This is the first report of the SHV-1 penicillinase in epidemic P. aeruginosa strain. PMID:18456431

  17. Characterization of Beta-lactamases in Faecal Enterobacteriaceae Recovered from Healthy Humans in Spain: Focusing on AmpC Polymorphisms.

    PubMed

    Porres-Osante, Nerea; Sáenz, Yolanda; Somalo, Sergio; Torres, Carmen

    2015-07-01

    The intestinal tract is a huge reservoir of Enterobacteriaceae, some of which are opportunist pathogens. Several genera of these bacteria harbour intrinsic antibiotic resistance genes, such as ampC genes in species of Citrobacter, Enterobacter or Escherichia genera. In this work, beta-lactamases and other resistance mechanisms have been characterized in Enterobacteriaceae isolates recovered from healthy human faecal samples, focusing on the ampC beta-lactamase genes. Fifty human faecal samples were obtained, and 70 Enterobacteriaceae bacteria were isolated: 44 Escherichia coli, 4 Citrobacter braakii, 9 Citrobacter freundii, 8 Enterobacter cloacae, 1 Proteus mirabilis, 1 Proteus vulgaris, 1 Klebsiella oxytoca, 1 Serratia sp. and 1 Cronobacter sp. A high percentage of resistance to ampicillin was detected (57%), observing the AmpC phenotype in 22 isolates (31%) and the ESBL phenotype in 3 isolates. AmpC molecular characterization showed high diversity into bla CMY and bla ACT genes from Citrobacter and Enterobacter species, respectively, and the pulsed-field gel electrophoresis (PFGE) analysis demonstrated low clonality among them. The prevalence of people colonized by strains carrying plasmid-mediated ampC genes obtained in this study was 2%. The unique plasmid-mediated bla AmpC identified in this study was the bla CMY-2 gene, detected in an E. coli isolate ascribed to the sequence type ST405 which belonged to phylogenetic group D. The hybridization and conjugation experiments demonstrated that the ISEcp1-bla CMY-2-blc structure was carried by a ~78-kb self-transferable IncK plasmid. This study shows a high polymorphism among beta-lactamase genes in Enterobacteriaceae from healthy people microbiota. Extensive AmpC-carrier studies would provide important information and could allow the anticipation of future global health problems. PMID:25501887

  18. Peptidase activity of beta-lactamases.

    PubMed Central

    Rhazi, N; Galleni, M; Page, M I; Frère, J M

    1999-01-01

    Although beta-lactamases have generally been considered as being devoid of peptidase activity, a low but significant hydrolysis of various N-acylated dipeptides was observed with representatives of each class of beta-lactamases. The kcat/Km values were below 0.1 M(-1). s(-1), but the enzyme rate enhancement factors were in the range 5000-20000 for the best substrates. Not unexpectedly, the best 'peptidase' was the class C beta-lactamase of Enterobacter cloacae P99, but, more surprisingly, the activity was always higher with the phenylacetyl- and benzoyl-d-Ala-d-Ala dipeptides than with the diacetyl- and alpha-acetyl-l-Lys-d-Ala-d-Ala tripeptides, which are the preferred substrates of the low-molecular-mass, soluble dd-peptidases. A comparison between the beta-lactamases and dd-peptidases showed that it might be as difficult for a dd-peptidase to open the beta-lactam ring as it is for the beta-lactamases to hydrolyse the peptides, an observation which can be explained by geometric and stereoelectronic considerations. PMID:10393100

  19. Sequence analysis of PER-1 extended-spectrum beta-lactamase from Pseudomonas aeruginosa and comparison with class A beta-lactamases.

    PubMed Central

    Nordmann, P; Naas, T

    1994-01-01

    We have determined the nucleotide sequence (EMBL accession number, Z 21957) of the cloned chromosomal PER-1 extended-spectrum beta-lactamase gene from a Pseudomonas aeruginosa RNL-1 clinical isolate, blaPER-1 corresponds to a 924-bp open reading frame which encodes a polypeptide of 308 amino acids. This open reading frame is preceded by a -10 and a -35 region consistent with a putative P. aeruginosa promoter. Primer extension analysis of the PER-1 mRNA start revealed that this promoter was active in P. aeruginosa but not in Escherichia coli, in which PER-1 expression was driven by vector promoter sequences. N-terminal sequencing identified the PER-1 26-amino-acid leader peptide and enabled us to calculate the molecular mass (30.8 kDa) of the PER-1 mature form. Analysis of the percent GC content of blaPER-1 and of its 5' upstream sequences, as well as the codon usage for blaPER-1, indicated that blaPER-1 may have been inserted into P. aeruginosa genomic DNA from a nonpseudomonad bacterium. The PER-1 gene showed very low homology with other beta-lactamase genes at the DNA level. By using computer methods, assessment of the extent of identity between PER-1 and 10 beta-lactamase amino acid sequences indicated that PER-1 is a class A beta-lactamase. PER-1 shares around 27% amino acid identity with the sequenced extended-spectrum beta-lactamases of the TEM-SHV series and MEN-1 from Enterobacteriaceae species. The use of parsimony methods showed that PER-1 is not more closely related to gram-negative than to gram-positive bacterial class A beta-lactamases. Surprisingly, among class A beta-lactamases, PER-1 was most closely related to the recently reported CFXA from Bacteroides vulgatus, with which it shared 40% amino acid identity. This work indicates that non-Enterobacteriaceae species such as P. aeruginosa may possess class A extended-spectrum beta-lactamase genes possibly resulting from intergeneric DNA transfer. Images PMID:8141562

  20. Systematic mutagenesis of the active site omega loop of TEM-1 beta-lactamase.

    PubMed Central

    Petrosino, J F; Palzkill, T

    1996-01-01

    Beta-Lactamase is a bacterial protein that provides resistance against beta-lactam antibiotics. TEM-1 beta-lactamase is the most prevalent plasmid-mediated beta-lactamase in gram-negative bacteria. Normally, this enzyme has high levels of hydrolytic activity for penicillins, but mutant beta-lactamases have evolved with activity toward a variety of beta-lactam antibiotics. It has been shown that active site substitutions are responsible for changes in the substrate specificity. Since mutant beta-lactamases pose a serious threat to antimicrobial therapy, the mechanisms by which mutations can alter the substrate specificity of TEM-1 beta-lactamase are of interest. Previously, screens of random libraries encompassing 31 of 55 active site amino acid positions enabled the identification of the residues responsible for maintaining the substrate specificity of TEM-1 beta-lactamase. In addition to substitutions found in clinical isolates, many other specificity-altering mutations were also identified. Interestingly, many nonspecific substitutions in the N-terminal half of the active site omega loop were found to increase ceftazidime hydrolytic activity and decrease ampicillin hydrolytic activity. To complete the active sight study, eight additional random libraries were constructed and screened for specificity-altering mutations. All additional substitutions found to alter the substrate specificity were located in the C-terminal half of the active site loop. These mutants, much like the N-terminal omega loop mutants, appear to be less stable than the wild-type enzyme. Further analysis of a 165-YYG-167 triple mutant, selected for high levels of ceftazidime hydrolytic activity, provides an example of the correlation which exists between enzyme instability and increased ceftazidime hydrolytic activity in the ceftazidime-selected omega loop mutants. PMID:8606154

  1. Beta-lactamase stability of faropenem.

    PubMed

    Dalhoff, A; Nasu, T; Okamoto, K

    2003-09-01

    Faropenem (FAR) is an orally available member of the penem class unique among carbapenems and other available beta-lactams. This study compared FAR to cephalosporins and imipenem with respect to beta-lactamase (BLA) stability and emergence of resistance to Staphylococcus aureus and Escherichia coli. BLA stability was studied using enzyme preparations from sonicated/centrifuged 24-hour cultures of E. coli, Enterobacter cloacae, Proteus vulgaris, Providencia rettgeri, Klebsiella pneumoniae, S. aureus, and Bacteroides fragilis grown in the presence of 20 mg/l ampicillin or cephaloridine to induce penicillinase or cephalosporinase, respectively. Substrate hydrolysis was quantitated spectrophotometrically. Multistep acquisition of resistance was promoted by growing bacteria in broth containing 2-fold dilutions of antibiotic over 10 cycles. Aliquots from test tubes with visible growth provided the inoculum for the next series of dilutions. FAR as well as other cephalosporins tested were highly stable to penicillinase derived from S. aureus and E. coli. However, E. coli- and P. vulgaris-derived cephalosporinase hydrolyzed cephaloridine, cefaclor and cefotiam considerably, whereas FAR was highly stable. FAR was highly stable against hydrolysis by various BLAs prepared from four B. fragilis strains and the rate of FAR hydrolysis by metallo-BLA was 5 times lower than that for imipenem. Additionally, the acquisition of resistant S. aureus strains was less pronounced for FAR compared to other agents tested. MICs rose 8-fold after the 10th sub-MIC exposure, while MICs rose 16-, 31- and 512-fold for cefixime, cefazolin and cefaclor, respectively. E. coli shifts in MICs were moderate for all the agents tested. In conclusion, FAR is characterized by pronounced BLA stability compared to other cephalosporins and imipenem. Furthermore, a lower propensity for resistance development with FAR as compared to cephalosporins was observed. PMID:14504433

  2. Side chain SAR of bicyclic [beta]-lactamase inhibitors (BLIs). 1. Discovery of a class C BLI for combination with imipinem

    SciTech Connect

    Blizzard, Timothy A.; Chen, Helen; Kim, Seongkon; Wu, Jane; Young, Katherine; Park, Young-Whan; Ogawa, Amy; Raghoobar, Susan; Painter, Ronald E.; Hairston, Nichelle; Lee, Sang Ho; Misura, Andrew; Felcetto, Tom; Fitzgerald, Paula; Sharma, Nandini; Lu, Jun; Ha, Sookhee; Hickey, Emily; Hermes, Jeff; Hammond, Milton L.

    2010-09-17

    Bridged monobactam {beta}-lactamase inhibitors were prepared and evaluated as potential partners for combination with imipenem to overcome class C {beta}-lactamase mediated resistance. The (S)-azepine analog 2 was found to be effective in both in vitro and in vivo assays and was selected for preclinical development.

  3. Antimicrobial susceptibility and beta-lactamase production of selected gram-negative bacilli from two Croatian hospitals: MYSTIC study results.

    PubMed

    Bedenic, B; Goic-Barisic, I; Budimir, A; Tonkic, M; Mihajkevic, L J; Novak, A; Sviben, M; Plecko, V; Punda-Polic, V; Kalenic, S

    2010-06-01

    The meropenem yearly Susceptibility Test Information Collection (MYSTIC) programme is a global, longitudinal resistance surveillance network that monitors the activity of meropenem and compares its activity with other broadspectrum antimicrobial agents. We now report the antimicrobial efficacy of meropenem compared to other broad-spectrum agents within the selective Gram-negative pathogen groups from two Croatian Hospitals investigated between 2002-2007. A total of 1510 Gram-negative pathogens were tested and the minimum-inhibitory concentrations (MICs) were determined by broth microdilution method according to CLSI.There was no resistance to either imipenem or meropenem observed for Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis in both medical centers. High resistance rates of K. pneumoniae to ceftazidime (18%), cefepime (17%) and gentamicin (39%) are raising concern. Acinetobacter baumannii turned out to be the most resistant Gram-negative bacteria with 81% resistant to ceftazidime, 73% to cefepime, 69% to gentamicin and 71% to ciprofloxacin. Almost 20% of Pseudomonas aeruginosa strains were resistant to imipenem, 13% to meropenem, 69% to gentamicin and 38% to ciprofloxacin.The prevalence of extended-spectrum beta-lactamases (ESBLs) in E. coli was 10% and in K. pneumoniae 49%. PCR and sequencing of the amplicons revealed the presence of SHV-5 in nine E. coli strains and additional tem-1 beta-lactamase five strains. Five K. pneumoniae strains were positive for bla(SHV-5 )gene. Eight ESBL positive Enterobacter spp. strains were found to produce tem and CtX-m beta-lactamases. Plasmid-mediated AmpC beta-lactamases were not found among K. pneumoniae, E. coli and Enterobacter spp. Three A. baumannii strains from Zagreb University Center were identified by multiplex PCR as OXA-58 like producers. Six A. baumannii strains from Split University Center were found to possess an ISAba1 insertion sequence upstream of bla(OXA-51 )gene. According to our results

  4. Extended-spectrum plasmid-mediated beta-lactamases.

    PubMed

    Sirot, D

    1995-07-01

    Extended-spectrum beta-lactamases (ESBLs) are mutant enzymes which derive from TEM or SHV (class A) enzymes. They confer variable levels of resistance to cefotaxime, ceftazidime and other broad-spectrum cephalosporins and to monobactams such as aztreonam but have no detectable activity against cephamycins and carbapenems. Recently, new plasmid-mediated ESBLs, not derived from TEM or SHV enzymes but related to cephalosporinases of Enterobacteriaceae (class C enzymes), that confer resistance to all cephalosporins including cephamycins, have been reported. However, to date there have been no reported outbreaks due to strains producing transferable cephalosporinases. Klebsiella pneumoniae is the species in which the ESBL enzymes have been most commonly reported around the world. Most of the clinical isolates that produce TEM- or SHV-derived ESBL, come from hospitalised patients and have frequently caused nosocomial outbreaks. Care should be taken in the selection of a beta-lactam for the treatment of infections because the presence of an ESBL does not prevent other mechanisms of resistance, such as decreased permeability, from emerging. Broad-spectrum cephalosporins including cefepime and cefpirome are hydrolysed by ESBL. However, low level resistance to cefotaxime, ceftriaxone, cefepime and aztreonam does occur in some strains producing certain TEM-derived ESBL. It remains to be seen, therefore, whether such isolates are clinically susceptible to these drugs. The combination of a third-generation cephalosporin and a beta-lactamase inhibitor such as sulbactam could be of interest against some strains producing certain ESBLs. Among the 7-alpha-methoxy cephalosporins, cefotetan and latamoxef are the most active. However, cephamycins should be used with caution to treat infections caused by ESBL-producing K. pneumoniae because of the relative ease with which clinical strains decrease the expression of outer membrane proteins. The most active beta-lactams are the

  5. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  6. OXA-14, another extended-spectrum variant of OXA-10 (PSE-2) beta-lactamase from Pseudomonas aeruginosa.

    PubMed Central

    Danel, F; Hall, L M; Gur, D; Livermore, D M

    1995-01-01

    Pseudomonas aeruginosa 455, isolated in Ankara, Turkey, produced a pI 6.2 beta-lactamase determined by plasmid pMLH53 and resisted all beta-lactams except carbapenems. This beta-lactamase, named OXA-14, corresponded to OXA-10 (PSE-2) except that aspartate replaced glycine at position 157 and thus is intermediate between OXA-10 and OXA-11, which has aspartate at position 157 and a further substitution at position 143. PMID:7486940

  7. Structural Aspects for Evolution of [beta]-Lactamases from Penicillin-Binding Proteins

    SciTech Connect

    Meroueh, Samy O.; Minasov, George; Lee, Wenlin; Shoichet, Brian K.; Mobashery, Shahriar

    2010-03-08

    Penicillin-binding proteins (PBPs), biosynthetic enzymes of bacterial cell wall assembly, and {beta}-lactamases, resistance enzymes to {beta}-lactam antibiotics, are related to each other from an evolutionary point of view. Massova and Mobashery (Antimicrob. Agents Chemother. 1998, 42, 1-17) have proposed that for {beta}-lactamases to have become effective at their function as antibiotic resistance enzymes, they would have had to undergo structure alterations such that they would not interact with the peptidoglycan, which is the substrate for PBPs. A cephalosporin analogue, 7{beta}-[N-Acetyl-L-alanyl-{gamma}-D-glutamyl-L-lysine]-3-acetoxymethyl-3-cephem-carboxylic acid (compound 6), was conceived and synthesized to test this notion. The X-ray structure of the complex of this cephalosporin bound to the active site of the deacylation-deficient Q120L/Y150E variant of the class C AmpC {beta}-lactamase from Escherichia coli was solved at 1.71 {angstrom} resolution. This complex revealed that the surface for interaction with the strand of peptidoglycan that acylates the active site, which is present in PBPs, is absent in the {beta}-lactamase active site. Furthermore, insertion of a peptide in the {beta}-lactamase active site at a location where the second strand of peptidoglycan in some PBPs binds has effectively abolished the possibility for such interaction with the {beta}-lactamase. A 2.6 ns dynamics simulation was carried out for the complex, which revealed that the peptidoglycan surrogate (i.e., the active-site-bound ligand) undergoes substantial motion and is not stabilized for binding within the active site. These factors taken together disclose the set of structure modifications in the antibiotic resistance enzyme that prevent it from interacting with the peptidoglycan, en route to achieving catalytic proficiency for their intended function.

  8. Using steric hindrance to design new inhibitors of class C beta-lactamases

    SciTech Connect

    Trehan, Indi; Morandi, F.; Blaszczak, L.C.; Shoichet, Brian K.

    2010-03-08

    {beta}-lactamases confer resistance to {beta}-lactam antibiotics such as penicillins and cephalosporins. However, {beta}-lactams that form an acyl-intermediate with the enzyme but subsequently are hindered from forming a catalytically competent conformation seem to be inhibitors of {beta}-lactamases. This inhibition may be imparted by specific groups on the ubiquitous R1 side chain of {beta}-lactams, such as the 2-amino-4-thiazolyl methoxyimino (ATMO) group common among third-generation cephalosporins. Using steric hindrance of deacylation as a design guide, penicillin and carbacephem substrates were converted into effective {beta}-lactamase inhibitors and antiresistance antibiotics. To investigate the structural bases of inhibition, the crystal structures of the acyl-adducts of the penicillin substrate amoxicillin and the new analogous inhibitor ATMO-penicillin were determined. ATMO-penicillin binds in a catalytically incompetent conformation resembling that adopted by third-generation cephalosporins, demonstrating the transferability of such sterically hindered groups in inhibitor design.

  9. Antimicrobial resistance in faecal Escherichia coli isolates from farmed red deer and wild small mammals. Detection of a multiresistant E. coli producing extended-spectrum beta-lactamase.

    PubMed

    Alonso, C A; González-Barrio, D; Tenorio, Carmen; Ruiz-Fons, F; Torres, C

    2016-04-01

    Eighty-nine Escherichia coli isolates recovered from faeces of red deer and small mammals, cohabiting the same area, were analyzed to determine the prevalence and mechanisms of antimicrobial resistance and molecular typing. Antimicrobial resistance was detected in 6.7% of isolates, with resistances to tetracycline and quinolones being the most common. An E. coli strain carrying blaCTX-M-1 as well as other antibiotic resistant genes included in an unusual class 1 integron (Intl1-dfrA16-blaPSE-1-aadA2-cmlA1-aadA1-qacH-IS440-sul3-orf1-mef(B)Δ-IS26) was isolated from a deer. The blaCTX-M-1 gene was transferred by conjugation and transconjugants also acquired an IncN plasmid. This strain was typed as ST224, which seems to be well adapted to both clinical and environmental settings. The phylogenetic distribution of the 89 strains varied depending on the animal host. This work reveals low antimicrobial resistance levels among faecal E. coli from wild mammals, which reflects a lower selective pressure affecting these bacteria, compared to livestock. However, it is remarkable the detection of a multi-resistant ESBL-E. coli with an integron carrying clinically relevant antibiotic-resistance genes, which can contribute to the dissemination of resistance determinants among different ecosystems. PMID:27012919

  10. Occurrence and characteristics of extended spectrum beta-lactamases-producing Enterobacteriaceae from foods of animal origin.

    PubMed

    Tekiner, İsmail Hakkı; Özpınar, Haydar

    2016-01-01

    Presence of extended spectrum beta-lactamases (ESBL) in bacteria is a growing health concern of global significance. The local, regional, national, and international epidemiological studies for extended spectrum beta-lactamases-producing Enterobacteriaceae and their encoding genes in foods are still incomplete. The objective of this study was to determine the occurrence of extended spectrum beta-lactamases-producing Enterobacteriaceae and the characteristics of their encoding genes from a total of 250 samples of various foods of animal-origin (100 raw chicken meat, 100 raw cow milk, and 50 raw cow milk cheese) sold in Turkey. Overall, 55 isolates were positive as extended spectrum beta-lactamases-producing Enterobacteriaceae. The most prevalent extended spectrum beta-lactamases-producing strain were identified as Escherichia coli (80%), followed by Enterobacter cloacae (9.1%), Citrobacter braakii (5.5%), Klebsiella pneumoniae (3.6%), and Citrobacter werkmanii (1.8%) by Vitek(®) MS. The simultaneous production of extended spectrum beta-lactamases and AmpC was detected in five isolates (9.1%) in E. coli (80%) and E. cloacae (20%). The frequency rates of blaTEM, blaCTX-M, and blaSHV were 96.4%, 53.7%, and 34.5%, respectively. The co-existence of bla-genes was observed in 82% of extended spectrum beta-lactamases producers with a distribution of blaTEM &blaCTX-M (52.7%), blaTEM &blaSHV (20%), blaTEM &blaCTX-M &blaSHV (12.7%), and blaSHV &blaCTX-M (1.8%). The most prevalent variant of blaCTX-M clusters was defined as blaCTX-M-1 (97.2%), followed by blaCTX-M-8 (2.8%). In summary, the analysed foods were found to be posing a health risk for Turkish consumers due to contamination by Enterobacteriaceae with a diversity of extended spectrum beta-lactamases encoding genes. PMID:26991276

  11. Energetic, Structural, and Antimicrobial Analyses of [beta]-Lactam Side Chain Recognition by [beta]-Lactamases

    SciTech Connect

    Caselli, E.; Powers, R.A.; Blaszczak, L.C.; Wu, C.Y.E.; Prati, F.; Shoichet, B.K.

    2010-03-05

    Penicillins and cephalosporins are among the most widely used and successful antibiotics. The emergence of resistance to these {beta}-lactams, most often through bacterial expression of {beta}-lactamases, threatens public health. To understand how {beta}-lactamases recognize their substrates, it would be helpful to know their binding energies. Unfortunately, these have been difficult to measure because {beta}-lactams form covalent adducts with {beta}-lactamases. This has complicated functional analyses and inhibitor design. To investigate the contribution to interaction energy of the key amide (R1) side chain of {beta}-lactam antibiotics, eight acylglycineboronic acids that bear the side chains of characteristic penicillins and cephalosporins, as well as four other analogs, were synthesized. These transition-state analogs form reversible adducts with serine {beta}-lactamases. Therefore, binding energies can be calculated directly from K{sub i} values. The K{sub i} values measured span four orders of magnitude against the Group I {beta}-lactamase AmpC and three orders of magnitude against the Group II {beta}-lactamase TEM-1. The acylglycineboronic acids have K{sub i} values as low as 20 nM against AmpC and as low as 390 nM against TEM-1. The inhibitors showed little activity against serine proteases, such as chymotrypsin. R1 side chains characteristic of {beta}-lactam inhibitors did not have better affinity for AmpC than did side chains characteristic of {beta}-lactam substrates. Two of the inhibitors reversed the resistance of pathogenic bacteria to {beta}-lactams in cell culture. Structures of two inhibitors in their complexes with AmpC were determined by X-ray crystallography to 1.90 {angstrom} and 1.75 {angstrom} resolution; these structures suggest interactions that are important to the affinity of the inhibitors. Acylglycineboronic acids allow us to begin to dissect interaction energies between {beta}-lactam side chains and {beta}-lactamases. Surprisingly

  12. Quinolone-Resistant Escherichia coli O127a:K63 Serotype with an Extended-Spectrum-Beta-Lactamase Phenotype from a Food Poisoning Outbreak in China

    PubMed Central

    Hao, Rongzhang; Qiu, Shaofu; Yang, Guang; Su, Wenli; Song, Lixue; Zhang, Jia; Chen, Jiaxu; Jia, Leili; Wang, Ligui

    2012-01-01

    We report an atypical enteropathogenic Escherichia coli O127a:K63 strain with resistance to quinolones and extended-spectrum cephalosporins isolated from a 2010 food poisoning outbreak involving 112 adults in China. Two resistance genes [blaCTX-M-15, aac(6′)-Ib-c] and five mutations (two in gyrA, two in parC, one in parE) coexisted in this enteropathogenic E. coli strain. PMID:22553233

  13. Novel Computational Protocols for Functionally Classifying and Characterising Serine Beta-Lactamases.

    PubMed

    Lee, David; Das, Sayoni; Dawson, Natalie L; Dobrijevic, Dragana; Ward, John; Orengo, Christine

    2016-06-01

    Beta-lactamases represent the main bacterial mechanism of resistance to beta-lactam antibiotics and are a significant challenge to modern medicine. We have developed an automated classification and analysis protocol that exploits structure- and sequence-based approaches and which allows us to propose a grouping of serine beta-lactamases that more consistently captures and rationalizes the existing three classification schemes: Classes, (A, C and D, which vary in their implementation of the mechanism of action); Types (that largely reflect evolutionary distance measured by sequence similarity); and Variant groups (which largely correspond with the Bush-Jacoby clinical groups). Our analysis platform exploits a suite of in-house and public tools to identify Functional Determinants (FDs), i.e. residue sites, responsible for conferring different phenotypes between different classes, different types and different variants. We focused on Class A beta-lactamases, the most highly populated and clinically relevant class, to identify FDs implicated in the distinct phenotypes associated with different Class A Types and Variants. We show that our FunFHMMer method can separate the known beta-lactamase classes and identify those positions likely to be responsible for the different implementations of the mechanism of action in these enzymes. Two novel algorithms, ASSP and SSPA, allow detection of FD sites likely to contribute to the broadening of the substrate profiles. Using our approaches, we recognise 151 Class A types in UniProt. Finally, we used our beta-lactamase FunFams and ASSP profiles to detect 4 novel Class A types in microbiome samples. Our platforms have been validated by literature studies, in silico analysis and some targeted experimental verification. Although developed for the serine beta-lactamases they could be used to classify and analyse any diverse protein superfamily where sub-families have diverged over both long and short evolutionary timescales. PMID

  14. Novel Computational Protocols for Functionally Classifying and Characterising Serine Beta-Lactamases

    PubMed Central

    Das, Sayoni; Dawson, Natalie L.; Dobrijevic, Dragana; Orengo, Christine

    2016-01-01

    Beta-lactamases represent the main bacterial mechanism of resistance to beta-lactam antibiotics and are a significant challenge to modern medicine. We have developed an automated classification and analysis protocol that exploits structure- and sequence-based approaches and which allows us to propose a grouping of serine beta-lactamases that more consistently captures and rationalizes the existing three classification schemes: Classes, (A, C and D, which vary in their implementation of the mechanism of action); Types (that largely reflect evolutionary distance measured by sequence similarity); and Variant groups (which largely correspond with the Bush-Jacoby clinical groups). Our analysis platform exploits a suite of in-house and public tools to identify Functional Determinants (FDs), i.e. residue sites, responsible for conferring different phenotypes between different classes, different types and different variants. We focused on Class A beta-lactamases, the most highly populated and clinically relevant class, to identify FDs implicated in the distinct phenotypes associated with different Class A Types and Variants. We show that our FunFHMMer method can separate the known beta-lactamase classes and identify those positions likely to be responsible for the different implementations of the mechanism of action in these enzymes. Two novel algorithms, ASSP and SSPA, allow detection of FD sites likely to contribute to the broadening of the substrate profiles. Using our approaches, we recognise 151 Class A types in UniProt. Finally, we used our beta-lactamase FunFams and ASSP profiles to detect 4 novel Class A types in microbiome samples. Our platforms have been validated by literature studies, in silico analysis and some targeted experimental verification. Although developed for the serine beta-lactamases they could be used to classify and analyse any diverse protein superfamily where sub-families have diverged over both long and short evolutionary timescales. PMID

  15. Bacterial cell wall recycling provides cytosolic muropeptides as effectors for beta-lactamase induction.

    PubMed Central

    Jacobs, C; Huang, L J; Bartowsky, E; Normark, S; Park, J T

    1994-01-01

    A mechanism for bacteria to monitor the status of their vital cell wall peptidoglycan is suggested by the convergence of two phenomena: peptidoglycan recycling and beta-lactamase induction. ampG and ampD, genes essential for beta-lactamase regulation, are here shown to be required for recycling as well. Cells lacking either AmpG or AmpD lose up to 40% of their peptidoglycan per generation, whereas Escherichia coli normally suffers minimal losses and instead recycles 40 or 50% of the tripeptide, L-alanyl-D-glutamyl-meso-diaminopimelic acid, from its peptidoglycan each generation. The ampG mutant releases peptidoglycan-derived material into the medium. In contrast, the ampD mutant accumulates a novel cell wall muropeptide, 1,6-anhydro N-acetylmuramyl-L-alanyl-D-glutamyl-meso-diaminopimelic acid (anhMurNAc-tripeptide), in its cytoplasm. This work suggests that AmpG is the permease for a large muropeptide and AmpD is a novel cytosolic N-acetylmuramyl-L-alanine amidase that cleaves anhMurNAc-tripeptide to release tripeptide, which is then recycled. These results also suggest that the phenomenon of beta-lactamase induction is regulated by the level of muropeptide(s) in the cytoplasm, since an ampD mutation that results in beta-lactamase expression even in the absence of a beta-lactamase inducer coincides with accumulation of anhMurNAc-tripeptide. The transcriptional regulator AmpR is presumably converted into an activator for beta-lactamase production by sensing the higher level of muropeptide(s). This may be an example of a general mechanism for signaling the progress of external events such as cell wall maturation, cell division or cell wall damage. PMID:7925310

  16. Terminal truncations in amp C beta-lactamase from a clinical isolate of Pseudomonas aeruginosa.

    PubMed

    Walther-Rasmussen, J; Johnsen, A H; Høiby, N

    1999-07-01

    AmpC beta-lactamases from strains of Pseudomonas aeruginosa have previously been shown to be heterogeneous with respect to their isoelectric point (pI). In order to elucidate the origin of this heterogeneity enzymes were isolated from a clinical isolate of a multiresistant P. aeruginosa strain and biochemically characterized. The purification was accomplished in four chromatographic steps comprising dye-affinity, size-exclusion, hydrophobic interaction chromatography, and chromatofocusing; this resulted in five forms with pI values of 9.1, 8.7, 8.3, 8.2, and 7.6. When analysed by SDS/PAGE and agarose IEF each separated beta-lactamase appeared to be both size- and charge-homogeneous. The specific activities of the variants were very similar. MS of each isolated beta-lactamase form showed minor differences in molecular mass (range 40.0-40.8 kDa). MS of the beta-lactamase with a pI of 8.2 demonstrated the presence of two subforms. The N-terminal sequences of three of the beta-lactamases were identical to the published sequence [Lodge, J.M. , Minchin, S.D., Piddock, L.J.V. & Busby, J.W. (1990) Biochem. J. 272, 627-631], while two variants were truncated by two amino-acid residues, one of which was acidic. The previously published sequence contains an alanine as the ultimate residue, but two of the beta-lactamases showed a substitution of Ala371 for arginine, whereas in the remaining forms C-terminal truncations by one and three residues were found. Our results indicate that the P. aeruginosa strain does not harbour multiple copies of the ampC gene, but rather that the five beta-lactamase isoforms are products of a single structural gene. The combinations of the identified N- and/or C-terminal truncations explained the multiple pI values of the beta-lactamase isoforms. PMID:10406957

  17. New system based on site-directed mutagenesis for highly accurate comparison of resistance levels conferred by SHV beta-lactamases.

    PubMed Central

    Nüesch-Inderbinen, M T; Hächler, H; Kayser, F H

    1995-01-01

    We developed a system based on site-directed mutagenesis that allows a precise comparison of SHV enzymes under isogenic conditions. In addition, the influences of two different, naturally occurring promoters were examined for each SHV derivative. The system comprised two separately cloned DNA fragments, each the size of 3.6 kb. Both fragments encoded an SHV gene originating from clinical isolates but with different promoters. The structural genes were made identical by site-directed mutagenesis. Other mutations were then introduced into both fragments by means of site-directed mutagenesis, resulting in the SHV derivatives SHV-1, SHV-2, SHV-2a, SHV-3, and SHV-5. The amino acid exchange of glutamic acid at position 235 for lysine in SHV-5 resulted in the highest resistance levels. SHV-3, differing from SHV-2 by the exchange of arginine at position 201 for leucine and previously described as indistinguishable from SHV-2, was shown to cause slightly higher resistance to ceftazidime and lower resistance to ceftriaxone, cefotaxime, and cefepime than SHV-2. The point mutation in SHV-2a, with the leucine-to-glutamine replacement at the unusual position 31, previously considered almost insignificant, proved to increase resistance to ceftazidime but reduced the MICs of all other cephalosporins tested when compared with those for SHV-2. For all clones harboring SHV derivatives, resistance was increased by a stronger promoter, in some cases masking the effect of the point mutation itself and demonstrating the importance of regulatory mechanisms of resistance. PMID:7486909

  18. Exploring the potential reservoirs of non specific TEM beta lactamase (blaTEM) gene in the Indo-Gangetic region: A risk assessment approach to predict health hazards.

    PubMed

    Singh, Gulshan; Vajpayee, Poornima; Rani, Neetika; Amoah, Isaac Dennis; Stenström, Thor Axel; Shanker, Rishi

    2016-08-15

    The emergence of antimicrobial resistant bacteria is an important public health and environmental contamination issue. Antimicrobials of β-lactam group accounts for approximately two thirds, by weight, of all antimicrobials administered to humans due to high clinical efficacy and low toxicity. This study explores β-lactam resistance determinant gene (blaTEM) as emerging contaminant in Indo-Gangetic region using qPCR in molecular beacon format. Quantitative Microbial Risk Assessment (QMRA) approach was adopted to predict risk to human health associated with consumption/exposure of surface water, potable water and street foods contaminated with bacteria having blaTEM gene. It was observed that surface water and sediments of the river Ganga and Gomti showed high numbers of blaTEM gene copies and varied significantly (p<0.05) among the sampling locations. The potable water collected from drinking water facility and clinical settings exhibit significant number of blaTEM gene copies (13±0.44-10200±316 gene copies/100mL). It was observed that E.crassipes among aquatic flora encountered in both the rivers had high load of blaTEM gene copies. The information on prevalence of environmental reservoirs of blaTEM gene containing bacteria in Indo-Gangetic region and risk associated will be useful for formulating strategies to protect public from menace of clinical risks linked with antimicrobial resistant bacteria. PMID:27111425

  19. Outbreak of meropenem-resistant Serratia marcescens comediated by chromosomal AmpC beta-lactamase overproduction and outer membrane protein loss.

    PubMed

    Suh, Borum; Bae, Il Kwon; Kim, Juwon; Jeong, Seok Hoon; Yong, Dongeun; Lee, Kyungwon

    2010-12-01

    The aim of this study was to investigate the mechanisms involved in the meropenem resistance of Serratia marcescens clinical isolates. Meropenem-resistant (MIC range, 16 to 32 μg/ml) S. marcescens isolates were recovered from nine patients in a tertiary hospital in Seoul, South Korea, from June to November 2005. All the isolates shared identical or similar (>85% similarity) SpeI macrorestriction patterns, indicating clonal spread. PCR experiments did not detect any carbapenemase in those isolates. They carried the bla(CTX-M-22) gene located on a 150-kbp plasmid of the incompatibility group L/M; however, the addition of clavulanic acid exhibited few effects on meropenem MICs. Although meropenem MICs were reduced 4- to 16-fold with the addition of boronic acid, no plasmid-borne AmpC β-lactamase gene was detected in PCR experiments. Real-time quantitative PCR experiments showed that expression levels of the chromosomal ampC gene in those isolates were 87.06 to 155.76 times higher than that of the reference strain ATCC 8100. SDS-PAGE showed a lack of the 42-kDa outer membrane protein (OmpF). In combination with the overproduction of the chromosomal AmpC enzyme, the loss of OmpF may have played a role in the acquisition of meropenem resistance in our isolates. PMID:20876374

  20. Detection of cfxA2, cfxA3, and cfxA6 genes in beta-lactamase producing oral anaerobes

    PubMed Central

    BINTA, Buhle; PATEL, Mrudula

    2016-01-01

    ABSTRACT Purpose The aim of this study was to identify β-lactamase-producing oral anaerobic bacteria and screen them for the presence of cfxA and BlaTEM genes that are responsible for β-lactamase production and resistance to β-lactam antibiotics. Material and Methods Periodontal pocket debris samples were collected from 48 patients with chronic periodontitis and anaerobically cultured on blood agar plates with and without β-lactam antibiotics. Presumptive β-lactamase-producing isolates were evaluated for definite β-lactamase production using the nitrocefin slide method and identified using the API Rapid 32A system. Antimicrobial susceptibility was performed using disc diffusion and microbroth dilution tests as described by CLSI Methods. Isolates were screened for the presence of the β-lactamase-TEM (BlaTEM) and β-lactamase-cfxA genes using Polymerase Chain Reaction (PCR). Amplified PCR products were sequenced and the cfxA gene was characterized using Genbank databases. Results Seventy five percent of patients carried two species of β-lactamase-producing anaerobic bacteria that comprised 9.4% of the total number of cultivable bacteria. Fifty one percent of β-lactamase-producing strains mainly Prevotella, Porphyromonas, and Bacteroides carried the cfxA gene, whereas none of them carried blaTEM. Further characterization of the cfxA gene showed that 76.7% of these strains carried the cfxA2 gene, 14% carried cfxA3, and 9.3% carried cfxA6. The cfxA6 gene was present in three Prevotella spp. and in one Porphyromonas spp. Strains containing cfxA genes (56%) were resistant to the β-lactam antibiotics. Conclusion This study indicates that there is a high prevalence of the cfxA gene in β-lactamase-producing anaerobic oral bacteria, which may lead to drug resistance and treatment failure. PMID:27119762

  1. The phototrophic bacterium Rhodopseudomonas capsulata sp108 encodes an indigenous class A beta-lactamase.

    PubMed Central

    Campbell, J I; Scahill, S; Gibson, T; Ambler, R P

    1989-01-01

    The nucleotide sequence of a 2.37 kb DNA fragment derived from cloning a total DNA digest of Rhodopseudomonas capsulata sp108 was determined. The DNA codes for a beta-lactamase, a protein showing sequence similarity to the ampR protein of Enterobacter cloacae and an unidentified open reading frame. Hybridization experiments with a probe carrying DNA from within the beta-lactamase gene suggests a chromosomal location for the coding sequences in strain sp108 and in sp109, a penicillin-sensitive revertant of sp108 in which the enzyme is not inducible. A protein-sequence comparison of the deduced amino acid sequence of the Rps. capsulata beta-lactamase indicates that it is a Class A enzyme and that its sequence can be aligned with those of the characterized beta-lactamases from Staphylococcus aureus, Bacillus licheniformis and the Escherichia coli plasmid (R-TEM enzyme), with only a few insertions or deletions. The corresponding DNA sequence is, however, characteristically rhodopseudomonad, suggesting that it is not a recently transposed gene. Images Fig. 4. PMID:2788410

  2. Eradication of methicillin-resistant Staphylococcus aureus and of Enterobacteriaceae expressing extended-spectrum beta-lactamases on a model pig farm.

    PubMed

    Schmithausen, Ricarda Maria; Kellner, Sophia Ricarda; Schulze-Geisthoevel, Sophia Veronika; Hack, Sylvia; Engelhart, Steffen; Bodenstein, Isabel; Al-Sabti, Nahed; Reif, Marion; Fimmers, Rolf; Körber-Irrgang, Barbara; Harlizius, Jürgen; Hoerauf, Achim; Exner, Martin; Bierbaum, Gabriele; Petersen, Brigitte; Bekeredjian-Ding, Isabelle

    2015-11-01

    Colonization of livestock with bacteria resistant to antibiotics is considered a risk for the entry of drug-resistant pathogens into the food chain. For this reason, there is a need for novel concepts to address the eradication of drug-resistant commensals on farms. In the present report, we evaluated the decontamination measures taken on a farm contaminated with methicillin-resistant Staphylococcus aureus (MRSA) and Enterobacteriaceae expressing extended-spectrum β-lactamases (ESBL-E). The decontamination process preceded the conversion from piglet breeding to gilt production. Microbiological surveillance showed that the decontamination measures eliminated the MRSA and ESBL-E strains that were detected on the farm before the complete removal of pigs, cleaning and disinfection of the stable, and construction of an additional stable meeting high-quality standards. After pig production was restarted, ESBL-E remained undetectable over 12 months, but MRSA was recovered from pigs and the environment within the first 2 days. However, spa (Staphylococcus aureus protein A gene) typing revealed acquisition of an MRSA strain (type t034) that had not been detected before decontamination. Interestingly, we observed that a farmworker who had been colonized with the prior MRSA strain (t2011) acquired the new strain (t034) after 2 months. In summary, this report demonstrates that decontamination protocols similar to those used here can lead to successful elimination of contaminating MRSA and ESBL-E in pigs and the stable environment. Nevertheless, decontamination protocols do not prevent the acquisition of new MRSA strains. PMID:26341200

  3. Eradication of Methicillin-Resistant Staphylococcus aureus and of Enterobacteriaceae Expressing Extended-Spectrum Beta-Lactamases on a Model Pig Farm

    PubMed Central

    Kellner, Sophia Ricarda; Schulze-Geisthoevel, Sophia Veronika; Hack, Sylvia; Engelhart, Steffen; Bodenstein, Isabel; Al-Sabti, Nahed; Reif, Marion; Fimmers, Rolf; Körber-Irrgang, Barbara; Harlizius, Jürgen; Hoerauf, Achim; Exner, Martin; Bierbaum, Gabriele; Petersen, Brigitte

    2015-01-01

    Colonization of livestock with bacteria resistant to antibiotics is considered a risk for the entry of drug-resistant pathogens into the food chain. For this reason, there is a need for novel concepts to address the eradication of drug-resistant commensals on farms. In the present report, we evaluated the decontamination measures taken on a farm contaminated with methicillin-resistant Staphylococcus aureus (MRSA) and Enterobacteriaceae expressing extended-spectrum β-lactamases (ESBL-E). The decontamination process preceded the conversion from piglet breeding to gilt production. Microbiological surveillance showed that the decontamination measures eliminated the MRSA and ESBL-E strains that were detected on the farm before the complete removal of pigs, cleaning and disinfection of the stable, and construction of an additional stable meeting high-quality standards. After pig production was restarted, ESBL-E remained undetectable over 12 months, but MRSA was recovered from pigs and the environment within the first 2 days. However, spa (Staphylococcus aureus protein A gene) typing revealed acquisition of an MRSA strain (type t034) that had not been detected before decontamination. Interestingly, we observed that a farmworker who had been colonized with the prior MRSA strain (t2011) acquired the new strain (t034) after 2 months. In summary, this report demonstrates that decontamination protocols similar to those used here can lead to successful elimination of contaminating MRSA and ESBL-E in pigs and the stable environment. Nevertheless, decontamination protocols do not prevent the acquisition of new MRSA strains. PMID:26341200

  4. Outbreak of Serratia marcescens Coproducing ArmA and CTX-M-15 Mediated High Levels of Resistance to Aminoglycoside and Extended-Spectrum Beta-Lactamases, Algeria.

    PubMed

    Batah, Rima; Loucif, Lotfi; Olaitan, Abiola Olumuyiwa; Boutefnouchet, Nafissa; Allag, Hamoudi; Rolain, Jean-Marc

    2015-08-01

    Serratia marcescens is one of the most important pathogens responsible for nosocomial infections worldwide. Here, we have investigated the molecular support of antibiotic resistance and genetic relationships in a series of 54 S. marcescens clinical isolates collected from Eastern Algeria between December 2011 and July 2013. The 54 isolates were identified by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Antibiotic susceptibility testing was performed by disc diffusion and E-test methods. Antibiotic resistance genes were detected by polymerase chain reaction (PCR). The genetic transfer of antibiotic resistance was performed by conjugation using azide-resistant Escherichia coli J53 as the recipient strain, and plasmid analysis was done by PCR-based replicon typing. The relatedness of our isolates was determined by phylogenetic analysis based on partial sequences of four protein-encoding genes (gyrB, rpoB, infB, and atpD) and then compared to MALDI-TOF MS clustering. Thirty-five out of 54 isolates yielded an extended-spectrum β-lactamase (ESBL) phenotype and carried bla(CTX-M-15) (n=32), bla(TEM-1) (n=26), bla(TEM-71) (n=1), bla(SHV-1a) (n=1), and bla(PER-2) (n=12). Among these isolates, we identified a cluster of 15 isolates from a urology unit that coharbored ESBL and the 16S rRNA methyltransferase armA. Conjugation was successful for five selected strains, demonstrating the transferability of a conjugative plasmid of incompatibility group incL/M type. Phylogenetic analysis along with MALDI-TOF clustering likely suggested an outbreak of such isolates in the urology unit. In this study, we report for the first time the co-occurrence of armA methyltransferase with ESBL in S. marcescens clinical isolates in Eastern Algeria. PMID:25884511

  5. [beta]-Lactamases in the Biochemistry and Molecular Biology Laboratory

    ERIC Educational Resources Information Center

    Amador, Paula; Prudencio, Cristina; Vieira, Monica; Ferraz, Ricardo; Fonte, Rosalia; Silva, Nuno; Coelho, Pedro; Fernandes, Ruben

    2009-01-01

    [beta]-lactamases are hydrolytic enzymes that inactivate the [beta]-lactam ring of antibiotics such as penicillins and cephalosporins. The major diversity of studies carried out until now have mainly focused on the characterization of [beta]-lactamases recovered among clinical isolates of Gram-positive staphylococci and Gram-negative…

  6. Novel variant (bla(VIM-4)) of the metallo-beta-lactamase gene bla(VIM-1) in a clinical strain of Pseudomonas aeruginosa.

    PubMed

    Pournaras, Spyros; Tsakris, Athanassios; Maniati, Maria; Tzouvelekis, Leonidas S; Maniatis, Antonios N

    2002-12-01

    A Pseudomonas aeruginosa isolate highly resistant to carbapenems was collected from a patient with postsurgical cerebrospinal infection in Greece. The isolate carried a class 1 integron that contained as a sole cassette the gene bla(VIM-4), a novel variant of bla(VIM-1), with one nucleotide difference resulting in a Ser-to-Arg change at amino acid position 175 of the VIM-1 enzyme. This is the first detection of a VIM-1 variant after its appearance in Italy. PMID:12435718

  7. Evaluation of the contemporary occurrence rates of metallo-beta-lactamases in multidrug-resistant Gram-negative bacilli in Japan: report from the SENTRY Antimicrobial Surveillance Program (1998-2002).

    PubMed

    Jones, Ronald N; Deshpande, Lalitagauri M; Bell, Jan M; Turnidge, John D; Kohno, Shigeru; Hirakata, Yoichi; Ono, Yasuo; Miyazawa, Yukihisa; Kawakama, Sayoko; Inoue, Matsuhisa; Hirata, Yasuyoshi; Toleman, Mark A

    2004-08-01

    Metallo-beta-lactamases (M beta L) were initially characterized in Japan, usually of the IMP-type, and found in Pseudomonas aeruginosa (PSA), Acinetobacter spp. (ACB), or Serratia marcescens (SM). The number of M beta L types has increased worldwide, but geographic dissemination within Japan has appeared limited. This study compares baseline levels of M beta L resistance from two 22-center studies (1996-1997) to the longitudinal sample (3 sites) of Japanese isolates from the SENTRY Antimicrobial Surveillance Program (1998-2002). All minimal inhibitory concentration results were determined by reference methods. A total of 26.8% PSA, 3.4% ACB, and 3.1% Enterobacteriaceae (enterobacters and SM) with resistance to monitored carbapenems (CARB) (minimal inhibitory concentration, > or =8 microg/mL) were screened for M beta L production by disk approximation tests (EDTA and 2-MPA inhibitors), CARB hydrolysis by enzyme extracts, and selected PCR primers for known M beta L types. All M beta L-positive strains (10) were sequenced to determine enzyme identification. Clonality in each center was determined by automated ribotyping and PFGE. The CARB susceptibility rates in PSA decreased (80.7% to 62.0%) over the monitored interval (1998-2002), but varied by medical center location. Among CARB-resistant isolates, 10.8% were attributed to M beta L strains (1.1% of all PSA tested). M beta L identification showed the following: five PSA (three IMP-1, two IMP-2), four SM (one IMP-1, two IMP-1 + OXA-1, and one IMP-11). Also a single ACB had an IMP-1. Eight of 10 M beta L isolations occurred between 2000 and 2002; four occurred in 2002. BRL42715, an AMP-C inhibitor, confirmed AMP-C-mediated resistance in 87.3% of PSA, and outer membrane protein changes were also discovered by membrane studies. Prior results (22 sites, 1997-1998) showed CARB resistance at 22.4-25.6% and 0.5-0.9% M beta Ls (IMP-1) overall; it was slightly elevated in this SENTRY Program sample. In conclusion, M beta L

  8. Immunological properties of beta-lactamases that hydrolyze cefuroxime and cefotaxime.

    PubMed Central

    Hirai, K; Sato, K; Matsubara, N; Katsumata, R; Inoue, M; Mitsuhashi, S

    1981-01-01

    Antiserum against purified beta-lactamase from Proteus vulgaris GN7919 cross-reacted with beta-lactamases produced by strains of Pseudomonas cepacia in a neutralization test. Anti-P. cepacia beta-lactamase serum, however, did not show any cross-reactions with P. vulgaris beta-lactamases. Each of these enzymes can hydrolyze cefuroxime and cefotaxime. PMID:6269489

  9. First Description of the Extended Spectrum-Beta-Lactamase Gene blaCTX-M-109 in Salmonella Grumpensis Strains Isolated from Neonatal Nosocomial Infections in Dakar, Senegal.

    PubMed

    Diop, Amadou; Sambe-Ba, Bissoume; Seck, Abdoulaye; Dia, Mouhamadou Lamine; Timbiné, Lassina Gadi; Niang, Aïssatou Ameth; Ndiaye, El Hadji Momar; Sonko, Mouhamadou Abdoulaye; Wane, Abdoul Aziz; Bercion, Raymond; Ndiaye, Ousmane; Cissé, Moussa Fafa; Gassama-Sow, Amy

    2016-01-01

    Nosocomial infections are very common in African hospitals, particularly in neonatal units. These infections are most often caused by bacteria such as Escherichia coli, Klebsiella spp and Staphylococcus spp. Salmonella strains are rarely involved in nosocomial infections. Here, we report the first description of S. Grumpensis in neonatal infections in Senegal. Seventeen Salmonella strains were isolated from hospitalized infants' stool samples. The following resistance phenotype was described in strains: AMXRTICRCFR FOXRCFXRCTXRCAZRIMPSATMRNARNORRCIPRTMRGMRTERSXTR. All isolates were susceptible to imipenem, 15 out of 17 produced an extended spectrum ß-lactamase (ESBL). blaOXA-1, blaSHV-1, blaTEM-1, blaCTX-M1 genes were detected in strains 8, 13, 5 and 8, respectively. blaCTX-M1 sequencing revealed the presence of blaCTX-M-109. Thirteen of the 17 Salmonella Grumpensis strains were analyzed by PFGE. These 13 isolates belonged to a single pulsotype and were genotypically identical. This is the first report of neonatal S. Grumpensis infections in Senegal, and the first report of blaCTX-M-109 in the genus Salmonella. PMID:27355480

  10. First Description of the Extended Spectrum-Beta-Lactamase Gene blaCTX-M-109 in Salmonella Grumpensis Strains Isolated from Neonatal Nosocomial Infections in Dakar, Senegal

    PubMed Central

    Seck, Abdoulaye; Dia, Mouhamadou Lamine; Timbiné, Lassina Gadi; Niang, Aïssatou Ameth; Ndiaye, El Hadji Momar; Sonko, Mouhamadou Abdoulaye; Wane, Abdoul Aziz; Bercion, Raymond; Ndiaye, Ousmane; Cissé, Moussa Fafa; Gassama-Sow, Amy

    2016-01-01

    Nosocomial infections are very common in African hospitals, particularly in neonatal units. These infections are most often caused by bacteria such as Escherichia coli, Klebsiella spp and Staphylococcus spp. Salmonella strains are rarely involved in nosocomial infections. Here, we report the first description of S. Grumpensis in neonatal infections in Senegal. Seventeen Salmonella strains were isolated from hospitalized infants’ stool samples. The following resistance phenotype was described in strains: AMXRTICRCFR FOXRCFXRCTXRCAZRIMPSATMRNARNORRCIPRTMRGMRTERSXTR. All isolates were susceptible to imipenem, 15 out of 17 produced an extended spectrum ß-lactamase (ESBL). blaOXA-1, blaSHV-1, blaTEM-1, blaCTX-M1 genes were detected in strains 8, 13, 5 and 8, respectively. blaCTX-M1 sequencing revealed the presence of blaCTX-M-109. Thirteen of the 17 Salmonella Grumpensis strains were analyzed by PFGE. These 13 isolates belonged to a single pulsotype and were genotypically identical. This is the first report of neonatal S. Grumpensis infections in Senegal, and the first report of blaCTX-M-109 in the genus Salmonella. PMID:27355480

  11. Detection of KPC-2 in a Clinical Isolate of Proteus mirabilis and First Reported Description of Carbapenemase Resistance Caused by a KPC Beta-Lactamase in P. mirabilis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An isolate of Proteus mirabilis recovered from bacterial cultures was shown to be resistant to imipenem, meropenem, and ertapenem by disk diffusion susceptibility testing. Amplification of whole cell and/or plasmid DNA recovered from the isolate using primers specific for the blaKPC carbapenemase g...

  12. Extended-spectrum beta-lactamase-producing Shigella strains in Israel, 2000-2004.

    PubMed

    Vasilev, V; Japheth, R; Yishai, R; Andorn, N; Valinsky, L; Navon-Venezia, S; Chmelnitsky, I; Carmeli, Y; Cohen, D

    2007-03-01

    Routine susceptibility testing of 5,616 Shigella isolates at the National Shigella Reference Centre in Israel over a 5-year period (2000-2004) revealed resistance to ceftriaxone in one strain of Shigella boydii 2 and in two strains each of Shigella flexneri 2a, S. flexneri 6, and Shigella sonnei. All seven isolates were confirmed as producers of extended-spectrum beta-lactamase (ESBL) by the combination disk method, the Vitek 1 system, and a modification of the double-disk synergy test, which is based on the inhibitory properties of clavulanic acid, tazobactam, and sulbactam. Tazobactam had the strongest effect in all seven strains. Molecular characterization of the ESBLs identified CTX-M-type enzymes, consisting of the CTX-M-9 group (n = 3), CTX-M-3 (n = 2), CTX-M-39 (n = 1), and CTX-M-2 group (n = 1). Three of the strains also carried bla-(OXA) genes and a bla-(TEM) gene. Although the prevalence of ESBLs in this study was low, further research is needed on the spread and transfer of resistance genes, both in hospitals and in the community. PMID:17265070

  13. Prevalence and Clonal Dissemination of Metallo-Beta-Lactamase-Producing Pseudomonas aeruginosa in Kermanshah

    PubMed Central

    Akya, Alisha; Salimi, Afsaneh; Nomanpour, Bizhan; Ahmadi, Kamal

    2015-01-01

    Background: Pseudomonas aeruginosa is an opportunistic pathogen associated with nosocomial infections. The emergence and dissemination of metallo-beta-lactamases (MBLs) has contributed to the high rate of resistance among P. aeruginosa isolates. Objectives: The purpose of this study was to describe the prevalence and the clonal dissemination of MBL- producing P. aeruginosa isolates collected from major hospitals in Kermanshah. Materials and Methods: Antibiotic susceptibility testing was performed using the minimal inhibitory concentrations. The MBLs were investigated using the Double-Disk Synergy Test (DDST) and Polymerase Chain Reaction. Molecular typing was performed by Pulsed-Field Gel Electrophoresis (PFGE). Results: Of the 60 P. aeruginosa isolates included in this study, 30 (50%) were resistant to Gentamicin, 38 (63.3%) to Piperacillin, 42 (70%) to Ceftazidime, and 45 (75%) to Cefepime. Twenty-nine (48.3%) isolates were MBL producers in the DDST test. Five (8.3%) isolates were positive for the VIM gene. PFGE analysis among the MBL producers revealed 12 distinct clonal patterns. Conclusions: The inter- and intra-hospital dissemination of resistant clones is a matter of concern and is an indicator of the level of the improvement and surveillance of standard hygiene, particularly disinfection and hand washing before and after contact with patients. Given the emergence of MBL-producing strains, surveillance has become an important procedure to control the transmission of resistant strains. PMID:26421137

  14. Insight into the Effect of Inhibitor Resistant S130G Mutant on Physico-Chemical Properties of SHV Type Beta-Lactamase: A Molecular Dynamics Study

    PubMed Central

    Baig, Mohd Hassan; Sudhakar, D. Raja; Kalaiarasan, Ponnusamy; Subbarao, Naidu; Wadhawa, Gulshan; Lohani, Mohtashim; Khan, M Kalim A; Khan, Asad U.

    2014-01-01

    Bacterial resistance is a serious threat to human health. The production of β-lactamase, which inactivates β-lactams is most common cause of resistance to the β-lactam antibiotics. The Class A enzymes are most frequently encountered among the four β-lactamases in the clinic isolates. Mutations in class A β-lactamases play a crucial role in substrate and inhibitor specificity. SHV and TEM type are known to be most common class A β-lactamases. In the present study, we have analyzed the effect of inhibitor resistant S130G point mutation of SHV type Class-A β-lactamase using molecular dynamics and other in silico approaches. Our study involved the use of different in silico methods to investigate the affect of S130G point mutation on the major physico-chemical properties of SHV type class A β-lactamase. We have used molecular dynamics approach to compare the dynamic behaviour of native and S130G mutant form of SHV β-lactamase by analyzing different properties like root mean square deviation (RMSD), H-bond, Radius of gyration (Rg) and RMS fluctuation of mutation. The results clearly suggest notable loss in the stability of S130G mutant that may further lead to decrease in substrate specificity of SHV. Molecular docking further indicates that S130G mutation decreases the binding affinity of all the three inhibitors in clinical practice. PMID:25479359

  15. Comparative possession of Shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase (ESBL) genes in Escherichia coli isolated from backyard and farmed poultry.

    PubMed

    Samanta, I; Joardar, S N; Das, P K; Sar, T K

    2015-01-01

    The present work was conducted to compare the occurrence of Escherichia coli possessing virulence and ESBL genes in backyard and farmed poultry. Three hundred and sixty samples from the poultry kept in backyard system and 120 samples from the farmed birds were collected from West Bengal, India. Among the E. coli isolates of backyard poultry (O2, O10, O25, O55, O60, O106, UT), none of them possessed any of the Shiga toxin genes and eight E. coli isolates (8/272; 2.9%) harboured eaeA gene alone. Whereas among the E. coli isolated from the farmed poultry (O17, O20, O22, O102, O114, O119, rough, UT), four isolates (4/78, 5.1%) harboured stx 1/stx 2 gene and 11 isolates (11/78, 14.1%) possessed eaeA gene. None of the E. coli isolates from the backyard poultry harboured any studied ESBL gene. Whereas 29.4% of E. coli isolates from the farmed poultry were found to possess the ESBL genes. PMID:27175158

  16. Comparative possession of Shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase (ESBL) genes in Escherichia coli isolated from backyard and farmed poultry

    PubMed Central

    Samanta, I.; Joardar, S. N.; Das, P. K.; Sar, T. K.

    2015-01-01

    The present work was conducted to compare the occurrence of Escherichia coli possessing virulence and ESBL genes in backyard and farmed poultry. Three hundred and sixty samples from the poultry kept in backyard system and 120 samples from the farmed birds were collected from West Bengal, India. Among the E. coli isolates of backyard poultry (O2, O10, O25, O55, O60, O106, UT), none of them possessed any of the Shiga toxin genes and eight E. coli isolates (8/272; 2.9%) harboured eaeA gene alone. Whereas among the E. coli isolated from the farmed poultry (O17, O20, O22, O102, O114, O119, rough, UT), four isolates (4/78, 5.1%) harboured stx1/stx2 gene and 11 isolates (11/78, 14.1%) possessed eaeA gene. None of the E. coli isolates from the backyard poultry harboured any studied ESBL gene. Whereas 29.4% of E. coli isolates from the farmed poultry were found to possess the ESBL genes. PMID:27175158

  17. Characterization of extended spectrum beta-lactamase-producing Klebsiella pneumoniae from Beijing, China.

    PubMed

    Shen, D; Winokur, P; Jones, R N

    2001-08-01

    Fourteen clinical isolates of Klebsiella pneumoniae with extended-spectrum beta-lactamases (ESBLs) were detected by the double disk synergy test and the Etest ESBL strip. Co-resistances included high MICs for aminoglycosides, fluoroquinolones, tetracyclines, and trimethoprim/sulphamethoxazole. Co-resistance was not observed in five of the 14 strains. These isolates were all genetically distinct as determined by the automated ribotyping method. Isoelectric focusing documented the presence of multiple beta-lactamases (one to four per isolate) with pIs ranging from 5.4 to 8.4. The majority of isolates contained beta-lactamases with pI values of 7.6 and 8.4 consistent with SHV-type ESBLs and an Amp C enzyme, respectively. Emerging ESBL strains in K. pneumoniae compromise the use of agents such as cefotaxime, ceftriaxone, ceftazidime in China; leading to the expansion of quality infection control practices and formulary management programmes to minimize clonal expansion. PMID:11516943

  18. Amp C beta-lactamase-producing Escherichia coli in neonatal meningitis: diagnostic and therapeutic challenge.

    PubMed

    Fakioglu, E; Queenan, A M; Bush, K; Jenkins, S G; Herold, B C

    2006-08-01

    Antibiotic resistance is a global health priority. Major defenses for Gram-negative bacteria are beta-lactamase enzymes, which have co-evolved with the development and increasing utilization of new antibiotics. Bacteria harboring the plasmid-mediated AmpC enzymes are increasingly prevalent among adult patients, but have not previously been reported in neonates. Early-onset neonatal meningitis caused by an AmpC beta-lactamase-producing Escherichia coli is described for the first time; the plasmid was identified as a transferable CMY-2 family beta-lactamase. Limited experience with newer antibiotics and pharmacokinetics in neonates presents a therapeutic challenge. Currently, there are no Clinical Laboratory Standards Institute (CLSI) recommendations for detecting AmpC nor is the optimal treatment for AmpC-producing organisms known. Thus, it is imperative that clinicians have a high index of suspicion when antimicrobial susceptibility patterns are inconsistent. Development of better microbiology screening tests to rapidly detect resistance is essential. Additionally, pharmacokinetic studies with newer antibiotics in neonates are warranted. PMID:16871223

  19. Is multiresistant Klebsiella pneumoniae New Delhi metallo-beta-lactamase (NDM-1) a new threat for kidney transplant recipients?

    PubMed

    Karczewski, M; Tomczak, H; Piechocka-Idasiak, I; Cichanska, L; Adamska, Z; Stronka, M

    2014-09-01

    Urinary tract infections (UTIs) are the most frequent infections among kidney transplant (KT) patients. This case documents the emergence of New Delhi metallo-beta-lactamase (NDM-1) Klebsiella pneumonia--a factor of recurrent post-KT UTI, leading to graft loss. Spreading globally, and multidrug resistant, NDM-1 may become a great threat to transplant patients all over the world. PMID:25242796

  20. Studies on structure-based sequence alignment and phylogenies of beta-lactamases

    PubMed Central

    Salahuddin, Parveen; Khan, Asad U

    2014-01-01

    The β-lactamases enzymes cleave the amide bond in β-lactam ring, rendering β-lactam antibiotics harmless to bacteria. In this communication we have studied structure-function relationship and phylogenies of class A, B and D beta-lactamases using structure-based sequence alignment and phylip programs respectively. The data of structure-based sequence alignment suggests that in different isolates of TEM-1, mutations did not occur at or near sequence motifs. Since deletions are reported to be lethal to structure and function of enzyme. Therefore, in these variants antibiotic hydrolysis profile and specificity will be affected. The alignment data of class A enzyme SHV-1, CTX-M-15, class D enzyme, OXA-10, and class B enzyme VIM-2 and SIM-1 show sequence motifs along with other part of polypeptide are essentially conserved. These results imply that conformations of betalactamases are close to native state and possess normal hydrolytic activities towards beta-lactam antibiotics. However, class B enzyme such as IMP-1 and NDM-1 are less conserved than other class A and D studied here because mutation and deletions occurred at critically important region such as active site. Therefore, the structure of these beta-lactamases will be altered and antibiotic hydrolysis profile will be affected. Phylogenetic studies suggest that class A and D beta-lactamases including TOHO-1 and OXA-10 respectively evolved by horizontal gene transfer (HGT) whereas other member of class A such as TEM-1 evolved by gene duplication mechanism. Taken together, these studies justify structure-function relationship of beta-lactamases and phylogenetic studies suggest these enzymes evolved by different mechanisms. PMID:24966539

  1. Studies on structure-based sequence alignment and phylogenies of beta-lactamases.

    PubMed

    Salahuddin, Parveen; Khan, Asad U

    2014-01-01

    The β-lactamases enzymes cleave the amide bond in β-lactam ring, rendering β-lactam antibiotics harmless to bacteria. In this communication we have studied structure-function relationship and phylogenies of class A, B and D beta-lactamases using structure-based sequence alignment and phylip programs respectively. The data of structure-based sequence alignment suggests that in different isolates of TEM-1, mutations did not occur at or near sequence motifs. Since deletions are reported to be lethal to structure and function of enzyme. Therefore, in these variants antibiotic hydrolysis profile and specificity will be affected. The alignment data of class A enzyme SHV-1, CTX-M-15, class D enzyme, OXA-10, and class B enzyme VIM-2 and SIM-1 show sequence motifs along with other part of polypeptide are essentially conserved. These results imply that conformations of betalactamases are close to native state and possess normal hydrolytic activities towards beta-lactam antibiotics. However, class B enzyme such as IMP-1 and NDM-1 are less conserved than other class A and D studied here because mutation and deletions occurred at critically important region such as active site. Therefore, the structure of these beta-lactamases will be altered and antibiotic hydrolysis profile will be affected. Phylogenetic studies suggest that class A and D beta-lactamases including TOHO-1 and OXA-10 respectively evolved by horizontal gene transfer (HGT) whereas other member of class A such as TEM-1 evolved by gene duplication mechanism. Taken together, these studies justify structure-function relationship of beta-lactamases and phylogenetic studies suggest these enzymes evolved by different mechanisms. PMID:24966539

  2. Prevalence of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates in Nosocomial and Community-Acquired Urinary Tract Infections

    PubMed Central

    Latifpour, Mohammad; Gholipour, Abolfazl; Damavandi, Mohammad Sadegh

    2016-01-01

    Background Klebsiella pneumoniae is a family member of Enterobacteriaceae. Isolates of K. pneumoniae produce enzymes that cause decomposition of third generation cephalosporins. These enzymes are known as extended-spectrum beta-lactamase (ESBL). Resistance of K. pneumoniae to beta-lactamase antibiotics is commonly mediated by beta-lactamase genes. Objectives The aim of this study was to identify the ESBL produced by K. pneumoniae isolates that cause community-acquired and nosocomial urinary tract infections within a one-year period (2013 to 2014) in Kashani and Hajar university hospitals of Shahrekord, Iran. Patients and Methods From 2013 to 2014, 150 strains of K. pneumoniae isolate from two different populations with nosocomial and community-acquired infections were collected. The strains were then investigated by double disk synergism and multiplex polymerase chain reaction (PCR). Results The study population of 150 patients with nosocomial and community-acquired infections were divided to two groups of 75 each. We found that 48 of the K. pneumoniae isolates in the patients with nosocomial infection and 39 isolates in those with community-acquired infections produced ESBL. The prevalence of TEM1, SHV1 and VEB1 in ESBL-producing isolates in nosocomial patients was 24%, 29.3% and 10.6%, and in community-acquired patients, 17.3%, 22.7% and 8%, respectively. Conclusions The prevalence of ESBL-producing K. pneumoniae isolate is of great concern; therefore, continuous investigation seems essential to monitor ESBL-producing bacteria in patients with nosocomial and community-acquired infections. PMID:27226874

  3. OXA-46, a new class D beta-lactamase of narrow substrate specificity encoded by a blaVIM-1-containing integron from a Pseudomonas aeruginosa clinical isolate.

    PubMed

    Giuliani, Francesco; Docquier, Jean-Denis; Riccio, Maria Letizia; Pagani, Laura; Rossolini, Gian Maria

    2005-05-01

    A novel OXA-type enzyme, named OXA-46, was found to be encoded by a gene cassette inserted into a class 1 integron from a multidrug-resistant Pseudomonas aeruginosa clinical isolate. The variable region of the integron also contained a bla(VIM-1) metallo-beta-lactamase cassette and a duplicated aacA4 aminoglycoside acetyltransferase cassette. OXA-46 belongs to the OXA-2 lineage of class D beta-lactamases. It exhibits 78% sequence identity with OXA-2 and the highest similarity (around 92% identity) with another OXA-type enzyme detected in clinical isolates of Burkholderia cepacia and in unidentified bacteria from a wastewater plant. Expression of bla(OXA-46) in Escherichia coli decreased susceptibility to penicillins and narrow-spectrum cephalosporins but not to extended-spectrum cephalosporins, cefsulodin, aztreonam, or carbapenems. The enzyme was overproduced in E. coli and purified by two anion-exchange chromatography steps (approximate yield, 6 mg/liter). OXA-46 was made of a 28.5-kDa polypeptide and exhibited an alkaline pI (7.8). In its native form OXA-46 appeared to be dimeric, and the oligomerization state was not affected by EDTA. Kinetic analysis of OXA-46 revealed a specificity for narrow-spectrum substrates, including oxacillin, other penicillins (but not temocillin), and narrow-spectrum cephalosporins. The enzyme apparently did not interact with temocillin, oxyimino-cephalosporins, or aztreonam. OXA-46 was inactivated by tazobactam and carbapenems and, although less efficiently, also by clavulanic acid. Enzyme activity was not affected either by EDTA or by divalent cations and exhibited low susceptibility to NaCl. These findings underscore the functional and structural diversity that can be encountered among class D beta-lactamases. PMID:15855521

  4. qnrA prevalence in extended-spectrum beta-lactamase-positive Enterobacteriaceae isolates from Turkey.

    PubMed

    Oktem, I Mehmet Ali; Gulay, Zeynep; Bicmen, Meral; Gur, Deniz

    2008-01-01

    Quinolone resistance mostly originates from chromosomal mutations. In recent years, however, plasmid-mediated quinolone resistance has been reported in several parts of the world. Plasmid-borne qnrA, qnrB, or qnrS genes are responsible for this kind of resistance. Little is known about the diversity, type, and species range of the qnr genes in Turkey. We screened qnrA, qnrB, and qnrS genes in quinolone-resistant blood culture isolates collected from six different medical centers in Turkey which produced extended-spectrum beta-lactamases (ESBLs). A total of 78 ESBL-positive isolates were enrolled in this study. Of these, 37 (47.4%) were nalidixic-acid resistant or intermediate. qnrA was found on large plasmids isolated from five (6.4%) of the Nal(I/R) isolates. In three of these, the same plasmid also carried bla(CTX-M). Four of the qnrA-positive isolates were Klebsiella pneumoniae from Dokuz Eylul University Hospital, Izmir, and the fifth isolate was Escherichia coli from Istanbul University Hospital. Two of the isolates from Izmir were found by enterobacterial repetitive interegenic consensus sequence-PCR to be clonally related. This is the first report on the qnrA prevalence among ESBL-positive blood culture isolates collected from different regions in Turkey. According to our results, plasmid-mediated resistance is a potential problem for the spread of quinolone resistance, and this mechanism could be emerging strongly among the ESBL-positive Enterobacteriaceae in Turkey. PMID:18219128

  5. Trends in Extended Spectrum Beta-Lactamase (ESBL) Producing Enterobacteriaceae and ESBL Genes in a Dutch Teaching Hospital, Measured in 5 Yearly Point Prevalence Surveys (2010-2014)

    PubMed Central

    Willemsen, Ina; Oome, Stijn; Verhulst, Carlo; Pettersson, Annika; Verduin, Kees; Kluytmans, Jan

    2015-01-01

    This paper describes the trends in prevalence of ESBL producing Enterobacteriaceae (ESBL-E) and ESBL genes, measured in five consecutive yearly Point Prevalence Surveys (PPS). All patients present in the hospital and in a day-care clinic (including patients on dialysis) on the day of the survey, were screened for perianal ESBL-E carriage. Perianal swabs were taken and cultured using an enrichment broth and a selective agar plate. Both phenotypic and genotypic methods were used to detect the production of ESBL, presence of ESBL-genes and clonal relatedness. Out of 2,695 patients, 135 (5.0%) were tested ESBL-E positive. The overall ESBL-E prevalence was stable over the years. Overall 5.2% of all ESBL-E were acquired by nosocomial transmission. A relative decrease of CTX-M-1-1-like ESBL genes (from 44 to 25%, p = 0.026) was observed, possibly related to the strong (>60%) decrease in antibiotic use in livestock in our country during the same period. PMID:26528549

  6. Extended-spectrum beta-lactamases among Enterobacteriaceae isolated in a public hospital in Brazil.

    PubMed

    Dropa, Milena; Balsalobre, Livia C; Lincopan, Nilton; Mamizuka, Elsa M; Murakami, Thays; Cassettari, Valéria C; Franco, Fábio; Guida, Stella M; Balabakis, Angelica J; Passadore, Lilian F; Santos, Silvia R; Matté, Glavur R; Matté, Maria H

    2009-01-01

    Extended-spectrum beta-lactamases (ESBL) in enterobacteria are recognized worldwide as a great hospital problem. In this study, 127 ESBL-producing Enterobacteriaceae isolated in one year from inpatients and outpatients at a public teaching hospital at São Paulo, Brazil, were submitted to analysis by PCR with specific primers for bla SHV, bla TEM and bla CTX-M genes. From the 127 isolates, 96 (75.6%) Klebsiella pneumoniae, 12 (9.3%) Escherichia coli, 8 (6.2%) Morganella morganii, 3 (2.3%) Proteus mirabilis, 2 (1.6%) Klebsiella oxytoca, 2 (1.6%) Providencia rettgeri, 2 (1.6%) Providencia stuartti, 1 (0.8%) Enterobacter aerogenes and 1 (0.8%) Enterobacter cloacae were identified as ESBL producers. Bla SHV, bla TEM and bla CTX-M were detected in 63%, 17.3% and 33.9% strains, respectively. Pulsed field gel eletrophoresis genotyping of K. pneumoniae revealed four main molecular patterns and 29 unrelated profiles. PCR results showed a high variety of ESBL groups among strains, in nine different species. The results suggest the spread of resistance genes among genetically different strains of ESBL-producing K. pneumoniae in some hospital wards, and also that some strongly related strains were identified in different hospital wards, suggesting clonal spread in the institutional environment. PMID:19739000

  7. Activities of beta-lactam antibiotics against Escherichia coli strains producing extended-spectrum beta-lactamases.

    PubMed

    Jacoby, G A; Carreras, I

    1990-05-01

    Seven extended-spectrum beta-lactamases related to TEM and four enzymes derived from SHV-1 were transferred to a common Escherichia coli host so that the activity of a variety of beta-lactams could be tested in a uniform genetic environment. For most derivatives, penicillinase activity was 10% or less than that of strains making TEM-1, TEM-2, or SHV-1 beta-lactamase, suggesting that reduced catalytic efficiency accompanied the broader substrate spectrum. Despite this deficit, resistance to aztreonam, carumonam, cefdinir, cefepime, cefixime, cefmenoxime, cefotaxime, cefotiam, cefpirome, cefpodoxime, ceftazidime, ceftibuten, ceftizoxime, ceftriaxone, cefuroxime, and E1040 was enhanced. For strains producing TEM-type enzymes, however, MICs of carumonam, cefepime, cefmenoxime, cefotiam, cefpirome, and ceftibuten were 8 micrograms/ml or less. Susceptibilities of cefmetazole, cefotetan, cefoxitin, flomoxef, imipenem, meropenem, moxalactam, temocillin, FCE 22101, and Sch 34343 were unaffected. FCE 22101, imipenem, meropenem, and Sch 34343 were inhibitory for all strains at 1 microgram/ml or less. In E. coli an OmpF- porin mutation in combination with an extended-spectrum beta-lactamase enhanced resistance to many of these agents, but generally by only fourfold. Hyperproduction of chromosomal AmpC beta-lactamase increased resistance to 7-alpha-methoxy beta-lactams but not that to temocillin. When tested at 8 micrograms/ml, clavulanate was more potent than sulbactam or tazobactam in overcoming resistance to ampicillin, while cefoperazone-sulbactam was more active than ticarcillin-clavulanate or piperacillin-tazobactam, especially against TEM-type extended-spectrum beta-lactamases. PMID:2193623

  8. The prevalence of Escherichia coli strains with extended spectrum beta-lactamases isolated in China

    PubMed Central

    Liu, Haihong; Wang, Yueling; Wang, Gang; Xing, Quantai; Shao, Lihua; Dong, Xiaomeng; Sai, Lintao; Liu, Yongjuan; Ma, Lixian

    2015-01-01

    The extended-spectrum-lactamases-producing Escherichia coli has rapidly spread worldwide. Escherichia coli has been becoming much more resistant to β-lactam antibiotics and other commonly available antimicrobials. We investigated the prevalence, resistance, and probable gene type of extended spectrum beta-lactamases (ESBLs) using minimum inhibitory concentrations (MICs) testing and polymerase chain reaction (PCR). We have collected 289 single-patient E. coli Isolates based on samples of China from July 2013 to August 2014. This article explored that the prevalence of ESBL-producing Isolates showed multi-resistant to antimicrobials such as fluoroquinolones, trimethoprim, tetracycline and aminoglycosides, and so on. The frequencies of resistance in Isolates were as follows: Ciprofloxacin, 74%, gentamicin, 69.5%, levofloxacin, 63%, tobramycin, 39%, and minocycline, 7.9%. According to our results, 197(68.2%) of the total 289 Isolates were ESBL-producing strains; further, 172 (87.3%) producers contained genes encoding CTX-M enzymes and 142(72.1%) producers contained genes encoding TEM enzymes. Most ESBL-producing Escherichia coli has produced more than one type of β-lactamase. Nucleotide sequence analysis has revealed the diversity of ESBLs types: CTX-M -15 is in the majority and TEM-135, CTX-M-3, CTX-M-98, CTX-M-14, CTX-M-142, CTX-M-65, CTX-M-55, CTX-M-27, and CTX-M-123 have been recovered. The results confirm that ESBL producers which are common in hospital strains of Escherichia coli are resistant to cephalosporins and other antibiotics in China. It is important to monitor such strains closely and provide scientific evidence of rational application of antibiotics to prevent their spread. PMID:25954262

  9. Evaluation of the new VITEK 2 extended-spectrum beta-lactamase (ESBL) test for rapid detection of ESBL production in Enterobacteriaceae isolates.

    PubMed

    Spanu, Teresa; Sanguinetti, Maurizio; Tumbarello, Mario; D'Inzeo, Tiziana; Fiori, Barbara; Posteraro, Brunella; Santangelo, Rosaria; Cauda, Roberto; Fadda, Giovanni

    2006-09-01

    Extended-spectrum beta-lactamases (ESBLs) are a large, rapidly evolving group of enzymes that confer resistance to oxyimino cephalosporins and monobactams and are inhibited by clavulanate. Rapid reliable detection of ESBL production is a prerequisite for successful infection management and for monitoring resistance trends and implementation of intervention strategies. We evaluated the performance of the new VITEK 2 ESBL test system (bioMérieux, Inc, Hazelwood, Mo.) in the identification of ESBL-producing Enterobacteriaceae isolates. We examined a total of 1,129 clinically relevant Enterobacteriaceae isolates (including 218 that had been previously characterized). The ESBL classification furnished by the VITEK 2 ESBL test system was concordant with that of the comparison method (molecular identification of beta-lactamase genes) for 1,121 (99.3%) of the 1,129 isolates evaluated. ESBL production was correctly detected in 306 of the 312 ESBL-producing organisms (sensitivity, 98.1%; positive predictive value, 99.3%). False-positive results emerged for 2 of the 817 ESBL-negative isolates (specificity, 99.7%; negative predictive value, 99.3%). VITEK 2 ESBL testing took 6 to 13 h (median, 7.5 h; mean +/- SD, 8.2 +/- 2.39 h). This automated short-incubation system appears to be a rapid and reliable tool for routine identification of ESBL-producing isolates of Enterobacteriaceae. PMID:16954257

  10. Prevalence of plasmid-mediated AmpC beta-lactamases among Enterobacteriaceae in Algiers hospitals.

    PubMed

    Iabadene, Hassen; Messai, Yamina; Ammari, Houria; Alouache, Souhila; Verdet, Charlotte; Bakour, Rabah; Arlet, Guillaume

    2009-10-01

    The aim of this study was to investigate the prevalence and diversity of plasmid-mediated AmpC cephalosporinases (PAcBLs) in clinical isolates of Enterobacteriaceae collected between 2003 and 2007 from three Algiers hospitals. Antibiograms were determined on Mueller-Hinton agar plates using the disk diffusion method, and minimum inhibitory concentrations were determined by Etest. Isolates resistant to cefoxitin or ceftazidime were screened for bla(CMY), bla(DHA), bla(FOX) and bla(ACC) as well as extended-spectrum beta-lactamase (ESBL) genes by polymerase chain reaction (PCR). PCR products were sequenced by the Sanger method. Plasmid incompatibility grouping was conducted by PCR-based replicon typing. The prevalence of PAcBLs was 2.18% (11/505), comprising 8 CMY-2 and 3 DHA-1 enzymes. CTX-M-15 was co-produced with CMY-2 in three isolates and with DHA-1 in one isolate; the two remaining DHA-1-producers co-expressed SHV-12 ESBL. This is the first report of plasmid-mediated AmpC from Algeria, with the first detection of DHA-1 in Enterobacter cloacae. PMID:19570655

  11. NDM-1 (New Delhi metallo beta lactamase-1) producing Gram-negative bacilli: Emergence & clinical implications

    PubMed Central

    Fomda, Bashir Ahmad; Khan, Asiya; Zahoor, Danish

    2014-01-01

    Backgound & objectives: Resistance to carbapenems in Gram-negative bacteria conferred by NDM-1 is a global health problem. We investigated the occurrence of NDM-1 in clinical isolates of Gram-negative bacilli in a tertiary care hospital in Kashmir valley, India. Methods: Gram-negative bacilli from different clinical isolates were included in the study. Antimicrobial susceptibility was performed by Kirby Bauer disk diffusion method and interpreted using Clinical Laboratory Standards Institute (CLSI) guidelines. Isolates resistant to carbapenems were subjected to different phenotypic test such as modified Hodge test (MHT), boronic acid and oxacillin based MHT (BA-MHT and OXA-MHT), combined disk test and minimum inhibitory concentration (MIC) with imipenem and imipenem -EDTA for determination of class B metallo enzymes. Presence of blaNDM-1 gene was established by PCR and confirmed by sequencing. Results: Of the total 1625 Gram-negative isolates received, 100 were resistant to imipenem. Of the 100 isolates, 55 (55%) were positive by modified Hodge test indicating carbapenemase production. Of the 100 isolates tested by MHT, BA-MHT and OXA-MHT, 29 (29%) isolates belonged to Class A and 15 (15%) to Class B, while 56 (56%) isolates were negative. Of the 15 class B metallo beta lactamase producers, nine carried the blaNDM-1 gene. NDM-1 was found among Escherichia coli (2 isolates), Klebsiella pneumoniae (2 isolates), Citrobacter freundii (3 isolates), Acinetobacter spp (1 isolate), and one isolate of Pseudomonas aeruginosa. Isolates were resistant to all antibiotic tested except polymyxin B and tigecycline. Interpretation & conclusions: Our study showed the presence of clinical isolates expressing NDM-1 in Srinagar, Jammu & Kashmir, India. These isolates harbour plasmid mediated multiple drug resistant determinants and can disseminate easily across several unrelated genera. To halt their spread, early identification of these isolates is mandatory. PMID:25579151

  12. Comparison between phenotypic and PCR for detection of OXA-23 type and metallo-beta-lactamases producer Acinetobacter spp.

    PubMed Central

    Azimi, Leila; Lari, Abdolaziz Rastegar; Talebi, Malihe; Namvar, Amirmorteza Ebrahimzadeh; Jabbari, Mosadegh

    2013-01-01

    Background: Resistance to carbapenems is developing around the world and can cause many problems for treatment of patients. Production of metallo-beta-lactamase (MBL) is one of the main mechanism for this type of resistance. So, detection of MBL-producer microorganisms can prevent the spread of this type of resistance. Materials and methods: In this study 94 Acinetobacter spp. were investigated. Resistance to imipenem was conducted after purification and identification. Combination disc (CD) and Double Disc Synergy Test (DDST) were performed for phenotypic detection of MBL and the molecular PCR method was done for vim-1, vim-2, imp-1 and OXA-23 genes. Results: According to TSI, SIM and oxidation-fermentation (OF) test and PCR assay 93 Acinetobacter baumannii and one strain Acinetobacter lwoffii were identified. 85% of them were resistant to imipenem. 34% of them have a positive combination disc test (CD) while Double Disc Synergy Test (DDST) was negative for all of them. The vim-1, vim-2 and imp-1 genes were not detected in PCR molecular method, however in 74% of strains with positive results in combination disc, were positive for the OXA-23 gene after PCR test. This study shows that the blaOXA-23 resistance determinant may become an emerging therapeutic problem. Discussion: According to the results, it seems that combination disc does not have enough specificity for detection of MBL-producer Acinetobacter and using Double Disc Synergy Test (DDST) can be more convenient. PMID:24327942

  13. Nuclear magnetic resonance spectrometric assay of beta-lactamase.

    PubMed Central

    Kono, M; O'Hara, K; Shiomi, Y

    1980-01-01

    Beta-Lactam antibiotics and the crude enzyme were mixed in deuterium oxide and placed in a nuclear magnetic resonance tube. The change of the nuclear magnetic resonance spectrum during the enzymatic reaction was then analyzed to determine beta-lactamase activity. By using beta-lactam antibiotics such as penicillins, cephalosporins, and cephamycins as substrates, a comparison of the beta-lactamase activities was made between the nuclear magnetic resonance spectrometric assay and the iodometric assay. There was a close correlation between these two methods. PMID:6986114

  14. Ligand-Dependent Disorder of Loop Observed in Extended-Spectrum SHV-Type beta-Lactamase

    SciTech Connect

    J Sampson; W Ke; C Bethel; S Pagadala; M Nottingham; R Bonomo; J Buynak; F van den Akker

    2011-12-31

    Among Gram-negative bacteria, resistance to {beta}-lactams is mediated primarily by {beta}-lactamases (EC 3.2.6.5), periplasmic enzymes that inactivate {beta}-lactam antibiotics. Substitutions at critical amino acid positions in the class A {beta}-lactamase families result in enzymes that can hydrolyze extended-spectrum cephalosporins, thus demonstrating an 'extended-spectrum' {beta}-lactamase (ESBL) phenotype. Using SHV ESBLs with substitutions in the {Omega} loop (R164H and R164S) as target enzymes to understand this enhanced biochemical capability and to serve as a basis for novel {beta}-lactamase inhibitor development, we determined the spectra of activity and crystal structures of these variants. We also studied the inactivation of the R164H and R164S mutants with tazobactam and SA2-13, a unique {beta}-lactamase inhibitor that undergoes a distinctive reaction chemistry in the active site. We noted that the reduced K{sub i} values for the R164H and R164S mutants with SA2-13 are comparable to those with tazobactam (submicromolar). The apo enzyme crystal structures of the R164H and R164S SHV variants revealed an ordered {Omega} loop architecture that became disordered when SA2-13 was bound. Important structural alterations that result from the binding of SA2-13 explain the enhanced susceptibility of these ESBL enzymes to this inhibitor and highlight ligand-dependent {Omega} loop flexibility as a mechanism for accommodating and hydrolyzing {beta}-lactam substrates.

  15. In vitro antibacterial activity and beta-lactamase stability of a new carbapenem, BO-2727.

    PubMed Central

    Inoue, K; Hamana, Y; Mitsuhashi, S

    1995-01-01

    The in vitro activity of BO-2727, a new carbapenem, was compared with those of meropenem, biapenem, imipenem, and ceftazidime. BO-2727 was four- or eightfold more active than the other carbapenems against methicillin-resistant staphylococci and Pseudomonas aeruginosa strains, including imipenem- and ceftazidime-resistant bacteria. BO-2727 was quite stable to penicillinases, cephalosporinases, and oxyiminocephalosporinases, but not to metallo-beta-lactamase. Time-kill studies against Staphylococcus aureus Smith, Escherichia coli ML4707, and P. aeruginosa GN11189 showed that BO-2727 has potent bactericidal activity at concentrations greater than the MIC. PMID:8619591

  16. Metallo-beta-lactamase inhibitory activity of phthalic acid derivatives.

    PubMed

    Hiraiwa, Yukiko; Morinaka, Akihiro; Fukushima, Takayoshi; Kudo, Toshiaki

    2009-09-01

    4-Butyl-3-methylphthalic acid was recognized as a metallo-beta-lactamase inhibitor. The structure-activity relationship study of substituted phthalic acids afforded 3-phenylphthalic acid derivatives as potent IMP-1 inhibitors. On the other hand, 3-substituted with 4-hydroxyphenyl phthalic acid derivative displayed a potent combination effect with biapenem (BIPM) against Pseudomonas aeruginosa that produce IMP-1. PMID:19632114

  17. Community faecal carriage of extended-spectrum beta-lactamase-producing Enterobacteriaceae in french children

    PubMed Central

    2012-01-01

    Background The increasing incidence of community acquired infection due to Extended-Spectrum Beta-Lactamase (ESBL) -Producing Enterobacteriaceae represent a great concern because there are few therapeutic alternatives. The fecal flora of children in the community can represent a reservoir for ESBLs genes which are located on highly transmissible plasmids and the spread of these genes among bacterial pathogens is concerning. Because intestinal carriage is a key factor in the epidemiology of ESBL-producing Enterobacteriaceae, the study of the prevalence of these resistant bacteria and risk factors in young children is of particular interest. Methods We assessed the prevalence and risk factors of community-acquired faecal carriage of extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae in children aged from 6 to 24 months, by means of rectal swabbing in community pediatric practices. Child’s lifestyle and risk factors for carriage of resistant bacteria were noted. Results Among the 411 children enrolled, 4.6% carried ESBL-producing Enterobacteriaceae. CTX-M-1, CTX-M-15 and CTX-M-14 were the predominant ESBLs. The 18 E. coli isolates were genetically heterogeneous. Recent third-generation oral-cephalosporin exposure was associated with a higher risk of ESBL carriage (AOR=3.52, 95% CI[1.06-11.66], p=0.04). Conclusions The carriage rate of ESBL-producing Enterobacteriacae in young children in the French community setting is noteworthy, underlining the importance of this population as a reservoir. Exposure to third-generation oral cephalosporins was associated with a significant risk of ESBL carriage in our study. Because of the significant public health implications including the treatment of community-acquired urinary tract infections, the spread of organisms producing ESBLs in the community merits close monitoring with enhanced efforts for surveillance. PMID:23171127

  18. Prevalence of extended-spectrum beta-lactamases produced by nosocomial isolates of Enterobacteriaceae in Trakya University Hospital, Turkey.

    PubMed

    Akata, F; Tatman-Otkun, M; Ozkan, E; Tansel, O; Otkun, M; Tugrul, M

    2003-07-01

    The prevalence of extended-spectrum beta-lactamase (ESBL) production by 194 nosocomial isolates of Enterobacteriacea recovered from 1995 to 1999 was investigated. The ESBL production was determined by the double-disk synergy test and was confirmed by the E-test ESBL strip. Twenty-three isolates (21 Klebsiella pneumoniae, one Escherichia coli, one Providencia rettgeri) were found as ESBL-producers (11.8%). These isolates were also usually resistant to non-betalactam antibiotics. Most of them contained a beta-lactamase with a pI of 7.6. All the strains conjugally transferred their ESBLs to recipient E. coli. Contrary to others, ESBL-producing K. pneumoniae strains isolated in 1999 were resistant to ciprofloxacin, and had the identical plasmid profiles suggestive of an outbreak. Ciprofloxacin resistance in these strains could not be transferred. In conclusion, K. pneumoniae was the main ESBL-producing species among nosocomial isolates of Enterobacteriacae in our hospital. PMID:12901421

  19. [First outbreak report of VIM-1 metallo-beta-lactamase producing Pseudomonas aeruginosa in Japan].

    PubMed

    Miki, Kanji; Takegawa, Hiroshi; Etoh, Masaaki; Hayashi, Michio; Haruta, Tsunekazu; Yamane, Kunikazu; Arakawa, Yoshichika

    2010-11-01

    VIM-1 metallo-beta-lactamase (MBL) producing Pseudomonas aeruginosa was isolated from 35 Kobe City Medical Center General Hospital patients from September 2007 to July 2008. All but one were highly resistant to all beta-lactams, aminoglycoside, and fluoroquinolone, and one susceptible to amikacin. Strains negative to a disk diffusion screening test using sodium mercaptoacetate for detecting MBL numbered 35. PCR for MBL indicated all strains were positive for bla(VIWM-1). These strains were indistinguishable by pulsed-field gel electrophoresis, indicating an outbreak of infections caused by VIM-1 MBL producing Pseudomonas aeruginosa. After intervention to control contact, the outbreak was controlled. PMID:21226324

  20. Impact of the New Delhi metallo-beta-lactamase on beta-lactam antibiotics

    PubMed Central

    Zmarlicka, Monika T; Nailor, Michael D; Nicolau, David P

    2015-01-01

    Since the first New Delhi metallo-beta-lactamase (NDM) report in 2009, NDM has spread globally causing various types of infections. NDM-positive organisms produce in vitro resistance phenotypes to carbapenems and many other antimicrobials. It is thus surprising that the literature examining clinical experiences with NDM does not report corresponding poor clinical outcomes. There are many instances where good clinical outcomes are described, despite a mismatch between administered antimicrobials and resistant in vitro susceptibilities. Available in vitro data for either monotherapy or combination therapy does not provide an explanation for these observations. However, animal studies do begin to shed more light on this phenomenon. They imply that the in vivo expression of NDM may not confer clinical resistance to all cephalosporin and carbapenem antibiotics as predicted by in vitro testing but other resistance mechanisms need to be present to generate a resistant phenotype. As such, previously abandoned therapies, particularly carbapenems and beta-lactamase inhibitor combinations, may retain utility against infections caused by NDM producers. PMID:26345624

  1. Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli Isolates possessing the plasmid-mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in intensive care units of a Chinese hospital.

    PubMed

    Cai, Jia Chang; Zhou, Hong Wei; Zhang, Rong; Chen, Gong-Xiang

    2008-06-01

    Twenty-one Serratia marcescens, ten Klebsiella pneumoniae, and one Escherichia coli isolate with carbapenem resistance or reduced carbapenem susceptibility were recovered from intensive care units (ICUs) in our hospital. Enterobacterial repetitive intergenic consensus-PCR and pulsed-field gel electrophoresis demonstrated that all the S. marcescens isolates belonged to a clonal strain and the 10 K. pneumoniae isolates were indistinguishable or closely related to each other. The MICs of imipenem, meropenem, and ertapenem for all isolates were 2 to 8 microg/ml, except for K. pneumoniae K10 (MICs of 128, 256, and >256 microg/ml). Isoelectric focusing, PCRs, and DNA sequencing indicated that all S. marcescens isolates produced KPC-2 and a beta-lactamase with a pI of 6.5. All K. pneumoniae isolates produced TEM-1, KPC-2, CTX-M-14, and a beta-lactamase with a pI of 7.3. The E. coli E1 isolate produced KPC-2, CTX-M-15, and a beta-lactamase with a pI of 7.3. Conjugation studies with E. coli (EC600) resulted in the transfer of reduced carbapenem susceptibility compared to that of the original isolates, and only the bla(KPC-2) gene was detected in E. coli transconjugants. Plasmid restriction analysis showed identical restriction patterns among all E. coli transconjugants. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and ompK35/36 gene sequence analysis of outer membrane proteins revealed that K. pneumoniae K10 failed to express OmpK36, because of insertional inactivation by an insertion sequence ISEcp1. All these results indicate that KPC-2-producing S. marcescens, K. pneumoniae, and E. coli isolates emerged in ICUs in our hospital. KPC-2 combined with porin deficiency results in high-level carbapenem resistance in K. pneumoniae. The same bla(KPC-2)-encoding plasmid was spread among the three different genera. PMID:18332176

  2. RESULTS OF MONITORING METALLO-BETA-LACTAMASE-PRODUCING STRAINS OF PSEUDOMONAS AERUGINOSA IN A MULTI-PROFILE HOSPITAL.

    PubMed

    Shamaeva, S K; Portnyagina, U S; Edelstein, M V; Kuzmina, A A; Maloguloval, S; Varfolomeeva, N A

    2015-01-01

    The authors present the results of long-term monitoring of metallo-beta-lactamase (MBL) producing strains of Pseudomonas aeruginosa in the Republican Hospital No 2 of Yakutsk, Russian Federation. Hospitals across Russia, as well as the rest of the world, face a rapid appearance and a virtually unchecked spread of multiresistant and panresistant nosocomial pathogens. Especially prevalent are multidrug-resistant isolates of P. aeruginosa, most often found among the patients of intensive care and intensive therapy units, as well as surgery departments. The aim of this study is to investigate the prevalence of metallo-beta-lactamase-producing strains of P. aeruginosa in a multi-profile hospital. 2,135 isolates of P. aeruginosa were studied, collected during a time span of seven years (2008-2014) from clinical specimens of hospitalised patients in acute surgery, purulent surgery, neurosurgery, otolaryngology, coloproctology departments, intensive care and intensive therapy, burn units, as well as intensive care unit for patients with acute cerebrovascular accidents and coronary care unit. Strains were identified and re-identified using established methods, NEFERMtest 24 (MICROLATEST) biochemical microtest and API (bioMerieux) test systems were used. For all carbapenem-resistant strains a phenotype screening for MBL was performed using the double-disks method with EDTA. In order to identify VIM-type and IMP-type MBL genes a real-time multiplex polymerase chain reaction was used. Among the investigated strains the largest number of P. aeruginosa - 35.6% (761 isolates) was found in patients at intensive care and intensive therapy units. Clonal expansion of extensively drug-resistant strain P. aeruginosa ST235 (VIM-2) was determined, the resistance mechanism of which is connected to MBL. Sensitivity determination of MBL-producing isolates of P. aeruginosa has shown that isolated strains have a high level of resistance (100%) to all tested antibacterial agents: piperacillin

  3. The Deacylation Mechanism of AmpC [beta]-Lactamase at Ultrahigh Resolution

    SciTech Connect

    Chen, Yu; Minasov, George; Roth, Tomer A.; Prati, Fabio; Shoichet, Brian K.

    2010-03-05

    {beta}-Lactamases confer bacterial resistance to {beta}-lactam antibiotics, such as penicillins. The characteristic class C {beta}-lactamase AmpC catalyzes the reaction with several key residues including Ser64, Tyr150, and Lys67. Here, we describe a 1.07 {angstrom} X-ray crystallographic structure of AmpC {beta}-lactamase in complex with a boronic acid deacylation transition-state analogue. The high quality of the electron density map allows the determination of many proton positions. The proton on the Tyr150 hydroxyl group is clearly visible and is donated to the boronic oxygen mimicking the deacylation water. Meanwhile, Lys67 hydrogen bonds with Ser64O{gamma}, Asn152O{delta}1, and the backbone oxygen of Ala220. This suggests that this residue is positively charged and has relinquished the hydrogen bond with Tyr150 observed in acyl-enzyme complex structures. Together with previous biochemical and NMR studies, these observations indicate that Tyr150 is protonated throughout the reaction coordinate, disfavoring mechanisms that involve a stable tyrosinate as the general base for deacylation. Rather, the hydroxyl of Tyr150 appears to be well positioned to electrostatically stabilize the negative charge buildup in the tetrahedral high-energy intermediate. This structure, in itself, appears consistent with a mechanism involving either Tyr150 acting as a transient catalytic base in conjunction with a neutral Lys67 or the lactam nitrogen as the general base. Whereas mutagenesis studies suggest that Lys67 may be replaced by an arginine, disfavoring the conjugate base mechanism, distinguishing between these two hypotheses may ultimately depend on direct determination of the pKa of Lys67 along the reaction coordinate.

  4. Reduced Susceptibility to Cefepime in Clinical Isolates of Enterobacteriaceae Producing OXA-1 Beta-Lactamase.

    PubMed

    Torres, Eva; López-Cerero, Lorena; Rodríguez-Martínez, José Manuel; Pascual, Álvaro

    2016-03-01

    An increase of Enterobacteriaceae isolates with reduced susceptibility to cefepime (FEP) and amoxicillin/clavulanate (AMC) has been observed in our area. The aim of this study was to characterize this antibiotic resistance phenotype and its molecular epidemiology. A total of 33 Enterobacteriaceae strains were studied. blaOXA-1 genes and their genetic environment were analyzed by polymerase chain reaction (PCR) and sequencing. Plasmids were transferred by conjugation and/or transformation and classified using PCR-based inc/rep typing and IncF subtyping. Escherichia coli isolates were typed by phylogroup, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing. Outer membrane proteins were studied by sodium dodecylsulfate-polyacrylamide gel electrophoresis and expression of blaOXA-1 genes by reverse transcription-PCR. FEP minimum inhibitory concentration yielded values of 1-16 mg/L. Twenty-nine (87.9%) isolates produced OXA-1, of which 24 (82.7%) were located in class 1 integron, and 9 (27.3%) produced TEM-1. Among the 24 E. coli OXA-1-producers, PFGE revealed two main clusters: one belonged to C-ST88 and the other to B23-ST131. Thirteen plasmids containing blaOXA-1 were transferred, nine belonged to IncF replicon (4 F2:A1:B-, 2 F1:A1:B1, 1 F1:A2:B-, 1 F18:A2:B1, 1 F5:A-:B1) and four were nontypeable. In conclusion, reduced susceptibility to FEP was mostly due to OXA-1 beta-lactamase. In E. coli, this increase is mainly due to the dissemination of two clones, which have captured different IncF plasmids. Among non-E. coli strains, five isolates produced OXA-1 and one isolate produced only TEM-1. PMID:26295796

  5. High prevalence of extended-spectrum and plasmidic AmpC beta-lactamase-producing Escherichia coli from poultry in Tunisia.

    PubMed

    Maamar, Elaa; Hammami, Samia; Alonso, Carla Andrea; Dakhli, Nouha; Abbassi, Mohamed Salah; Ferjani, Sana; Hamzaoui, Zaineb; Saidani, Mabrouka; Torres, Carmen; Boutiba-Ben Boubaker, Ilhem

    2016-08-16

    This study was conducted to detect extended spectrum beta-lactamases (ESBLs) and plasmidic AmpC beta-lactamase (pAmpC-BL)-producing Escherichia coli isolates in industrial poultry samples were collected from healthy chickens of the three farms. Samples were inoculated onto desoxycholate-lactose-agar plates supplemented with cefotaxime (2mg/L). E. coli was identified by biochemical and molecular methods and antibiotic susceptibility testing by the disk diffusion method. Genes encoding ESBLs and pAmpC-BL were detected by PCR and sequencing. Phylogenetic groups were determined by triplex PCR. The molecular typing of strains was done by pulsed field gel electrophoresis (PFGE) and Multilocus Sequence Typing (MLST) in those isolates showing different PFGE patterns. Cefotaxime-resistant E. coli isolates were recovered in 48 of 137 fecal samples (35%), and one isolate/sample was further studied. The following beta-lactamase genes were detected: blaCTX-M-1 (29 isolates, isolated in all three farms), blaCTX-M-15 (5 isolates, confined in farm II), blaCTX-M-14 and blaCMY-2 (one isolate and 13 isolates, respectively, in farm III). The 48 cefotaxime-resistant isolates were distributed into phylogroups: B1 (n=21), A (n=15) and D (n=12). PFGE analysis revealed 19 unrelated patterns: 15 different profiles among ESBL-positive strains and 4 among the CMY-2-positive isolates. The following sequence types-associated phylogroups were detected: a) CTX-M-1-positive strains: lineages ST542-B1, ST212-B1, ST58-B1, ST155-B1 and ST349-D; b) CTX-M-15-positive strain: lineage ST405-D; c) CTX-M-14-positive strain: lineage ST1056-B1; d) CMY-2-positive strains: lineages ST117-D, ST2197-A, and ST155-B1. Healthy chickens constitute an important reservoir of ESBL- and pAmpC-BL-producing E. coli isolates that potentially could be transmitted to humans via the food chain or by direct contact. PMID:27220012

  6. Inhibition of class A beta-lactamases by carbapenems: crystallographic observation of two conformations of meropenem in SHV-1.

    PubMed

    Nukaga, Michiyosi; Bethel, Christopher R; Thomson, Jodi M; Hujer, Andrea M; Distler, Anne; Anderson, Vernon E; Knox, James R; Bonomo, Robert A

    2008-09-24

    Carbapenem antibiotics are often the "last resort" in the treatment of infections caused by bacteria resistant to penicillins and cephalosporins. To understand why meropenem is resistant to hydrolysis by the SHV-1 class A beta-lactamase, the atomic structure of meropenem inactivated SHV-1 was solved to 1.05 A resolution. Two conformations of the Ser70 acylated intermediate are observed in the SHV-1-meropenem complex; the meropenem carbonyl oxygen atom of the acyl-enzyme is in the oxyanion hole in one conformation, while in the other conformation it is not. Although the structures of the SHV-1 apoenzyme and the SHV-1-meropenem complex are very similar (0.29 A rmsd for Calpha atoms), the orientation of the conserved Ser130 is different. Notably, the Ser130-OH group of the SHV-1-meropenem complex is directed toward Lys234Nz, while the Ser130-OH of the apo enzyme is oriented toward the Lys73 amino group. This altered position may affect proton transfer via Ser130 and the rate of hydrolysis. A most intriguing finding is the crystallographic detection of protonation of the Glu166 known to be involved in the deacylation mechanism. The critical deacylation water molecule has an additional hydrogen-bonding interaction with the OH group of meropenem's 6alpha-1 R-hydroxyethyl substituent. This interaction may weaken the nucleophilicity and/or change the direction of the lone pair of electrons of the water molecule and result in poor turnover of meropenem by the SHV-1 beta-lactamase. Using timed mass spectrometry, we further show that meropenem is covalently attached to SHV-1 beta-lactamase for at least 60 min. These observations explain key properties of meropenem's ability to resist hydrolysis by SHV-1 and lead to important insights regarding future carbapenem and beta-lactamase inhibitor design. PMID:18761444

  7. Biosynthesis of ketomycin. (II) biomimetic model for beta-lactamase catalysis: host-guest interactions in cyclodextrin-penicillin inclusion complex

    SciTech Connect

    Mak, H.W.

    1986-01-01

    The antibiotic ketomycin is formed from shikimic acid via chorismic acid and prephenic acid. Phenylalanine and 2',5'-dihydrophenylalanine derived from shikimic acid are not intermediates in the biosynthesis. Degradation of ketomycin derived from (1,6-/sup 14/C)shikimic acid showed that prephenic acid is converted into ketomycin with stereospecific discrimination between the two enantiotopic edges of the ring, the pro-S-R edge giving rise to the C-2', C-3' side of the cyclohexane ring of ketomycin. The resistance of pathogenic bacteria to the action of ..beta..-lactam antibiotics is mainly ascribed to their ability to produce ..beta..-lactamase to cleave the ..beta..-lactam ring. It is essential to understand the molecular nature of ..beta..-lactamase-penicillin recognition for designing and formulating more effective ..beta..-lactam antibiotics. A biomimetic study of ..beta..-lactamase is therefore initiated. To meet the requirements of hydrophobic and serine protease characteristics of ..beta..-lactamase, ..cap alpha..-cyclodextrin is chosen as a biomimetic model for ..beta..-lactamase. The structural specificity and the chemical dynamics of ..cap alpha..-cyclodextrin-phenoxymethyl penicillin inclusion complex in solid state and in solution have been determined by IR and NMR spectroscopy. The spectral results strongly indicate that the phenyl portion of the phenoxymethyl penicillin forms a stable inclusion complex with the hydrophobic cavity of ..cap alpha..-cyclodextrin in solution as well as in the solid state. Kinetic studies followed by /sup 1/HNMR and HPLC analyses under alkaline condition have shown that the ..cap alpha..-cyclodextrin mimics the catalytic function of serine of ..beta..-lactamase in the stereospecific hydrolysis of the ..beta..-lactam ring of phenoxymethyl penicillin.

  8. [TEM and CTX-M extended-spectrum beta-lactamase in Klebsiella spp and Escherichia coli isolates from inanimate surfaces of hospital environments].

    PubMed

    Rivera-Jacinto, Marco; Rodríguez-Ulloa, Claudia; Flores Clavo, René; Serquén López, Luis; Arce Gil, Zhandra

    2015-10-01

    The aim of the study was to determine the genotype of 15 ESBL strains of Enterobacteriaceae resistant to beta-lactams, isolated from inanimate surfaces and phenotypically characterized as producing extended-spectrum beta-lactamase. After evaluation and screening of the bacterial strains, a PCR was conducted to amplify fragments of 1078 bp and 544 bp corresponding to type TEM and CTX-M ESBL. Eleven strains presented both fragments at the time and only three had blaCTX-M. In conclusion, the presence of ESBL genes in cultures from the environment was demonstrated, some of which may belong to more than one type. This information could serve as a basis for implementing preventive measures to prevent the transmission of multiresistant bacteria from inanimate surfaces to patients, mainly in critical hospital areas. PMID:26732925

  9. Relative importances of outer membrane permeability and group 1 beta-lactamase as determinants of meropenem and imipenem activities against Enterobacter cloacae.

    PubMed Central

    Cornaglia, G; Russell, K; Satta, G; Fontana, R

    1995-01-01

    The roles of outer membrane permeability and Bush group 1 beta-lactamase activity in determining Enterobacter cloacae susceptibility to either meropenem or imipenem were investigated. A beta-lactamase-deficient strain was obtained by mutagenesis from a clinical isolate of E. cloacae, and a porin-deficient strain was selected from this mutant with cefoxitin. Both strains were transformed with the plasmid pAA20R, which contained the gene coding for the carbapenem-hydrolyzing CphA beta-lactamase, and the carbapenem permeability coefficients were measured by the Zimmermann and Rosselet technique (W. Zimmermann and A. Rosselet, Antimicrob. Agents Chemother. 12:368-372, 1977). The permeability coefficient of meropenem was roughly half that of imipenem in the normally permeable strain and almost seven times lower than that of imipenem in the porin-deficient strain. In the porin-deficient strain, the virtual absence of porins caused the MICs of meropenem to increase from 8 to 16 times, while it did not affect the MICs of imipenem. Conversely, the beta-lactamase affected imipenem but not meropenem activity: meropenem showed a similar activity in the parent strain and in the beta-lactamase-deficient mutant with both a low- and high-density inoculum, whereas imipenem was 16 times less active against the parent strain when the high-density inoculum was used. It is concluded that outer membrane permeability and stability to group 1 beta-lactamase have different impacts on the activities of meropenem and imipenem against E. cloacae. PMID:7726496

  10. Molecular modeling and docking analysis of beta-lactamases with inhibitors: a comparative study.

    PubMed

    Danishuddin, Mohd; Khan, Asad U

    Beta-lactamases are bacterial enzymes which impart resistance against β-lactam-antibiotics. CTX-Ms are the β-lactamases that target cephalosporin antibiotics (e.g. cefotaxime and ceftazidime) while SME-1, KPC-2, IMI-1 and SFC-1 target carbapenems. Clavulanic acid, sulbactam and tazobactam are traditional β-lactamase inhibitors while LN1-255 and NXL-104 whereas novel inhibitors, inhibiting the activity of these enzymes. Studying the binding pattern of these drugs is helpful in predicting the versatile inhibitors for betalactamases. The aims of the study were: describing the mode of interaction of CTX-M (modeled from the blaCTX-M gene of this study) and the said carbapenemases with their respective target drugs and inhibitors and to perform an in silico comparison of the efficacies of traditional and novel β-lactamase-inhibitors based on fitness score. The blaCTX-M marker was PCR-amplified from plasmid DNA of E. coli strain isolated from community-acquired urinary tract infection. E. coli C600 cells (harboring cloned blaCTX-M) were found positive for extended-spectrum-β-lactamase (ESBL) production by the double-disk-synergy test. The three dimensional structures of CTX-M-15, SME-1 and IMI-1 were predicted by Swiss Model Server. The interaction between selected structures and inhibitors was performed by GOLD 5.0. On the basis of the docking score and binding pattern, we conclude that compound LN1-255 followed by tazobactam is best inhibitor against all the selected target enzymes as compared to clavulanate, sulbactam and NXL-104. Five conserved amino acids, Ser70, Ser130, Lys235, Thr236 and Gly237 were found crucial in stabilizing the complexes through hydrogen bonding and hydrophobic interactions. PMID:23202428

  11. Effect of tannin extract against Pseudomonas aeruginosa producing metallo beta-lactamase.

    PubMed

    Ghafourian, S; Mohebi, R; Sekawi, Z; Raftari, M; Neela, V; Ghafourian, E; Aboualigalehdari, E; Rahbar, M; Sadeghifard, N

    2012-01-01

    Carbapenems are the most potent beta-lactam agents with a broad-spectrum activity against Gram-negative and Gram-positive bacteria. They are stable in the presence of penicillinases and cephalosporinases. This study was focused on frequency of metallo beta- lactamase (MBL) among Pesudomonas aeruginosa strains isolated in patients with urinary tract infection, effect of tannin against PA positive strains which produced blaVIM or blaIMP and both of these genes (Species). Detection of MBL was performed by phonotypic and genotypic methods. Tannin extract was tested against P. aeruginosa producing MBL. During the study period, 240 P. aeruginosa isolates were identified. Among them 64 (26.6 percent) isolates were imipenem non-susceptible and confirmed by imipenem/EDTA. Our results revealed that the growth of blaVIM positive P. aeruginosa inhibited at 15 microg/ml concentration. The experiment repeated for blaIMP-positive P. aeruginosa and P. aeruginosa which harbored blaIMP and blaVIM, the results showed 35 microg/ml was the best concentration for inhibition of P. aeruginosa-positive blaIMP and also P. aeruginosa blaIMP and blaVIM. In conclusion, tannin was effective against P. aeruginosa producing blaVIM and blaIMP and both of them so it can be substituted with common antibiotics. The result showed significantly P. aeruginosa-harbored blaIMP was more responsible for imipenem resistance than P. aeruginosa-positive blaVIM. Interestingly, tannin was more effective against MBL-P. aeruginosa in comparison with current antibiotics. PMID:22824750

  12. Antimicrobial susceptibility pattern of extended-spectrum beta- lactamase producing Klebsiella pneumoniae clinical isolates in an Indian tertiary hospital

    PubMed Central

    Singh, Amit Kumar; Jain, Sonali; Kumar, Dinesh; Singh, Ravinder Pal; Bhatt, Hitesh

    2015-01-01

    Objective: There is an increased prevalence of extended-spectrum beta-lactamase producing Klebsiella pneumoniae (ESBL-KP) worldwide including India, which is a major concern for the clinicians, especially in intensive care units and pediatric patients. This study aims to determine the prevalence of ESBL-KP and antimicrobial sensitivity profile to plan a proper hospital infection control program to prevent the spread of resistant strains. Methods: KP isolates obtained from various clinical samples were evaluated to detect the production of ESBL by phenotypic methods. Antimicrobial susceptibility profile was also determined of all the isolates. Findings: Of 223 nonduplicate isolates of K. pneumoniae, 114 (51.1%) were ESBL producer and antimicrobial susceptibility profile showed the isolates were uniformly sensitive to imipenem and highly susceptible to beta-lactamase inhibitor combination drugs (67–81%) and aminoglycosides (62–76%), but less susceptible to third generation cephalosporins (14–24%) and non-β-lactam antibiotics such as nitrofurantoin (57%), fluoroquinolones (29–57%), piperacillin (19–23%), and aztreonam (15–24%). Conclusion: This study found that beta-lactamase inhibitor combinations are effective in treatment of such infections due to ESBL-KP thus these drugs should be a part of the empirical therapy and carbapenems should be used when the antimicrobial susceptibility tests report resistance against inhibitors combinations. PMID:26312255

  13. In vitro activity of LK-157, a novel tricyclic carbapenem as broad-spectrum {beta}-lactamase inhibitor.

    PubMed

    Paukner, Susanne; Hesse, Lars; Prezelj, Andrej; Solmajer, Tomaz; Urleb, Uros

    2009-02-01

    LK-157 is a novel tricyclic carbapenem with potent activity against class A and class C beta-lactamases. When tested against the purified TEM-1 and SHV-1 enzymes, LK-157 exhibited 50% inhibitory concentrations (IC(50)s) in the ranges of the clavulanic acid and tazobactam IC(50)s (55 nM and 151 nM, respectively). Moreover, LK-157 significantly inhibited AmpC beta-lactamase (IC(50), 62 nM), as LK-157 was >2,000-fold more potent than clavulanic acid and approximately 28-fold more active than tazobactam. The in vitro activities of LK-157 in combination with amoxicillin, piperacillin, ceftazidime, cefotaxime, ceftriaxone, cefepime, cefpirome, and aztreonam against an array of Ambler class A (TEM-, SHV-, CTX-M-, KPC-, PER-, BRO-, and PC-type)- and class C-producing bacterial strains derived from clinical settings were evaluated in synergism experiments and compared with those of clavulanic acid, tazobactam, and sulbactam. In vitro MICs against ESBL-producing strains (except CTX-M-containing strains) were reduced 2- to >256-fold, and those against AmpC-producing strains were reduced even up to >32-fold. The lowest MICs (< or =0.025 to 1.6 microg/ml) were observed for the combination of cefepime and cefpirome with a constant LK-157 concentration of 4 microg/ml, thus raising an interest for further development. LK-157 proved to be a potent beta-lactamase inhibitor, combining activity against class A and class C beta-lactamases, which is an absolute necessity for use in the clinical setting due to the worldwide increasing prevalence of bacterial strains resistant to beta-lactam antibiotics. PMID:19075067

  14. The 1.4 Å Crystal Structure of the Class D [beta]-Lactamase OXA-1 Complexed with Doripenem

    SciTech Connect

    Schneider, Kyle D.; Karpen, Mary E.; Bonomo, Robert A.; Leonard, David A.; Powers, Rachel A.

    2010-01-12

    The clinical efficacy of carbapenem antibiotics depends on their resistance to the hydrolytic action of {beta}-lactamase enzymes. The structure of the class D {beta}-lactamase OXA-1 as an acyl complex with the carbapenem doripenem was determined to 1.4 {angstrom} resolution. Unlike most class A and class C carbapenem complexes, the acyl carbonyl oxygen in the OXA-1-doripenem complex is bound in the oxyanion hole. Interestingly, no water molecules were observed in the vicinity of the acyl linkage, providing an explanation for why carbapenems inhibit OXA-1. The side chain amine of K70 remains fully carboxylated in the acyl structure, and the resulting carbamate group forms a hydrogen bond to the alcohol of the 6{alpha}-hydroxyethyl moiety of doripenem. The carboxylate attached to the {beta}-lactam ring of doripenem is stabilized by a salt bridge to K212 and a hydrogen bond with T213, in lieu of the interaction with an arginine side chain found in most other {beta}-lactamase-{beta}-lactam complexes (e.g., R244 in the class A member TEM-1). This novel set of interactions with the carboxylate results in a major shift of the carbapenem's pyrroline ring compared to the structure of the same ring in meropenem bound to OXA-13. Additionally, bond angles of the pyrroline ring suggest that after acylation, doripenem adopts the {Delta}{sup 1} tautomer. These findings provide important insights into the role that carbapenems may have in the inactivation process of class D {beta}-lactamases.

  15. Metallo-beta-lactamase IMP-1 in Providencia rettgeri from two different hospitals in Japan.

    PubMed

    Shiroto, Katsuaki; Ishii, Yoshikazu; Kimura, Soichiro; Alba, Jimena; Watanabe, Kiwao; Matsushima, Yoshiko; Yamaguchi, Keizo

    2005-11-01

    In 2002, 495 indole-positive proteae strains were isolated from patients at 60 hospitals in Japan. Nine indole-positive proteae strains had reduced susceptibility to imipenem (MIC > or = 8 microg ml(-1)) and were identified as Providencia rettgeri by BD Phoenix. Eight of the nine Prov. rettgeri isolates were confirmed as metallo-beta-lactamase producers by the double-disc synergy test. All the metallo-beta-lactamases were classified as IMP-1 by PCR and DNA sequence analysis. These bla(IMP-1) genes were encoded in the integron structure on conjugative plasmids. These plasmids could transfer from Prov. rettgeri clinical isolates to Escherichia coli ML4903 at a frequency between 1.5 x 10(-5) and 5.5 x 10(-7). The eight bla(IMP)-positive strains were isolated from two hospitals, and showed two different PFGE patterns, two different integron structures and two different incompatibility groups, which corresponded to the two hospitals. These results strongly suggest the possibility of nosocomial infections by bla(IMP-1)-producing Prov. rettgeri isolates. PMID:16192438

  16. Prevalence of antimicrobial resistance and resistance genes in faecal Escherichia coli isolates recovered from healthy pets.

    PubMed

    Costa, Daniela; Poeta, Patricia; Sáenz, Yolanda; Coelho, Ana Cláudia; Matos, Manuela; Vinué, Laura; Rodrigues, Jorge; Torres, Carmen

    2008-02-01

    Faecal samples of healthy dogs (n=39) and cats (n=36) obtained in Northern Portugal were seeded on Levine agar plates, and two Escherichia coli isolates per sample were recovered (78 of dogs and 66 of cats). The susceptibility to 16 antimicrobial agents was tested in this series of 144 E. coli isolates. Almost 20% of them showed tetracycline resistance and 12 and 15% presented ampicillin or streptomycin resistance, respectively. The percentage of resistance to the other antimicrobial agents was in all cases below 4%, and no resistant isolates were detected for ceftazidime, imipenem, cefoxitin or amikacin. Two isolates (from one dog) showed cefotaxime-resistance and harboured both the CTX-M-1 and OXA-30 beta-lactamases. A bla(TEM) gene was detected in 12 of 17 ampicillin-resistant isolates, the aac(3)-II gene in the three gentamicin-resistant isolates, aadA in 7 of 22 streptomycin-resistant isolates, and tet(A) and/or tet(B) gene in all 28 tetracycline-resistant isolates. The gene encoding class 1 integrase was detected in six E. coli isolates, including the four trimethoprim-sulfamethoxazole-resistant isolates and those two harbouring CTX-M-1 and OXA-30 beta-lactamases; different gene cassette arrangements were identified: dfrA1+aadA1 (two isolates), dfrA12+orfF+aadA2 (two isolates) and bla(OXA30)+aadA1 (two isolates). One amino acid change in GyrA protein (Ser83Leu or Asp87Tyr) was detected in four nalidixic acid-resistant and ciprofloxacin-susceptible isolates and two amino acid changes in GyrA (Ser83Leu+Asp87Asn) and one in ParC (Ser80Ile) were identified in one nalidixic acid- and ciprofloxacin-resistant isolate. Faecal E. coli isolates of healthy pets could be a reservoir of antimicrobial resistance genes. PMID:17870255

  17. A step towards the discrimination of beta-lactamase-producing clinical isolates of Enterobacteriaceae and Pseudomonas aeruginosa by MALDI-TOF mass spectrometry

    PubMed Central

    Schaumann, Reiner; Knoop, Nicolas; Genzel, Gelimer H.; Losensky, Kevin; Rosenkranz, Christiane; Stîngu, Catalina S.; Schellenberger, Wolfgang; Rodloff, Arne C.; Eschrich, Klaus

    2012-01-01

    Summary Background Matrix-Assisted Laser-Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF MS) has already proven to be a powerful tool for species identification in microbiological laboratories. As adequate and rapid screening methods for antibiotic resistance are crucially needed, the present study investigated the discrimination potential of MALDI-TOF MS among extended-spectrum-beta-lactamase (ESBL) or metallo-beta-lactamases- (MBL) producing and the nonproducing strains of Escherichia coli (n=19), Klebsiella pneumoniae (n=19), and Pseudomonas aeruginosa (n=38), respectively. Material/Methods We used a MALDI-TOF MS protocol, usually applied for species identification, in order to integrate a screening method for beta-lactamases into the routine species identification workflow. The acquired spectra were analyzed by visual inspection, statistical similarity analysis and support vector machine (SVM) classification algorithms. Results Neither visual inspection nor mathematical similarity analysis allowed discrimination between spectra of beta-lactamase-producing and the nonproducing strains, but classification within a species by SVM-based algorithms could achieve a correct classification rate of up to 70%. Conclusions This shows that MALDI-TOF MS has definite potential to discriminate antibiotic-resistant strains due to ESBL and MBL production from nonproducing strains, but this performance is not yet sufficiently reliable for routine microbiological diagnostics. PMID:22936198

  18. Characterization of Extended-Spectrum Beta-lactamase from Escherichia coli and Klebsiella Species from North Eastern Nigeria

    PubMed Central

    Gadzama, Galadima Bala; Zailani, Sambo Bello; Aboderin, Aaron Oladipo

    2016-01-01

    Introduction Resistance to antimicrobials has become a serious global health concern complicating treatment strategies and increasing health-care costs. The extended-spectrum beta-lactamase producing bacteria stand out as bacteria of great epidemic concern among Gram negative bacilli. Control and appropriate interventions for antimicrobial resistance depend on effective surveillance and knowledge of the patterns and determinants of resistance. Aim The present study was undertaken to detect and characterize ESBLs in Escherichia coli and Klebsiella Species from University of Maiduguri Teaching Hospital, Maiduguri, North-Eastern Nigeria. Materials and Methods Confirmed variants of Escherichia coli and Klebsiella Species isolated from 439 patients that were admitted in various units of University of Maiduguri Teaching Hospital (UMTH) were screened for ESBL using CLSI breakpoints. Suspected ESBLs producers were subjected to confirmation using double disk synergy method. Detection of ESBL genes was further done by multiplex PCR. Results Out of the 439 isolates screened; the result shows 147 (33.5%) were ESBL producers but only 121(23.6%) were confirmed by the double disk synergy method. The prevalence of ESBL amongst the organisms were; 41/172 (23.8%) for Escherichia coli and 80/267/(30.0%) for Klebsiella Species. Based on PCR analysis, the various percentage genotypes of the ESBL producers were 44 (36.4%) for SHV gene followed by 38(31.4%) for TEM gene and the lowest of 33(27.3%) for CTX-M gene. Conclusion ESBLs are prevalent among Species of Escherichia coli and Klebsiella Species in Maiduguri, Borno State, not only are there TEM and SHV but also CTX-M types. Antibiotic stewardship program to maximise use of available antibiotics is underscored as well as coordinated national efforts in combating resistance. PMID:27042460

  19. [Extended-spectrum beta-lactamases in Klebsiella pneumoniae isolated at the Cordoba Children's Hospital, Argentina].

    PubMed

    Saka, H A; Egea, M; Culasso, C; Rollán, R; Avaro, A; Carvajal, L

    2003-01-01

    The aim of the present study was to investigate the presence of extended-spectrum beta-lactamases (ESBL) in Klebsiella pneumoniae isolated at the "Hospital de Niños de Córdoba". The strains were collected from inpatients between January 1996 and July 2000. A total of 150 ESBL producer isolates were detected. During 1996 the prevalence of ESBL producer K. pneumoniae was 20%, but since 1998 the values have increased to approximately 60%. Phenotypic analysis such as isoelectric point (pl) and antibiotyping performed in 32 randomly selected isolates showed two different enzyme profiles: 81% had ESBL with pl = 7.9 and preferential activity against cefotaxime, while 19% showed ESBL with pl = 5.4 and preferential activity against ceftazidime. No isolates resistant to imipenem or ciprofloxacin were detected. Susceptibility to other antimicrobial agents varied, but resistance to gentamicin was strongly associated with ESBL producer isolates. Resistance determinants could be transferred to Escherichia coli by conjugation assays. PMID:12833674

  20. A case of extended spectrum beta-lactamase producing Salmonella enterica serotype paratyphi A from India.

    PubMed

    Roy, Priyamvada; Rawat, Deepti; Malik, Sonia

    2015-01-01

    Enteric fever caused by Salmonella enterica is a systemic infection with high rates of morbidity and mortality. Increasing antibiotic resistance in S. enterica has led to shift in the choice of antibiotics used against this organism from chloramphenicol and ampicillin to trimethoprim-sulfamethoxazole, fluoroquinolones, and extended-spectrum cephalosporins. Resistance to cephalosporins, due to the production of extended-spectrum beta-lactamases (ESBLs), is the cause of serious concern worldwide. So far, these enzymes have been detected in many species of the family Enterobacteriaceae including different serotypes of S. enterica. To the best of our knowledge, however, ESBL production in Salmonella Paratyphi A has not yet been reported from India. We present here a case of ESBL producing Salmonella Paratyphi A from India. This is a worrisome finding with grave clinical implications, since the dissemination of this resistance trait would further limit the therapeutic options available for the treatment of enteric fever. PMID:25673610

  1. SMB-1, a novel subclass B3 metallo-beta-lactamase, associated with ISCR1 and a class 1 integron, from a carbapenem-resistant Serratia marcescens clinical isolate.

    PubMed

    Wachino, Jun-ichi; Yoshida, Hiroyuki; Yamane, Kunikazu; Suzuki, Satowa; Matsui, Mari; Yamagishi, Takuya; Tsutsui, Atsuko; Konda, Toshifumi; Shibayama, Keigo; Arakawa, Yoshichika

    2011-11-01

    A carbapenem-resistant Serratia marcescens strain, 10mdr148, was identified in a Japanese hospital in 2010. The carbapenem resistance of this strain was attributed to the production of a novel metallo-β-lactamase (MBL), named SMB-1 (Serratia metallo-β-lactamase). SMB-1 possessed a zinc binding motif, H(Q)XHXDH (residues 116 to 121), H196, and H263 and was categorized as a member of subclass B3 MBL. SMB-1 has 75% amino acid identity with the most closely related MBL, AMO1, of uncultured bacterium, recently identified through the metagenomic analysis of apple orchard soil. The introduction of bla(SMB-1) into Escherichia coli conferred resistance to a variety of β-lactam antibiotics, penicillins, cephalosporins, and carbapenems, but not aztreonam, a resistance pattern consistent with those of other MBLs. SMB-1 demonstrated high k(cat) values of >500 s(-1) for carbapenems, resulting in the highest hydrolyzing efficiency (k(cat)/K(m)) among the agents tested. The hydrolyzing activity of SMB-1 was well inhibited by chelating agents. The bla(SMB-1) gene was located on the chromosome of S. marcescens strain 10mdr148 and at the 3' end of the ISCR1 element in complex with a typical class 1 integron carrying aac(6')-Ib and catB3 gene cassettes. Downstream of bla(SMB-1), the second copy of the 3'conserved segment and ISCR1 were found. To our knowledge, this is the first subclass B3 MBL gene associated with an ISCR1 element identified in an Enterobacteriaceae clinical isolate. A variety of antibiotic resistance genes embedded with ISCR1 have been widely spread among Enterobacteriaceae clinical isolates, thus the further dissemination of bla(SMB-1) mediated by ISCR1 transposition activity may become a future concern. PMID:21876060

  2. Ampc Beta lactamases among gram negative clinical isolates from a tertiary hospital, South India.

    PubMed

    Mohamudha Parveen, R; Harish, B N; Parija, S C

    2010-07-01

    AmpC β-lactamases are cephalosporinases that hydrolyze cephamycins as well as other extended-spectrum cephalosporins and are poorly inhibited by clavulanic acid. Although reported with increasing frequency, the true rate of occurrence of AmpC β-lactamases in different organisms, including members of Enterobacteriaceae, remains unknown. The present study was designed to determine the occurrence of AmpC enzyme-harbouring Gram-negative clinical isolates in a tertiary care hospital in Pondicherry state, South India. A total of 235 Gram negative clinical isolates were tested for resistance to cefoxitin, third generation cephalosporin (3GC) antibiotics, ampicillin, amikacin, co-trimoxazole, gentamicin, meropenem and tetracycline by disc diffusion method. Isolates found resistant to 3GC and cefoxitin were tested for the production of AmpC β -lactamases by three dimensional extraction method and AmpC disc method. Isolates found to sensitive to 3GC were subjected to disc antagonism test for inducible AmpC production. One hundred and thirty four (57%) strains were resistant to 3GC, among which 63(47%) were positive for plasmid-mediated AmpC beta lactamases production. Among the 101 strains sensitive to 3GC, 23 (22.7%) revealed the presence of inducible AmpC beta lactamases by disc approximation test. A total of 80.9% (51/63) of screen positive isolates were detected by Amp C disc test and 93.6% (59/63) by three dimensional extraction method. Out of the 86 AmpC producers, 67 (77.9%) were cefoxitin resistant .Inducible AmpC was not found in Esch.coli and Klebsiella spp. The AmpC producers also concurrently showed multidrug resistance pattern. AmpC producers were found to be prevalent in our hospital and though three dimensional extraction test detects AmpC better, the disk test is easier to perform routinely and is user- friendly. PMID:24031534

  3. Extended-spectrum beta-lactamases: implications for the clinical laboratory and therapy.

    PubMed

    Harada, Sohei; Ishii, Yoshikazu; Yamaguchi, Keizo

    2008-12-01

    Production of extended-spectrum beta-lactamase (ESBL) is one of the most important resistance mechanisms that hamper the antimicrobial treatment of infections caused by Enterobacteriaceae. ESBLs are classified into several groups according to their amino-acid sequence homology. While TEM and SHV enzymes were the most common ESBLs in the 1990s, CTX-M enzymes have spread rapidly among Enterobacteriaceae in the past decade. In addition, some epidemiological studies showed that organisms producing CTX-M enzymes had become increasingly prevalent in the community setting in certain areas in the world. Several novel enzymes with hydrolyzing activity against oxyimino-cephalosporins, albeit with additional enzymatic characteristics different from those of original TEM and SHV ESBLs (e.g., inhibitor-resistance), have been discovered and pose a problem on the definition of ESBLs. Although several methods to detect the production of ESBL are available in clinical laboratories, existence of other factors contributing resistance against beta-lactams, e.g., inducible production of Amp-C beta-lactamase by some species of Enterobacteriaceae, or inhibitor-resistance in some ESBLs may hinder the detection of ESBLs with these methods. Carbapenems are stable against hydrolyzing activity of ESBLs and are regarded as the drug of choice for the treatment of infections caused by ESBL-producing Enterobacteriaceae. Although several other antimicrobial agents, such as fluoroquinolones and cephamycins, may have some role in the treatment of mild infections due to those organisms, clinical data that warrant the use of antimicrobial agents other than carbapenems in the treatment of serious infections due to those organisms are scarce for now. PMID:19127103

  4. [In vitro activity of faropenem against beta-lactamase producing clinical isolates].

    PubMed

    Nishiyama, T; Matsuzaki, K; Koyama, H; Saika, T; Hasegawa, M; Kobayashi, I

    2000-03-01

    Each 20 strains of beta-lactamase producing methicillin susceptible Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Haemophilus influenzae, Moraxella (Branhamella) catarrhalis, and Bacteroides fragilis group were used as the test strains. Drug susceptibility of these strains to faropenem (FRPM), cefdinir, cefditoren, cefcapene, cefteram, cefaclor, and ampicillin was determined by an agar dilution method according to the NCCLS guideline M100-S9. beta-Lactamase activity of the test strains was determined by a spectrophotometric method. In the present study, FRPM was highly active against beta-lactamase-producing strains, and no close correlation was found between the MICs of FRPM for the test strains and their beta-lactamase activities. These results suggest that FRPM has potential in successful application for the treatment of infectious diseases with various types of bacterial pathogens including beta-lactamase producing strains. PMID:10834149

  5. Novel Insights Into The Mode of Inhibition of Class A SHV-1 Beta-Lactamases Revealed by Boronic Acid Transition State Inhibitors

    SciTech Connect

    W Ke; J Sampson; C Ori; F Prati; S Drawz; C Bethel; R Bonomo; F van den Akker

    2011-12-31

    Boronic acid transition state inhibitors (BATSIs) are potent class A and C {beta}-lactamase inactivators and are of particular interest due to their reversible nature mimicking the transition state. Here, we present structural and kinetic data describing the inhibition of the SHV-1 {beta}-lactamase, a clinically important enzyme found in Klebsiella pneumoniae, by BATSI compounds possessing the R1 side chains of ceftazidime and cefoperazone and designed variants of the latter, compounds 1 and 2. The ceftazidime and cefoperazone BATSI compounds inhibit the SHV-1 {beta}-lactamase with micromolar affinity that is considerably weaker than their inhibition of other {beta}-lactamases. The solved crystal structures of these two BATSIs in complex with SHV-1 reveal a possible reason for SHV-1's relative resistance to inhibition, as the BATSIs adopt a deacylation transition state conformation compared to the usual acylation transition state conformation when complexed to other {beta}-lactamases. Active-site comparison suggests that these conformational differences might be attributed to a subtle shift of residue A237 in SHV-1. The ceftazidime BATSI structure revealed that the carboxyl-dimethyl moiety is positioned in SHV-1's carboxyl binding pocket. In contrast, the cefoperazone BATSI has its R1 group pointing away from the active site such that its phenol moiety moves residue Y105 from the active site via end-on stacking interactions. To work toward improving the affinity of the cefoperazone BATSI, we synthesized two variants in which either one or two extra carbons were added to the phenol linker. Both variants yielded improved affinity against SHV-1, possibly as a consequence of releasing the strain of its interaction with the unusual Y105 conformation.

  6. Purification and properties of inducible penicillin beta-lactamase isolated from Alcaligenes faecalis.

    PubMed

    Fujii, T; Sato, K; Inoue, M; Mitsuhashi, S

    1985-04-01

    An inducible penicillin beta-lactamase was purified from a strain of Alcaligenes faecalis resistant to beta-lactam antibiotics. The purified enzyme preparation gave a single protein band on polyacrylamide gel electrophoresis, and its molecular weight was 29,000 based on sodium dodecyl sulfate-acrylamide gel electrophoresis. Its isoelectric point was 5.9. The enzyme more rapidly hydrolyzed penicillins, such as penicillin G, ampicillin, carbenicillin, piperacillin, and cloxacillin, than it hydrolyzed cephalosporins. For the hydrolysis of penicillin G, the optimal pH was 5.5, and the optimal temperature was 35 degrees C. The enzyme activity was inhibited by iodine, Cu2+, Hg2+, and EDTA but was not inhibited by clavulanic acid and sulbactam. PMID:3873902

  7. Structure of the Covalent Adduct Formed Between Mycobacterium tuberculosis beta-Lactamase and Clavulanate

    SciTech Connect

    Tremblay,L.; Hugonnet, J.; Blanchard, J.

    2008-01-01

    The intrinsic resistance of Mycobacterium tuberculosis to the {beta}-lactam class of antibiotics arises from a chromosomally encoded, extended spectrum, class A {beta}-lactamase, BlaC. Herein, we report the X-ray crystallographic structure of BlaC inhibited with clavulanate at a resolution of 1.7 Angstroms with an R-factor value of 0.180 and R-free value of 0.212 for the m/z +154 clavulanate-derived fragment observed in the active site. Structural evidence reveals the presence of hydrogen bonds to the C1 carbonyl along with a coplanar arrangement of C1, C2, C3, and N4, which favors enolization to generate a trans-a, {beta}-eneamine, stabilizing the +154 adduct from hydrolysis. The irreversible inhibition of BlaC suggests that treatment of M. tuberculosis with a combination of a {beta}-lactam antibiotic and clavulanate may lead to rapid bactericidal activity.

  8. An alkaline D-stereospecific endopeptidase with beta-lactamase activity from Bacillus cereus.

    PubMed

    Asano, Y; Ito, H; Dairi, T; Kato, Y

    1996-11-22

    We purified a novel extracellular D-stereospecific endopeptidase, alkaline D-peptidase (D-stereospecific peptide hydrolase, EC 3.4.11.-), to homogeneity from the culture broth of the soil bacterium Bacillus cereus strain DF4-B. The Mr of the enzyme was 37,952, and it was composed of a single polypeptide chain. The optimal pH for activity was approximately 10.3. The enzyme was strictly D-stereospecific toward oligopeptides composed of Dphenylalanine such as (D-Phe)3 and (D-Phe)4. The enzyme also acted to a lesser extent on (D-Phe)6, Boc-(D-Phe)4 (where Boc is tert-butoxycarbonyl), Boc-(D-Phe)4 methyl ester, Boc-(D-Phe)3 methyl ester, Boc-(D-Phe)2, (D-Phe)2, and others, but not upon their corresponding peptides composed of L-Phe, (D-Ala)n (n = 2-5), (D-Val)3, and (D-Leu)2. The mode of action of the enzyme was clarified with synthetic substrates ((D-Phe)2-D-Tyr and D-Tyr-(D-Phe)2) and eight stereoisomers of (Phe)3. The enzyme had beta-lactamase activity toward ampicillin and penicillin G, although carboxypeptidase DD and D-aminopeptidase activities were undetectable. The gene coding for alkaline D-peptidase (adp) was cloned into plasmid pUC118, and a 1164-base pair open reading frame consisting of 388 codons was identified as the adp gene. The predicted polypeptide was similar to carboxypeptidase DD from Streptomyces R61, penicillin-binding proteins from Streptomyces lactamdurans and Bacillus subtilis, and class C beta-lactamases. Thus, the enzyme was categorized as a new "penicillin-recognizing enzyme." PMID:8939979

  9. Biochemical and Structural Characterization of Mycobacterium tuberculosis beta-Lactamase with the Carbapenems Ertapenem and Doripenem

    SciTech Connect

    L Tremblay; F Fan; J Blanchard

    2011-12-31

    Despite the enormous success of {beta}-lactams as broad-spectrum antibacterials, they have never been widely used for the treatment of tuberculosis (TB) due to intrinsic resistance that is caused by the presence of a chromosomally encoded gene (blaC) in Mycobacterium tuberculosis. Our previous studies of TB BlaC revealed that this enzyme is an extremely broad-spectrum {beta}-lactamase hydrolyzing all {beta}-lactam classes. Carbapenems are slow substrates that acylate the enzyme but are only slowly deacylated and can therefore act also as potent inhibitors of BlaC. We conducted the in vitro characterization of doripenem and ertapenem with BlaC. A steady-state kinetic burst was observed with both compounds with magnitudes proportional to the concentration of BlaC used. The results provide apparent K{sub m} and k{sub cat} values of 0.18 {micro}M and 0.016 min{sup -1} for doripenem and 0.18 {micro}M and 0.017 min{sup -1} for ertapenem, respectively. FTICR mass spectrometry demonstrated that the doripenem and ertapenem acyl-enzyme complexes remain stable over a time period of 90 min. The BlaC-doripenem covalent complex obtained after a 90 min soak was determined to 2.2 {angstrom}, while the BlaC-ertapenem complex obtained after a 90 min soak was determined to 2.0 {angstrom}. The 1.3 {angstrom} diffraction data from a 10 min ertapenem-soaked crystal revealed an isomerization occurring in the BlaC-ertapenem adduct in which the original {Delta}2-pyrroline ring was tautomerized to generate the {Delta}1-pyrroline ring. The isomerization leads to the flipping of the carbapenem hydroxyethyl group to hydrogen bond to carboxyl O2 of Glu166. The hydroxyethyl flip results in both the decreased basicity of Glu166 and a significant increase in the distance between carboxyl O2 of Glu166 and the catalytic water molecule, slowing hydrolysis.

  10. A clinical strain of Escherichia coli possessing CMY-2 plasmid-mediated amp C beta-lactamase: an emerging concern in pediatrics?

    PubMed

    Hoyen, Claudia M; Hujer, Andrea M; Hujer, Kristine M; Marshall, Steven H; Carias, Lenore; Toltzis, Philip; Rice, Louis B; Bonomo, Robert A

    2002-01-01

    A 5-year-old child was colonized by an isolate of Escherichia coli that transferred resistance to third-generation cephalosporins and cefoxitin. This resistance phenotype was encoded on a >75-kb plasmid pLRM 22. The transferable plasmid contained both blaCMY-2 and blaTEM-1b. Increasing reports of CMY-2 beta-lactamase in clinical isolates in children raise concerns about the empiric use of third-generation cephalosporins in this patient group. PMID:12523630

  11. Zero prevalence of extended spectrum beta-lactamase-producing bacteria in 300 breeding Collared Flycatchers in Sweden.

    PubMed

    Järhult, Josef D; Stedt, Johan; Gustafsson, Lars

    2013-01-01

    Wild birds are important indicators and potential spreaders of antibiotic resistance. The order Passerines is scarcely studied apart from Corvus sp. but extended spectrum beta-lactamases (ESBLs) has been found in Blackbirds. We tested 300 fecal samples from a well-studied population of Collared Flycatchers (Ficedula albicollis) at the Island of Gotland in Sweden and found no ESBL-producing bacteria. These results support the idea of 'ecological guild' as Blackbirds are ground-foraging invertebrate feeders, whereas Collared Flycatchers are aerial insectivores not regularly coming into contact with fecal contaminations and therefore less prone to acquire pathogens spread by the fecal-oral route. PMID:23898397

  12. Escherichia coli-producing extended-spectrum beta-lactamase CTX-M-15 in a captive South American tapir (Tapirus terrestris).

    PubMed

    Klimes, Jiri; Machalkova, Marketa; Dolejska, Monika; Cizek, Alois; Janoszowska, Dagmar; Alexa, Pavel; Albrechtova, Katerina; Vojtech, Jiri; Literak, Ivan

    2013-03-01

    Only a few reports exist on the occurrence of resistant bacteria in zoo animals. Therefore, an isolation of multiresistant Escherichia coli from the lungs of a captive South American tapir (Tapirus terrestris) lead to its characterization and further investigation of samples from animals inhabiting the same paddock and from the shared environment. The tapir suffered from an intermandibular abscess and pneumonia and was euthanatized after unsuccessful therapy, including administration of antibiotics. The authors performed selective isolation of extended-spectrum beta-lactamase (ESBL)-positive E. coli strains and identification of resistance genes using polymerase chain reaction. Seven multiresistant, ESBL-producing E. coli isolates were obtained, all belonging to the B2 phylogenetic group and showing identical profile on pulsed-field gel electrophoresis. These isolates carried several resistance genes, including the gene bla(CTX-M-15). This case demonstrates the transmission of related epidemiologically important E. coli isolates whose potential transmission to other animals and zoo staff can be assumed. PMID:23505722

  13. Sequence of pNL194, a 79.3-kilobase IncN plasmid carrying the blaVIM-1 metallo-beta-lactamase gene in Klebsiella pneumoniae.

    PubMed

    Miriagou, V; Papagiannitsis, C C; Kotsakis, S D; Loli, A; Tzelepi, E; Legakis, N J; Tzouvelekis, L S

    2010-10-01

    The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including bla(VIM-1), aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes. PMID:20660690

  14. Characterization of eight beta-lactamases of Gram-negative bacteria.

    PubMed Central

    Sawai, T; Kanno, M; Tsukamoto, K

    1982-01-01

    Eight kinds of beta-lactamases produced by gram-negative bacteria were characterized by the following properties: molecular weight, isoelectric point, pH optimum, molecular activity, immunochemical reactivity, and kinetic parameters with respect to twelve kinds of common beta-lactam antibiotics. These beta-lactamases included two types of penicillinases mediated by R plasmids and six kinds of species-specific cephalosporinases. To determine a reliable value of the kinetic parameter, Km, we introduced a continuous and acidimetric assay method of beta-lactamase activity with a pH stat. PMID:6752115

  15. Surveillance of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Dairy Cattle Farms in the Nile Delta, Egypt

    PubMed Central

    Braun, Sascha D.; Ahmed, Marwa F. E.; El-Adawy, Hosny; Hotzel, Helmut; Engelmann, Ines; Weiß, Daniel; Monecke, Stefan; Ehricht, Ralf

    2016-01-01

    Introduction: Industrial livestock farming is a possible source of multi-resistant Gram-negative bacteria, including producers of extended spectrum beta-lactamases (ESBLs) conferring resistance to 3rd generation cephalosporins. Limited information is currently available on the situation of ESBL producers in livestock farming outside of Western Europe. A surveillance study was conducted from January to May in 2014 in four dairy cattle farms in different areas of the Nile delta, Egypt. Materials and Methods: In total, 266 samples were collected from 4 dairy farms including rectal swabs from clinically healthy cattle (n = 210), and environmental samples from the stalls (n = 56). After 24 h pre-enrichment in buffered peptone water, all samples were screened for 3rd generation cephalosporin-resistant Escherichia coli using Brilliance™ ESBL agar. Suspected colonies of putatively ESBL-producing E. coli were sub-cultured and subsequently genotypically and phenotypically characterized. Susceptibility testing using the VITEK-2 system was performed. All suspect isolates were genotypically analyzed using two DNA-microarray based assays: CarbDetect AS-1 and E. coli PanType AS-2 kit (ALERE). These tests allow detection of a multitude of genes and their alleles associated with resistance toward carbapenems, cephalosporins, and other frequently used antibiotics. Serotypes were determined using the E. coli SeroGenotyping AS-1 kit (ALERE). Results: Out of 266 samples tested, 114 (42.8%) ESBL-producing E. coli were geno- and phenotypically identified. 113 of 114 phenotypically 3rd generation cephalosporin-resistant isolates harbored at least one of the ESBL resistance genes covered by the applied assays [blaCTX-M15 (n = 105), blaCTX-M9 (n = 1), blaTEM (n = 90), blaSHV (n = 1)]. Alarmingly, the carbapenemase genes blaOXA-48 (n = 5) and blaOXA-181 (n = 1) were found in isolates that also were phenotypically resistant to imipenem and meropenem. Using the array-based serogenotyping

  16. Shedding of Clostridium difficile, fecal beta-lactamase activity, and gastrointestinal symptoms in 51 volunteers treated with oral cefixime.

    PubMed Central

    Chachaty, E; Bourneix, C; Renard, S; Bonnay, M; Andremont, A

    1993-01-01

    Microbial changes including the shedding of Clostridium difficile, fecal beta-lactamase activity, and gastrointestinal symptoms were assessed in 51 healthy volunteers given 200 mg of cefixime twice daily for 8 days. The number of organisms of the family Enterobacteriaceae (means +/- standard deviations) dropped from 6.9 +/- 1.1 to 3.9 +/- 1.8 log CFU/g of feces (P < 0.01), whereas counts of enterococci rose from 7.0 +/- 1.5 to 9.0 +/- 1.0 log CFU/g of feces (P < 0.01). Both counts returned to their initial levels 50 days after the cessation of treatment. Cefixime did not significantly modify the frequency of fecal excretion of Pseudomonas aeruginosa, Staphylococcus spp., yeasts, or members of the Enterobacteriaceae resistant to ceftazidime or ampicillin. The proportion of subjects shedding C. difficile rose from 6% before treatment to 57% (P < 0.01) at the end of treatment but returned to 8% 50 days thereafter. No case of pseudomembranous colitis was observed. Stool changes occurred in 13 volunteers during treatment (25%) and in 2 others more than 10 days after the end of treatment (4%). These changes were not significantly associated with the shedding of toxigenic strains of C. difficile or with the presence of toxin A in feces. By contrast, during treatment, stool changes occurred in 8 of the 18 volunteers (44%) who had antibiotic activity in their feces but in only 5 of the 33 (15%) for whom no such activity was found (P < 0.05). The absence of antibiotic activity in the feces was itself linked with the presence of beta-lactamase activity in the feces. Since we had found earlier that fecal beta-lactamase activity afforded protection against alteration in stool consistency during treatments with oral cephalosporins, the present study confirmed our previous preliminary results in this respect. PMID:8363371

  17. Shedding of Clostridium difficile, fecal beta-lactamase activity, and gastrointestinal symptoms in 51 volunteers treated with oral cefixime.

    PubMed

    Chachaty, E; Bourneix, C; Renard, S; Bonnay, M; Andremont, A

    1993-07-01

    Microbial changes including the shedding of Clostridium difficile, fecal beta-lactamase activity, and gastrointestinal symptoms were assessed in 51 healthy volunteers given 200 mg of cefixime twice daily for 8 days. The number of organisms of the family Enterobacteriaceae (means +/- standard deviations) dropped from 6.9 +/- 1.1 to 3.9 +/- 1.8 log CFU/g of feces (P < 0.01), whereas counts of enterococci rose from 7.0 +/- 1.5 to 9.0 +/- 1.0 log CFU/g of feces (P < 0.01). Both counts returned to their initial levels 50 days after the cessation of treatment. Cefixime did not significantly modify the frequency of fecal excretion of Pseudomonas aeruginosa, Staphylococcus spp., yeasts, or members of the Enterobacteriaceae resistant to ceftazidime or ampicillin. The proportion of subjects shedding C. difficile rose from 6% before treatment to 57% (P < 0.01) at the end of treatment but returned to 8% 50 days thereafter. No case of pseudomembranous colitis was observed. Stool changes occurred in 13 volunteers during treatment (25%) and in 2 others more than 10 days after the end of treatment (4%). These changes were not significantly associated with the shedding of toxigenic strains of C. difficile or with the presence of toxin A in feces. By contrast, during treatment, stool changes occurred in 8 of the 18 volunteers (44%) who had antibiotic activity in their feces but in only 5 of the 33 (15%) for whom no such activity was found (P < 0.05). The absence of antibiotic activity in the feces was itself linked with the presence of beta-lactamase activity in the feces. Since we had found earlier that fecal beta-lactamase activity afforded protection against alteration in stool consistency during treatments with oral cephalosporins, the present study confirmed our previous preliminary results in this respect. PMID:8363371

  18. In vitro potentiation of carbapenems with ME1071, a novel metallo-beta-lactamase inhibitor, against metallo-beta-lactamase- producing Pseudomonas aeruginosa clinical isolates.

    PubMed

    Ishii, Yoshikazu; Eto, Maki; Mano, Yoko; Tateda, Kazuhiro; Yamaguchi, Keizo

    2010-09-01

    ME1071, a maleic acid derivative, is a novel specific inhibitor for metallo-beta-lactamases (MBL). In this study, the potentiation of ME1071 in combination with several beta-lactams was evaluated using MBL-producing Pseudomonas aeruginosa isolates. The rates of susceptibility of MBL producers to carbapenems (imipenem, biapenem, and doripenem) and ceftazidime were increased by 8 to 27% in the presence of 32 microg/ml of ME1071. The corresponding resistance rates were decreased by 13 to 46%, respectively. On the other hand, ME1071 showed weaker or no potentiation with non-MBL producers. The K(i) value of ME1071 for IMP-1 was 0.4 microM, significantly lower than the K(m) values of carbapenems for the IMP-1 enzyme. On the other hand, the K(i) value of ME1071 for VIM-2 was 120 microM, higher than the K(m) values of carbapenems for the VIM-2 enzyme. Results of this study indicate that ME1071 can potentiate the activity of ceftazidime and carbapenems against MBL-producing strains of P. aeruginosa. PMID:20606062

  19. Prevalence of metallo-beta-lactamase among Pseudomonas aeruginosa and Acinetobacter baumannii in a Korean university hospital and comparison of screening methods for detecting metallo-beta-lactamase.

    PubMed

    Oh, Eun-Jee; Lee, Seungok; Park, Yeon-Joon; Park, Jung Jun; Park, Kanggyun; Kim, Sang-Il; Kang, Moon Won; Kim, Byung Kee

    2003-09-01

    To identify the metallo-beta-lactamases (MBLs) prevalent in Korea, a total of 130 clinical isolates of Pseudomonas aeruginosa and Acinetobacter baumannii (99 P. aeruginosa and 31 A. baumannii) with a reduced susceptibility to imipenem (IPM) and/or ceftazidime (CAZ) was subjected to PCR analyses with primers specific to bla(IMP-1), bla(VIM-1), and bla(VIM-2). In addition, inhibitor-potentiated disk diffusion methods (IPD) using two kinds of substrate-inhibitor combinations (ceftazidime-2-mercaptopropionic acid (2MPA) and imipenem-EDTA) were investigated. Thirty-three isolates (29 P. aeruginosa and 4 A. baumannii) carried bla(VIM-2) and two P. aeruginosa isolates harbored bla(IMP-1). The enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) pattern revealed that many of the VIM-2-producing P. aeruginosa isolates were clonally related, whereas the A. baumannii isolates were diverse. The inhibitor-potentiated disk diffusion test using imipenem-EDTA was highly sensitive and specific for detecting the VIM-2 producer. These results suggest that VIM-2 is an important MBL in P. aeruginosa and A. baumannii in the Korean hospital of this study and that the IMP-1-producing P. aeruginosa has also emerged. Screening for MBLs and strict infection control for these isolates will contribute to prevent further spread of resistance. PMID:12842488

  20. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    PubMed

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar prevalences

  1. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste

    PubMed Central

    Durso, Lisa M.; Harhay, Dayna M.; Schmidt, John W.

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two “low impact” environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  2. Improved detection of extended spectrum beta-lactamase (ESBL)-producing Escherichia coli in input and output samples of German biogas plants by a selective pre-enrichment procedure.

    PubMed

    Schauss, Thorsten; Glaeser, Stefanie P; Gütschow, Alexandra; Dott, Wolfgang; Kämpfer, Peter

    2015-01-01

    The presence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli was investigated in input (manure from livestock husbandry) and output samples of six German biogas plants in 2012 (one sampling per biogas plant) and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU) per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%), few SHV-type beta lactamase (6%). Sixty-four blaCTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85%) and 9 (13%), and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71%) and B1 (27%), only one to group D (2%). Genomic fingerprinting and multilocus sequence typing (MLST) showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT) genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E. coli in

  3. Improved Detection of Extended Spectrum Beta-Lactamase (ESBL)-Producing Escherichia coli in Input and Output Samples of German Biogas Plants by a Selective Pre-Enrichment Procedure

    PubMed Central

    Schauss, Thorsten; Glaeser, Stefanie P.; Gütschow, Alexandra; Dott, Wolfgang; Kämpfer, Peter

    2015-01-01

    The presence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli was investigated in input (manure from livestock husbandry) and output samples of six German biogas plants in 2012 (one sampling per biogas plant) and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU) per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%), few SHV-type beta lactamase (6%). Sixty-four blaCTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85%) and 9 (13%), and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71%) and B1 (27%), only one to group D (2%). Genomic fingerprinting and multilocus sequence typing (MLST) showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT) genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E. coli in

  4. BetalasEN: microdilution panel for identifying beta-lactamases present in isolates of Enterobacteriaceae.

    PubMed

    Sanders, Christine C; Ehrhardt, Anton F; Moland, Ellen Smith; Thomson, Kenneth S; Zimmer, Barbara; Roe, Darcie E

    2002-01-01

    A dried investigational use-only microdilution panel named betalasEN (a short named derived from the panel's purpose, to identify beta-lactamases in Enterobacteriaceae) containing 10 beta-lactam drugs with and without beta-lactamase inhibitors was developed to identify beta-lactamases among clinical isolates of Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Citrobacter koseri, Citrobacter freundii group, Enterobacter spp., and Serratia marcescens. The MICs obtained with a collection of 383 organisms containing well-characterized beta-lactamases were used to develop numeric codes and logic pathways for computerized analysis of results. The resultant logic pathways and betalasEN panel were then used to test and identify beta-lactamases among 885 isolates of Enterobacteriaceae recovered in cultures obtained at six different hospital laboratories across the United States. beta-Lactamases present in 801 (90.5%) of the 885 isolates were identified by betalasEN by using the existing logic pathways and codes or after minor modifications were made to the existing codes. The 84 strains that gave codes that betalasEN could not identify were collected, reidentified, and retested by using betalasEN. Three strains had been misidentified, 54 strains gave different codes upon repeat testing that could be identified by betalasEN, and 27 strains repeated new codes. The beta-lactamases in these strains were identified, and the new codes were added to the betalasEN logic pathways. These results indicate that betalasEN can identify clinically important beta-lactamases among most isolates of Enterobacteriaceae. The results also show that good quality control and attention to proper performance of the tests are essential to the correct performance of betalasEN. PMID:11773104

  5. Structural Milestones in the Reaction Pathway of an Amide Hydrolase: Substrate, Acyl, and Product Complexes of Cephalothin with AmpC [beta]-Lactamase

    SciTech Connect

    Beadle, Beth M.; Trehan, Indi; Focia, Pamela J.; Shoichet, Brian K.

    2010-03-05

    {beta}-lactamases hydrolyze {beta}-lactam antibiotics and are the leading cause of bacterial resistance to these drugs. Although {beta}-lactamases have been extensively studied, structures of the substrate-enzyme and product-enzyme complexes have proven elusive. Here, the structure of a mutant AmpC in complex with the {beta}-lactam cephalothin in its substrate and product forms was determined by X-ray crystallography to 1.53 {angstrom} resolution. The acyl-enzyme intermediate between AmpC and cephalothin was determined to 2.06 {angstrom} resolution. The ligand undergoes a dramatic conformational change as the reaction progresses, with the characteristic six-membered dihydrothiazine ring of cephalothin rotating by 109{sup o}. These structures correspond to all three intermediates along the reaction path and provide insight into substrate recognition, catalysis, and product expulsion.

  6. Physiological studies of the regulation of beta-lactamase expression in Pseudomonas maltophilia.

    PubMed Central

    Rosta, S; Mett, H

    1989-01-01

    The kinetics of beta-lactamase induction in Pseudomonas maltophilia IID1275/873 were investigated. Upon induction with beta-lactam antibiotics, a correlation was seen between the increase in specific beta-lactamase activity and the generation time, as well as the concentration of inducer in the medium. The specific beta-lactamase activity increased slowly within the first 0.5 generation and then more rapidly; it decreased regularly after about 2 generations of growth in the presence of inducer. This decrease could presumably be attributed to the continuous breakdown of inducer by beta-lactamases in the culture medium. In a chemostat culture with continuous supply of fresh inducer-containing medium, the specific beta-lactamase activity could be stabilized at a high level over several generations. Removal of the beta-lactam after a certain induction time showed that a short exposure of the bacteria to inducer caused induction kinetics comparable to those resulting from continuous exposure of the cells to inducer. The two beta-lactamases of P. maltophilia, L1 and L2, were induced simultaneously under various experimental conditions. PMID:2783690

  7. Structures of the Michaelis Complex (1.2A) and the Covalent Acyl Intermediate (2.0A ) of Cefamandole Bound in the Active Sites of the Mycobacterium tuberculosis beta-Lactamase K72A and E166A Mutants

    SciTech Connect

    L Tremblay; h Xu; J Blanchard

    2011-12-31

    The genome of Mycobacterium tuberculosis (TB) contains a gene that encodes a highly active {beta}-lactamase, BlaC, that imparts TB with resistance to {beta}-lactam chemotherapy. The structure of covalent BlaC-{beta}-lactam complexes suggests that active site residues K73 and E166 are essential for acylation and deacylation, respectively. We have prepared the K73A and E166A mutant forms of BlaC and have determined the structures of the Michaelis complex of cefamandole and the covalently bound acyl intermediate of cefamandole at resolutions of 1.2 and 2.0 {angstrom}, respectively. These structures provide insight into the details of the catalytic mechanism.

  8. The Ocean as a Global Reservoir of Antibiotic Resistance Genes

    PubMed Central

    Hatosy, Stephen M.

    2015-01-01

    Recent studies of natural environments have revealed vast genetic reservoirs of antibiotic resistance (AR) genes. Soil bacteria and human pathogens share AR genes, and AR genes have been discovered in a variety of habitats. However, there is little knowledge about the presence and diversity of AR genes in marine environments and which organisms host AR genes. To address this, we identified the diversity of genes conferring resistance to ampicillin, tetracycline, nitrofurantoin, and sulfadimethoxine in diverse marine environments using functional metagenomics (the cloning and screening of random DNA fragments). Marine environments were host to a diversity of AR-conferring genes. Antibiotic-resistant clones were found at all sites, with 28% of the genes identified as known AR genes (encoding beta-lactamases, bicyclomycin resistance pumps, etc.). However, the majority of AR genes were not previously classified as such but had products similar to proteins such as transport pumps, oxidoreductases, and hydrolases. Furthermore, 44% of the genes conferring antibiotic resistance were found in abundant marine taxa (e.g., Pelagibacter, Prochlorococcus, and Vibrio). Therefore, we uncovered a previously unknown diversity of genes that conferred an AR phenotype among marine environments, which makes the ocean a global reservoir of both clinically relevant and potentially novel AR genes. PMID:26296734

  9. [Antibacterial activity and beta-lactamase stability of eleven oral cephalosporins].

    PubMed

    Bauernfeind, A; Jungwirth, R; Schweighart, S; Theopold, M

    1990-01-01

    Oral cephalosporins (cefixime, cefdinir, cefetamet, ceftibuten, cefpodoxime, loracarbef, cefprozil, cefuroxime, cefaclor, cefadroxil and BAY 3522) were compared by their antibacterial profile including stability against new beta-lactamases. Both activity and antibacterial spectrum of compounds structurally related to third generation parenteral cephalosporins (of the oximino class) were superior to established compounds. Activity against staphylococci was found to be highest for cefdinir, cefprozil and BAY 3522. Cefetamet, ceftibuten and cefixime demonstrate no clinically meaningful antistaphylococcal activity while the other compounds investigated demonstrate intermediate activity. The antibacterial spectrum was broadest for cefdinir and cefpodoxime. New oral cephalosporins are equally inactive as established compounds against Enterobacter spp., Morganella, Listeria, Pseudomonas and Acinetobacter spp., methicillin-resistant staphylococci, Enterococcus spp., penicillin-resistant pneumococci and anaerobes. New extended broad-spectrum betalactamases (TEM-3, TEM-5, TEM-6, TEM-7, SHV-2, SHV-3, SHV-4, SHV-5, CMY-1, CMY-2, and CTX-M) are active against the majority of oral cephalosporins. Ceftibuten, cefetamet, cefixime and cefdinir were stable against some of these enzymes even to a higher extent than parenteral cephalosporins. New oral cephalosporins should improve the therapeutic perspectives of oral cephalosporins due to their higher activity against pathogens marginally susceptible to established compounds (higher multiplicity of maximum plasma concentrations over MICs of the pathogens) and furthermore by including in their spectrum organisms resistant to established absorbable cephalosporins (e.g. Proteus spp., Providencia spp., Citrobacter spp., and Serratia spp.). PMID:2079378

  10. Site-directed mutagenesis of dicarboxylic acids near the active site of Bacillus cereus 5/B/6 beta-lactamase II.

    PubMed Central

    Lim, H M; Iyer, R K; Pène, J J

    1991-01-01

    An amino acid residue functioning as a general base has been proposed to assist in the hydrolysis of beta-lactam antibiotics by the zinc-containing Bacillus cereus beta-lactamase II [Bicknell & Waley (1985) Biochemistry 24, 6876-6887]. Oligonucleotide-directed mutagenesis of cloned Bacillus cereus 5/B/6 beta-lactamase II was used in an 'in vivo' study to investigate the role of carboxy-group-containing amino acids near the active site of the enzyme. Substitution of asparagine for the wild-type aspartic acid residue at position 81 resulted in fully functional enzyme. An aspartic acid residue at position 90 is essential for beta-lactamase II to confer any detectable ampicillin and cephalosporin C resistance to Escherichia coli. Conversion of Asp90 into Asn90 or Glu90 lead to the synthesis of inactive enzyme, suggesting that the spatial position of the beta-carboxy group of Asp90 is critical for enzyme function. Images Fig. 2. Fig. 3. PMID:1904717