Science.gov

Sample records for beta-lactamase resistance genes

  1. [Mechanisms of resistance in Enterobacteriaceae towards beta-lactamase antibiotics].

    PubMed

    Susić, Edita

    2004-01-01

    cefepime, aztreonam, as well as penicillins and other cephalosporins, except for cephamycin (cefoxitin and cefotetan). They are inhibited by beta-lactamase inhibitors. AmpC beta-lactamases are chromosomal and inducible in most Enterobacter spp., C. freundii, Serratia spp., M. morganii and Providentia spp. They are resistant to almost all penicillins and cephalosporins, to beta-lactamase inhibitors and aztreonam, and are susceptible to cefepime and carbapenems as well. Plasmid-mediated AmpC beta-lactamases have arisen through the transfer of chromosomal genes for the inducible AmpC beta-lactamase onto plasmids. All plasmid-mediated AmpC beta-lactamases have similar substrate profiles to the parental enzymes from which they appear to be derived. With one exception, plasmid-mediated AmpCs differ from chromosomal AmpCs in being uninducible. The National Committee for Clinical Laboratory Standards (NCCLS) has issued recommendations for ESBL screening and confirmation for isolates of E. coli, K. pneumoniae and K. oxytoca. No NCCLS recommendations exist for ESBLs detection and reporting for other organisms or for detecting plasmid-mediated AmpC beta-lactamases. High-level expression of AmpC may prevent recognition of an ESBL in species that produce a chromosomally encoded inducible AmpC beta-lactamase. AmpC-inducible species (e. g. Enterobacter spp. and C. freundii) can be recognized by cefoxitin/cefotaxime disk antagonism tests. Since clinical laboratories are first to encounter bacteria with new forms of antibiotic resistance, they need appropriate tools to recognize these bacteria, including trained staff with sufficient time and equipment to follow up important observations. Because bacterial pathogenes are constantly changing, training must be an ongoing process. PMID:15700687

  2. Multidrug resistance mediated by co-carriage of extended-spectrum beta-lactamases, AmpC and New Delhi metallo-beta-lactamase-1 genes among carbapenem-resistant Enterobacteriaceae at five Indian medical centres.

    PubMed

    Manoharan, A; Barla, G S; Peter, R; Sugumar, M; Mathai, D

    2016-01-01

    In this study, we evaluated the coexistence of extended-spectrum beta-lactamases (ESBL), AmpC and New Delhi metallo-beta-lactamase-1 (NDM-1) genes among carbapenem-resistant Enterobacteriaceae (CRE) recovered prospectively from patients at multiple sites. The study included 285 CRE strains from 2782 Gram-negative Bacilli collected from multiple centres during 2007-2010, of which 87 were characterised. Standard and reference laboratory methods were used for resistance determination. Detection of blaNDM-1 , blaAmpC , blaTEM , blaSHV and blaCTX-M was done by polymerase chain reaction. High levels of antimicrobial resistance observed among study isolates. Co-carriage of ESBLs, AmpC and NDM-1 was 26.3%. Nosocomial origin among the co-carriage isolates was 64.3%, with 9.2% associated mortality. PMID:27514962

  3. The investigation of oxacillinase/metallo-beta-lactamase genes and clonal analysis in carbapenem-resistant Klebsiella pneumoniae.

    PubMed

    Cetinkol, Yeliz; Yildirim, Arzu Altunçekiç; Telli, Murat; Calgin, Mustafa Kerem

    2016-03-01

    Infections due to carbapenem-resistant Klebsiella pneumoniae represent a growing problem nationally. In our study, we aimed to examine carbapenem-resistant K. pneumoniae with multiple resistance isolated in the intensive care unit of our hospital. Isolates were investigated for the presence of oxacillinase and metallo-beta lactamase genes with a view to determining the clonal relationship between the strains intensely over a short period. Strain identification was completed with conventional methods and automated identification kit. OXA-58, OXA-23, OXA-51, OXA-24 and OXA-48 and metallo-beta lactamase genes IPM, VIM, SPM, SIM, GIM and NDM-1 were investigated with PCR. For clonal relationships of carbapenem-resistant strains, the PFGE experiment was performed. While all of these carbapenem-resistant strains were positive for OXA-48, the resistant genes NDM-1, VIM, KPC, IPM, SPM, GIM, SIM, OXA-23, OXA-24, OXA-58 and OXA-51 were not observed. When molecular typing results were investigated, PFGE determined clonal distribution of three pulsotypes. However, it was observed that the strains intensified in a single clone and this was assessed as the outbreak isolate. The results of this study showed the primary enzyme responsible for carbapenem resistance in K. pneumoniae strains in our hospital is still OXA-48. To prevent the spread of carbapenem-resistant K. pneumoniae isolates, with epidemic potential, national-level monitoring and effective infection control precautions should be enforced. PMID:27031897

  4. Characterization of a new beta-lactamase gene from isolates of Vibrio spp. in Korea.

    PubMed

    Jun, Lyu Jin; Kim, Jae Hoon; Jin, Ji Woong; Jeong, Hyun Do

    2012-04-01

    PCR was performed to analyze the beta-lactamase genes carried by ampicillin-resistant Vibrio spp. strains isolated from marine environments in Korea between 2006 and 2009. All 36 strains tested showed negative results in PCR with the primers designed from the nucleotide sequences of various known beta-lactamase genes. This prompted us to screen new beta-lactamase genes. A novel beta-lactamase gene was cloned from Vibrio alginolyticus KV3 isolated from the aquaculture water of Geoje Island of Korea. The determined nucleotide sequence (VAK-3 beta-lactamase) revealed an open reading frame (ORF) of 852 bp, encoding a protein of 283 amino acids (aa), which displayed low homology to any other beta-lactamase genes reported in public databases. The deduced 283 aa sequence of VAK-3, consisting of a 19 aa signal peptide and a 264 aa mature protein, contained highly conserved peptide segments specific to class A beta-lactamases including the specific amino acid residues STFK (62-65), SDN (122-124), E (158), and RTG (226-228). Results from PCR performed with primers specific to the VAK-3 beta-lactamase gene identified 3 of the 36 isolated strains as V. alginolyticus, Vibrio cholerae, and Photobacterium damselae subsp. damselae, indicating the utilization of various beta-lactamase genes including unidentified ones in ampicillin-resistant Vibrio spp. strains from the marine environment. In a mating experiment, none of the isolates transfered the VAK-3 beta-lactamase gene to the Escherichia coli recipient. This lack of mobility, and the presence of a chromosomal acyl-CoA flanking sequence upstream of the VAK-3 beta- lactamase gene, led to the assumption that the location of this new beta-lactamase gene was in the chromosome, rather than the mobile plasmid. Antibiotic susceptibility of VAK-3 beta-lactamase was indicated by elevated levels of resistance to penicillins, but not to cephalosporins in the wild type and E. coli harboring recombinant plasmid pKV-3, compared with those of

  5. Extended spectrum beta-lactamase and fluoroquinolone resistance genes and plasmids among Escherichia coli isolates from zoo animals, Czech Republic.

    PubMed

    Dobiasova, Hana; Dolejska, Monika; Jamborova, Ivana; Brhelova, Eva; Blazkova, Lucie; Papousek, Ivo; Kozlova, Marketa; Klimes, Jiri; Cizek, Alois; Literak, Ivan

    2013-09-01

    Commensal Escherichia coli isolates from healthy zoo animals kept in Ostrava Zoological Garden, Czech Republic, were investigated to evaluate the dissemination of extended-spectrum beta-lactamase (ESBL) and plasmid-mediated quinolone resistance (PMQR) genes. A total of 160 faecal samples of various animal species were inoculated onto MacConkey agar with cefotaxime (2 mg L(-1)) or ciprofloxacin (0.05 mg L(-1)) to obtain ESBL- or PMQR-positive E. coli isolates. Clonality of E. coli isolates was investigated by multilocus sequence typing and pulsed-field gel electrophoresis. Plasmids carrying ESBL or PMQR genes were typed by PCR-based replicon typing, plasmid multilocus sequence typing and restriction fragment length polymorphism. Forty-nine (71%, n = 69) cefotaxime-resistant and 15 (16%, n = 94) ciprofloxacin-resistant E. coli isolates harboured ESBL or PMQR genes. Isolates were assigned to 18 sequence types (ST) and 20 clusters according to their macrorestriction patterns by pulsed-field gel electrophoresis. The genes blaCTX -M-1 and qnrS1 were detected on highly related IncI1 plasmids assigned to clonal complex 3 (ST3, ST38) and on non-related IncN plasmids of ST1 and ST3, respectively. The gene qnrS1 was located on related IncX1 plasmids. Dissemination of antibiotic resistance is associated with spreading of particular E. coli clones and plasmids of specific incompatibility groups among various animal species. PMID:23679004

  6. Organization of the antiseptic resistance gene qacA and Tn552-related beta-lactamase genes in multidrug- resistant Staphylococcus haemolyticus strains of animal and human origins.

    PubMed

    Anthonisen, I-L; Sunde, M; Steinum, T M; Sidhu, M S; Sørum, H

    2002-11-01

    A part (12 kb) of a plasmid containing the beta-lactamase genes of Tn552, the disinfectant resistance gene qacA, and flanking DNA has been cloned from a Staphylococcus haemolyticus isolate and sequenced. This region was used to map the corresponding regions in six other multiresistant S. haemolyticus isolates of human and animal origin. The organizations of the genetic structures were almost identical in all isolates studied. The beta-lactamase and qacA genes from S. haemolyticus have >99.9% identities at the nucleotide level with the same genes from S. aureus, demonstrating that various staphylococcal species able to colonize animal and human hosts can exchange the genetic elements involved in resistance to antibiotics and disinfectants. The use of antibiotics and disinfectants in veterinary practice and animal husbandry may also contribute to the selection and maintenance of resistance factors among the staphylococcal species. Different parts of the 12-kb section analyzed had high degrees of nucleotide identity with regions from several other different Staphylococcus aureus plasmids. This suggests the contribution of interplasmid recombination in the evolutionary makeup of this 12-kb section involving plasmids that can intermingle between various staphylococcal species. The lateral spread of resistance genes between various staphylococcal species is probably facilitated by the generation of large multiresistance plasmids and the subsequent interspecies exchange of them. PMID:12384372

  7. beta-Lactamases in laboratory and clinical resistance.

    PubMed Central

    Livermore, D M

    1995-01-01

    beta-Lactamases are the commonest single cause of bacterial resistance to beta-lactam antibiotics. Numerous chromosomal and plasmid-mediated types are known and may be classified by their sequences or phenotypic properties. The ability of a beta-lactamase to cause resistance varies with its activity, quantity, and cellular location and, for gram-negative organisms, the permeability of the producer strain. beta-Lactamases sometimes cause obvious resistance to substrate drugs in routine tests; often, however, these enzymes reduce susceptibility without causing resistance at current, pharmacologically chosen breakpoints. This review considers the ability of the prevalent beta-lactamases to cause resistance to widely used beta-lactams, whether resistance is accurately reflected in routine tests, and the extent to which the antibiogram for an organism can be used to predict the type of beta-lactamase that it produces. PMID:8665470

  8. Beta-lactamase gene expression in a penicillin-resistant Bacillus anthracis strain.

    PubMed

    Chen, Yahua; Tenover, Fred C; Koehler, Theresa M

    2004-12-01

    Expression of the bla1 and bla2 genes in an archetypal Bacillus anthracis strain is insufficient for penicillin resistance. In a penicillin-resistant clinical isolate, both genes are highly transcribed, but bla1 is the major contributor to high-level resistance to ampicillin. Differential expression of the bla genes is dependent upon strain background. PMID:15561870

  9. A nosocomial outbreak of Serratia marcescens producing inducible Amp C-type beta-lactamase enzyme and carrying antimicrobial resistance genes within a class 1 integron.

    PubMed

    Bagattini, M; Crispino, M; Gentile, F; Barretta, E; Schiavone, D; Boccia, M C; Triassi, M; Zarrilli, R

    2004-01-01

    We investigated an outbreak of Serratia marcescens in the adult intensive care unit of the University Hospital of Napoli. The outbreak involved 13 cases of infection by S. marcescens over a nine-month period and was caused by a single pulsed-field gel electrophoresis clone. The epidemic strain was multiply antibiotic resistant, producing an inducible Amp C-type beta-lactamase enzyme and carrying the trimethoprim-resistance gene and the adenyltransferase gene, which confers resistance to streptomycin and spectinomycin, within a class 1 integron. Antimicrobial therapy with beta-lactams was associated with S. marcescens acquisition in the intensive care unit. PMID:14706268

  10. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  11. Multifocal outbreaks of metallo-beta-lactamase-producing Pseudomonas aeruginosa resistant to broad-spectrum beta-lactams, including carbapenems.

    PubMed Central

    Senda, K; Arakawa, Y; Nakashima, K; Ito, H; Ichiyama, S; Shimokata, K; Kato, N; Ohta, M

    1996-01-01

    A total of 3,700 Pseudomonas aeruginosa isolates were collected from 17 general hospitals in Japan from 1992 to 1994. Of these isolates, 132 carbapenem-resistant strains were subjected to DNA hybridization analysis with the metallo-beta-lactamase gene (blaIMP)-specific probe. Fifteen strains carrying the metallo-beta-lactamase gene were identified in five hospitals in different geographical areas. Three strains of P. aeruginosa demonstrated high-level imipenem resistance (MIC, > or = 128 micrograms/ml), two strains exhibited low-level imipenem resistance (MIC, < or = 4 micrograms/ml), and the rest of the strains were in between. These results revealed that the acquisition of a metallo-beta-lactamase gene alone does not necessarily confer elevated resistance to carbapenems. In several strains, the metallo-beta-lactamase gene was carried by large plasmids, and carbapenem resistance was transferred from P. aeruginosa to Escherichia coli by electroporation in association with the acquisition of the large plasmid. Southern hybridization analysis and genomic DNA fingerprinting profiles revealed different genetic backgrounds for these 15 isolates, although considerable similarity was observed for the strains isolated from the same hospital. These findings suggest that the metallo-beta-lactamase-producing P. aeruginosa strains are not confined to a unique clonal lineage but proliferated multifocally by plasmid-mediated dissemination of the metallo-beta-lactamase gene in strains of different genetic backgrounds. Thus, further proliferation of metallo-beta-lactamase-producing strains with resistance to various beta-lactams may well be inevitable in the future, which emphasizes the need for early recognition of metallo-beta-lactamase-producing strains, rigorous infection control, and restricted clinical use of broad-spectrum beta-lactams including carbapenems. PMID:8834878

  12. Detection of Extended Spectrum Beta-Lactamases Resistance Genes among Bacteria Isolated from Selected Drinking Water Distribution Channels in Southwestern Nigeria.

    PubMed

    Adesoji, Ayodele T; Ogunjobi, Adeniyi A

    2016-01-01

    Extended Spectrum Beta-Lactamases (ESBL) provide high level resistance to beta-lactam antibiotics among bacteria. In this study, previously described multidrug resistant bacteria from raw, treated, and municipal taps of DWDS from selected dams in southwestern Nigeria were assessed for the presence of ESBL resistance genes which include bla TEM, bla SHV, and bla CTX by PCR amplification. A total of 164 bacteria spread across treated (33), raw (66), and municipal taps (68), belonging to α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Flavobacteriia, Bacilli, and Actinobacteria group, were selected for this study. Among these bacteria, the most commonly observed resistance was for ampicillin and amoxicillin/clavulanic acid (61 isolates). Sixty-one isolates carried at least one of the targeted ESBL genes with bla TEM being the most abundant (50/61) and bla CTX being detected least (3/61). Klebsiella was the most frequently identified genus (18.03%) to harbour ESBL gene followed by Proteus (14.75%). Moreover, combinations of two ESBL genes, bla SHV + bla TEM or bla CTX + bla TEM, were observed in 11 and 1 isolate, respectively. In conclusion, classic bla TEM ESBL gene was present in multiple bacterial strains that were isolated from DWDS sources in Nigeria. These environments may serve as foci exchange of genetic traits in a diversity of Gram-negative bacteria. PMID:27563674

  13. Detection of Extended Spectrum Beta-Lactamases Resistance Genes among Bacteria Isolated from Selected Drinking Water Distribution Channels in Southwestern Nigeria

    PubMed Central

    Ogunjobi, Adeniyi A.

    2016-01-01

    Extended Spectrum Beta-Lactamases (ESBL) provide high level resistance to beta-lactam antibiotics among bacteria. In this study, previously described multidrug resistant bacteria from raw, treated, and municipal taps of DWDS from selected dams in southwestern Nigeria were assessed for the presence of ESBL resistance genes which include blaTEM, blaSHV, and blaCTX by PCR amplification. A total of 164 bacteria spread across treated (33), raw (66), and municipal taps (68), belonging to α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Flavobacteriia, Bacilli, and Actinobacteria group, were selected for this study. Among these bacteria, the most commonly observed resistance was for ampicillin and amoxicillin/clavulanic acid (61 isolates). Sixty-one isolates carried at least one of the targeted ESBL genes with blaTEM being the most abundant (50/61) and blaCTX being detected least (3/61). Klebsiella was the most frequently identified genus (18.03%) to harbour ESBL gene followed by Proteus (14.75%). Moreover, combinations of two ESBL genes, blaSHV + blaTEM or blaCTX + blaTEM, were observed in 11 and 1 isolate, respectively. In conclusion, classic blaTEM ESBL gene was present in multiple bacterial strains that were isolated from DWDS sources in Nigeria. These environments may serve as foci exchange of genetic traits in a diversity of Gram-negative bacteria. PMID:27563674

  14. Beta-lactamase genes of the penicillin-susceptible Bacillus anthracis Sterne strain.

    PubMed

    Chen, Yahua; Succi, Janice; Tenover, Fred C; Koehler, Theresa M

    2003-02-01

    Susceptibility to penicillin and other beta-lactam-containing compounds is a common trait of Bacillus anthracis. Beta-lactam agents, particularly penicillin, have been used worldwide to treat anthrax in humans. Nonetheless, surveys of clinical and soil-derived strains reveal penicillin G resistance in 2 to 16% of isolates tested. Bacterial resistance to beta-lactam agents is often mediated by production of one or more types of beta-lactamases that hydrolyze the beta-lactam ring, inactivating the antimicrobial agent. Here, we report the presence of two beta-lactamase (bla) genes in the penicillin-susceptible Sterne strain of B. anthracis. We identified bla1 by functional cloning with Escherichia coli. bla1 is a 927-nucleotide (nt) gene predicted to encode a protein with 93.8% identity to the type I beta-lactamase gene of Bacillus cereus. A second gene, bla2, was identified by searching the unfinished B. anthracis chromosome sequence database of The Institute for Genome Research for open reading frames (ORFs) predicted to encode beta-lactamases. We found a partial ORF predicted to encode a protein with significant similarity to the carboxy-terminal end of the type II beta-lactamase of B. cereus. DNA adjacent to the 5' end of the partial ORF was cloned using inverse PCR. bla2 is a 768-nt gene predicted to encode a protein with 92% identity to the B. cereus type II enzyme. The bla1 and bla2 genes confer ampicillin resistance to E. coli and Bacillus subtilis when cloned individually in these species. The MICs of various antimicrobial agents for the E. coli clones indicate that the two beta-lactamase genes confer different susceptibility profiles to E. coli; bla1 is a penicillinase, while bla2 appears to be a cephalosporinase. The beta-galactosidase activities of B. cereus group species harboring bla promoter-lacZ transcriptional fusions indicate that bla1 is poorly transcribed in B. anthracis, B. cereus, and B. thuringiensis. The bla2 gene is strongly expressed in B

  15. Tn5393d, a complex Tn5393 derivative carrying the PER-1 extended-spectrum beta-lactamase gene and other resistance determinants.

    PubMed

    Mantengoli, Elisabetta; Rossolini, Gian Maria

    2005-08-01

    In Alcaligenes faecalis FL-424/98, a clinical isolate that produces the PER-1 extended-spectrum beta-lactamase, the bla(PER-1) gene was found to be carried on a 44-kb nonconjugative plasmid, named pFL424, that was transferred to Escherichia coli by electroporation. Investigation of the genetic context of the bla(PER-1) gene in pFL424 by means of a combined cloning and PCR mapping approach revealed that the gene is associated with a transposonlike element of the Tn3 family. This 14-kb element is a Tn5393 derivative of original structure, named Tn5393d, which contains the transposition module and the strAB genes typical of other members of the Tn5393 lineage plus additional resistance determinants, including the bla(PER-1) gene and a new allelic variant of the aphA6 aminoglycoside phosphotransferase gene, named aphA6b, whose product is active against kanamycin, streptomycin, and amikacin. Tn5393d apparently originated from the consecutive insertion of two composite transposons into a Tn5393 backbone carrying the aphA6b and the bla(PER-1) genes, respectively. The putative composite transposon carrying bla(PER-1), named Tn4176, is made of two original and nonidentical insertion sequences of the IS4 family, named IS1387a and IS1387b, of which one is interrupted by the insertion of an original insertion sequence of the IS30 family, named IS1066. In pFL424, Tn5393d is inserted into a Tn501-like mercury resistance transposon. Transposition of Tn5393d or modules thereof containing the bla(PER-1) gene from pFL424 to small multicopy plasmids or to a bacterial artificial chromosome was not detected in an E. coli host harboring both replicons. PMID:16048938

  16. Endemic carbapenem-resistant Pseudomonas aeruginosa with acquired metallo-beta-lactamase determinants in European hospital.

    PubMed

    Lagatolla, Cristina; Tonin, Enrico A; Monti-Bragadin, Carlo; Dolzani, Lucilla; Gombac, Francesca; Bearzi, Claudia; Edalucci, Elisabetta; Gionechetti, Fabrizia; Rossolini, Gian Maria

    2004-03-01

    Acquired metallo-beta-lactamases (MBLs) can confer broad-spectrum beta-lactam resistance (including carbapenems) not reversible by conventional beta-lactamase inhibitors and are emerging resistance determinants of remarkable clinical importance. In 2001, multidrug-resistant Pseudomonas aeruginosa carrying bla(VIM) MBL genes were found to be widespread (approximately 20% of all P. aeruginosa isolates and 70% of the carbapenem-resistant isolates) at Trieste University Hospital. Clonal diversity and heterogeneity of resistance determinants (either bla(VIM-1)-like or bla(VIM-2)-like) were detected among MBL producers. This evidence is the first that acquired MBLs can rapidly emerge and establish a condition of endemicity in certain epidemiologic settings. PMID:15109432

  17. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

    PubMed

    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen

    2004-02-13

    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  18. Cloning and characterization of the endogenous cephalosporinase gene, cepA, from Bacteroides fragilis reveals a new subgroup of Ambler class A beta-lactamases.

    PubMed Central

    Rogers, M B; Parker, A C; Smith, C J

    1993-01-01

    Bacteroides fragilis CS30 is a clinical isolate resistant to high concentrations of benzylpenicillin and cephaloridine but not to cephamycin or penem antibiotics. beta-Lactam resistance is mediated by a chromosomally encoded cephalosporinase produced at a high level. The gene encoding this beta-lactamase was cloned from genomic libraries constructed in Escherichia coli and then mated with B. fragilis 638 for identification of ampicillin-resistant (Apr) strains. Apr transconjugants contained a nitrocefin-reactive protein with the physical and enzymatic properties of the original CS30 isolate. The beta-lactamase gene (cepA) was localized by deletion analysis and subcloned, and its nucleotide sequence was determined. The 903-bp cepA open reading frame encoded a 300-amino-acid precursor protein (predicted molecular mass, 34,070 Da). A beta-lactamase-deficient mutant strain of B. fragilis 638 was constructed by insertional inactivation with the cepA gene of CS30, demonstrating strict functional homology between these chromosomal beta-lactamase genes. An extensive comparison of the CepA protein sequence by alignment with other beta-lactamases revealed the strict conservation of at least four elements common to Ambler class A. A further comparison of the CepA protein sequence with protein sequences of beta-lactamases from two other Bacteroides species indicated that they constitute their own distinct subgroup of class A beta-lactamases. Images PMID:8285623

  19. Antibiotic Resistance Pattern and Evaluation of Metallo-Beta Lactamase Genes Including bla-IMP and bla-VIM Types in Pseudomonas aeruginosa Isolated from Patients in Tehran Hospitals

    PubMed Central

    Aghamiri, Samira; Amirmozafari, Nour; Fallah Mehrabadi, Jalil; Fouladtan, Babak; Samadi Kafil, Hossein

    2014-01-01

    Beta-lactamase producing strains of Pseudomonas aeruginosa are important etiological agents of hospital infections. Carbapenems are among the most effective antibiotics used against Pseudomonas infections, but they can be rendered infective by group B β-lactamase, commonly called metallo-beta lactamase. In this study, the antimicrobial sensitivity patterns of P. aeruginosa strains isolated from 9 different hospitals in Tehran, Iran, as well as the prevalence of MBLs genes (bla-VIM and bla-IMP) were determined. A total of 212 strains of P. aeruginosa recovered from patients in hospitals in Tehran were confirmed by both biochemical methods and PCR. Their antimicrobial sensitivity patterns were determined by Kirby-Bauer disk diffusion method. Following MIC determination, imipenem resistant strains were selected by DDST method which was followed by PCR tests for determination of MBLs genes: bla-IMP and bla-VIM. The results indicated that, in the DDST phenotypic method, among the 100 imipenem resistant isolates, 75 strains were MBLs positive. The PCR test indicated that 70 strains (33%) carried bla-VIM gene and 20 strains (9%) harbored bla-IMP. The results indicated that the extent of antibiotic resistance among Pseudomonas aeruginosa is on the rise. This may be due to production of MBLs enzymes. Therefore, determination of antibiotic sensitivity patterns and MBLs production by these bacteria, can be important in control of clinical Pseudomonas infection. PMID:24944839

  20. [Investigation of beta-lactamase genes and clonal relationship among the extended-spectrum beta-lactamase producing nosocomial Escherichia coli isolates].

    PubMed

    Görgeç, Sündüz; Kuzucu, Çiğdem; Otlu, Barış; Yetkin, Funda; Ersoy, Yasemin

    2015-01-01

    Extended-spectrum beta-lactamase (ESBL) producing microorganisms currently cause a major problem. Among theseCTX-M beta-lactamase producing Escherichia coli has also disseminated worldwide as an important cause of both nosocomial and community-acquired infections. The aims of this study were to determine the prevalence of the beta-lactamase genes, antibiotic susceptibilities and clonal relationships of ESBL-producing nosocomial E.coli isolates. A total of 76 ESBL-producing E.coli strains isolated from urine (n= 26), blood (n= 25) and wound (n= 25) specimens of hospitalized patients identified as nosocomial infection agents according to the CDC criteria between June 2010-June 2011 were included in the study. Antibiotic susceptibilities of the isolates were detected by Kirby-Bauer disc diffusion method according to CLSI recommendations. ESBL production was tested by double disc diffusion method, and cefotaxime/cefotaxime-clavulanic acid E-test strips (AB Biodisk, Sweden) were used for indeterminate results. Presence of TEM, SHV, CTX-M, OXA-2 group, 0XA-10 group, PER, VEB and GES beta-lactamase genes were investigated by polymerase chain reaction (PCR) using specific primers. Pulsed-field gel electrophoresis (PFGE) method was used for the detection of clonal relationships among the strains. Most of the ESBL-producing E.coli strains were isolated from samples of inpatients in intensive care (35%), internal medicine (16%) and general surgery (13%) units. All of the 76 strains were found susceptible to imipenem, meropenem and amikacin; however all were resistant to cefotaxime and ceftriaxone. The susceptibility rates of the isolates to cefoxitin, ertapenem, cefoperazone/sulbactam, piperacillin-tazobactam, gentamicin, ciprofloxacin, cefepime, amoxicillin-clavulanic acid, aztreonam and ceftazidime were 96%, 83%, 63%, 61%, 50%, 41%, 25%, 21%, 20% and 18%, respectively. Among E.coli isolates, the frequency of CTX-M, TEM, OXA-2 group, PER, SHV and OXA-10 group beta-lactamase

  1. Recognition and Resistance in TEM [superscript beta]-Lactamase

    SciTech Connect

    Wang, Xiaojun; Minasov, George; Blazquez, Jesus; Caselli, Emilia; Prati, Fabio; Shoichet, Brian K.

    2010-03-08

    Developing antimicrobials that are less likely to engender resistance has become an important design criterion as more and more drugs fall victim to resistance mutations. One hypothesis is that the more closely an inhibitor resembles a substrate, the more difficult it will be to develop resistant mutations that can at once disfavor the inhibitor and still recognize the substrate. To investigate this hypothesis, 10 transition-state analogues, of greater or lesser similarity to substrates, were tested for inhibition of TEM-1 beta-lactamase, the most widespread resistance enzyme to penicillin antibiotics. The inhibitors were also tested against four characteristic mutant enzymes: TEM-30, TEM-32, TEM-52, and TEM-64. The inhibitor most similar to the substrate, compound 10, was the most potent inhibitor of the WT enzyme, with a K(i) value of 64 nM. Conversely, compound 10 was the most susceptible to the TEM-30 (R244S) mutant, for which inhibition dropped by over 100-fold. The other inhibitors were relatively impervious to the TEM-30 mutant enzyme. To understand recognition and resistance to these transition-state analogues, the structures of four of these inhibitors in complex with TEM-1 were determined by X-ray crystallography. These structures suggest a structural basis for distinguishing inhibitors that mimic the acylation transition state and those that mimic the deacylation transition state; they also suggest how TEM-30 reduces the affinity of compound 10. In cell culture, this inhibitor reversed the resistance of bacteria to ampicillin, reducing minimum inhibitory concentrations of this penicillin by between 4- and 64-fold, depending on the strain of bacteria. Notwithstanding this activity, the resistance of TEM-30, which is already extant in the clinic, suggests that there can be resistance liabilities with substrate-based design.

  2. Common mechanism of ampC beta-lactamase induction in enterobacteria: regulation of the cloned Enterobacter cloacae P99 beta-lactamase gene.

    PubMed Central

    Lindberg, F; Normark, S

    1987-01-01

    Expression of the chromosomal beta-lactamase from the ampC gene in inducible in both Enterobacter cloacae and Citrobacter freundii. Cloning of ampC as well as its regulatory gene, ampR, from E. cloacae P99 revealed a gene organization indentical to that of C. freundii in the corresponding region. Although almost no similarities could be found between the restriction maps of ampC and ampR in the two species, the genes cross-hybridize. Also, both ampR gene products have a size of about 31,000. The regulatory features of E. cloacae beta-lactamase induction are very similar to those in C. freundii, i.e., beta-lactamase synthesis is repressed by AmpR in the absence, and stimulated in the presence, of inducer. The AmpR function can be transcomplemented between the two species, but there are quantitative regulatory aberrations in such hybrids, in contrast to the total complementation obtained within each system. These results suggest that the mechanism of beta-lactamase induction is the same in E. cloacae, C. freundii, and other gram-negative bacteria with inducible chromosomal beta-lactamase expression. Images PMID:3027046

  3. Analysis of the beta-lactamase plasmid of borderline methicillin-susceptible Staphylococcus aureus: focus on bla complex genes and cadmium resistance determinants cadD and cadX.

    PubMed

    Massidda, Orietta; Mingoia, Marina; Fadda, Daniela; Whalen, Michael B; Montanari, Maria Pia; Varaldo, Pietro E

    2006-03-01

    Borderline methicillin-susceptible Staphylococcus aureus strains are a rather homogeneous group, characterized by MICs of penicillinase-resistant penicillins (PRPs) at or just below the susceptibility breakpoint. Other features unique to this group include the presence of a pBW15-like beta-lactamase plasmid, the association with phage complex 94/96, and the production of a PRP-hydrolyzing beta-lactamase activity in addition to the classical penicillinase activity. The four HindIII fragments of pBORa53, a pBW15-like plasmid from the well-studied borderline S. aureus strain a53, were cloned in Escherichia coli, sequenced and analyzed. The plasmid (17,334 bp in size) contains 14 open reading frames (ORFs) and a complete copy of transposon Tn552, which harbors the three genes of the bla complex (blaZ, blaR1, and blaI) necessary for penicillinase production. Among the other 11 ORFs identified, two were homologous to cadmium resistance determinants of Staphylococcus lugdunensis and to the cadD and cadX genes recently detected in S. aureus. Consistent with this, strain a53 was found to be cadmium resistant. From a collection of 30 S. aureus isolates with borderline PRP MIC levels, 27 matched strain a53 in the positive amplification reactions with all of the four primer pairs targeting the cadD-cadX region, the presence of the 17.3-kb plasmid, and the level of cadmium resistance. The well-established S. aureus laboratory strain ATCC 29213 was also found to express cadD-cadX-mediated cadmium resistance. pBORa53 could be re-isolated from transformants obtained by transferring it into a PRP-susceptible recipient. However, while the transformants demonstrated levels of cadmium and penicillin resistance similar to those of strain a53, they remained fully susceptible to PRPs. PMID:16229889

  4. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample. PMID:27196551

  5. Chromosomal beta-lactamase genes of Klebsiella oxytoca are divided into two main groups, blaOXY-1 and blaOXY-2.

    PubMed Central

    Fournier, B; Roy, P H; Lagrange, P H; Philippon, A

    1996-01-01

    The chromosomally encoded beta-lactamase gene (blaOXY-2) of the wild-type Klebsiella oxytoca SL911 was cloned and sequenced. Its nucleotide sequence similarity with the previously sequenced K. oxytoca beta-lactamase gene (blaOXY-1) (Y. Arakawa, M. Ohta, N. Kido, M. Mori, H. Ito, T. Komatsu, Y. Fujii, and N. Kato, Antimicrob. Agents Chemother. 33:63-70, 1989) is 87.3%, and its amino acid similarity is 89.7%. This group of K. oxytoca beta-lactamases is related to chromosomal beta-lactamases of Citrobacter diversus, Proteus vulgaris, and Yersinia enterocolitica and to the plasmid-mediated extended-spectrum beta-lactamases MEN-1 and Toho-1. By colony hybridization with 86 strains susceptible and resistant to aztreonam, isolated in six countries, K. oxytoca beta-lactamase genes hybridized with either a specific blaOXY-1 DNA probe (668 bp) or a blaOXY-2 DNA probe (723 bp). Thus, beta-lactamase genes could be divided into two groups: blaOXY-1 (47% of the strains) and blaOXY-2 (53% of the strains). A study of isoelectric points confirmed the great variability reported in the literature. However, the two beta-lactamase groups were each represented by four different pIs: for OXY-2, 5.2, 5.7, 6.4, and 6.8, with the 5.2 form representing 59% of all OXY-2 enzymes, and for OXY-1, 7.1, 7.5, 8.2, and 8.8, with the 7.5 form representing 88% of all OXY-1 enzymes. PMID:8834897

  6. Next-Generation Sequencing for Typing and Detection of Resistance Genes: Performance of a New Commercial Method during an Outbreak of Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli

    PubMed Central

    Overdevest, I. T.; Snelders, E.; Willemsen, I.; Hendriks, Y.; Adesokan, A.; Doran, G.; Bruso, S.; Rolfe, A.; Pettersson, A.; Kluytmans, J. A. J. W.

    2014-01-01

    Next-generation sequencing (NGS) has the potential to provide typing results and detect resistance genes in a single assay, thus guiding timely treatment decisions and allowing rapid tracking of transmission of resistant clones. We evaluated the performance of a new NGS assay (Hospital Acquired Infection BioDetection System; Pathogenica) during an outbreak of sequence type 131 (ST131) Escherichia coli infections in a nursing home in The Netherlands. The assay was performed on 56 extended-spectrum-beta-lactamase (ESBL) E. coli isolates collected during 2 prevalence surveys (March and May 2013). Typing results were compared to those of amplified fragment length polymorphism (AFLP), whereby we visually assessed the agreement of the BioDetection phylogenetic tree with clusters defined by AFLP. A microarray was considered the gold standard for detection of resistance genes. AFLP identified a large cluster of 31 indistinguishable isolates on adjacent departments, indicating clonal spread. The BioDetection phylogenetic tree showed that all isolates of this outbreak cluster were strongly related, while the further arrangement of the tree also largely agreed with other clusters defined by AFLP. The BioDetection assay detected ESBL genes in all but 1 isolate (sensitivity, 98%) but was unable to discriminate between ESBL and non-ESBL TEM and SHV beta-lactamases or to specify CTX-M genes by group. The performance of the hospital-acquired infection (HAI) BioDetection System for typing of E. coli isolates compared well with the results of AFLP. Its performance with larger collections from different locations, and for typing of other species, was not evaluated and needs further study. PMID:24789184

  7. A novel class C beta-lactamase (FOX-2) in Escherichia coli conferring resistance to cephamycins.

    PubMed Central

    Bauernfeind, A; Wagner, S; Jungwirth, R; Schneider, I; Meyer, D

    1997-01-01

    An Escherichia coli strain resistant to a broad spectrum of beta-lactams, including cephamycins, was isolated from a patient suffering from urinary tract infection. A resistance plasmid (pMVP-7) was transferred from the clinical isolate to an Escherichia coli recipient. Both strains produce a cefoxitin-hydrolyzing beta-lactamase focusing at pI 6.7. The phenotype was similar to that of a Klebsiella pneumoniae strain producing cephamycinase FOX-1, so primers were selected from the FOX-1 sequence to amplify the bla gene of the transconjugant. The PCR product obtained was sequenced. The percentage of identity of the deduced amino acid sequence with sequences of other AmpC-type beta-lactamases was 96.9% with FOX-1, 74.9% with CMY-1, and 67.7% with MOX-1. This new plasmid-mediated enzyme is most closely related to FOX-1 (11 amino acid exchanges). We therefore propose the designation FOX-2. PMID:9303413

  8. Hospital outbreak of carbapenem-resistant Pseudomonas aeruginosa producing VIM-1, a novel transferable metallo-beta-lactamase.

    PubMed

    Cornaglia, G; Mazzariol, A; Lauretti, L; Rossolini, G M; Fontana, R

    2000-11-01

    A total of 8 Pseudomonas aeruginosa isolates was collected from 7 different patients in different wards of the University Hospital of Verona, Italy, from February 1997 to February 1998. The high level of resistance to carbapenems (imipenem minimum inhibitory concentration was always >128 microg/mL) and other broad-spectrum beta-lactams and the rate of imipenem hydrolysis and its inhibition by ethylenediamine-tetra-acetic acid were all suggestive of production of a carbapenem-hydrolyzing metallo-beta-lactamase. A specific DNA probe derived from the recently cloned bla(VIM-1) gene hybridized to all the isolates. A genomic DNA fingerprinting profile revealed clonal relatedness for 7 of 8 isolates. A description of this hospital outbreak is reported, the occurrence of which confirms that proliferation of metallo-beta-lactamase-producing strains multiply resistant to beta-lactams is already a reality outside Japan. These findings emphasize the need for early recognition of similar isolates. PMID:11073738

  9. Phenotypic detection and molecular characterization of beta-lactamase genes among Citrobacter species in a tertiary care hospital

    PubMed Central

    Praharaj, Ashok Kumar; Khajuria, Atul; Kumar, Mahadevan; Grover, Naveen

    2016-01-01

    Objective: To examine the distribution, emergence, and spread of genes encoding beta-lactamase resistance in Citrobacter species isolated from hospitalized patients in a tertiary care hospital. Methods: A prospective study was conducted in a 1000-bed tertiary care center in Pune, India from October 2010 to October 2013. A total of 221 Citrobacter spp. isolates were recovered from clinical specimens from different patients (one isolate per patient) admitted to the surgical ward, medical ward and medical and surgical Intensive Care Units. Polymerase chain reaction (PCR) assays and sequencing were used to determine the presence of beta-lactamase encoding genes. Conjugation experiments were performed to determine their transferability. Isolate relatedness were determined by repetitive element based-PCR, enterobacterial repetitive intergenic consensus-PCR and randomly amplified polymorphic DNA. Results: Among 221 tested isolates of Citrobacter spp. recovered from various clinical specimens, 179 (80.9%) isolates showed minimum inhibitory concentration (MIC) >4 μg/ml against meropenem and imipenem. One hundred and forty-five isolates with increased MICs value against carbapenems were further processed for molecular characterization of beta-lactamase genes. Susceptibility profiling of the isolates indicated that 100% retained susceptibility to colistin. Conjugation experiments indicated that blaNDM-1 was transferable via a plasmid. Conclusion: The ease of NDM-1 plasmid transmissibility may help their dissemination among the Citrobacter species as well as to others in Enterobacteriaceae. Early detection, antimicrobial stewardship and adequate infection control measures will help in limiting the spread of these organisms. PMID:26952135

  10. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes

    PubMed Central

    Alves, Marta S.; Pereira, Anabela; Araújo, Susana M.; Castro, Bruno B.; Correia, António C. M.; Henriques, Isabel

    2014-01-01

    The aim of this study was to examine antibiotic resistance (AR) dissemination in coastal water, considering the contribution of different sources of fecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of fecal contamination: human-derived sewage and seagull feces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin, and amoxicillin were the most frequent. Higher rates of AR were found among seawater and feces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull feces (29 and 32%) were lower than in isolates from seawater (39%). Seawater AR profiles were similar to those from seagull feces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes blaTEM, sul1, sul2, tet(A), and tet(B), were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (blaCTX-M-1 and blaSHV-12) and seagull feces (blaCMY-2). Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull feces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived fecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health. PMID:25191308

  11. Antibiotic-Resistant Escherichia coli Bacteria, Including Strains with Genes Encoding the Extended-Spectrum Beta-Lactamase and QnrS, in Waterbirds on the Baltic Sea Coast of Poland▿

    PubMed Central

    Literak, Ivan; Dolejska, Monika; Janoszowska, Dagmar; Hrusakova, Jolana; Meissner, Wlodzimierz; Rzyska, Hanna; Bzoma, Szymon; Cizek, Alois

    2010-01-01

    Individual cloacal swabs of mallards (Anas platyrhynchos) and of herring gulls (Larus argentatus), as well as samples of waterbird feces obtained in 2008 and 2009, were cultivated for Escherichia coli. Isolates of E. coli were tested for susceptibilities to 12 antimicrobial agents by the disk diffusion method. Moreover, the samples were subcultivated on MacConkey agar (MCA) containing cefotaxime (2 mg liter−1) to detect E. coli with extended-spectrum beta-lactamase (ESBL) and subsequently on MCA supplemented with ciprofloxacin (0.05 mg liter−1) and MCA with nalidixic acid (20 mg liter−1) to isolate fluoroquinolone-resistant E. coli. PCR was used to detect specific antibiotic resistance genes. We found 9 E. coli isolates producing ESBL with bla genes: blaCTX-M-1 (6 isolates), blaCTX-M-9 plus blaTEM-1b (1 isolate), blaCTX-M-15 plus blaOXA-1 (1 isolate), and blaSHV-12 (1 isolate). In the isolate with blaCTX-M-15, the gene aac(6)-Ib-cr was also detected. The bla genes were harbored by transferable plasmids of the IncN and IncI1 groups. Nine quinolone-resistant E. coli isolates with qnrS genes were found and characterized. The gene qnrS was associated with a Tn3-like transposon on the IncX1 plasmid together with blaTEM-1 in two isolates. The gene qnrS was also harbored by conjugative plasmids of the IncN and IncX2 groups. Even if populations of wild birds are not directly influenced by antibiotic practice, we have demonstrated that antibiotic-resistant E. coli strains, including strains with various ESBL and qnrS genes, are found in the feces of wild birds on the coast of the Baltic Sea in Poland. PMID:20952638

  12. Antibiotic-resistant Escherichia coli bacteria, including strains with genes encoding the extended-spectrum beta-lactamase and QnrS, in waterbirds on the Baltic Sea Coast of Poland.

    PubMed

    Literak, Ivan; Dolejska, Monika; Janoszowska, Dagmar; Hrusakova, Jolana; Meissner, Wlodzimierz; Rzyska, Hanna; Bzoma, Szymon; Cizek, Alois

    2010-12-01

    Individual cloacal swabs of mallards (Anas platyrhynchos) and of herring gulls (Larus argentatus), as well as samples of waterbird feces obtained in 2008 and 2009, were cultivated for Escherichia coli. Isolates of E. coli were tested for susceptibilities to 12 antimicrobial agents by the disk diffusion method. Moreover, the samples were subcultivated on MacConkey agar (MCA) containing cefotaxime (2 mg liter(-1)) to detect E. coli with extended-spectrum beta-lactamase (ESBL) and subsequently on MCA supplemented with ciprofloxacin (0.05 mg liter(-1)) and MCA with nalidixic acid (20 mg liter(-1)) to isolate fluoroquinolone-resistant E. coli. PCR was used to detect specific antibiotic resistance genes. We found 9 E. coli isolates producing ESBL with bla genes: bla(CTX-M-1) (6 isolates), bla(CTX-M-9) plus bla(TEM-1b) (1 isolate), bla(CTX-M-15) plus bla(OXA-1) (1 isolate), and bla(SHV-12) (1 isolate). In the isolate with bla(CTX-M-15), the gene aac(6)-Ib-cr was also detected. The bla genes were harbored by transferable plasmids of the IncN and IncI1 groups. Nine quinolone-resistant E. coli isolates with qnrS genes were found and characterized. The gene qnrS was associated with a Tn3-like transposon on the IncX1 plasmid together with bla(TEM-1) in two isolates. The gene qnrS was also harbored by conjugative plasmids of the IncN and IncX2 groups. Even if populations of wild birds are not directly influenced by antibiotic practice, we have demonstrated that antibiotic-resistant E. coli strains, including strains with various ESBL and qnrS genes, are found in the feces of wild birds on the coast of the Baltic Sea in Poland. PMID:20952638

  13. Gene Network Analysis of Metallo Beta Lactamase Family Proteins Indicates the Role of Gene Partners in Antibiotic Resistance and Reveals Important Drug Targets.

    PubMed

    Parimelzaghan, Anitha; Anbarasu, Anand; Ramaiah, Sudha

    2016-06-01

    Metallo Beta (β) Lactamases (MBL) are metal dependent bacterial enzymes that hydrolyze the β-lactam antibiotics. In recent years, MBL have received considerable attention because it inactivates most of the β-lactam antibiotics. Increase in dissemination of MBL encoding antibiotic resistance genes in pathogenic bacteria often results in unsuccessful treatments. Gene interaction network of MBL provides a complete understanding on the molecular basis of MBL mediated antibiotic resistance. In our present study, we have constructed the MBL network of 37 proteins with 751 functional partners from pathogenic bacterial spp. We found 12 highly interconnecting clusters. Among the 37 MBL proteins considered in the present study, 22 MBL proteins are from B3 subclass, 14 are from B1 subclass and only one is from B2 subclass. Global topological parameters are used to calculate and compare the probability of interactions in MBL proteins. Our results indicate that the proteins associated within the network have a strong influence in antibiotic resistance mechanism. Interestingly, several drug targets are identified from the constructed network. We believe that our results would be helpful for researchers exploring MBL-mediated antibiotic resistant mechanisms. J. Cell. Biochem. 117: 1330-1339, 2016. © 2015 Wiley Periodicals, Inc. PMID:26517410

  14. Experimental prediction of the evolution of cefepime resistance from the CMY-2 AmpC beta-lactamase.

    PubMed Central

    Barlow, Miriam; Hall, Barry G

    2003-01-01

    Understanding of the evolutionary histories of many genes has not yet allowed us to predict the evolutionary potential of those genes. Intuition suggests that current biochemical activity of gene products should be a good predictor of the potential to evolve related activities; however, we have little evidence to support that intuition. Here we use our in vitro evolution method to evaluate biochemical activity as a predictor of future evolutionary potential. Neither the class C Citrobacter freundii CMY-2 AmpC beta-lactamase nor the class A TEM-1 beta-lactamase confer resistance to the beta-lactam antibiotic cefepime, nor do any of the naturally occurring alleles descended from them. However, the CMY-2 AmpC enzyme and some alleles descended from TEM-1 confer high-level resistance to the structurally similar ceftazidime. On the basis of the comparison of TEM-1 and CMY-2, we asked whether biochemical activity is a good predictor of the evolutionary potential of an enzyme. If it is, then CMY-2 should be more able than the TEMs to evolve the ability to confer higher levels of cefepime resistance. Although we generated CMY-2 evolvants that conferred increased cefepime resistance, we did not recover any CMY-2 evolvants that conferred resistance levels as high as the best cefepime-resistant TEM alleles. PMID:12750318

  15. Imipenem resistance in Klebsiella pneumoniae is associated with the combination of ACT-1, a plasmid-mediated AmpC beta-lactamase, and the foss of an outer membrane protein.

    PubMed Central

    Bradford, P A; Urban, C; Mariano, N; Projan, S J; Rahal, J J; Bush, K

    1997-01-01

    Six Escherichia coli and 12 Klebsiella pneumoniae isolates from a single hospital expressed a common beta-lactamase with a pI of approximately 9.0 and were resistant to cefoxitin and cefotetan (MIC ranges, 64 to > 128 and 16 to > 128 micrograms/ml, respectively). Seventeen of the 18 strains produced multiple beta-lactamases. Most significantly, three K. pneumoniae strains were also resistant to imipenem (MICs, 8 to 32 micrograms/ml). Spectrophotometric beta-lactamase assays with purified enzyme indicated hydrolysis of cephamycins, in addition to cephaloridine and benzylpenicillin. The 4ene encoding the pI 9.0 beta-lactamase (designated ACT-1 for AmpC type) was cloned and sequenced, which revealed an ampC-type beta-lactamase gene that originated from Enterobacter cloacae and that had 86% sequence homology to the P99 beta-lactamase and 94% homology to the partial sequence of MIR-1. Southern blotting revealed that the gene encoding ACT-1 was on a large plasmid in some of the K. pneumoniae strains as well as on the chromosomes of all of the strains, suggesting that the gene is located on an easily mobilized element. Outer membrane protein profiles of the K. pneumoniae strains revealed that the three imipenem-resistant strains were lacking a major outer membrane protein of approximately 42 kDa which was present in the imipenem-susceptible strains. ACT-1 is the first plasmid-mediated AmpC-type beta-lactamase derived from Enterobacter which has been completely sequenced. This work demonstrates that in addition to resistance to cephamycins, imipenem resistance can occur in K. pneumoniae when a high level of the ACT-1 beta-lactamase is produced in combination with the loss of a major outer membrane protein. PMID:9055993

  16. Resistance of Xanthomonas maltophilia to antibiotics and the effect of beta-lactamase inhibitors.

    PubMed

    Neu, H C; Saha, G; Chin, N X

    1989-01-01

    We examined the susceptibility of 50 isolates of Xanthomonas maltophilia and the effect of beta-lactamase inhibitors upon the susceptibility. The majority of isolates were resistant to azlocillin, piperacillin, mezlocillin, ticarcillin, cefotaxime, ceftizoxime, ceftriaxone, cefoperazone, and ceftazidime. All isolates were resistant to imipenem, CGP 31608, aztreonam, and carumonam. Although disk susceptibility tests showed that the combination of clavulanate with ticarcillin inhibited many isolates, at a ratio of 1:20 few isolates were susceptible to the combination. Addition of clavulanate to aztreonam and to imipenem failed to make organisms susceptible. Sulbactam combined with cefoperazone made some organisms susceptible, but ampicillin-sulbactam was ineffective, whereas tazobactam combined with piperacillin at a ratio of 1:4 made half the isolates have MICs of 32 micrograms/ml or less. The beta-lactamases from the isolates hydrolyzed all of the beta-lactams. PMID:2791491

  17. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  18. Extended-Spectrum-Beta-Lactamases, AmpC Beta-Lactamases and Plasmid Mediated Quinolone Resistance in Klebsiella spp. from Companion Animals in Italy

    PubMed Central

    Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S.; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

    2014-01-01

    We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6′)-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6′)-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6′)-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission

  19. Antibiotic resistance pattern and evaluation of metallo-beta lactamase genes (VIM and IMP) in Pseudomonas aeruginosa strains producing MBL enzyme, isolated from patients with secondary immunodeficiency

    PubMed Central

    Shirani, Kiana; Ataei, Behrouz; Roshandel, Fardad

    2016-01-01

    Background: One of the most common causes of hospital-acquired secondary infections in hospitalized patients is Pseudomonas aeruginosa. The aim of this study is to evaluate the expression of IMP and VIM in Pseudomonas aeruginosa strains (carbapenem resistant and producer MBL enzyme) in patients with secondary immunodeficiency. Materials and Methods: In a cross sectional study, 96 patients with secondary immunodeficiency hospitalized in the Al-Zahra hospital were selected. Carbapenem resistant strains isolated and modified Hodge test was performed in order to confirm the presence of the metallo carbapenemase enzyme. Under the standard conditions they were sent to the central laboratory for investigating nosocomial infection Multiplex PCR. Results: Of 96 samples 28.1% were IMP positive, 5.2% VIM positive and 3.1% both VIM and IMP positive. The prevalence of multidrug resistance in the IMP and/or VIM negative samples was 29%, while all 5 VIM positive samples have had multidrug resistance. Also the prevalence of multi-drug resistance in IMP positive samples were 96.3% and in IMP and VIM positive samples were 100%. According to Fisher’s test, the prevalence of multi-drug resistance based on gene expression has significant difference (P < 0.001). Conclusion: Based on the results of this study it can be concluded that, a significant percentage of patients with secondary immunodeficiency that suffer nosocomial infections with multidrug resistance, especially Pseudomonas aeruginosa, are probably MBL-producing gene positive. Therefore the cause of infection should be considered in the hospital care system to identify their features, the presence of genes involved in the development of multi-drug resistance and antibiotic therapy. PMID:27563634

  20. Antibacterial activities of multi drug resistant Myroides odoratimimus bacteria isolated from adult flesh flies (Diptera: sarcophagidae) are independent of metallo beta-lactamase gene

    PubMed Central

    Dharne, M.S.; Gupta, A.K.; Rangrez, A.Y.; Ghate, H.V.; Patole, M.S.; Shouche, Y.S.

    2008-01-01

    Flesh flies (Diptera: Sarcophagidae) are well known cause of myiasis and their gut bacteria have never been studied for antimicrobial activity against bacteria. Antimicrobial studies of Myroides spp. are restricted to nosocomial strains. A Gram-negative bacterium, Myroides sp., was isolated from the gut of adult flesh flies (Sarcophaga sp.) and submitted to evaluation of nutritional parameters using Biolog GN, 16S rRNA gene sequencing, susceptibility to various antimicrobials by disc diffusion method and detection of metallo β-lactamase genes (TUS/MUS). The antagonistic effects were tested on Gram-negative and Gram-positive bacteria isolated from human clinical specimens, environmental samples and insect mid gut. Bacterial species included were Aeromonas hydrophila, A. culicicola, Morganella morganii subsp. sibonii, Ochrobactrum anthropi, Weissella confusa, Escherichia coli, Ochrobactrum sp., Serratia sp., Kestersia sp., Ignatzschineria sp., Bacillus sp. The Myroides sp. strain was resistant to penicillin-G, erythromycin, streptomycin, amikacin, kanamycin, gentamycin, ampicillin, trimethoprim and tobramycin. These strain showed antibacterial action against all bacterial strains except W. confusa, Ignatzschineria sp., A. hydrophila and M. morganii subsp. sibonii. The multidrug resistance of the strain was similar to the resistance of clinical isolates, inhibiting growth of bacteria from clinical, environmental and insect gut samples. The metallo β-lactamase (TUS/MUS) genes were absent, and resistance due to these genes was ruled out, indicating involvement of other secretion machinery. PMID:24031236

  1. Cloning and sequencing of the metallothioprotein beta-lactamase II gene of Bacillus cereus 569/H in Escherichia coli.

    PubMed Central

    Hussain, M; Carlino, A; Madonna, M J; Lampen, J O

    1985-01-01

    The structural gene for beta-lactamase II (EC 3.5.2.6), a metallothioenzyme, from Bacillus cereus 569/H (constitutive for high production of the enzyme) was cloned in Escherichia coli, and the nucleotide sequence was determined. This is the first class B beta-lactamase whose primary structure has been reported. The amino acid sequence of the exoenzyme form, deduced from the DNA, indicates that beta-lactamase II, like other secreted proteins, is synthesized as a precursor with a 30-amino acid N-terminal signal peptide. The pre-beta-lactamase II (Mr, 28,060) is processed in E. coli and in B. cereus to a single mature protein (Mr, 24,932) which is totally secreted by B. cereus but in E. coli remains intracellular, probably in the periplasm. The expression of the gene in E. coli RR1 on the multicopy plasmid pRWHO12 was comparable to that in B. cereus, where it is presumably present as a single copy. The three histidine residues that are involved (along with the sole cysteine of the mature protein) in Zn(II) binding and hence in enzymatic activity against beta-lactams were identified. These findings will help to define the secondary structure, mechanism of action, and evolutionary lineage of B. cereus beta-lactamase II and other class B beta-lactamases. Images PMID:3930467

  2. Investigation of Metallo Beta Lactamases and Oxacilinases in Carbapenem Resistant Acinetobacter baumannii Strains Isolated from Inpatients

    PubMed Central

    Aksoy, M. Duygu; Çavuşlu, Şaban; Tuğrul, H. Murat

    2015-01-01

    Background: Resistance to beta-lactam antibiotics is widespread among Acinetobacter strains. Plasmid-mediated metallo beta lactamases (MBL) are responsible for carbapenem resistance, as are oxacillinases (OXA). In recent years, MBL producing carbapenem-resistant strains have been reported in the world and in Turkey in increasing rates. In our country, besides the OXA 51-like enzyme which is inherent in A. baumannii strains, OXA 58-like and OXA 23-like carbapenemases producing strains have also been widely detected. In addition, Verona Imipenemase (VIM) and (IMP)-type MBL have been reported in some centers. Aims: The aim of our study was to investigate the presence of carbapenemases in Acinetobacter strains isolated from hospitalized patients in Edirne. Study Design: Cross-sectional study. Methods: A total of 52 imipenem-resistant A. baumannii strains isolated between January and March 2013 were investigated. The presence of MBL was described phenotypically by the combined disk diffusion test (CDDT), double disk synergy test (DDST), MBL E-test (only performed in 28 strains) and modified Hodge test. blaIMP, blaVIM, blaGIM, blaSIM, blaSPM genes and blaOXA-23, blaOXA-51, blaOXA-40, blaOXA-58 genes were investigated by multiplex polymerase chain reaction (PCR). The blaNDM-1 gene was determined by PCR. Results: By modified Hodge test, 50 strains (96%) were found to be MBL positive. Positivity of MBL was 21% by both CDDT (0.1 M EDTA) and DDST. Twenty-four of 28 strains (85.7%) were positive by MBL E-test. OXA 23-like and OXA 51-like carbapenemases were detected in all strains, but OXA 58-like and OXA 40-like carbapenemases-producing A. baumannii were not detected. Also, MBL genes were not detected by genotypic methods. Conclusion: Only OXA 23-like carbapenemase was responsible for carbapenem resistance in carbapenem-resistant Acinetobacter strains in Edirne. The MBL-producing Acinetobacter strain is not yet a problem in our hospital. MBL resistance was found by

  3. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    PubMed Central

    Hassan, Sabry A.; Shobrak, Mohammed Y.

    2015-01-01

    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were TEM and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets. PMID:27047051

  4. [A new method for evaluation of beta-lactamase production of resistant enterobacteriaceae strains (author's transl)].

    PubMed

    Schassan, H H

    1978-01-01

    Resistant strains of Enterobacteriaceae were investigated with a chemical and microbiological test on beta-lactamase activity. The chemical method was needed as screening-test basing on the enzymatic hydrolysis of the chromogenic cephalosporin compound 87/312. The microbiological test is a modified cup plate method using Staph. aureus SG 511 as sensitive test strain for penicillins and cephalosporins. In one of the two cups of the blood agar plate 20 microliter of the beta-lactam antibiotic, in the other cup 20 microliter of the supernatant of the 24 h broth of the bacterial strain was pipettet. If the lactamase in the supernatant neutralises the antibiotic, a halfemoonlike blank is forming on the left site of the inhibition zone. An unchangeable inhibition zone demonstrates stability of the antibiotic to the enzyme. Each of 10 ampicillin- and/or cephalothin-resistant strains of E. coli, Klebsiella, Enterobacter and Serratia were investigated against 6 penicillins (penicillin G, ampicillin, ticarcillin, mezlocillin, azlocillin, bay k 4999) and 6 cephalosporins (cefoxitin, cefuroxime, cefamandol, cephalothin, cefazolin, cefradine). The microbiological method allows the statement, against which beta-lactam antibiotic the enzyme is effective. A correlation between the beta-lactamase activity and the MIC values in Enterobacteriaceae was not found. PMID:371259

  5. Studies of Antibiotic Resistance of Beta-Lactamase Bacteria under Different Nutrition Limitations at the Single-Cell Level

    PubMed Central

    Wang, Ying; Ran, Min; Wang, Jun; Ouyang, Qi; Luo, Chunxiong

    2015-01-01

    Drug resistance involves many biological processes, including cell growth, cell communication, and cell cooperation. In the last few decades, bacterial drug resistance studies have made substantial progress. However, a major limitation of the traditional resistance study still exists: most of the studies have concentrated on the average behavior of enormous amounts of cells rather than surveying single cells with different phenotypes or genotypes. Here, we report our study of beta-lactamase bacterial drug resistance in a well-designed microfluidic device, which allows us to conduct more controllable experiments, such as controlling the nutrient concentration, switching the culture media, performing parallel experiments, observing single cells, and acquiring time-lapse images. By using GFP as a beta-lactamase indicator and acquiring time-lapse images at the single-cell level, we observed correlations between the bacterial heterogeneous phenotypes and their behavior in different culture media. The feedback loop between the growth rate and the beta-lactamase production suggests that the beta-lactamase bacteria are more resistant in a rich medium than in a relatively poor medium. In the poorest medium, the proportion of dormant cells may increase, which causes a lower death rate in the same generation. Our work may contribute to assaying the antibiotic resistance of pathogenic bacteria in heterogeneous complex media. PMID:25993008

  6. Beta-Lactamase Repressor BlaI Modulates Staphylococcus aureus Cathelicidin Antimicrobial Peptide Resistance and Virulence

    PubMed Central

    Pence, Morgan A.; Haste, Nina M.; Meharena, Hiruy S.; Olson, Joshua; Gallo, Richard L.; Nizet, Victor; Kristian, Sascha A.

    2015-01-01

    BlaI is a repressor of BlaZ, the beta-lactamase responsible for penicillin resistance in Staphylococcus aureus. Through screening a transposon library in S. aureus Newman for susceptibility to cathelicidin antimicrobial peptide, we discovered BlaI as a novel cathelicidin resistance factor. Additionally, through integrational mutagenesis in S. aureus Newman and MRSA Sanger 252 strains, we confirmed the role of BlaI in resistance to human and murine cathelidicin and showed that it contributes to virulence in human whole blood and murine infection models. We further demonstrated that BlaI could be a target for innate immune-based antimicrobial therapies; by removing BlaI through subinhibitory concentrations of 6-aminopenicillanic acid, we were able to sensitize S. aureus to LL-37 killing. PMID:26305782

  7. Effect of the inoculum size on carbapenem susceptibilities of beta-lactamase-negative, ampicillin-resistant Haemophilus influenzae.

    PubMed

    Miyazaki, Hiroo; Horii, Toshinobu; Nagura, Osanori; Suda, Takafumi; Chida, Kingo; Nakamura, Hirotoshi

    2009-01-01

    A higher inoculum size of beta-lactamase-positive Haemophilus influenzae is reported to increase minimum inhibitory concentrations (MICs) for beta-lactams. However, the effect of inoculum size of beta-lactamase-negative, ampicillin-resistant H. influenzae (BLNAR) on MICs for carbapenems has not been investigated. This study evaluated the effect of inoculum size on MICs for carbapenems and other beta-lactams in nine clinical isolates of BLNAR. The MICs were determined by both the standard method described by the Clinical and Laboratory Standards Institute (final inoculum size of 5 x 10(5) colony-forming units [CFU]/ml) and a modified method (final inoculum size of 5 x 10(6) CFU/ml) using viable cell counts. The findings showed that the higher inoculum size increased MICs for imipenem, meropenem, panipenem, biapenem, ampicillin, ceftazidime, and ceftriaxone. The inoculum effect (4 log(2) dilution or a greater increase in the MIC) with imipenem, meropenem, panipenem, and biapenem was found in three, five, two, and two isolates, respectively. The magnitude of the inoculum effect for panipenem significantly increased with the levels of MICs, but correlation between them for the others was not statistically significant. The mutations of penicillin-binding protein genes had little relevance to the reduced susceptibility to carbapenems or to the magnitude of the inoculum effect. These results suggest that MIC determination using turbidity can produce interpretive errors in the antimicrobial susceptibility testing of BLNAR for carbapenems because of their inoculum effect. Thus, accurate adjustment of inoculum size, such as viable cell count, is helpful for confirming the true MICs when the isolates are interpreted as "resistant" by turbidity-based MIC determination. PMID:18815831

  8. Occurrence of Multidrug Resistant Extended Spectrum Beta-Lactamase-Producing Bacteria on Iceberg Lettuce Retailed for Human Consumption

    PubMed Central

    Talreja, Deepa; Rana, Sonia Walia; Walia, Sandeep; Walia, Satish K.

    2015-01-01

    Antibiotic resistance in bacteria is a global problem exacerbated by the dissemination of resistant bacteria via uncooked food, such as green leafy vegetables. New strains of bacteria are emerging on a daily basis with novel expanded antibiotic resistance profiles. In this pilot study, we examined the occurrence of antibiotic resistant bacteria against five classes of antibiotics on iceberg lettuce retailed in local convenience stores in Rochester, Michigan. In this study, 138 morphologically distinct bacterial colonies from 9 iceberg lettuce samples were randomly picked and tested for antibiotic resistance. Among these isolates, the vast majority (86%) demonstrated resistance to cefotaxime, and among the resistant bacteria, the majority showed multiple drug resistance, particularly against cefotaxime, chloramphenicol, and tetracycline. Three bacterial isolates (2.17%) out of 138 were extended spectrum beta-lactamase (ESBL) producers. Two ESBL producers (T1 and T5) were identified as Klebsiella pneumoniae, an opportunistic pathogen with transferable sulfhydryl variable- (SHV-) and TEM-type ESBLs, respectively. The DNA sequence analysis of the blaSHV detected in K. pneumoniae isolate T1 revealed 99% relatedness to blaSHV genes found in clinical isolates. This implies that iceberg lettuce is a potential reservoir of newly emerging and evolving antibiotic resistant bacteria and its consumption poses serious threat to human health. PMID:26064922

  9. Emergence of carbapenem-resistant Klebsiella species possessing the class A carbapenem-hydrolyzing KPC-2 and inhibitor-resistant TEM-30 beta-lactamases in New York City.

    PubMed

    Bradford, Patricia A; Bratu, Simona; Urban, Carl; Visalli, Melissa; Mariano, Noriel; Landman, David; Rahal, James J; Brooks, Steven; Cebular, Sanda; Quale, John

    2004-07-01

    Nineteen isolates of carbapenem-resistant Klebsiella species were recovered from 7 hospitals in New York City. Most K. pneumoniae belonged to a single ribotype. Nucleotide sequencing identified KPC-2, a carbapenem-hydrolyzing beta -lactamase. In 3 strains, TEM-30, an inhibitor-resistant beta -lactamase, was detected. Carbapenem-resistant Klebsiella species possessing KPC-2 are endemic in New York City. This study documents the identification of an inhibitor-resistant TEM beta -lactamase in the United States. PMID:15206053

  10. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-beta-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France.

    PubMed

    Poirel, L; Naas, T; Nicolas, D; Collet, L; Bellais, S; Cavallo, J D; Nordmann, P

    2000-04-01

    Pseudomonas aeruginosa COL-1 was identified in a blood culture of a 39-year-old-woman treated with imipenem in Marseilles, France, in 1996. This strain was resistant to beta-lactams, including ureidopenicillins, ticarcillin-clavulanic acid, cefepime, ceftazidime, imipenem, and meropenem, but remained susceptible to the monobactam aztreonam. The carbapenem-hydrolyzing beta-lactamase gene of P. aeruginosa COL-1 was cloned, sequenced, and expressed in Escherichia coli DH10B. The deduced 266-amino-acid protein was an Ambler class B beta-lactamase, with amino acid identities of 32% with B-II from Bacillus cereus; 31% with IMP-1 from several gram-negative rods in Japan, including P. aeruginosa; 27% with CcrA from Bacteroides fragilis; 24% with BlaB from Chryseobacterium meningosepticum; 24% with IND-1 from Chryseobacterium indologenes; 21% with CphA-1 from Aeromonas hydrophila; and 11% with L-1 from Stenotrophomonas maltophilia. It was most closely related to VIM-1 beta-lactamase recently reported from Italian P. aeruginosa clinical isolates (90% amino acid identity). Purified VIM-2 beta-lactamase had a pI of 5.6, a relative molecular mass of 29.7 kDa, and a broad substrate hydrolysis range, including penicillins, cephalosporins, cephamycins, oxacephamycins, and carbapenems, but not monobactams. As a metallo-beta-lactamase, its activity was zinc dependent and inhibited by EDTA (50% inhibitory concentration, 50 microM). VIM-2 conferred a resistance pattern to beta-lactams in E. coli DH10B that paralleled its in vitro hydrolytic properties, except for susceptibility to ureidopenicillins, carbapenems, and cefepime. bla(VIM-2) was located on a ca. 45-kb plasmid that in addition conferred resistance to sulfamides and that was not self-transmissible either from P. aeruginosa to E. coli or from E. coli to E. coli. bla(VIM-2) was the only gene cassette located within the variable region of a novel class 1 integron, In56, that was weakly related to the bla(VIM-1)-containing

  11. Characterization of Multidrug Resistant Extended-Spectrum Beta-Lactamase-Producing Escherichia coli among Uropathogens of Pediatrics in North of Iran.

    PubMed

    Rezai, Mohammad Sadegh; Salehifar, Ebrahim; Rafiei, Alireza; Langaee, Taimour; Rafati, Mohammadreza; Shafahi, Kheironesa; Eslami, Gohar

    2015-01-01

    Escherichia coli remains as one of the most important bacteria causing infections in pediatrics and producing extended-spectrum beta-lactamases (ESBLs) making them resistant to beta-lactam antibiotics. In this study we aimed to genotype ESBL-producing E. coli isolates from pediatric patients for ESBL genes and determine their association with antimicrobial resistance. One hundred of the E. coli isolates were initially considered ESBL producing based on their MIC results. These isolates were then tested by polymerase chain reaction (PCR) for the presence or absence of CTX, TEM, SHV, GES, and VEB beta-lactamase genes. About 30.5% of isolated E. coli was ESBL-producing strain. The TEM gene was the most prevalent (49%) followed by SHV (44%), CTX (28%), VEB (8%), and GES (0%) genes. The ESBL-producing E. coli isolates were susceptible to carbapenems (66%) and amikacin (58%) and showed high resistance to cefixime (99%), colistin (82%), and ciprofloxacin (76%). In conclusion, carbapenems were the most effective antibiotics against ESBl-producing E. coli in urinary tract infection in North of Iran. The most prevalent gene is the TEM-type, but the other resistant genes and their antimicrobial resistance are on the rise. PMID:26064896

  12. Increase in isolation of extended spectrum beta lactamase producing multidrug resistant non typhoidal Salmonellae in Pakistan

    PubMed Central

    2010-01-01

    Background Increasing resistance to quinolones and ceftriaxone in non typhoidal Salmonellae is a global concern. Resistance to quinolone and 3rd generation cephalosporin amongst non typhoidal Salmonellae (NTS) from Pakistan has been reported in this study. Methods Retrospective analysis of laboratory data was conducted (1990-2006). NTS were isolated and identified from clinical samples using standard microbiological techniques. Antimicrobial susceptibility testing was performed by Kirby Bauer. Extended spectrum beta lactamase production (ESBL) was detected using combined disc method. Ciprofloxacin sensitivity was detected by nalidixic acid screening method. Minimum inhibitory concentration (MIC) of ciprofloxacin was determined by agar dilution method. Statistical analysis was performed using SPSS version 13. Results Analysis of 1967 NTS isolates showed a significant increase in ciprofloxacin resistance from 23% in 2002 to 50.5% in 2006, with increased mean MIC values from 0.6 to 1.3 ug/mL. Ceftriaxone resistant NTS also increased and ESBL production was seen in 98.7% isolates. These isolates exhibited high resistance against amoxicillin clavulanic acid (57%), gentamicin (69%), amikacin (44%) and piperacillin tazobactam (30%). No resistance to carbapenem was seen. Ceftriaxone resistance was significantly higher in children <1 year, in invasive isolates and in Salmonella Typhimurium. Conclusions Increase in quinolone and ceftriaxone NTS is a serious threat to public health requiring continuous surveillance and use of appropriate screening tests for laboratory detection. PMID:20409348

  13. Coexistence of plasmid-mediated quinolone resistance determinants and AmpC-Beta-Lactamases in Escherichia coli strains in Egypt.

    PubMed

    Abd El-Aziz, N K; Gharib, A A

    2015-01-01

    Three kinds of plasmid—mediated quinolone resistance (PMQR) determinants (qnr genes, qepA and aac(6')—Ib—cr) have been discovered and shown to be widely distributed among clinical isolates. To characterize the prevalence of PMQR determinants among AmpC—producing E. coli strains in food—producing animals and animal by—products in Egypt, twenty—nine E. coli strains were tested for their susceptibilities to antimicrobials and screened for PMQR determinants and AmpC Beta lactamases using PCR and plasmid profiling. It was found that qnr genes being detected alone or in combination with qepA or aac(6')—Ib—cr genes in 11 (37.9%) strains comprising 9 for qnrA and only one for both qnrB and qnrS. Moreover, qepA and aac(6')—Ib—cr were detected in 41.38% and 3.45% of E. coli strains, respectively. The ampC β—lactamase genes were detected in 75.86 % of all strains and in 100% and 53.3% of the PMQR determinant—positive and negative strains, respectively. In several cases, plasmid profiling of E. coli strains exhibiting the coexistence of both PMQR determinants and ampC genes on a single plasmid as a first report in Egypt that may contribute to rapid spread and increase in bacterial resistance, which is important to public health concern. PMID:26475385

  14. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta-lactamase genes.

    PubMed Central

    Bauernfeind, A; Stemplinger, I; Jungwirth, R; Wilhelm, R; Chong, Y

    1996-01-01

    A plasmidic beta-lactamase which hydrolyzed cephamycins was first detected and reported in 1989. At that time its description was restricted to phenotypic characteristics. We analyzed nucleotide sequence of its gene and explored it genetic relationship with other bla genes. The deduced amino acid sequence of the blaCMY-1 product was compared with those of other known plasmidic cephamycinases and of chromosomal AmpC beta-lactamases. The results indicate that the relationship of CMY-1 is closest to MOX-1 among the plasmidic cephamycinases and to AmpC of Pseudomonas aeruginosa among the chromosomal cephalosporinases. We conclude that the plasmidic cephamycinases described up to now may be classified into three families, as follows: CMY-1, MOX-1, and FOX-1 with AmpC of P. aeruginosa; CMY-2, BIL-1 and LAT-1 with AmpC of Citrobacter freundii; and MIR-1 with AmpC of Enterobacter cloacae. Plasmidic cephamycinases are now recognized as clinically relevant class C beta-lactamases. PMID:8843306

  15. Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 Genes Among Clinical Pseudomonas aeruginosa Species Isolated in Zahedan, Iran

    PubMed Central

    Ghamgosha, Mehdi; Shahrekizahedani, Shahram; Kafilzadeh, Farshid; Bameri, Zakaria; Taheri, Ramezan Ali; Farnoosh, Gholamreza

    2015-01-01

    Background: One of the major clinical problems regarding Pseudomonas aeruginosa is attributed to metallo-beta-lactamases (MBL). This group of enzymes is a subset of beta lactamases which belong to group B of Ambler classification and cause hydrolysis of carbapenems. Based on epidemiological studies conducted worldwide, it is proved that prevalence of genes coding MBLs in P. aeruginosa species are different in various geographic zones and even in various hospitals. Therefore, according to the clinical importance of organisms generating MBLs, it is necessary to identify and control these bacteria in hospitals for therapeutic purposes. Objectives: The current study aimed to investigate the Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 genes among clinical P. aeruginosa species isolated in Zahedan, Iran. Materials and Methods: The current study investigated the presence of MBL through phenotypic and genotypic methods and also the pattern of antibiotic resistance in P. aeruginosa species isolated in hospitals. The Minimum Inhibitory Concentration (MIC) against imipeneme was measured for 191 P. aeruginosa species isolated from Zahedan hospitals after identification through biochemical methods and determination of the antibiotic resistance pattern. Strains with MIC > 4 µg/mL were studied by phenotypic and genotypic methods. Results: The rate of resistance against imipeneme was 5.7% and after carrying out the phenotypic experiments, nine species were identified as of MBL producer. Seven species were confirmed by Polymerase Chain Reaction (PCR) method. Gene VIM-1 was the predominant gene among the positive (antibiotic resistant) species. Conclusions: The study results showed that MBL genes were present in some of the species isolated from Zahedan hospitals. Regarding the importance of MBL producer bacteria in hospitals, quick identification and evaluation of these clinical species can be considered as an important and basic step for treatment and control of pseudomonad

  16. Differences in Extended-Spectrum Beta-Lactamase Producing Escherichia coli Virulence Factor Genes in the Baltic Sea Region

    PubMed Central

    Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp

    2014-01-01

    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  17. Differences in extended-spectrum beta-lactamase producing Escherichia coli virulence factor genes in the Baltic Sea region.

    PubMed

    Lillo, Jana; Pai, Kristiine; Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Ivanova, Marina; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Parv, Kristel; Pavelkovich, Anastasia; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp

    2014-01-01

    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  18. Nosocomial infections caused by multidrug-resistant isolates of pseudomonas putida producing VIM-1 metallo-beta-lactamase.

    PubMed

    Lombardi, Gianluigi; Luzzaro, Francesco; Docquier, Jean-Denis; Riccio, Maria Letizia; Perilli, Mariagrazia; Colì, Alessandra; Amicosante, Gianfranco; Rossolini, Gian Maria; Toniolo, Antonio

    2002-11-01

    Successful carbapenem-based chemotherapy for the treatment of Pseudomonas infections has been seriously hindered by the recent appearance of IMP- and VIM-type metallo-beta-lactamases, which confer high-level resistance to carbapenems and most other beta-lactams. Recently, multidrug-resistant Pseudomonas putida isolates for which carbapenem MICs were >/=32 micro g/ml were recovered from cultures of urine from three inpatients in the general intensive care unit of the Ospedale di Circolo, Varese, Italy. Enzyme assays revealed production of a metallo-beta-lactamase activity, while molecular analysis detected in each isolate a bla(VIM-1) determinant carried by an apparently identical medium-sized plasmid. Conjugation experiments were unsuccessful in transferring the beta-lactamase determinant to Escherichia coli or Pseudomonas aeruginosa. Macrorestriction analysis by pulsed-field gel electrophoresis demonstrated that the isolates were of clonal origin. PCR mapping and sequencing of the variable region of the plasmid-borne class 1 integron carrying the bla(VIM-1) determinant (named In110) showed that the bla(VIM-1)-containing cassette was identical to that previously found in strains of different species from other Italian hospitals and that the cassette array of In110 was not identical but clearly related to that of In70 (a bla(VIM-1)-containing plasmid-borne integron from an Achromobacter xylosoxidans isolate), pointing to a common origin of this cassette and to a related evolutionary history of their cognate integrons. PMID:12409373

  19. Combination of IMP-4 metallo-beta-lactamase production and porin deficiency causes carbapenem resistance in a Klebsiella oxytoca clinical isolate.

    PubMed

    Chen, Li-Rong; Zhou, Hong-Wei; Cai, Jia-Chang; Zhang, Rong; Chen, Gong-Xiang

    2009-10-01

    This study shows for the first time the mechanism of carbapenem resistance of a Klebsiella oxytoca clinical isolate ZC101 recovered from a Zhejiang University Hospital in Hangzhou, China. MIC values of imipenem, meropenem, and ertapenem for K. oxytoca ZC101 were 16, 16, and 128 microg/mL, respectively. Conjugation experiments demonstrated the transferability of a resistance determinant from K. oxytoca ZC101 to Escherichia coli EC600. Results from isoelectric focusing, polymerase chain reactions, and DNA sequencing confirmed that K. oxytoca ZC101 produced IMP-4 metallo-beta-lactamase (MBL) and CTX-M-14 extended-spectrum beta-lactamase, whereas E. coli transconjugant only produced the IMP-4. Amplification of integron revealed that bla(IMP-4) gene is located within a class I integron that was carried in a plasmid approximately 55 kb in size. Sodium dodecyl sulfate polyacrylamide gel electrophoresis profiling of outer membrane proteins of K. oxytoca ZC101 indicated lack of expression of the OmpK36 porin. DNA sequence analysis of ompK36 gene of K. oxytoca ZC101 showed the gene was disrupted by an insertion sequence IS5. In all, the results show that plasmid-mediated IMP-4 MBL production combined with the loss of OmpK36 porin caused the resistance in K. oxytoca ZC101 to carbapenems. PMID:19748427

  20. Shiga toxin and beta-lactamases genes in Escherichia coli phylotypes isolated from carcasses of broiler chickens slaughtered in Iran.

    PubMed

    Bagheri, Mahboube; Ghanbarpour, Reza; Alizade, Hesam

    2014-05-01

    Two hundred and four Escherichia coli strains were isolated from external and visceral cavity surfaces of 102 slaughtered broiler carcasses. The isolates were screened to determine the phylogenetic background and presence of Shiga toxins (stx1, stx2), intimin (eae) and beta-lactamase (blaTEM, blaSHV) genes. Phylotyping results revealed that the E. coli isolates segregated in four phylogenetic groups A (56.86%), B1 (19.12%), B2 (4.90%) and D (19.12%). PCR assays revealed that 13 isolates (6.37%) from 12 carcasses were positive for eae (12 isolates) and/or stx2 (2) genes. The eae positive isolates belonged to phylogenetic groups A (A0, A1), B1, B2 (B22) and D (D2). Two stx2 positive and seven eae positive isolates were recovered from visceral cavity surface, whereas only 5 eae positive isolates were from the external surface of the carcasses. On the other hand, thirty one E. coli strains isolated from visceral cavity and external surface of 26 carcasses carried the blaTEM (27) and blaSHV (4) genes and belonged to different phylo-groups. This study suggests that broiler carcasses could be considered as an important source of EPEC and STEC pathotypes in southeast of Iran; as well as the examined antibiotic resistance genes, which were carried by some isolates and could be transferred to pathogens through the food chain. PMID:24590116

  1. Emergence of Multidrug Resistance and Metallo-beta-lactamase Producing Acinetobacter baumannii Isolated from Patients in Shiraz, Iran

    PubMed Central

    Moghadam, MN; Motamedifar, M; Sarvari, J; Sedigh, Ebrahim-Saraie H; Mousavi, Same M; Moghadam, FN

    2016-01-01

    Background: Metallo-beta-lactamase (MβL) enzymes production is one of the most important resistance mechanisms against carbapenems in some bacteria including Acinetobacter baumannii. Aims: This study was aimed to determine the antimicrobial susceptibility and the prevalence of MβL among carbapenem-resistant isolates of A. baumannii. Materials and Methods: In this cross-sectional study from October 2012 to April 2013, 98 isolates were identified as A. baumannii using Microgen™ kits and confirmed by molecular method. These isolates were tested for antimicrobial susceptibilities by disk diffusion method according to the Clinical and Laboratory Standards Institute guidelines. Carbapenem-resistant isolates were further detected phenotypically by MβL minimal inhibitory concentration (MIC)-test strips, and subsequently positive MβL isolates were confirmed by polymerase chain reaction (PCR). Results: Overall, 98% (96/98) of A. baumannii isolates were detected as carbapenem-resistant by MIC test. Highest sensitivity to the tested antibiotic with 42.9% (42/98) was observed to colistin. Of 96 carbapenem-resistant isolates, 43 were phenotypically positive for MβL; out of 43 isolates, 37 were confirmed for the presence of MβL genes by PCR. Conclusion: The frequency of drug resistance among the clinical samples of A. baumannii isolated in our study against most of the antibiotics was very high. Moreover, all MβL producing isolates were multidrug resistance. Therefore, systematic surveillance to detect MβL producing bacteria and rational prescription and use of carbapenems could be helpful to prevent the spread of carbapenem resistance. PMID:27398247

  2. Activity of cephalosporins against methicillin-susceptible and methicillin-resistant, coagulase-negative staphylococci: minimal effect of beta-lactamase.

    PubMed Central

    John, J F; McNeill, W F

    1980-01-01

    Eight cephalosporins were tested for their activity against methicillin-susceptible and methicillin-resistant, coagulase-negative staphylococci and for their resistance to beta-lactamase from methicillin-resistant, coagulase-negative staphylococci. Susceptibility testing by the agar plate method was evaluated for the effect of inoculum size and duration of incubation. Methicillin-susceptible, coagulase-negative staphylococci were highly susceptible to the cephalosporins, with cephapirin and cepahlothin showing the greatest activity, followed by cefazolin and cefamandole. Methicillin-resistant, coagulase-negative staphylococci displayed nearly total cross-resistance to the cephalosporins. Resistance increased with increasing inoculum size. Beta-Lactamases produced by methicillin-resistant, coagulase-negative staphylococci had a minimal hydrolytic effect on cepahlothin, cephapirin, cefazolin, and cefamandole and no measurable effect on cefoxitin. There was no correlation between the anti-staphylococcal activity and resistance to beta-lactamases. PMID:6966906

  3. High prevalence of extensively drug-resistant and metallo beta-lactamase-producing clinical Acinetobacter baumannii in Iran.

    PubMed

    Maspi, Hossein; Mahmoodzadeh Hosseini, Hamideh; Amin, Mohsen; Imani Fooladi, Abbas Ali

    2016-09-01

    Acinetobacter species particularly Acinetobacter baumannii (A. baumannii) have been widely reported as broad-spectrum antibiotic resistant pathogens. Expression of various types of metallo beta-lactamases (MBL), classified as Ambler class B, has been associated with carbapenem resistance. Here, we attempted to assess the frequency of extensively drug-resistant (XDR) and MBL-producing A. baumannii among clinical isolates. 86 clinical A. baumannii strains were collected from 2014 to 2015 and their susceptibility to meropenem (10 μg), imipenem (10 μg), azteronem (30 μg), pipracillin (100 μg) tazobactam (110 μg), tobramycin (10 μg), fosfomycin (200 μg), rifampicin (5 μg), colistin (10 μg), tigecycline (15 μg), sulbactam/ampicillin (10 μg + 10 μg) and polymixin B (300 U) was evaluated using disk diffusion method. The MBL-producing isolates were screened using combined disc diffusion method. Furthermore, the presence of blaVIM, blaIMP, blaSPM, blaGIM, blaSIM and blaNDM was detected by PCR. 34.9% of isolates were recovered from bronchoalveolar lavage (BAL). 81 (94.2%) and 62 (71.2%) isolates were multidrug resistance (MDR) and XDR, respectively. 44 (51.2%) and 65 (75.6%) isolates were MBL-producing strains with resistance to imipenem and meropenem, respectively. 2 (2.3%), 13 (15.1%), 2 (2.3%), 4 (4.7%) and 2 (2.3%) isolates carried blaVIM, blaIMP, blaSPM, blaGIM and blaSIM genes, respectively. Our data showed that the rate of XDR and MBL A. baumannii is on the rise. PMID:27448835

  4. Presence of blaPER-1 and blaVEB-1 beta-lactamase genes among isolates of Pseudomonas aeruginosa from South West of Iran.

    PubMed

    Davodian, Elham; Sadeghifard, Nourkhoda; Ghasemian, Abdolmajid; Noorbakhsh, Samileh

    2016-09-01

    Pseudomonas aeruginosa isolates have acquired resistance to antibiotics such as novel beta-lactams. The aim of this study was to investigate the blaPER-1, blaVEB-1, and blaPSE-1 genes among isolates of P. aeruginosa among intensive care unit (ICU) patients. Sixty-five isolates were collected. The antibiotic susceptibility testing and combined disk tests were performed to detect the isolates producing extended spectrum beta-lactamases (ESBLs) among ceftazidime-resistant isolates. Polymerase chain reaction (PCR) amplification of blaPER-1, blaVEB-1, and blaPSE-1 genes was conducted. Ten (15.3%) isolates were ESBL-positive, of which 40% (n=4) belonged to males and 60% (n=6) were collected from females. Moreover, two and one isolates harbored blaPER-1 and blaVEB-1 genes, respectively. PMID:26944896

  5. Beta-lactamases in Enterobacteriaceae infections in children.

    PubMed

    Moxon, Christopher Alan; Paulus, Stéphane

    2016-07-01

    Multi-drug resistance in Gram negative bacteria, particularly in Enterobacteriaceae, is a major clinical and public health challenge. The main mechanism of resistance in Enterobacteriaceae is linked to the production of beta-lactamase hydrolysing enzymes such as extended spectrum beta-lactamases (ESBL), AmpC beta-lactamases and carbapenemases (Carbapenemase Producing Enterobacteriaceae (CPE)). ESBL and CPE resistance genes are located on plasmids, which can be transmitted between Enterobacteriaceae, facilitating their spread in hospitals and communities. These plasmids usually harbour multiple additional co-resistance genes, including to trimethoprim-sulfamethoxazole, aminoglycosides, and fluoroquinolones, making these infections challenging to treat. Asymptomatic carriage in healthy children as well as community acquired infections are increasingly reported, particularly with ESBL. Therapeutic options are limited and previously little used antimicrobials such as fosfomycin and colistin have been re-introduced in clinical practice. Paediatric experience with these agents is limited hence there is a need to further examine their clinical efficacy, dosage and toxicity in children. Antimicrobial stewardship along with strict infection prevention and control practices need to be adopted widely in order to preserve currently available antimicrobials. The future development of novel agents effective against beta-lactamases producers and their applicability in children is urgently needed to address the challenge of multi-resistant Gram negative infections. PMID:27180312

  6. Emergence of co-production of plasmid-mediated AmpC beta-lactamase and ESBL in cefoxitin-resistant uropathogenic Escherichia coli.

    PubMed

    Ghosh, B; Mukherjee, M

    2016-09-01

    Plasmid-mediated AmpC (pAmpC) and ESBL co-production was detected in Escherichia coli a major etiologic agent of urinary tract infection. Isolates resistant to cefoxitin by CLSI methodology were tested for pAmpC beta-lactamase using phenylboronic acid and ESBLs by combined disk diffusion method. pAmpC/ESBL genes were characterized by PCR and sequencing. Transconjugation experiments were done to study the transfer of pAmpC and ESBL production from clinical isolates as donor to E. coli J53 AziR as recipient. Incompatibility groups of transmissible plasmids were classified by PCR-based replicon typing (PBRT). Among 148 urine culture positive isolates, E. coli was reported in 39.86 % (59/148), with 93.22 % (55/59) of cefoxitin resistance. pAmpC production was detected in 25, with varied distribution of blaCMY-2 and blaDHA-1type genes alone (n = 13 and 7 respectively) or in combination (n = 5). ESBL co-production was observed in 88 % (22/25) of pAmpC producing isolates with predominance of blaTEM (n = 20). Twenty-three transconjugants showed transmission of pAmpC-and ESBL-resistant genes with co-carriage of blaCMY-2 and blaTEM (n = 15) in plasmids of IncF type (n = 9) being predominant, followed by IncI1 (n = 4) and IncH1 (n = 2) in combination. All clinical isolates were clonally diverse. Resistance against different beta-lactams in uropathogenic E. coli has been an emerging concern in resource- poor countries such as India. Knowledge on the occurrence of AmpC beta-lactamases and ESBL amongst this pathogen and its transmission dynamics may aid in hospital infection control. PMID:27250633

  7. Detection of New Delhi Metallo-Beta-Lactamase-1 (NDM-1) in carbapenem- resistant Klebsiella pneumoniae isolated from a university hospital in Iran

    PubMed Central

    Fazeli, H; Norouzi-Barough, M; Ahadi, A M; Shokri, D; Solgi, H

    2015-01-01

    Background New Delhi metallo-beta-lactamase-1(NDM-1) is a novel type of metallo-beta-lactamase (MBL) which inactivates all β-lactam antibiotics except aztreonam. Enterobacteriaceae expressing NDM-1 have been identified worldwide. The aim of this study was to detect MBLs in carbapenem-resistant K. pneumoniae isolates obtained from patients hospitalized in one of the university hospitals in Isfahan, Iran. Methods Of the 112 isolates obtained from various clinical samples, 49 were selected for carbapenemase detection based on their reduced susceptibility to imipenem or meropenem according to the disc diffusion method. These isolates were screened for carbapenemase and MBL production using the Modified Hodge Test (MHT) and Epsilometer test (E-test) MBL strips. Polymerase chain reaction was performed on all 49 isolates using specific primers to detect genes encoding IMP (active on imipenem), VIM (Verona integron-encoded metallo-β-lactamase), SPM-1 (Sao Paulo metallo-β-lactamase) and NDM-1. Results Among 49 carbapenem-resistant isolates, 32 (65.3 %) were positive for MHT and 6 (12.2 %) were found positive for blaNDM-1. Other MBL genes were not detected. Conclusion This is the second report on the detection of blaNDM-1 in Iran since it was first reported by Shahcheraghi and colleagues in 2012. This study indicated that resistance to carbapenems and isolation of bacteria producing NDM-1 is increasing. Therefore, the rapid detection of isolates expressing NDM-1 is essential to control their spread. Hippokratia 2015; 19 (3): 205-209. PMID:27418777

  8. Commensal Enterobacteriaceae as reservoirs of extended-spectrum beta-lactamases, integrons, and sul genes in Portugal

    PubMed Central

    Machado, Elisabete; Coque, Teresa M.; Cantón, Rafael; Sousa, João C.; Peixe, Luísa

    2013-01-01

    Bacteria colonizing the human intestine have a relevant role in the spread of antimicrobial resistance. We investigated the faecal carriage of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in healthy humans from Portugal and analyzed the distribution of sul genes and class 1 and 2 integrons. Faecal samples (n = 113) were recovered from healthy persons (North/Centre of Portugal, 2001–2004) and plated on MacConkey agar with and without ceftazidime (1 mg/L) or cefotaxime (1 mg/L). Isolates representing different morphotypes/plate and antibiotic susceptibility patterns (n = 201) were selected. Isolates resistant to sulfonamides and/or streptomycin, gentamicin, and trimethoprim were screened (PCR and sequencing) for sul genes (sul1, sul2, sul3) and class 1 and 2 integrons. Presence of ESBLs was inferred using the double disk synergy test (DDST) and further confirmed by PCR and sequencing. ESBL producers were selected for clonal analysis, plasmid characterization and conjugation assays by standard methods. ESBL-producing isolates were found in 1.8% (2/113) of samples, corresponding to Escherichia coli of phylogroups A (n = 1) and B1 (n = 1) carrying transferable blaCTX-M-14 and the new blaTEM-153, respectively. A 80kb IncK plasmid bearing blaCTX-M-14 was found, being highly related to that widely spread among CTX-M-14 producers of humans and animals from Portugal and other European countries. sul genes were found in 88% (22/25; sul2-60%, sul1-48%, sul3-4%) of the sulfonamide resistant isolates. Class 1 integrons were more frequently found than class 2 (7%, 14/201 vs. 3%, 6/201). Interestingly, gene cassette arrangements within these platforms were identical to those commonly observed among Enterobacteriaceae from Portuguese food-producing animals, although aadA13 is here firstly described in Morganella morganii. These results reinforce the relevance of human commensal flora as reservoir of clinically relevant antibiotic resistance genes including

  9. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carrying IMP-1 metallo-beta-lactamase gene in a University Hospital in Turkey.

    PubMed

    Ozgumus, Osman Birol; Caylan, Rahmet; Tosun, Ilknur; Sandalli, Cemal; Aydin, Kemalettin; Koksal, Iftihar

    2007-01-01

    Pseudomonas aeruginosa isolates carrying IMP- or VIM-type metallo-beta-lactamase (MBL) have been increasingly reported in hospitals worldwide. One hundred P. aeruginosa clinical isolates from unrelated inpatients hospitalized at a Turkish university hospital were screened for the presence of bla(IMP) and bla(VIM) genes by polymerase chain reaction (PCR). One (1%) isolate was found to carry a VIM-type MBL gene, whereas nine (9%) carried an IMP-1 MBL gene carried on a cassette inserted into a class 1 integron. Only four of the IMP producers were detected as MBL producers according to E-test MBL. Minimum inhibitory concentrations (MICs) of imipenem for the IMP-1 and VIM-type MBL-producers were highly variable (MIC values, 8-128 mug/ml). Imipenem resistance was not plasmid-mediated according to the transformation assays. Piperacillin/tazobactam was the only effective drug in antimicrobial susceptibility testing. No aztreonam-resistant IMP and VIM producers were detected to produce an extended-spectrum beta-lactamase (ESBL). Three class 1 integrons of approximately 2,300 bp, 1,800 bp, and 1,500 bp in size were detected in each of the nine IMP-positive isolates. Sequencing revealed three novel gene cassette arrays, aac(3)-1c-cmlA5, bla(IMP-1)-aadA7-like, and aacA7-smr-2-orfD. Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) indicated that a clonal spread of IMP-1-producers had occurred in this hospital. PMID:17949306

  10. An update on newer beta-lactamases.

    PubMed

    Gupta, Varsha

    2007-11-01

    The resistance to beta-lactam antibiotics is an increasing problem worldwide and beta lactamases production is the most common mechanism of drug resistance. Both global and Indian figures showed a marked increase in the number of beta-lactamases producing organisms. These enzymes extended spectrum beta-lactamases (ESBLs) are numerous and continuous mutation has led to the development of enzymes having expanded substrate profile. To date, there are more than 130 TEM type and more than 50 sulphydryl variable (SHV) type beta-lactamases found in Gram negative bacilli. ESBL producing Enterobacteriaceae are, as a rule, resistant to all cephalosporins and extended spectrum penicillins including the monobactam, aztreonam, while resistance to trimethoprim - sulphamethaxazole and aminoglycosides is frequently co-transferred on the same plasmid. Many ESBL producing organisms also express Amp C beta-lactamases. Amp C- beta-lactamases are clinically significant, as these confer resistance to cephalosporins in the oxyimino group, 7 alpha-methoxy cephalosporins, and are poorly inhibited by clavulanic acid. Carbepenems are the drugs of choice for the treatment of infections caused by ESBL producing organisms but carbapenemases (MBLs) have emerged and have spread from Pseudomonas aeruginosa to Enterobacteriaceae. The routine clinical microbiology laboratories should employ simple methods to recognize these enzymes using various substrates and inhibitors. These organisms may lead to therapeutic dead ends. Presently, the therapy relies on beta-lactam/ beta-lactamases inhibitor combinations, carbepenems and piperacillin - tazobactam plus aminoglycoside combination. Proper infection control practices and barrier precautions are essential to contain the organisms producing beta-lactamases. PMID:18160745

  11. Effect of certain bioactive plant extracts on clinical isolates of beta-lactamase producing methicillin resistant Staphylococcus aureus.

    PubMed

    Aqil, Farrukh; Khan, M Sajjad A; Owais, Mohd; Ahmad, Iqbal

    2005-01-01

    Ethanolic extracts and some fractions from 10 Indian medicinal plants, known for antibacterial activity, were investigated for their ability to inhibit clinical isolates of beta-lactamase producing methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-sensitive S. aureus (MSSA). Synergistic interaction of plant extracts with certain antibiotics was also evaluated. The MRSA test strains were found to be multi-drug resistant and also exhibited high level of resistance to common beta-lactam antibiotics. These strains produced beta-lactamases, which hydrolyze one or other beta-lactam antibiotics, tested. The extract of the plants from Camellia sinensis (leaves), Delonix regia (flowers), Holarrhena antidysenterica (bark), Lawsonia inermis (leaves), Punica granatum (rind), Terminalia chebula (fruits) and Terminalia belerica (fruits) showed a broad-spectrum of antibacterial activity with an inhibition zone size of 11 mm to 27 mm, against all the test bacteria. The extracts from the leaves of Ocimum sanctum showed better activity against the three MRSA strains. On the other hand, extracts from Allium sativum (bulb) and Citrus sinensis (rind) exhibited little or no activity, against MRSA strains. The antibacterial potency of crude extracts was determined in terms of minimum inhibitory concentration (MIC) by the tube dilution method. MIC values, of the plant extracts, ranged from 1.3 to 8.2 mg/ml, against the test bacteria. Further, the extracts from Punica granatum and Delonix regia were fractionated in benzene, acetone and methanol. Antibacterial activity was observed in acetone as well as in the methanol fractions. In vitro synergistic interaction of crude extracts from Camellia sinensis, Lawsonia inermis, Punica granatum, Terminalia chebula and Terminalia belerica was detected with tetracycline. Moreover, the extract from Camellia sinensis also showed synergism with ampicillin.TLC of the above extracts revealed the presence of major phytocompounds, like

  12. beta -Lactamases: which ones are clinically important?

    PubMed

    Rice, Louis B.; Bonomo, Robert A.

    2000-06-01

    The introduction of a large array of beta-lactam antibiotics has spawned the emergence of an even larger variety of beta-lactamases designed to confer resistance to these agents. beta-lactamases are produced by both gram-positive and gram-negative bacteria, but their clinical importance is far greater among the gram-negatives. The virtual explosion in our knowledge about the variety of these enzymes can often create confusion and frustration among those not well versed in the field. In this paper, we attempt to focus the discussion of beta-lactamases on those enzymes that are of the greatest clinical importance, the Ambler Class A and C enzymes. We also discuss the growing importance of the Ambler Class B metallo beta-lactamases, which hydrolyze carbapenems and are increasing in prevalence in areas of significant carbapenem usage. Copyright 2000 Harcourt Publishers Ltd. PMID:11498383

  13. Prevalence of 16S rRNA methylase, modifying enzyme, and extended-spectrum beta-lactamase genes among Acinetobacter baumannii isolates.

    PubMed

    Liu, Zhenru; Ling, Baodong; Zhou, Liming

    2015-08-01

    Multidrug-resistant Acinetobacter baumannii has become a worldwide problem, and methylation of 16S rRNA has recently emerged as a new mechanism of resistance to aminoglycosides, which is mediated by a newly recognized group of 16S rRNA methylases. 16S rRNA methylase confers a high-level resistance to all 4,6-substituted deoxystreptamine aminoglycosides that are currently used in clinical practice. Some of the A. baumannii isolates have been found to coproduce extended-spectrum beta-lactamases (ESBLs), contributing to their multidrug resistance. The aim of this study was to detect the determinants of the 16S rRNA methylase genes armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA, the modifying enzyme genes aac(6')-Ib, ant(3″)-Ia, aph(3')-I, and the extended-spectrum beta-lactamase genes bla(TEM), bla(SHV), and bla(CTX-M-3) among A. baumannii isolates in northeastern Sichuan, China. Minimum inhibitory concentrations (MICs) of 21 different antimicrobial agents against the A. baumannii isolates were determined. The clinical isolates showed a high level of resistance (MIC≧256 μg/ml) to aminoglycosides, which ranged from 50·1 to 83·8%. The resistances to meropenem and imipenem, two of the beta-lactam antibiotics and the most active antibiotics against A. baumannii, were 9·1 and 8·2%, respectively. Among 60 amikacin-resistant isolates, only the 16S rRNA methylase gene armA was found to be prevalent (66·7%), but the other 16S rRNA methylase genes rmtA, rmtB, rmtC, rmtD, rmtE, and npmA were not detected. The prevalences of the modifying enzyme genes aac (6')-Ib, ant (3″)-Ia, and aph (3')-I were 51·7, 81·7, and 58·3%, respectively, which are different from a previous study in which the occurrences of these genes were 3, 64, and 72%, respectively. Among the 40 isolates that were armA-positive, the prevalences of bla(TEM), bla(SHV), and bla(CTX-M-3) genes were detected for the first time in China, and their occurrences were 45, 65, and 52·5%, respectively. In all, A

  14. Phenotypic Detection of Metallo-Beta-Lactamases in Carbapenem Resistant Acinetobacter baumannii Isolated from Pediatric Patients in Pakistan

    PubMed Central

    Anwar, Muneeza; Ejaz, Hassan; Zafar, Aizza; Hamid, Hamdan

    2016-01-01

    Multidrug resistant A. baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections especially in neonates and immunocompromised patients because they have least capacity to fight against infections. Carbapenems are used as last resort antibiotics for treating these infections but currently resistance against carbapenems due to MBL production is on the rise. The objective of this study was to determine the frequency of antibiotic resistance in A. baumannii and also to compare the efficacy of combined disk test and double disk synergy test for detection of metallo-beta-lactamases. A total of 112 A. baumannii were identified from various clinical samples and antibiotic susceptibility profile was determined by Kirby-Bauer Disk Diffusion method. Out of 112, 66 (58.9%) isolates were resistant to both imipenem and meropenem (OXOID). These resistant isolates were tested for carbapenemase production, and 55 (83.3%) were carbapenemase producers by Modified Hodge Test. These isolates were further tested for MBL production by combined disk test and double disk synergy test. Out of 66, 49 isolates were positive by both methods, CDT and DDST, and only one isolate was detected as negative (with kappa value = 0.038). All MBL producing strains showed remarkable resistance to cephalosporins, fluoroquinolones, aminoglycosides, and piperacillin/tazobactam (OXOID). The antibiotic resistance was very high in A. baumannii which were isolated from children in Pakistan specially attending a nephrology unit. PMID:27123345

  15. Phenotypic Detection of Metallo-Beta-Lactamases in Carbapenem Resistant Acinetobacter baumannii Isolated from Pediatric Patients in Pakistan.

    PubMed

    Anwar, Muneeza; Ejaz, Hassan; Zafar, Aizza; Hamid, Hamdan

    2016-01-01

    Multidrug resistant A. baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections especially in neonates and immunocompromised patients because they have least capacity to fight against infections. Carbapenems are used as last resort antibiotics for treating these infections but currently resistance against carbapenems due to MBL production is on the rise. The objective of this study was to determine the frequency of antibiotic resistance in A. baumannii and also to compare the efficacy of combined disk test and double disk synergy test for detection of metallo-beta-lactamases. A total of 112 A. baumannii were identified from various clinical samples and antibiotic susceptibility profile was determined by Kirby-Bauer Disk Diffusion method. Out of 112, 66 (58.9%) isolates were resistant to both imipenem and meropenem (OXOID). These resistant isolates were tested for carbapenemase production, and 55 (83.3%) were carbapenemase producers by Modified Hodge Test. These isolates were further tested for MBL production by combined disk test and double disk synergy test. Out of 66, 49 isolates were positive by both methods, CDT and DDST, and only one isolate was detected as negative (with kappa value = 0.038). All MBL producing strains showed remarkable resistance to cephalosporins, fluoroquinolones, aminoglycosides, and piperacillin/tazobactam (OXOID). The antibiotic resistance was very high in A. baumannii which were isolated from children in Pakistan specially attending a nephrology unit. PMID:27123345

  16. Increasing prevalence of imipenem-resistant Pseudomonas aeruginosa and molecular typing of metallo-beta-lactamase producers in a Korean hospital.

    PubMed

    Kim, In-Suk; Lee, Nam Yong; Ki, Chang-Seok; Oh, Won Sup; Peck, Kyong Ran; Song, Jae-Hoon

    2005-01-01

    The types of metallo-beta-lactamases (MBLs), integrons, and genetic relatedness among Pseudomonas aeruginosa were investigated with a recent high prevalence of imipenem resistance in a Korean hospital. During 2000-2003, a total of 116 non-duplicate imipenem-resistant P. aeruginosa isolates were analyzed by PCR and DNA sequencing to detect of bla (IMP-1), bla (VIM-1), bla (VIM-2), bla (SPM-1), intI 1, intI 2, and intI 3 genes. Among them, MBL-producing isolates were evaluated for genetic relatedness using pulsed-field gel electrophoresis (PFGE) profiles. Of 116 isolates, 21 (18.1%) carried bla (VIM-2) gene with the intI 1 gene. Analysis of VIM-2 procuders by PFGE grouped 21 isolates into eight different clusters. Six of eight cluster I strains, all of four cluster II strains, and all of three cluster III strains were isolated in 2000, 2002, and 2003, respectively. Data concluded that P. aeruginosa carrying bla (VIM-2) with a class 1 integron was the only type among MBLs. A hospital outbreak by VIM-2 producers occurred annually, which could be at least a part of a recent high prevalence of imipenem resistance. PMID:16359195

  17. Prevalence and antibacterial resistance patterns of extended-spectrum beta-lactamase producing Gram-negative bacteria isolated from ocular infections

    PubMed Central

    Rameshkumar, G; Ramakrishnan, R; Shivkumar, C; Meenakshi, R; Anitha, V; Venugopal Reddy, Y C; Maneksha, V

    2016-01-01

    Purpose: Extended-spectrum beta-lactamases (ESBLs) mediated resistance is more prevalent worldwide, especially among Gram-negative bacterial isolates, conferring resistance to the expanded spectrum cephalosporins. As limited data were available on the prevalence of ESBLs in this area, the current study was undertaken to determine the prevalence, antibacterial resistance patterns, and molecular detection and characterization of ESBL encoding resistance genes among ocular Gram-negative bacterial isolates from ocular infections. Materials and Methods: A prospective study was done on 252 ocular Gram-negative bacterial isolates recovered from ocular infections during a study period from February 2011 to January 2014. All isolates were subjected to detection of ESBLs by cephalosporin/clavulanate combination disc test and their antibacterial resistance pattern was studied. Molecular detection and characterization of ESBL encoding blaTEM-, blaSHV, blaOXA-, and blaCTX-M (phylogenetic groups 1, 2, 9, and 8/25) resistance genes by multiplex polymerase chain reaction and DNA sequence analysis. Results: Of all Gram-negative bacteria, Pseudomonas aeruginosa (44%) was the most common strain, followed by Enterobacter agglomerans and Klebsiella pneumoniae each (10%). Among the 252, 42 (17%) were ESBL producers. The major source of ESBL producers were corneal scraping specimens, highest ESBL production was observed in P. aeruginosa 16 (38%) and Escherichia coli 7 (16.6%). Among ESBL-producing genes, the prevalence of blaTEM-gene was the highest (83%) followed by blaOXA-gene (35%), blaSHV-gene (18.5%), and blaCTX-M-1-gene (18.5%) alone or together. Conclusion: The higher rate of prevalence of ESBLs-encoding genes among ocular Gram-negative bacteria is of great concern, as it causes limitation to therapeutic options. This regional knowledge will help in guiding appropriate antibiotic use which is highly warranted. PMID:27221683

  18. Prevalence of Class 1 Integrons and Extended Spectrum Beta Lactamases among Multi-Drug Resistant Escherichia coli Isolates from North of Iran

    PubMed Central

    Mehdipour Moghaddam, Mohammad Javad; Mirbagheri, Adeleh Alsadat; Salehi, Zivar; Habibzade, Seyyed Mahmood

    2015-01-01

    Background: Extended spectrum beta lactamases (ESBLs) are an important cause of transferable multidrug resistance (MDR) in gram-negative bacteria. The most described ESBL genes are generally found within integron-like structures as mobile genetic elements. The aim of this study was to identify the accompanying of class 1 integrons and ESBLs in the MDR E. coli isolates. Methods: Susceptibility to antimicrobial agents was determined for 33 E. coli strains by the disk diffusion method. Double-disk synergy test was applied for screening ESBL. To identify the strains carrying integrons, the conserved regions of integron-encoded integrase gene intI1 were amplified. For detection of gene cassettes, 5′CS and 3′CS primers were used. Results: All E. coli isolates were identified as multi-drug resistant. More than 50% of the isolates were resistant to tetracycline, cephalothin, cefuroxime, amoxicillin-clavulanic acid, and third generation cephalosporines. Nearly all of the isolates displayed sensitivity to piperacillin. There was a significant correlation between production of ESBL and resistance to all antibiotics except for ciprofloxacin and piperacillin (P < 0.01). Thirty two MDR strains (97%) included class 1 integron, and some isolates that included integrons were similar in the size of gene cassettes. The isolates were different in the resistance profiles; however, some others had similar resistance profiles. Of eight ESBL positive isolates, seven (87.5%) carried class 1 integrons. Conclusion: Class 1 integrons were frequent in MDR and also ESBL-producing E. coli isolates. High prevalence of class 1 integrons confirms that integron-mediated antimicrobial gene cassettes are important in E. coli resistance profile. PMID:26220727

  19. Prevalence of multidrug resistant and extended spectrum beta-lactamase producing Pseudomonas aeruginosa in a tertiary care hospital

    PubMed Central

    Shaikh, Sibhghatulla; Fatima, Jamale; Shakil, Shazi; Danish Rizvi, Syed Mohd.; Kamal, Mohammad Amjad

    2014-01-01

    Resistance to broad-spectrum beta-lactams, mediated by extended-spectrum beta-lactamase enzymes (ESBL), is an increasing problem worldwide. The present study was undertaken to determine the incidence of ESBL-production among the clinical isolates of Pseudomonas aeruginosa and their susceptibility to selected antimicrobials. A total of one eighty-seven clinical specimens were tested for the presence of ESBL production using the double-disc synergy test. Of these, 25.13% (n = 47) isolates of P. aeruginosa were observed as ESBL positive. The maximum number of ESBL-producing strains were found in sputum (41.67%; n = 24) followed by pus (28.36%; n = 19), cerebrospinal fluid and other body fluids (21.74%; n = 5), urine (20.45%; n = 9) and blood (13.79%; n = 4). ESBL producing isolates exhibited co-resistance to an array of antibiotics tested. Imipenem and meropenem can be suggested as the drugs of choice in our study. PMID:25561885

  20. The Structural Bases of Antibiotic Resistance in the Clinically Derived Mutant beta-Lactamases TEM-30, TEM-32, and TEM-34

    SciTech Connect

    Wang, Xiaojun; Minasov, George; Shoichet, Brian K.

    2010-03-08

    Widespread use of {beta}-lactam antibiotics has promoted the evolution of {beta}-lactamase mutant enzymes that can hydrolyze ever newer classes of these drugs. Among the most pernicious mutants are the inhibitor-resistant TEM {beta}-lactamases (IRTs), which elude mechanism-based inhibitors, such as clavulanate. Despite much research on these IRTs, little is known about the structural bases of their action. This has made it difficult to understand how many of the resistance substitutions act as they often occur far from Ser-130. Here, three IRT structures, TEM-30 (R244S), TEM-32 (M69I/M182T), and TEM-34 (M69V), are determined by x-ray crystallography at 2.00, 1.61, and 1.52 {angstrom}, respectively. In TEM-30, the Arg-244 {yields} Ser substitution (7.8 {angstrom} from Ser-130) displaces a conserved water molecule that usually interacts with the {beta}-lactam C3 carboxylate. In TEM-32, the substitution Met-69 {yields} Ile (10 {angstrom} from Ser-130) appears to distort Ser-70, which in turn causes Ser-130 to adopt a new conformation, moving its O{gamma} further away, 2.3 {angstrom} from where the inhibitor would bind. This substitution also destabilizes the enzyme by 1.3 kcal/mol. The Met-182 {yields} Thr substitution (20 {angstrom} from Ser-130) has no effect on enzyme activity but rather restabilizes the enzyme by 2.9 kcal/mol. In TEM-34, the Met-69 {yields} Val substitution similarly leads to a conformational change in Ser-130, this time causing it to hydrogen bond with Lys-73 and Lys-234. This masks the lone pair electrons of Ser-130 O{gamma}, reducing its nucleophilicity for cross-linking. In these three structures, distant substitutions result in accommodations that converge on the same point of action, the local environment of Ser-130. TEM-1 {beta}-lactamase is the predominant source of resistance to {beta}-lactams, such as the penicillins. TEM-1 and related class A {beta}-lactamases confer resistance by hydrolyzing the {beta}-lactam ring of these antibiotics

  1. Resistance to cefepime and cefpirome due to a 4-amino-acid deletion in the chromosome-encoded AmpC beta-lactamase of a Serratia marcescens clinical isolate.

    PubMed

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-03-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The bla(AmpC) gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the bla(AmpC) gene from S. marcescens HD had a 12-nucleotide deletion compared to the bla(AmpC) gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the beta-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type beta-lactamases. PMID:14982755

  2. Isolation and characterization of a beta-lactamase-inhibitory protein from Streptomyces clavuligerus and cloning and analysis of the corresponding gene.

    PubMed Central

    Doran, J L; Leskiw, B K; Aippersbach, S; Jensen, S E

    1990-01-01

    Culture filtrates of Streptomyces clavuligerus contain a proteinaceous beta-lactamase inhibitor (BLIP) in addition to a variety of beta-lactam compounds. BLIP was first detected by its ability to inhibit Bactopenase, a penicillinase derived from Bacillus cereus, but it has also been shown to inhibit the plasmid pUC- and chromosomally mediated beta-lactamases of Escherichia coli. BLIP showed no inhibitory effect against Enterobacter cloacae beta-lactamase, and it also showed no activity against an alternative source of B. cereus penicillinase. BLIP was purified to homogeneity, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis gave a size estimate for BLIP of 16,900 to 18,000. The interaction between purified BLIP and the E. coli(pUC) beta-lactamase was investigated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and determined to be noncovalent, with an estimated 1:1 molar stoichiometry. The BLIP gene was isolated on a 13.5-kilobase fragment of S. clavuligerus chromosomal DNA which did not overlap a 40-kilobase region of DNA known to contain genes for beta-lactam antibiotic biosynthesis. The gene encoded a mature protein with a deduced amino acid sequence of 165 residues (calculated molecular weight of 17,523) and also encoded a 36-amino-acid signal sequence. No significant sequence similarity to BLIP was found by pairwise comparisons using various protein and nucleotide sequence data banks or by hybridization experiments, and no BLIP activity was detected in the culture supernatants of other Streptomyces spp. Images PMID:2203736

  3. [Investigation of the presence of New Delhi metallo-beta-lactamase-1 (NDM-1) by PCR in carbapenem-resistant gram-negative isolates].

    PubMed

    Yanık, Keramettin; Emir, Dilek; Eroğlu, Cafer; Karadağ, Adil; Güney, Akif Koray; Günaydın, Murat

    2013-04-01

    Bacteria producing New Delhi metallo-beta-lactamase-1 (NDM-1) exhibit high level resistance to beta-lactams including carbapenems. This broad-spectrum resistance limits treatment options for infections caused by NDM-1 producers. NDM-1 was first isolated from an Indian patient in Sweden; since then, NDM-1 producing isolates have been identified in many countries including Turkey. In this study, we investigated the presence of NDM-1 by PCR method in various gram-negative isolates recovered from clinical specimens in tertiary care hospitals in Samsun, Turkey. A total of 210 carbapenem-resistant gram-negative isolates (132 Acinetobacter baumannii, 54 Pseudomonas aeruginosa, 5 Pseudomonas putida, 8 Enterobacter cloacae, 3 Enterobacter aerogenes, 3 Klebsiella pneumoniae, 2 Providencia rettgeri, 2 Escherichia coli and 1 Citrobacter freundii) were included in the study. Identification and antibiotic susceptibility testing of the isolates were performed by using Vitek-2 Compact (bioMerieux, France) and BD Phoenix (BD Diagnostic Systems, MD) automated systems. The results of antibiotic susceptibility testing were interpreted according to the CLSI recommendations. In our study, NDM-1 gene was not detected in any of the clinical isolates by PCR. There was only one case study that reported the presence of NDM-1 in clinical isolates from Turkey [Poirel L et al. Antimicrob Agents Chemother 2012;56:2784]. Our data, together with the others, indicated that the existence of NDM-1 in clinical isolates is not common in Turkey. However, since NDM-1 is a plasmid-encoded enzyme, there is always a risk of spread of this resistance through the bacterial strains in our country. Therefore, continuous surveillance and investigation of carbapenem-resistant isolates with resistance patterns suggestive of NDM-1 may enable to identify NDM-1 producing isolates. Meanwhile special care should be given on rational antibiotic use and establishment of appropriate infection control policies to prevent

  4. The prevalence of extended-spectrum beta-lactamase in environmental isolates of Enterobacter.

    PubMed

    Sharma, Anjana; Dour, Prashant; Singh, Thakur Nirbhay

    2008-01-01

    The incidence of extended-spectrum beta-lactamase (ESBL)-producing strains and multidrug-resistant strains of Enterobacter spp. isolated from the 1312 km long river Narmada was investigated. Out of the 57 isolates of Enterobacter, 73.68% were found to be ESBL producers including the isolates of E. taylorae and isolates of E. agglomerans, which have been characterized for the first time. All the isolates were found susceptible to the antibiotic imipenem. AmpC gene was found in all the Enterobacter strains tested. AmpC beta-lactamase-producing bacterial pathogens may cause major therapeutic failure if not detected and reported in time. It was seen that these enzymes are mainly chromosomally mediated along with several non-AmpC beta-lactamase. PMID:18417885

  5. Carbapenem-resistant Pseudomonas aeruginosa strains from a Spanish hospital: characterization of metallo-beta-lactamases, porin OprD and integrons.

    PubMed

    Rojo-Bezares, Beatriz; Estepa, Vanesa; Cebollada, Rocío; de Toro, María; Somalo, Sergio; Seral, Cristina; Castillo, Francisco Javier; Torres, Carmen; Sáenz, Yolanda

    2014-05-01

    Molecular typing and mechanisms of carbapenem resistance such as alterations in porin OprD and presence of metallo-beta-lactamases (MBLs), as well as integrons have been studied in a collection of carbapenem-resistant Pseudomonas aeruginosa (CRPA) isolates from a Spanish hospital. One hundred and twenty-three CRPA isolates were recovered from different samples of 80 patients. Clonal relationship among CRPA was analyzed by SpeI-PFGE. Susceptibility testing to 11 antibiotics and MBL phenotype was determined by microdilution, IP/IPI E-test and double disc method. The oprD gene was studied by PCR and sequencing, and mutations were determined comparing with P. aeruginosa PAO1 sequence. Characterization of MBLs, and class 1 and 2 integrons were studied by PCR and sequencing. SDS-PAGE analysis of outer membrane proteins of selected strains was performed. Seventy-four-per-cent of patients with CRPA were hospitalised in the ICU setting and 50% had long hospitalization stays. Sixty-four different PFGE patterns were detected, and 87 CRPA strains were further analyzed. MBL phenotype was detected in 43 of 87 strains (49.4%), which contained blaVIM-2 gene inside class 1 integrons. VIM-2-producing strains belonged to lineages ST175, ST235, and ST973. A great diversity of nucleotide insertions, deletions, and mutations in oprD gene, and the presence of a new insertion sequence (ISPa45) truncating oprD were identified among CRPA strains. Class 1 integrons were detected in 75% of CRPA strains, blaVIM-2 and the new arrangement aac(3)-Ia+ISPa34+aadA1 (named as In661) being the most frequent gene-cassette arrays detected. Other gene cassettes detected in integrons were: aadB, aadA6, aadA7, aac(6')-Ib', and blaOXA-46. PMID:24594145

  6. Determinants of the activity of beta-lactamase inhibitor combinations.

    PubMed

    Livermore, D M

    1993-01-01

    Inhibitor combinations provide one strategy to overcome beta-lactamase-mediated resistance. Their success depends, obviously, on the inhibitor being able to bind and inactivate the beta-lactamase molecules. Clavulanate, sulbactam and tazobactam are irreversible inactivators of many beta-lactamases, forming covalent complexes which resist hydrolysis. 'Suicide' kinetics are seen with some, but not all, enzymes. All three compounds inactivate staphylococcal penicillinase, the chromosomal beta-lactamases of Proteus vulgaris and Bacteroides spp., and the Class IV beta-lactamases present in some klebsiellae. Tazobactam, but not the other compounds, has moderate activity against some Class I (AmpC) chromosomal beta-lactamases, notably that of Morganella morganii, but not that of Enterobacter cloacae. Both clavulanate and tazobactam are strong inhibitors of the widely distributed TEM and SHV plasmid-mediated beta-lactamases; sulbactam is a weaker inhibitor. Other factors, aside from the affinity of the inhibitor for the enzyme, co-determine the success or failure of inhibition. Potentiation is most readily achieved if little enzyme is produced, and if the organism is very permeable to the inhibitor. Thus, resistance to inhibitor combinations is rare in strains of Haemophilus influenzae and Neisseria gonorrhoeae that produce TEM-beta-lactamase, but is commoner in enterobacteria that produce this enzyme, since these are less permeable and sometimes manufacture very large amounts of enzyme. The partner beta-lactam agent is also important. Irrespective of the inhibitor used, piperacillin is easier to protect against TEM beta-lactamases and the M. morganii Class I enzyme than are ampicillin, amoxycillin or ticarcillin. This may relate to the lower affinity of piperacillin for these enzymes, or to its greater affinity for the bacterial penicillin-binding proteins. Finally, pH can affect the degree of inhibition achieved with sulphones for some beta-lactamases, notably TEM-1

  7. Effective treatment of cephalosporin-rifampin combinations against cryptic methicillin-resistant beta-lactamase-producing coagulase-negative staphylococcal experimental endocarditis.

    PubMed Central

    Brandt, C M; Rouse, M S; Tallan, B M; Laue, N W; Wilson, W R; Steckelberg, J M

    1995-01-01

    The efficacy of cefazolin or cefpirome alone or combined with rifampin was compared with that of vancomycin alone or combined with rifampin in an experimental model of methicillin-resistant, beta-lactamase-producing, coagulase-negative staphylococcal endocarditis. Phenotypically, the mecA gene-positive strain used in vivo did not exhibit methicillin resistance by the agar dilution or disk susceptibility method but was resistant in vitro (oxacillin MIC, 64 micrograms/ml) by the microtiter dilution method with 2% NaCl supplementation. Macrodilution broth susceptibilities of standard inocula failed to demonstrate cross-resistance of staphylococci to cefazolin (MIC, 8 micrograms/ml) or cefpirome (MIC, 4 micrograms/ml). In vivo, vancomycin and cefpirome had similar activities, and both regimens were more effective than was cefazolin alone. While the MIC of rifampin was low (0.031 micrograms/ml), monotherapy with rifampin resulted in a bimodal distribution of outcomes due to the expected emergence of resistant mutants. The results in vitro of time-kill synergy studies using rifampin in combination with cefazolin or cefpirome varied with the antimicrobial concentrations tested and did not reliably predict activities in vivo of rifampin-beta-lactam combination therapies. Cefpirome, but not cefazolin or vancomycin, in combination with rifampin was synergistic in vivo. Cefpirome in combination with rifampin was more effective than was cefazolin in combination with rifampin. Both cephalosporin-rifampin regimens were significantly more effective than was cephalosporin or vancomycin monotherapy and were as effective as vancomycin combined with rifampin. These data support further evaluation of rifampin-beta-lactam combinations as possible alternative therapies to vancomycin-containing regimens for selected methicillin-resistant coagulase-negative staphylococcal infections. PMID:7486924

  8. Sequence analysis and enzyme kinetics of the L2 serine beta-lactamase from Stenotrophomonas maltophilia.

    PubMed Central

    Walsh, T R; MacGowan, A P; Bennett, P M

    1997-01-01

    The L2 serine active-site beta-lactamase from Stenotrophomonas maltophilia has been classified as a clavulanic acid-sensitive cephalosporinase. The gene encoding this enzyme from S. maltophilia 1275 IID has been cloned on a 3.3-kb fragment into pK18 under the control of a Ptac promoter to generate recombinant plasmid pUB5840; when expressed in Escherichia coli, this gene confers resistance to cephalosporins and penicillins. Sequence analysis has revealed an open reading frame (ORF) of 909 bp with a GC content of 71.6%, comparable to that of the L1 metallo-beta-lactamase gene (68.4%) from the same bacterium. The ORF encodes an unmodified protein of 303 amino acids with a predicted molecular mass of 31.5 kDa, accommodating a putative leader peptide of 27 amino acids. Comparison of the amino acid sequence with those of other beta-lactamases showed it to be most closely related (54% identity) to the BLA-A beta-lactamase from Yersinia enterocolitica. Sequence identity is most obvious near the STXK active-site motif and the SDN loop motif common to all serine active-site penicillinases. Sequences outside the conserved regions display low homology with comparable regions of other class A penicillinases. Kinetics of the enzyme from the cloned gene demonstrated an increase in activity with cefotaxime but markedly less activity with imipenem than previously reported. Hence, the S. maltophilia L2 beta-lactamase is an inducible Ambler class A beta-lactamase which would account for the sensitivity to clavulanic acid. PMID:9210666

  9. Haemophilus influenzae with Non-Beta-Lactamase-Mediated Beta-Lactam Resistance: Easy To Find but Hard To Categorize.

    PubMed

    Skaare, Dagfinn; Lia, Astrid; Hannisdal, Anja; Tveten, Yngvar; Matuschek, Erika; Kahlmeter, Gunnar; Kristiansen, Bjørn-Erik

    2015-11-01

    Haemophilus influenzae is a major pathogen, and beta-lactams are first-line drugs. Resistance due to altered penicillin-binding protein 3 (rPBP3) is frequent, and susceptibility testing of such strains is challenging. A collection of 154 beta-lactamase-negative isolates with a large proportion of rPBP3 (67.5%) was used to evaluate and compare Etest (Haemophilus test medium [HTM]) and disk diffusion (EUCAST method) for categorization of susceptibility to aminopenicillins and cefuroxime, using MICs generated with broth (HTM) microdilution and clinical breakpoints from CLSI and EUCAST as the gold standards. In addition, the proficiency of nine disks in screening for the rPBP3 genotype (N526K positive) was evaluated. By Etest, both essential and categorical agreement were generally poor (<70%), with high very major errors (VME) (CLSI, 13.0%; EUCAST, 34.3%) and falsely susceptible rates (FSR) (CLSI, 87.0%; EUCAST, 88.3%) for ampicillin. Ampicillin (2 μg) with adjusted (+2 mm) zone breakpoints was superior to Etest for categorization of susceptibility to ampicillin (agreement, 74.0%; VME, 11.0%; FSR, 28.3%). Conversely, Etest was superior to 30 μg cefuroxime for categorization of susceptibility to cefuroxime (agreement, 57.1% versus 60.4%; VME, 2.6% versus 9.7%; FSR, 7.1% versus 26.8%). Benzylpenicillin (1 unit) (EUCAST screening disk) and cefuroxime (5 μg) identified rPBP3 isolates with highest accuracies (95.5% and 92.2%, respectively). In conclusion, disk screening reliably detects rPBP3 H. influenzae, but false ampicillin susceptibility is frequent with routine methods. We suggest adding a comment recommending high-dose aminopenicillin therapy or the use of other agents for severe infections with screening-positive isolates that are susceptible to aminopenicillins by gradient or disk diffusion. PMID:26354813

  10. Haemophilus influenzae with Non-Beta-Lactamase-Mediated Beta-Lactam Resistance: Easy To Find but Hard To Categorize

    PubMed Central

    Lia, Astrid; Hannisdal, Anja; Tveten, Yngvar; Matuschek, Erika; Kahlmeter, Gunnar; Kristiansen, Bjørn-Erik

    2015-01-01

    Haemophilus influenzae is a major pathogen, and beta-lactams are first-line drugs. Resistance due to altered penicillin-binding protein 3 (rPBP3) is frequent, and susceptibility testing of such strains is challenging. A collection of 154 beta-lactamase-negative isolates with a large proportion of rPBP3 (67.5%) was used to evaluate and compare Etest (Haemophilus test medium [HTM]) and disk diffusion (EUCAST method) for categorization of susceptibility to aminopenicillins and cefuroxime, using MICs generated with broth (HTM) microdilution and clinical breakpoints from CLSI and EUCAST as the gold standards. In addition, the proficiency of nine disks in screening for the rPBP3 genotype (N526K positive) was evaluated. By Etest, both essential and categorical agreement were generally poor (<70%), with high very major errors (VME) (CLSI, 13.0%; EUCAST, 34.3%) and falsely susceptible rates (FSR) (CLSI, 87.0%; EUCAST, 88.3%) for ampicillin. Ampicillin (2 μg) with adjusted (+2 mm) zone breakpoints was superior to Etest for categorization of susceptibility to ampicillin (agreement, 74.0%; VME, 11.0%; FSR, 28.3%). Conversely, Etest was superior to 30 μg cefuroxime for categorization of susceptibility to cefuroxime (agreement, 57.1% versus 60.4%; VME, 2.6% versus 9.7%; FSR, 7.1% versus 26.8%). Benzylpenicillin (1 unit) (EUCAST screening disk) and cefuroxime (5 μg) identified rPBP3 isolates with highest accuracies (95.5% and 92.2%, respectively). In conclusion, disk screening reliably detects rPBP3 H. influenzae, but false ampicillin susceptibility is frequent with routine methods. We suggest adding a comment recommending high-dose aminopenicillin therapy or the use of other agents for severe infections with screening-positive isolates that are susceptible to aminopenicillins by gradient or disk diffusion. PMID:26354813

  11. PER-1 extended-spectrum beta-lactamase production in an Alcaligenes faecalis clinical isolate resistant to expanded-spectrum cephalosporins and monobactams from a hospital in Northern Italy.

    PubMed

    Pereira, M; Perilli, M; Mantengoli, E; Luzzaro, F; Toniolo, A; Rossolini, G M; Amicosante, G

    2000-01-01

    An Alicaligenes faecalis (FL-424/98) resistant to expanded-spectrum cephalosporins and aztreonam was isolated from the urine of an inpatient at the Intensive Care Unit of the Varese Hospital (Northern Italy) after antimicrobial chemotherapy with cefazolin, vancomycin, and amikacin. Clavulanic acid restored the activity of expanded-spectrum cephalosporins, suggesting the production of an extended-spectrum beta-lactamase (ESbetaL). A crude extract of FL-424/98 showed the presence of two beta-lactamase activities focusing at pH 5.3 and 7.6, respectively. The ESbetaL activity, purified by means of three chromatographic steps, was found to correspond to the pI 5.3 enzyme. Determination of kinetic parameters confirmed that the enzyme efficiently hydrolyzed expanded-spectrum cephalosporins and aztreonam. A colony-blot hybridization revealed the presence of blaPER-related sequences in FL-424/98, and sequencing confirmed the identity of this determinant with blaPER-1, previously detected in Pseudomonas aeruginosa, Acinetobacter, and Salmonella clinical isolates from Turkey. Finding of blaPER-1 in a species that can be part of the resident human microbiota raises the possibility that it could be an efficient shuttle for spreading of this resistance gene among other opportunistic pathogens that are normally members of the resident microbiota. Kinetic parameters determined for the PER-1 enzyme with some cephalosporin substrates were somewhat different from those previously reported. PMID:10868812

  12. Characterization of the new metallo-beta-lactamase VIM-13 and its integron-borne gene from a Pseudomonas aeruginosa clinical isolate in Spain.

    PubMed

    Juan, Carlos; Beceiro, Alejandro; Gutiérrez, Olivia; Albertí, Sebastián; Garau, Margalida; Pérez, José L; Bou, Germán; Oliver, Antonio

    2008-10-01

    During a survey conducted to evaluate the incidence of class B carbapenemase (metallo-beta-lactamase [MBL])-producing Pseudomonas aeruginosa strains from hospitals in Majorca, Spain, five clinical isolates showed a positive Etest MBL screening test result. In one of them, strain PA-SL2, the presence of a new bla(VIM) derivative (bla(VIM-13)) was detected by PCR amplification with bla(VIM-1)-specific primers followed by sequencing. The bla(VIM-13)-producing isolate showed resistance to all beta-lactams (except aztreonam), gentamicin, tobramycin, and ciprofloxacin. VIM-13 exhibited 93% and 88% amino acid sequence identities with VIM-1 and VIM-2, respectively. bla(VIM-13) was cloned in parallel with bla(VIM-1), and the resistance profile conferred was analyzed both in Escherichia coli and in P. aeruginosa backgrounds. Compared to VIM-1, VIM-13 conferred slightly higher levels of resistance to piperacillin and lower levels of resistance to ceftazidime and cefepime. VIM-13 and VIM-1 were purified in parallel as well, and their kinetic parameters were compared. The k(cat)/K(m) ratios for the antibiotics mentioned above were in good agreement with the MIC data. Furthermore, EDTA inhibited the activity of VIM-13 approximately 25 times less than it inhibited the activity of VIM-1. VIM-13 was harbored in a class 1 integron, along with a new variant (Ala108Thr) of the aminoglycoside-modifying enzyme encoding gene aacA4, which confers resistance to gentamicin and tobramycin. Finally, the VIM-13 integron was apparently located in the chromosome, since transformation and conjugation experiments consistently yielded negative results and the bla(VIM-13) probe hybridized only with the genomic DNA. PMID:18644957

  13. The influence of Imipenem resistant metallo-beta-lactamase positive and negative Pseudomonas aeruginosa nosocomial infections on mortality and morbidity

    PubMed Central

    Babu, Kolhal Veerappa Yogeesha; Visweswaraiah, Divakara Siddanakatte; Kumar, Arun

    2014-01-01

    Background: Metallo-beta-lactamase (MBL) mediated resistance to carbapenems is an emerging threat in Pseudomonas aeruginosa (PA) nosocomial infections. Limited data on role of Imipenem resistant MBL positive PA (IR-MBLP-PA) and IR-MBL negative-PA (IR-MBLN-PA) infections on mortality and morbidity initiated the present study. Objectives: The aim of this study is to determine the role of IR-MBLP-PA and IR-MBLN-PA infections on mortality and morbidity. Materials and Methods: Prospective observational study of 1 year with 110 PA nosocomial infections was conducted with Imipenem + ethylene-diamine-tetra-acetic acid combined disc test for MBL detection. Role of IR-MBLP-PA and IR-MBLN-PA infections on the outcome and morbidity were assessed in terms of crude mortality rate, Charlson's comorbidity score and mean duration of stay in intensive care unit (ICU) until cure and until death, number of episodes of complications and underlying disease. Results were analyzed by z test for proportions and Student t-test. Results: Relatively high crude mortality was observed among IR-MBLP-PA infections than IR-MBLN-PA (42.86% [6/14] vs. 20% [2/10], Z = 0.69, P = 0.49 NS). Ventilator-associated pneumonia was the underlying disease and a confounding factor in all deaths due to IR-MBLP-PA infections. IR-MBLP-PA infections resulted in rapid downhill course to death with short mean duration of stay in ICU until death than IR-MBLN-PA infections (3.167 ± 0.98 days vs. 16 ± 2.82, P < 0.001 highly significant [HS]) with more number of complications (5.85 ± 1.65 vs. 3.7 ± 1.31, P < 0.001 HS). With the exception of previous Imipenem therapy, association of higher Charlson's comorbidity score, severe underlying diseases, multidrug and pandrug resistance and pre-disposing risk factors with IR-MBLP-PA infections was not statistically significant. Conclusions: Higher mortality in IR-MBLP-PA than in IR-MBLN-PA was not significant indicating IR as an important predictor of mortality than MBL

  14. Extended Spectrum Beta Lactamase producing Cephalosporin resistant Salmonella Typhi, reported from Rawalpindi, Pakistan.

    PubMed

    Munir, Tehmina; Lodhi, Munir; Ansari, Jawad Khaliq; Andleeb, Saadia; Ahmed, Mushtaq

    2016-08-01

    Typhoid is endemic in many parts of southeast Asia. Due to the resistance of the organism to first line of antibiotics (ampicillin, chloramphenicol, cotrimoxazole) as well as to fluoroquinolones, third generation cephalosporins have been in use for the empiric treatment of typhoid for years. However an increasing incidence of Salmonella Typhi is being reported sporadically from various regions. We report a case of typhoid due to Salmonella Typhi which was non-responsive to treatment with a cephalosporin, was found to be multidrug resistant and resistant to ciprofloxacin and third generation cephalosporin as well. The patient was finally treated successfully with intravenous administration of a carbapenem. PMID:27524545

  15. Spread of integron-associated VIM-type metallo-beta-lactamase genes among imipenem-nonsusceptible Pseudomonas aeruginosa strains in Greek hospitals.

    PubMed

    Giakkoupi, P; Petrikkos, G; Tzouvelekis, L S; Tsonas, S; Legakis, N J; Vatopoulos, A C

    2003-02-01

    Fifty-eight imipenem-nonsusceptible (MIC >or= 8 microg/ml) Pseudomonas aeruginosa strains isolated during May 2001 in 15 Greek hospitals were studied. Thirty-six isolates derived from nine hospitals carried VIM-type metallo-beta-lactamase genes, as found by PCR. In 34 isolates, bla(VIM) was associated with class 1 integrons of various sizes. DNA sequencing indicated the presence of bla(VIM-2) gene cassettes in a variety of integron structures. Random amplified polymorphic DNA typing suggested diversity of the bla(VIM)-positive strains. Synergy between 2-mercaptoacetic acid and imipenem indicated carbapenemase activity in 26 bla(VIM)-positive strains. PMID:12574292

  16. Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment

    PubMed Central

    Shaikh, Sibhghatulla; Fatima, Jamale; Shakil, Shazi; Rizvi, Syed Mohd. Danish; Kamal, Mohammad Amjad

    2014-01-01

    Antibiotic resistance is a problem of deep scientific concern both in hospital and community settings. Rapid detection in clinical laboratories is essential for the judicious recognition of antimicrobial resistant organisms. Production of extended-spectrum β-lactamases (ESBLs) is a significant resistance-mechanism that impedes the antimicrobial treatment of infections caused by Enterobacteriaceae and is a serious threat to the currently available antibiotic armory. ESBLs are classified into several groups according to their amino acid sequence homology. Proper infection control practices and barriers are essential to prevent spread and outbreaks of ESBL producing bacteria. As bacteria have developed different strategies to counter the effects of antibiotics, the identification of the resistance mechanism may help in the discovery and design of new antimicrobial agents. The carbapenems are widely regarded as the drugs of choice for the treatment of severe infections caused by ESBL-producing Enterobacteriaceae, although comparative clinical trials are scarce. Hence, more expeditious diagnostic testing of ESBL-producing bacteria and the feasible modification of guidelines for community-onset bacteremia associated with different infections are prescribed. PMID:25561890

  17. Beta-Lactamase Encoded Genes blaTEM and blaCTX Among Acinetobacter baumannii Species Isolated From Medical Devices of Intensive Care Units in Tehran Hospitals

    PubMed Central

    Khalilzadegan, Sara; Sade, Mojtaba; Godarzi, Hussein; Eslami, Gita; Hallajzade, Masoumeh; Fallah, Fatemeh; Yadegarnia, Davood

    2016-01-01

    Background Excessive consumption of antimicrobial materials in hospitals is considered as the main encoder leading to the emergence, development and acquisition of new bacterial resistance to beta-lactamase. Objectives Owing to the lack of proper information regarding the mechanism of the bacterial resistance to antibiotics and responsible genes in the country, the current study aimed to consider the resistance or sensitivity of the Acinetobacter baumannii multi drug resistant (MDR) isolates facing 2% glutaraldehyde. The study was conducted in the selected intensive care units in Tehran hospitals, Iran, in 2013. Materials and Methods In this study conducted over a period of 10 months, A. baumannii species were isolated by bacterial culture following biochemical tests from intensive care units (ICUs) of some hospitals in Tehran, Iran (Fayazbaksh, Taleghani, Imam Khomeini, Valiasr, Labafinejad). The resistance and sensitivity of the isolates to antibiotics were considered according to the clinical and laboratory standard institute CLSI (2012) guidelines. By multiplex PCR method, blaCTX and blaTEM genes were detected and finally, MDR strains were treated with 2% glutaraldehyde. PCR was used for each strain of MDR using specific primers. Results In the current study, 131 A. baumannii isolates (22.3%) out of 588 were studied. The level of resistance to various antibiotics was in the range of 69.4% to 100%. The frequencies of blaTEM and blaCTX genes were 3.2% and 19.4%, respectively. MIC50% and MIC90% of imipenem and meropenem antibiotics were 32 ± 1 µg/mL and 64 ± 1 µg/mL, respectively (P < 0.9). However no resistance to glutaraldehyde was observed. Different bands of MDR strains were observed in the PCR product by electrophoresis. Conclusions It seems that besides the variety and prevalence of blaTEM and blaCTX, enormous mechanisms such as porin and leaking systems (efflux pumps) are responsible for the information of the A. baumannii resistance to disinfectants

  18. Mosaic structure of p1658/97, a 125-kilobase plasmid harboring an active amplicon with the extended-spectrum beta-lactamase gene blaSHV-5.

    PubMed

    Zienkiewicz, M; Kern-Zdanowicz, I; Gołebiewski, M; Zyliñska, J; Mieczkowski, P; Gniadkowski, M; Bardowski, J; Cegłowski, P

    2007-04-01

    Escherichia coli isolates recovered from patients during a clonal outbreak in a Warsaw, Poland, hospital in 1997 produced different levels of an extended-spectrum beta-lactamase (ESBL) of the SHV type. The beta-lactamase hyperproduction correlated with the multiplication of ESBL gene copies within a plasmid. Here, we present the complete nucleotide sequence of plasmid p1658/97 carried by the isolates recovered during the outbreak. The plasmid is 125,491 bp and shows a mosaic structure in which all modules constituting the plasmid core are homologous to those found in plasmids F and R100 and are separated by segments of homology to other known regions (plasmid R64, Providencia rettgeri genomic island R391, Vibrio cholerae STX transposon, Klebsiella pneumoniae or E. coli chromosomes). Plasmid p1658/97 bears two replication systems, IncFII and IncFIB; we demonstrated that both are active in E. coli. The presence of an active partition system (sopABC locus) and two postsegregational killing systems (pemIK and hok/sok) indicates that the plasmid should be stably maintained in E. coli populations. The conjugative transfer is ensured by the operons of the tra and trb genes. We also demonstrate that the plasmidic segment undergoing amplification contains the blaSHV-5 gene and is homologous to a 7.9-kb fragment of the K. pneumoniae chromosome. The amplicon displays the structure of a composite transposon of type I. PMID:17220406

  19. AmpC-BETA Lactamases among Enterobacteriaceae Isolated at a Tertiary Hospital, South Western Uganda

    PubMed Central

    Nakaye, Martha; Bwanga, Freddie; Itabangi, Herbert; Stanley, Iramiot J.; Bashir, Mwambi; Bazira, Joel

    2015-01-01

    Aim To characterize AmpC-beta lactamases among Enterobacteriaceae isolates from clinical samples at Mbarara Regional Referral Hospital. Study Design Laboratory-based descriptive cross-sectional study Place and Duration of Study Microbiology Department, Mbarara Regional Referral Hospital and MBN clinical Laboratories, between May to September 2013. Methodology This study included 293 Enterobacteriaceae isolates recovered from clinical specimens that included blood, urine, stool and aspirates. AmpC Beta lactamase production was determined using disc placement method for cefoxitin at a break point of <18mm. Common AmpC plasmid mediated genes were EBC, ACC, FOX, DHA, CIT and MOX were; was determined by Multiplex PCR as described by Hanson and Perez-Perez. Results Plasmid mediated AmpC phenotype was confirmed in 107 of the 293 (36.5%) cefoxitin resistant isolates with 30 isolates having more than one gene coding for resistance. The commonest source that harbored AmpC beta lactamases was urine and E. coli was the most common AmpC producer (59.5%). The genotypes detected in this study, included EBC (n=36), FOX (n=18), ACC (n=11), CIT (n=10), DHA (n=07) and MOX (n=1). Conclusion Our findings showed that prevalence of AmpC beta-lactamase at MRRH was high (39.6), with EBC as the commonest genotype among Enterobacteriaceae Urine and E. coli were the commonest source and organism respectively that harbored AmpC beta-lactamases. There‘s rational antimicrobial therapy and antibiotic susceptibility tests should be requested by health workers especially patients presenting with urinary tract infections and bacteraemias. PMID:26078920

  20. Expression, purification, crystallization, and preliminary X-ray crystallographic analysis of OXA-17, an extended-spectrum {beta}-lactamase conferring severe antibiotic resistance

    SciTech Connect

    Lee, J. H. Sohn, S. G. Jung, H. I. An, Y. J. Lee, S. H.

    2013-07-15

    OXA-17, an extended-spectrum {beta}-lactamase (ESBL) conferring severe antibiotic resistance, hydrolytically inactivates {beta}-lactam antibiotics, inducing a lack of eradication of pathogenic bacteria by oxyimino {beta}-lactams and not helping hospital infection control. Thus, the enzyme is a potential target for developing antimicrobial agents against pathogens producing ESBLs. OXA-17 was purified and crystallized at 298 K. X-ray diffraction data from OXA-17 crystal have been collected to 1.85 A resolution using synchrotron radiation. The crystal of OXA-17 belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.37, b = 101.12, and c = 126.07 A. Analysis of the packing density shows that the asymmetric unit probably contains two molecules with a solvent content of 54.6%.

  1. X-ray structure of the Asn276Asp variant of the Escherichia coli TEM-1 beta-lactamase: direct observation of electrostatic modulation in resistance to inactivation by clavulanic acid.

    PubMed

    Swarén, P; Golemi, D; Cabantous, S; Bulychev, A; Maveyraud, L; Mobashery, S; Samama, J P

    1999-07-27

    The clinical use of beta-lactam antibiotics combined with beta-lactamase inactivators, such as clavulanate, has resulted in selection of beta-lactamases that are insensitive to inactivation by these molecules. Therefore, therapeutic combinations of an enzyme inactivator and a penicillin are harmless for bacteria harboring such an enzyme. The TEM beta-lactamase variants are the most frequently encountered enzymes of this type, and presently, 20 variants are designated as inhibitor-resistant TEM ("IRT") enzymes. Three mutations appear to account for the phenotype of the majority of IRT enzymes, one of them being the Asn276Asp substitution. In this study, we have characterized the kinetic properties of the inhibition process of the wild-type TEM-1 beta-lactamase and of its Asn276Asp variant with the three clinically used inactivators, clavulanic acid (clavulanate), sulbactam, and tazobactam, and we report the X-ray structure for the mutant variant at 2.3 A resolution. The changes in kinetic parameters for the interactions of the inhibitors with the wild-type and the mutant enzymes were more pronounced for clavulanate, and relatively inconsequential for sulbactam and tazobactam. The structure of the Asn276Asp mutant enzyme revealed a significant movement of Asp276 and the formation of a salt bridge of its side chain with the guanidinium group of Arg244, the counterion of the inhibitor carboxylate. A water molecule critical for the inactivation chemistry by clavulanate, which is observed in the wild-type enzyme structure, is not present in the crystal structure of the mutant variant. Such structural changes favor the turnover process over the inactivation chemistry for clavulanate, with profound phenotypic consequences. The report herein represents the best studied example of inhibitor-resistant beta-lactamases. PMID:10423234

  2. Study on imipenem resistance and prevalence of blaVIM1 and blaVIM2 metallo-beta lactamases among clinical isolates of Pseudomonas aeruginosa from Mashhad, Northeast of Iran

    PubMed Central

    Mirbagheri, Seyedeh Zohreh; Meshkat, Zahra; Naderinasab, Mahboubeh; Rostami, Sina; Nabavinia, Maryam Sadat; Rahmati, Mehdi

    2015-01-01

    Background and Objectives: The main cause of serious nosocomial infections is a Gram-negative pathogen known as Pseudomonas aeruginosa (P. aeruginosa). Carbapenems are widely used as an appropriate treatment for these infections, however resistance to these agents has been observed and is increasing. Metallo beta-lactamase (MBLs) enzyme is one of the main causes of resistance to carbapenem. In the current study the frequency and production of VIM1 and VIM2 by imipenem-resistant P. aeruginosa isolates of patients hospitalized in Imam Reza hospital were evaluated. Materials and Methods: In this study, 131 clinical samples were collected from patients hospitalized in Imam Reza hospital in Mashhad during a 15-month period from May 2011 to November 2012. After verification of P. aeruginosa isolates, antibiotic resistance patterns of isolates were determined for 14 antibiotics by Kirby-Bauer standard disk diffusion according to the CLSI guidelines. Combined-disk test was used for phenotypic determination of MBLs-producing isolates and after DNA extraction, genotypic determination of VIM1 and VIM2 metallo beta-lactamase genes was carried out using Multiplex-PCR. Results: Of 63 imipenem-resistant isolates (48.5%), 56 (88.8%) were MBL-producing in phenotypic assessments. Also amongst imipenem-resistant isolates, the frequency of VIM1 and VIM2 genes were 58.7 and 3.17%, respectively. Conclusion: The results of the current study along with the results of the other conducted studies in Iran in recent years demonstrate that the average resistance to imipenem in P. aeruginosa isolates was 51.3% which has increased in comparison with the results in 2006 (32.9%). It was also determined that the frequency of VIM1 gene was more than VIM2 gene. In phenotypic assessment by using CD method, 49.6% of isolates were determined as MBLs-producing. The sensitivity and specificity of this method were verified in comparison with the results of PCR test. PMID:26622967

  3. Genetic and biochemical characterization of TRU-1, the endogenous class C beta-lactamase from Aeromonas enteropelogenes.

    PubMed

    De Luca, Filomena; Giraud-Morin, Chantal; Rossolini, Gian Maria; Docquier, Jean-Denis; Fosse, Thierry

    2010-04-01

    Aeromonas enteropelogenes (formerly A. tructi) was described to be an ampicillin-susceptible and cephalothin-resistant Aeromonas species, which suggests the production of a cephalosporinase. Strain ATCC 49803 was susceptible to amoxicillin, cefotaxime, and imipenem but resistant to cefazolin (MICs of 2, 0.032, 0.125, and >256 microg/ml, respectively) and produced an inducible beta-lactamase. Cefotaxime-resistant mutants (MIC, 32 microg/ml) that showed constitutive beta-lactamase production could be selected in vitro. The gene coding for the cephalosporinase of A. enteropelogenes ATCC 49803 was cloned, and its biochemical properties were investigated. Escherichia coli transformants showing resistance to various beta-lactams carried a 3.5-kb plasmid insert whose sequence revealed a 1,146-bp open reading frame (ORF) encoding a class C beta-lactamase, named TRU-1, showing the highest identity scores with A. punctata CAV-1 (75%), A. salmonicida AmpC (75%), and A. hydrophila CepH (71%). The bla(TRU-1) locus includes open reading frames (ORFs) showing significant homology with genes found in the genomes of other Aeromonas species, although it exhibits a different organization, as reflected by the presence of additional ORFs located downstream of the beta-lactamase gene in the A. hydrophila and A. salmonicida genomes. Specific PCR assays were negative for cphA-like and bla(OXA-12)-like genes in three A. enteropelogenes ATCC strains. Purified TRU-1 showed a broad substrate profile, efficiently hydrolyzing benzylpenicillin, cephalothin, cefoxitin, and, although with significantly lower turnover rates, oxyiminocephalosporins. Cephaloridine and cefepime were poorly recognized by the enzyme, as reflected by the high K(m) values observed with these substrates. Thus far, A. enteropelogenes represents the only known example of an Aeromonas species that produces only one beta-lactamase belonging to molecular class C. PMID:20124004

  4. [Transfer of plasmid beta-lactamases in enterobacteria].

    PubMed

    Umaran, A; Garaizar, J; Gallego, L; Colom, K; Cisterna, R

    1989-04-01

    The aim of the present study was to determine which types of beta-lactamases codified by plasmids are transferred by conjugation from several species of enterobacteria. To this end, 352 strains of ampicillin-resistant enterobacteria from clinical samples from the Hospital Civil of Bilbao were evaluated. Their beta-lactamase activity and their capacity to transfer this capacity by conjugation were evaluated. The several types of plasmidic beta-lactamases in the strains that conjugated and in their respective transconjugants were characterized by analytic isoelectric approach, and also the sensitivity of these stains to 20 beta-lactamic antibiotics and the size of their plasmids. Twenty different types were detected, with a clear predominance of TEM 1. Type TEM 2 was found in 19% of the strains which conjugated, and much less commonly the types SHV 1, HMS 1 and a beta-lactamase of an approximate pl of 4.9 were found. The transfer of these beta-lactamases is mediated by a great variety of plasmids and is associated with variable levels of resistance to penicillins and unstable cephalosporins. The presence of betalactamases with activity on the more stable cephalosporins has not been detected. PMID:2490696

  5. Antimicrobial susceptibilities and beta-lactamase characterization of Capnocytophaga species.

    PubMed Central

    Roscoe, D L; Zemcov, S J; Thornber, D; Wise, R; Clarke, A M

    1992-01-01

    Capnocytophaga species have been associated with a wide variety of infections in both immunocompetent and immunocompromised patients. On the basis of data from antimicrobial susceptibility studies, beta-lactam antibiotics have been considered efficacious therapy. Six of 19 isolates from primarily clinical sources across Canada demonstrated beta-lactamase production, and agar dilution susceptibility testing showed broad resistance to beta-lactam antibiotics. For the beta-lactamase producing isolates, clavulanate reduced the MIC of amoxicillin for 90% of the strains tested by 64-fold. Isolates were highly susceptible to clindamycin, imipenem, and ciprofloxacin. Characterization of the beta-lactamases produced by two of these isolates (Van1 and Van2) was performed. Isoelectric focusing revealed an identical isoelectric point of 5.6 for both enzymes, but they had markedly different relative hydrolysis efficiencies, and different conditions were required to extract the enzymes. This study demonstrates the production of different types of beta-lactamases by Capnocytophaga spp. and suggests the need to screen all clinical isolates of Capnocytophaga spp. for the presence of beta-lactamases. PMID:1444299

  6. [Screening methods for detection of metallo-beta-lactamase producing gram negative rods].

    PubMed

    Mereuţă, Ana-Irina; Poiati, Antonia; Tuchiluş, Cristina; Dorneanu, Olivia; Nistor, Silvia; Copăcianu, Brînduşa

    2005-01-01

    Modified Hodge test and a method using a disk with imipenem plus 1000 mg of EDTA were used to determine the presence of metallo-beta-lactamase producing gram-negative rods among 166 clinical isolates from hospitals in Iaşi and Galaţi. Of 9 imipenem resistant strains found, only one Pseudomonas aeruginosa gave positive results with both tests and other two P. aeruginosa clinical isolates gave negative results with both tests. The rest of the strains (2 P. aeruginosa, 2 Acinetobacter baumanii, 1 Sphingomonas paucimobilis) did not give conclusive results. These screening methods are useful, simple and accessible to clinical laboratories. PCR is needed to confirm the presence of metallo-beta-lactamase gene in bacteria and to determine the type of the enzymes. PMID:16607806

  7. Transcriptional induction of Streptomyces cacaoi beta-lactamase by a beta-lactam compound.

    PubMed

    Forsman, M; Lindgren, L; Häggström, B; Jaurin, B

    1989-10-01

    The soil bacterium Streptomyces cacaoi produces an extracellular beta-lactamase. The beta-lactamase expression could be induced by the beta-lactam compound 6-amino penicillinoic acid (6-APA). In liquid cultures, a 50-fold increase in beta-lactamase expression was observed within the first three hours after addition of 6-APA. Using the cloned beta-lactamase gene as a probe, it was shown that this increase was mediated at the level of transcriptional initiation. The start point of the induced beta-lactamase transcript was determined, and the nucleotide sequence of the promoter region was analysed. No noticeable homology was found to control regions of inducible beta-lactamase genes of other bacteria. A striking feature was the presence of six direct repeats (ten base pairs each) upstream of the promoter region. Thus, an example of an inducible regulatory gene system in this Gram-positive microorganism is presented. Also, the primary structure of the beta-lactamase was deduced, showing a high degree of homology with class A beta-lactamases. PMID:2559297

  8. An altered zinc-binding site confers resistance to a covalent inactivator of New Delhi metallo-beta-lactamase-1 (NDM-1) discovered by high-throughput screening

    PubMed Central

    Thomas, Pei W.; Spicer, Timothy; Cammarata, Michael; Brodbelt, Jennifer S.; Hodder, Peter; Fast, Walter

    2013-01-01

    Due to the global threat of antibiotic resistance mediated by New Delhi metallo-beta-lactamase-1 (NDM-1) and the lack of structurally diverse inhibitors reported for this enzyme, we developed screening and counter-screening assays for manual and automated formats. The manual assay is a trans-well absorbance-based endpoint assay in 96-well plates and has a Z’ factor of 0.8. The automated assay is an epi-absorbance endpoint assay in 384-well plates, has a Z’ factor of ≥ 0.8, good signal / baseline ratios (> 3.8), and is likely scalable for high-throughput screening (HTS). A TEM-1-based counter-screen is also presented to eliminate false positives due to assay interference or off-target activities. A pilot screen of a pharmacologically characterized compound library identified two thiol-modifying compounds as authentic NDM-1 inhibitors: p-hloromecuribenzoate (p-CMB) and nitroprusside. Recombinant NDM-1 has one Cys residue that serves as a conserved active-site primary zinc ligand and is selectively modified by p-CMB as confirmed by LC-MS/MS. However a C208D mutation results in an enzyme that maintains almost full lactamase activity, yet is completely resistant to the inhibitor. These results predict that covalent targeting of the conserved active-site Cys residue may have drawbacks as a drug design strategy. PMID:23591260

  9. Suspected nosocomial infections with multi-drug resistant E. coli, including extended-spectrum beta-lactamase (ESBL)-producing strains, in an equine clinic.

    PubMed

    Walther, Birgit; Lübke-Becker, Antina; Stamm, Ivonne; Gehlen, Heidrun; Barton, Ann Kristin; Janssen, Traute; Wieler, Lothar H; Guenther, Sebastian

    2014-01-01

    Enterobacteriaceae such as Escherichia coli are common commensals as well as opportunistic and obligate pathogens. They cause a broad spectrum of infectious diseases in various hosts, including hospital-associated infections. In recent years, the rise of extended spectrum beta-lactamase (ESBL)-producing E. coli in companion animals (dogs, cats and horses) has been striking. However, reports on nosocomial infections are mostly anecdotic. Here we report on the suspected nosocomial spread of both ESBL-producing and non-ESBL-producing multi-drug resistant E. coli isolates in three equine patients within an equine clinic. Unlike easy-to-clean hospitalization opportunities available for small animal settings like boxes and cages made of ceramic floor tiles or stainless steel, clinical settings for horses are challenging environments for infection control programs due to unavoidable extraneous material including at least hay and materials used for horse bedding. The development of practice-orientated recommendations is needed to improve the possibilities for infection control to prevent nosocomial infections with multi-drug resistant and other transmissible pathogens in equine clinical settings. PMID:25872251

  10. Identification of a metagenomic gene cluster containing a new class A beta-lactamase and toxin-antitoxin systems

    PubMed Central

    Vercammen, Ken; Garcia-Armisen, Tamara; Goeders, Nathalie; Melderen, Laurence; Bodilis, Josselin; Cornelis, Pierre

    2013-01-01

    Abstract Several reports mention the presence of antibiotic resistance genes in natural and polluted environments, but many studies are based on their detection via polymerase chain reaction (PCR amplification of known genes and not on an activity screening. We constructed a metagenomic fosmid bank from DNA isolated from a polluted river in Brussels, Belgium, the Zenne. A total of 120,000 clones were pooled and plated directly on solid media containing different antibiotics. Several clones were isolated which could grow in the presence of ampicillin. The DNA from several clones was extracted and subjected to restriction analysis and, based on their restriction pattern, two different clones were found. One of the clones was selected for further study as it showed a higher level of resistance to different β-lactams antibiotics (ticarcilline and ceftazidime). To find out which gene is responsible for the resistance, an in vitro transposon mutagenesis was performed and clones having lost the resistance phenotype were analyzed via inverse PCR amplification. Several clones had an insert in a gene encoding a new type of β-lactamase. The amplified fosmid DNA was fully sequenced revealing an insert of 41 kb containing 39 open reading frames (ORFs). Transposon insertions inactivating the resistance to β-lactams were also found in the ORF upstream of the blaA gene, encoding an aminotransferase, suggesting a polar effect on the transcription of the gene downstream. In addition, other genes were found such as histidine biosynthesis genes, which were found to be scattered on the insert, a relA/spoT gene, and genes belonging to type II toxin–antitoxin system. This predicted system was experimentally validated in Escherichia coli using an inducible expression system. PMID:23873667

  11. Identification of a metagenomic gene cluster containing a new class A beta-lactamase and toxin-antitoxin systems.

    PubMed

    Vercammen, Ken; Garcia-Armisen, Tamara; Goeders, Nathalie; Van Melderen, Laurence; Bodilis, Josselin; Cornelis, Pierre

    2013-08-01

    Several reports mention the presence of antibiotic resistance genes in natural and polluted environments, but many studies are based on their detection via polymerase chain reaction (PCR amplification of known genes and not on an activity screening. We constructed a metagenomic fosmid bank from DNA isolated from a polluted river in Brussels, Belgium, the Zenne. A total of 120,000 clones were pooled and plated directly on solid media containing different antibiotics. Several clones were isolated which could grow in the presence of ampicillin. The DNA from several clones was extracted and subjected to restriction analysis and, based on their restriction pattern, two different clones were found. One of the clones was selected for further study as it showed a higher level of resistance to different β-lactams antibiotics (ticarcilline and ceftazidime). To find out which gene is responsible for the resistance, an in vitro transposon mutagenesis was performed and clones having lost the resistance phenotype were analyzed via inverse PCR amplification. Several clones had an insert in a gene encoding a new type of β-lactamase. The amplified fosmid DNA was fully sequenced revealing an insert of 41 kb containing 39 open reading frames (ORFs). Transposon insertions inactivating the resistance to β-lactams were also found in the ORF upstream of the blaA gene, encoding an aminotransferase, suggesting a polar effect on the transcription of the gene downstream. In addition, other genes were found such as histidine biosynthesis genes, which were found to be scattered on the insert, a relA/spoT gene, and genes belonging to type II toxin-antitoxin system. This predicted system was experimentally validated in Escherichia coli using an inducible expression system. PMID:23873667

  12. Validation of the VITEK2 and the Advance Expert System with a collection of Enterobacteriaceae harboring extended spectrum or inhibitor resistant beta-lactamases.

    PubMed

    Cantón, R; Pérez-Vázquez, M; Oliver, A; Coque, T M; Loza, E; Ponz, F; Baquero, F

    2001-01-01

    The susceptibility testing accuracy of the VITEK2 system and the ability of the Advance Expert System (AES) to provide interpretive readings were evaluated against 86 extended spectrum (ESBL) and 6 inhibitor-resistant-TEM (IRT) beta-lactamases producing Enterobacteriaceae clinical isolates. VITEK2 MICs of 12 beta-lactams were compared with those obtained by the standard NCCLS microdilution technique. The overall essential agreement ( +/- 1 log dilution) was 87.8%. Discrepancies were mainly observed with cefepime (30.3% of total number of discrepancies), ceftazidime (21.2%), and cefotaxime (15.1%). MIC discrepancies were slightly higher in CTX-M- (14.4%) than in TEM- (12.5%) or SHV- (11.9%) type ESBL producers and were rare in IRT producers (1.4%). Overall interpretive agreement was 92.5% and minor, major, and very major errors were 5.4%, 1.7%, and 2.1%, respectively. The AES was able to identify an ESBL phenotype in 85 out of 86 isolates (98.8%) and an IRT phenotype in all 6 isolates harboring these enzymes, thus reducing very major errors to 0.9%. The VITEK2 system, in conjunction with the AES software, is a reliable tool for detection of ESBL or IRT producing Enterobacteriaceae isolates. PMID:11687316

  13. Coexistence of Extended Spectrum Beta-Lactamases, AmpC Beta-Lactamases and Metallo-Beta-Lactamases in Acinetobacter baumannii from burns patients: a report from a tertiary care centre of India

    PubMed Central

    Gupta, V.; Garg, R.; Garg, S.; Chander, J.; Attri, A.K.

    2013-01-01

    Summary Multidrug-resistant Acinetobacter baumanii is a major pathogen encountered in pyogenic infections, especially from burns patients in hospital settings. Often there is also coexistence of multiple beta-lactamase enzymes responsible for beta-lactam resistance in a single isolate, which further complicates treatment options. We conducted a study on burn wound pus samples obtained from the burns unit of our hospital. Phenotypic tests were used to determine the Extended Spectrum Beta-Lactamase, AmpC Beta-Lactamase and Metallo-Beta-Lactamase producing status of the isolates. Almost half of the samples from the burn wounds yielded Acinetobacter baumanii as the predominant pathogen (54.05%). Coexistence of the three resistance mechanisms was seen in 25 of the 100 (25%) isolates of Acinetobacter baumanii. This study emphasizes the need for the detection of isolates that produce these enzymes to avoid therapeutic failures and nosocomial outbreaks. PMID:24799848

  14. Coexistence of Extended Spectrum Beta-Lactamases, AmpC Beta-Lactamases and Metallo-Beta-Lactamases in Acinetobacter baumannii from burns patients: a report from a tertiary care centre of India.

    PubMed

    Gupta, V; Garg, R; Garg, S; Chander, J; Attri, A K

    2013-12-31

    Multidrug-resistant Acinetobacter baumanii is a major pathogen encountered in pyogenic infections, especially from burns patients in hospital settings. Often there is also coexistence of multiple beta-lactamase enzymes responsible for beta-lactam resistance in a single isolate, which further complicates treatment options. We conducted a study on burn wound pus samples obtained from the burns unit of our hospital. Phenotypic tests were used to determine the Extended Spectrum Beta-Lactamase, AmpC Beta-Lactamase and Metallo-Beta-Lactamase producing status of the isolates. Almost half of the samples from the burn wounds yielded Acinetobacter baumanii as the predominant pathogen (54.05%). Coexistence of the three resistance mechanisms was seen in 25 of the 100 (25%) isolates of Acinetobacter baumanii. This study emphasizes the need for the detection of isolates that produce these enzymes to avoid therapeutic failures and nosocomial outbreaks. PMID:24799848

  15. Strategic Design of an Effective beta-Lactamase Inhibitor

    SciTech Connect

    Pattanaik, P.; Bethel, C; Hujer, A; Hujer, K; Distler, A; Taracila, M; Anderson, V; Fritsche, T; Jones, R; et. al.

    2009-01-01

    In an effort to devise strategies for overcoming bacterial beta-lactamases, we studied LN-1-255, a 6-alkylidene-2'-substituted penicillin sulfone inhibitor. By possessing a catecholic functionality that resembles a natural bacterial siderophore, LN-1-255 is unique among beta-lactamase inhibitors. LN-1-255 combined with piperacillin was more potent against Escherichia coli DH10B strains bearing bla(SHV) extended-spectrum and inhibitor-resistant beta-lactamases than an equivalent amount of tazobactam and piperacillin. In addition, LN-1-255 significantly enhanced the activity of ceftazidime and cefpirome against extended-spectrum cephalosporin and Sme-1 containing carbapenem-resistant clinical strains. LN-1-255 inhibited SHV-1 and SHV-2 beta-lactamases with nm affinity (K(I) = 110 +/- 10 and 100 +/- 10 nm, respectively). When LN-1-255 inactivated SHV beta-lactamases, a single intermediate was detected by mass spectrometry. The crystal structure of LN-1-255 in complex with SHV-1 was determined at 1.55A resolution. Interestingly, this novel inhibitor forms a bicyclic aromatic intermediate with its carbonyl oxygen pointing out of the oxyanion hole and forming hydrogen bonds with Lys-234 and Ser-130 in the active site. Electron density for the 'tail' of LN-1-255 is less ordered and modeled in two conformations. Both conformations have the LN-1-255 carboxyl group interacting with Arg-244, yet the remaining tails of the two conformations diverge. The observed presence of the bicyclic aromatic intermediate with its carbonyl oxygen positioned outside of the oxyanion hole provides a rationale for the stability of this inhibitory intermediate. The 2'-substituted penicillin sulfone, LN-1-255, is proving to be an important lead compound for novel beta-lactamase inhibitor design.

  16. Antimicrobial susceptibility patterns, beta-lactamases, and biochemical identification of Yokenella regensburgei strains.

    PubMed

    Stock, Ingo; Sherwood, Kimberley J; Wiedemann, Bernd

    2004-01-01

    Yokenella regensburgei is an opportunistic human pathogen that phenotypically resembles Hafnia alvei. The susceptibility of 10 Y. regensburgei strains to 75 antimicrobial agents was examined, applying a microdilution procedure in cation-adjusted Mueller-Hinton broth (CAMHB) and IsoSensitest broth (ISB). beta-Lactamases were characterized phenotypically with beta-lactamase activity and induction assays. Genotypically, PCR experiments applying degenerated primer pairs for the detection of AmpC beta-lactamase genes were performed. Examining the phenotypic properties of Yokenella and 76 H. alvei strains with commercial identification systems and conventional tests, a database for an accurate biochemical separation of Y. regensburgei from H. alvei was established. In CAMHB, all tested yokenellae were resistant or at least of intermediate susceptibility to penicillin G, oxacillin, amoxicillin, amoxicillin-clavulanate, cefaclor, cefazoline, loracarbef, cefoxitin, all tested macrolides, lincosamides, streptogramins, ketolides, fusidic acid, glycopeptides, linezolid, and rifampicin. All Yokenella strains were sensitive to several beta-lactams, all tested aminoglycosides, chloramphenicol, folate-pathway inhibitors, fosfomycin, nitrofurantion, quinolones, and tetracyclines. In ISB, the minimum inhibitory concentration (MIC) values of several beta-lactams were one to four MIC doubling dilution steps lower than those found in CAMHB (depending on the beta-lactam). All yokenellae yielded specific amplification products for ampC, and all of these strains expressed beta-lactamases that were strongly inducible. Hydroxyproline amidase, maltosidase, tri-peptidase, proline deaminase, catalase reaction, Voges-Proskauer test, and fermentation of glycerol, melibiose and myo-inositol were suitable parameters to separate Y. regensburgei from H. alvei. PMID:14761716

  17. [Identification of SHV-type extended spectrum beta-lactamase genes in Pseudomonas aeruginosa by PCR-restriction fragment length polymorphism and insertion site restriction-PCR].

    PubMed

    Kalai Blagui, S; Achour, W; Abdeladhim, A; Ben Hassen, A

    2009-07-01

    We propose a simple and rapid method to discriminate SHV-type extended spectrum beta-lactamase (ESBL) genes in P. aeruginosa based on PCR techniques (PCR-RFLP and RSI-PCR). We studied 22 producing ESBL P. aeruginosa strains isolated from seven immunocompromised patients (19 isolates) and from environmental swabs (three isolates) at the Bone Marrow Transplantation Center of Tunis. Screening PCR with primer pairs designed to detect gene encoding TEM, SHV, OXA group I, OXA group II, OXA-18 and PER-1 ESBL was positive for bla(OXA18) and bla(SHV) genes in all isolates. Pulsed field gel electrophoresis using SpeI endonuclease defined five genotypic groups. For at least one isolate corresponding to each genotype observed, restriction of PCR products by DdeI and BsrI revealed the same restriction pattern that the bla(SHV-1) negative control; in the same way, RSI-PCR products digestion by NruI, thus excluding 35, 238 and 240 mutations characterizing reported ESBL in P. aeruginosa (SHV-2a, SHV5 et SHV12), and suggesting that studied bla(SHV) genes were not ESBL ones. Genomic DNA hybridization by southern blot with probe consisting in bla(SHV-1) gene was positive in these isolates. Sequencing the full-length open reading frame revealed nucleotide sequence of the bla(SHV-1). PCR-RFLP and RSI-PCR results were then confirmed. This approach is effective for screening P. aeruginosa for ESBL genes carriage in epidemiological studies and for detecting new variants. PMID:18838231

  18. Use of microdilution panels with and without beta-lactamase inhibitors as a phenotypic test for beta-lactamase production among Escherichia coli, Klebsiella spp., Enterobacter spp., Citrobacter freundii, and Serratia marcescens.

    PubMed

    Thomson, K S; Sanders, C C; Moland, E S

    1999-06-01

    Over the past decade, a number of new beta-lactamases have appeared in clinical isolates of Enterobacteriaceae that, unlike their predecessors, do not confer beta-lactam resistance that is readily detected in routine antibiotic susceptibility tests. Because optimal methodologies are needed to detect these important new beta-lactamases, a study was designed to evaluate the ability of a panel of various beta-lactam antibiotics tested alone and in combination with beta-lactamase inhibitors to discriminate between the production of extended-spectrum beta-lactamases, AmpC beta-lactamases, high levels of K1 beta-lactamase, and other beta-lactamases in 141 isolates of Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Enterobacter aerogenes, Citrobacter freundii, and Serratia marcescens possessing well-characterized beta-lactamases. The microdilution panels studied contained aztreonam, cefpodoxime, ceftazidime, cefotaxime, and ceftriaxone, with and without 1, 2, and 4 microg of clavulanate per ml or 8 microg of sulbactam per ml and cefoxitin and cefotetan with and without 8 microg of sulbactam per ml. The results indicated that a minimum panel of five tests would provide maximum separation of extended-spectrum beta-lactamase high AmpC, high K1, and other beta-lactamase production in Enterobacteriaceae. These included cefpodoxime, cefpodoxime plus 4 microg of clavulanate per ml, ceftazidime, ceftriaxone, and ceftriaxone plus 8 microg of sulbactam per ml. Ceftriaxone plus 2 microg of clavulanate per ml could be substituted for cefpodoxime plus 4 microg of clavulanate per ml without altering the accuracy of the tests. This study indicated that tests with key beta-lactam drugs, alone and in combination with beta-lactamase inhibitors, could provide a convenient approach to the detection of a variety of beta-lactamases in members of the family Enterobacteriaceae. PMID:10348759

  19. Molecular and biochemical characterization of the chromosome-encoded class A beta-lactamase BCL-1 from Bacillus clausii.

    PubMed

    Girlich, Delphine; Leclercq, Roland; Naas, Thierry; Nordmann, Patrice

    2007-11-01

    A chromosomal beta-lactamase gene from Bacillus clausii NR, which is used as a probiotic, was cloned and expressed in Escherichia coli. It encodes a clavulanic acid-susceptible Ambler class A beta-lactamase, BCL-1, with a pI of 5.5 and a molecular mass of ca. 32 kDa. It shares 91% and 62% amino acid identity with the chromosomally encoded PenP penicillinases from B. clausii KSM-K16 and Bacillus licheniformis, respectively. The hydrolytic profile of this beta-lactamase includes penicillins, narrow-spectrum cephalosporins, and cefpirome. This chromosome-encoded enzyme was inducible in B. clausii, and its gene is likely related to upstream-located regulatory genes that share significant identity with those reported to be upstream of the penicillinase gene of B. licheniformis. The bla(BCL-1) gene was located next to the known chromosomal aadD2 gene and the erm34 gene, which encode resistance to aminoglycosides and macrolides, respectively. Similar genes were found in a collection of B. clausii reference strains. PMID:17846134

  20. Characterization of extended-spectrum beta-lactamases and antimicrobial resistance of Klebsiella pneumoniae in intra-abdominal infection isolates in Latin America, 2008-2012. Results of the Study for Monitoring Antimicrobial Resistance Trends.

    PubMed

    Kazmierczak, Krystyna M; Lob, Sibylle H; Hoban, Daryl J; Hackel, Meredith A; Badal, Robert E; Bouchillon, Samuel K

    2015-07-01

    The Study for Monitoring Antimicrobial Resistance Trends has monitored the in vitro activity of several recommended antimicrobials used in the management of intra-abdominal infections (IAIs) globally since 2002. In this report, we document the changing susceptibility patterns to recommended antimicrobials in Klebsiella pneumoniae isolates from patients with IAIs in 11 Latin American countries between 2008 and 2012 and describe the beta-lactamases encoded by phenotypically extended-spectrum beta-lactamase (ESBL)-positive and ertapenem-nonsusceptible isolates. Overall, the incidence of phenotypically ESBL-positive K. pneumoniae did not change significantly from 2008 (40.4%) to 2012 (41.2%) (P > 0.05). However, trend analysis documented an increase in isolates encoding K. pneumoniae carbapenemase (KPC) or both KPC and an ESBL. Decreasing susceptibility (P < 0.05) was noted for cefepime, ceftazidime, ceftriaxone, ertapenem, and imipenem among all K. pneumoniae, as well as for cefepime, cefotaxime, cefoxitin, ceftriaxone, ertapenem, and imipenem among ESBL-positive isolates, while susceptibility of ESBL-negative isolates to ampicillin-sulbactam actually increased (P < 0.05). PMID:25956930

  1. Cloning and sequence analysis of a class A beta-lactamase from Mycobacterium tuberculosis H37Ra.

    PubMed Central

    Hackbarth, C J; Unsal, I; Chambers, H F

    1997-01-01

    A cosmid library from Mycobacterium tuberculosis H37Ra was introduced into Mycobacterium smegmatis, and eight recombinant clones with increased resistance to cefoxitin were identified. Isoelectric focusing detected an M. tuberculosis-derived beta-lactamase in one of these recombinant clones. A sequence analysis identified it as a class A beta-lactamase whose expression correlated with the increased resistance phenotype. PMID:9145897

  2. Beta-lactamase inhibitors from laboratory to clinic.

    PubMed Central

    Bush, K

    1988-01-01

    beta-Lactamases constitute the major defense mechanism of pathogenic bacteria against beta-lactam antibiotics. When the beta-lactam ring of this antibiotic class is hydrolyzed, antimicrobial activity is destroyed. Although beta-lactamases have been identified with clinical failures for over 40 years, enzymes with various abilities to hydrolyze specific penicillins or cephalosporins are appearing more frequently in clinical isolates. One approach to counteracting this resistance mechanism has been through the development of beta-lactamase inactivators. beta-Lactamase inhibitors include clavulanic acid and sulbactam, molecules with minimal antibiotic activity. However, when combined with safe and efficacious penicillins or cephalosporins, these inhibitors can serve to protect the familiar beta-lactam antibiotics from hydrolysis by penicillinases or broad-spectrum beta-lactamases. Both of these molecules eventually inactivate the target enzymes permanently. Although clavulanic acid exhibits more potent inhibitory activity than sulbactam, especially against the TEM-type broad-spectrum beta-lactamases, the spectrum of inhibitory activities are very similar. Neither of these inhibitors acts as a good inhibitor of the cephalosporinases. Clavulanic acid has been most frequently combined with amoxicillin in the orally active Augmentin and with ticarcillin in the parenteral beta-lactam combination Timentin. Sulbactam has been used primarily to protect ampicillin from enzymatic hydrolysis. Sulbactam has been used either in the orally absorbed prodrug form as sultamicillin or as the injectable combination ampicillin-sulbactam. Synergy has been demonstrated for these combinations for most members of the Enterobacteriaceae, although those organisms that produce cephalosporinases are not well inhibited. Synergy has also been observed for Neisseria gonorrhoeae, Haemophilus influenzae, penicillinase-producing Staphylococcus aureus, and anaerobic organisms. These antibiotic

  3. Antimicrobial resistance among producers and non-producers of extended spectrum beta-lactamases in urinary isolates at a tertiary Hospital in Tanzania

    PubMed Central

    2010-01-01

    Background Published data on the existence and magnitude of extended spectrum beta-lactamase (ESBL) production in urinary pathogens in local setting is limited. The aim of the present study was to determine the prevalence of antimicrobial resistance and ESBL production among Escherichia coli and Klebsiella spp from urine samples in a tertiary hospital. This was a cross sectional study conducted at Muhimbili National Hospital in Dar es Salaam, Tanzania. Findings A total of 270 E.coli and Klebsiella spp urinary pathogens from children and adults isolated from January to March 2010 were included in the study. E. coli and Klebsiella spp isolates were tested for antimicrobial susceptibility by the Clinical and Laboratory Standard Institute's disc diffusion method. These isolates were further screened for ESBL phenotype using cefotaxime and ceftazidime discs. Isolates with reduced sensitivity were confirmed using ESBL E-test strips. Of 270 isolates, 138 (51.1%) were E. coli and 132 (48.9%) were Klebsiella spp. ESBL was detected in 122 (45.2%) of all the isolates. ESBL- producing E. coli strains were significantly more resistance to cotrimoxazole (90.7%), ciprofloxacin (46.3%) and nalidixic acid (61.6%) than strains that did not produce ESBL (p < 0.05). Similarly, ESBL- producing Klebsiella spp strains were significantly more resistance to cotrimoxazole (92.6%), ciprofloxacin (25.0%), nalidixic acid (66.2%), and gentamicin (38.2%) than strains that did not produce ESBL (P < 0.05). Multi-drug resistance was found to be significantly (P < 0.05) more in ESBL producing isolates (90.5%) than non ESBL producers (68.9%). The occurrence of ESBL was significantly higher among isolates from inpatients than outpatients [95 (50.5%) vs. 27(32.9%)] (p = 0.008). The occurrence of ESBL was significantly higher among isolates from children than in adults [84 (54.9%) vs. 38(32.5%)] (p < 0.001). Conclusions High prevalence of ESBL-producing E. coli and Klebsiella spp strains was found among

  4. Crystallographic Studies of Two Bacterial AntibioticResistance Enzymes: Aminoglycoside Phosphotransferase (2')-Ic and GES-1\\beta-lactamase

    SciTech Connect

    Brynes, Laura; /Rensselaer Poly.

    2007-10-31

    Guiana Extended-Spectrum-1 (GES-1) and Aminoglycoside phosphotransferase (2')-Ic (APH(2')-Ic) are two bacteria-produced enzymes that essentially perform the same task: they provide resistance to an array of antibiotics. Both enzymes are part of a growing resistance problem in the medical world. In order to overcome the ever-growing arsenal of antibiotic-resistance enzymes, it is necessary to understand the molecular basis of their action. Accurate structures of these proteins have become an invaluable tool to do this. Using protein crystallography techniques and X-ray diffraction, the protein structure of GES-1 bound to imipenem (an inhibitor) has been solved. Also, APH(2')-Ic has been successfully crystallized, but its structure was unable to be solved using molecular replacement using APH(2')-Ib as a search model. The structure of GES-1, with bound imipenem was solved to a resolution of 1.89A, and though the inhibitor is bound with only moderate occupancy, the structure shows crucial interactions inside the active site that render the enzyme unable to complete the hydrolysis of the {beta}-lactam ring. The APH(2')-Ic dataset could not be matched to the model, APH(2')-Ib, with which it shares 25% sequence identity. The structural information gained from GES-1, and future studies using isomorphous replacement to solve the APH(2')-Ic structure can aid directly to the creation of novel drugs to combat both of these classes of resistance enzymes.

  5. Multidrug-Resistant and Extended Spectrum Beta-Lactamase-Producing Escherichia coli in Dutch Surface Water and Wastewater

    PubMed Central

    Blaak, Hetty; Lynch, Gretta; Italiaander, Ronald; Hamidjaja, Raditijo A.; Schets, Franciska M.; de Roda Husman, Ana Maria

    2015-01-01

    Objective The goal of the current study was to gain insight into the prevalence and concentrations of antimicrobial resistant (AMR) Escherichia coli in Dutch surface water, and to explore the role of wastewater as AMR contamination source. Methods The prevalence of AMR E. coli was determined in 113 surface water samples obtained from 30 different water bodies, and in 33 wastewater samples obtained at five health care institutions (HCIs), seven municipal wastewater treatment plants (mWWTPs), and an airport WWTP. Overall, 846 surface water and 313 wastewater E. coli isolates were analysed with respect to susceptibility to eight antimicrobials (representing seven different classes): ampicillin, cefotaxime, tetracycline, ciprofloxacin, streptomycin, sulfamethoxazole, trimethoprim, and chloramphenicol. Results Among surface water isolates, 26% were resistant to at least one class of antimicrobials, and 11% were multidrug-resistant (MDR). In wastewater, the proportions of AMR/MDR E. coli were 76%/62% at HCIs, 69%/19% at the airport WWTP, and 37%/27% and 31%/20% in mWWTP influents and effluents, respectively. Median concentrations of MDR E. coli were 2.2×102, 4.0×104, 1.8×107, and 4.1×107 cfu/l in surface water, WWTP effluents, WWTP influents and HCI wastewater, respectively. The different resistance types occurred with similar frequencies among E. coli from surface water and E. coli from municipal wastewater. By contrast, among E. coli from HCI wastewater, resistance to cefotaxime and resistance to ciprofloxacin were significantly overrepresented compared to E. coli from municipal wastewater and surface water. Most cefotaxime-resistant E. coliisolates produced ESBL. In two of the mWWTP, ESBL-producing variants were detected that were identical with respect to phylogenetic group, sequence type, AMR-profile, and ESBL-genotype to variants from HCI wastewater discharged onto the same sewer and sampled on the same day (A1/ST23/CTX-M-1, B23/ST131/CTX-M-15, D2/ST405/CTX

  6. Antimicrobial resistance status and prevalence rates of extended spectrum beta-lactamase producers isolated from a mixed human population

    PubMed Central

    Afunwa, Ruth A.; Odimegwu, Damian C.; Iroha, Romanus I.; Esimone, Charles O.

    2011-01-01

    Owing to the increasing epidemiological and therapeutic challenges associated with infections due to ESBL producers, ESBL prevalence rate among some bacteria isolates from healthy and non-healthy human population in a metropolitan Nigerian setting was evaluated. A total of one hundred and forty-five (145) bacteria strains were isolated from a total of four hundred and sixty (460) samples collected from urine, wound, throat and anal swabs of 220 healthy volunteers in the community and from 240 patients in 2 secondary and 2 tertiary hospitals (altogether, 4) in Enugu metropolis. The presumptive confirmatory test used for ESBL detection was the Double Disc Synergy Test (DDST) method. Conjugation and plasmid curing studies were also done for resistance factor determination. Of the 145 isolates, 20 were ESBL producers with 35% of these ESBL producers being of community origin and 65% from hospitals. This translates to 4.8% and 9% incidences (comparably higher than established prevalence of 4.4% and 7.5 respectively) for community and hospital infections respectively. The ESBL isolates showed high resistance to tetracycline, gentamicin, pefloxacin, ceftriaxone, cefuroxime, ciprofloxacin and Augmentin® (Amoxicilin and clavulanic acid combination). Conjugation studies for Resistance plasmid transfer showed non-transference of resistance determinants between the ESBL transconjugants and recipient strains. Correspondingly, the plasmid curing studies revealed that the acridine orange could not effect a cure on the isolates as they still retained high resistance to the antibiotics after the treatment. This study confirms the growing incidences/pool of ESBL strains in Nigeria and call for widespread and continuous monitoring towards an effective management of the potential therapeutic hurdle posed by this trend. PMID:21619555

  7. Beta-Lactamase Producing Escherichia coli Isolates in Imported and Locally Produced Chicken Meat from Ghana

    PubMed Central

    Rasmussen, Mette Marie; Opintan, Japheth A.; Frimodt-Møller, Niels; Styrishave, Bjarne

    2015-01-01

    The use of antibiotics in food animals is of public health concern, because resistant zoonotic pathogens can be transmitted to humans. Furthermore, global trade with food may rapidly spread multi-resistant pathogens between countries and even continents. The purpose of the study was to investigate whether imported chicken meat and meat from locally reared chicken are potential sources for human exposure to multi resistant Escherichia coli isolates. 188 samples from imported and locally produced chicken meat were sampled and analyzed. 153 bacteria isolates were successfully cultured and identified as E. coli using MALDI-ToF. Of these 109 isolates were from meat whereas the remaining 44 were isolated from the cloaca of locally reared live chickens. Antimicrobial susceptibility test was done on the identified E. coli isolates. Additionally, beta-lactamases production (ESBL and/or AmpC) were phenotypically confirmed on all isolates showing resistance to cefpodoxime. Beta-lactamase producing (BLP) E. coli meat isolates were further genotyped. Antimicrobial resistance to four antibiotic markers with highest resistance was detected more frequently in isolates from local chickens compared to imported chickens (tetracycline 88.9% vs. 57.5%, sulphonamide 75.0% vs. 46.6%, ampicillin 69.4% vs. 61.6% and trimethoprim 66.7% vs. 38.4%). Beta-lactamase production was found in 29 E. coli meat isolates, with 56.9% of them being multiple drug resistant (≥ 3). The predominant phylogroup identified was B1 followed by A and D, with similar distribution among the isolates from meat of locally reared chickens and imported chickens. Beta-lactamase producing genotype blaCTX-M-15 (50%; 10/20) was the most frequently drug resistant gene detected. More BLP E. coli isolates were found in imported chicken meat compared to locally reared chickens, demonstrating that these isolates may be spreading through food trade. In conclusion, both imported and locally produced chicken meats are potential

  8. Heat resistance in extended-spectrum beta-lactamase-producing Escherichia coli may favor environmental survival in a hospital setting.

    PubMed

    Boll, Erik J; Frimodt-Møller, Jakob; Olesen, Bente; Krogfelt, Karen A; Struve, Carsten

    2016-06-01

    Nosocomial infections caused by extended-spectrum β-lactamase (ESBL)-producing Escherichia coli are a major concern worldwide. There is an urgent need to identify bacterial factors promoting survival and persistence of these organisms in the nosocomial environment. Here, we describe the presence of a gene cluster, containing the Clp ATPase ClpK, within a collection of Danish ESBL-producing E. coli isolates. The cluster conferred thermoprotection upon the isolates, and thus might facilitate survival on medical devices exposed to semi-high temperatures in a hospital setting. PMID:26946311

  9. Beta-lactamase Escherichia coli and Staphylococcus aureus isolated from chickens in Nigeria.

    PubMed

    Mamza, Sunday Akidarju; Egwu, Godwin Onyemaechi; Mshelia, Gideon Dauda

    2010-01-01

    The occurrence of beta-lactamase-producing Escherichia coli and Staphylococcus aureus in chickens was investigated. Specimens (n = 1,300) were collected from 400 chickens and were streaked on MacConkey agar plates. From each plate, presumptive growths of organisms were picked and streaked on eosin methylene blue and Baird-Parker agars, respectively. Typical colonies of E. coli and S. aureus with similar morphologies were identified by biochemical tests. Isolates were tested for beta-lactamase production and antimicrobial susceptibilities. Results indicated that 805 E. coli isolates from which 89 (11%) were beta-lactamase-positive and 660 S. aureus from which 58 (8.8%) were beta-lactamase-positive. Both isolates showed a high level of resistance to all twelve antibiotics screened. The increased prevalence of antibiotic resistance amongst bacterial organisms is undoubtedly correlated with the discovery and characterisation of multiple, transferrable resistance determinants, such as beta-lactamases, corresponding to their respective phenotypes. The implications of this for humans when handling and/or consuming chickens and chicken products contaminated with strains of such isolates, is a risk of transferrable multi-drug resistance and a failure of treatment. The results of our study indicated that beta-lactamase-producing E. coli and S. aureus are prevalent in chickens in Nigeria. PMID:20560125

  10. Non-inducible, mainly cell-associated beta-lactamase from Nocardia asteroides strain 108.

    PubMed

    Scopetti, F; Fattorini, L; Franceschini, N; Amicosante, G; Orefici, G

    1997-07-01

    The beta-lactamase of the soil-borne strain 108 (parental strain) of Nocardia asteroides is a non-inducible enzyme mainly associated with the cells; it can be efficiently extracted by ultrasonication and SDS treatment. Crude enzyme preparations showed penicillinase and cephalosporinase activity. The kinetics of beta-lactamase production and in-vitro susceptibility to combinations of beta-lactam antibiotics plus beta-lactamase inhibitors have been studied in two stable overproducer mutants (A14 and B1) obtained by mutagenization of the parental strain with nitrosoguanidine. The cell-associated enzyme increased with bacterial growth in parental and mutant strains and was particularly abundant in stationary phase cells. The beta-lactamase inhibitors sulbactam and clavulanic acid decreased MIC values of penicillins more efficiently in the parental strain than in mutants, thus indicating some involvement of the enzyme in the resistance of N. asteroides strain 108 to beta-lactam antibiotics. PMID:9249198

  11. Characterization of SFO-1, a plasmid-mediated inducible class A beta-lactamase from Enterobacter cloacae.

    PubMed

    Matsumoto, Y; Inoue, M

    1999-02-01

    Enterobacter cloacae 8009 produced an inducible class A beta-lactamase which hydrolyzed cefotaxime efficiently. It also hydrolyzed other beta-lactams except cephamycins and carbapenems. The activity was inhibited by clavulanic acid and imipenem. The bla gene was transferable to Escherichia coli by electroporation of plasmid DNA. The molecular mass of the beta-lactamase was 29 kDa and its pI was 7.3. All of these phenotypic characteristics of the enzyme except for inducible production resemble those of some extended-spectrum class A beta-lactamases like FEC-1. The gene encoding this beta-lactamase was cloned and sequenced. The deduced amino acid sequence of the beta-lactamase was homologous to the AmpA sequences of the Serratia fonticola chromosomal enzyme (96%), MEN-1 (78%), Klebsiella oxytoca chromosomal enzymes (77%), TOHO-1 (75%), and FEC-1 (72%). The conserved sequences of class A beta-lactamases, including the S-X(T)-X(S)-K motif, in the active site were all conserved in this enzyme. On the basis of the high degree of homology to the beta-lactamase of S. fonticola, the enzyme was named SFO-1. The ampR gene was located upstream of the ampA gene, and the AmpR sequence of SFO-1 had homology with the AmpR sequences of the chromosomal beta-lactamases from Citrobacter diversus (80%), Proteus vulgaris (68%), and Pseudomonas aeruginosa (60%). SFO-1 was also inducible in E. coli. However, a transformant harboring plasmid without intact ampR produced a small amount of beta-lactamase constitutively, suggesting that AmpR works as an activator of ampA of SFO-1. This is the first report from Japan describing an inducible plasmid-mediated class A beta-lactamase in gram-negative bacteria. PMID:9925524

  12. Beta-lactamase targeted enzyme activatable photosensitizers for antimicrobial PDT

    NASA Astrophysics Data System (ADS)

    Zheng, Xiang; Verma, Sarika; Sallum, Ulysses W.; Hasan, Tayyaba

    2009-06-01

    Photodynamic therapy (PDT) as a treatment modality for infectious disease has shown promise. However, most of the antimicrobial photosensitizers (PS) non-preferentially accumulate in both bacteria and host tissues, causing host tissue phototoxicity during treatment. We have developed a new antimicrobial PDT strategy which exploits beta-lactam resistance mechanism, one of the major drug-resistance bacteria evolved, to achieve enhanced target specificity with limited host damage. Our strategy comprises a prodrug construct with a PS and a quencher linked by beta-lactam ring, resulting in a diminished phototoxicity. This construct, beta-lactamase enzyme-activated-photosensitizer (beta-LEAP), can only be activated in the presence of both light and bacteria, and remains inactive elsewhere such as mammalian tissue. Beta-LEAP construct had shown specific cleavage by purified beta-lactamase and by beta-lactamase over-expressing methicillin resistant Staphylococcus aureus (MRSA). Specific photodynamic toxicity was observed towards MRSA, while dark and light toxicity were equivalent to reference strains. The prodrug design, synthesis and photophysical properties will be discussed.

  13. Detection of Resistance to Beta-Lactamase Inhibitors in Strains with CTX-M Beta-Lactamases: a Multicenter External Proficiency Study Using a Well-Defined Collection of Escherichia coli Strains

    PubMed Central

    Ripoll, Aida; Rodríguez, Cristina; Tormo, Nuria; Gimeno, Concepción; Baquero, Fernando; Martínez-Martínez, Luis; Cantón, Rafael

    2014-01-01

    Under the auspices of the Spanish Society for Infectious Diseases and Clinical Microbiology Quality Control program, 14 Escherichia coli strains masked as blood culture isolates were sent to 68 clinical microbiology laboratories for antimicrobial susceptibility testing to β-lactam antibiotics. This collection included three control strains (E. coli ATCC 25922, an IRT-2 producer, and a CMY-2 producer), six isogenic strains with or without the OmpF porin and expressing CTX-M β-lactamases (CTX-M-1, CTX-M-15, and CTX-M-14), one strain carrying a double mechanism for β-lactam resistance (i.e., carrying CTX-M-15 and OXA-1 enzymes), and four strains carrying CTX-M variants with different levels of resistance to β-lactams and β-lactam–β-lactamase inhibitor (BLBLI) combinations. The main objective of the study was to ascertain how these variants with reduced susceptibilities to BLBLIs are identified in clinical microbiology laboratories. CTX-M variants with high resistance to BLBLIs were mainly identified as inhibitor-resistant TEM (IRT) enzymes (68.0%); however, isogenic CTX-M mutant strains with reduced susceptibilities to BLBLIs and cephalosporins were mainly associated with extended-spectrum β-lactamase production alone (51 to 80%) or in combination with other mechanisms (14 to 31%). Concerning all β-lactams tested, the overall interpretative discrepancy rate was 11.5%, of which 38.1% were the consequence of postreading changes in the clinical categories when a resistance mechanism was inferred. Therefore, failure to recognize these complex phenotypes might contribute to an explanation of their apparent absence in the clinical setting and might lead to inadequate drug treatment selection. A proposal for improving recognition is to adhere strictly to the current CLSI or EUCAST guidelines for detecting reduced susceptibility to BLBLI combinations, without any interpretative modification. PMID:24153133

  14. Purification and biochemical characterization of the VIM-1 metallo-beta-lactamase.

    PubMed

    Franceschini, N; Caravelli, B; Docquier, J D; Galleni, M; Frère, J M; Amicosante, G; Rossolini, G M

    2000-11-01

    VIM-1 is a new group 3 metallo-beta-lactamase recently detected in carbapenem-resistant nosocomial isolates of Pseudomonas aeruginosa from the Mediterranean area. In this work, VIM-1 was purified from an Escherichia coli strain carrying the cloned bla(VIM-1) gene by means of an anion-exchange chromatography step followed by a gel permeation chromatography step. The purified enzyme exhibited a molecular mass of 26 kDa in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and an acidic pI of 5.1 in analytical isoelectric focusing. Amino-terminal sequencing showed that mature VIM-1 results from the removal of a 26-amino-acid signal peptide from the precursor. VIM-1 hydrolyzes a broad array of beta-lactam compounds, including penicillins, narrow- to expanded-spectrum cephalosporins, carbapenems, and mechanism-based serine-beta-lactamase inactivators. Only monobactams escape hydrolysis. The highest catalytic constant/K(m) ratios (>10(6) M(-1). s(-1)) were observed with carbenicillin, azlocillin, some cephalosporins (cephaloridine, cephalothin, cefuroxime, cefepime, and cefpirome), imipenem, and biapenem. Kinetic parameters showed remarkable variability with different beta-lactams and also within the various penam, cephem, and carbapenem compounds, resulting in no clear preference of the enzyme for any of these beta-lactam subfamilies. Significant differences were observed with some substrates between the kinetic parameters of VIM-1 and those of other metallo-beta-lactamases. Inactivation assays carried out with various chelating agents (EDTA, 1,10-o-phenanthroline, and pyridine-2,6-dicarboxylic acid) indicated that formation of a ternary enzyme-metal-chelator complex precedes metal removal from the zinc center of the protein and revealed notable differences in the inactivation parameters of VIM-1 with different agents. PMID:11036013

  15. Reduced susceptibility to chlorhexidine disinfectant among New Delhi metallo-beta-lactamase-1 positive Enterobacteriaceae and other multidrug-resistant organisms: Report from a tertiary care hospital in Karachi, Pakistan.

    PubMed

    Mal, P B; Farooqi, J; Irfan, S; Hughes, M A; Khan, E

    2016-01-01

    We analysed susceptibility of multidrug-resistant organisms (MDROs) including New Delhi metallo-beta-lactamase-1 positive Enterobacteriaceae to chlorhexidine and compared results to their susceptible counterparts. Susceptibilities of chlorhexidine digluconate in a standard (CHX-S) preparation and two commercial disinfectants containing different CHX concentrations (2% w/v and 4% w/w) were performed. MDROs had narrower range of higher CHX-S minimum inhibitory concentrations (MICs) as compared to pan-sensitive organisms. The MIC values for commercial disinfectants products for MDROs were many folds higher (20-600 times), than CHX-S for in vitro use. Increasing antibiotic resistance among bacterial isolates can be an indirect marker of reduced susceptibility to chlorhexidine in hospital setting. PMID:27514958

  16. Detection of SHV-1 beta-lactamase in Pseudomonas aeruginosa strains by genetic methods.

    PubMed

    Kalai Blagui, S; Achour, W; Bejaoui, M; Abdeladhim, A; Ben Hassen, A

    2009-05-01

    Twelve multidrug-resistant Pseudomonas aeruginosa (MDRPA) isolates were recovered over a period of two years in the National Bone Marrow Transplant Centre of Tunisia. MDRPA isolates were isolated from seven patients and from three environmental samples. Isoelectric focusing revealed pIs of 8.2, 5.5 and 7.6 in all MDRPA isolates. These strains produced the OXA-18 extended spectrum beta-lactamase and an SHV type beta-lactamase as shown by screening PCR analysis. DNA hybridization confirmed this inference, detecting bla(SHV) gene in these isolates. Pulsed-field gel electrophoresis (PFGE) defined one predominant genomic group; group A (seven isolates) and four different genotypes containing one to two isolates. Clonally related isolates were recovered from three patients and from two washbasins. Sequencing DNA of cluster representative strains identified the classical bla(SHV-1) gene. For these strains, the nucleotide sequence of the structural bla(SHV-1) gene was nearly identical to those previously described. Such enzyme has not been reported from P. aeruginosa. This is the first report of the SHV-1 penicillinase in epidemic P. aeruginosa strain. PMID:18456431

  17. Characterization of Beta-lactamases in Faecal Enterobacteriaceae Recovered from Healthy Humans in Spain: Focusing on AmpC Polymorphisms.

    PubMed

    Porres-Osante, Nerea; Sáenz, Yolanda; Somalo, Sergio; Torres, Carmen

    2015-07-01

    The intestinal tract is a huge reservoir of Enterobacteriaceae, some of which are opportunist pathogens. Several genera of these bacteria harbour intrinsic antibiotic resistance genes, such as ampC genes in species of Citrobacter, Enterobacter or Escherichia genera. In this work, beta-lactamases and other resistance mechanisms have been characterized in Enterobacteriaceae isolates recovered from healthy human faecal samples, focusing on the ampC beta-lactamase genes. Fifty human faecal samples were obtained, and 70 Enterobacteriaceae bacteria were isolated: 44 Escherichia coli, 4 Citrobacter braakii, 9 Citrobacter freundii, 8 Enterobacter cloacae, 1 Proteus mirabilis, 1 Proteus vulgaris, 1 Klebsiella oxytoca, 1 Serratia sp. and 1 Cronobacter sp. A high percentage of resistance to ampicillin was detected (57%), observing the AmpC phenotype in 22 isolates (31%) and the ESBL phenotype in 3 isolates. AmpC molecular characterization showed high diversity into bla CMY and bla ACT genes from Citrobacter and Enterobacter species, respectively, and the pulsed-field gel electrophoresis (PFGE) analysis demonstrated low clonality among them. The prevalence of people colonized by strains carrying plasmid-mediated ampC genes obtained in this study was 2%. The unique plasmid-mediated bla AmpC identified in this study was the bla CMY-2 gene, detected in an E. coli isolate ascribed to the sequence type ST405 which belonged to phylogenetic group D. The hybridization and conjugation experiments demonstrated that the ISEcp1-bla CMY-2-blc structure was carried by a ~78-kb self-transferable IncK plasmid. This study shows a high polymorphism among beta-lactamase genes in Enterobacteriaceae from healthy people microbiota. Extensive AmpC-carrier studies would provide important information and could allow the anticipation of future global health problems. PMID:25501887

  18. Peptidase activity of beta-lactamases.

    PubMed Central

    Rhazi, N; Galleni, M; Page, M I; Frère, J M

    1999-01-01

    Although beta-lactamases have generally been considered as being devoid of peptidase activity, a low but significant hydrolysis of various N-acylated dipeptides was observed with representatives of each class of beta-lactamases. The kcat/Km values were below 0.1 M(-1). s(-1), but the enzyme rate enhancement factors were in the range 5000-20000 for the best substrates. Not unexpectedly, the best 'peptidase' was the class C beta-lactamase of Enterobacter cloacae P99, but, more surprisingly, the activity was always higher with the phenylacetyl- and benzoyl-d-Ala-d-Ala dipeptides than with the diacetyl- and alpha-acetyl-l-Lys-d-Ala-d-Ala tripeptides, which are the preferred substrates of the low-molecular-mass, soluble dd-peptidases. A comparison between the beta-lactamases and dd-peptidases showed that it might be as difficult for a dd-peptidase to open the beta-lactam ring as it is for the beta-lactamases to hydrolyse the peptides, an observation which can be explained by geometric and stereoelectronic considerations. PMID:10393100

  19. Sequence analysis of PER-1 extended-spectrum beta-lactamase from Pseudomonas aeruginosa and comparison with class A beta-lactamases.

    PubMed Central

    Nordmann, P; Naas, T

    1994-01-01

    We have determined the nucleotide sequence (EMBL accession number, Z 21957) of the cloned chromosomal PER-1 extended-spectrum beta-lactamase gene from a Pseudomonas aeruginosa RNL-1 clinical isolate, blaPER-1 corresponds to a 924-bp open reading frame which encodes a polypeptide of 308 amino acids. This open reading frame is preceded by a -10 and a -35 region consistent with a putative P. aeruginosa promoter. Primer extension analysis of the PER-1 mRNA start revealed that this promoter was active in P. aeruginosa but not in Escherichia coli, in which PER-1 expression was driven by vector promoter sequences. N-terminal sequencing identified the PER-1 26-amino-acid leader peptide and enabled us to calculate the molecular mass (30.8 kDa) of the PER-1 mature form. Analysis of the percent GC content of blaPER-1 and of its 5' upstream sequences, as well as the codon usage for blaPER-1, indicated that blaPER-1 may have been inserted into P. aeruginosa genomic DNA from a nonpseudomonad bacterium. The PER-1 gene showed very low homology with other beta-lactamase genes at the DNA level. By using computer methods, assessment of the extent of identity between PER-1 and 10 beta-lactamase amino acid sequences indicated that PER-1 is a class A beta-lactamase. PER-1 shares around 27% amino acid identity with the sequenced extended-spectrum beta-lactamases of the TEM-SHV series and MEN-1 from Enterobacteriaceae species. The use of parsimony methods showed that PER-1 is not more closely related to gram-negative than to gram-positive bacterial class A beta-lactamases. Surprisingly, among class A beta-lactamases, PER-1 was most closely related to the recently reported CFXA from Bacteroides vulgatus, with which it shared 40% amino acid identity. This work indicates that non-Enterobacteriaceae species such as P. aeruginosa may possess class A extended-spectrum beta-lactamase genes possibly resulting from intergeneric DNA transfer. Images PMID:8141562

  20. Systematic mutagenesis of the active site omega loop of TEM-1 beta-lactamase.

    PubMed Central

    Petrosino, J F; Palzkill, T

    1996-01-01

    Beta-Lactamase is a bacterial protein that provides resistance against beta-lactam antibiotics. TEM-1 beta-lactamase is the most prevalent plasmid-mediated beta-lactamase in gram-negative bacteria. Normally, this enzyme has high levels of hydrolytic activity for penicillins, but mutant beta-lactamases have evolved with activity toward a variety of beta-lactam antibiotics. It has been shown that active site substitutions are responsible for changes in the substrate specificity. Since mutant beta-lactamases pose a serious threat to antimicrobial therapy, the mechanisms by which mutations can alter the substrate specificity of TEM-1 beta-lactamase are of interest. Previously, screens of random libraries encompassing 31 of 55 active site amino acid positions enabled the identification of the residues responsible for maintaining the substrate specificity of TEM-1 beta-lactamase. In addition to substitutions found in clinical isolates, many other specificity-altering mutations were also identified. Interestingly, many nonspecific substitutions in the N-terminal half of the active site omega loop were found to increase ceftazidime hydrolytic activity and decrease ampicillin hydrolytic activity. To complete the active sight study, eight additional random libraries were constructed and screened for specificity-altering mutations. All additional substitutions found to alter the substrate specificity were located in the C-terminal half of the active site loop. These mutants, much like the N-terminal omega loop mutants, appear to be less stable than the wild-type enzyme. Further analysis of a 165-YYG-167 triple mutant, selected for high levels of ceftazidime hydrolytic activity, provides an example of the correlation which exists between enzyme instability and increased ceftazidime hydrolytic activity in the ceftazidime-selected omega loop mutants. PMID:8606154

  1. Beta-lactamase stability of faropenem.

    PubMed

    Dalhoff, A; Nasu, T; Okamoto, K

    2003-09-01

    Faropenem (FAR) is an orally available member of the penem class unique among carbapenems and other available beta-lactams. This study compared FAR to cephalosporins and imipenem with respect to beta-lactamase (BLA) stability and emergence of resistance to Staphylococcus aureus and Escherichia coli. BLA stability was studied using enzyme preparations from sonicated/centrifuged 24-hour cultures of E. coli, Enterobacter cloacae, Proteus vulgaris, Providencia rettgeri, Klebsiella pneumoniae, S. aureus, and Bacteroides fragilis grown in the presence of 20 mg/l ampicillin or cephaloridine to induce penicillinase or cephalosporinase, respectively. Substrate hydrolysis was quantitated spectrophotometrically. Multistep acquisition of resistance was promoted by growing bacteria in broth containing 2-fold dilutions of antibiotic over 10 cycles. Aliquots from test tubes with visible growth provided the inoculum for the next series of dilutions. FAR as well as other cephalosporins tested were highly stable to penicillinase derived from S. aureus and E. coli. However, E. coli- and P. vulgaris-derived cephalosporinase hydrolyzed cephaloridine, cefaclor and cefotiam considerably, whereas FAR was highly stable. FAR was highly stable against hydrolysis by various BLAs prepared from four B. fragilis strains and the rate of FAR hydrolysis by metallo-BLA was 5 times lower than that for imipenem. Additionally, the acquisition of resistant S. aureus strains was less pronounced for FAR compared to other agents tested. MICs rose 8-fold after the 10th sub-MIC exposure, while MICs rose 16-, 31- and 512-fold for cefixime, cefazolin and cefaclor, respectively. E. coli shifts in MICs were moderate for all the agents tested. In conclusion, FAR is characterized by pronounced BLA stability compared to other cephalosporins and imipenem. Furthermore, a lower propensity for resistance development with FAR as compared to cephalosporins was observed. PMID:14504433

  2. Side chain SAR of bicyclic [beta]-lactamase inhibitors (BLIs). 1. Discovery of a class C BLI for combination with imipinem

    SciTech Connect

    Blizzard, Timothy A.; Chen, Helen; Kim, Seongkon; Wu, Jane; Young, Katherine; Park, Young-Whan; Ogawa, Amy; Raghoobar, Susan; Painter, Ronald E.; Hairston, Nichelle; Lee, Sang Ho; Misura, Andrew; Felcetto, Tom; Fitzgerald, Paula; Sharma, Nandini; Lu, Jun; Ha, Sookhee; Hickey, Emily; Hermes, Jeff; Hammond, Milton L.

    2010-09-17

    Bridged monobactam {beta}-lactamase inhibitors were prepared and evaluated as potential partners for combination with imipenem to overcome class C {beta}-lactamase mediated resistance. The (S)-azepine analog 2 was found to be effective in both in vitro and in vivo assays and was selected for preclinical development.

  3. Antimicrobial susceptibility and beta-lactamase production of selected gram-negative bacilli from two Croatian hospitals: MYSTIC study results.

    PubMed

    Bedenic, B; Goic-Barisic, I; Budimir, A; Tonkic, M; Mihajkevic, L J; Novak, A; Sviben, M; Plecko, V; Punda-Polic, V; Kalenic, S

    2010-06-01

    The meropenem yearly Susceptibility Test Information Collection (MYSTIC) programme is a global, longitudinal resistance surveillance network that monitors the activity of meropenem and compares its activity with other broadspectrum antimicrobial agents. We now report the antimicrobial efficacy of meropenem compared to other broad-spectrum agents within the selective Gram-negative pathogen groups from two Croatian Hospitals investigated between 2002-2007. A total of 1510 Gram-negative pathogens were tested and the minimum-inhibitory concentrations (MICs) were determined by broth microdilution method according to CLSI.There was no resistance to either imipenem or meropenem observed for Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis in both medical centers. High resistance rates of K. pneumoniae to ceftazidime (18%), cefepime (17%) and gentamicin (39%) are raising concern. Acinetobacter baumannii turned out to be the most resistant Gram-negative bacteria with 81% resistant to ceftazidime, 73% to cefepime, 69% to gentamicin and 71% to ciprofloxacin. Almost 20% of Pseudomonas aeruginosa strains were resistant to imipenem, 13% to meropenem, 69% to gentamicin and 38% to ciprofloxacin.The prevalence of extended-spectrum beta-lactamases (ESBLs) in E. coli was 10% and in K. pneumoniae 49%. PCR and sequencing of the amplicons revealed the presence of SHV-5 in nine E. coli strains and additional tem-1 beta-lactamase five strains. Five K. pneumoniae strains were positive for bla(SHV-5 )gene. Eight ESBL positive Enterobacter spp. strains were found to produce tem and CtX-m beta-lactamases. Plasmid-mediated AmpC beta-lactamases were not found among K. pneumoniae, E. coli and Enterobacter spp. Three A. baumannii strains from Zagreb University Center were identified by multiplex PCR as OXA-58 like producers. Six A. baumannii strains from Split University Center were found to possess an ISAba1 insertion sequence upstream of bla(OXA-51 )gene. According to our results

  4. Extended-spectrum plasmid-mediated beta-lactamases.

    PubMed

    Sirot, D

    1995-07-01

    Extended-spectrum beta-lactamases (ESBLs) are mutant enzymes which derive from TEM or SHV (class A) enzymes. They confer variable levels of resistance to cefotaxime, ceftazidime and other broad-spectrum cephalosporins and to monobactams such as aztreonam but have no detectable activity against cephamycins and carbapenems. Recently, new plasmid-mediated ESBLs, not derived from TEM or SHV enzymes but related to cephalosporinases of Enterobacteriaceae (class C enzymes), that confer resistance to all cephalosporins including cephamycins, have been reported. However, to date there have been no reported outbreaks due to strains producing transferable cephalosporinases. Klebsiella pneumoniae is the species in which the ESBL enzymes have been most commonly reported around the world. Most of the clinical isolates that produce TEM- or SHV-derived ESBL, come from hospitalised patients and have frequently caused nosocomial outbreaks. Care should be taken in the selection of a beta-lactam for the treatment of infections because the presence of an ESBL does not prevent other mechanisms of resistance, such as decreased permeability, from emerging. Broad-spectrum cephalosporins including cefepime and cefpirome are hydrolysed by ESBL. However, low level resistance to cefotaxime, ceftriaxone, cefepime and aztreonam does occur in some strains producing certain TEM-derived ESBL. It remains to be seen, therefore, whether such isolates are clinically susceptible to these drugs. The combination of a third-generation cephalosporin and a beta-lactamase inhibitor such as sulbactam could be of interest against some strains producing certain ESBLs. Among the 7-alpha-methoxy cephalosporins, cefotetan and latamoxef are the most active. However, cephamycins should be used with caution to treat infections caused by ESBL-producing K. pneumoniae because of the relative ease with which clinical strains decrease the expression of outer membrane proteins. The most active beta-lactams are the

  5. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  6. OXA-14, another extended-spectrum variant of OXA-10 (PSE-2) beta-lactamase from Pseudomonas aeruginosa.

    PubMed Central

    Danel, F; Hall, L M; Gur, D; Livermore, D M

    1995-01-01

    Pseudomonas aeruginosa 455, isolated in Ankara, Turkey, produced a pI 6.2 beta-lactamase determined by plasmid pMLH53 and resisted all beta-lactams except carbapenems. This beta-lactamase, named OXA-14, corresponded to OXA-10 (PSE-2) except that aspartate replaced glycine at position 157 and thus is intermediate between OXA-10 and OXA-11, which has aspartate at position 157 and a further substitution at position 143. PMID:7486940

  7. Structural Aspects for Evolution of [beta]-Lactamases from Penicillin-Binding Proteins

    SciTech Connect

    Meroueh, Samy O.; Minasov, George; Lee, Wenlin; Shoichet, Brian K.; Mobashery, Shahriar

    2010-03-08

    Penicillin-binding proteins (PBPs), biosynthetic enzymes of bacterial cell wall assembly, and {beta}-lactamases, resistance enzymes to {beta}-lactam antibiotics, are related to each other from an evolutionary point of view. Massova and Mobashery (Antimicrob. Agents Chemother. 1998, 42, 1-17) have proposed that for {beta}-lactamases to have become effective at their function as antibiotic resistance enzymes, they would have had to undergo structure alterations such that they would not interact with the peptidoglycan, which is the substrate for PBPs. A cephalosporin analogue, 7{beta}-[N-Acetyl-L-alanyl-{gamma}-D-glutamyl-L-lysine]-3-acetoxymethyl-3-cephem-carboxylic acid (compound 6), was conceived and synthesized to test this notion. The X-ray structure of the complex of this cephalosporin bound to the active site of the deacylation-deficient Q120L/Y150E variant of the class C AmpC {beta}-lactamase from Escherichia coli was solved at 1.71 {angstrom} resolution. This complex revealed that the surface for interaction with the strand of peptidoglycan that acylates the active site, which is present in PBPs, is absent in the {beta}-lactamase active site. Furthermore, insertion of a peptide in the {beta}-lactamase active site at a location where the second strand of peptidoglycan in some PBPs binds has effectively abolished the possibility for such interaction with the {beta}-lactamase. A 2.6 ns dynamics simulation was carried out for the complex, which revealed that the peptidoglycan surrogate (i.e., the active-site-bound ligand) undergoes substantial motion and is not stabilized for binding within the active site. These factors taken together disclose the set of structure modifications in the antibiotic resistance enzyme that prevent it from interacting with the peptidoglycan, en route to achieving catalytic proficiency for their intended function.

  8. Using steric hindrance to design new inhibitors of class C beta-lactamases

    SciTech Connect

    Trehan, Indi; Morandi, F.; Blaszczak, L.C.; Shoichet, Brian K.

    2010-03-08

    {beta}-lactamases confer resistance to {beta}-lactam antibiotics such as penicillins and cephalosporins. However, {beta}-lactams that form an acyl-intermediate with the enzyme but subsequently are hindered from forming a catalytically competent conformation seem to be inhibitors of {beta}-lactamases. This inhibition may be imparted by specific groups on the ubiquitous R1 side chain of {beta}-lactams, such as the 2-amino-4-thiazolyl methoxyimino (ATMO) group common among third-generation cephalosporins. Using steric hindrance of deacylation as a design guide, penicillin and carbacephem substrates were converted into effective {beta}-lactamase inhibitors and antiresistance antibiotics. To investigate the structural bases of inhibition, the crystal structures of the acyl-adducts of the penicillin substrate amoxicillin and the new analogous inhibitor ATMO-penicillin were determined. ATMO-penicillin binds in a catalytically incompetent conformation resembling that adopted by third-generation cephalosporins, demonstrating the transferability of such sterically hindered groups in inhibitor design.

  9. Antimicrobial resistance in faecal Escherichia coli isolates from farmed red deer and wild small mammals. Detection of a multiresistant E. coli producing extended-spectrum beta-lactamase.

    PubMed

    Alonso, C A; González-Barrio, D; Tenorio, Carmen; Ruiz-Fons, F; Torres, C

    2016-04-01

    Eighty-nine Escherichia coli isolates recovered from faeces of red deer and small mammals, cohabiting the same area, were analyzed to determine the prevalence and mechanisms of antimicrobial resistance and molecular typing. Antimicrobial resistance was detected in 6.7% of isolates, with resistances to tetracycline and quinolones being the most common. An E. coli strain carrying blaCTX-M-1 as well as other antibiotic resistant genes included in an unusual class 1 integron (Intl1-dfrA16-blaPSE-1-aadA2-cmlA1-aadA1-qacH-IS440-sul3-orf1-mef(B)Δ-IS26) was isolated from a deer. The blaCTX-M-1 gene was transferred by conjugation and transconjugants also acquired an IncN plasmid. This strain was typed as ST224, which seems to be well adapted to both clinical and environmental settings. The phylogenetic distribution of the 89 strains varied depending on the animal host. This work reveals low antimicrobial resistance levels among faecal E. coli from wild mammals, which reflects a lower selective pressure affecting these bacteria, compared to livestock. However, it is remarkable the detection of a multi-resistant ESBL-E. coli with an integron carrying clinically relevant antibiotic-resistance genes, which can contribute to the dissemination of resistance determinants among different ecosystems. PMID:27012919

  10. Occurrence and characteristics of extended spectrum beta-lactamases-producing Enterobacteriaceae from foods of animal origin.

    PubMed

    Tekiner, İsmail Hakkı; Özpınar, Haydar

    2016-01-01

    Presence of extended spectrum beta-lactamases (ESBL) in bacteria is a growing health concern of global significance. The local, regional, national, and international epidemiological studies for extended spectrum beta-lactamases-producing Enterobacteriaceae and their encoding genes in foods are still incomplete. The objective of this study was to determine the occurrence of extended spectrum beta-lactamases-producing Enterobacteriaceae and the characteristics of their encoding genes from a total of 250 samples of various foods of animal-origin (100 raw chicken meat, 100 raw cow milk, and 50 raw cow milk cheese) sold in Turkey. Overall, 55 isolates were positive as extended spectrum beta-lactamases-producing Enterobacteriaceae. The most prevalent extended spectrum beta-lactamases-producing strain were identified as Escherichia coli (80%), followed by Enterobacter cloacae (9.1%), Citrobacter braakii (5.5%), Klebsiella pneumoniae (3.6%), and Citrobacter werkmanii (1.8%) by Vitek(®) MS. The simultaneous production of extended spectrum beta-lactamases and AmpC was detected in five isolates (9.1%) in E. coli (80%) and E. cloacae (20%). The frequency rates of blaTEM, blaCTX-M, and blaSHV were 96.4%, 53.7%, and 34.5%, respectively. The co-existence of bla-genes was observed in 82% of extended spectrum beta-lactamases producers with a distribution of blaTEM &blaCTX-M (52.7%), blaTEM &blaSHV (20%), blaTEM &blaCTX-M &blaSHV (12.7%), and blaSHV &blaCTX-M (1.8%). The most prevalent variant of blaCTX-M clusters was defined as blaCTX-M-1 (97.2%), followed by blaCTX-M-8 (2.8%). In summary, the analysed foods were found to be posing a health risk for Turkish consumers due to contamination by Enterobacteriaceae with a diversity of extended spectrum beta-lactamases encoding genes. PMID:26991276

  11. Energetic, Structural, and Antimicrobial Analyses of [beta]-Lactam Side Chain Recognition by [beta]-Lactamases

    SciTech Connect

    Caselli, E.; Powers, R.A.; Blaszczak, L.C.; Wu, C.Y.E.; Prati, F.; Shoichet, B.K.

    2010-03-05

    Penicillins and cephalosporins are among the most widely used and successful antibiotics. The emergence of resistance to these {beta}-lactams, most often through bacterial expression of {beta}-lactamases, threatens public health. To understand how {beta}-lactamases recognize their substrates, it would be helpful to know their binding energies. Unfortunately, these have been difficult to measure because {beta}-lactams form covalent adducts with {beta}-lactamases. This has complicated functional analyses and inhibitor design. To investigate the contribution to interaction energy of the key amide (R1) side chain of {beta}-lactam antibiotics, eight acylglycineboronic acids that bear the side chains of characteristic penicillins and cephalosporins, as well as four other analogs, were synthesized. These transition-state analogs form reversible adducts with serine {beta}-lactamases. Therefore, binding energies can be calculated directly from K{sub i} values. The K{sub i} values measured span four orders of magnitude against the Group I {beta}-lactamase AmpC and three orders of magnitude against the Group II {beta}-lactamase TEM-1. The acylglycineboronic acids have K{sub i} values as low as 20 nM against AmpC and as low as 390 nM against TEM-1. The inhibitors showed little activity against serine proteases, such as chymotrypsin. R1 side chains characteristic of {beta}-lactam inhibitors did not have better affinity for AmpC than did side chains characteristic of {beta}-lactam substrates. Two of the inhibitors reversed the resistance of pathogenic bacteria to {beta}-lactams in cell culture. Structures of two inhibitors in their complexes with AmpC were determined by X-ray crystallography to 1.90 {angstrom} and 1.75 {angstrom} resolution; these structures suggest interactions that are important to the affinity of the inhibitors. Acylglycineboronic acids allow us to begin to dissect interaction energies between {beta}-lactam side chains and {beta}-lactamases. Surprisingly

  12. Novel Computational Protocols for Functionally Classifying and Characterising Serine Beta-Lactamases

    PubMed Central

    Das, Sayoni; Dawson, Natalie L.; Dobrijevic, Dragana; Orengo, Christine

    2016-01-01

    Beta-lactamases represent the main bacterial mechanism of resistance to beta-lactam antibiotics and are a significant challenge to modern medicine. We have developed an automated classification and analysis protocol that exploits structure- and sequence-based approaches and which allows us to propose a grouping of serine beta-lactamases that more consistently captures and rationalizes the existing three classification schemes: Classes, (A, C and D, which vary in their implementation of the mechanism of action); Types (that largely reflect evolutionary distance measured by sequence similarity); and Variant groups (which largely correspond with the Bush-Jacoby clinical groups). Our analysis platform exploits a suite of in-house and public tools to identify Functional Determinants (FDs), i.e. residue sites, responsible for conferring different phenotypes between different classes, different types and different variants. We focused on Class A beta-lactamases, the most highly populated and clinically relevant class, to identify FDs implicated in the distinct phenotypes associated with different Class A Types and Variants. We show that our FunFHMMer method can separate the known beta-lactamase classes and identify those positions likely to be responsible for the different implementations of the mechanism of action in these enzymes. Two novel algorithms, ASSP and SSPA, allow detection of FD sites likely to contribute to the broadening of the substrate profiles. Using our approaches, we recognise 151 Class A types in UniProt. Finally, we used our beta-lactamase FunFams and ASSP profiles to detect 4 novel Class A types in microbiome samples. Our platforms have been validated by literature studies, in silico analysis and some targeted experimental verification. Although developed for the serine beta-lactamases they could be used to classify and analyse any diverse protein superfamily where sub-families have diverged over both long and short evolutionary timescales. PMID

  13. Novel Computational Protocols for Functionally Classifying and Characterising Serine Beta-Lactamases.

    PubMed

    Lee, David; Das, Sayoni; Dawson, Natalie L; Dobrijevic, Dragana; Ward, John; Orengo, Christine

    2016-06-01

    Beta-lactamases represent the main bacterial mechanism of resistance to beta-lactam antibiotics and are a significant challenge to modern medicine. We have developed an automated classification and analysis protocol that exploits structure- and sequence-based approaches and which allows us to propose a grouping of serine beta-lactamases that more consistently captures and rationalizes the existing three classification schemes: Classes, (A, C and D, which vary in their implementation of the mechanism of action); Types (that largely reflect evolutionary distance measured by sequence similarity); and Variant groups (which largely correspond with the Bush-Jacoby clinical groups). Our analysis platform exploits a suite of in-house and public tools to identify Functional Determinants (FDs), i.e. residue sites, responsible for conferring different phenotypes between different classes, different types and different variants. We focused on Class A beta-lactamases, the most highly populated and clinically relevant class, to identify FDs implicated in the distinct phenotypes associated with different Class A Types and Variants. We show that our FunFHMMer method can separate the known beta-lactamase classes and identify those positions likely to be responsible for the different implementations of the mechanism of action in these enzymes. Two novel algorithms, ASSP and SSPA, allow detection of FD sites likely to contribute to the broadening of the substrate profiles. Using our approaches, we recognise 151 Class A types in UniProt. Finally, we used our beta-lactamase FunFams and ASSP profiles to detect 4 novel Class A types in microbiome samples. Our platforms have been validated by literature studies, in silico analysis and some targeted experimental verification. Although developed for the serine beta-lactamases they could be used to classify and analyse any diverse protein superfamily where sub-families have diverged over both long and short evolutionary timescales. PMID

  14. Quinolone-Resistant Escherichia coli O127a:K63 Serotype with an Extended-Spectrum-Beta-Lactamase Phenotype from a Food Poisoning Outbreak in China

    PubMed Central

    Hao, Rongzhang; Qiu, Shaofu; Yang, Guang; Su, Wenli; Song, Lixue; Zhang, Jia; Chen, Jiaxu; Jia, Leili; Wang, Ligui

    2012-01-01

    We report an atypical enteropathogenic Escherichia coli O127a:K63 strain with resistance to quinolones and extended-spectrum cephalosporins isolated from a 2010 food poisoning outbreak involving 112 adults in China. Two resistance genes [blaCTX-M-15, aac(6′)-Ib-c] and five mutations (two in gyrA, two in parC, one in parE) coexisted in this enteropathogenic E. coli strain. PMID:22553233

  15. Bacterial cell wall recycling provides cytosolic muropeptides as effectors for beta-lactamase induction.

    PubMed Central

    Jacobs, C; Huang, L J; Bartowsky, E; Normark, S; Park, J T

    1994-01-01

    A mechanism for bacteria to monitor the status of their vital cell wall peptidoglycan is suggested by the convergence of two phenomena: peptidoglycan recycling and beta-lactamase induction. ampG and ampD, genes essential for beta-lactamase regulation, are here shown to be required for recycling as well. Cells lacking either AmpG or AmpD lose up to 40% of their peptidoglycan per generation, whereas Escherichia coli normally suffers minimal losses and instead recycles 40 or 50% of the tripeptide, L-alanyl-D-glutamyl-meso-diaminopimelic acid, from its peptidoglycan each generation. The ampG mutant releases peptidoglycan-derived material into the medium. In contrast, the ampD mutant accumulates a novel cell wall muropeptide, 1,6-anhydro N-acetylmuramyl-L-alanyl-D-glutamyl-meso-diaminopimelic acid (anhMurNAc-tripeptide), in its cytoplasm. This work suggests that AmpG is the permease for a large muropeptide and AmpD is a novel cytosolic N-acetylmuramyl-L-alanine amidase that cleaves anhMurNAc-tripeptide to release tripeptide, which is then recycled. These results also suggest that the phenomenon of beta-lactamase induction is regulated by the level of muropeptide(s) in the cytoplasm, since an ampD mutation that results in beta-lactamase expression even in the absence of a beta-lactamase inducer coincides with accumulation of anhMurNAc-tripeptide. The transcriptional regulator AmpR is presumably converted into an activator for beta-lactamase production by sensing the higher level of muropeptide(s). This may be an example of a general mechanism for signaling the progress of external events such as cell wall maturation, cell division or cell wall damage. PMID:7925310

  16. Terminal truncations in amp C beta-lactamase from a clinical isolate of Pseudomonas aeruginosa.

    PubMed

    Walther-Rasmussen, J; Johnsen, A H; Høiby, N

    1999-07-01

    AmpC beta-lactamases from strains of Pseudomonas aeruginosa have previously been shown to be heterogeneous with respect to their isoelectric point (pI). In order to elucidate the origin of this heterogeneity enzymes were isolated from a clinical isolate of a multiresistant P. aeruginosa strain and biochemically characterized. The purification was accomplished in four chromatographic steps comprising dye-affinity, size-exclusion, hydrophobic interaction chromatography, and chromatofocusing; this resulted in five forms with pI values of 9.1, 8.7, 8.3, 8.2, and 7.6. When analysed by SDS/PAGE and agarose IEF each separated beta-lactamase appeared to be both size- and charge-homogeneous. The specific activities of the variants were very similar. MS of each isolated beta-lactamase form showed minor differences in molecular mass (range 40.0-40.8 kDa). MS of the beta-lactamase with a pI of 8.2 demonstrated the presence of two subforms. The N-terminal sequences of three of the beta-lactamases were identical to the published sequence [Lodge, J.M. , Minchin, S.D., Piddock, L.J.V. & Busby, J.W. (1990) Biochem. J. 272, 627-631], while two variants were truncated by two amino-acid residues, one of which was acidic. The previously published sequence contains an alanine as the ultimate residue, but two of the beta-lactamases showed a substitution of Ala371 for arginine, whereas in the remaining forms C-terminal truncations by one and three residues were found. Our results indicate that the P. aeruginosa strain does not harbour multiple copies of the ampC gene, but rather that the five beta-lactamase isoforms are products of a single structural gene. The combinations of the identified N- and/or C-terminal truncations explained the multiple pI values of the beta-lactamase isoforms. PMID:10406957

  17. New system based on site-directed mutagenesis for highly accurate comparison of resistance levels conferred by SHV beta-lactamases.

    PubMed Central

    Nüesch-Inderbinen, M T; Hächler, H; Kayser, F H

    1995-01-01

    We developed a system based on site-directed mutagenesis that allows a precise comparison of SHV enzymes under isogenic conditions. In addition, the influences of two different, naturally occurring promoters were examined for each SHV derivative. The system comprised two separately cloned DNA fragments, each the size of 3.6 kb. Both fragments encoded an SHV gene originating from clinical isolates but with different promoters. The structural genes were made identical by site-directed mutagenesis. Other mutations were then introduced into both fragments by means of site-directed mutagenesis, resulting in the SHV derivatives SHV-1, SHV-2, SHV-2a, SHV-3, and SHV-5. The amino acid exchange of glutamic acid at position 235 for lysine in SHV-5 resulted in the highest resistance levels. SHV-3, differing from SHV-2 by the exchange of arginine at position 201 for leucine and previously described as indistinguishable from SHV-2, was shown to cause slightly higher resistance to ceftazidime and lower resistance to ceftriaxone, cefotaxime, and cefepime than SHV-2. The point mutation in SHV-2a, with the leucine-to-glutamine replacement at the unusual position 31, previously considered almost insignificant, proved to increase resistance to ceftazidime but reduced the MICs of all other cephalosporins tested when compared with those for SHV-2. For all clones harboring SHV derivatives, resistance was increased by a stronger promoter, in some cases masking the effect of the point mutation itself and demonstrating the importance of regulatory mechanisms of resistance. PMID:7486909

  18. Exploring the potential reservoirs of non specific TEM beta lactamase (blaTEM) gene in the Indo-Gangetic region: A risk assessment approach to predict health hazards.

    PubMed

    Singh, Gulshan; Vajpayee, Poornima; Rani, Neetika; Amoah, Isaac Dennis; Stenström, Thor Axel; Shanker, Rishi

    2016-08-15

    The emergence of antimicrobial resistant bacteria is an important public health and environmental contamination issue. Antimicrobials of β-lactam group accounts for approximately two thirds, by weight, of all antimicrobials administered to humans due to high clinical efficacy and low toxicity. This study explores β-lactam resistance determinant gene (blaTEM) as emerging contaminant in Indo-Gangetic region using qPCR in molecular beacon format. Quantitative Microbial Risk Assessment (QMRA) approach was adopted to predict risk to human health associated with consumption/exposure of surface water, potable water and street foods contaminated with bacteria having blaTEM gene. It was observed that surface water and sediments of the river Ganga and Gomti showed high numbers of blaTEM gene copies and varied significantly (p<0.05) among the sampling locations. The potable water collected from drinking water facility and clinical settings exhibit significant number of blaTEM gene copies (13±0.44-10200±316 gene copies/100mL). It was observed that E.crassipes among aquatic flora encountered in both the rivers had high load of blaTEM gene copies. The information on prevalence of environmental reservoirs of blaTEM gene containing bacteria in Indo-Gangetic region and risk associated will be useful for formulating strategies to protect public from menace of clinical risks linked with antimicrobial resistant bacteria. PMID:27111425

  19. Outbreak of meropenem-resistant Serratia marcescens comediated by chromosomal AmpC beta-lactamase overproduction and outer membrane protein loss.

    PubMed

    Suh, Borum; Bae, Il Kwon; Kim, Juwon; Jeong, Seok Hoon; Yong, Dongeun; Lee, Kyungwon

    2010-12-01

    The aim of this study was to investigate the mechanisms involved in the meropenem resistance of Serratia marcescens clinical isolates. Meropenem-resistant (MIC range, 16 to 32 μg/ml) S. marcescens isolates were recovered from nine patients in a tertiary hospital in Seoul, South Korea, from June to November 2005. All the isolates shared identical or similar (>85% similarity) SpeI macrorestriction patterns, indicating clonal spread. PCR experiments did not detect any carbapenemase in those isolates. They carried the bla(CTX-M-22) gene located on a 150-kbp plasmid of the incompatibility group L/M; however, the addition of clavulanic acid exhibited few effects on meropenem MICs. Although meropenem MICs were reduced 4- to 16-fold with the addition of boronic acid, no plasmid-borne AmpC β-lactamase gene was detected in PCR experiments. Real-time quantitative PCR experiments showed that expression levels of the chromosomal ampC gene in those isolates were 87.06 to 155.76 times higher than that of the reference strain ATCC 8100. SDS-PAGE showed a lack of the 42-kDa outer membrane protein (OmpF). In combination with the overproduction of the chromosomal AmpC enzyme, the loss of OmpF may have played a role in the acquisition of meropenem resistance in our isolates. PMID:20876374

  20. Detection of cfxA2, cfxA3, and cfxA6 genes in beta-lactamase producing oral anaerobes

    PubMed Central

    BINTA, Buhle; PATEL, Mrudula

    2016-01-01

    ABSTRACT Purpose The aim of this study was to identify β-lactamase-producing oral anaerobic bacteria and screen them for the presence of cfxA and BlaTEM genes that are responsible for β-lactamase production and resistance to β-lactam antibiotics. Material and Methods Periodontal pocket debris samples were collected from 48 patients with chronic periodontitis and anaerobically cultured on blood agar plates with and without β-lactam antibiotics. Presumptive β-lactamase-producing isolates were evaluated for definite β-lactamase production using the nitrocefin slide method and identified using the API Rapid 32A system. Antimicrobial susceptibility was performed using disc diffusion and microbroth dilution tests as described by CLSI Methods. Isolates were screened for the presence of the β-lactamase-TEM (BlaTEM) and β-lactamase-cfxA genes using Polymerase Chain Reaction (PCR). Amplified PCR products were sequenced and the cfxA gene was characterized using Genbank databases. Results Seventy five percent of patients carried two species of β-lactamase-producing anaerobic bacteria that comprised 9.4% of the total number of cultivable bacteria. Fifty one percent of β-lactamase-producing strains mainly Prevotella, Porphyromonas, and Bacteroides carried the cfxA gene, whereas none of them carried blaTEM. Further characterization of the cfxA gene showed that 76.7% of these strains carried the cfxA2 gene, 14% carried cfxA3, and 9.3% carried cfxA6. The cfxA6 gene was present in three Prevotella spp. and in one Porphyromonas spp. Strains containing cfxA genes (56%) were resistant to the β-lactam antibiotics. Conclusion This study indicates that there is a high prevalence of the cfxA gene in β-lactamase-producing anaerobic oral bacteria, which may lead to drug resistance and treatment failure. PMID:27119762

  1. The phototrophic bacterium Rhodopseudomonas capsulata sp108 encodes an indigenous class A beta-lactamase.

    PubMed Central

    Campbell, J I; Scahill, S; Gibson, T; Ambler, R P

    1989-01-01

    The nucleotide sequence of a 2.37 kb DNA fragment derived from cloning a total DNA digest of Rhodopseudomonas capsulata sp108 was determined. The DNA codes for a beta-lactamase, a protein showing sequence similarity to the ampR protein of Enterobacter cloacae and an unidentified open reading frame. Hybridization experiments with a probe carrying DNA from within the beta-lactamase gene suggests a chromosomal location for the coding sequences in strain sp108 and in sp109, a penicillin-sensitive revertant of sp108 in which the enzyme is not inducible. A protein-sequence comparison of the deduced amino acid sequence of the Rps. capsulata beta-lactamase indicates that it is a Class A enzyme and that its sequence can be aligned with those of the characterized beta-lactamases from Staphylococcus aureus, Bacillus licheniformis and the Escherichia coli plasmid (R-TEM enzyme), with only a few insertions or deletions. The corresponding DNA sequence is, however, characteristically rhodopseudomonad, suggesting that it is not a recently transposed gene. Images Fig. 4. PMID:2788410

  2. Eradication of methicillin-resistant Staphylococcus aureus and of Enterobacteriaceae expressing extended-spectrum beta-lactamases on a model pig farm.

    PubMed

    Schmithausen, Ricarda Maria; Kellner, Sophia Ricarda; Schulze-Geisthoevel, Sophia Veronika; Hack, Sylvia; Engelhart, Steffen; Bodenstein, Isabel; Al-Sabti, Nahed; Reif, Marion; Fimmers, Rolf; Körber-Irrgang, Barbara; Harlizius, Jürgen; Hoerauf, Achim; Exner, Martin; Bierbaum, Gabriele; Petersen, Brigitte; Bekeredjian-Ding, Isabelle

    2015-11-01

    Colonization of livestock with bacteria resistant to antibiotics is considered a risk for the entry of drug-resistant pathogens into the food chain. For this reason, there is a need for novel concepts to address the eradication of drug-resistant commensals on farms. In the present report, we evaluated the decontamination measures taken on a farm contaminated with methicillin-resistant Staphylococcus aureus (MRSA) and Enterobacteriaceae expressing extended-spectrum β-lactamases (ESBL-E). The decontamination process preceded the conversion from piglet breeding to gilt production. Microbiological surveillance showed that the decontamination measures eliminated the MRSA and ESBL-E strains that were detected on the farm before the complete removal of pigs, cleaning and disinfection of the stable, and construction of an additional stable meeting high-quality standards. After pig production was restarted, ESBL-E remained undetectable over 12 months, but MRSA was recovered from pigs and the environment within the first 2 days. However, spa (Staphylococcus aureus protein A gene) typing revealed acquisition of an MRSA strain (type t034) that had not been detected before decontamination. Interestingly, we observed that a farmworker who had been colonized with the prior MRSA strain (t2011) acquired the new strain (t034) after 2 months. In summary, this report demonstrates that decontamination protocols similar to those used here can lead to successful elimination of contaminating MRSA and ESBL-E in pigs and the stable environment. Nevertheless, decontamination protocols do not prevent the acquisition of new MRSA strains. PMID:26341200

  3. Eradication of Methicillin-Resistant Staphylococcus aureus and of Enterobacteriaceae Expressing Extended-Spectrum Beta-Lactamases on a Model Pig Farm

    PubMed Central

    Kellner, Sophia Ricarda; Schulze-Geisthoevel, Sophia Veronika; Hack, Sylvia; Engelhart, Steffen; Bodenstein, Isabel; Al-Sabti, Nahed; Reif, Marion; Fimmers, Rolf; Körber-Irrgang, Barbara; Harlizius, Jürgen; Hoerauf, Achim; Exner, Martin; Bierbaum, Gabriele; Petersen, Brigitte

    2015-01-01

    Colonization of livestock with bacteria resistant to antibiotics is considered a risk for the entry of drug-resistant pathogens into the food chain. For this reason, there is a need for novel concepts to address the eradication of drug-resistant commensals on farms. In the present report, we evaluated the decontamination measures taken on a farm contaminated with methicillin-resistant Staphylococcus aureus (MRSA) and Enterobacteriaceae expressing extended-spectrum β-lactamases (ESBL-E). The decontamination process preceded the conversion from piglet breeding to gilt production. Microbiological surveillance showed that the decontamination measures eliminated the MRSA and ESBL-E strains that were detected on the farm before the complete removal of pigs, cleaning and disinfection of the stable, and construction of an additional stable meeting high-quality standards. After pig production was restarted, ESBL-E remained undetectable over 12 months, but MRSA was recovered from pigs and the environment within the first 2 days. However, spa (Staphylococcus aureus protein A gene) typing revealed acquisition of an MRSA strain (type t034) that had not been detected before decontamination. Interestingly, we observed that a farmworker who had been colonized with the prior MRSA strain (t2011) acquired the new strain (t034) after 2 months. In summary, this report demonstrates that decontamination protocols similar to those used here can lead to successful elimination of contaminating MRSA and ESBL-E in pigs and the stable environment. Nevertheless, decontamination protocols do not prevent the acquisition of new MRSA strains. PMID:26341200

  4. Outbreak of Serratia marcescens Coproducing ArmA and CTX-M-15 Mediated High Levels of Resistance to Aminoglycoside and Extended-Spectrum Beta-Lactamases, Algeria.

    PubMed

    Batah, Rima; Loucif, Lotfi; Olaitan, Abiola Olumuyiwa; Boutefnouchet, Nafissa; Allag, Hamoudi; Rolain, Jean-Marc

    2015-08-01

    Serratia marcescens is one of the most important pathogens responsible for nosocomial infections worldwide. Here, we have investigated the molecular support of antibiotic resistance and genetic relationships in a series of 54 S. marcescens clinical isolates collected from Eastern Algeria between December 2011 and July 2013. The 54 isolates were identified by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Antibiotic susceptibility testing was performed by disc diffusion and E-test methods. Antibiotic resistance genes were detected by polymerase chain reaction (PCR). The genetic transfer of antibiotic resistance was performed by conjugation using azide-resistant Escherichia coli J53 as the recipient strain, and plasmid analysis was done by PCR-based replicon typing. The relatedness of our isolates was determined by phylogenetic analysis based on partial sequences of four protein-encoding genes (gyrB, rpoB, infB, and atpD) and then compared to MALDI-TOF MS clustering. Thirty-five out of 54 isolates yielded an extended-spectrum β-lactamase (ESBL) phenotype and carried bla(CTX-M-15) (n=32), bla(TEM-1) (n=26), bla(TEM-71) (n=1), bla(SHV-1a) (n=1), and bla(PER-2) (n=12). Among these isolates, we identified a cluster of 15 isolates from a urology unit that coharbored ESBL and the 16S rRNA methyltransferase armA. Conjugation was successful for five selected strains, demonstrating the transferability of a conjugative plasmid of incompatibility group incL/M type. Phylogenetic analysis along with MALDI-TOF clustering likely suggested an outbreak of such isolates in the urology unit. In this study, we report for the first time the co-occurrence of armA methyltransferase with ESBL in S. marcescens clinical isolates in Eastern Algeria. PMID:25884511

  5. [beta]-Lactamases in the Biochemistry and Molecular Biology Laboratory

    ERIC Educational Resources Information Center

    Amador, Paula; Prudencio, Cristina; Vieira, Monica; Ferraz, Ricardo; Fonte, Rosalia; Silva, Nuno; Coelho, Pedro; Fernandes, Ruben

    2009-01-01

    [beta]-lactamases are hydrolytic enzymes that inactivate the [beta]-lactam ring of antibiotics such as penicillins and cephalosporins. The major diversity of studies carried out until now have mainly focused on the characterization of [beta]-lactamases recovered among clinical isolates of Gram-positive staphylococci and Gram-negative…

  6. Novel variant (bla(VIM-4)) of the metallo-beta-lactamase gene bla(VIM-1) in a clinical strain of Pseudomonas aeruginosa.

    PubMed

    Pournaras, Spyros; Tsakris, Athanassios; Maniati, Maria; Tzouvelekis, Leonidas S; Maniatis, Antonios N

    2002-12-01

    A Pseudomonas aeruginosa isolate highly resistant to carbapenems was collected from a patient with postsurgical cerebrospinal infection in Greece. The isolate carried a class 1 integron that contained as a sole cassette the gene bla(VIM-4), a novel variant of bla(VIM-1), with one nucleotide difference resulting in a Ser-to-Arg change at amino acid position 175 of the VIM-1 enzyme. This is the first detection of a VIM-1 variant after its appearance in Italy. PMID:12435718

  7. Evaluation of the contemporary occurrence rates of metallo-beta-lactamases in multidrug-resistant Gram-negative bacilli in Japan: report from the SENTRY Antimicrobial Surveillance Program (1998-2002).

    PubMed

    Jones, Ronald N; Deshpande, Lalitagauri M; Bell, Jan M; Turnidge, John D; Kohno, Shigeru; Hirakata, Yoichi; Ono, Yasuo; Miyazawa, Yukihisa; Kawakama, Sayoko; Inoue, Matsuhisa; Hirata, Yasuyoshi; Toleman, Mark A

    2004-08-01

    Metallo-beta-lactamases (M beta L) were initially characterized in Japan, usually of the IMP-type, and found in Pseudomonas aeruginosa (PSA), Acinetobacter spp. (ACB), or Serratia marcescens (SM). The number of M beta L types has increased worldwide, but geographic dissemination within Japan has appeared limited. This study compares baseline levels of M beta L resistance from two 22-center studies (1996-1997) to the longitudinal sample (3 sites) of Japanese isolates from the SENTRY Antimicrobial Surveillance Program (1998-2002). All minimal inhibitory concentration results were determined by reference methods. A total of 26.8% PSA, 3.4% ACB, and 3.1% Enterobacteriaceae (enterobacters and SM) with resistance to monitored carbapenems (CARB) (minimal inhibitory concentration, > or =8 microg/mL) were screened for M beta L production by disk approximation tests (EDTA and 2-MPA inhibitors), CARB hydrolysis by enzyme extracts, and selected PCR primers for known M beta L types. All M beta L-positive strains (10) were sequenced to determine enzyme identification. Clonality in each center was determined by automated ribotyping and PFGE. The CARB susceptibility rates in PSA decreased (80.7% to 62.0%) over the monitored interval (1998-2002), but varied by medical center location. Among CARB-resistant isolates, 10.8% were attributed to M beta L strains (1.1% of all PSA tested). M beta L identification showed the following: five PSA (three IMP-1, two IMP-2), four SM (one IMP-1, two IMP-1 + OXA-1, and one IMP-11). Also a single ACB had an IMP-1. Eight of 10 M beta L isolations occurred between 2000 and 2002; four occurred in 2002. BRL42715, an AMP-C inhibitor, confirmed AMP-C-mediated resistance in 87.3% of PSA, and outer membrane protein changes were also discovered by membrane studies. Prior results (22 sites, 1997-1998) showed CARB resistance at 22.4-25.6% and 0.5-0.9% M beta Ls (IMP-1) overall; it was slightly elevated in this SENTRY Program sample. In conclusion, M beta L

  8. Immunological properties of beta-lactamases that hydrolyze cefuroxime and cefotaxime.

    PubMed Central

    Hirai, K; Sato, K; Matsubara, N; Katsumata, R; Inoue, M; Mitsuhashi, S

    1981-01-01

    Antiserum against purified beta-lactamase from Proteus vulgaris GN7919 cross-reacted with beta-lactamases produced by strains of Pseudomonas cepacia in a neutralization test. Anti-P. cepacia beta-lactamase serum, however, did not show any cross-reactions with P. vulgaris beta-lactamases. Each of these enzymes can hydrolyze cefuroxime and cefotaxime. PMID:6269489

  9. First Description of the Extended Spectrum-Beta-Lactamase Gene blaCTX-M-109 in Salmonella Grumpensis Strains Isolated from Neonatal Nosocomial Infections in Dakar, Senegal

    PubMed Central

    Seck, Abdoulaye; Dia, Mouhamadou Lamine; Timbiné, Lassina Gadi; Niang, Aïssatou Ameth; Ndiaye, El Hadji Momar; Sonko, Mouhamadou Abdoulaye; Wane, Abdoul Aziz; Bercion, Raymond; Ndiaye, Ousmane; Cissé, Moussa Fafa; Gassama-Sow, Amy

    2016-01-01

    Nosocomial infections are very common in African hospitals, particularly in neonatal units. These infections are most often caused by bacteria such as Escherichia coli, Klebsiella spp and Staphylococcus spp. Salmonella strains are rarely involved in nosocomial infections. Here, we report the first description of S. Grumpensis in neonatal infections in Senegal. Seventeen Salmonella strains were isolated from hospitalized infants’ stool samples. The following resistance phenotype was described in strains: AMXRTICRCFR FOXRCFXRCTXRCAZRIMPSATMRNARNORRCIPRTMRGMRTERSXTR. All isolates were susceptible to imipenem, 15 out of 17 produced an extended spectrum ß-lactamase (ESBL). blaOXA-1, blaSHV-1, blaTEM-1, blaCTX-M1 genes were detected in strains 8, 13, 5 and 8, respectively. blaCTX-M1 sequencing revealed the presence of blaCTX-M-109. Thirteen of the 17 Salmonella Grumpensis strains were analyzed by PFGE. These 13 isolates belonged to a single pulsotype and were genotypically identical. This is the first report of neonatal S. Grumpensis infections in Senegal, and the first report of blaCTX-M-109 in the genus Salmonella. PMID:27355480

  10. First Description of the Extended Spectrum-Beta-Lactamase Gene blaCTX-M-109 in Salmonella Grumpensis Strains Isolated from Neonatal Nosocomial Infections in Dakar, Senegal.

    PubMed

    Diop, Amadou; Sambe-Ba, Bissoume; Seck, Abdoulaye; Dia, Mouhamadou Lamine; Timbiné, Lassina Gadi; Niang, Aïssatou Ameth; Ndiaye, El Hadji Momar; Sonko, Mouhamadou Abdoulaye; Wane, Abdoul Aziz; Bercion, Raymond; Ndiaye, Ousmane; Cissé, Moussa Fafa; Gassama-Sow, Amy

    2016-01-01

    Nosocomial infections are very common in African hospitals, particularly in neonatal units. These infections are most often caused by bacteria such as Escherichia coli, Klebsiella spp and Staphylococcus spp. Salmonella strains are rarely involved in nosocomial infections. Here, we report the first description of S. Grumpensis in neonatal infections in Senegal. Seventeen Salmonella strains were isolated from hospitalized infants' stool samples. The following resistance phenotype was described in strains: AMXRTICRCFR FOXRCFXRCTXRCAZRIMPSATMRNARNORRCIPRTMRGMRTERSXTR. All isolates were susceptible to imipenem, 15 out of 17 produced an extended spectrum ß-lactamase (ESBL). blaOXA-1, blaSHV-1, blaTEM-1, blaCTX-M1 genes were detected in strains 8, 13, 5 and 8, respectively. blaCTX-M1 sequencing revealed the presence of blaCTX-M-109. Thirteen of the 17 Salmonella Grumpensis strains were analyzed by PFGE. These 13 isolates belonged to a single pulsotype and were genotypically identical. This is the first report of neonatal S. Grumpensis infections in Senegal, and the first report of blaCTX-M-109 in the genus Salmonella. PMID:27355480

  11. Detection of KPC-2 in a Clinical Isolate of Proteus mirabilis and First Reported Description of Carbapenemase Resistance Caused by a KPC Beta-Lactamase in P. mirabilis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An isolate of Proteus mirabilis recovered from bacterial cultures was shown to be resistant to imipenem, meropenem, and ertapenem by disk diffusion susceptibility testing. Amplification of whole cell and/or plasmid DNA recovered from the isolate using primers specific for the blaKPC carbapenemase g...

  12. Extended-spectrum beta-lactamase-producing Shigella strains in Israel, 2000-2004.

    PubMed

    Vasilev, V; Japheth, R; Yishai, R; Andorn, N; Valinsky, L; Navon-Venezia, S; Chmelnitsky, I; Carmeli, Y; Cohen, D

    2007-03-01

    Routine susceptibility testing of 5,616 Shigella isolates at the National Shigella Reference Centre in Israel over a 5-year period (2000-2004) revealed resistance to ceftriaxone in one strain of Shigella boydii 2 and in two strains each of Shigella flexneri 2a, S. flexneri 6, and Shigella sonnei. All seven isolates were confirmed as producers of extended-spectrum beta-lactamase (ESBL) by the combination disk method, the Vitek 1 system, and a modification of the double-disk synergy test, which is based on the inhibitory properties of clavulanic acid, tazobactam, and sulbactam. Tazobactam had the strongest effect in all seven strains. Molecular characterization of the ESBLs identified CTX-M-type enzymes, consisting of the CTX-M-9 group (n = 3), CTX-M-3 (n = 2), CTX-M-39 (n = 1), and CTX-M-2 group (n = 1). Three of the strains also carried bla-(OXA) genes and a bla-(TEM) gene. Although the prevalence of ESBLs in this study was low, further research is needed on the spread and transfer of resistance genes, both in hospitals and in the community. PMID:17265070

  13. Prevalence and Clonal Dissemination of Metallo-Beta-Lactamase-Producing Pseudomonas aeruginosa in Kermanshah

    PubMed Central

    Akya, Alisha; Salimi, Afsaneh; Nomanpour, Bizhan; Ahmadi, Kamal

    2015-01-01

    Background: Pseudomonas aeruginosa is an opportunistic pathogen associated with nosocomial infections. The emergence and dissemination of metallo-beta-lactamases (MBLs) has contributed to the high rate of resistance among P. aeruginosa isolates. Objectives: The purpose of this study was to describe the prevalence and the clonal dissemination of MBL- producing P. aeruginosa isolates collected from major hospitals in Kermanshah. Materials and Methods: Antibiotic susceptibility testing was performed using the minimal inhibitory concentrations. The MBLs were investigated using the Double-Disk Synergy Test (DDST) and Polymerase Chain Reaction. Molecular typing was performed by Pulsed-Field Gel Electrophoresis (PFGE). Results: Of the 60 P. aeruginosa isolates included in this study, 30 (50%) were resistant to Gentamicin, 38 (63.3%) to Piperacillin, 42 (70%) to Ceftazidime, and 45 (75%) to Cefepime. Twenty-nine (48.3%) isolates were MBL producers in the DDST test. Five (8.3%) isolates were positive for the VIM gene. PFGE analysis among the MBL producers revealed 12 distinct clonal patterns. Conclusions: The inter- and intra-hospital dissemination of resistant clones is a matter of concern and is an indicator of the level of the improvement and surveillance of standard hygiene, particularly disinfection and hand washing before and after contact with patients. Given the emergence of MBL-producing strains, surveillance has become an important procedure to control the transmission of resistant strains. PMID:26421137

  14. Insight into the Effect of Inhibitor Resistant S130G Mutant on Physico-Chemical Properties of SHV Type Beta-Lactamase: A Molecular Dynamics Study

    PubMed Central

    Baig, Mohd Hassan; Sudhakar, D. Raja; Kalaiarasan, Ponnusamy; Subbarao, Naidu; Wadhawa, Gulshan; Lohani, Mohtashim; Khan, M Kalim A; Khan, Asad U.

    2014-01-01

    Bacterial resistance is a serious threat to human health. The production of β-lactamase, which inactivates β-lactams is most common cause of resistance to the β-lactam antibiotics. The Class A enzymes are most frequently encountered among the four β-lactamases in the clinic isolates. Mutations in class A β-lactamases play a crucial role in substrate and inhibitor specificity. SHV and TEM type are known to be most common class A β-lactamases. In the present study, we have analyzed the effect of inhibitor resistant S130G point mutation of SHV type Class-A β-lactamase using molecular dynamics and other in silico approaches. Our study involved the use of different in silico methods to investigate the affect of S130G point mutation on the major physico-chemical properties of SHV type class A β-lactamase. We have used molecular dynamics approach to compare the dynamic behaviour of native and S130G mutant form of SHV β-lactamase by analyzing different properties like root mean square deviation (RMSD), H-bond, Radius of gyration (Rg) and RMS fluctuation of mutation. The results clearly suggest notable loss in the stability of S130G mutant that may further lead to decrease in substrate specificity of SHV. Molecular docking further indicates that S130G mutation decreases the binding affinity of all the three inhibitors in clinical practice. PMID:25479359

  15. Comparative possession of Shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase (ESBL) genes in Escherichia coli isolated from backyard and farmed poultry.

    PubMed

    Samanta, I; Joardar, S N; Das, P K; Sar, T K

    2015-01-01

    The present work was conducted to compare the occurrence of Escherichia coli possessing virulence and ESBL genes in backyard and farmed poultry. Three hundred and sixty samples from the poultry kept in backyard system and 120 samples from the farmed birds were collected from West Bengal, India. Among the E. coli isolates of backyard poultry (O2, O10, O25, O55, O60, O106, UT), none of them possessed any of the Shiga toxin genes and eight E. coli isolates (8/272; 2.9%) harboured eaeA gene alone. Whereas among the E. coli isolated from the farmed poultry (O17, O20, O22, O102, O114, O119, rough, UT), four isolates (4/78, 5.1%) harboured stx 1/stx 2 gene and 11 isolates (11/78, 14.1%) possessed eaeA gene. None of the E. coli isolates from the backyard poultry harboured any studied ESBL gene. Whereas 29.4% of E. coli isolates from the farmed poultry were found to possess the ESBL genes. PMID:27175158

  16. Comparative possession of Shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase (ESBL) genes in Escherichia coli isolated from backyard and farmed poultry

    PubMed Central

    Samanta, I.; Joardar, S. N.; Das, P. K.; Sar, T. K.

    2015-01-01

    The present work was conducted to compare the occurrence of Escherichia coli possessing virulence and ESBL genes in backyard and farmed poultry. Three hundred and sixty samples from the poultry kept in backyard system and 120 samples from the farmed birds were collected from West Bengal, India. Among the E. coli isolates of backyard poultry (O2, O10, O25, O55, O60, O106, UT), none of them possessed any of the Shiga toxin genes and eight E. coli isolates (8/272; 2.9%) harboured eaeA gene alone. Whereas among the E. coli isolated from the farmed poultry (O17, O20, O22, O102, O114, O119, rough, UT), four isolates (4/78, 5.1%) harboured stx1/stx2 gene and 11 isolates (11/78, 14.1%) possessed eaeA gene. None of the E. coli isolates from the backyard poultry harboured any studied ESBL gene. Whereas 29.4% of E. coli isolates from the farmed poultry were found to possess the ESBL genes. PMID:27175158

  17. Characterization of extended spectrum beta-lactamase-producing Klebsiella pneumoniae from Beijing, China.

    PubMed

    Shen, D; Winokur, P; Jones, R N

    2001-08-01

    Fourteen clinical isolates of Klebsiella pneumoniae with extended-spectrum beta-lactamases (ESBLs) were detected by the double disk synergy test and the Etest ESBL strip. Co-resistances included high MICs for aminoglycosides, fluoroquinolones, tetracyclines, and trimethoprim/sulphamethoxazole. Co-resistance was not observed in five of the 14 strains. These isolates were all genetically distinct as determined by the automated ribotyping method. Isoelectric focusing documented the presence of multiple beta-lactamases (one to four per isolate) with pIs ranging from 5.4 to 8.4. The majority of isolates contained beta-lactamases with pI values of 7.6 and 8.4 consistent with SHV-type ESBLs and an Amp C enzyme, respectively. Emerging ESBL strains in K. pneumoniae compromise the use of agents such as cefotaxime, ceftriaxone, ceftazidime in China; leading to the expansion of quality infection control practices and formulary management programmes to minimize clonal expansion. PMID:11516943

  18. Amp C beta-lactamase-producing Escherichia coli in neonatal meningitis: diagnostic and therapeutic challenge.

    PubMed

    Fakioglu, E; Queenan, A M; Bush, K; Jenkins, S G; Herold, B C

    2006-08-01

    Antibiotic resistance is a global health priority. Major defenses for Gram-negative bacteria are beta-lactamase enzymes, which have co-evolved with the development and increasing utilization of new antibiotics. Bacteria harboring the plasmid-mediated AmpC enzymes are increasingly prevalent among adult patients, but have not previously been reported in neonates. Early-onset neonatal meningitis caused by an AmpC beta-lactamase-producing Escherichia coli is described for the first time; the plasmid was identified as a transferable CMY-2 family beta-lactamase. Limited experience with newer antibiotics and pharmacokinetics in neonates presents a therapeutic challenge. Currently, there are no Clinical Laboratory Standards Institute (CLSI) recommendations for detecting AmpC nor is the optimal treatment for AmpC-producing organisms known. Thus, it is imperative that clinicians have a high index of suspicion when antimicrobial susceptibility patterns are inconsistent. Development of better microbiology screening tests to rapidly detect resistance is essential. Additionally, pharmacokinetic studies with newer antibiotics in neonates are warranted. PMID:16871223

  19. Is multiresistant Klebsiella pneumoniae New Delhi metallo-beta-lactamase (NDM-1) a new threat for kidney transplant recipients?

    PubMed

    Karczewski, M; Tomczak, H; Piechocka-Idasiak, I; Cichanska, L; Adamska, Z; Stronka, M

    2014-09-01

    Urinary tract infections (UTIs) are the most frequent infections among kidney transplant (KT) patients. This case documents the emergence of New Delhi metallo-beta-lactamase (NDM-1) Klebsiella pneumonia--a factor of recurrent post-KT UTI, leading to graft loss. Spreading globally, and multidrug resistant, NDM-1 may become a great threat to transplant patients all over the world. PMID:25242796

  20. Studies on structure-based sequence alignment and phylogenies of beta-lactamases.

    PubMed

    Salahuddin, Parveen; Khan, Asad U

    2014-01-01

    The β-lactamases enzymes cleave the amide bond in β-lactam ring, rendering β-lactam antibiotics harmless to bacteria. In this communication we have studied structure-function relationship and phylogenies of class A, B and D beta-lactamases using structure-based sequence alignment and phylip programs respectively. The data of structure-based sequence alignment suggests that in different isolates of TEM-1, mutations did not occur at or near sequence motifs. Since deletions are reported to be lethal to structure and function of enzyme. Therefore, in these variants antibiotic hydrolysis profile and specificity will be affected. The alignment data of class A enzyme SHV-1, CTX-M-15, class D enzyme, OXA-10, and class B enzyme VIM-2 and SIM-1 show sequence motifs along with other part of polypeptide are essentially conserved. These results imply that conformations of betalactamases are close to native state and possess normal hydrolytic activities towards beta-lactam antibiotics. However, class B enzyme such as IMP-1 and NDM-1 are less conserved than other class A and D studied here because mutation and deletions occurred at critically important region such as active site. Therefore, the structure of these beta-lactamases will be altered and antibiotic hydrolysis profile will be affected. Phylogenetic studies suggest that class A and D beta-lactamases including TOHO-1 and OXA-10 respectively evolved by horizontal gene transfer (HGT) whereas other member of class A such as TEM-1 evolved by gene duplication mechanism. Taken together, these studies justify structure-function relationship of beta-lactamases and phylogenetic studies suggest these enzymes evolved by different mechanisms. PMID:24966539

  1. Studies on structure-based sequence alignment and phylogenies of beta-lactamases

    PubMed Central

    Salahuddin, Parveen; Khan, Asad U

    2014-01-01

    The β-lactamases enzymes cleave the amide bond in β-lactam ring, rendering β-lactam antibiotics harmless to bacteria. In this communication we have studied structure-function relationship and phylogenies of class A, B and D beta-lactamases using structure-based sequence alignment and phylip programs respectively. The data of structure-based sequence alignment suggests that in different isolates of TEM-1, mutations did not occur at or near sequence motifs. Since deletions are reported to be lethal to structure and function of enzyme. Therefore, in these variants antibiotic hydrolysis profile and specificity will be affected. The alignment data of class A enzyme SHV-1, CTX-M-15, class D enzyme, OXA-10, and class B enzyme VIM-2 and SIM-1 show sequence motifs along with other part of polypeptide are essentially conserved. These results imply that conformations of betalactamases are close to native state and possess normal hydrolytic activities towards beta-lactam antibiotics. However, class B enzyme such as IMP-1 and NDM-1 are less conserved than other class A and D studied here because mutation and deletions occurred at critically important region such as active site. Therefore, the structure of these beta-lactamases will be altered and antibiotic hydrolysis profile will be affected. Phylogenetic studies suggest that class A and D beta-lactamases including TOHO-1 and OXA-10 respectively evolved by horizontal gene transfer (HGT) whereas other member of class A such as TEM-1 evolved by gene duplication mechanism. Taken together, these studies justify structure-function relationship of beta-lactamases and phylogenetic studies suggest these enzymes evolved by different mechanisms. PMID:24966539

  2. OXA-46, a new class D beta-lactamase of narrow substrate specificity encoded by a blaVIM-1-containing integron from a Pseudomonas aeruginosa clinical isolate.

    PubMed

    Giuliani, Francesco; Docquier, Jean-Denis; Riccio, Maria Letizia; Pagani, Laura; Rossolini, Gian Maria

    2005-05-01

    A novel OXA-type enzyme, named OXA-46, was found to be encoded by a gene cassette inserted into a class 1 integron from a multidrug-resistant Pseudomonas aeruginosa clinical isolate. The variable region of the integron also contained a bla(VIM-1) metallo-beta-lactamase cassette and a duplicated aacA4 aminoglycoside acetyltransferase cassette. OXA-46 belongs to the OXA-2 lineage of class D beta-lactamases. It exhibits 78% sequence identity with OXA-2 and the highest similarity (around 92% identity) with another OXA-type enzyme detected in clinical isolates of Burkholderia cepacia and in unidentified bacteria from a wastewater plant. Expression of bla(OXA-46) in Escherichia coli decreased susceptibility to penicillins and narrow-spectrum cephalosporins but not to extended-spectrum cephalosporins, cefsulodin, aztreonam, or carbapenems. The enzyme was overproduced in E. coli and purified by two anion-exchange chromatography steps (approximate yield, 6 mg/liter). OXA-46 was made of a 28.5-kDa polypeptide and exhibited an alkaline pI (7.8). In its native form OXA-46 appeared to be dimeric, and the oligomerization state was not affected by EDTA. Kinetic analysis of OXA-46 revealed a specificity for narrow-spectrum substrates, including oxacillin, other penicillins (but not temocillin), and narrow-spectrum cephalosporins. The enzyme apparently did not interact with temocillin, oxyimino-cephalosporins, or aztreonam. OXA-46 was inactivated by tazobactam and carbapenems and, although less efficiently, also by clavulanic acid. Enzyme activity was not affected either by EDTA or by divalent cations and exhibited low susceptibility to NaCl. These findings underscore the functional and structural diversity that can be encountered among class D beta-lactamases. PMID:15855521

  3. Prevalence of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates in Nosocomial and Community-Acquired Urinary Tract Infections

    PubMed Central

    Latifpour, Mohammad; Gholipour, Abolfazl; Damavandi, Mohammad Sadegh

    2016-01-01

    Background Klebsiella pneumoniae is a family member of Enterobacteriaceae. Isolates of K. pneumoniae produce enzymes that cause decomposition of third generation cephalosporins. These enzymes are known as extended-spectrum beta-lactamase (ESBL). Resistance of K. pneumoniae to beta-lactamase antibiotics is commonly mediated by beta-lactamase genes. Objectives The aim of this study was to identify the ESBL produced by K. pneumoniae isolates that cause community-acquired and nosocomial urinary tract infections within a one-year period (2013 to 2014) in Kashani and Hajar university hospitals of Shahrekord, Iran. Patients and Methods From 2013 to 2014, 150 strains of K. pneumoniae isolate from two different populations with nosocomial and community-acquired infections were collected. The strains were then investigated by double disk synergism and multiplex polymerase chain reaction (PCR). Results The study population of 150 patients with nosocomial and community-acquired infections were divided to two groups of 75 each. We found that 48 of the K. pneumoniae isolates in the patients with nosocomial infection and 39 isolates in those with community-acquired infections produced ESBL. The prevalence of TEM1, SHV1 and VEB1 in ESBL-producing isolates in nosocomial patients was 24%, 29.3% and 10.6%, and in community-acquired patients, 17.3%, 22.7% and 8%, respectively. Conclusions The prevalence of ESBL-producing K. pneumoniae isolate is of great concern; therefore, continuous investigation seems essential to monitor ESBL-producing bacteria in patients with nosocomial and community-acquired infections. PMID:27226874

  4. qnrA prevalence in extended-spectrum beta-lactamase-positive Enterobacteriaceae isolates from Turkey.

    PubMed

    Oktem, I Mehmet Ali; Gulay, Zeynep; Bicmen, Meral; Gur, Deniz

    2008-01-01

    Quinolone resistance mostly originates from chromosomal mutations. In recent years, however, plasmid-mediated quinolone resistance has been reported in several parts of the world. Plasmid-borne qnrA, qnrB, or qnrS genes are responsible for this kind of resistance. Little is known about the diversity, type, and species range of the qnr genes in Turkey. We screened qnrA, qnrB, and qnrS genes in quinolone-resistant blood culture isolates collected from six different medical centers in Turkey which produced extended-spectrum beta-lactamases (ESBLs). A total of 78 ESBL-positive isolates were enrolled in this study. Of these, 37 (47.4%) were nalidixic-acid resistant or intermediate. qnrA was found on large plasmids isolated from five (6.4%) of the Nal(I/R) isolates. In three of these, the same plasmid also carried bla(CTX-M). Four of the qnrA-positive isolates were Klebsiella pneumoniae from Dokuz Eylul University Hospital, Izmir, and the fifth isolate was Escherichia coli from Istanbul University Hospital. Two of the isolates from Izmir were found by enterobacterial repetitive interegenic consensus sequence-PCR to be clonally related. This is the first report on the qnrA prevalence among ESBL-positive blood culture isolates collected from different regions in Turkey. According to our results, plasmid-mediated resistance is a potential problem for the spread of quinolone resistance, and this mechanism could be emerging strongly among the ESBL-positive Enterobacteriaceae in Turkey. PMID:18219128

  5. Trends in Extended Spectrum Beta-Lactamase (ESBL) Producing Enterobacteriaceae and ESBL Genes in a Dutch Teaching Hospital, Measured in 5 Yearly Point Prevalence Surveys (2010-2014)

    PubMed Central

    Willemsen, Ina; Oome, Stijn; Verhulst, Carlo; Pettersson, Annika; Verduin, Kees; Kluytmans, Jan

    2015-01-01

    This paper describes the trends in prevalence of ESBL producing Enterobacteriaceae (ESBL-E) and ESBL genes, measured in five consecutive yearly Point Prevalence Surveys (PPS). All patients present in the hospital and in a day-care clinic (including patients on dialysis) on the day of the survey, were screened for perianal ESBL-E carriage. Perianal swabs were taken and cultured using an enrichment broth and a selective agar plate. Both phenotypic and genotypic methods were used to detect the production of ESBL, presence of ESBL-genes and clonal relatedness. Out of 2,695 patients, 135 (5.0%) were tested ESBL-E positive. The overall ESBL-E prevalence was stable over the years. Overall 5.2% of all ESBL-E were acquired by nosocomial transmission. A relative decrease of CTX-M-1-1-like ESBL genes (from 44 to 25%, p = 0.026) was observed, possibly related to the strong (>60%) decrease in antibiotic use in livestock in our country during the same period. PMID:26528549

  6. Extended-spectrum beta-lactamases among Enterobacteriaceae isolated in a public hospital in Brazil.

    PubMed

    Dropa, Milena; Balsalobre, Livia C; Lincopan, Nilton; Mamizuka, Elsa M; Murakami, Thays; Cassettari, Valéria C; Franco, Fábio; Guida, Stella M; Balabakis, Angelica J; Passadore, Lilian F; Santos, Silvia R; Matté, Glavur R; Matté, Maria H

    2009-01-01

    Extended-spectrum beta-lactamases (ESBL) in enterobacteria are recognized worldwide as a great hospital problem. In this study, 127 ESBL-producing Enterobacteriaceae isolated in one year from inpatients and outpatients at a public teaching hospital at São Paulo, Brazil, were submitted to analysis by PCR with specific primers for bla SHV, bla TEM and bla CTX-M genes. From the 127 isolates, 96 (75.6%) Klebsiella pneumoniae, 12 (9.3%) Escherichia coli, 8 (6.2%) Morganella morganii, 3 (2.3%) Proteus mirabilis, 2 (1.6%) Klebsiella oxytoca, 2 (1.6%) Providencia rettgeri, 2 (1.6%) Providencia stuartti, 1 (0.8%) Enterobacter aerogenes and 1 (0.8%) Enterobacter cloacae were identified as ESBL producers. Bla SHV, bla TEM and bla CTX-M were detected in 63%, 17.3% and 33.9% strains, respectively. Pulsed field gel eletrophoresis genotyping of K. pneumoniae revealed four main molecular patterns and 29 unrelated profiles. PCR results showed a high variety of ESBL groups among strains, in nine different species. The results suggest the spread of resistance genes among genetically different strains of ESBL-producing K. pneumoniae in some hospital wards, and also that some strongly related strains were identified in different hospital wards, suggesting clonal spread in the institutional environment. PMID:19739000

  7. Activities of beta-lactam antibiotics against Escherichia coli strains producing extended-spectrum beta-lactamases.

    PubMed

    Jacoby, G A; Carreras, I

    1990-05-01

    Seven extended-spectrum beta-lactamases related to TEM and four enzymes derived from SHV-1 were transferred to a common Escherichia coli host so that the activity of a variety of beta-lactams could be tested in a uniform genetic environment. For most derivatives, penicillinase activity was 10% or less than that of strains making TEM-1, TEM-2, or SHV-1 beta-lactamase, suggesting that reduced catalytic efficiency accompanied the broader substrate spectrum. Despite this deficit, resistance to aztreonam, carumonam, cefdinir, cefepime, cefixime, cefmenoxime, cefotaxime, cefotiam, cefpirome, cefpodoxime, ceftazidime, ceftibuten, ceftizoxime, ceftriaxone, cefuroxime, and E1040 was enhanced. For strains producing TEM-type enzymes, however, MICs of carumonam, cefepime, cefmenoxime, cefotiam, cefpirome, and ceftibuten were 8 micrograms/ml or less. Susceptibilities of cefmetazole, cefotetan, cefoxitin, flomoxef, imipenem, meropenem, moxalactam, temocillin, FCE 22101, and Sch 34343 were unaffected. FCE 22101, imipenem, meropenem, and Sch 34343 were inhibitory for all strains at 1 microgram/ml or less. In E. coli an OmpF- porin mutation in combination with an extended-spectrum beta-lactamase enhanced resistance to many of these agents, but generally by only fourfold. Hyperproduction of chromosomal AmpC beta-lactamase increased resistance to 7-alpha-methoxy beta-lactams but not that to temocillin. When tested at 8 micrograms/ml, clavulanate was more potent than sulbactam or tazobactam in overcoming resistance to ampicillin, while cefoperazone-sulbactam was more active than ticarcillin-clavulanate or piperacillin-tazobactam, especially against TEM-type extended-spectrum beta-lactamases. PMID:2193623

  8. The prevalence of Escherichia coli strains with extended spectrum beta-lactamases isolated in China

    PubMed Central

    Liu, Haihong; Wang, Yueling; Wang, Gang; Xing, Quantai; Shao, Lihua; Dong, Xiaomeng; Sai, Lintao; Liu, Yongjuan; Ma, Lixian

    2015-01-01

    The extended-spectrum-lactamases-producing Escherichia coli has rapidly spread worldwide. Escherichia coli has been becoming much more resistant to β-lactam antibiotics and other commonly available antimicrobials. We investigated the prevalence, resistance, and probable gene type of extended spectrum beta-lactamases (ESBLs) using minimum inhibitory concentrations (MICs) testing and polymerase chain reaction (PCR). We have collected 289 single-patient E. coli Isolates based on samples of China from July 2013 to August 2014. This article explored that the prevalence of ESBL-producing Isolates showed multi-resistant to antimicrobials such as fluoroquinolones, trimethoprim, tetracycline and aminoglycosides, and so on. The frequencies of resistance in Isolates were as follows: Ciprofloxacin, 74%, gentamicin, 69.5%, levofloxacin, 63%, tobramycin, 39%, and minocycline, 7.9%. According to our results, 197(68.2%) of the total 289 Isolates were ESBL-producing strains; further, 172 (87.3%) producers contained genes encoding CTX-M enzymes and 142(72.1%) producers contained genes encoding TEM enzymes. Most ESBL-producing Escherichia coli has produced more than one type of β-lactamase. Nucleotide sequence analysis has revealed the diversity of ESBLs types: CTX-M -15 is in the majority and TEM-135, CTX-M-3, CTX-M-98, CTX-M-14, CTX-M-142, CTX-M-65, CTX-M-55, CTX-M-27, and CTX-M-123 have been recovered. The results confirm that ESBL producers which are common in hospital strains of Escherichia coli are resistant to cephalosporins and other antibiotics in China. It is important to monitor such strains closely and provide scientific evidence of rational application of antibiotics to prevent their spread. PMID:25954262

  9. Evaluation of the new VITEK 2 extended-spectrum beta-lactamase (ESBL) test for rapid detection of ESBL production in Enterobacteriaceae isolates.

    PubMed

    Spanu, Teresa; Sanguinetti, Maurizio; Tumbarello, Mario; D'Inzeo, Tiziana; Fiori, Barbara; Posteraro, Brunella; Santangelo, Rosaria; Cauda, Roberto; Fadda, Giovanni

    2006-09-01

    Extended-spectrum beta-lactamases (ESBLs) are a large, rapidly evolving group of enzymes that confer resistance to oxyimino cephalosporins and monobactams and are inhibited by clavulanate. Rapid reliable detection of ESBL production is a prerequisite for successful infection management and for monitoring resistance trends and implementation of intervention strategies. We evaluated the performance of the new VITEK 2 ESBL test system (bioMérieux, Inc, Hazelwood, Mo.) in the identification of ESBL-producing Enterobacteriaceae isolates. We examined a total of 1,129 clinically relevant Enterobacteriaceae isolates (including 218 that had been previously characterized). The ESBL classification furnished by the VITEK 2 ESBL test system was concordant with that of the comparison method (molecular identification of beta-lactamase genes) for 1,121 (99.3%) of the 1,129 isolates evaluated. ESBL production was correctly detected in 306 of the 312 ESBL-producing organisms (sensitivity, 98.1%; positive predictive value, 99.3%). False-positive results emerged for 2 of the 817 ESBL-negative isolates (specificity, 99.7%; negative predictive value, 99.3%). VITEK 2 ESBL testing took 6 to 13 h (median, 7.5 h; mean +/- SD, 8.2 +/- 2.39 h). This automated short-incubation system appears to be a rapid and reliable tool for routine identification of ESBL-producing isolates of Enterobacteriaceae. PMID:16954257

  10. Prevalence of plasmid-mediated AmpC beta-lactamases among Enterobacteriaceae in Algiers hospitals.

    PubMed

    Iabadene, Hassen; Messai, Yamina; Ammari, Houria; Alouache, Souhila; Verdet, Charlotte; Bakour, Rabah; Arlet, Guillaume

    2009-10-01

    The aim of this study was to investigate the prevalence and diversity of plasmid-mediated AmpC cephalosporinases (PAcBLs) in clinical isolates of Enterobacteriaceae collected between 2003 and 2007 from three Algiers hospitals. Antibiograms were determined on Mueller-Hinton agar plates using the disk diffusion method, and minimum inhibitory concentrations were determined by Etest. Isolates resistant to cefoxitin or ceftazidime were screened for bla(CMY), bla(DHA), bla(FOX) and bla(ACC) as well as extended-spectrum beta-lactamase (ESBL) genes by polymerase chain reaction (PCR). PCR products were sequenced by the Sanger method. Plasmid incompatibility grouping was conducted by PCR-based replicon typing. The prevalence of PAcBLs was 2.18% (11/505), comprising 8 CMY-2 and 3 DHA-1 enzymes. CTX-M-15 was co-produced with CMY-2 in three isolates and with DHA-1 in one isolate; the two remaining DHA-1-producers co-expressed SHV-12 ESBL. This is the first report of plasmid-mediated AmpC from Algeria, with the first detection of DHA-1 in Enterobacter cloacae. PMID:19570655

  11. NDM-1 (New Delhi metallo beta lactamase-1) producing Gram-negative bacilli: Emergence & clinical implications

    PubMed Central

    Fomda, Bashir Ahmad; Khan, Asiya; Zahoor, Danish

    2014-01-01

    Backgound & objectives: Resistance to carbapenems in Gram-negative bacteria conferred by NDM-1 is a global health problem. We investigated the occurrence of NDM-1 in clinical isolates of Gram-negative bacilli in a tertiary care hospital in Kashmir valley, India. Methods: Gram-negative bacilli from different clinical isolates were included in the study. Antimicrobial susceptibility was performed by Kirby Bauer disk diffusion method and interpreted using Clinical Laboratory Standards Institute (CLSI) guidelines. Isolates resistant to carbapenems were subjected to different phenotypic test such as modified Hodge test (MHT), boronic acid and oxacillin based MHT (BA-MHT and OXA-MHT), combined disk test and minimum inhibitory concentration (MIC) with imipenem and imipenem -EDTA for determination of class B metallo enzymes. Presence of blaNDM-1 gene was established by PCR and confirmed by sequencing. Results: Of the total 1625 Gram-negative isolates received, 100 were resistant to imipenem. Of the 100 isolates, 55 (55%) were positive by modified Hodge test indicating carbapenemase production. Of the 100 isolates tested by MHT, BA-MHT and OXA-MHT, 29 (29%) isolates belonged to Class A and 15 (15%) to Class B, while 56 (56%) isolates were negative. Of the 15 class B metallo beta lactamase producers, nine carried the blaNDM-1 gene. NDM-1 was found among Escherichia coli (2 isolates), Klebsiella pneumoniae (2 isolates), Citrobacter freundii (3 isolates), Acinetobacter spp (1 isolate), and one isolate of Pseudomonas aeruginosa. Isolates were resistant to all antibiotic tested except polymyxin B and tigecycline. Interpretation & conclusions: Our study showed the presence of clinical isolates expressing NDM-1 in Srinagar, Jammu & Kashmir, India. These isolates harbour plasmid mediated multiple drug resistant determinants and can disseminate easily across several unrelated genera. To halt their spread, early identification of these isolates is mandatory. PMID:25579151

  12. Comparison between phenotypic and PCR for detection of OXA-23 type and metallo-beta-lactamases producer Acinetobacter spp.

    PubMed Central

    Azimi, Leila; Lari, Abdolaziz Rastegar; Talebi, Malihe; Namvar, Amirmorteza Ebrahimzadeh; Jabbari, Mosadegh

    2013-01-01

    Background: Resistance to carbapenems is developing around the world and can cause many problems for treatment of patients. Production of metallo-beta-lactamase (MBL) is one of the main mechanism for this type of resistance. So, detection of MBL-producer microorganisms can prevent the spread of this type of resistance. Materials and methods: In this study 94 Acinetobacter spp. were investigated. Resistance to imipenem was conducted after purification and identification. Combination disc (CD) and Double Disc Synergy Test (DDST) were performed for phenotypic detection of MBL and the molecular PCR method was done for vim-1, vim-2, imp-1 and OXA-23 genes. Results: According to TSI, SIM and oxidation-fermentation (OF) test and PCR assay 93 Acinetobacter baumannii and one strain Acinetobacter lwoffii were identified. 85% of them were resistant to imipenem. 34% of them have a positive combination disc test (CD) while Double Disc Synergy Test (DDST) was negative for all of them. The vim-1, vim-2 and imp-1 genes were not detected in PCR molecular method, however in 74% of strains with positive results in combination disc, were positive for the OXA-23 gene after PCR test. This study shows that the blaOXA-23 resistance determinant may become an emerging therapeutic problem. Discussion: According to the results, it seems that combination disc does not have enough specificity for detection of MBL-producer Acinetobacter and using Double Disc Synergy Test (DDST) can be more convenient. PMID:24327942

  13. Nuclear magnetic resonance spectrometric assay of beta-lactamase.

    PubMed Central

    Kono, M; O'Hara, K; Shiomi, Y

    1980-01-01

    Beta-Lactam antibiotics and the crude enzyme were mixed in deuterium oxide and placed in a nuclear magnetic resonance tube. The change of the nuclear magnetic resonance spectrum during the enzymatic reaction was then analyzed to determine beta-lactamase activity. By using beta-lactam antibiotics such as penicillins, cephalosporins, and cephamycins as substrates, a comparison of the beta-lactamase activities was made between the nuclear magnetic resonance spectrometric assay and the iodometric assay. There was a close correlation between these two methods. PMID:6986114

  14. Ligand-Dependent Disorder of Loop Observed in Extended-Spectrum SHV-Type beta-Lactamase

    SciTech Connect

    J Sampson; W Ke; C Bethel; S Pagadala; M Nottingham; R Bonomo; J Buynak; F van den Akker

    2011-12-31

    Among Gram-negative bacteria, resistance to {beta}-lactams is mediated primarily by {beta}-lactamases (EC 3.2.6.5), periplasmic enzymes that inactivate {beta}-lactam antibiotics. Substitutions at critical amino acid positions in the class A {beta}-lactamase families result in enzymes that can hydrolyze extended-spectrum cephalosporins, thus demonstrating an 'extended-spectrum' {beta}-lactamase (ESBL) phenotype. Using SHV ESBLs with substitutions in the {Omega} loop (R164H and R164S) as target enzymes to understand this enhanced biochemical capability and to serve as a basis for novel {beta}-lactamase inhibitor development, we determined the spectra of activity and crystal structures of these variants. We also studied the inactivation of the R164H and R164S mutants with tazobactam and SA2-13, a unique {beta}-lactamase inhibitor that undergoes a distinctive reaction chemistry in the active site. We noted that the reduced K{sub i} values for the R164H and R164S mutants with SA2-13 are comparable to those with tazobactam (submicromolar). The apo enzyme crystal structures of the R164H and R164S SHV variants revealed an ordered {Omega} loop architecture that became disordered when SA2-13 was bound. Important structural alterations that result from the binding of SA2-13 explain the enhanced susceptibility of these ESBL enzymes to this inhibitor and highlight ligand-dependent {Omega} loop flexibility as a mechanism for accommodating and hydrolyzing {beta}-lactam substrates.

  15. In vitro antibacterial activity and beta-lactamase stability of a new carbapenem, BO-2727.

    PubMed Central

    Inoue, K; Hamana, Y; Mitsuhashi, S

    1995-01-01

    The in vitro activity of BO-2727, a new carbapenem, was compared with those of meropenem, biapenem, imipenem, and ceftazidime. BO-2727 was four- or eightfold more active than the other carbapenems against methicillin-resistant staphylococci and Pseudomonas aeruginosa strains, including imipenem- and ceftazidime-resistant bacteria. BO-2727 was quite stable to penicillinases, cephalosporinases, and oxyiminocephalosporinases, but not to metallo-beta-lactamase. Time-kill studies against Staphylococcus aureus Smith, Escherichia coli ML4707, and P. aeruginosa GN11189 showed that BO-2727 has potent bactericidal activity at concentrations greater than the MIC. PMID:8619591

  16. Metallo-beta-lactamase inhibitory activity of phthalic acid derivatives.

    PubMed

    Hiraiwa, Yukiko; Morinaka, Akihiro; Fukushima, Takayoshi; Kudo, Toshiaki

    2009-09-01

    4-Butyl-3-methylphthalic acid was recognized as a metallo-beta-lactamase inhibitor. The structure-activity relationship study of substituted phthalic acids afforded 3-phenylphthalic acid derivatives as potent IMP-1 inhibitors. On the other hand, 3-substituted with 4-hydroxyphenyl phthalic acid derivative displayed a potent combination effect with biapenem (BIPM) against Pseudomonas aeruginosa that produce IMP-1. PMID:19632114

  17. Community faecal carriage of extended-spectrum beta-lactamase-producing Enterobacteriaceae in french children

    PubMed Central

    2012-01-01

    Background The increasing incidence of community acquired infection due to Extended-Spectrum Beta-Lactamase (ESBL) -Producing Enterobacteriaceae represent a great concern because there are few therapeutic alternatives. The fecal flora of children in the community can represent a reservoir for ESBLs genes which are located on highly transmissible plasmids and the spread of these genes among bacterial pathogens is concerning. Because intestinal carriage is a key factor in the epidemiology of ESBL-producing Enterobacteriaceae, the study of the prevalence of these resistant bacteria and risk factors in young children is of particular interest. Methods We assessed the prevalence and risk factors of community-acquired faecal carriage of extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae in children aged from 6 to 24 months, by means of rectal swabbing in community pediatric practices. Child’s lifestyle and risk factors for carriage of resistant bacteria were noted. Results Among the 411 children enrolled, 4.6% carried ESBL-producing Enterobacteriaceae. CTX-M-1, CTX-M-15 and CTX-M-14 were the predominant ESBLs. The 18 E. coli isolates were genetically heterogeneous. Recent third-generation oral-cephalosporin exposure was associated with a higher risk of ESBL carriage (AOR=3.52, 95% CI[1.06-11.66], p=0.04). Conclusions The carriage rate of ESBL-producing Enterobacteriacae in young children in the French community setting is noteworthy, underlining the importance of this population as a reservoir. Exposure to third-generation oral cephalosporins was associated with a significant risk of ESBL carriage in our study. Because of the significant public health implications including the treatment of community-acquired urinary tract infections, the spread of organisms producing ESBLs in the community merits close monitoring with enhanced efforts for surveillance. PMID:23171127

  18. Prevalence of extended-spectrum beta-lactamases produced by nosocomial isolates of Enterobacteriaceae in Trakya University Hospital, Turkey.

    PubMed

    Akata, F; Tatman-Otkun, M; Ozkan, E; Tansel, O; Otkun, M; Tugrul, M

    2003-07-01

    The prevalence of extended-spectrum beta-lactamase (ESBL) production by 194 nosocomial isolates of Enterobacteriacea recovered from 1995 to 1999 was investigated. The ESBL production was determined by the double-disk synergy test and was confirmed by the E-test ESBL strip. Twenty-three isolates (21 Klebsiella pneumoniae, one Escherichia coli, one Providencia rettgeri) were found as ESBL-producers (11.8%). These isolates were also usually resistant to non-betalactam antibiotics. Most of them contained a beta-lactamase with a pI of 7.6. All the strains conjugally transferred their ESBLs to recipient E. coli. Contrary to others, ESBL-producing K. pneumoniae strains isolated in 1999 were resistant to ciprofloxacin, and had the identical plasmid profiles suggestive of an outbreak. Ciprofloxacin resistance in these strains could not be transferred. In conclusion, K. pneumoniae was the main ESBL-producing species among nosocomial isolates of Enterobacteriacae in our hospital. PMID:12901421

  19. [First outbreak report of VIM-1 metallo-beta-lactamase producing Pseudomonas aeruginosa in Japan].

    PubMed

    Miki, Kanji; Takegawa, Hiroshi; Etoh, Masaaki; Hayashi, Michio; Haruta, Tsunekazu; Yamane, Kunikazu; Arakawa, Yoshichika

    2010-11-01

    VIM-1 metallo-beta-lactamase (MBL) producing Pseudomonas aeruginosa was isolated from 35 Kobe City Medical Center General Hospital patients from September 2007 to July 2008. All but one were highly resistant to all beta-lactams, aminoglycoside, and fluoroquinolone, and one susceptible to amikacin. Strains negative to a disk diffusion screening test using sodium mercaptoacetate for detecting MBL numbered 35. PCR for MBL indicated all strains were positive for bla(VIWM-1). These strains were indistinguishable by pulsed-field gel electrophoresis, indicating an outbreak of infections caused by VIM-1 MBL producing Pseudomonas aeruginosa. After intervention to control contact, the outbreak was controlled. PMID:21226324

  20. Impact of the New Delhi metallo-beta-lactamase on beta-lactam antibiotics

    PubMed Central

    Zmarlicka, Monika T; Nailor, Michael D; Nicolau, David P

    2015-01-01

    Since the first New Delhi metallo-beta-lactamase (NDM) report in 2009, NDM has spread globally causing various types of infections. NDM-positive organisms produce in vitro resistance phenotypes to carbapenems and many other antimicrobials. It is thus surprising that the literature examining clinical experiences with NDM does not report corresponding poor clinical outcomes. There are many instances where good clinical outcomes are described, despite a mismatch between administered antimicrobials and resistant in vitro susceptibilities. Available in vitro data for either monotherapy or combination therapy does not provide an explanation for these observations. However, animal studies do begin to shed more light on this phenomenon. They imply that the in vivo expression of NDM may not confer clinical resistance to all cephalosporin and carbapenem antibiotics as predicted by in vitro testing but other resistance mechanisms need to be present to generate a resistant phenotype. As such, previously abandoned therapies, particularly carbapenems and beta-lactamase inhibitor combinations, may retain utility against infections caused by NDM producers. PMID:26345624

  1. Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli Isolates possessing the plasmid-mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in intensive care units of a Chinese hospital.

    PubMed

    Cai, Jia Chang; Zhou, Hong Wei; Zhang, Rong; Chen, Gong-Xiang

    2008-06-01

    Twenty-one Serratia marcescens, ten Klebsiella pneumoniae, and one Escherichia coli isolate with carbapenem resistance or reduced carbapenem susceptibility were recovered from intensive care units (ICUs) in our hospital. Enterobacterial repetitive intergenic consensus-PCR and pulsed-field gel electrophoresis demonstrated that all the S. marcescens isolates belonged to a clonal strain and the 10 K. pneumoniae isolates were indistinguishable or closely related to each other. The MICs of imipenem, meropenem, and ertapenem for all isolates were 2 to 8 microg/ml, except for K. pneumoniae K10 (MICs of 128, 256, and >256 microg/ml). Isoelectric focusing, PCRs, and DNA sequencing indicated that all S. marcescens isolates produced KPC-2 and a beta-lactamase with a pI of 6.5. All K. pneumoniae isolates produced TEM-1, KPC-2, CTX-M-14, and a beta-lactamase with a pI of 7.3. The E. coli E1 isolate produced KPC-2, CTX-M-15, and a beta-lactamase with a pI of 7.3. Conjugation studies with E. coli (EC600) resulted in the transfer of reduced carbapenem susceptibility compared to that of the original isolates, and only the bla(KPC-2) gene was detected in E. coli transconjugants. Plasmid restriction analysis showed identical restriction patterns among all E. coli transconjugants. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and ompK35/36 gene sequence analysis of outer membrane proteins revealed that K. pneumoniae K10 failed to express OmpK36, because of insertional inactivation by an insertion sequence ISEcp1. All these results indicate that KPC-2-producing S. marcescens, K. pneumoniae, and E. coli isolates emerged in ICUs in our hospital. KPC-2 combined with porin deficiency results in high-level carbapenem resistance in K. pneumoniae. The same bla(KPC-2)-encoding plasmid was spread among the three different genera. PMID:18332176

  2. RESULTS OF MONITORING METALLO-BETA-LACTAMASE-PRODUCING STRAINS OF PSEUDOMONAS AERUGINOSA IN A MULTI-PROFILE HOSPITAL.

    PubMed

    Shamaeva, S K; Portnyagina, U S; Edelstein, M V; Kuzmina, A A; Maloguloval, S; Varfolomeeva, N A

    2015-01-01

    The authors present the results of long-term monitoring of metallo-beta-lactamase (MBL) producing strains of Pseudomonas aeruginosa in the Republican Hospital No 2 of Yakutsk, Russian Federation. Hospitals across Russia, as well as the rest of the world, face a rapid appearance and a virtually unchecked spread of multiresistant and panresistant nosocomial pathogens. Especially prevalent are multidrug-resistant isolates of P. aeruginosa, most often found among the patients of intensive care and intensive therapy units, as well as surgery departments. The aim of this study is to investigate the prevalence of metallo-beta-lactamase-producing strains of P. aeruginosa in a multi-profile hospital. 2,135 isolates of P. aeruginosa were studied, collected during a time span of seven years (2008-2014) from clinical specimens of hospitalised patients in acute surgery, purulent surgery, neurosurgery, otolaryngology, coloproctology departments, intensive care and intensive therapy, burn units, as well as intensive care unit for patients with acute cerebrovascular accidents and coronary care unit. Strains were identified and re-identified using established methods, NEFERMtest 24 (MICROLATEST) biochemical microtest and API (bioMerieux) test systems were used. For all carbapenem-resistant strains a phenotype screening for MBL was performed using the double-disks method with EDTA. In order to identify VIM-type and IMP-type MBL genes a real-time multiplex polymerase chain reaction was used. Among the investigated strains the largest number of P. aeruginosa - 35.6% (761 isolates) was found in patients at intensive care and intensive therapy units. Clonal expansion of extensively drug-resistant strain P. aeruginosa ST235 (VIM-2) was determined, the resistance mechanism of which is connected to MBL. Sensitivity determination of MBL-producing isolates of P. aeruginosa has shown that isolated strains have a high level of resistance (100%) to all tested antibacterial agents: piperacillin

  3. The Deacylation Mechanism of AmpC [beta]-Lactamase at Ultrahigh Resolution

    SciTech Connect

    Chen, Yu; Minasov, George; Roth, Tomer A.; Prati, Fabio; Shoichet, Brian K.

    2010-03-05

    {beta}-Lactamases confer bacterial resistance to {beta}-lactam antibiotics, such as penicillins. The characteristic class C {beta}-lactamase AmpC catalyzes the reaction with several key residues including Ser64, Tyr150, and Lys67. Here, we describe a 1.07 {angstrom} X-ray crystallographic structure of AmpC {beta}-lactamase in complex with a boronic acid deacylation transition-state analogue. The high quality of the electron density map allows the determination of many proton positions. The proton on the Tyr150 hydroxyl group is clearly visible and is donated to the boronic oxygen mimicking the deacylation water. Meanwhile, Lys67 hydrogen bonds with Ser64O{gamma}, Asn152O{delta}1, and the backbone oxygen of Ala220. This suggests that this residue is positively charged and has relinquished the hydrogen bond with Tyr150 observed in acyl-enzyme complex structures. Together with previous biochemical and NMR studies, these observations indicate that Tyr150 is protonated throughout the reaction coordinate, disfavoring mechanisms that involve a stable tyrosinate as the general base for deacylation. Rather, the hydroxyl of Tyr150 appears to be well positioned to electrostatically stabilize the negative charge buildup in the tetrahedral high-energy intermediate. This structure, in itself, appears consistent with a mechanism involving either Tyr150 acting as a transient catalytic base in conjunction with a neutral Lys67 or the lactam nitrogen as the general base. Whereas mutagenesis studies suggest that Lys67 may be replaced by an arginine, disfavoring the conjugate base mechanism, distinguishing between these two hypotheses may ultimately depend on direct determination of the pKa of Lys67 along the reaction coordinate.

  4. Reduced Susceptibility to Cefepime in Clinical Isolates of Enterobacteriaceae Producing OXA-1 Beta-Lactamase.

    PubMed

    Torres, Eva; López-Cerero, Lorena; Rodríguez-Martínez, José Manuel; Pascual, Álvaro

    2016-03-01

    An increase of Enterobacteriaceae isolates with reduced susceptibility to cefepime (FEP) and amoxicillin/clavulanate (AMC) has been observed in our area. The aim of this study was to characterize this antibiotic resistance phenotype and its molecular epidemiology. A total of 33 Enterobacteriaceae strains were studied. blaOXA-1 genes and their genetic environment were analyzed by polymerase chain reaction (PCR) and sequencing. Plasmids were transferred by conjugation and/or transformation and classified using PCR-based inc/rep typing and IncF subtyping. Escherichia coli isolates were typed by phylogroup, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing. Outer membrane proteins were studied by sodium dodecylsulfate-polyacrylamide gel electrophoresis and expression of blaOXA-1 genes by reverse transcription-PCR. FEP minimum inhibitory concentration yielded values of 1-16 mg/L. Twenty-nine (87.9%) isolates produced OXA-1, of which 24 (82.7%) were located in class 1 integron, and 9 (27.3%) produced TEM-1. Among the 24 E. coli OXA-1-producers, PFGE revealed two main clusters: one belonged to C-ST88 and the other to B23-ST131. Thirteen plasmids containing blaOXA-1 were transferred, nine belonged to IncF replicon (4 F2:A1:B-, 2 F1:A1:B1, 1 F1:A2:B-, 1 F18:A2:B1, 1 F5:A-:B1) and four were nontypeable. In conclusion, reduced susceptibility to FEP was mostly due to OXA-1 beta-lactamase. In E. coli, this increase is mainly due to the dissemination of two clones, which have captured different IncF plasmids. Among non-E. coli strains, five isolates produced OXA-1 and one isolate produced only TEM-1. PMID:26295796

  5. High prevalence of extended-spectrum and plasmidic AmpC beta-lactamase-producing Escherichia coli from poultry in Tunisia.

    PubMed

    Maamar, Elaa; Hammami, Samia; Alonso, Carla Andrea; Dakhli, Nouha; Abbassi, Mohamed Salah; Ferjani, Sana; Hamzaoui, Zaineb; Saidani, Mabrouka; Torres, Carmen; Boutiba-Ben Boubaker, Ilhem

    2016-08-16

    This study was conducted to detect extended spectrum beta-lactamases (ESBLs) and plasmidic AmpC beta-lactamase (pAmpC-BL)-producing Escherichia coli isolates in industrial poultry samples were collected from healthy chickens of the three farms. Samples were inoculated onto desoxycholate-lactose-agar plates supplemented with cefotaxime (2mg/L). E. coli was identified by biochemical and molecular methods and antibiotic susceptibility testing by the disk diffusion method. Genes encoding ESBLs and pAmpC-BL were detected by PCR and sequencing. Phylogenetic groups were determined by triplex PCR. The molecular typing of strains was done by pulsed field gel electrophoresis (PFGE) and Multilocus Sequence Typing (MLST) in those isolates showing different PFGE patterns. Cefotaxime-resistant E. coli isolates were recovered in 48 of 137 fecal samples (35%), and one isolate/sample was further studied. The following beta-lactamase genes were detected: blaCTX-M-1 (29 isolates, isolated in all three farms), blaCTX-M-15 (5 isolates, confined in farm II), blaCTX-M-14 and blaCMY-2 (one isolate and 13 isolates, respectively, in farm III). The 48 cefotaxime-resistant isolates were distributed into phylogroups: B1 (n=21), A (n=15) and D (n=12). PFGE analysis revealed 19 unrelated patterns: 15 different profiles among ESBL-positive strains and 4 among the CMY-2-positive isolates. The following sequence types-associated phylogroups were detected: a) CTX-M-1-positive strains: lineages ST542-B1, ST212-B1, ST58-B1, ST155-B1 and ST349-D; b) CTX-M-15-positive strain: lineage ST405-D; c) CTX-M-14-positive strain: lineage ST1056-B1; d) CMY-2-positive strains: lineages ST117-D, ST2197-A, and ST155-B1. Healthy chickens constitute an important reservoir of ESBL- and pAmpC-BL-producing E. coli isolates that potentially could be transmitted to humans via the food chain or by direct contact. PMID:27220012

  6. Inhibition of class A beta-lactamases by carbapenems: crystallographic observation of two conformations of meropenem in SHV-1.

    PubMed

    Nukaga, Michiyosi; Bethel, Christopher R; Thomson, Jodi M; Hujer, Andrea M; Distler, Anne; Anderson, Vernon E; Knox, James R; Bonomo, Robert A

    2008-09-24

    Carbapenem antibiotics are often the "last resort" in the treatment of infections caused by bacteria resistant to penicillins and cephalosporins. To understand why meropenem is resistant to hydrolysis by the SHV-1 class A beta-lactamase, the atomic structure of meropenem inactivated SHV-1 was solved to 1.05 A resolution. Two conformations of the Ser70 acylated intermediate are observed in the SHV-1-meropenem complex; the meropenem carbonyl oxygen atom of the acyl-enzyme is in the oxyanion hole in one conformation, while in the other conformation it is not. Although the structures of the SHV-1 apoenzyme and the SHV-1-meropenem complex are very similar (0.29 A rmsd for Calpha atoms), the orientation of the conserved Ser130 is different. Notably, the Ser130-OH group of the SHV-1-meropenem complex is directed toward Lys234Nz, while the Ser130-OH of the apo enzyme is oriented toward the Lys73 amino group. This altered position may affect proton transfer via Ser130 and the rate of hydrolysis. A most intriguing finding is the crystallographic detection of protonation of the Glu166 known to be involved in the deacylation mechanism. The critical deacylation water molecule has an additional hydrogen-bonding interaction with the OH group of meropenem's 6alpha-1 R-hydroxyethyl substituent. This interaction may weaken the nucleophilicity and/or change the direction of the lone pair of electrons of the water molecule and result in poor turnover of meropenem by the SHV-1 beta-lactamase. Using timed mass spectrometry, we further show that meropenem is covalently attached to SHV-1 beta-lactamase for at least 60 min. These observations explain key properties of meropenem's ability to resist hydrolysis by SHV-1 and lead to important insights regarding future carbapenem and beta-lactamase inhibitor design. PMID:18761444

  7. Biosynthesis of ketomycin. (II) biomimetic model for beta-lactamase catalysis: host-guest interactions in cyclodextrin-penicillin inclusion complex

    SciTech Connect

    Mak, H.W.

    1986-01-01

    The antibiotic ketomycin is formed from shikimic acid via chorismic acid and prephenic acid. Phenylalanine and 2',5'-dihydrophenylalanine derived from shikimic acid are not intermediates in the biosynthesis. Degradation of ketomycin derived from (1,6-/sup 14/C)shikimic acid showed that prephenic acid is converted into ketomycin with stereospecific discrimination between the two enantiotopic edges of the ring, the pro-S-R edge giving rise to the C-2', C-3' side of the cyclohexane ring of ketomycin. The resistance of pathogenic bacteria to the action of ..beta..-lactam antibiotics is mainly ascribed to their ability to produce ..beta..-lactamase to cleave the ..beta..-lactam ring. It is essential to understand the molecular nature of ..beta..-lactamase-penicillin recognition for designing and formulating more effective ..beta..-lactam antibiotics. A biomimetic study of ..beta..-lactamase is therefore initiated. To meet the requirements of hydrophobic and serine protease characteristics of ..beta..-lactamase, ..cap alpha..-cyclodextrin is chosen as a biomimetic model for ..beta..-lactamase. The structural specificity and the chemical dynamics of ..cap alpha..-cyclodextrin-phenoxymethyl penicillin inclusion complex in solid state and in solution have been determined by IR and NMR spectroscopy. The spectral results strongly indicate that the phenyl portion of the phenoxymethyl penicillin forms a stable inclusion complex with the hydrophobic cavity of ..cap alpha..-cyclodextrin in solution as well as in the solid state. Kinetic studies followed by /sup 1/HNMR and HPLC analyses under alkaline condition have shown that the ..cap alpha..-cyclodextrin mimics the catalytic function of serine of ..beta..-lactamase in the stereospecific hydrolysis of the ..beta..-lactam ring of phenoxymethyl penicillin.

  8. [TEM and CTX-M extended-spectrum beta-lactamase in Klebsiella spp and Escherichia coli isolates from inanimate surfaces of hospital environments].

    PubMed

    Rivera-Jacinto, Marco; Rodríguez-Ulloa, Claudia; Flores Clavo, René; Serquén López, Luis; Arce Gil, Zhandra

    2015-10-01

    The aim of the study was to determine the genotype of 15 ESBL strains of Enterobacteriaceae resistant to beta-lactams, isolated from inanimate surfaces and phenotypically characterized as producing extended-spectrum beta-lactamase. After evaluation and screening of the bacterial strains, a PCR was conducted to amplify fragments of 1078 bp and 544 bp corresponding to type TEM and CTX-M ESBL. Eleven strains presented both fragments at the time and only three had blaCTX-M. In conclusion, the presence of ESBL genes in cultures from the environment was demonstrated, some of which may belong to more than one type. This information could serve as a basis for implementing preventive measures to prevent the transmission of multiresistant bacteria from inanimate surfaces to patients, mainly in critical hospital areas. PMID:26732925

  9. Relative importances of outer membrane permeability and group 1 beta-lactamase as determinants of meropenem and imipenem activities against Enterobacter cloacae.

    PubMed Central

    Cornaglia, G; Russell, K; Satta, G; Fontana, R

    1995-01-01

    The roles of outer membrane permeability and Bush group 1 beta-lactamase activity in determining Enterobacter cloacae susceptibility to either meropenem or imipenem were investigated. A beta-lactamase-deficient strain was obtained by mutagenesis from a clinical isolate of E. cloacae, and a porin-deficient strain was selected from this mutant with cefoxitin. Both strains were transformed with the plasmid pAA20R, which contained the gene coding for the carbapenem-hydrolyzing CphA beta-lactamase, and the carbapenem permeability coefficients were measured by the Zimmermann and Rosselet technique (W. Zimmermann and A. Rosselet, Antimicrob. Agents Chemother. 12:368-372, 1977). The permeability coefficient of meropenem was roughly half that of imipenem in the normally permeable strain and almost seven times lower than that of imipenem in the porin-deficient strain. In the porin-deficient strain, the virtual absence of porins caused the MICs of meropenem to increase from 8 to 16 times, while it did not affect the MICs of imipenem. Conversely, the beta-lactamase affected imipenem but not meropenem activity: meropenem showed a similar activity in the parent strain and in the beta-lactamase-deficient mutant with both a low- and high-density inoculum, whereas imipenem was 16 times less active against the parent strain when the high-density inoculum was used. It is concluded that outer membrane permeability and stability to group 1 beta-lactamase have different impacts on the activities of meropenem and imipenem against E. cloacae. PMID:7726496

  10. Effect of tannin extract against Pseudomonas aeruginosa producing metallo beta-lactamase.

    PubMed

    Ghafourian, S; Mohebi, R; Sekawi, Z; Raftari, M; Neela, V; Ghafourian, E; Aboualigalehdari, E; Rahbar, M; Sadeghifard, N

    2012-01-01

    Carbapenems are the most potent beta-lactam agents with a broad-spectrum activity against Gram-negative and Gram-positive bacteria. They are stable in the presence of penicillinases and cephalosporinases. This study was focused on frequency of metallo beta- lactamase (MBL) among Pesudomonas aeruginosa strains isolated in patients with urinary tract infection, effect of tannin against PA positive strains which produced blaVIM or blaIMP and both of these genes (Species). Detection of MBL was performed by phonotypic and genotypic methods. Tannin extract was tested against P. aeruginosa producing MBL. During the study period, 240 P. aeruginosa isolates were identified. Among them 64 (26.6 percent) isolates were imipenem non-susceptible and confirmed by imipenem/EDTA. Our results revealed that the growth of blaVIM positive P. aeruginosa inhibited at 15 microg/ml concentration. The experiment repeated for blaIMP-positive P. aeruginosa and P. aeruginosa which harbored blaIMP and blaVIM, the results showed 35 microg/ml was the best concentration for inhibition of P. aeruginosa-positive blaIMP and also P. aeruginosa blaIMP and blaVIM. In conclusion, tannin was effective against P. aeruginosa producing blaVIM and blaIMP and both of them so it can be substituted with common antibiotics. The result showed significantly P. aeruginosa-harbored blaIMP was more responsible for imipenem resistance than P. aeruginosa-positive blaVIM. Interestingly, tannin was more effective against MBL-P. aeruginosa in comparison with current antibiotics. PMID:22824750

  11. Molecular modeling and docking analysis of beta-lactamases with inhibitors: a comparative study.

    PubMed

    Danishuddin, Mohd; Khan, Asad U

    Beta-lactamases are bacterial enzymes which impart resistance against β-lactam-antibiotics. CTX-Ms are the β-lactamases that target cephalosporin antibiotics (e.g. cefotaxime and ceftazidime) while SME-1, KPC-2, IMI-1 and SFC-1 target carbapenems. Clavulanic acid, sulbactam and tazobactam are traditional β-lactamase inhibitors while LN1-255 and NXL-104 whereas novel inhibitors, inhibiting the activity of these enzymes. Studying the binding pattern of these drugs is helpful in predicting the versatile inhibitors for betalactamases. The aims of the study were: describing the mode of interaction of CTX-M (modeled from the blaCTX-M gene of this study) and the said carbapenemases with their respective target drugs and inhibitors and to perform an in silico comparison of the efficacies of traditional and novel β-lactamase-inhibitors based on fitness score. The blaCTX-M marker was PCR-amplified from plasmid DNA of E. coli strain isolated from community-acquired urinary tract infection. E. coli C600 cells (harboring cloned blaCTX-M) were found positive for extended-spectrum-β-lactamase (ESBL) production by the double-disk-synergy test. The three dimensional structures of CTX-M-15, SME-1 and IMI-1 were predicted by Swiss Model Server. The interaction between selected structures and inhibitors was performed by GOLD 5.0. On the basis of the docking score and binding pattern, we conclude that compound LN1-255 followed by tazobactam is best inhibitor against all the selected target enzymes as compared to clavulanate, sulbactam and NXL-104. Five conserved amino acids, Ser70, Ser130, Lys235, Thr236 and Gly237 were found crucial in stabilizing the complexes through hydrogen bonding and hydrophobic interactions. PMID:23202428

  12. Antimicrobial susceptibility pattern of extended-spectrum beta- lactamase producing Klebsiella pneumoniae clinical isolates in an Indian tertiary hospital

    PubMed Central

    Singh, Amit Kumar; Jain, Sonali; Kumar, Dinesh; Singh, Ravinder Pal; Bhatt, Hitesh

    2015-01-01

    Objective: There is an increased prevalence of extended-spectrum beta-lactamase producing Klebsiella pneumoniae (ESBL-KP) worldwide including India, which is a major concern for the clinicians, especially in intensive care units and pediatric patients. This study aims to determine the prevalence of ESBL-KP and antimicrobial sensitivity profile to plan a proper hospital infection control program to prevent the spread of resistant strains. Methods: KP isolates obtained from various clinical samples were evaluated to detect the production of ESBL by phenotypic methods. Antimicrobial susceptibility profile was also determined of all the isolates. Findings: Of 223 nonduplicate isolates of K. pneumoniae, 114 (51.1%) were ESBL producer and antimicrobial susceptibility profile showed the isolates were uniformly sensitive to imipenem and highly susceptible to beta-lactamase inhibitor combination drugs (67–81%) and aminoglycosides (62–76%), but less susceptible to third generation cephalosporins (14–24%) and non-β-lactam antibiotics such as nitrofurantoin (57%), fluoroquinolones (29–57%), piperacillin (19–23%), and aztreonam (15–24%). Conclusion: This study found that beta-lactamase inhibitor combinations are effective in treatment of such infections due to ESBL-KP thus these drugs should be a part of the empirical therapy and carbapenems should be used when the antimicrobial susceptibility tests report resistance against inhibitors combinations. PMID:26312255

  13. In vitro activity of LK-157, a novel tricyclic carbapenem as broad-spectrum {beta}-lactamase inhibitor.

    PubMed

    Paukner, Susanne; Hesse, Lars; Prezelj, Andrej; Solmajer, Tomaz; Urleb, Uros

    2009-02-01

    LK-157 is a novel tricyclic carbapenem with potent activity against class A and class C beta-lactamases. When tested against the purified TEM-1 and SHV-1 enzymes, LK-157 exhibited 50% inhibitory concentrations (IC(50)s) in the ranges of the clavulanic acid and tazobactam IC(50)s (55 nM and 151 nM, respectively). Moreover, LK-157 significantly inhibited AmpC beta-lactamase (IC(50), 62 nM), as LK-157 was >2,000-fold more potent than clavulanic acid and approximately 28-fold more active than tazobactam. The in vitro activities of LK-157 in combination with amoxicillin, piperacillin, ceftazidime, cefotaxime, ceftriaxone, cefepime, cefpirome, and aztreonam against an array of Ambler class A (TEM-, SHV-, CTX-M-, KPC-, PER-, BRO-, and PC-type)- and class C-producing bacterial strains derived from clinical settings were evaluated in synergism experiments and compared with those of clavulanic acid, tazobactam, and sulbactam. In vitro MICs against ESBL-producing strains (except CTX-M-containing strains) were reduced 2- to >256-fold, and those against AmpC-producing strains were reduced even up to >32-fold. The lowest MICs (< or =0.025 to 1.6 microg/ml) were observed for the combination of cefepime and cefpirome with a constant LK-157 concentration of 4 microg/ml, thus raising an interest for further development. LK-157 proved to be a potent beta-lactamase inhibitor, combining activity against class A and class C beta-lactamases, which is an absolute necessity for use in the clinical setting due to the worldwide increasing prevalence of bacterial strains resistant to beta-lactam antibiotics. PMID:19075067

  14. The 1.4 Å Crystal Structure of the Class D [beta]-Lactamase OXA-1 Complexed with Doripenem

    SciTech Connect

    Schneider, Kyle D.; Karpen, Mary E.; Bonomo, Robert A.; Leonard, David A.; Powers, Rachel A.

    2010-01-12

    The clinical efficacy of carbapenem antibiotics depends on their resistance to the hydrolytic action of {beta}-lactamase enzymes. The structure of the class D {beta}-lactamase OXA-1 as an acyl complex with the carbapenem doripenem was determined to 1.4 {angstrom} resolution. Unlike most class A and class C carbapenem complexes, the acyl carbonyl oxygen in the OXA-1-doripenem complex is bound in the oxyanion hole. Interestingly, no water molecules were observed in the vicinity of the acyl linkage, providing an explanation for why carbapenems inhibit OXA-1. The side chain amine of K70 remains fully carboxylated in the acyl structure, and the resulting carbamate group forms a hydrogen bond to the alcohol of the 6{alpha}-hydroxyethyl moiety of doripenem. The carboxylate attached to the {beta}-lactam ring of doripenem is stabilized by a salt bridge to K212 and a hydrogen bond with T213, in lieu of the interaction with an arginine side chain found in most other {beta}-lactamase-{beta}-lactam complexes (e.g., R244 in the class A member TEM-1). This novel set of interactions with the carboxylate results in a major shift of the carbapenem's pyrroline ring compared to the structure of the same ring in meropenem bound to OXA-13. Additionally, bond angles of the pyrroline ring suggest that after acylation, doripenem adopts the {Delta}{sup 1} tautomer. These findings provide important insights into the role that carbapenems may have in the inactivation process of class D {beta}-lactamases.

  15. Metallo-beta-lactamase IMP-1 in Providencia rettgeri from two different hospitals in Japan.

    PubMed

    Shiroto, Katsuaki; Ishii, Yoshikazu; Kimura, Soichiro; Alba, Jimena; Watanabe, Kiwao; Matsushima, Yoshiko; Yamaguchi, Keizo

    2005-11-01

    In 2002, 495 indole-positive proteae strains were isolated from patients at 60 hospitals in Japan. Nine indole-positive proteae strains had reduced susceptibility to imipenem (MIC > or = 8 microg ml(-1)) and were identified as Providencia rettgeri by BD Phoenix. Eight of the nine Prov. rettgeri isolates were confirmed as metallo-beta-lactamase producers by the double-disc synergy test. All the metallo-beta-lactamases were classified as IMP-1 by PCR and DNA sequence analysis. These bla(IMP-1) genes were encoded in the integron structure on conjugative plasmids. These plasmids could transfer from Prov. rettgeri clinical isolates to Escherichia coli ML4903 at a frequency between 1.5 x 10(-5) and 5.5 x 10(-7). The eight bla(IMP)-positive strains were isolated from two hospitals, and showed two different PFGE patterns, two different integron structures and two different incompatibility groups, which corresponded to the two hospitals. These results strongly suggest the possibility of nosocomial infections by bla(IMP-1)-producing Prov. rettgeri isolates. PMID:16192438

  16. Prevalence of antimicrobial resistance and resistance genes in faecal Escherichia coli isolates recovered from healthy pets.

    PubMed

    Costa, Daniela; Poeta, Patricia; Sáenz, Yolanda; Coelho, Ana Cláudia; Matos, Manuela; Vinué, Laura; Rodrigues, Jorge; Torres, Carmen

    2008-02-01

    Faecal samples of healthy dogs (n=39) and cats (n=36) obtained in Northern Portugal were seeded on Levine agar plates, and two Escherichia coli isolates per sample were recovered (78 of dogs and 66 of cats). The susceptibility to 16 antimicrobial agents was tested in this series of 144 E. coli isolates. Almost 20% of them showed tetracycline resistance and 12 and 15% presented ampicillin or streptomycin resistance, respectively. The percentage of resistance to the other antimicrobial agents was in all cases below 4%, and no resistant isolates were detected for ceftazidime, imipenem, cefoxitin or amikacin. Two isolates (from one dog) showed cefotaxime-resistance and harboured both the CTX-M-1 and OXA-30 beta-lactamases. A bla(TEM) gene was detected in 12 of 17 ampicillin-resistant isolates, the aac(3)-II gene in the three gentamicin-resistant isolates, aadA in 7 of 22 streptomycin-resistant isolates, and tet(A) and/or tet(B) gene in all 28 tetracycline-resistant isolates. The gene encoding class 1 integrase was detected in six E. coli isolates, including the four trimethoprim-sulfamethoxazole-resistant isolates and those two harbouring CTX-M-1 and OXA-30 beta-lactamases; different gene cassette arrangements were identified: dfrA1+aadA1 (two isolates), dfrA12+orfF+aadA2 (two isolates) and bla(OXA30)+aadA1 (two isolates). One amino acid change in GyrA protein (Ser83Leu or Asp87Tyr) was detected in four nalidixic acid-resistant and ciprofloxacin-susceptible isolates and two amino acid changes in GyrA (Ser83Leu+Asp87Asn) and one in ParC (Ser80Ile) were identified in one nalidixic acid- and ciprofloxacin-resistant isolate. Faecal E. coli isolates of healthy pets could be a reservoir of antimicrobial resistance genes. PMID:17870255

  17. A step towards the discrimination of beta-lactamase-producing clinical isolates of Enterobacteriaceae and Pseudomonas aeruginosa by MALDI-TOF mass spectrometry

    PubMed Central

    Schaumann, Reiner; Knoop, Nicolas; Genzel, Gelimer H.; Losensky, Kevin; Rosenkranz, Christiane; Stîngu, Catalina S.; Schellenberger, Wolfgang; Rodloff, Arne C.; Eschrich, Klaus

    2012-01-01

    Summary Background Matrix-Assisted Laser-Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF MS) has already proven to be a powerful tool for species identification in microbiological laboratories. As adequate and rapid screening methods for antibiotic resistance are crucially needed, the present study investigated the discrimination potential of MALDI-TOF MS among extended-spectrum-beta-lactamase (ESBL) or metallo-beta-lactamases- (MBL) producing and the nonproducing strains of Escherichia coli (n=19), Klebsiella pneumoniae (n=19), and Pseudomonas aeruginosa (n=38), respectively. Material/Methods We used a MALDI-TOF MS protocol, usually applied for species identification, in order to integrate a screening method for beta-lactamases into the routine species identification workflow. The acquired spectra were analyzed by visual inspection, statistical similarity analysis and support vector machine (SVM) classification algorithms. Results Neither visual inspection nor mathematical similarity analysis allowed discrimination between spectra of beta-lactamase-producing and the nonproducing strains, but classification within a species by SVM-based algorithms could achieve a correct classification rate of up to 70%. Conclusions This shows that MALDI-TOF MS has definite potential to discriminate antibiotic-resistant strains due to ESBL and MBL production from nonproducing strains, but this performance is not yet sufficiently reliable for routine microbiological diagnostics. PMID:22936198

  18. Characterization of Extended-Spectrum Beta-lactamase from Escherichia coli and Klebsiella Species from North Eastern Nigeria

    PubMed Central

    Gadzama, Galadima Bala; Zailani, Sambo Bello; Aboderin, Aaron Oladipo

    2016-01-01

    Introduction Resistance to antimicrobials has become a serious global health concern complicating treatment strategies and increasing health-care costs. The extended-spectrum beta-lactamase producing bacteria stand out as bacteria of great epidemic concern among Gram negative bacilli. Control and appropriate interventions for antimicrobial resistance depend on effective surveillance and knowledge of the patterns and determinants of resistance. Aim The present study was undertaken to detect and characterize ESBLs in Escherichia coli and Klebsiella Species from University of Maiduguri Teaching Hospital, Maiduguri, North-Eastern Nigeria. Materials and Methods Confirmed variants of Escherichia coli and Klebsiella Species isolated from 439 patients that were admitted in various units of University of Maiduguri Teaching Hospital (UMTH) were screened for ESBL using CLSI breakpoints. Suspected ESBLs producers were subjected to confirmation using double disk synergy method. Detection of ESBL genes was further done by multiplex PCR. Results Out of the 439 isolates screened; the result shows 147 (33.5%) were ESBL producers but only 121(23.6%) were confirmed by the double disk synergy method. The prevalence of ESBL amongst the organisms were; 41/172 (23.8%) for Escherichia coli and 80/267/(30.0%) for Klebsiella Species. Based on PCR analysis, the various percentage genotypes of the ESBL producers were 44 (36.4%) for SHV gene followed by 38(31.4%) for TEM gene and the lowest of 33(27.3%) for CTX-M gene. Conclusion ESBLs are prevalent among Species of Escherichia coli and Klebsiella Species in Maiduguri, Borno State, not only are there TEM and SHV but also CTX-M types. Antibiotic stewardship program to maximise use of available antibiotics is underscored as well as coordinated national efforts in combating resistance. PMID:27042460

  19. [Extended-spectrum beta-lactamases in Klebsiella pneumoniae isolated at the Cordoba Children's Hospital, Argentina].

    PubMed

    Saka, H A; Egea, M; Culasso, C; Rollán, R; Avaro, A; Carvajal, L

    2003-01-01

    The aim of the present study was to investigate the presence of extended-spectrum beta-lactamases (ESBL) in Klebsiella pneumoniae isolated at the "Hospital de Niños de Córdoba". The strains were collected from inpatients between January 1996 and July 2000. A total of 150 ESBL producer isolates were detected. During 1996 the prevalence of ESBL producer K. pneumoniae was 20%, but since 1998 the values have increased to approximately 60%. Phenotypic analysis such as isoelectric point (pl) and antibiotyping performed in 32 randomly selected isolates showed two different enzyme profiles: 81% had ESBL with pl = 7.9 and preferential activity against cefotaxime, while 19% showed ESBL with pl = 5.4 and preferential activity against ceftazidime. No isolates resistant to imipenem or ciprofloxacin were detected. Susceptibility to other antimicrobial agents varied, but resistance to gentamicin was strongly associated with ESBL producer isolates. Resistance determinants could be transferred to Escherichia coli by conjugation assays. PMID:12833674

  20. A case of extended spectrum beta-lactamase producing Salmonella enterica serotype paratyphi A from India.

    PubMed

    Roy, Priyamvada; Rawat, Deepti; Malik, Sonia

    2015-01-01

    Enteric fever caused by Salmonella enterica is a systemic infection with high rates of morbidity and mortality. Increasing antibiotic resistance in S. enterica has led to shift in the choice of antibiotics used against this organism from chloramphenicol and ampicillin to trimethoprim-sulfamethoxazole, fluoroquinolones, and extended-spectrum cephalosporins. Resistance to cephalosporins, due to the production of extended-spectrum beta-lactamases (ESBLs), is the cause of serious concern worldwide. So far, these enzymes have been detected in many species of the family Enterobacteriaceae including different serotypes of S. enterica. To the best of our knowledge, however, ESBL production in Salmonella Paratyphi A has not yet been reported from India. We present here a case of ESBL producing Salmonella Paratyphi A from India. This is a worrisome finding with grave clinical implications, since the dissemination of this resistance trait would further limit the therapeutic options available for the treatment of enteric fever. PMID:25673610

  1. SMB-1, a novel subclass B3 metallo-beta-lactamase, associated with ISCR1 and a class 1 integron, from a carbapenem-resistant Serratia marcescens clinical isolate.

    PubMed

    Wachino, Jun-ichi; Yoshida, Hiroyuki; Yamane, Kunikazu; Suzuki, Satowa; Matsui, Mari; Yamagishi, Takuya; Tsutsui, Atsuko; Konda, Toshifumi; Shibayama, Keigo; Arakawa, Yoshichika

    2011-11-01

    A carbapenem-resistant Serratia marcescens strain, 10mdr148, was identified in a Japanese hospital in 2010. The carbapenem resistance of this strain was attributed to the production of a novel metallo-β-lactamase (MBL), named SMB-1 (Serratia metallo-β-lactamase). SMB-1 possessed a zinc binding motif, H(Q)XHXDH (residues 116 to 121), H196, and H263 and was categorized as a member of subclass B3 MBL. SMB-1 has 75% amino acid identity with the most closely related MBL, AMO1, of uncultured bacterium, recently identified through the metagenomic analysis of apple orchard soil. The introduction of bla(SMB-1) into Escherichia coli conferred resistance to a variety of β-lactam antibiotics, penicillins, cephalosporins, and carbapenems, but not aztreonam, a resistance pattern consistent with those of other MBLs. SMB-1 demonstrated high k(cat) values of >500 s(-1) for carbapenems, resulting in the highest hydrolyzing efficiency (k(cat)/K(m)) among the agents tested. The hydrolyzing activity of SMB-1 was well inhibited by chelating agents. The bla(SMB-1) gene was located on the chromosome of S. marcescens strain 10mdr148 and at the 3' end of the ISCR1 element in complex with a typical class 1 integron carrying aac(6')-Ib and catB3 gene cassettes. Downstream of bla(SMB-1), the second copy of the 3'conserved segment and ISCR1 were found. To our knowledge, this is the first subclass B3 MBL gene associated with an ISCR1 element identified in an Enterobacteriaceae clinical isolate. A variety of antibiotic resistance genes embedded with ISCR1 have been widely spread among Enterobacteriaceae clinical isolates, thus the further dissemination of bla(SMB-1) mediated by ISCR1 transposition activity may become a future concern. PMID:21876060

  2. Ampc Beta lactamases among gram negative clinical isolates from a tertiary hospital, South India.

    PubMed

    Mohamudha Parveen, R; Harish, B N; Parija, S C

    2010-07-01

    AmpC β-lactamases are cephalosporinases that hydrolyze cephamycins as well as other extended-spectrum cephalosporins and are poorly inhibited by clavulanic acid. Although reported with increasing frequency, the true rate of occurrence of AmpC β-lactamases in different organisms, including members of Enterobacteriaceae, remains unknown. The present study was designed to determine the occurrence of AmpC enzyme-harbouring Gram-negative clinical isolates in a tertiary care hospital in Pondicherry state, South India. A total of 235 Gram negative clinical isolates were tested for resistance to cefoxitin, third generation cephalosporin (3GC) antibiotics, ampicillin, amikacin, co-trimoxazole, gentamicin, meropenem and tetracycline by disc diffusion method. Isolates found resistant to 3GC and cefoxitin were tested for the production of AmpC β -lactamases by three dimensional extraction method and AmpC disc method. Isolates found to sensitive to 3GC were subjected to disc antagonism test for inducible AmpC production. One hundred and thirty four (57%) strains were resistant to 3GC, among which 63(47%) were positive for plasmid-mediated AmpC beta lactamases production. Among the 101 strains sensitive to 3GC, 23 (22.7%) revealed the presence of inducible AmpC beta lactamases by disc approximation test. A total of 80.9% (51/63) of screen positive isolates were detected by Amp C disc test and 93.6% (59/63) by three dimensional extraction method. Out of the 86 AmpC producers, 67 (77.9%) were cefoxitin resistant .Inducible AmpC was not found in Esch.coli and Klebsiella spp. The AmpC producers also concurrently showed multidrug resistance pattern. AmpC producers were found to be prevalent in our hospital and though three dimensional extraction test detects AmpC better, the disk test is easier to perform routinely and is user- friendly. PMID:24031534

  3. Extended-spectrum beta-lactamases: implications for the clinical laboratory and therapy.

    PubMed

    Harada, Sohei; Ishii, Yoshikazu; Yamaguchi, Keizo

    2008-12-01

    Production of extended-spectrum beta-lactamase (ESBL) is one of the most important resistance mechanisms that hamper the antimicrobial treatment of infections caused by Enterobacteriaceae. ESBLs are classified into several groups according to their amino-acid sequence homology. While TEM and SHV enzymes were the most common ESBLs in the 1990s, CTX-M enzymes have spread rapidly among Enterobacteriaceae in the past decade. In addition, some epidemiological studies showed that organisms producing CTX-M enzymes had become increasingly prevalent in the community setting in certain areas in the world. Several novel enzymes with hydrolyzing activity against oxyimino-cephalosporins, albeit with additional enzymatic characteristics different from those of original TEM and SHV ESBLs (e.g., inhibitor-resistance), have been discovered and pose a problem on the definition of ESBLs. Although several methods to detect the production of ESBL are available in clinical laboratories, existence of other factors contributing resistance against beta-lactams, e.g., inducible production of Amp-C beta-lactamase by some species of Enterobacteriaceae, or inhibitor-resistance in some ESBLs may hinder the detection of ESBLs with these methods. Carbapenems are stable against hydrolyzing activity of ESBLs and are regarded as the drug of choice for the treatment of infections caused by ESBL-producing Enterobacteriaceae. Although several other antimicrobial agents, such as fluoroquinolones and cephamycins, may have some role in the treatment of mild infections due to those organisms, clinical data that warrant the use of antimicrobial agents other than carbapenems in the treatment of serious infections due to those organisms are scarce for now. PMID:19127103

  4. [In vitro activity of faropenem against beta-lactamase producing clinical isolates].

    PubMed

    Nishiyama, T; Matsuzaki, K; Koyama, H; Saika, T; Hasegawa, M; Kobayashi, I

    2000-03-01

    Each 20 strains of beta-lactamase producing methicillin susceptible Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Haemophilus influenzae, Moraxella (Branhamella) catarrhalis, and Bacteroides fragilis group were used as the test strains. Drug susceptibility of these strains to faropenem (FRPM), cefdinir, cefditoren, cefcapene, cefteram, cefaclor, and ampicillin was determined by an agar dilution method according to the NCCLS guideline M100-S9. beta-Lactamase activity of the test strains was determined by a spectrophotometric method. In the present study, FRPM was highly active against beta-lactamase-producing strains, and no close correlation was found between the MICs of FRPM for the test strains and their beta-lactamase activities. These results suggest that FRPM has potential in successful application for the treatment of infectious diseases with various types of bacterial pathogens including beta-lactamase producing strains. PMID:10834149

  5. Novel Insights Into The Mode of Inhibition of Class A SHV-1 Beta-Lactamases Revealed by Boronic Acid Transition State Inhibitors

    SciTech Connect

    W Ke; J Sampson; C Ori; F Prati; S Drawz; C Bethel; R Bonomo; F van den Akker

    2011-12-31

    Boronic acid transition state inhibitors (BATSIs) are potent class A and C {beta}-lactamase inactivators and are of particular interest due to their reversible nature mimicking the transition state. Here, we present structural and kinetic data describing the inhibition of the SHV-1 {beta}-lactamase, a clinically important enzyme found in Klebsiella pneumoniae, by BATSI compounds possessing the R1 side chains of ceftazidime and cefoperazone and designed variants of the latter, compounds 1 and 2. The ceftazidime and cefoperazone BATSI compounds inhibit the SHV-1 {beta}-lactamase with micromolar affinity that is considerably weaker than their inhibition of other {beta}-lactamases. The solved crystal structures of these two BATSIs in complex with SHV-1 reveal a possible reason for SHV-1's relative resistance to inhibition, as the BATSIs adopt a deacylation transition state conformation compared to the usual acylation transition state conformation when complexed to other {beta}-lactamases. Active-site comparison suggests that these conformational differences might be attributed to a subtle shift of residue A237 in SHV-1. The ceftazidime BATSI structure revealed that the carboxyl-dimethyl moiety is positioned in SHV-1's carboxyl binding pocket. In contrast, the cefoperazone BATSI has its R1 group pointing away from the active site such that its phenol moiety moves residue Y105 from the active site via end-on stacking interactions. To work toward improving the affinity of the cefoperazone BATSI, we synthesized two variants in which either one or two extra carbons were added to the phenol linker. Both variants yielded improved affinity against SHV-1, possibly as a consequence of releasing the strain of its interaction with the unusual Y105 conformation.

  6. Purification and properties of inducible penicillin beta-lactamase isolated from Alcaligenes faecalis.

    PubMed

    Fujii, T; Sato, K; Inoue, M; Mitsuhashi, S

    1985-04-01

    An inducible penicillin beta-lactamase was purified from a strain of Alcaligenes faecalis resistant to beta-lactam antibiotics. The purified enzyme preparation gave a single protein band on polyacrylamide gel electrophoresis, and its molecular weight was 29,000 based on sodium dodecyl sulfate-acrylamide gel electrophoresis. Its isoelectric point was 5.9. The enzyme more rapidly hydrolyzed penicillins, such as penicillin G, ampicillin, carbenicillin, piperacillin, and cloxacillin, than it hydrolyzed cephalosporins. For the hydrolysis of penicillin G, the optimal pH was 5.5, and the optimal temperature was 35 degrees C. The enzyme activity was inhibited by iodine, Cu2+, Hg2+, and EDTA but was not inhibited by clavulanic acid and sulbactam. PMID:3873902

  7. Structure of the Covalent Adduct Formed Between Mycobacterium tuberculosis beta-Lactamase and Clavulanate

    SciTech Connect

    Tremblay,L.; Hugonnet, J.; Blanchard, J.

    2008-01-01

    The intrinsic resistance of Mycobacterium tuberculosis to the {beta}-lactam class of antibiotics arises from a chromosomally encoded, extended spectrum, class A {beta}-lactamase, BlaC. Herein, we report the X-ray crystallographic structure of BlaC inhibited with clavulanate at a resolution of 1.7 Angstroms with an R-factor value of 0.180 and R-free value of 0.212 for the m/z +154 clavulanate-derived fragment observed in the active site. Structural evidence reveals the presence of hydrogen bonds to the C1 carbonyl along with a coplanar arrangement of C1, C2, C3, and N4, which favors enolization to generate a trans-a, {beta}-eneamine, stabilizing the +154 adduct from hydrolysis. The irreversible inhibition of BlaC suggests that treatment of M. tuberculosis with a combination of a {beta}-lactam antibiotic and clavulanate may lead to rapid bactericidal activity.

  8. An alkaline D-stereospecific endopeptidase with beta-lactamase activity from Bacillus cereus.

    PubMed

    Asano, Y; Ito, H; Dairi, T; Kato, Y

    1996-11-22

    We purified a novel extracellular D-stereospecific endopeptidase, alkaline D-peptidase (D-stereospecific peptide hydrolase, EC 3.4.11.-), to homogeneity from the culture broth of the soil bacterium Bacillus cereus strain DF4-B. The Mr of the enzyme was 37,952, and it was composed of a single polypeptide chain. The optimal pH for activity was approximately 10.3. The enzyme was strictly D-stereospecific toward oligopeptides composed of Dphenylalanine such as (D-Phe)3 and (D-Phe)4. The enzyme also acted to a lesser extent on (D-Phe)6, Boc-(D-Phe)4 (where Boc is tert-butoxycarbonyl), Boc-(D-Phe)4 methyl ester, Boc-(D-Phe)3 methyl ester, Boc-(D-Phe)2, (D-Phe)2, and others, but not upon their corresponding peptides composed of L-Phe, (D-Ala)n (n = 2-5), (D-Val)3, and (D-Leu)2. The mode of action of the enzyme was clarified with synthetic substrates ((D-Phe)2-D-Tyr and D-Tyr-(D-Phe)2) and eight stereoisomers of (Phe)3. The enzyme had beta-lactamase activity toward ampicillin and penicillin G, although carboxypeptidase DD and D-aminopeptidase activities were undetectable. The gene coding for alkaline D-peptidase (adp) was cloned into plasmid pUC118, and a 1164-base pair open reading frame consisting of 388 codons was identified as the adp gene. The predicted polypeptide was similar to carboxypeptidase DD from Streptomyces R61, penicillin-binding proteins from Streptomyces lactamdurans and Bacillus subtilis, and class C beta-lactamases. Thus, the enzyme was categorized as a new "penicillin-recognizing enzyme." PMID:8939979

  9. Biochemical and Structural Characterization of Mycobacterium tuberculosis beta-Lactamase with the Carbapenems Ertapenem and Doripenem

    SciTech Connect

    L Tremblay; F Fan; J Blanchard

    2011-12-31

    Despite the enormous success of {beta}-lactams as broad-spectrum antibacterials, they have never been widely used for the treatment of tuberculosis (TB) due to intrinsic resistance that is caused by the presence of a chromosomally encoded gene (blaC) in Mycobacterium tuberculosis. Our previous studies of TB BlaC revealed that this enzyme is an extremely broad-spectrum {beta}-lactamase hydrolyzing all {beta}-lactam classes. Carbapenems are slow substrates that acylate the enzyme but are only slowly deacylated and can therefore act also as potent inhibitors of BlaC. We conducted the in vitro characterization of doripenem and ertapenem with BlaC. A steady-state kinetic burst was observed with both compounds with magnitudes proportional to the concentration of BlaC used. The results provide apparent K{sub m} and k{sub cat} values of 0.18 {micro}M and 0.016 min{sup -1} for doripenem and 0.18 {micro}M and 0.017 min{sup -1} for ertapenem, respectively. FTICR mass spectrometry demonstrated that the doripenem and ertapenem acyl-enzyme complexes remain stable over a time period of 90 min. The BlaC-doripenem covalent complex obtained after a 90 min soak was determined to 2.2 {angstrom}, while the BlaC-ertapenem complex obtained after a 90 min soak was determined to 2.0 {angstrom}. The 1.3 {angstrom} diffraction data from a 10 min ertapenem-soaked crystal revealed an isomerization occurring in the BlaC-ertapenem adduct in which the original {Delta}2-pyrroline ring was tautomerized to generate the {Delta}1-pyrroline ring. The isomerization leads to the flipping of the carbapenem hydroxyethyl group to hydrogen bond to carboxyl O2 of Glu166. The hydroxyethyl flip results in both the decreased basicity of Glu166 and a significant increase in the distance between carboxyl O2 of Glu166 and the catalytic water molecule, slowing hydrolysis.

  10. A clinical strain of Escherichia coli possessing CMY-2 plasmid-mediated amp C beta-lactamase: an emerging concern in pediatrics?

    PubMed

    Hoyen, Claudia M; Hujer, Andrea M; Hujer, Kristine M; Marshall, Steven H; Carias, Lenore; Toltzis, Philip; Rice, Louis B; Bonomo, Robert A

    2002-01-01

    A 5-year-old child was colonized by an isolate of Escherichia coli that transferred resistance to third-generation cephalosporins and cefoxitin. This resistance phenotype was encoded on a >75-kb plasmid pLRM 22. The transferable plasmid contained both blaCMY-2 and blaTEM-1b. Increasing reports of CMY-2 beta-lactamase in clinical isolates in children raise concerns about the empiric use of third-generation cephalosporins in this patient group. PMID:12523630

  11. Zero prevalence of extended spectrum beta-lactamase-producing bacteria in 300 breeding Collared Flycatchers in Sweden.

    PubMed

    Järhult, Josef D; Stedt, Johan; Gustafsson, Lars

    2013-01-01

    Wild birds are important indicators and potential spreaders of antibiotic resistance. The order Passerines is scarcely studied apart from Corvus sp. but extended spectrum beta-lactamases (ESBLs) has been found in Blackbirds. We tested 300 fecal samples from a well-studied population of Collared Flycatchers (Ficedula albicollis) at the Island of Gotland in Sweden and found no ESBL-producing bacteria. These results support the idea of 'ecological guild' as Blackbirds are ground-foraging invertebrate feeders, whereas Collared Flycatchers are aerial insectivores not regularly coming into contact with fecal contaminations and therefore less prone to acquire pathogens spread by the fecal-oral route. PMID:23898397

  12. Escherichia coli-producing extended-spectrum beta-lactamase CTX-M-15 in a captive South American tapir (Tapirus terrestris).

    PubMed

    Klimes, Jiri; Machalkova, Marketa; Dolejska, Monika; Cizek, Alois; Janoszowska, Dagmar; Alexa, Pavel; Albrechtova, Katerina; Vojtech, Jiri; Literak, Ivan

    2013-03-01

    Only a few reports exist on the occurrence of resistant bacteria in zoo animals. Therefore, an isolation of multiresistant Escherichia coli from the lungs of a captive South American tapir (Tapirus terrestris) lead to its characterization and further investigation of samples from animals inhabiting the same paddock and from the shared environment. The tapir suffered from an intermandibular abscess and pneumonia and was euthanatized after unsuccessful therapy, including administration of antibiotics. The authors performed selective isolation of extended-spectrum beta-lactamase (ESBL)-positive E. coli strains and identification of resistance genes using polymerase chain reaction. Seven multiresistant, ESBL-producing E. coli isolates were obtained, all belonging to the B2 phylogenetic group and showing identical profile on pulsed-field gel electrophoresis. These isolates carried several resistance genes, including the gene bla(CTX-M-15). This case demonstrates the transmission of related epidemiologically important E. coli isolates whose potential transmission to other animals and zoo staff can be assumed. PMID:23505722

  13. Sequence of pNL194, a 79.3-kilobase IncN plasmid carrying the blaVIM-1 metallo-beta-lactamase gene in Klebsiella pneumoniae.

    PubMed

    Miriagou, V; Papagiannitsis, C C; Kotsakis, S D; Loli, A; Tzelepi, E; Legakis, N J; Tzouvelekis, L S

    2010-10-01

    The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including bla(VIM-1), aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes. PMID:20660690

  14. Characterization of eight beta-lactamases of Gram-negative bacteria.

    PubMed Central

    Sawai, T; Kanno, M; Tsukamoto, K

    1982-01-01

    Eight kinds of beta-lactamases produced by gram-negative bacteria were characterized by the following properties: molecular weight, isoelectric point, pH optimum, molecular activity, immunochemical reactivity, and kinetic parameters with respect to twelve kinds of common beta-lactam antibiotics. These beta-lactamases included two types of penicillinases mediated by R plasmids and six kinds of species-specific cephalosporinases. To determine a reliable value of the kinetic parameter, Km, we introduced a continuous and acidimetric assay method of beta-lactamase activity with a pH stat. PMID:6752115

  15. Surveillance of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Dairy Cattle Farms in the Nile Delta, Egypt

    PubMed Central

    Braun, Sascha D.; Ahmed, Marwa F. E.; El-Adawy, Hosny; Hotzel, Helmut; Engelmann, Ines; Weiß, Daniel; Monecke, Stefan; Ehricht, Ralf

    2016-01-01

    Introduction: Industrial livestock farming is a possible source of multi-resistant Gram-negative bacteria, including producers of extended spectrum beta-lactamases (ESBLs) conferring resistance to 3rd generation cephalosporins. Limited information is currently available on the situation of ESBL producers in livestock farming outside of Western Europe. A surveillance study was conducted from January to May in 2014 in four dairy cattle farms in different areas of the Nile delta, Egypt. Materials and Methods: In total, 266 samples were collected from 4 dairy farms including rectal swabs from clinically healthy cattle (n = 210), and environmental samples from the stalls (n = 56). After 24 h pre-enrichment in buffered peptone water, all samples were screened for 3rd generation cephalosporin-resistant Escherichia coli using Brilliance™ ESBL agar. Suspected colonies of putatively ESBL-producing E. coli were sub-cultured and subsequently genotypically and phenotypically characterized. Susceptibility testing using the VITEK-2 system was performed. All suspect isolates were genotypically analyzed using two DNA-microarray based assays: CarbDetect AS-1 and E. coli PanType AS-2 kit (ALERE). These tests allow detection of a multitude of genes and their alleles associated with resistance toward carbapenems, cephalosporins, and other frequently used antibiotics. Serotypes were determined using the E. coli SeroGenotyping AS-1 kit (ALERE). Results: Out of 266 samples tested, 114 (42.8%) ESBL-producing E. coli were geno- and phenotypically identified. 113 of 114 phenotypically 3rd generation cephalosporin-resistant isolates harbored at least one of the ESBL resistance genes covered by the applied assays [blaCTX-M15 (n = 105), blaCTX-M9 (n = 1), blaTEM (n = 90), blaSHV (n = 1)]. Alarmingly, the carbapenemase genes blaOXA-48 (n = 5) and blaOXA-181 (n = 1) were found in isolates that also were phenotypically resistant to imipenem and meropenem. Using the array-based serogenotyping

  16. Shedding of Clostridium difficile, fecal beta-lactamase activity, and gastrointestinal symptoms in 51 volunteers treated with oral cefixime.

    PubMed Central

    Chachaty, E; Bourneix, C; Renard, S; Bonnay, M; Andremont, A

    1993-01-01

    Microbial changes including the shedding of Clostridium difficile, fecal beta-lactamase activity, and gastrointestinal symptoms were assessed in 51 healthy volunteers given 200 mg of cefixime twice daily for 8 days. The number of organisms of the family Enterobacteriaceae (means +/- standard deviations) dropped from 6.9 +/- 1.1 to 3.9 +/- 1.8 log CFU/g of feces (P < 0.01), whereas counts of enterococci rose from 7.0 +/- 1.5 to 9.0 +/- 1.0 log CFU/g of feces (P < 0.01). Both counts returned to their initial levels 50 days after the cessation of treatment. Cefixime did not significantly modify the frequency of fecal excretion of Pseudomonas aeruginosa, Staphylococcus spp., yeasts, or members of the Enterobacteriaceae resistant to ceftazidime or ampicillin. The proportion of subjects shedding C. difficile rose from 6% before treatment to 57% (P < 0.01) at the end of treatment but returned to 8% 50 days thereafter. No case of pseudomembranous colitis was observed. Stool changes occurred in 13 volunteers during treatment (25%) and in 2 others more than 10 days after the end of treatment (4%). These changes were not significantly associated with the shedding of toxigenic strains of C. difficile or with the presence of toxin A in feces. By contrast, during treatment, stool changes occurred in 8 of the 18 volunteers (44%) who had antibiotic activity in their feces but in only 5 of the 33 (15%) for whom no such activity was found (P < 0.05). The absence of antibiotic activity in the feces was itself linked with the presence of beta-lactamase activity in the feces. Since we had found earlier that fecal beta-lactamase activity afforded protection against alteration in stool consistency during treatments with oral cephalosporins, the present study confirmed our previous preliminary results in this respect. PMID:8363371

  17. Shedding of Clostridium difficile, fecal beta-lactamase activity, and gastrointestinal symptoms in 51 volunteers treated with oral cefixime.

    PubMed

    Chachaty, E; Bourneix, C; Renard, S; Bonnay, M; Andremont, A

    1993-07-01

    Microbial changes including the shedding of Clostridium difficile, fecal beta-lactamase activity, and gastrointestinal symptoms were assessed in 51 healthy volunteers given 200 mg of cefixime twice daily for 8 days. The number of organisms of the family Enterobacteriaceae (means +/- standard deviations) dropped from 6.9 +/- 1.1 to 3.9 +/- 1.8 log CFU/g of feces (P < 0.01), whereas counts of enterococci rose from 7.0 +/- 1.5 to 9.0 +/- 1.0 log CFU/g of feces (P < 0.01). Both counts returned to their initial levels 50 days after the cessation of treatment. Cefixime did not significantly modify the frequency of fecal excretion of Pseudomonas aeruginosa, Staphylococcus spp., yeasts, or members of the Enterobacteriaceae resistant to ceftazidime or ampicillin. The proportion of subjects shedding C. difficile rose from 6% before treatment to 57% (P < 0.01) at the end of treatment but returned to 8% 50 days thereafter. No case of pseudomembranous colitis was observed. Stool changes occurred in 13 volunteers during treatment (25%) and in 2 others more than 10 days after the end of treatment (4%). These changes were not significantly associated with the shedding of toxigenic strains of C. difficile or with the presence of toxin A in feces. By contrast, during treatment, stool changes occurred in 8 of the 18 volunteers (44%) who had antibiotic activity in their feces but in only 5 of the 33 (15%) for whom no such activity was found (P < 0.05). The absence of antibiotic activity in the feces was itself linked with the presence of beta-lactamase activity in the feces. Since we had found earlier that fecal beta-lactamase activity afforded protection against alteration in stool consistency during treatments with oral cephalosporins, the present study confirmed our previous preliminary results in this respect. PMID:8363371

  18. Prevalence of metallo-beta-lactamase among Pseudomonas aeruginosa and Acinetobacter baumannii in a Korean university hospital and comparison of screening methods for detecting metallo-beta-lactamase.

    PubMed

    Oh, Eun-Jee; Lee, Seungok; Park, Yeon-Joon; Park, Jung Jun; Park, Kanggyun; Kim, Sang-Il; Kang, Moon Won; Kim, Byung Kee

    2003-09-01

    To identify the metallo-beta-lactamases (MBLs) prevalent in Korea, a total of 130 clinical isolates of Pseudomonas aeruginosa and Acinetobacter baumannii (99 P. aeruginosa and 31 A. baumannii) with a reduced susceptibility to imipenem (IPM) and/or ceftazidime (CAZ) was subjected to PCR analyses with primers specific to bla(IMP-1), bla(VIM-1), and bla(VIM-2). In addition, inhibitor-potentiated disk diffusion methods (IPD) using two kinds of substrate-inhibitor combinations (ceftazidime-2-mercaptopropionic acid (2MPA) and imipenem-EDTA) were investigated. Thirty-three isolates (29 P. aeruginosa and 4 A. baumannii) carried bla(VIM-2) and two P. aeruginosa isolates harbored bla(IMP-1). The enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) pattern revealed that many of the VIM-2-producing P. aeruginosa isolates were clonally related, whereas the A. baumannii isolates were diverse. The inhibitor-potentiated disk diffusion test using imipenem-EDTA was highly sensitive and specific for detecting the VIM-2 producer. These results suggest that VIM-2 is an important MBL in P. aeruginosa and A. baumannii in the Korean hospital of this study and that the IMP-1-producing P. aeruginosa has also emerged. Screening for MBLs and strict infection control for these isolates will contribute to prevent further spread of resistance. PMID:12842488

  19. In vitro potentiation of carbapenems with ME1071, a novel metallo-beta-lactamase inhibitor, against metallo-beta-lactamase- producing Pseudomonas aeruginosa clinical isolates.

    PubMed

    Ishii, Yoshikazu; Eto, Maki; Mano, Yoko; Tateda, Kazuhiro; Yamaguchi, Keizo

    2010-09-01

    ME1071, a maleic acid derivative, is a novel specific inhibitor for metallo-beta-lactamases (MBL). In this study, the potentiation of ME1071 in combination with several beta-lactams was evaluated using MBL-producing Pseudomonas aeruginosa isolates. The rates of susceptibility of MBL producers to carbapenems (imipenem, biapenem, and doripenem) and ceftazidime were increased by 8 to 27% in the presence of 32 microg/ml of ME1071. The corresponding resistance rates were decreased by 13 to 46%, respectively. On the other hand, ME1071 showed weaker or no potentiation with non-MBL producers. The K(i) value of ME1071 for IMP-1 was 0.4 microM, significantly lower than the K(m) values of carbapenems for the IMP-1 enzyme. On the other hand, the K(i) value of ME1071 for VIM-2 was 120 microM, higher than the K(m) values of carbapenems for the VIM-2 enzyme. Results of this study indicate that ME1071 can potentiate the activity of ceftazidime and carbapenems against MBL-producing strains of P. aeruginosa. PMID:20606062

  20. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    PubMed

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar prevalences

  1. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste

    PubMed Central

    Durso, Lisa M.; Harhay, Dayna M.; Schmidt, John W.

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two “low impact” environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  2. Improved detection of extended spectrum beta-lactamase (ESBL)-producing Escherichia coli in input and output samples of German biogas plants by a selective pre-enrichment procedure.

    PubMed

    Schauss, Thorsten; Glaeser, Stefanie P; Gütschow, Alexandra; Dott, Wolfgang; Kämpfer, Peter

    2015-01-01

    The presence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli was investigated in input (manure from livestock husbandry) and output samples of six German biogas plants in 2012 (one sampling per biogas plant) and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU) per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%), few SHV-type beta lactamase (6%). Sixty-four blaCTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85%) and 9 (13%), and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71%) and B1 (27%), only one to group D (2%). Genomic fingerprinting and multilocus sequence typing (MLST) showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT) genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E. coli in

  3. Improved Detection of Extended Spectrum Beta-Lactamase (ESBL)-Producing Escherichia coli in Input and Output Samples of German Biogas Plants by a Selective Pre-Enrichment Procedure

    PubMed Central

    Schauss, Thorsten; Glaeser, Stefanie P.; Gütschow, Alexandra; Dott, Wolfgang; Kämpfer, Peter

    2015-01-01

    The presence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli was investigated in input (manure from livestock husbandry) and output samples of six German biogas plants in 2012 (one sampling per biogas plant) and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU) per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%), few SHV-type beta lactamase (6%). Sixty-four blaCTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85%) and 9 (13%), and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71%) and B1 (27%), only one to group D (2%). Genomic fingerprinting and multilocus sequence typing (MLST) showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT) genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E. coli in

  4. BetalasEN: microdilution panel for identifying beta-lactamases present in isolates of Enterobacteriaceae.

    PubMed

    Sanders, Christine C; Ehrhardt, Anton F; Moland, Ellen Smith; Thomson, Kenneth S; Zimmer, Barbara; Roe, Darcie E

    2002-01-01

    A dried investigational use-only microdilution panel named betalasEN (a short named derived from the panel's purpose, to identify beta-lactamases in Enterobacteriaceae) containing 10 beta-lactam drugs with and without beta-lactamase inhibitors was developed to identify beta-lactamases among clinical isolates of Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Citrobacter koseri, Citrobacter freundii group, Enterobacter spp., and Serratia marcescens. The MICs obtained with a collection of 383 organisms containing well-characterized beta-lactamases were used to develop numeric codes and logic pathways for computerized analysis of results. The resultant logic pathways and betalasEN panel were then used to test and identify beta-lactamases among 885 isolates of Enterobacteriaceae recovered in cultures obtained at six different hospital laboratories across the United States. beta-Lactamases present in 801 (90.5%) of the 885 isolates were identified by betalasEN by using the existing logic pathways and codes or after minor modifications were made to the existing codes. The 84 strains that gave codes that betalasEN could not identify were collected, reidentified, and retested by using betalasEN. Three strains had been misidentified, 54 strains gave different codes upon repeat testing that could be identified by betalasEN, and 27 strains repeated new codes. The beta-lactamases in these strains were identified, and the new codes were added to the betalasEN logic pathways. These results indicate that betalasEN can identify clinically important beta-lactamases among most isolates of Enterobacteriaceae. The results also show that good quality control and attention to proper performance of the tests are essential to the correct performance of betalasEN. PMID:11773104

  5. Structural Milestones in the Reaction Pathway of an Amide Hydrolase: Substrate, Acyl, and Product Complexes of Cephalothin with AmpC [beta]-Lactamase

    SciTech Connect

    Beadle, Beth M.; Trehan, Indi; Focia, Pamela J.; Shoichet, Brian K.

    2010-03-05

    {beta}-lactamases hydrolyze {beta}-lactam antibiotics and are the leading cause of bacterial resistance to these drugs. Although {beta}-lactamases have been extensively studied, structures of the substrate-enzyme and product-enzyme complexes have proven elusive. Here, the structure of a mutant AmpC in complex with the {beta}-lactam cephalothin in its substrate and product forms was determined by X-ray crystallography to 1.53 {angstrom} resolution. The acyl-enzyme intermediate between AmpC and cephalothin was determined to 2.06 {angstrom} resolution. The ligand undergoes a dramatic conformational change as the reaction progresses, with the characteristic six-membered dihydrothiazine ring of cephalothin rotating by 109{sup o}. These structures correspond to all three intermediates along the reaction path and provide insight into substrate recognition, catalysis, and product expulsion.

  6. Physiological studies of the regulation of beta-lactamase expression in Pseudomonas maltophilia.

    PubMed Central

    Rosta, S; Mett, H

    1989-01-01

    The kinetics of beta-lactamase induction in Pseudomonas maltophilia IID1275/873 were investigated. Upon induction with beta-lactam antibiotics, a correlation was seen between the increase in specific beta-lactamase activity and the generation time, as well as the concentration of inducer in the medium. The specific beta-lactamase activity increased slowly within the first 0.5 generation and then more rapidly; it decreased regularly after about 2 generations of growth in the presence of inducer. This decrease could presumably be attributed to the continuous breakdown of inducer by beta-lactamases in the culture medium. In a chemostat culture with continuous supply of fresh inducer-containing medium, the specific beta-lactamase activity could be stabilized at a high level over several generations. Removal of the beta-lactam after a certain induction time showed that a short exposure of the bacteria to inducer caused induction kinetics comparable to those resulting from continuous exposure of the cells to inducer. The two beta-lactamases of P. maltophilia, L1 and L2, were induced simultaneously under various experimental conditions. PMID:2783690

  7. Structures of the Michaelis Complex (1.2A) and the Covalent Acyl Intermediate (2.0A ) of Cefamandole Bound in the Active Sites of the Mycobacterium tuberculosis beta-Lactamase K72A and E166A Mutants

    SciTech Connect

    L Tremblay; h Xu; J Blanchard

    2011-12-31

    The genome of Mycobacterium tuberculosis (TB) contains a gene that encodes a highly active {beta}-lactamase, BlaC, that imparts TB with resistance to {beta}-lactam chemotherapy. The structure of covalent BlaC-{beta}-lactam complexes suggests that active site residues K73 and E166 are essential for acylation and deacylation, respectively. We have prepared the K73A and E166A mutant forms of BlaC and have determined the structures of the Michaelis complex of cefamandole and the covalently bound acyl intermediate of cefamandole at resolutions of 1.2 and 2.0 {angstrom}, respectively. These structures provide insight into the details of the catalytic mechanism.

  8. The Ocean as a Global Reservoir of Antibiotic Resistance Genes

    PubMed Central

    Hatosy, Stephen M.

    2015-01-01

    Recent studies of natural environments have revealed vast genetic reservoirs of antibiotic resistance (AR) genes. Soil bacteria and human pathogens share AR genes, and AR genes have been discovered in a variety of habitats. However, there is little knowledge about the presence and diversity of AR genes in marine environments and which organisms host AR genes. To address this, we identified the diversity of genes conferring resistance to ampicillin, tetracycline, nitrofurantoin, and sulfadimethoxine in diverse marine environments using functional metagenomics (the cloning and screening of random DNA fragments). Marine environments were host to a diversity of AR-conferring genes. Antibiotic-resistant clones were found at all sites, with 28% of the genes identified as known AR genes (encoding beta-lactamases, bicyclomycin resistance pumps, etc.). However, the majority of AR genes were not previously classified as such but had products similar to proteins such as transport pumps, oxidoreductases, and hydrolases. Furthermore, 44% of the genes conferring antibiotic resistance were found in abundant marine taxa (e.g., Pelagibacter, Prochlorococcus, and Vibrio). Therefore, we uncovered a previously unknown diversity of genes that conferred an AR phenotype among marine environments, which makes the ocean a global reservoir of both clinically relevant and potentially novel AR genes. PMID:26296734

  9. [Antibacterial activity and beta-lactamase stability of eleven oral cephalosporins].

    PubMed

    Bauernfeind, A; Jungwirth, R; Schweighart, S; Theopold, M

    1990-01-01

    Oral cephalosporins (cefixime, cefdinir, cefetamet, ceftibuten, cefpodoxime, loracarbef, cefprozil, cefuroxime, cefaclor, cefadroxil and BAY 3522) were compared by their antibacterial profile including stability against new beta-lactamases. Both activity and antibacterial spectrum of compounds structurally related to third generation parenteral cephalosporins (of the oximino class) were superior to established compounds. Activity against staphylococci was found to be highest for cefdinir, cefprozil and BAY 3522. Cefetamet, ceftibuten and cefixime demonstrate no clinically meaningful antistaphylococcal activity while the other compounds investigated demonstrate intermediate activity. The antibacterial spectrum was broadest for cefdinir and cefpodoxime. New oral cephalosporins are equally inactive as established compounds against Enterobacter spp., Morganella, Listeria, Pseudomonas and Acinetobacter spp., methicillin-resistant staphylococci, Enterococcus spp., penicillin-resistant pneumococci and anaerobes. New extended broad-spectrum betalactamases (TEM-3, TEM-5, TEM-6, TEM-7, SHV-2, SHV-3, SHV-4, SHV-5, CMY-1, CMY-2, and CTX-M) are active against the majority of oral cephalosporins. Ceftibuten, cefetamet, cefixime and cefdinir were stable against some of these enzymes even to a higher extent than parenteral cephalosporins. New oral cephalosporins should improve the therapeutic perspectives of oral cephalosporins due to their higher activity against pathogens marginally susceptible to established compounds (higher multiplicity of maximum plasma concentrations over MICs of the pathogens) and furthermore by including in their spectrum organisms resistant to established absorbable cephalosporins (e.g. Proteus spp., Providencia spp., Citrobacter spp., and Serratia spp.). PMID:2079378

  10. Site-directed mutagenesis of dicarboxylic acids near the active site of Bacillus cereus 5/B/6 beta-lactamase II.

    PubMed Central

    Lim, H M; Iyer, R K; Pène, J J

    1991-01-01

    An amino acid residue functioning as a general base has been proposed to assist in the hydrolysis of beta-lactam antibiotics by the zinc-containing Bacillus cereus beta-lactamase II [Bicknell & Waley (1985) Biochemistry 24, 6876-6887]. Oligonucleotide-directed mutagenesis of cloned Bacillus cereus 5/B/6 beta-lactamase II was used in an 'in vivo' study to investigate the role of carboxy-group-containing amino acids near the active site of the enzyme. Substitution of asparagine for the wild-type aspartic acid residue at position 81 resulted in fully functional enzyme. An aspartic acid residue at position 90 is essential for beta-lactamase II to confer any detectable ampicillin and cephalosporin C resistance to Escherichia coli. Conversion of Asp90 into Asn90 or Glu90 lead to the synthesis of inactive enzyme, suggesting that the spatial position of the beta-carboxy group of Asp90 is critical for enzyme function. Images Fig. 2. Fig. 3. PMID:1904717

  11. Identification of two regions of Klebsiella oxytoca pullulanase that together are capable of promoting beta-lactamase secretion by the general secretory pathway.

    PubMed

    Sauvonnet, N; Pugsley, A P

    1996-10-01

    Pullulanase (PulA) is a 116 kDa amylolytic lipoprotein secreted by the Gram-negative bacterium Klebsiella oxytoca via the general secretory pathway. A deletion strategy was used in an attempt to determine the nature and the location of the secretion signal(s) in PulA presumed to be necessary for its specific secretion. The starting material was a gene fusion coding for an efficiently secreted PulA-beta-lactamase hybrid protein. Successive series of exonuclease III-generated deletions were used to remove internal segments of PulA from this hybrid. A simple plate test allowed the identification of truncated hybrids that retained beta-lactamase activity and that were secreted. Two non-adjacent regions, A and B (78 and 80 amino acids, respectively), were together necessary and sufficient to promote beta-lactamase translocation across the outer membrane. Secretion of PulA itself was markedly reduced when either of these regions was deleted, and was completely abolished when both regions were eliminated. PMID:8899703

  12. Coevolutionary Landscape Inference and the Context-Dependence of Mutations in Beta-Lactamase TEM-1.

    PubMed

    Figliuzzi, Matteo; Jacquier, Hervé; Schug, Alexander; Tenaillon, Oliver; Weigt, Martin

    2016-01-01

    The quantitative characterization of mutational landscapes is a task of outstanding importance in evolutionary and medical biology: It is, for example, of central importance for our understanding of the phenotypic effect of mutations related to disease and antibiotic drug resistance. Here we develop a novel inference scheme for mutational landscapes, which is based on the statistical analysis of large alignments of homologs of the protein of interest. Our method is able to capture epistatic couplings between residues, and therefore to assess the dependence of mutational effects on the sequence context where they appear. Compared with recent large-scale mutagenesis data of the beta-lactamase TEM-1, a protein providing resistance against beta-lactam antibiotics, our method leads to an increase of about 40% in explicative power as compared with approaches neglecting epistasis. We find that the informative sequence context extends to residues at native distances of about 20 Å from the mutated site, reaching thus far beyond residues in direct physical contact. PMID:26446903

  13. Coevolutionary Landscape Inference and the Context-Dependence of Mutations in Beta-Lactamase TEM-1

    PubMed Central

    Figliuzzi, Matteo; Jacquier, Hervé; Schug, Alexander; Tenaillon, Oliver; Weigt, Martin

    2016-01-01

    The quantitative characterization of mutational landscapes is a task of outstanding importance in evolutionary and medical biology: It is, for example, of central importance for our understanding of the phenotypic effect of mutations related to disease and antibiotic drug resistance. Here we develop a novel inference scheme for mutational landscapes, which is based on the statistical analysis of large alignments of homologs of the protein of interest. Our method is able to capture epistatic couplings between residues, and therefore to assess the dependence of mutational effects on the sequence context where they appear. Compared with recent large-scale mutagenesis data of the beta-lactamase TEM-1, a protein providing resistance against beta-lactam antibiotics, our method leads to an increase of about 40% in explicative power as compared with approaches neglecting epistasis. We find that the informative sequence context extends to residues at native distances of about 20 Å from the mutated site, reaching thus far beyond residues in direct physical contact. PMID:26446903

  14. Evaluation of Zataria MultiFlora Boiss and Carum copticum antibacterial activity on IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa

    PubMed Central

    Fallah, F.; Taherpour, A.; Borhan, R.S.; Hashemi, A.; Habibi, M.; Sajadi Nia, R.

    2013-01-01

    Summary Carbapenem resistance due to acquired metallo-beta-lactamases (MBLs) is considered to be more serious than other resistance mechanisms. The aim of this study was to evaluate the antibacterial activity of Zataria multiflora Boiss and Carum copticum plants on IMP-producing P.aeruginosa strains. This experimental study was carried out on hospitalized burn patients during 2011 and 2012. Antibiotics and extracts susceptibility tests were performed by disc diffusion and broth microdilution methods. MBL detection was performed by Combination Disk Diffusion Test (CDDT). The bla(VIM) and bla(IMP) genes were detected by PCR and sequencing methods. Using Combination Disk Diffusion test method, it was found that among 83 imipenem resistant P.aeruginosa strains, 48 (57.9%) were MBL producers. PCR and sequencing methods proved that these isolates were positive for blaIMP-1 genes, whereas none were positive for bla(VIM) genes. The mortality rate of hospitalized patients with MBL-producing Pseudomonas infection was 4/48 (8.3%). It was shown that Zataria multiflora and Carum copticum extracts had a high antibacterial effect on regular and IMP-producing P. aeruginosa strains in 6.25 mg/ml concentration. The incidence of MBL-producing P. aeruginosa in burn patients is very high. In our study, all MBL-producing isolates carry the blaIMP-1 gene. Therefore, detection of MBL-producing isolates is of great importance in identifying drug resistance patterns in P. aeruginosa, and in prevention and control of infections. In this study, it was shown that extracts of Z. multiflora and C. copticum have high antibacterial effects on ß-lactamase producing P. aeruginosa strains. PMID:24799849

  15. Evaluation of Zataria MultiFlora Boiss and Carum copticum antibacterial activity on IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa.

    PubMed

    Fallah, F; Taherpour, A; Borhan, R S; Hashemi, A; Habibi, M; Sajadi Nia, R

    2013-12-31

    Carbapenem resistance due to acquired metallo-beta-lactamases (MBLs) is considered to be more serious than other resistance mechanisms. The aim of this study was to evaluate the antibacterial activity of Zataria multiflora Boiss and Carum copticum plants on IMP-producing P.aeruginosa strains. This experimental study was carried out on hospitalized burn patients during 2011 and 2012. Antibiotics and extracts susceptibility tests were performed by disc diffusion and broth microdilution methods. MBL detection was performed by Combination Disk Diffusion Test (CDDT). The bla(VIM) and bla(IMP) genes were detected by PCR and sequencing methods. Using Combination Disk Diffusion test method, it was found that among 83 imipenem resistant P.aeruginosa strains, 48 (57.9%) were MBL producers. PCR and sequencing methods proved that these isolates were positive for blaIMP-1 genes, whereas none were positive for bla(VIM) genes. The mortality rate of hospitalized patients with MBL-producing Pseudomonas infection was 4/48 (8.3%). It was shown that Zataria multiflora and Carum copticum extracts had a high antibacterial effect on regular and IMP-producing P. aeruginosa strains in 6.25 mg/ml concentration. The incidence of MBL-producing P. aeruginosa in burn patients is very high. In our study, all MBL-producing isolates carry the blaIMP-1 gene. Therefore, detection of MBL-producing isolates is of great importance in identifying drug resistance patterns in P. aeruginosa, and in prevention and control of infections. In this study, it was shown that extracts of Z. multiflora and C. copticum have high antibacterial effects on ß-lactamase producing P. aeruginosa strains. PMID:24799849

  16. Mechanism of suppression of piperacillin resistance in enterobacteria by tazobactam.

    PubMed Central

    Kadima, T A; Weiner, J H

    1997-01-01

    Resistance to piperacillin in several isolates of Citrobacter freundii and Enterobacter cloacae was investigated and confirmed to occur at a frequency of 10(-7) to 10(-6). Development of resistance to piperacillin was significantly suppressed by tazobactam but not by clavulanic acid. To elucidate the mechanism by which resistance suppression occurs, the effect of piperacillin plus tazobactam on the induction of AmpC beta-lactamase was analyzed by monitoring the beta-galactosidase activity of an inducible ampC-lacZ gene fusion in Escherichia coli. The combination exerted no inhibitory effect on AmpC beta-lactamase induction. Tazobactam also had no effect on the accumulation of a key intermediate in the AmpC beta-lactamase induction pathway, 1,6-anhydromurotripeptide, in an ampD mutant strain of E. coli. However, the addition of tazobactam to liquid cultures of E. cloacae 40001 in the presence of piperacillin at four times the MIC caused a delay in the recovery of the culture to piperacillin-induced stress. At 16 times the MIC, a complete suppression of regrowth occurred. Analysis of culture viability on piperacillin plates showed that the culture recovery was due to growth by moderately resistant mutants preexisting in the cell population, which at 16 times the MIC became susceptible to the combination. Evidence from the kinetics of inhibition of the E. cloacae 40001 AmpC beta-lactamase by clavulanic acid, sulbactam, and tazobactam and from the effects of these drugs on the frequency of resistance to piperacillin suggests that the suppressive effect of tazobactam on the appearance of resistance is primarily mediated by the beta-lactamase inhibitory activity. PMID:9333044

  17. [THE APPLICATION OF SELECTIVE CHROMOGENIC AGAR FOR DETECTING ENTEROBACTERIA WITH PRODUCTION OF BETA-LACTAMASES].

    PubMed

    Korobova, A G; Frolova, L N; Kliasova, G A

    2015-11-01

    The detection of enterobacteria with production of beta-lactamases of extended spectrum in selective chromogenic agar was analyzed The results ofdetection of beta-lactamases of extended spectrum was compared with "double disc" technique. The smears from mucous membrane of guttur and rectum from patients were analyzed in parallel on solid growth agar (Endo or Mac Conkey) and on selective agar CHROMagartm ESBL (CHROMagar France). The production of beta-lactamases of extended spectrum was confirmed using "double discs" technique. To exclude hyper-production of ampC beta-lactamases E-test was applied containing cefotetan and cefotetan with cloxacillin. The sampling consisted of 1552 samples from patients. The study permitted to isolate 1243 strains of enterobacteria on agar Endo or Mac Conkey and 409 strains of enterobacteria on selective agar CHROMagartm ESBL (Escherichia coli n = 226, Klebsiella pneumoniae n = 105, enterobacter spp. n = 35, Citrobacter spp. n = 21, others n = 22). The application of "double discs" technique confirmed production of beta-lactamases of extended spectrum in 386 (94%) out of 409 strains isolated on agar CHROMagartm ESBL. In 23 (6%) of strains no confirmation was established and hyper-production of ampC of beta-lactamases was established 15 out of total. Additionally, 8 were sensitive to cephalosporin of third generation. All enterobacteria isolated on agar Endo or Mac Conkey also were tested by "double discs" technique. Overall, 394 strains of enterobacteria with production of beta-lactamases of extended spectrum were obtained. On all agars (agar Endo or Mac Conkey and CHROMagartm ESBL)--263 (67%) strains; only on CHROMagartm ESBL--123 (31%) and only on agar Endo or Mac Conkey--8 (2%) (p < 0.0001). The sensitivity of selective agar CHROMagartm ESBL made up to 98% and specificity--97%. The resolution about detection of enterobacteria producing beta-lactamases of extended spectrum were submitted to clinic in 18-24 hours after arrival

  18. blaCTX-M-I group extended spectrum beta lactamase-producing Salmonella typhi from hospitalized patients in Lagos, Nigeria

    PubMed Central

    Akinyemi, Kabiru O; Iwalokun, Bamidele A; Alafe, Olajide O; Mudashiru, Sulaiman A; Fakorede, Christopher

    2015-01-01

    Purpose The global spread of blaCTX-M-I extended-spectrum beta-lactamase (ESBL)-producing Salmonella spp. remains a major threat to treatment and control. Evidence of emergence and spread of this marker are lacking in Nigeria. This study investigated blaCTX-M-I ESBL production among Salmonella isolates from hospitalized patients. Methods Patients (158 total) made up of two groups were evaluated. Group A was composed of 135 patients with persistent pyrexia and group B was composed of 23 gastroenteritis patients and their stool samples. Samples were cultured, and isolates were identified and were subjected to antibiotic susceptibility testing by standard methods. Isolates were further screened for ESBL production, blaCTX-M-I genes and transferability by double disk synergy test, plasmid extraction, polymerase chain reaction, and conjugation experiment. Results Thirty-five (25.9%) Salmonella isolates were identified from group A, of which 74.3% were S. typhi, 22.9% were S. paratyphi and two (5.7%) were invasive non-typhoidal S. enteritidis. Nine Plasmodium falciparum infections were recorded, four of which were identified as co-infections with typhoidal Salmonella. Only two (8.7%) S. enteritidis samples were obtained from group B (P>0.05). A total of 24 isolates were ESBL-positive, eliciting resistance to five to seven antibiotics, and were multiple-drug resistant. ESBL production due to the blaCTX-M-I gene cluster was detected in eleven (45.8%) Salmonella isolates. Nine (81.8%) of the eleven blaCTX-M-I ESBL producers were S. typhi and two (18.2%) isolates were S. enteritidis. Four of nine S. typhi blaCTX-M-I ESBL-producing strains harbored 23 kb self-transmissible plasmid that was co-transferred with cefotaxime and augmentin resistance to Escherichia coli j53-2 transconjugants. Conclusion This study revealed the emergence of blaCTX-M-I S. typhi as an agent of persistent pyrexia with potential to spread to other Enterobacteriaceae in Lagos, Nigeria. Cautionary

  19. The in vitro activity of beta-lactamase inhibitors in combination with cephalosporins against M. tuberculosis.

    PubMed

    Chen, C H; Yang, M H; Lin, J S; Lee, Y C; Perng, R P

    1995-04-01

    Although there are reports that the addition of a beta-lactamase inhibitor to ampicillin or amoxicillin greatly improves their in vitro activity against M. tuberculosis, there are no written reports about the antituberculosis effects of beta-lactamase inhibitors in combination with cephalosporins against M. tuberculosis. In this report, we have determined the minimal inhibitory concentrations (MIC) of 5 cephalosporins with or without combination with beta-lactamase inhibitor against M. tuberculosis strains isolated from patients before antituberculosis treatment and checked the production of beta-lactamase by bacteria before this procedure. Four strains of M. tuberculosis were contaminated during the experiment, and all the other 16 strains hydrolyzed the nitrocefin disc, thus indicating a beta-lactamase producer. The MICs of cephalosporins alone against M. tuberculosis were 200-400 micrograms/ml for ceforanide, 100-400 micrograms/ml for cephapirin, 400-1600 micrograms/ml for cefamandole, 200-1600 micrograms/ml for cefotaxime, and 800-1600 micrograms/ml for ceftriaxone. After adding the equimolar concentrations of sulbactam, the MICs were reduced to 100-200 micrograms/ml for ceforanide, 12.5-100 micrograms/ml for cephapirin, 100-400 micrograms/ml for cefamandole, 25-200 micrograms/ml for cefotaxime, and 100-800 micrograms/ml for ceftriaxone. We concluded that sulbactam enhanced the antituberculosis effect of cephalosporins. PMID:7624446

  20. beta-Lactamase-catalyzed hydrolysis of acyclic depsipeptides and acyl transfer to specific amino acid acceptors.

    PubMed Central

    Pratt, R F; Govardhan, C P

    1984-01-01

    beta-Lactamases from all three classes, A, B, and C, catalyze the hydrolysis of specific acyclic depsipeptide (PhCH2CONHCR1R2CO2CHR3CO2H) analogs of acyl-D-alanyl-D-alanine peptides. The depsipeptides investigated, which are chemically as reactive toward nucleophiles as penicillins, are in general poor substrates, although differences between the classes of beta-lactamases have been observed: the order of effectiveness seems to be C greater than B greater than A. Certain class A and C beta-lactamases also catalyze phenylacetylglycyl transfer between phenylacetylglycyl depsipeptides and specific amino acid acceptors, a type of reaction hitherto identified more closely with D-alanyl-D-alanine transpeptidases than with beta-lactamases. Preliminary indications of an acyl-enzyme intermediate in these reactions have been obtained. These results support the suggestion [Tipper, D.J. and Strominger, J.L. (1965) Proc. Natl. Acad. Sci. USA 54, 1133-1141] that beta-lactamases are evolutionary descendants of bacterial cell wall D-alanyl-D-alanine transpeptidases. PMID:6424114

  1. Effect of porin loss on the activity of tigecycline against Klebsiella pneumoniae producing extended-spectrum beta-lactamases or plasmid-mediated AmpC-type beta-lactamases.

    PubMed

    Conejo, M Carmen; Hernández, J Ramón; Pascual, Alvaro

    2008-07-01

    Tigecycline showed excellent in vitro activity against 50 clinical isolates of Klebsiella pneumoniae producing extended-spectrum beta-lactamases, plasmid-mediated AmpC-type beta-lactamases, or both. This activity was not affected by porin loss. Porin loss, however, did affect the activity of imipenem against strains that expressed both types of enzymes. PMID:18339509

  2. Beta Lactamase Producing Clostridium perfringens Bacteremia in an Elderly Man with Acute Pancreatitis

    PubMed Central

    Mishra, Rashmi; Duncalf, Richard

    2016-01-01

    Clostridium perfringens bacteremia is associated with adverse outcomes. Known risk factors include chronic kidney disease, malignancy, diabetes mellitus, and gastrointestinal disease. We present a 74-year-old man admitted with confusion, vomiting, and abdominal pain. Exam revealed tachycardia, hypotension, lethargy, distended abdomen, and cold extremities. He required intubation and aggressive resuscitation for septic shock. Laboratory data showed leukocytosis, metabolic acidosis, acute kidney injury, and elevated lipase. CT scan of abdomen revealed acute pancreatitis and small bowel ileus. He was started on vancomycin and piperacillin-tazobactam. Initial blood cultures were positive for C. perfringens on day five. Metronidazole and clindamycin were added to the regimen. Repeat CT (day 7) revealed pancreatic necrosis. The patient developed profound circulatory shock requiring multiple vasopressors, renal failure requiring dialysis, and bacteremia with vancomycin-resistant enterococci. Hemodynamic instability precluded surgical intervention and he succumbed to multiorgan failure. Interestingly, our isolate was beta lactamase producing. We review the epidemiology, risk factors, presentation, and management of C. perfringens bacteremia. This case indicates a need for high clinical suspicion for clostridial sepsis and that extended spectrum beta lactam antibiotic coverage may be inadequate and should be supplemented with use of clindamycin or metronidazole if culture is positive, until sensitivities are known. PMID:26904307

  3. New Delhi metallo-beta-lactamase 1-producing Enterobacteriaceae: emergence and response in Europe.

    PubMed

    Struelens, M J; Monnet, D L; Magiorakos, A P; Santos O'Connor, F; Giesecke, J

    2010-11-18

    Acquired carbapenemases confer extensive antibiotic resistance to Enterobacteriaceae and represent a public health threat. A novel acquired carbapenemase, New Delhi metallo-beta-lactamase 1 (NDM-1), has recently been described in the United Kingdom and Sweden, mostly in patients who had received care on the Indian subcontinent. We conducted a survey among 29 European countries (the European Union Member States, Iceland and Norway) to gather information on the spread of NDM-1-producing Enterobacteriaceae in Europe, on public health responses and on available national guidance on detection, surveillance and control. A total of 77 cases were reported from 13 countries from 2008 to 2010. Klebsiella pneumoniae was the most frequently reported species with 54%. Among 55 cases with recorded travel history, 31 had previously travelled or been admitted to a hospital in India or Pakistan and five had been hospitalised in the Balkan region. Possible nosocomial acquisition accounted for 13 of 77 cases. National guidance on NDM-1 detection was available in 14 countries and on NDM-1 control in 11 countries. In conclusion, NDM-1 is spreading across Europe, where it is frequently linked to a history of healthcare abroad, but also to emerging nosocomial transmission. National guidance in response to the threat of carbapenemase-producing Enterobacteriaceae is available in approximately half of the surveyed European countries. Surveillance of carbapenemase- producing Enterobacteriaceae must be enhanced in Europe and effective control measures identified and implemented. PMID:21144431

  4. Prevalence of extended-spectrum beta-lactamase-producing Enterobacteriaceae isolated from blood cultures in Africa.

    PubMed

    Sangare, S A; Maiga, A I; Guindo, I; Maiga, A; Camara, N; Savadogo, S; Diallo, S; Bougoudogo, F; Armand-Lefevre, L; Andremont, A; Maiga, I I

    2015-09-01

    Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae have been isolated from many regions of the world. Epidemiological studies are being conducted in Europe, North America, and Asia. No study has however been conducted in Africa to determine the prevalence and distribution of ESBLs on the continent. This literature review aimed at describing the prevalence of ESBL-producing Enterobacteriaceae isolated from blood cultures, as well as the ESBL genes involved at the international level. Our focus was mainly on Africa. We conducted a literature review on PubMed. Articles related to our study field and published between 1996 and 2014 were reviewed and entirely read for most of them, while we only focused on the abstracts of some other articles. Relevant articles to our study were then carefully reviewed and included in the review. The prevalence of ESBL-producing Enterobacteriaceae differs from one country to another. The results of our literature review however indicate that class A ESBLs prevail over the other types. We took into consideration articles focusing on various types of samples to assess the prevalence of ESBL-producing Enterobacteriaceae, but information on isolates from blood cultures is limited. The worldwide prevalence of ESBL-producing Enterobacteriaceae has increased over time. Evidence of ESBL-producing Enterobacteriaceae can be found in all regions of the world. Studies conducted in Africa mainly focused on the Northern and Eastern parts of the continent, while only rare studies were carried out in the rest of the continent. PMID:26433872

  5. Extensive Within-Host Diversity in Fecally Carried Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli Isolates: Implications for Transmission Analyses.

    PubMed

    Stoesser, N; Sheppard, A E; Moore, C E; Golubchik, T; Parry, C M; Nget, P; Saroeun, M; Day, N P J; Giess, A; Johnson, J R; Peto, T E A; Crook, D W; Walker, A S

    2015-07-01

    Studies of the transmission epidemiology of antimicrobial-resistant Escherichia coli, such as strains harboring extended-spectrum beta-lactamase (ESBL) genes, frequently use selective culture of rectal surveillance swabs to identify isolates for molecular epidemiological investigation. Typically, only single colonies are evaluated, which risks underestimating species diversity and transmission events. We sequenced the genomes of 16 E. coli colonies from each of eight fecal samples (n = 127 genomes; one failure), taken from different individuals in Cambodia, a region of high ESBL-producing E. coli prevalence. Sequence data were used to characterize both the core chromosomal diversity of E. coli isolates and their resistance/virulence gene content as a proxy measure of accessory genome diversity. The 127 E. coli genomes represented 31 distinct sequence types (STs). Seven (88%) of eight subjects carried ESBL-positive isolates, all containing blaCTX-M variants. Diversity was substantial, with a median of four STs/individual (range, 1 to 10) and wide genetic divergence at the nucleotide level within some STs. In 2/8 (25%) individuals, the same blaCTX-M variant occurred in different clones, and/or different blaCTX-M variants occurred in the same clone. Patterns of other resistance genes and common virulence factors, representing differences in the accessory genome, were also diverse within and between clones. The substantial diversity among intestinally carried ESBL-positive E. coli bacteria suggests that fecal surveillance, particularly if based on single-colony subcultures, will likely underestimate transmission events, especially in high-prevalence settings. PMID:25903575

  6. Genetic Environment of Plasmid Mediated CTX-M-15 Extended Spectrum Beta-Lactamases from Clinical and Food Borne Bacteria in North-Eastern India

    PubMed Central

    Upadhyay, Supriya; Hussain, Abbas; Mishra, Shweta; Maurya, Anand Prakash; Bhattacharjee, Amitabha; Joshi, Santa Ram

    2015-01-01

    Background The study investigated the presence of CTX-M-15 type extended spectrum beta-lactamases (ESBL), compared their genetic arrangements and plasmid types in gram negative isolates of hospital and food origin in north-east India. From September 2013 to April 2014, a total of 252 consecutive, non-duplicate clinical isolates and 88 gram negative food isolates were selected. Phenotypic and molecular characterization of ESBL genes was performed. Presence of integrons and gene cassettes were analyzed by integrase and 59 base-element PCR respectively. The molecular environments surrounding blaCTX-M and plasmid types were investigated by PCR and PCR-based replicon typing respectively. Transformation was carried out to assess plasmid transfer. Southern blotting was conducted to localize the blaCTX-M-15 genes. DNA fingerprinting was performed by ERIC-PCR. Results Prevalence of ESBL was found to be 40.8% (103/252) in clinical and 31.8% (28/88) in food-borne isolates. Molecular characterization revealed the presence of 56.3% (58/103) and 53.5% (15/28) blaCTX-M-15 in clinical and food isolates respectively. Strains of clinical and food origin were non-clonal. Replicon typing revealed that IncI1 and IncFII plasmid were carrying blaCTX-M-15 in clinical and food isolates and were horizontally transferable. The ISEcp1 element was associated with blaCTX-M-15 in both clinical and food isolates. Conclusions The simultaneous presence of resistance determinants in non-clonal isolates of two different groups thus suggests that the microbiota of common food products consumed may serve as a reservoir for some of the drug resistance genes prevalent in human pathogens. PMID:26361395

  7. PCR typing of genetic determinants for metallo-beta-lactamases and integrases carried by gram-negative bacteria isolated in Japan, with focus on the class 3 integron.

    PubMed

    Shibata, Naohiro; Doi, Yohei; Yamane, Kunikazu; Yagi, Tetsuya; Kurokawa, Hiroshi; Shibayama, Keigo; Kato, Haru; Kai, Kumiko; Arakawa, Yoshichika

    2003-12-01

    From January 2001 to December 2002, 587 strains of gram-negative bacterial isolates demonstrating resistance to ceftazidime and a combination of sulbactam and cefoperazone were subjected to a disk diffusion screening test using sodium mercaptoacetic acid; 431 strains (73.4%) appeared to produce metallo-beta-lactamase (MBL). Of these 431 strains, 357 were found by PCR to carry genes for IMP-1 type MBL (bla(IMP-1)), while only 7 and 67 strains carried the IMP-2 gene (bla(IMP-2)) and the VIM-2 gene (bla(VIM-2)), respectively. Neither VIM-1 nor SPM-1 type MBL genes were found among the strains tested. Of 431 strains, 427 carried the intI1 gene, and 4 strains carrying both the intI1 and intI3 genes were reidentified as Pseudomonas putida harboring bla(IMP-1). Of these four P. putida strains, three strains and one strain, respectively, were separately isolated from two hospitals located in the same prefecture, and the three strains showed very similar pulsed-field gel electrophoresis patterns. Of 357 bla(IMP-1) carriers, 116, 53, 51, 47, and 30 strains were identified as Pseudomonas aeruginosa, Alcaligenes xylosoxidans, P. putida/fluorescens, Serratia marcescens, and Acinetobacter baumannii, respectively. Four strains carrying bla(IMP-2) were reidentified as P. putida. Sixty-three P. aeruginosa strains and four P. putida strains carried bla(VIM-2). Of 427 intI1-positive strains, 180, 53, 51, 47, and 35 were identified as P. aeruginosa, A. xylosoxidans, P. putida/fluorescens, S. marcescens, and A. baumannii, respectively. In the present study, it was confirmed that strains carrying bla(IMP-1) with a class 1 integron are the most prevalent type in Japan, although several intI3 carriers have also been identified sporadically in this country. PMID:14662918

  8. Extended Spectrum Beta-lactamase Detection in Gram-negative Bacilli of Nosocomial Origin

    PubMed Central

    Tsering, Dechen C; Das, Shyamasree; Adhiakari, Luna; Pal, Ranabir; Singh, Takhellambam SK

    2009-01-01

    Background: Resistance to third generation cephalosporins by acquisition and expression of extended spectrum beta lactamase (ESBL) enzymes among gram-negative bacilli is on a rise. The presence of ESBL producing organisms significantly affects the course and outcome of an infection and poses a challenge to infection management worldwide. Materials and Methods: In the period from June 2007 to 2008, we collected 1489 samples from patients suspected of nosocomial infection. The isolates were identified based on colony morphology and biochemical reaction. Gram negative bacilli resistant to third generation cephalosporins were tested for ESBL by double disc synergy test (DDST- a screening test)and then phenotypic confirmatory test. Antimicrobial susceptibility testing was done by modified Kirby Bauer disc diffusion method. Results: From the sample of 238 gram-negative bacilli, we isolated Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Citrobacter freundii, Proteus mirabilis, Morganella morganii and Enterobacter cloacae. Following both methods, 34% isolates were ESBL-positive. The ESBL producing isolates were significantly resistant (p < 0.01) to ampicillin, piperacillin, piperacillin/tazobactam, trimethoprim/sulfamethoxazole, tetracycline, ciprofloxacin and gentamicin as compared to non-ESBL producers. Multidrug resistance was significantly (p < 0.01) higher (69.14%) in ESBL positive isolates than non-ESBL isolates (21.66%). Conclusion: High prevalence of ESBL in our hospital cannot be ignored. ESBL producers can be detected by DDST and phenotypic confirmatory test with equal efficacy. The sensitivity of screening test improved with the use of more than one antibiotic and addition of one or two antibiotics would not increase cost and labor. We recommend DDST using multiple antibiotics in all microbiology units as a routine screening test. PMID:20300397

  9. Activity of imipenem against VIM-1 metallo-beta-lactamase-producing Klebsiella pneumoniae in the murine thigh infection model.

    PubMed

    Daikos, G L; Panagiotakopoulou, A; Tzelepi, E; Loli, A; Tzouvelekis, L S; Miriagou, V

    2007-02-01

    The in-vivo activity of imipenem against VIM-1-producing Klebsiella pneumoniae (VPKP) was assessed in a thigh infection model in neutropenic mice. Animals were infected with three VPKP isolates (imipenem MICs 2, 4 and 32 mg/L, respectively) and a susceptible clinical isolate (MIC 0.125 mg/L) that did not produce any beta-lactamase with broad-spectrum activity. Bacterial density at the site of infection was determined after imipenem treatment (30 and 60 mg/kg every 2 h for 24 h). The log(10) reduction in CFU/thigh was greatest for the wild-type isolate, intermediate for the two imipenem-susceptible VPKP isolates, and lowest for the imipenem-resistant VPKP isolate. Whilst in-vivo imipenem activity appeared reduced against in-vitro susceptible VIM-1 producers compared with a VIM-1-negative control, an increased drug dosage could moderate this reduction. PMID:17328735

  10. Neutron Diffraction Studies of a Class A beta-Lactamase Toho-1 E166A/R274N/R276N Triple Mutant

    SciTech Connect

    Blakeley, Matthew P.; Chen, Yu; Afonine, Pavel

    2010-01-01

    beta-Lactam antibiotics have been used effectively over several decades against many types of bacterial infectious diseases. However, the most common cause of resistance to the beta-lactam antibiotics is the production of beta-lactamase enzymes that inactivate beta-lactams by rapidly hydrolyzing the amide group of the beta-lactam ring. Specifically, the class A extended-spectrum beta-lactamases (ESBLs) and inhibitor-resistant enzymes arose that were capable of hydrolyzing penicillins and the expanded-spectrum cephalosporins and monobactams in resistant bacteria, which lead to treatment problems in many clinical settings. A more complete understanding of the mechanism of catalysis of these ESBL enzymes will impact current antibiotic drug discovery efforts. Here, we describe the neutron structure of the class A, CTX-M-type ESBL Toho-1 E166A/R274N/R276N triple mutant in its apo form, which is the first reported neutron structure of a beta-lactamase enzyme. This neutron structure clearly reveals the active-site protonation states and hydrogen-bonding network of the apo Toho-1 ESBL prior to substrate binding and subsequent acylation. The protonation states of the active-site residues Ser70, Lys73, Ser130, and Lys234 in this neutron structure are consistent with the prediction of a proton transfer pathway from Lys73 to Ser130 that is likely dependent on the conformation of Lys73, which has been hypothesized to be coupled to the protonation state of Glu166 during the acylation reaction. Thus, this neutron structure is in agreement with a proposed mechanism for acylation that identifies Glu166 as the general base for catalysis.

  11. Novel bacteriophage therapy for controlling metallo-beta-lactamase producing Pseudomonas aeruginosa infection in Catfish

    PubMed Central

    2013-01-01

    Background The bacteriophage therapy is an effective antimicrobial approach with potentially important applications in medicine and biotechnology which can be seen as an additional string in the bow. Emerging drug resistant bacteria in aquaculture industry due to unrestricted use of antibiotics warrants more sustainable and environmental friendly strategies for controlling fish infections. The isolated bacteria from fish lesions was characterised based on isolation on selective and differential medium like Pseudomonas agar, gram staining, biochemical tests and 16SrRNA sequencing. The metallo-beta-lactamase (MBL) producing bacterial isolate was evaluated using Imipenem - Ethylenediaminetetraacetic acid (EDTA) disk method. The specific bacteriophage was isolated and concentrated using coal bed developed in our lab at CSIR-NEERI. The isolated and enriched bacteriophage was characterised by nucleotide sequencing and electron microscopy. The phage therapy was applied for treating ulcerative lesion in fish. Results The pathogenic bacterium responsible for causing ulcerative lesions in catfish species (Clarias gariepinus) was identified as Pseudomonas aeruginosa. One out of twenty P. aeruginosa isolate showing multi drug resistance (MDR) was incidentally found to be MBL producing as determined by Imipenem-EDTA disk method. The phage therapy effectively cured the ulcerative lesions of the infected fish in 8–10 days of treatment, with a sevenfold reduction of the lesion with untreated infection control. Conclusion Bacteriophage therapy can have potential applications soon as an alternative or as a complement to antibiotic treatment in the aquaculture. We present bacteriophage therapy as a treatment method for controlling MDR P. aeruginosa infection in C. gariepinus. To the best of our knowledge this is a first report of application of phage therapy against MBL producing P. aeruginosa isolated from aquatic ecosystem. PMID:24369750

  12. Production and property of beta-lactamases in Streptomyces: comparison of the strains isolated newly and thirty years ago.

    PubMed

    Ogawara, H; Horikawa, S; Shimada-Miyoshi, S; Yasuzawa, K

    1978-05-01

    Productivity and property of beta-lactamases of Streptomyces strains isolated from soil some 30 years ago were studied in comparison with those of the newly isolated strains. At least three-quarters of the Streptomyces strains produced beta-lactamase constitutively and extracellularly, mainly as penicillinases, as in the cases of those from the newly isolated strains. Strains such as S. albus, S. diastatochromogenes, S. fradiae, and S. lavendulae were the highest producing strains, and the amounts of beta-lactamase activity they produced were comparable to those produced by Bacillus cereus 569/H and B. licheniformis 749/C. In isoelectric focusing, most strains contained one main beta-lactamase band with a number of satellite bands, but some strains contained one band only. Although beta-lactamases from most strains showed isoelectric points of pH 5 to 6, some strains produced beta-lactamases with strongly basic isoelectric points of pH 8 to 9. Molecular weights were between 20,000 and 30,000. From these results, it is suggested that the proportion of the producing strains of Streptomyces and the properties of the beta-lactamases have not been affected significantly by the introduction of penicillin into the natural environment, in contrast to the cases of other microorganisms. PMID:666306

  13. Detection of Favorable Oral Cephalosporin-Clavulanate Interactions by In Vitro Disk Approximation Susceptibility Testing of Extended-Spectrum-Beta-Lactamase-Producing Members of the Enterobacteriaceae

    PubMed Central

    Campbell, Jennifer D.; Lewis, James S.; McElmeel, M. Leticia; Fulcher, Letitia C.

    2012-01-01

    Extended-spectrum-beta-lactamase (ESBL)-producing members of the Enterobacteriaceae are often resistant to multiple drug classes, making therapy of urinary infections with oral antibiotics difficult. Previously it was shown that amoxicillin-clavulanate can provide clavulanate inhibition of ESBLs and protect an oral cephalosporin present in combination when tested by broth microdilution. This study has shown that disk approximation testing could detect favorable cephalosporin-clavulanate interactions among a group of 101 previously characterized members of the Enterobacteriaceae with CTX-M, SHV, or TEM ESBLs. PMID:22170910

  14. Biochemical properties of inducible beta-lactamases produced from Xanthomonas maltophilia.

    PubMed Central

    Paton, R; Miles, R S; Amyes, S G

    1994-01-01

    Four different beta-lactamases have been found in several strains of Xanthomonas maltophilia isolated from blood cultures during 1984 to 1991 at the Edinburgh Royal Infirmary. One was a metallo-beta-lactamase with predominantly penicillinase activity and an isoelectric point of 6.8. Its molecular size as determined by gel filtration was 96 kDa but was only 26 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), suggesting a tetramer of four equal subunits. The enzyme hydrolyzed all classes of beta-lactams except the monobactam aztreonam. This enzyme was not inhibited by potassium clavulanate or BRL 42715 but was inhibited by p-chloromercuribenzoate, mercuric chloride, and EDTA. The beta-lactamase was unstable in 50 mM sodium phosphate buffer (pH 8.0) but stable in 50 mM Tris HCl (pH 8.0). The other beta-lactamases focused as a series of different isoelectric points, ranging from pI 5.2 to 6.6. Together, these enzymes exhibited a broad spectrum of activity, hydrolyzing most classes of beta-lactams but not imipenem or aztreonam. Their molecular size was 48 kDa by Sephadex gel filtration and 24 kDa by SDS-PAGE, indicating that they were enzymes consisting of two equal subunits. They were inhibited by p-chloromercuribenzoate, mercuric chloride, potassium clavulanate, and BRL 42715 but not EDTA. This study demonstrated that X. maltophilia produces more than just the L1 and L2 beta-lactamases. Images PMID:7811033

  15. High prevalence and risk factors of fecal carriage of CTX-M type extended-spectrum beta-lactamase-producing Enterobacteriaceae from healthy rural residents of Taian, China.

    PubMed

    Zhang, Hongna; Zhou, Yufa; Guo, Shuyuan; Chang, Weishan

    2015-01-01

    The study was carried out to understand the prevalence of CTX-M type extended-spectrum beta-lactamase (ESBL)-harboring Enterobacteriaceae and to analyze risk factors related with fecal carriage in healthy rural residents in Taian, China. A total of 620 stool samples were collected from rural residents. The ESBL-positive Enterobacteriaceae was screened using ChromID ESBL agar, and then further confirmed by double-disk diffusion. The CTX-M genes were determined using polymerase chain reaction. The risk factors associated with fecal carriage of CTX-M-positive isolates were analyzed using the standard statistic methods. 458 isolates carrying CTX-M gene (458/620, 73.9%) were obtained from different individuals, and the most dominant genotype was CTX-M-9 group (303/458, 66.2%). The dominant species were Escherichia coli (E. coli; 403/458, 88.0%) and Klebsiella pneumoniae (K. pneumoniae; 26/458, 5.7%) among the isolates carrying CTX-M genes. All the CTX-M producers were resistant to ampicillin, cefazolin, cefuroxime, and ceftriaxone, but were all susceptible to biapenem, imipenem, and meropenem. The results of multivariate logistic regression model identified the enrollment in formal education (OR 2.321; 95% CI 1.302-3.768; P= 0.039), the hospitalization history within the last 6 months (OR 1.753; 95% CI 1.127-2.584; P= 0.031) and the antibiotics use within the last 6 months (OR 1.892; 95% CI 1.242-2.903; P= 0.034). The three variables were significantly associated with carriage of CTX-M ESBL producers (x (2) = 21.21; df = 3; P< 0.001). The prevalence of fecal carriage of CTX-M ESBL-producing Enterobacteriaceae among healthy rural humans in Taian was high, and the recent antibiotic use and hospitalization history may be the important contributors. PMID:25870591

  16. Comparison of rates of fecal colonization with extended-spectrum beta-lactamase-producing enterobacteria among patients in different wards, outpatients and medical students.

    PubMed

    Ebrahimi, Fatemeh; Mózes, Julianna; Monostori, Júlia; Gorácz, Orsolya; Fésűs, Adina; Majoros, László; Szarka, Krisztina; Kardos, Gábor

    2016-05-01

    Because asymptomatic carriage of extended-spectrum beta-lactamase (ESBL) producers is a risk factor for infection, data on colonization dynamics are important when planning infection control. This study investigated fecal colonization with ESBL producers among inpatients, outpatients and medical students and compares the characteristics of ESBL producers among these groups. Carriage rates were investigated in 5581 fecal samples; 4343 from inpatients (330, 1397, 619 and 1864 from adult ICUs [intensive care units], adult non-ICUs, pediatric ICUs and pediatric non-ICUs, respectively), 814 from outpatients and 424 from screening of medical students. ESBL producers were characterized by co-resistance, integrons carried, and aminoglycoside resistance and ESBL genes. Dynamic regression models were built to identify relationships between combinations of time series of monthly antibiotic consumption, prevalence of carriers and infected subjects. Inpatients, ICU patients and adults showed higher prevalence than outpatients, non-ICU patients or children (7.4%, 9.3% and 12.0% vs. 3.1%, 6.1% and 4.1%, respectively). Klebsiella pneumoniae was more frequent in ICU patients; dominance of CTX-M-15 producers was more marked in adult than in pediatric inpatients. ESBL carriage was shown to be a consequence of infection in adults in the time-series analysis; antibiotic consumption had little effect. The epidemiology of colonization with ESBL producers differed between pediatric ICU, adult ICU and adult non-ICU patients. In adults, carriage of ESBL producers seems to be the consequence of infection, especially in ICU patients; the main source of colonization is nosocomial acquisition. In contrast, children are less likely to acquire colonizer strains in hospitals; importation of ESBL producers by colonized children seems to be significant. PMID:26959958

  17. Antibacterial and toxicological evaluation of beta-lactams synthesized by immobilized beta-lactamase-free penicillin amidase produced by Alcaligenes sp.

    PubMed

    Gayen, Jiaur R; Majee, Sutapa B; Das, Shuvendu; Samanta, Timir B

    2007-12-01

    Search for anti-beta-lactamase and synthesis of newer penicillin were suggested to overcome resistance to penicillin in chemotherapy. It was found that clavulanic acid, an ant-beta-lactamase was ineffective due to its structural modification by bacteria. Thus, there is a need for the synthesis of newer pencillins. Retro-synthesis was inspired by the success of forward reaction i.e.conversion of penicillin G to 6-aminopenicillanic acid (6-APA) by biological process. In the present study a better enzymatic method of synthesis of newer pencillin by a beta-lactamase-free penicillin amidase produced by Alcaligenes sp. is attempted. Antibacterial and toxicological evaluation of the enzymatically synthesized beta-lactams are reported. Condensation of 6-APA with acyl donor was found to be effective when the reaction is run in dimethyl formamide (DMF 50% v/v) in acetate buffer (25 mM pH 5.0) at 37 degrees C. Periplasm entrapped in calcium alginate exihibited the highest yield (approximately 34%) in synthesis. The minimum inhibitory concentration of the synthetic products against Staphylococcus aureus and Salmonella typhi varied between 20-80 microg/ml. Some of the products exhibited antibacterial activity against enteric pathogens. It was interesting to note that product A was potent like penicillin G. LD50 value of three products (product A, B and C) was more than 12 mg/kg. Furthermore, these synthetic beta-lactams did not exihibit any adverse effect on house keeping enzymes viz., serum glutamate oxalacetate-trans-aminase, serum glutamate pyruvate -trans-aminase, acid phosphatase, alkaline phosphatase of the test animals. The hematological profile (RBC and WBC) of the test animals also remained unaffected. PMID:18254214

  18. Crystal structure of the AmpR effector binding domain provides insight into the molecular regulation of inducible ampc beta-lactamase.

    PubMed

    Balcewich, Misty D; Reeve, Thomas M; Orlikow, Evan A; Donald, Lynda J; Vocadlo, David J; Mark, Brian L

    2010-07-30

    Hyperproduction of AmpC beta-lactamase (AmpC) is a formidable mechanism of resistance to penicillins and cephalosporins in Gram-negative bacteria such as Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is regulated by the LysR-type transcriptional regulator AmpR. ampR and ampC genes form a divergent operon with overlapping promoters to which AmpR binds and regulates the transcription of both genes. AmpR induces ampC by binding to one member of the family of 1,6-anhydro-N-acetylmuramyl peptides, which are cytosolic catabolites of peptidoglycan that accumulate during beta-lactam challenge. To gain structural insights into AmpR regulation, we determined the crystal structure of the effector binding domain (EBD) of AmpR from Citrobacter freundii up to 1.83 A resolution. The AmpR EBD is dimeric and each monomer comprises two subdomains that adopt alpha/beta Rossmann-like folds. Located between the monomer subdomains is a pocket that was found to bind the crystallization buffer molecule 2-(N-morpholino)ethanesulfonic acid. The pocket, together with a groove along the surface of subdomain I, forms a putative effector binding site into which a molecule of 1,6-anhydro-N-acetylmuramyl pentapeptide could be modeled. Amino acid substitutions at the base of the interdomain pocket either were found to render AmpR incapable of inducing ampC (Thr103Val, Ser221Ala and Tyr264Phe) or resulted in constitutive ampC expression (Gly102Glu). While the substitutions that prevented ampC induction did not alter the overall AmpR EBD structure, circular dichroism spectroscopy revealed that the nonconservative Gly102Glu mutation affected EBD secondary structure, confirming previous work suggesting that Gly102Glu induces a conformational change to result in constitutive AmpC production. PMID:20594961

  19. Ceftazidime/avibactam: a novel cephalosporin/nonbeta-lactam beta-lactamase inhibitor for the treatment of complicated urinary tract infections and complicated intra-abdominal infections.

    PubMed

    Hidalgo, Jose A; Vinluan, Celeste M; Antony, Nishaal

    2016-01-01

    There has been greater interest in developing additional antimicrobial agents due to the increasing health care costs and resistance resulting from bacterial pathogens to currently available treatment options. Gram-negative organisms including Enterobacteriaceae and Pseudomonas aeruginosa are some of the most concerning threats due to their resistance mechanisms: extended-spectrum beta-lactamase production and Klebsiella pneumoniae carbapenemase enzymes. Ceftazidime is a third-generation broad-spectrum cephalosporin with activity against P. aeruginosa and avibactam is a novel nonbeta-lactam beta-lactamase inhibitor. Avycaz(®), the trade name for this new combination antibiotic, restores the activity of ceftazidime against some of the previously resistant pathogens. Avycaz was approved in 2015 for the treatment of complicated urinary tract infections, including pyelonephritis, and complicated intra-abdominal infections with the addition of metronidazole in patients with little to no other treatment options. This review article assesses the clinical trials and data that led to the approval of this antibiotic, in addition to its spectrum of activity and limitations. PMID:27528799

  20. Ceftazidime/avibactam: a novel cephalosporin/nonbeta-lactam beta-lactamase inhibitor for the treatment of complicated urinary tract infections and complicated intra-abdominal infections

    PubMed Central

    Hidalgo, Jose A; Vinluan, Celeste M; Antony, Nishaal

    2016-01-01

    There has been greater interest in developing additional antimicrobial agents due to the increasing health care costs and resistance resulting from bacterial pathogens to currently available treatment options. Gram-negative organisms including Enterobacteriaceae and Pseudomonas aeruginosa are some of the most concerning threats due to their resistance mechanisms: extended-spectrum beta-lactamase production and Klebsiella pneumoniae carbapenemase enzymes. Ceftazidime is a third-generation broad-spectrum cephalosporin with activity against P. aeruginosa and avibactam is a novel nonbeta-lactam beta-lactamase inhibitor. Avycaz®, the trade name for this new combination antibiotic, restores the activity of ceftazidime against some of the previously resistant pathogens. Avycaz was approved in 2015 for the treatment of complicated urinary tract infections, including pyelonephritis, and complicated intra-abdominal infections with the addition of metronidazole in patients with little to no other treatment options. This review article assesses the clinical trials and data that led to the approval of this antibiotic, in addition to its spectrum of activity and limitations. PMID:27528799

  1. [Typing of extended-spectrum beta-lactamase-producing Salmonella typhimurium strains isolated in a pediatric unit].

    PubMed

    Mhand, R A; Soukri, A; Amarouch, H; Mdaghri, N E; Benbachir, M

    1999-01-01

    Extended-spectrum b-lactamases (ESBLs) derive mainly from TEM and SHV b-lactamases. These enzymes confer resistance to all oxyimino cephalosporins and monobactams except cephamycins and carbapems. ESBLs are often encoded by large plasmids that carry resistance determinants to multiple antibiotics and spread among the members of the Enterobacteriaceae. Since the first outbreak of Klebsiella pneumoniae expressing an extended-spectrum beta-lactamase reported in 1984, nosocomial infections due to Enterobacteriaceae species which produce ESBLs have been generally recovered from patients hospitalized in intensive care units. The most frequently isolated ESBL-producing strains belong to the genus Klebsiella, Escherichia, Enterobacter and Proteus; ESBLs are rarely associated with the genus Salmonella. The first Salmonella were detected in France in 1984 (Salmonella typhimurium), in Tunisia in 1988 (Salmonella wien) and in Argentina in 1991 (Salmonella typhimurium). In 1994, 10 isolates of Salmonella typhimurium expressing an extended-spectrum beta-lactamase were isolated for the first time from 10 children hospitalized in a pediatric unit of the hospital Ibn-Rochd, Casablanca. Previous study showed that all isolates belonged the same serotype, and biotype, and showed a resistance to oxyimino beta-lactams, gentamycin, tobramycin and trimethoprim-sulfamethoxazole but remained susceptible to tetracycline, chloramphenicol and quinolones. Oxyimino beta-lactams resistance determinant of all strains of Salmonella typhimurium was transferred by conjugation to Escherichia coli; Resistance to gentamycin and trimethoprim-sulfamethoxazole was also cotransferred. In this study, we characterized the relationship between all isolates by comparing plasmid profiles and patterns of proteins because there appear to be the more effective method for evaluating epidemiologic relationship between Salmonella species, and the protein profiles method has been used for many bacterial species. These

  2. Antibacterial Activity of Some Plant Extracts Against Extended- Spectrum Beta-Lactamase Producing Escherichia coli Isolates

    PubMed Central

    Saeidi, Saeide; Amini Boroujeni, Negar; Ahmadi, Hassan; Hassanshahian, Mehdi

    2015-01-01

    Background: The extended-spectrum beta-lactamase (ESBL) -producing Escherichia coli isolates make many serious infections, especially urinary tract infections. Objectives: The purpose of this study was to determine the antibacterial activities of some natural plant extracts against ESBL-producing E. coli isolates, which harbor the TEM gene in urine samples of the patients who have urinary tract infections. Materials and Methods: Evaluation has to be exactly determined for both methods of disk diffusion test and polymerase chain reaction (PCR), separately. We evaluated 120 strains of E. coli isolates from the urine culture of the patients in Boo-Ali Hospital (Zahedan, south-eastern Iran) who were suffering from urinary tract infections. The ESBL-producing E. coli isolates were evaluated by disk diffusion test and PCR through TEM gene detection. The minimal inhibitory concentration (MIC) of commonly used antibiotics including ceftazidime, ceftriaxon, amikacin, gentamicin and ciprofloxacin along with the MIC of the alcoholic extract of different natural plants including Myrtus communis L (Myrtaceae), Amaranthus retraflexus (Amaranthaceae), Cyminum cuminum L (Apiaceae), Marrubium vulgare (Laminaceae) and Peganum. harmala (Zygrophyllaceae) against the ESBL-producing E. coli isolates, which harbor the TEM genes, were determined using the microdulition method. Results: Results of this study showed that in disk diffusion method, 80 samples of E. coli produced ESBLs. In PCR method, the TEM gene distribution in the isolated ESBL-producing organisms was 50 (41.6%). Amikacin was the most effective anti-bacterial agent and ciprofloxacin was the least effective against E. coli isolates. All the natural plant extracts mentioned above, especially P. harmala, were effective against the selected isolates of ESBL-producing E. coli. The most frequent ESBL rate producing E. coli isolates (32 out of 50) had MIC of 2.5 mg/mL in ethanol extract of P. harmala. Conclusions: The alcoholic

  3. [Investigation of plasmid mediated AmpC beta-lactamases among Escherichia coli and Klebsiella pneumoniae isolated from blood cultures].

    PubMed

    Sarı, Ayşe Nur; Biçmen, Meral; Gülay, Zeynep

    2013-10-01

    The aim of this study was to investigate the prevalence and types of plasmid-mediated AmpC (pAmpC) beta-lactamase enzymes in Escherichia coli and Klebsiella pneumoniae strains isolated from blood cultures of hospitalized patients in Dokuz Eylul University Hospital between 2007 and 2012. A total of 261 isolates which consisted of 184 E.coli (70.5%) and 77 K.pneumoniae (29.5%) were included in the study. All isolates were resistant to cefotaxime and/or ceftazidime but susceptible to imipenem. Cefoxitin resistance was investigated as an indicator of AmpC type enzymes. A total of 57 (21.8%) isolates which were cefoxitin-resistant (32 E.coli, 25 K.pneumoniae), were screened for pampC genes by a multiplex polymerase chain reaction (PCR) assay. Additionally, 10 of each cefoxitin susceptible isolates per year were chosen randomly and screened by the same PCR assay to detect the presence of ACC enzymes, which can not hydrolyze cefoxitin. Positive PCR results were confirmed by sequence analysis. Plasmid analysis and macrorestriction analysis were performed for pampC-positive isolates. The presence of pAmpC enzymes has been shown in 9.4% (3/32) of cefoxitin-resistant E.coli, and 8% (2/25) of cefoxitin-resistant K.pneumoniae strains. It was noted that there were no strains producing this enzyme isolated in 2007 and 2008, however the prevalence of pAmpC was detected as 1.6% in 2009 (one ACT-1 producing K.pneumoniae), increasing to 4.8% in 2011 (one ACT-1 producing K.pneumoniae) and 6.4% in 2012 (three CMY-2 producing E.coli). These enzymes were found to be carried on 81 kb size plasmids in K.pneumoniae isolates and on a 9 kb size plasmid in E.coli isolates. Macrorestriction analysis indicated that two of the three CMY-2 producing E.coli had the same PFGE (Pulsed-field gel electrophoresis) pattern. If these two strains are considered as identical, it can be concluded that the prevalence of pAmpC was low in the strains isolated between 2007-2012 (4/261; 1.5%) in our institution

  4. Draft Genome Sequences of Enterohemorrhagic Escherichia coli Encoding Extended-Spectrum Beta-Lactamases.

    PubMed

    Valat, Charlotte; Goldstone, Robert J; Hirchaud, Edouard; Haenni, Marisa; Smith, David G E; Madec, Jean-Yves

    2016-01-01

    Extended-spectrum beta-lactamases (ESBLs) have rarely been observed among Shiga toxigenic Escherichia coli (STEC), and, to our best knowledge, only three ESBL-positive isolates of the enterohemorrhagic E. coli (EHEC) subpathotype have been reported. Here, we present the first draft genome sequences of two ESBL-positive EHEC isolates belonging to serotypes O111:H8 and O151:H16. PMID:26868385

  5. Draft Genome Sequences of Enterohemorrhagic Escherichia coli Encoding Extended-Spectrum Beta-Lactamases

    PubMed Central

    Goldstone, Robert J.; Hirchaud, Edouard; Haenni, Marisa; Smith, David G. E.; Madec, Jean-Yves

    2016-01-01

    Extended-spectrum beta-lactamases (ESBLs) have rarely been observed among Shiga toxigenic Escherichia coli (STEC), and, to our best knowledge, only three ESBL-positive isolates of the enterohemorrhagic E. coli (EHEC) subpathotype have been reported. Here, we present the first draft genome sequences of two ESBL-positive EHEC isolates belonging to serotypes O111:H8 and O151:H16. PMID:26868385

  6. Analysis of Yersinia enterocolitica Effector Translocation into Host Cells Using Beta-lactamase Effector Fusions.

    PubMed

    Wolters, Manuel; Zobiak, Bernd; Nauth, Theresa; Aepfelbacher, Martin

    2015-01-01

    Many gram-negative bacteria including pathogenic Yersinia spp. employ type III secretion systems to translocate effector proteins into eukaryotic target cells. Inside the host cell the effector proteins manipulate cellular functions to the benefit of the bacteria. To better understand the control of type III secretion during host cell interaction, sensitive and accurate assays to measure translocation are required. We here describe the application of an assay based on the fusion of a Yersinia enterocolitica effector protein fragment (Yersinia outer protein; YopE) with TEM-1 beta-lactamase for quantitative analysis of translocation. The assay relies on cleavage of a cell permeant FRET dye (CCF4/AM) by translocated beta-lactamase fusion. After cleavage of the cephalosporin core of CCF4 by the beta-lactamase, FRET from coumarin to fluorescein is disrupted and excitation of the coumarin moiety leads to blue fluorescence emission. Different applications of this method have been described in the literature highlighting its versatility. The method allows for analysis of translocation in vitro and also in in vivo, e.g., in a mouse model. Detection of the fluorescence signals can be performed using plate readers, FACS analysis or fluorescence microscopy. In the setup described here, in vitro translocation of effector fusions into HeLa cells by different Yersinia mutants is monitored by laser scanning microscopy. Recording intracellular conversion of the FRET reporter by the beta-lactamase effector fusion in real-time provides robust quantitative results. We here show exemplary data, demonstrating increased translocation by a Y. enterocolitica YopE mutant compared to the wild type strain. PMID:26484613

  7. An Ultrahigh Resolution Structure of TEM-1 beta-Lactamase Suggests a Role for Glu166 as the General Base in Acylation

    SciTech Connect

    Minasov, George; Wang, Xiaojun; Shoichet, Brian K.

    2010-03-08

    Although TEM-1 {beta}-lactamase is among the best studied enzymes, its acylation mechanism remains controversial. To investigate this problem, the structure of TEM-1 in complex with an acylation transition-state analogue was determined at ultrahigh resolution (0.85 {angstrom}) by X-ray crystallography. The quality of the data was such as to allow for refinement to an R-factor of 9.1% and an R{sub free} of 11.2%. In the resulting structure, the electron density features were clear enough to differentiate between single and double bonds in carboxylate groups, to identify multiple conformations that are occupied by residues and loops, and to assign 70% of the protons in the protein. Unexpectedly, even at pH 8.0 where the protein was crystallized, the active site residue Glu166 is clearly protonated. This supports the hypothesis that Glu166 is the general base in the acylation half of the reaction cycle. This structure suggests that Glu166 acts through the catalytic water to activate Ser70 for nucleophilic attack on the {beta}-lactam ring of the substrate. The hydrolytic mechanism of class A {beta}-lactamases, such as TEM-1, appears to be symmetrical, as are the serine proteases. Apart from its mechanistic implications, this atomic resolution structure affords an unusually detailed view of the structure, dynamics, and hydrogen-bonding networks of TEM-1, which may be useful for the design of inhibitors against this key antibiotic resistance target.

  8. Carbapenemase Genes among Multidrug Resistant Gram Negative Clinical Isolates from a Tertiary Hospital in Mwanza, Tanzania

    PubMed Central

    Mushi, Martha F.; Mshana, Stephen E.; Imirzalioglu, Can; Bwanga, Freddie

    2014-01-01

    The burden of antimicrobial resistance (AMR) is rapidly growing across antibiotic classes, with increased detection of isolates resistant to carbapenems. Data on the prevalence of carbapenem resistance in developing countries is limited; therefore, in this study, we determined the prevalence of carbapenemase genes among multidrug resistant gram negative bacteria (MDR-GNB) isolated from clinical specimens in a tertiary hospital in Mwanza, Tanzania. A total of 227 MDR-GNB isolates were analyzed for carbapenem resistance genes. For each isolate, five different PCR assays were performed, allowing for the detection of the major carbapenemase genes, including those encoding the VIM-, IMP-, and NDM-type metallo-beta-lactamases, the class A KPC-type carbapenemases, and the class D OXA-48 enzyme. Of 227 isolates, 80 (35%) were positive for one or more carbapenemase gene. IMP-types were the most predominant gene followed by VIM, in 49 (21.59%) and 28 (12%) isolates, respectively. Carbapenemase genes were most detected in K. pneumoniae 24 (11%), followed by P. aeruginosa 23 (10%), and E. coli with 19 isolates (8%). We have demonstrated for the first time a high prevalence of MDR-GNB clinical isolates having carbapenem resistance genes in Tanzania. We recommend routine testing for carbapenem resistance among the MDR-GNB particularly in systemic infections. PMID:24707481

  9. Extended spectrum beta lactamase producing gram negative bacilli in a tertiary referral hospital of Assam--experience with two methods.

    PubMed

    Nath, Reema; Saikia, Lahari; Mahanta, J

    2006-10-01

    Extended Spectrum Beta Lactamases (ESBL) are enzymes produced in some gram negative bacilli that mediate resistance to extended spectrum cephalosporins. 683 clinical isolates of Escherisia coli and Klebsiella pneumoniae were studied for their capacity to produce ESBL. Isolates showing resistance to at least two of the third generation cephalosporins were studied for ESBL production by Jarlier technique and combination disc methods. Out of the 457 E. Coli and 226 Klebsiella pneumoniae isolated in Assam Medical College, 29.76% and 53.1% were resistant to two cephalosporins of which 29.41% and 29.16% strains showed production of ESBL. However, 6 (4.41%) and 16 (13.34%) strains additionally showed production of ESBL when tested with combination disc method. Though the Jarlier technique is popular, for detection of ESBL, yet false negative results warrants for alternative method. In the absence of molecular detection methods in routine clinical microbiology laboratory, combination disc method appears to be a better option. PMID:17183880

  10. The 3-D structure of a zinc metallo-beta-lactamase from Bacillus cereus reveals a new type of protein fold.

    PubMed Central

    Carfi, A; Pares, S; Duée, E; Galleni, M; Duez, C; Frère, J M; Dideberg, O

    1995-01-01

    The 3-D structure of Bacillus cereus (569/H/9) beta-lactamase (EC 3.5.2.6), which catalyses the hydrolysis of nearly all beta-lactams, has been solved at 2.5 A resolution by the multiple isomorphous replacement method, with density modification and phase combination, from crystals of the native protein and of a specially designed mutant (T97C). The current model includes 212 of the 227 amino acid residues, the zinc ion and 10 water molecules. The protein is folded into a beta beta sandwich with helices on each external face. To our knowledge, this fold has never been observed. An approximate internal molecular symmetry is found, with a 2-fold axis passing roughly through the zinc ion and suggesting a possible gene duplication. The active site is located at one edge of the beta beta sandwich and near the N-terminal end of a helix. The zinc ion is coordinated by three histidine residues (86, 88 and 149) and a water molecule. A sequence comparison of the relevant metallo-beta-lactamases, based on this protein structure, highlights a few well-conserved amino acid residues. The structure shows that most of these residues are in the active site. Among these, aspartic acid 90 and histidine 210 participate in a proposed catalytic mechanism for beta-lactam hydrolysis. Images PMID:7588620

  11. Identification of a series of tricyclic natural products as potent broad-spectrum inhibitors of metallo-beta-lactamases.

    PubMed

    Payne, David J; Hueso-Rodríguez, Juan Antonio; Boyd, Helen; Concha, Néstor O; Janson, Cheryl A; Gilpin, Martin; Bateson, John H; Cheever, Christy; Niconovich, Nancy L; Pearson, Stewart; Rittenhouse, Stephen; Tew, David; Díez, Emilio; Pérez, Paloma; De La Fuente, Jesus; Rees, Michael; Rivera-Sagredo, Alfonso

    2002-06-01

    This work describes the discovery and characterization of a novel series of tricyclic natural product-derived metallo-beta-lactamase inhibitors. Natural product screening of the Bacillus cereus II enzyme identified an extract from a strain of Chaetomium funicola with inhibitory activity against metallo-beta-lactamases. SB236050, SB238569, and SB236049 were successfully extracted and purified from this extract. The most active of these compounds was SB238569, which possessed K(i) values of 79, 17, and 3.4 microM for the Bacillus cereus II, Pseudomonas aeruginosa IMP-1, and Bacteroides fragilis CfiA metallo-beta-lactamases, respectively, yet none of the compounds exhibited any inhibitory activity against the Stenotrophomonas maltophilia L-1 metallo-beta-lactamase (50% inhibitory concentration > 1,000 microM). The lack of activity against angiotensin-converting enzyme and serine beta-lactamases demonstrated the selective nature of these compounds. The crystal structure of SB236050 complexed in the active site of CfiA has been obtained to a resolution of 2.5 A. SB236050 exhibits key polar interactions with Lys184, Asn193, and His162 and a stacking interaction with the indole ring of Trp49 in the flap, which is in the closed conformation over the active site groove. SB236050 and SB238569 also demonstrate good antibacterial synergy with meropenem. Eight micrograms of SB236050 per ml gave rise to an eightfold drop in the MIC of meropenem for two clinical isolates of B. fragilis producing CfiA, making these strains sensitive to meropenem (MIC < or = 4 microg/ml). Consequently, this series of metallo-beta-lactamase inhibitors exhibit the most promising antibacterial synergy activity so far observed against organisms producing metallo-beta-lactamases. PMID:12019104

  12. [Resistance to fluoroquinolone among Klebsiella spp strains producing extended-spectrum betalactamases isolated from urine].

    PubMed

    Tlamçani, Z; Ellaia, K; Benomar, A; Kabbaj, H; Alaoui, Ae; Seffar, M

    2009-01-01

    The aim of the study was to assess the frequency of resistance to fluoroquinolones in extended-spectrum beta-lactamase (ESBLs) Klebsiella spp isolated from urines of consulting and hospitalized patients in Rabat Specialities Hospital. A retrospective survey was made over 3 years (2006-2008). Two hundred ant fifty three patients presented with confirmed urinary tractus infection (UTI). Klebsiella spp was the etiologic agent in 28% (72/253) of reported UTI. Among them, 86% of Klebsiella pneumoniae and 14% of Klebsiella oxytoca. The frequency of Klebsiella spp resistance to fluoroquinolones was 33% and to third generation cephalosporins was 35%. Thirteen Klebsiella spp strains were producing extended-spectrum beta-lactamase witch corresponds to 18% of all the klebsiella. The extended-spectrum beta-lactamase strains with resistance to fluoroquinolones were 85% (11/13) or 15 % of all klebsiella (11/72). None of those strains was resistant to imipenem. In conclusions resistance of enterobacteries such as Klebsiella spp to fluoroquinolones is becoming worrying among consulting and hospitalized patients. Eleven strains multiresistant (ESBL + resistance to fluoroquinolones), isolated probably because of plasmids carrying genes of ESBL and fluoroquinolones resistances. This increasingly frequent resistance mechanism should lead to a more careful use of first line fluoroquinolones for UTI. PMID:19789127

  13. Characteristics of extended-spectrum β-lactamase (ESBL)- and pAmpC beta-lactamase-producing Enterobacteriaceae of water samples in Tunisia.

    PubMed

    Ben Said, Leila; Jouini, Ahlem; Alonso, Carla Andrea; Klibi, Naouel; Dziri, Raoudha; Boudabous, Abdellatif; Ben Slama, Karim; Torres, Carmen

    2016-04-15

    The presence of extended-spectrum beta-lactamase and plasmid-mediated AmpC beta-lactamase producing Enterobacteriaceae (ESBL-Eb and pAmpC-Eb, respectively) was analyzed in 57 wastewater and 57 surface-water samples in Tunisia. Twenty-four of the 57 wastewater samples (42.1%) and one of the 57 surface-water samples (1.7%, a river that received effluents of a wastewater-treatment-plant) contained ESBL-Eb or pAmpC-Eb; one ESBL/pAmpC-Eb per positive sample was further characterized. Beta-lactamase genes detected were as follows: blaCTX-M-1 (10 Escherichia coli),blaCTX-M-15 (eight E. coli, one Klebsiella pneumoniae, one Citrobacter freundii), blaCTX-M-14 (one E. coli) and blaCMY-2 (four E. coli). The blaTEM-1, blaOXA-1 or blaSHV-1 genes were also found in 72% of these isolates. The ISEcp1, orf477 or IS903 sequences were found upstream or downstream of blaCTX-M genes. Class 1 integrons were present in 16 of the 25 ESBL-Eb/pAmpC-Eb strains (64%), and contained five different gene-cassette arrays. Most of the strains (76%) showed a multiresistant phenotype and qnr genes were identified in four strains. Molecular typing of ESBL/CMY-2-producing E. coli isolates showed 23 different PFGE-patterns and 15 different sequence-types (ST10, ST46, ST48, ST58, ST69, ST101, ST117, ST131, ST141, ST288, ST359, ST399, ST405, ST617, and the new ST4530); these strains were ascribed to phylogroups A (11 isolates), B1 (3 isolates), D (6 isolates) and B2 (3 isolates). From one to five plasmids were detected in each strain (size from 30kb to >240kb) and ESBL or pAmpC genes were transferred by conjugation in 69.5% of the E. coli strains. In conclusion, ESBL-Eb and pAmpC-Eb strains are frequently detected in wastewater samples and they might be a source for dissemination in other environments with repercussion in public health. PMID:26871556

  14. The exocellular beta-lactamase of Streptomyces albus G. Purification, properties and comparison with the exocellular DD-carboxypeptidase.

    PubMed Central

    Duez, C; Frère, J M; Klein, D; Noël, M; Ghuysen, J M; Delcambe, L; Dierickx, L

    1981-01-01

    The exocellular beta-lactamase of Streptomyces albus G has been purified to near protein homogeneity. It consists of one single polypeptide chain of mol.wt. 30 000-31 000, has a rather low isoelectric point (at pH 6.0) and contains less lysine (2.1%) and more half-cystine residues than most beta-lactamases from other Gram-positive bacteria. Penicillins are much better substrates than delta 3-cephalosporins; the catalytic-centre activity of good penicillin substrates is 333-500 s-1. The exocellular, mol.wt. 17 000 DD-carboxypeptidase of S. albus G [previously purified to protein homogeneity; Duez, Frère, Geurts, Ghuysen, Dierickx & Delcambe (1978) Biochem. J. 175, 793-800] behaves as an exceedingly poor beta-lactamase, hydrolysing benzylpenicillin into benzylpenicilloate 5 x 10(-6)-fold less rapidly than does the exocellular beta-lactamase. To all appearances, the beta-lactamase has no bivalent cation requirement whereas, as shown elsewhere [Dideberg, Charlier, Dupont, Vermeire, Frère & Ghuysen (1980) FEBS Lett. 117, 212-214, and Dideberg, Joris, Frère, Ghuysen, Weber, Robaye, Delbrouck & Roelands (1980) FEBS Lett. 117, 215-218], the DD-carboxypeptidase possesses one essential Zn2+ ion per molecule. Peptide 'mapping' and immunological studies suggest that the two Streptomyces enzymes probably have very different structural and mechanistic properties. PMID:6975618

  15. Molecular aspects of high-level resistance to sulbactam-cefoperazone in Klebsiella oxytoca clinical isolates.

    PubMed Central

    Kimura, K; Arakawa, Y; Ohsuka, S; Ito, H; Suzuki, K; Kurokawa, H; Kato, N; Ohta, M

    1996-01-01

    Nine Klebsiella oxytoca strains which demonstrated resistance to the combination of sulbactam and cefoperazone were isolated from geographically separate hospitals in Japan in 1995. Among them, K. oxytoca SB23 showed high-level resistance to sulbactam-cefoperazone (MIC > 128 micrograms/ml) and aztreonam (MIC, 128 micrograms/ml). The sulbactam-cefoperazone resistance was not transferred from strain SB23 to Escherichia coli CSH2 by conjugation, beta-Lactamase RbiA, produced by strain SB23, was purified, and the molecular mass was estimated to be 29 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Kinetic parameters for RbiA revealed that cefoperazone and aztreonam were hydrolyzed efficiently by this enzyme. Moreover, ceftazidime and imipenem were also hydrolyzed weakly by RbiA, although strain SB23 did not show any resistance to these agents. Clavulanate, sulbactam, and tazobactam failed to block the hydrolysis of cefoperazone by RbiA. The structural gene of RbiA (blaRBI) was cloned and sequenced, and the deduced amino acid sequence of RbiA demonstrated high-level similarities to those of the beta-lactamases found in K. oxytoca D488, E23004, and plasmid-mediated MEN-1, which have been classified into Bush functional group 2be. Although RbiA demonstrates high-level molecular similarity to the enzymes in group 2be, from an enzymological point of view, this enzyme might be differentiated from the enzymes in that group. Hybridization analysis revealed that beta-lactamase genes highly similar to blaRBI were generally encoded on the chromosome of the sulbactam-cefoperazone-resistant clinical isolates of K. oxytoca tested in the study, despite their different derivations. This observation suggests that sulbactam-cefoperazone-resistant A. oxytoca strains which produce RbiA-type beta-lactamases have been proliferating in many hospitals in Japan. PMID:8878568

  16. Molecular characterization of the extended-spectrum beta-lactamase (ESBL)-producing Shigella spp. in Shanghai.

    PubMed

    Li, J; Li, B; Ni, Y; Sun, J

    2015-03-01

    Shigellosis is a public health concern in China. We tested 216 Shigella isolates collected in Shanghai in 2007 for the production of extended-spectrum beta-lactamases (ESBLs). ESBL-producing isolates were characterized using polymerase chain reaction (PCR)-based genotyping, conjugation, pulsed-field gel electrophoresis (PFGE), and DNA sequence analysis of regions adjacent to bla genes. Plasmids containing genes encoding ESBLs were analyzed using plasmid replicon typing. ESBLs were produced by 18.1 % (39/216) of Shigella isolates, and all 39 ESBL-producing strains harbored bla CTX-M genes. CTX-M-14 was the most frequent variant (69.2 %, 27/39), followed by CTX-M-15 (15.4 %, 6/39). All bla CTX-M genes were transferable by conjugation, and the insertion sequence ISEcp1 was detected upstream of all bla CTX-M genes. The CTX-M-producing Shigella isolates showed high clonal diversity. IncI1, IncFII, IncN, and IncB/O replicons were respectively detected in 23 (58.9 %), 9 (23.1 %), 1 (2.6 %), and 1 (2.6 %) of the 39 transconjugants carrying bla CTX-M. The bla CTX-M-14 genes were most frequently carried by IncI1 (n = 13, 48.1 %) or IncFII (n = 9, 33.3 %) plasmids, and the bla CTX-M-15 genes were closely associated with IncI1 (n = 5, 83.3 %). Our findings demonstrate the high prevalence of ESBL-producing Shigella in Shanghai, the importance of plasmids and ISEcp1 as carriers of bla CTX-M genes, and the close association between certain bla CTX-M genes with a specific plasmid. PMID:25252628

  17. Instant Typing Is Essential to Detect Transmission of Extended-Spectrum Beta-Lactamase-Producing Klebsiella Species

    PubMed Central

    Voor in 't holt, Anne F.; Severin, Juliëtte A.; Goessens, Wil H. F.; te Witt, René; Vos, Margreet C.

    2015-01-01

    Background Infections with multidrug-resistant (MDR) microorganisms are an increasing threat to hospitalized patients. Although rapid typing of MDR microorganisms is required to apply targeted prevention measures, technical barriers often prevent this. We aimed to assess whether extended-spectrum beta-lactamase (ESBL)-producing Klebsiella species are transmitted between patients and whether routine, rapid typing is needed. Methods For 43 months, the clonality of all ESBL-producing Klebsiella isolates from patients admitted to Erasmus MC University Medical Center in Rotterdam, the Netherlands was assessed with Raman spectroscopy. A cluster was defined as n ≥2 patients who had identical isolates. Primary patients were the first patients in each cluster. Secondary patients were those identified with an isolate clonally related to the isolate of the primary patient. Results Isolates from 132 patients were analyzed. We identified 17 clusters, with 17 primary and 56 secondary patients. Fifty-nine patients had a unique isolate. Patients (n = 15) in four out of the 17 clusters were epidemiologically related. Ten of these 15 patients developed an infection. Conclusions Clonal outbreaks of ESBL-producing Klebsiella species were detected in our hospital. Theoretically, after Raman spectroscopy had detected a cluster of n ≥2, six infections in secondary patients could have been prevented. These findings demonstrate that spread of ESBL-producing Klebsiella species occurs, even in a non-outbreak setting, and underscore the need for routine rapid typing of these MDR bacteria. PMID:26317428

  18. Refined models of New Delhi metallo-beta-lactamase-1 with inhibitors: an QM/MM modeling study.

    PubMed

    Wang, Yeng-Tseng; Cheng, Tian-Lu

    2016-10-01

    New Delhi metallo-beta-lactamase 1 (NDM-1) has been identified as a potential target for the treatment of multi-drug resistance bacterial infections. We used molecular docking, normal MD, SIE, QM/MM MD simulations, QM/MM GBSA binding free energy, and QM/MM GBSA alanine-scanning mutagenesis techniques to investigate interactions of the NDM-1 with 11 inhibitors (Tigecycline, BAL30072, D-captopril, Penicillin G, Ampicillin, Carbenicillin, Cephalexin, Cefaclor, Nitrocefin, Meropenem, and Imipenem). From our normal MD and QM/MM simulations, the correlation coefficients between the predicted binding free energies and experimental values are .88 and .93, respectively. Then simulations, which combined QM/MM/GBSA and alanine-scanning mutagenesis techniques, were performed and our results show that two residues (Lys211 and His250) have the strongest impact on the binding affinities of the 11 NDM-1/inhibitors. Therefore, our approach theoretically suggests that the two residues (Lys211 and His250) are responsible for the selectivity of NDM-1 associated inhibitors. PMID:26488313

  19. Common mechanistic features among metallo-beta-lactamases: a computational study of Aeromonas hydrophila CphA enzyme.

    PubMed

    Simona, Fabio; Magistrato, Alessandra; Dal Peraro, Matteo; Cavalli, Andrea; Vila, Alejandro J; Carloni, Paolo

    2009-10-01

    Metallo-beta-lactamases (MbetaLs) constitute an increasingly serious clinical threat by giving rise to beta-lactam antibiotic resistance. They accommodate in their catalytic pocket one or two zinc ions, which are responsible for the hydrolysis of beta-lactams. Recent x-ray studies on a member of the mono-zinc B2 MbetaLs, CphA from Aeromonas hydrophila, have paved the way to mechanistic studies of this important subclass, which is selective for carbapenems. Here we have used hybrid quantum mechanical/molecular mechanical methods to investigate the enzymatic hydrolysis by CphA of the antibiotic biapenem. Our calculations describe the entire reaction and point to a new mechanistic description, which is in agreement with the available experimental evidence. Within our proposal, the zinc ion properly orients the antibiotic while directly activating a second catalytic water molecule for the completion of the hydrolytic cycle. This mechanism provides an explanation for a variety of mutagenesis experiments and points to common functional facets across B2 and B1 MbetaLs. PMID:19671702

  20. High Prevalence of Escherichia coli-Producing CTX-M-15 Extended-Spectrum Beta-Lactamases in Poultry and Human Clinical Isolates in Romania.

    PubMed

    Maciuca, Iuliana E; Williams, Nicola J; Tuchilus, Cristina; Dorneanu, Olivia; Guguianu, Eleonora; Carp-Carare, Catalin; Rimbu, Cristina; Timofte, Dorina

    2015-12-01

    Use of antibiotics in food animals may contribute to development and spread of resistant organisms, particularly so in some countries. The aim of this study was two-fold; first, to establish the prevalence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli in chicken production in a region within Romania. Second, to study the relatedness of ESBL-producing E. coli isolates recovered from broilers, abattoir workers where the chickens were slaughtered and from the human clinical specimens from two regional hospitals. The results indicated a very high (69%) rate of carriage of ESBL and AmpC-producing E. coli in chickens with 36% CTX-M producers. Sequencing showed that chickens in Romania have the highest worldwide prevalence (53%) of blaCTX-M-15 reported in poultry E. coli isolates. The majority (53%) of the extended-spectrum cephalosporin-resistant E. coli carried plasmid-mediated blaampC genes, mostly blaCMY-2 type, one of the highest prevalences reported in Europe. The predominant CTX-M type found in the human clinical E. coli isolates was blaCTX-M-15 and most isolates coharbored blaOXA-1, blaTEM, and aac(6')-ib-cr. The majority (60%) of the human clinical isolates belonged to the pandemic virulent clone B2-ST131. The clonal relationship between broiler and the human CTX-M-producing E. coli isolates was assessed by macrorestriction pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST), which indicated strain diversity with no common STs found between human and poultry isolates. Moreover, IncI1 was the most prevalent replicon found in broiler ESBL-producing E. coli isolates and also in transconjugants, indicating that plasmids and not clonal spread may play a role in the transfer of blaCTX-M genes. This study identifies a high prevalence of ESBL-producing E. coli from broiler chickens in Romania with a high occurrence incidence of blaCTX-M-15, which reflects the main ESBL type found in human E. coli infections in this

  1. SHV-5, a novel SHV-type beta-lactamase that hydrolyzes broad-spectrum cephalosporins and monobactams.

    PubMed Central

    Gutmann, L; Ferré, B; Goldstein, F W; Rizk, N; Pinto-Schuster, E; Acar, J F; Collatz, E

    1989-01-01

    SHV-5 (pI 8.2), a novel broad-spectrum beta-lactamase encoded by a ca. 150-kilobase plasmid, was found in Klebsiella pneumoniae 160. SHV-5 beta-lactamase caused decreased susceptibility to most penicillins, cephalosporins, and monobactams, except imipenem and compounds which have a C6 or C7 alpha-methoxy substituent. beta-Lactamase inhibitors (clavulanic acid, sulbactam, and tazobactam) inhibited its activity and showed a synergistic effect when associated with different hydrolyzable beta-lactam compounds. Hybridization studies suggested that this enzyme may be related to, or derived from, the SHV enzyme. Increased MICs of cephamycins and temocillin associated with a decreased synergistic effect of the inhibitors on K. pneumoniae 160 might be linked to a decrease in two outer membrane proteins. Images PMID:2669628

  2. Induction of beta-lactamase by various beta-lactam antibiotics in Enterobacter cloacae.

    PubMed Central

    Minami, S; Yotsuji, A; Inoue, M; Mitsuhashi, S

    1980-01-01

    The induction of beta-lactamase in Enterobacter cloacae GN5797 was studied by using 23 beta-lactam antiobiotics, including newly introduced drugs, as inducers. the beta-lactam antibiotics can be classified into three groups on the basis of their inducer activity. Among the tested cephalosporins, cephamycin derivatives such as cefoxitin, cefmetazole, and YM09330 had high inducer activity even at low drug concentrations. On the other hand, cefoperazone, cefsulodin, piperacillin, and apalcillin showed low inducer activity when compared with the other cephalosporins. PMID:6968541

  3. Expression, purification, crystallization and preliminary X-ray analysis of Aeromonas hydrophilia metallo-[beta]-lactamase

    SciTech Connect

    Sharma, N.; Toney, J.H.; Fitzgerald, P.M.D.

    2010-07-20

    The CphA metallo-{beta}-lactamase from Aeromonas hydrophilia has been expressed, purified and crystallized by the hanging-drop vapor-diffusion method using ammonium sulfate as the precipitant. The crystals exhibit orthorhombic symmetry (P2{sub 1}2{sub 1}2), with unit-cell parameters a = 40.75, b = 42.05, c = 128.88 {angstrom}. There is one monomer in the asymmetric unit and the solvent content is estimated to be 44% by volume. A data set extending to 1.8 {angstrom} has been measured.

  4. Beta-lactamase-free penicillin amidase from Alcaligenes sp.: isolation strategy, strain characteristics, and enzyme immobilization.

    PubMed

    Pal, A; Samanta, T B

    1999-11-01

    Isolation and characterization of a beta-lactamase (EC 3.5.2.6)-free, penicillin amidase (penicillin amidohydrolase, EC 3.5.1. 11)-producing organism is reported. The test strain was isolated by an enrichment technique with a substrate other than penicillins. The isolated strain belongs to the genus Alcaligenes. Phenylacetic acid was found to be the inducer of penicillin amidase. The amidase has a broad substrate spectrum. It is very active against penicillin G and semisynthetic cephalosporins, whereas penicillin V and semisynthetic penicillins acted moderately as a substrate. Immobilized cells of Alcaligenes sp. were shown to act as a reversible enzyme. PMID:10489431

  5. Laboratory detection of extended-spectrum beta-lactamase by an automated system.

    PubMed

    Gagliotti, Carlo; Sarti, Mario; Benini, Franca; Cipolloni, Antonio Paolo; Testa, Giovanna; Venturelli, Claudia; Moro, Maria Luisa

    2008-10-01

    This study aims to evaluate the positive predictive value (PPV) and the negative predictive value (NPV) of Vitek2 in detecting extended-spectrum beta-lactamase (ESBL) phenotypes when compared to a manual confirmatory test as gold standard. A sample of Escherichia coli, Klebsiella spp and Proteus mirabilis isolates were collected by 5 laboratories in the Emilia-Romagna Region (Italy). Vitek2 appears to be an accurate tool to detect ESBL phenotypes of E. coli isolates; some concern remains about its performance with the other bacterial species, especially P. mirabilis. PMID:19123314

  6. High prevalence and risk factors of fecal carriage of CTX-M type extended-spectrum beta-lactamase-producing Enterobacteriaceae from healthy rural residents of Taian, China

    PubMed Central

    Zhang, Hongna; Zhou, Yufa; Guo, Shuyuan; Chang, Weishan

    2015-01-01

    The study was carried out to understand the prevalence of CTX-M type extended-spectrum beta-lactamase (ESBL)-harboring Enterobacteriaceae and to analyze risk factors related with fecal carriage in healthy rural residents in Taian, China. A total of 620 stool samples were collected from rural residents. The ESBL-positive Enterobacteriaceae was screened using ChromID ESBL agar, and then further confirmed by double-disk diffusion. The CTX-M genes were determined using polymerase chain reaction. The risk factors associated with fecal carriage of CTX-M-positive isolates were analyzed using the standard statistic methods. 458 isolates carrying CTX-M gene (458/620, 73.9%) were obtained from different individuals, and the most dominant genotype was CTX-M-9 group (303/458, 66.2%). The dominant species were Escherichia coli (E. coli; 403/458, 88.0%) and Klebsiella pneumoniae (K. pneumoniae; 26/458, 5.7%) among the isolates carrying CTX-M genes. All the CTX-M producers were resistant to ampicillin, cefazolin, cefuroxime, and ceftriaxone, but were all susceptible to biapenem, imipenem, and meropenem. The results of multivariate logistic regression model identified the enrollment in formal education (OR 2.321; 95% CI 1.302–3.768; P= 0.039), the hospitalization history within the last 6 months (OR 1.753; 95% CI 1.127–2.584; P= 0.031) and the antibiotics use within the last 6 months (OR 1.892; 95% CI 1.242–2.903; P= 0.034). The three variables were significantly associated with carriage of CTX-M ESBL producers (x2 = 21.21; df = 3; P< 0.001). The prevalence of fecal carriage of CTX-M ESBL-producing Enterobacteriaceae among healthy rural humans in Taian was high, and the recent antibiotic use and hospitalization history may be the important contributors. PMID:25870591

  7. The Human Gut Microbiome as a Transporter of Antibiotic Resistance Genes between Continents

    PubMed Central

    Bengtsson-Palme, Johan; Angelin, Martin; Huss, Mikael; Kjellqvist, Sanela; Kristiansson, Erik; Palmgren, Helena; Larsson, D. G. Joakim

    2015-01-01

    Previous studies of antibiotic resistance dissemination by travel have, by targeting only a select number of cultivable bacterial species, omitted most of the human microbiome. Here, we used explorative shotgun metagenomic sequencing to address the abundance of >300 antibiotic resistance genes in fecal specimens from 35 Swedish students taken before and after exchange programs on the Indian peninsula or in Central Africa. All specimens were additionally cultured for extended-spectrum beta-lactamase (ESBL)-producing enterobacteria, and the isolates obtained were genome sequenced. The overall taxonomic diversity and composition of the gut microbiome remained stable before and after travel, but there was an increasing abundance of Proteobacteria in 25/35 students. The relative abundance of antibiotic resistance genes increased, most prominently for genes encoding resistance to sulfonamide (2.6-fold increase), trimethoprim (7.7-fold), and beta-lactams (2.6-fold). Importantly, the increase observed occurred without any antibiotic intake. Of 18 students visiting the Indian peninsula, 12 acquired ESBL-producing Escherichia coli, while none returning from Africa were positive. Despite deep sequencing efforts, the sensitivity of metagenomics was not sufficient to detect acquisition of the low-abundant genes responsible for the observed ESBL phenotype. In conclusion, metagenomic sequencing of the intestinal microbiome of Swedish students returning from exchange programs in Central Africa or the Indian peninsula showed increased abundance of genes encoding resistance to widely used antibiotics. PMID:26259788

  8. Detection and clinical significance of extended-spectrum beta-lactamases in a tertiary-care medical center.

    PubMed Central

    Emery, C L; Weymouth, L A

    1997-01-01

    The prevalence of extended-spectrum beta-lactamase (ESBL)-mediated resistance remains unknown for most hospitals, and national guidelines for testing and reporting ESBL-mediated resistance have not yet been developed. We undertook a study to determine the prevalence of ESBLs and the clinical need for testing in our tertiary-care medical center. Members of the family Enterobacteriaceae isolated over a 6-month period for which ceftazidime or ceftriaxone MICs were greater than 1 microg/ml were tested for production of ESBLs by the double-disk synergy method. Approximately 1.5% of isolates of the family Enterobacteriaceae (50 of 3,273), which were isolated from 1.2% of patients (23 of 1,844), were found to express ESBLs. ESBL-producing strains included eight different species and were isolated from patients located throughout the hospital, including outpatient clinics. By using the interpretive guidelines of the National Committee for Clinical Laboratory Standards, 26 to 39% of the isolates would have been reported to be susceptible to ceftazidime, depending upon the routine susceptibility method used. However, tests with cefpodoxime found all of the ESBL-producing strains to be resistant or intermediate. Nine patients infected with ESBL-producing isolates were treated with therapy which included an expanded-spectrum cephalosporin. Seven were cured. The deaths of the other two patients were not attributed to bacterial resistance missed by routine susceptibility testing. These observations suggest that in our tertiary-care medical center, it may not be clinically necessary or cost-effective at this time to institute additional testing on a routine basis to detect ESBL production in all clinical isolates of the family Enterobacteriaceae. PMID:9230382

  9. Activity of sulbactam in combination with ceftriaxone in vitro and in experimental endocarditis caused by Escherichia coli producing SHV-2-like beta-lactamase.

    PubMed

    Fantin, B; Pangon, B; Potel, G; Caron, F; Vallée, E; Vallois, J M; Mohler, J; Buré, A; Philippon, A; Carbon, C

    1990-04-01

    We studied the efficacy of sulbactam, a beta-lactamase inhibitor, in combination with ceftriaxone in vitro and in experimental endocarditis due to an Escherichia coli strain producing an extended-spectrum beta-lactamase most similar to SHV-2, a new mechanism of resistance to broad-spectrum cephalosporins among members of the family Enterobacteriaceae. In vitro, ceftriaxone demonstrated an important inoculum effect (MICs were 2 and 256 micrograms/ml with 5 X 10(5) and 5 X 10(7) CFU of inoculum per ml, respectively). Sulbactam inhibited the beta-lactamase degradation of ceftriaxone and enhanced the killing by ceftriaxone with both inocula tested. In vivo, sulbactam (100 mg/kg every 8 h) or ceftriaxone (15 or 30 mg/kg every 24 h) alone were ineffective after a 4-day therapy. The addition of sulbactam to ceftriaxone (15 mg/kg) or to the ceftriaxone (15 mg/kg)-netilmicin (6 mg/kg every 24 h) combination produced a reduction of 2 log10 CFU/g of vegetation greater than that produced by therapy without sulbactam. The sulbactam-ceftriaxone (30 mg/kg) combination produced a reduction of almost 5 log10 CFU/g of vegetation greater than that produced by single-drug therapy (P less than 0.01), sterilized five of eight vegetations (versus none of seven for ceftriaxone [30 mg/kg] alone; P less than 0.05), and was as effective as the ceftriaxone (15 mg/kg)-sulbactam-netilmicin combination. We concluded that (i) SHV-2 production was responsible for ceftriaxone failure in vivo, probably because of the high inoculum present in vegetations; (ii) sulbactam used in a regimen which provided levels in serum constantly above 4 micrograms/ml and a vegetation/serum peak ratio of approximately 1:3 enhanced the activity of a broad-spectrum cephalosporin in a severe experimental infection; and (iii) the highest dose of ceftriaxone in combination with sulbactam was as effective as the lowest dose of ceftriaxone plus sulbactam plus an aminoglycoside. PMID:2188586

  10. Prevalence and Characteristics of the Epidemic Multiresistant Escherichia coli ST131 Clonal Group among Extended-Spectrum Beta-Lactamase-Producing E. coli Isolates in Copenhagen, Denmark

    PubMed Central

    Hansen, Dennis S.; Nilsson, Frida; Frimodt-Møller, Jakob; Leihof, Rikke Fleron; Struve, Carsten; Scheutz, Flemming; Johnston, Brian; Krogfelt, Karen A.; Johnson, James R.

    2013-01-01

    We report the characteristics of 115 extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli clinical isolates, from 115 unique Danish patients, over a 1-year study interval (1 October 2008 to 30 September 2009). Forty-four (38%) of the ESBL isolates represented sequence type 131 (ST13)1, from phylogenetic group B2. The remaining 71 isolates were from phylogenetic groups D (27%), A (22%), B1 (10%), and B2 (3%). Serogroup O25 ST131 isolates (n = 42; 95% of ST131) comprised 7 different K antigens, whereas two ST131 isolates were O16:K100:H5. Compared to non-ST131 isolates, ST131 isolates were associated positively with CTX-M-15 and negatively with CTX-M-1 and CTX-M-14. They also were associated positively with 11 virulence genes, including afa and dra (Dr family adhesins), the F10 papA allele (P fimbria variant), fimH (type 1 fimbriae), fyuA (yersiniabactin receptor), iha (adhesin siderophore), iutA (aerobactin receptor), kpsM II (group 2 capsules), malX (pathogenicity island marker), ompT (outer membrane protease), sat (secreted autotransporter toxin), and usp (uropathogenicity-specific protein) and negatively with hra (heat-resistant agglutinin) and iroN (salmochelin receptor). The consensus virulence gene profile (>90% prevalence) of the ST131 isolates included fimH, fyuA, malX, and usp (100% each), ompT and the F10 papA allele (95% each), and kpsM II and iutA (93% each). ST131 isolates were also positively associated with community acquisition, extraintestinal pathogenic E. coli (ExPEC) status, and the O25, K100, and H4 antigens. Thus, among ESBL E. coli isolates in Copenhagen, ST131 was the most prevalent clonal group, was community associated, and exhibited distinctive and comparatively extensive virulence profiles, plus a greater variety of capsular antigens than reported previously. PMID:23554186

  11. Susceptibility Pattern and Distribution of Oxacillinases and blaPER-1 Genes among Multidrug Resistant Acinetobacter baumannii in a Teaching Hospital in Iran

    PubMed Central

    Bagheri Josheghani, Sareh; Moniri, Rezvan; Firoozeh, Farzaneh; Sehat, Mojtaba; Dasteh Goli, Yasaman

    2015-01-01

    Acinetobacter baumannii (A. baumannii) is an important nosocomial pathogen in healthcare institutions. β-Lactamase-mediated resistance is the most common mechanism for carbapenem resistance in A. baumannii. The aim of this study was to determine the antibiotic resistance pattern, to detect OXA encoding genes, class A, blaPER-1, and to detect the presence of ISAba1. A total of 124 A. baumannii isolates were collected from hospitalized patients in a teaching hospital in Kashan, Iran. The susceptibility of isolates to different antibiotics was determined by disk-diffusion method. PCR was used to detect blaPER-1, blaOXA-23, blaOXA-24, blaOXA-51, blaOXA-58, and ISAba1 genes. All isolates were resistant to ceftazidime, ceftriaxone, and cefotaxime. All of the isolates revealed susceptibility to polymyxin B and colistin. Ninety-six percent of the isolates were extensive drug resistance (XDR), 5.6% extended spectrum beta-lactamase (ESBL), and 54.8% metallo-beta-lactamase (MBL). All isolates were positive for blaOXA-51 and ISAba1. blaOXA-23,  blaOXA-24, and blaOXA-58 were found in 79.8%, 25%, and 3.2%, respectively. The frequency rate of blaPER-1 gene was 52.4%. Multidrug resistant A. baumannii isolates are increasing in our setting and extensively limit therapeutic options. The high rate presence of class D carbapenemase-encoding genes, mainly blaOXA-23 carbapenemases, is worrying and alarming as an emerging threat in our hospital. PMID:26881082

  12. Rectal Carriage of Extended-Spectrum-Beta-Lactamase-Producing Enterobacteriaceae in Hospitalized Patients: Selective Preenrichment Increases Yield of Screening

    PubMed Central

    Verhulst, C.; Willemsen, L. E.; Verkade, E.; Bonten, M. J. M.; Kluytmans, J. A. J. W.

    2015-01-01

    This study evaluated the added value of selective preenrichment for the detection of rectal carriage of extended-spectrum-beta-lactamase-producing Enterobacteriaceae (ESBL-E). ESBL-E rectal carriage was identified in 4.8% of hospitalized patients, and 25.9% of ESBL-E rectal carriers were identified with selective preenrichment only. PMID:25994164

  13. Fulminant mediastinitis due to extended-spectrum beta-lactamase-producing Klebsiella pneumoniae: atypical presentation and spreading following cardiac surgery†

    PubMed Central

    Valenzuela, Horacio; Carrascal, Yolanda; Maroto, Laura; Arce, Nuria

    2013-01-01

    Mediastinitis due to Klebsiella pneumoniae, related to thoracic wall contamination after cardiac surgery, has rarely been described. We aim to report a case of fulminant mediastinitis due to extended-spectrum beta-lactamase-producing K. pneumoniae, secondary to a disseminated concomitant pulmonary infection. The patient remained pauci-symptomatic until clinical manifestations of sepsis acutely appeared. PMID:23416348

  14. Inhibitory effects of various essential oils and individual components against extended-spectrum beta-lactamase (ESBL) produced by Klebsiella pneumoniae and their chemical compositions.

    PubMed

    Orhan, Ilkay Erdogan; Ozcelik, Berrin; Kan, Yüksel; Kartal, Murat

    2011-10-01

    In the current study, in vitro inhibitory activity of several essential oils obtained from the cultivated plants, Foeniculum vulgare, Mentha piperita and M. spicata, Ocimum basilicum, Origanum majorana, O. onites, O. vulgare, Satureja cuneifolia, and a number of individual essential oil components of terpene and aromatic types were screened against 10 isolated strains of Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) enzyme, which makes this microorganism quite resistant against the antibiotics: trimetoprime-sulfametoksazol, sulbactam-ampicilin, clavulonate-amoxicilin, ceftriaxon, cefepime, imipenem, ceftazidime, tobramicine, gentamisine, ofloxacin, and ciprofloksasin. All of the essential oils and the components exerted a remarkable inhibition ranging between 32 and 64 μg/mL against all of these strains as strong as the references (ampicilin and oflaxocin) inhibiting at 32 μg/mL. Besides, chemical compositions of the essential oils were elucidated by gas chromatography-mass spectrometry (GC-MS). The essential oils and the pure components widely found in essential oils screened herein have shown remarkable inhibition against ESBL-producing K. pneumoniae strains, which leads to the suggestion that they may be used as food preservatives for this purpose. Practical Application:  The essential oils obtained from Foeniculum vulgare, Mentha piperita and M. spicata, O.cimum basilicum, Origanum majorana, O. onites, O. vulgare, and Satureja cuneifolia as well as common essential oil components have shown notable inhibitory effects against 10 isolated strains of Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) enzyme and they might be used as food preservative or ingredient. PMID:22417594

  15. Extended-Spectrum Beta-Lactamases Producing E. coli in Wildlife, yet Another Form of Environmental Pollution?

    PubMed Central

    Guenther, Sebastian; Ewers, Christa; Wieler, Lothar H.

    2011-01-01

    Wildlife is normally not exposed to clinically used antimicrobial agents but can acquire antimicrobial resistant bacteria through contact with humans, domesticated animals and the environment, where water polluted with feces seems to be the most important vector. Escherichia coli, an ubiquitous commensal bacterial species colonizing the intestinal tract of mammals and birds, is also found in the environment. Extended-spectrum beta-lactamases producing E. coli (ESBL-E. coli) represent a major problem in human and veterinary medicine, particular in nosocomial infections. Additionally an onset of community-acquired ESBL-E. coli infections and an emergence in livestock farming has been observed in recent years, suggesting a successful transmission as well as persistence of ESBL-E. coli strains outside clinical settings. Another parallel worldwide phenomenon is the spread of ESBL-E. coli into the environment beyond human and domesticated animal populations, and this seems to be directly influenced by antibiotic practice. This might be a collateral consequence of the community-onset of ESBL-E. coli infections but can result (a) in a subsequent colonization of wild animal populations which can turn into an infectious source or even a reservoir of ESBL-E. coli, (b) in a contribution of wildlife to the spread and transmission of ESBL-E. coli into fragile environmental niches, (c) in new putative infection cycles between wildlife, domesticated animals and humans, and (d) in problems in the medical treatment of wildlife. This review aims to summarize the current knowledge on ESBL-E. coli in wildlife, in turn underlining the need for more large scale investigations, in particular sentinel studies to monitor the impact of multiresistant bacteria on wildlife. PMID:22203818

  16. Laboratory detection of extended-spectrum-beta-lactamase-producing Enterobacteriaceae: evaluation of two screening agar plates and two confirmation techniques.

    PubMed

    Overdevest, I T M A; Willemsen, I; Elberts, S; Verhulst, C; Kluytmans, J A J W

    2011-02-01

    The worldwide prevalence of extended-spectrum-beta-lactamase-producing ESBL-producing Enterobacteriaceae (ESBL-E) is increasing, making the need for optimized detection techniques more urgent. In this study we investigated the performance of two ESBL-E screening and two ESBL-E confirmation techniques. In accordance with the Dutch national guidelines (www.wip.nl), a collection of 642 highly resistant Enterobacteriaceae strains, as identified by Vitek2, was used to test the performances of two screening techniques (EbSA ESBL agar plate and ChromID ESBL agar plate) and of two confirmation techniques (MIC-strip ESBL and Vitek2 ESBL test panel). The individual test results were compared by using Etest, followed by a combination disk test if Etest results were inconclusive. Among group 1 isolates (Escherichia coli, Klebsiella spp., Proteus spp., Salmonella spp., and Shigella spp.) 291 (57.6%) were ESBL-E, versus 65 (47.4%) in group 2 (Enterobacter spp., Citrobacter spp., Morganella morganii, Serratia spp., and Providencia spp.). The sensitivities of all four tests for group 1 were comparable (EbSA, 96.6%; ChromID, 97.3%; MIC-strip, 99.6%; and Vitek2, 95.1%). The specificities of the EbSA and ChromID were the same (93.9%). However, the confirmation techniques produced many inconclusive test results, which reduces the applicability in routine laboratories. Only the two screening agar plates were validated for ESBL testing of group 2 microorganisms. They showed comparable sensitivities; however, the EbSA screening agar plate had a significantly higher specificity (78.6% versus 44.3%). In conclusion the screening agar plates performed better than the two confirmation techniques. The EbSA agar plate had the best overall performance. PMID:21123527

  17. Resistance patterns, ESBL genes, and genetic relatedness of Escherichia coli from dogs and owners

    PubMed Central

    Carvalho, A.C.; Barbosa, A.V.; Arais, L.R.; Ribeiro, P.F.; Carneiro, V.C.; Cerqueira, A.M.F.

    2016-01-01

    Antimicrobial resistance in Escherichia coli isolated from pet dogs can be considered a potential threat of infection for the human population. Our objective was to characterize the resistance pattern, extended spectrum beta-lactamase production and genetic relatedness of multiresistant E. coli strains isolated from dogs (n = 134), their owners (n = 134), and humans who claim to have no contact with dogs (n = 44, control), searching for sharing of strains. The strains were assessed for their genetic relatedness by phylogenetic grouping and pulsed-field gel electrophoresis. Multiresistant E. coli strains were isolated from 42 (31.3%) fecal samples from pairs of dogs and owners, totaling 84 isolates, and from 19 (43.1%) control group subjects. The strains showed high levels of resistance to ampicillin, streptomycin, tetracycline, trimethoprim and sulfamethoxazole regardless of host species or group of origin. The blaTEM, blaCTX-M, and blaSHV genes were detected in similar proportions in all groups. All isolates positive for bla genes were ESBL producers. The phylogenetic group A was the most prevalent, irrespective of the host species. None of the strains belonging to the B2 group contained bla genes. Similar resistance patterns were found for strains from dogs, owners and controls; furthermore, identical PFGE profiles were detected in four (9.5%) isolate pairs from dogs and owners, denoting the sharing of strains. Pet dogs were shown to be a potential household source of multiresistant E. coli strains. PMID:26887238

  18. Probing the determinants of protein stability: comparison of class A beta-lactamases.

    PubMed Central

    Vanhove, M; Houba, S; b1motte-Brasseur, J; Frère, J M

    1995-01-01

    Five class A beta-lactamases produced by various mesophilic bacterial species have been compared. Although closely related in primary and overall structures, these enzymes exhibit very different stabilities. In order to investigate the factors responsible for these differences, several features deduced from the amino acid composition and three-dimensional structures were studied for the five proteins. This analysis revealed that higher stability appeared to correlate with increased numbers of intramolecular hydrogen bonds and of salt bridges. By contrast, the global hydrophobicity of the protein seemed to play a relatively minor role. A strongly unfavourable balance between charged residues and the presence of a cis-peptide bond preceding a non-proline residue might also contribute to the particularly low stability of two of the enzymes. PMID:8948443

  19. Resistance patterns among nosocomial pathogens: trends over the past few years.

    PubMed

    Jones, R N

    2001-02-01

    Multiple surveillance studies have demonstrated that resistance among prevalent pathogens is increasing at an alarming rate, leading to greater patient morbidity and mortality from nosocomial infections. Among Gram-positive organisms, the most important resistant pathogens are methicillin- (oxacillin-)resistant Staphylococcus aureus, beta-lactam-resistant and multidrug-resistant pneumococci, and vancomycin-resistant enterococci. Important causes of Gram-negative resistance include extended-spectrum beta-lactamases (ESBLs) in Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis, high-level third-generation cephalosporin (Amp C) beta-lactamase resistance among Enterobacter species and Citrobacter freundii, and multidrug-resistance genes observed in Pseudomonas aeruginosa, Acinetobacter, and Stenotrophomonas maltophilia. In selecting an empiric treatment for a nosocomial infection, one should consider the prevalent resistance patterns. Antimicrobials used for the treatment of nosocomial infections should be effective against any likely resistant pathogens and should not further promote the development of resistance. Recent data suggest that because of ESBLs and high-level amp C beta-lactamase resistances, use of third-generation cephalosporins may be ineffective in many patients with nosocomial infections. In addition, use of these agents may allow overgrowth of inherently resistant enterococci. The role of fluoroquinolones in the empiric treatment of nosocomial infections is also being limited by new resistance patterns and increasing resistance levels. Available antimicrobials with good activity against many resistant pathogens include the carbapenems, piperacillin/tazobactam, and cefepime. In addition, several new agents with good activity against Gram-positive organisms are in development or have been recently released. Appropriate antimicrobial selection, surveillance systems, and effective infection-control procedures are key partners in limiting

  20. Molecular characterization of carbapenem-resistant strains of Klebsiella pneumoniae isolated from Iranian patients: first identification of blaKPC gene in Iran.

    PubMed

    Nobari, Saman; Shahcheraghi, Fereshteh; Rahmati Ghezelgeh, Fatemeh; Valizadeh, Babak

    2014-08-01

    Multi-resistant Klebsiella pneumoniae has been considered a serious global threat. This study was initiated to investigate carbapenem resistance among K. pneumoniae isolates in Iran and to detect carbapenemases in resistant strains. From 2009 to 2012, 180 K. pneumoniae strains were collected from Tehran hospitals. Of the isolates, 42 isolates (23.3%) were resistant to meropenem, 29 isolates (16.1%) were resistant to ertapenem, and 14 isolates (7.7%) were resistant to imipenem. All of carbapenem-resistant isolates were also resistant to the third generation of cephalosporins. modified Hodge test was positive in 25 (59.5%) of carbapenem-resistant isolates showing carbapenemase production. bla(NDM) and bla(VIM) genes were identified in three and five carbapenem-resistant isolates, respectively. One isolate showed presence of bla(KPC) gene. Class 1 integrons were detected in 14 carbapenem-resistant isolates. The most important finding about class 1 integrons was identification of an integron containing metallo-β-lactamase gene VIM-1 that also harbored dfrA27 and arr3 genes. It is important to note that K. pneumoniae carbapenemase and New Delhi metallo-beta-lactamase-positive isolates identified in this study showed resistance to the majority of routine antimicrobial agents, including all β-lactams and other classes of antibiotics. To our knowledge, this is the first identification of bla(KPC) and bla(VIM-1) genes among isolates of K. pneumoniae in Iran. PMID:24428238

  1. SCO-1, a novel plasmid-mediated class A beta-lactamase with carbenicillinase characteristics from Escherichia coli.

    PubMed

    Papagiannitsis, C C; Loli, A; Tzouvelekis, L S; Tzelepi, E; Arlet, G; Miriagou, V

    2007-06-01

    A novel class A beta-lactamase (SCO-1) encoded by an 80-kb self-transferable plasmid from Escherichia coli is described. The interaction of SCO-1 with beta-lactams was similar to that of the CARB-type enzymes. Also, SCO-1 exhibited a 51% amino acid sequence identity with the RTG subgroup of chromosomal carbenicillinases (RTG-1, CARB-5, and CARB-8). PMID:17353248

  2. Emergence of New Delhi Metallo-Beta-Lactamase (NDM-1) and Klebsiella pneumoniae Carbapenemase (KPC-2) in South Africa

    PubMed Central

    Coetzee, Jennifer; Clay, Cornelis G.; Sithole, Sindi; Richards, Guy A.; Poirel, Laurent; Nordmann, Patrice

    2012-01-01

    This report documents emergence of New Delhi metallo-beta-lactamase (NDM-1) and Klebsiella pneumoniae carbapenemase (KPC-2) in K. pneumoniae and Enterobacter cloacae in South Africa. NDM-1 producers have not been described in South Africa, and this is the first instance that KPC producers have been identified in Africa. The two patients infected with these carbapenemase-producing bacteria demised. PMID:22116157

  3. A bifunctional monocyclic beta-lactam cross-links across the active site of beta-lactamase.

    PubMed

    Ahluwalia, R; Day, R A; Nauss, J

    1995-01-17

    A 4-alkoxy-2-azetidinone behaves as a bifunctional active site-directed inhibitor of the class A beta-lactamase from Bacillus cereus 569/H. It cross-links SER 70 and LYS 234 as it binds in a approximately 1:1 ratio. The cross-linked enzyme is irreversibly inhibited while the secondary structure is partially stabilized under conditions when the native enzyme is otherwise converted to a form with no detectable secondary structure by circular dichroism. PMID:7826374

  4. Specificity and cooperativity at [beta]-lactamase position 104 in TEM-1/BLIP and SHV-1/BLIP interactions

    SciTech Connect

    Hanes, Melinda S.; Reynolds, Kimberly A.; McNamara, Case; Ghosh, Partho; Bonomo, Robert A.; Kirsch, Jack F.; Handel, Tracy M.

    2011-11-02

    Establishing a quantitative understanding of the determinants of affinity in protein-protein interactions remains challenging. For example, TEM-1/{beta}-lactamase inhibitor protein (BLIP) and SHV-1/BLIP are homologous {beta}-lactamase/{beta}-lactamase inhibitor protein complexes with disparate K{sub d} values (3 nM and 2 {mu}M, respectively), and a single substitution, D104E in SHV-1, results in a 1000-fold enhancement in binding affinity. In TEM-1, E104 participates in a salt bridge with BLIP K74, whereas the corresponding SHV-1 D104 does not in the wild type SHV-1/BLIP co-structure. Here, we present a 1.6 {angstrom} crystal structure of the SHV-1 D104E/BLIP complex that demonstrates that this point mutation restores this salt bridge. Additionally, mutation of a neighboring residue, BLIP E73M, results in salt bridge formation between SHV-1 D104 and BLIP K74 and a 400-fold increase in binding affinity. To understand how this salt bridge contributes to complex affinity, the cooperativity between the E/K or D/K salt bridge pair and a neighboring hot spot residue (BLIP F142) was investigated using double mutant cycle analyses in the background of the E73M mutation. We find that BLIP F142 cooperatively stabilizes both interactions, illustrating how a single mutation at a hot spot position can drive large perturbations in interface stability and specificity through a cooperative interaction network.

  5. Severe sepsis facilitates intestinal colonization by extended-spectrum-β-lactamase-producing Klebsiella pneumoniae and transfer of the SHV-18 resistance gene to Escherichia coli during antimicrobial treatment.

    PubMed

    Guan, Jun; Liu, Shaoze; Lin, Zhaofen; Li, Wenfang; Liu, Xuefeng; Chen, Dechang

    2014-01-01

    Infections caused by multidrug-resistant pathogens are frequent and life threatening in critically ill patients. To investigate whether severe sepsis affects gut colonization by resistant pathogens and genetic exchange between opportunistic pathogens, we tested the intestinal-colonization ability of an extended-spectrum beta-lactamase-producing Klebsiella pneumoniae strain carrying the SHV-18 resistance gene and the transfer ability of the resistance gene to endogenous Escherichia coli under ceftriaxone treatment in rats with burn injury only or severe sepsis induced by burns plus endotoxin exposure. Without ceftriaxone treatment, the K. pneumoniae strain colonized the intestine in both septic and burned rats for a short time, with clearance occurring earlier in burn-only rats but never in sham burn rats. In both burned and septic rats, the colonization level of the challenge strain dropped at the beginning and then later increased during ceftriaxone treatment, after which it declined gradually. This pattern coincided with the change in resistance of K. pneumoniae to ceftriaxone during and after ceftriaxone treatment. Compared with burn-only injury, severe sepsis had a more significant effect on the change in antimicrobial resistance to ceftriaxone. Only in septic rats was the resistance gene successfully transferred from the challenge strain to endogenous E. coli during ceftriaxone treatment; the gene persisted for at least 4 weeks after ceftriaxone treatment. We concluded that severe sepsis can facilitate intestinal colonization by an exogenous resistant pathogen and the transfer of the resistance gene to a potential endogenous pathogen during antimicrobial treatment. PMID:24277046

  6. Recovery of cephalosporin-resistant Escherichia coli and Salmonella from pork, beef and chicken marketed in Nova Scotia

    PubMed Central

    Forward, Kevin R; Matheson, Katherine M; Hiltz, Margot; Musgrave, Heather; Poppe, Cornelius

    2004-01-01

    BACKGROUND: Antimicrobial use in farm animals is a potentially important contributor to the emergence of antimicrobial resistance. Resistant Salmonella may lead to serious human infections and resistant Escherichia coli may transfer plasmid-encoded resistance genes to other pathogens. OBJECTIVE: To determine the prevalence of E coli and Salmonella species resistant to the third generation of cephalosporins in retail meat products in Halifax, Nova Scotia in 2002. METHODS: Ground beef, ground pork and chicken wings were tested for E coli and Salmonella. E coli were selected on ceftriaxonecontaining media. Beta-lactamases were characterised by isoelectric focusing, polymerase chain reaction and sequencing. Pulsed field gel electrophoresis was performed to determine the relationship of strains. The transferability of plasmids and location of resistance genes was also determined. RESULTS: Forty-three of 75 packages of chicken wings contained ceftriaxone-resistant E coli; 42 of these contained beta-lactamases with isoelectric points at approximately 8.7. Six of seven CMY primer amplicons that were sequenced contained plasmid-mediated Citrobacter freundii-derived blaCMY-2; the other contained a CMY-2- like beta-lactamase. Pulsed field gel electrophoresis patterns demonstrated that strains were not clonal in nature. Four chicken samples contained Salmonella, one of which contained bla CMY-2-mediated resistance and an E coli bearing the same gene, but on different plasmids. Four of 100 beef samples contained blaCMY-2-bearing E coli; none contained Salmonella. Two of 75 pork samples contained ceftriaxone resistant E coli, one of which encoded for CMY-2. One susceptible Salmonella strain was recovered from pork. CONCLUSIONS: Chicken from retail outlets located in Halifax, Nova Scotia, commonly contained blaCMY-2-bearing E coli. The relationship antibiotics used in food-producing animals and its effect on resistance of commensals and pathogens needs to be determined. PMID

  7. Molecular epidemiology of Escherichia coli producing extended-spectrum beta-lactamases isolated in Rome, Italy.

    PubMed

    Carattoli, Alessandra; García-Fernández, Aurora; Varesi, Paola; Fortini, Daniela; Gerardi, Serena; Penni, Adriano; Mancini, Carlo; Giordano, Alessandra

    2008-01-01

    Escherichia coli strains producing extended-spectrum beta-lactamases (ESBLs) are a major problem in many different hospitals worldwide, causing outbreaks as well as sporadic infections. The prevalence of Escherichia coli ESBL producers was analyzed in a surveillance study performed on the population attending the Policlinico Umberto I, the largest university hospital in Rome, Italy. We also investigated genotypes, pathogenicity islands, and plasmids in the ESBL-positive E. coli isolates as further markers that are useful in describing the epidemiology of the infections. In this survey, 163 nonreplicate isolates of Escherichia coli were isolated from patients from 86 different wards, and 28 were confirmed as ESBL producers. A high prevalence (26/28) of CTX-M-15 producers was observed within the bacterial population circulating in this hospital, and the dissemination of this genetic trait was associated with the spread of related strains; however, these do not have the characteristics of a single epidemic clone spreading. The dissemination was also linked to horizontal transfer among the prevalent E. coli genotypes of multireplicon plasmids showing FIA, FIB, and FII replicons in various combinations, which are well adapted to the E. coli species. The analysis of related bacteria suggests a probable interpatient transmission occurring in several wards, causing small outbreaks. PMID:17959756

  8. Reactions of pyrazolylborate-zinc-hydroxide complexes related to beta-lactamase activity.

    PubMed

    Gross, Florian; Vahrenkamp, Heinrich

    2005-06-13

    Simple beta-lactams and their hydrolysis products, the beta-amino acids, react with TpZn-OH under deprotonation. The latter become semibidentate carboxylate ligands with a NH...O hydrogen bond, and the former become N-bound beta-lactamide ligands. Likewise the antibiotic derivatives 6-aminopenicillanic acid and 7-aminocephalosporanic acid are incorporated as carboxylate ligands. beta-Lactams bearing nitrophenyl or acyl substituents at the nitrogen atoms are opened hydrolytically by TpZn-OH, and the resulting N-substituted beta-amino acids are attached to zinc by their carboxylate functions. Only with trifluoroacetyl as the N-substituent does the hydrolytic cleavage occur at the external amide bond, yielding the free beta-lactam and TpZn-trifluoroacetate. The kinetic investigation of the opening reactions has shown them to be of second order like all other TpZn-OH-induced hydrolytic cleavages, thereby supporting the four-center mechanism for the monozinc beta-lactamases. PMID:15934776

  9. Towards a ligand targeted enzyme prodrug therapy: single round panning of a beta-lactamase scaffold library on human cancer cells.

    PubMed

    Shukla, Girja S; Murray, Christopher J; Estabrook, Melodie; Shen, Guang-Ping; Schellenberger, Volker; Krag, David N

    2007-05-15

    A novel beta-lactamase scaffold library in which the target-binding moiety is built into the enzyme was generated using phage display technology. The binding element is composed of a fully randomized 8 amino acid loop inserted at position between Y34 and K37 on the outer surface of Enterobacter cloacae P99 cephalosporinase (beta-lactamase, E.C. 3.5.2.6) with all library members retaining catalytic activity. The frequency and diversity of amino acids distributions in peptide inserts from library clones were analyzed. The complexity of the randomized loop appears consistent with standards of other types of phage display library systems. The library was panned against SKBR3 human breast cancer cells in 1 round using rolling circle amplification of phage DNA to recover bound phage. Individual beta-lactamase clones, independent of phage, were rapidly assessed for their binding to SKBR3 cells using a simple high throughput screen based on cell-bound beta-lactamase activity. SKBR3 cell-binding beta-lactamase enzymes were also shown to bind specifically using an immunochemical method. Selected beta-lactamase clones were further studied for their protein expression, enzyme activity and binding to nontumor cell-lines. Overall, the approach outlined here offers the opportunity of rapidly selecting targeted beta-lactamase ligands that may have a potential for their use in enzyme prodrug therapy with cephalosporin-based prodrugs. It is expected that a similar approach will be useful in developing tumor-targeting molecules of several other enzyme candidates of cancer prodrug therapy. PMID:17285581

  10. Silver Resistance Genes Are Overrepresented among Escherichia coli Isolates with CTX-M Production

    PubMed Central

    Edquist, Petra; Sandegren, Linus; Adler, Marlen; Tängdén, Thomas; Drobni, Mirva; Olsen, Björn; Melhus, Åsa

    2014-01-01

    Members of the Enterobacteriaceae with extended-spectrum beta-lactamases (ESBLs) of the CTX-M type have disseminated rapidly in recent years and have become a threat to public health. In parallel with the CTX-M type expansion, the consumption and widespread use of silver-containing products has increased. To determine the carriage rates of silver resistance genes in different Escherichia coli populations, the presence of three silver resistance genes (silE, silP, and silS) and genes encoding CTX-M-, TEM-, and SHV-type enzymes were explored in E. coli isolates of human (n = 105) and avian (n = 111) origin. The antibiotic profiles were also determined. Isolates harboring CTX-M genes were further characterized, and phenotypic silver resistance was examined. The silE gene was present in 13 of the isolates. All of them were of human origin. Eleven of these isolates harbored ESBLs of the CTX-M type (P = 0.007), and eight of them were typed as CTX-M-15 and three as CTX-M-14. None of the silE-positive isolates was related to the O25b-ST131 clone, but 10 out of 13 belonged to the ST10 or ST58 complexes. Phenotypic silver resistance (silver nitrate MIC > 512 mg/liter) was observed after silver exposure in 12 of them, and a concomitant reduced susceptibility to piperacillin-tazobactam developed in three. In conclusion, 12% of the human E. coli isolates but none of the avian isolates harbored silver resistance genes. This indicates another route for or level of silver exposure for humans than that caused by common environmental contamination. Since silE-positive isolates were significantly more often found in CTX-M-positive isolates, it is possible that silver may exert a selective pressure on CTX-M-producing E. coli isolates. PMID:25128339

  11. Prevalence of beta-lactams resistance among Escherichia coli clinical isolates from a hospital in Algiers.

    PubMed

    Messai, Y; Benhassine, T; Naim, M; Paul, G; Bakour, R

    2006-06-01

    A high prevalence of beta-lactams resistance among Enterobacteriaceae have been reported worldwide; however, there are not sufficient data on this issue in Algeria. beta-Lactams susceptibility of 203 Escherichia coli clinical isolates was determined by agar diffusion method, and production of extended-spectrum beta-lactamases (ESBL) was screened by double-disk synergy test. This analysis showed five well-defined phenotypes: 1) 62 isolates (30.5%) were susceptible to all beta-lactams; 2) 135 isolates (66.5%) presented a broad-spectrum beta-lactamases phenotype (BSBL); 3) three isolates (1.5%) were defined as producing ESBLs; 4) two isolates (1%) were AmpC cephalosporinase producers; and 5) one isolate (0.5%) presented a phenotype of cell-decreased permeability to beta-lactams. Isoelectric focusing revealed beta-lactamases with isolectric points of 5.4 or 7.6 for isolates with BSBL phenotype; approximately 9.0 for two ESBL isolates; 5.4, 7.6 and approximately 9.0 for the remaining ESBL isolate; and 5.4 and approximately 9.0 for the AmpC isolates. The cefotaxime hydrolysis corresponds to the basic bands with an isoelectric point of approximately 9.0. Conjugation assay showed transfer of penicillinase and AmpC resistance phenotypes and their corresponding beta-lactamases to recipient E. coli BM21 in association with plasmids of 71.4 kb for the AmpC isolates and from 40-56 kb for penicillinase isolates. This result showed that the AmpC phenotype is plasmid mediated. ESBL isolates were found not to transfer their resistance through conjugation experiment. Polymerase chain reaction (PCR) experiments using primers specific to blaTEM, blaAmpC and blaCTX-M genes showed specific amplification with blaCTX-M primer for two ESBL isolates; blaTEM and blaCTX-M for the remaining ESBL isolate; and blaTEM and blaAmpC for the AmpC isolates and their corresponding transconjugants. The study showed a high rate of isolates producing penicillinase, and low frequencies of AmpC and ESBL

  12. Characterization of extended-spectrum beta-lactamase (ESBL)-carrying plasmids and clones of Enterobacteriaceae causing cattle mastitis in France.

    PubMed

    Dahmen, Safia; Métayer, Véronique; Gay, Emilie; Madec, Jean-Yves; Haenni, Marisa

    2013-03-23

    Extended-spectrum beta-lactamases (ESBLs) have become widespread enzymes in food-producing and companion animals worldwide. However, in cattle mastitis, a major cause of economic loss in the dairy industry, ESBL-producers were rarely described. In this study, from a collection of 1427 Escherichia coli and Klebsiella pneumoniae isolates causing clinical mastitis in France, we report 0.4% (6/1427) of the isolates carrying an ESBL gene. These six isolates were genetically unrelated and recovered over a 3-year period of time. The bla(CTX-M-14) gene was found in 4/6 isolates, and was predominantly located on F2:A-:B- IncFII plasmids. The bla(CTX-M-1) IncI1/ST3, which is widespread in various animal species in France, was found as well. Interestingly, among the five E. coli isolates, the ST23 and ST58 clones were found twice, together with the ST10 clone, all of which were previously found as ESBL-carriers in humans. Despite the very limited number of ESBL-producers recovered, this study shows a surprisingly low molecular diversity of the strains causing mastitis in France with respect to ESBL genes, plasmids and clones. Further work is needed to understand the major driving forces of the ESBL epidemiology in animals, including for different infections within the same animal species. PMID:23127568

  13. Validation of Minim typing for fast and accurate discrimination of extended-spectrum, beta-lactamase-producing Klebsiella pneumoniae isolates in tertiary care hospital.

    PubMed

    Brhelova, Eva; Kocmanova, Iva; Racil, Zdenek; Hanslianova, Marketa; Antonova, Mariya; Mayer, Jiri; Lengerova, Martina

    2016-09-01

    Minim typing is derived from the multi-locus sequence typing (MLST). It targets the same genes, but sequencing is replaced by high resolution melt analysis. Typing can be performed by analysing six loci (6MelT), four loci (4MelT) or using data from four loci plus sequencing the tonB gene (HybridMelT). The aim of this study was to evaluate Minim typing to discriminate extended-spectrum beta-lactamase producing Klebsiella pneumoniae (ESBL-KLPN) isolates at our hospital. In total, 380 isolates were analyzed. The obtained alleles were assigned according to both the 6MelT and 4MelT typing scheme. In 97 isolates, the tonB gene was sequenced to enable HybridMelT typing. We found that the presented method is suitable to quickly monitor isolates of ESBL-KLPN; results are obtained in less than 2 hours and at a lower cost than MLST. We identified a local ESBL-KLPN outbreak and a comparison of colonizing and invasive isolates revealed a long term colonization of patients with the same strain. PMID:27394639

  14. Prevalence and diversity of carbapenem-resistant bacteria in untreated drinking water in Portugal.

    PubMed

    Henriques, Isabel S; Araújo, Susana; Azevedo, Juliana S N; Alves, Marta Salgueiro; Chouchani, Chedly; Pereira, Anabela; Correia, António

    2012-10-01

    We examined the prevalence and diversity of carbapenem-resistant bacteria (CRB) in untreated drinking water. Prevalence was estimated in plate count agar (PCA) and R2A media with or without antibiotics. Clonal relatedness of isolates was established by repetitive extragenic palindroitic (REP)-PCR. Phylogeny was based on the 16S rRNA gene. Antimicrobial susceptibility was assessed by disc diffusion methods. Genes encoding beta-lactamases and integrases were inspected by PCR. CRB ranged from 0.02% to 15.9% of cultivable bacteria, while ampicillin-resistant bacteria ranged from 1.5% to 31.4%. Carbapenem-resistant isolates affiliated with genera Stenotrophomonas, Pseudomonas, Janthinobacterium, Chryseobacterium, Sphingobacterium, Acidovorax, Caulobacter, Cupriavidus, and Sphingomonas. CRB were highly resistant to beta-lactams, but mostly susceptible to other classes. Transmissible beta-lactamase genes and integrase genes were not detected. The genus-specific bla(L1) was detected in 61% of the Stenotrophomonas isolates. Contrarily to what has been reported for extensively used antibiotics, low levels of carbapenem resistance were detected in untreated drinking water, often represented by intrinsically resistant genera. Production of chromosomal-encoded carbapenemases was the prevalent carbapenem resistance mechanism. Results suggest that the dissemination of anthropogenic-derived carbapenem resistance is at an early stage. This presents an opportunity to rationally develop monitoring strategies to identify dissemination routes and assess the impact of human actions in the environmental resistome. PMID:22663561

  15. Molecular Characterisation of nfsA Gene in Nitrofurantoin Resistant Uropathogens

    PubMed Central

    Shanmugam, Dhivyalakshmi; Narayanaswamy, Anbumani

    2016-01-01

    Introduction Majority of Urinary Tract Infections (UTI’s) are lower UTI’s which constitute the real burden in the primary care setting and are usually treated empirically. Nitrofurantoin is an underused antimicrobial for empiric therapy for community-acquired and nosocomial lower UTIs. Nitrofurantoin has a wide spectrum of action against Escherichia coli, Klebsiella pneumonia and Enterococci, which are the frequent causes of nosocomial lower UTIs and also against multidrug-resistant gram-negative organisms including extended spectrum beta lactamase (ESBL) producers, Amp-C producers and Carbapenamase producers. Aim The study was conducted to describe the resistance pattern of nitrofurantoin and to identify the genes responsible for nitrofurantoin resistance (i.e.) nfsA and the type of mutations involved. Settings and Design This study was conducted in a tertiary care hospital for a period of six months which caters to a total of 1200 beds. Materials and Methods A total of 115 clinical strains of Escherichia coli and Klebsiella pneumoniae including ESBL and Carbapenemase producing isolates were analysed for susceptibility to commonly used antimicrobials. Results ESBL producers 65% and 51% of carbapenems resistant strains were susceptible to nitrofurantoin by minimal inhibitory concentration. MIC to nitrofurantoin was determined by E-strip method. Nitroreductase nfsA gene was detected by PCR in 64 of 70 E.coli isolates with reduced susceptibility to nitrofurantoin. Gene sequencing was done using BLAST algorithm and substitution (N=12) and insertion mutation (N=1) were observed in the resistant strains. Conclusion Nitrofurantoin being an oral antibiotic, its usage in ESBL producers and carbapenamase producers is still warranted. Surprisingly, resistance to nitrofurantoin remains minimal even after extensive use and may be related to the fact that it has multiple mechanisms of action hence may require organisms to develop more than a single mutation to concur

  16. TEM-1 AND ROB-1 PRESENCE AND ANTIMICROBIAL RESISTANCE IN HAEMOPHILUS INFLUENZAE STRAINS, ISTANBUL, TURKEY.

    PubMed

    Kuvat, Nuray; Nazik, Hasan; Berkiten, Rahmiye; Öngen, Betigül

    2015-03-01

    Resistance of 235 Haemophilus influenzae clinical isolates from Istanbul Medical Faculty Hospital, Turkey were determined against 19 antibiotics by disc diffusion method, and minimum inhibitory concentrations (MICs) of those found resistant to ampicillin, cefuroxim, chloramphenicol and meropenem were measured using E-test. Ampicillin-resistant isolates producing beta-lactamase as demonstrated by a nitrocefin assay were analyzed for the presence of TEM-1 and ROB-1 genes by PCR. Eleven percent of the isolates were resistant to ampicillin (10 µg/ml), of which 73% were beta-lactamase positive and carried TEM-1 gene, but none were positive for ROB-1 gene. All isolates susceptible to amoxicillin-clavulanate (20/10 µg/ml), azithromycin (15 µg/ml), aztreonam (30 µg/ml), cefotaxime (30 µg/ml), ceftriaxone (30 µg/ml), ciprofloxacin (5 µg/ml), levofloxacin (5 µg/ml), and telithromycin (15 µg/ml) but 24%, 15%, 4%, 4%, 2%, 1%, 1%, 0.5%, 0.5% and 0.5% were resistant to trimethoprim-sulfamethoxazole (1.25/23.75 µg/ml), tetracycline (30 µg/ml), cefaclor (30 µg/ml), clarithromycin (15 µg/ml), cefuroxime (30 µg/ml), meropenem (10 µg/ml), chloramphenicol (30 µg/ml), ampicillin-sulbactam (10/10 µg/ml), nalidixic acid (30 µg/ml), and fosfomycin (30 µg/ml), respectively. MIC values of three cefuroxime-resistant isolates was 24, 48 and > 256 µg/ml, respectively; of two meropenem-resistant strains > 256 µg/ml; and of two chloramphenicol-susceptible isolates (by disc diffusion method) 6 µg/ml (considered as intermediate susceptible). Multiple- antibiotics resistance was detected in 15% of the strains, with resistance to 2, 3, 4, 5 and 6 antibiotics in 8.5%, 4%, 2%, 0.5% and 0.5% of the isolates, respectively. By identifying beta-lactamase-negative ampicillin-resistant H. influenzae, empirical therapy with beta-lactam/beta-lactamase inhibitor combinations and second generation cephalosporins would be inappropriate for such patients (approximately 3%). Our findings will

  17. Sequential Binding of Cobalt(II) to Metallo-beta-lactamase CcrA

    SciTech Connect

    Periyannan,G.; Costello, A.; Tierney, D.; Yang, K.; Bennett, b.; Crowder, M.

    2006-01-01

    In an effort to probe Co(II) binding to metallo-{beta}-lactamase CcrA, EPR, EXAFS, and 1H NMR studies were conducted on CcrA containing 1 equiv (1-Co(II)-CcrA) and 2 equiv (Co(II)Co(II)-CcrA) of Co(II). The EPR spectra of 1-Co(II)-CcrA and Co(II)Co(II)-CcrA are distinct and indicate 5/6-coordinate Co(II) ions. The EPR spectra also reveal the absence of significant spin-exchange coupling between the Co(II) ions in Co(II)Co(II)-CcrA. EXAFS spectra of 1-Co(II)-CcrA suggest 5/6-coordinate Co(II) with two or more histidine ligands. EXAFS spectra of Co(II)Co(II)-CcrA also indicate 5/6 ligands at a similar average distance to 1-Co(II)-CcrA, including an average of about two histidines per Co(II). {sup 1}H NMR spectra for 1-Co(II)-CcrA revealed seven paramagnetically shifted resonances, three of which were solvent-exchangeable, while the NMR spectra for Co(II)Co(II)-CcrA showed at least 16 shifted resonances, including an additional solvent-exchangeable resonance and a resonance at 208 ppm. The data indicate sequential binding of Co(II) to CcrA and that the first Co(II) binds to the consensus Zn{sub 1} site in the enzyme.

  18. Antimicrobial activity of antibiotics in combination with natural flavonoids against clinical extended-spectrum beta-lactamase (ESBL)-producing Klebsiella pneumoniae.

    PubMed

    Lin, Rong-Dih; Chin, Yi-Ping; Lee, Mei-Hsien

    2005-07-01

    Extended-spectrum beta-lactamases (ESBLs) are plasmid-mediated class A enzymes commonly found in the family Enterobacteriaceae, mainly in Klebsiella pneumoniae. Flavonoids have also been reported to possess antimicrobial activity. In this study, the in vitro activities of 18 antibiotics and 12 flavonoids against 20 ESBL-producing K. pneumoniae isolates were evaluated. All of these isolates were susceptible to imipenem and cefmetazole, but were resistant to ampicillin, ampicillin/sulbactam, aztreonam, cefazolin, cefoperazone, cefotaxime, ceftazidime, ceftriaxone, cefuroxime, piperacillin and ticarcillin. Susceptibilities to amikacin, amoxicillin/clavulanate, cefoxitin, ciprofloxacin and gentamicin were variable. Myricetin, a flavonol, inhibited ESBL-producing K. pneumoniae isolates at a high minimum inhibitory concentration (MIC) (MIC(90) value 256 mg/mL), but exhibited significant synergic activity against ESBL-producing K. pneumoniae in separate combination with amoxicillin/clavulanate, ampicillin/sulbactam and cefoxitin. Because of the low-toxic nature of flavonoids, the combination of antibiotics and flavonoids is a potential new strategy for developing therapies for infections caused by ESBL-producing bacteria in the future. PMID:16161024

  19. Presence of Clostridium difficile and antibiotic and beta-lactamase activities in feces of volunteers treated with oral cefixime, oral cefpodoxime proxetil, or placebo.

    PubMed Central

    Chachaty, E; Depitre, C; Mario, N; Bourneix, C; Saulnier, P; Corthier, G; Andremont, A

    1992-01-01

    Three groups of six healthy adult volunteers were randomly assigned to a treatment with 400 mg of oral cefpodoxime proxetil, oral cefixime, or placebo per day for 10 days. Informed consent was obtained from all volunteers. Clostridium difficile was not detected in the feces of any subject before treatment or at any time in the subjects in the placebo group. C. difficile was, however, detected in all subjects treated with cefpodoxime proxetil and in five of six treated with cefixime. Genomic DNA restriction patterns showed that the strains of C. difficile differed from one volunteer to another. Two subjects both shed different strains at different times during the 25-day surveillance period. All isolates were resistant to cefixime and cefpodoxime (MIC for 90% of strains, 256 and 512 mg/liter, respectively). Antibiotic activity was found in the feces of one volunteer treated with cefpodoxime proxetil and of four volunteers treated with cefixime. It was inversely correlated with the presence of fecal beta-lactamase activity. Intestinal side effects were limited to modifications of stool consistency, which occurred in only 3 of the 12 treated volunteers and did not lead to cessation of treatment. These modifications were significantly associated with the presence of fecal antibiotic activity (P less than 0.05) but not with the shedding of toxigenic or nontoxigenic strains of C. difficile or with the presence of toxin A in feces, which was detected only in one perfectly healthy treated volunteer. Images PMID:1416894

  20. Presence of Clostridium difficile and antibiotic and beta-lactamase activities in feces of volunteers treated with oral cefixime, oral cefpodoxime proxetil, or placebo.

    PubMed

    Chachaty, E; Depitre, C; Mario, N; Bourneix, C; Saulnier, P; Corthier, G; Andremont, A

    1992-09-01

    Three groups of six healthy adult volunteers were randomly assigned to a treatment with 400 mg of oral cefpodoxime proxetil, oral cefixime, or placebo per day for 10 days. Informed consent was obtained from all volunteers. Clostridium difficile was not detected in the feces of any subject before treatment or at any time in the subjects in the placebo group. C. difficile was, however, detected in all subjects treated with cefpodoxime proxetil and in five of six treated with cefixime. Genomic DNA restriction patterns showed that the strains of C. difficile differed from one volunteer to another. Two subjects both shed different strains at different times during the 25-day surveillance period. All isolates were resistant to cefixime and cefpodoxime (MIC for 90% of strains, 256 and 512 mg/liter, respectively). Antibiotic activity was found in the feces of one volunteer treated with cefpodoxime proxetil and of four volunteers treated with cefixime. It was inversely correlated with the presence of fecal beta-lactamase activity. Intestinal side effects were limited to modifications of stool consistency, which occurred in only 3 of the 12 treated volunteers and did not lead to cessation of treatment. These modifications were significantly associated with the presence of fecal antibiotic activity (P less than 0.05) but not with the shedding of toxigenic or nontoxigenic strains of C. difficile or with the presence of toxin A in feces, which was detected only in one perfectly healthy treated volunteer. PMID:1416894

  1. Emergence of clonally related multidrug resistant Haemophilus influenzae with penicillin-binding protein 3-mediated resistance to extended-spectrum cephalosporins, Norway, 2006 to 2013.

    PubMed

    Skaare, D; Anthonisen, I L; Kahlmeter, G; Matuschek, E; Natås, O B; Steinbakk, M; Sundsfjord, A; Kristiansen, B E

    2014-01-01

    Resistance to cephalosporins in Haemophilus influenzae is usually caused by characteristic alterations in penicillin-binding protein 3 (PBP3), encoded by the ftsI gene. Resistance to extended-spectrum cephalosporins is associated with high-level PBP3-mediated resistance (high-rPBP3), defined by the second stage S385T substitution in addition to a first stage substitution (R517H or N526K). The third stage L389F substitution is present in some high-rPBP3 strains. High-rPBP3 H. influenzae are considered rare outside Japan and Korea. In this study, 30 high-rPBP3 isolates from Norway, collected between 2006 and 2013, were examined by serotyping, multilocus sequence typing (MLST), ftsI sequencing, detection of beta-lactamase genes and minimum inhibitory concentration (MIC) determination. MICs were interpreted according to clinical breakpoints from the European Committee on Antimicrobial Susceptibility Testing (EUCAST). Respiratory isolates predominated (proportion: 24/30). The 30 isolates included one serotype f isolate, while the remaining 29 lacked polysaccharide capsule genes. Resistance to extended-spectrum cephalosporins (cefixime, 29 isolates/30 isolates; cefepime, 28/30; cefotaxime, 26 /30; ceftaroline, 26/30; ceftriaxone, 14/30), beta-lactamase production (11/30) and co-resistance to non-beta-lactams (trimethoprim-sulfamethoxazole, 13/30; tetracycline, 4/30; chloramphenicol, 4/30; ciprofloxacin, 3/30) was frequent. The N526K substitution in PBP3 was present in 23 of 30 isolates; these included a blood isolate which represents the first invasive S385T + N526K isolate reported from Europe. The L389F substitution, present in 16 of 30 isolates, coincided with higher beta-lactam MICs. Non-susceptibility to meropenem was frequent in S385T + L389F + N526K isolates (8/12). All 11 beta-lactamase positive isolates were TEM-1. Five clonal groups of two to 10 isolates with identical MLST-ftsI allelic profiles were observed, including the first reported high-rPBP3

  2. Detection of extended-spectrum beta-lactamases among Enterobacteriaceae by use of semiautomated microbiology systems and manual detection procedures.

    PubMed

    Wiegand, Irith; Geiss, Heinrich K; Mack, Dietrich; Stürenburg, Enno; Seifert, Harald

    2007-04-01

    Three commercially available microbiology identification and susceptibility testing systems were compared with regard to their ability to detect extended-spectrum beta-lactamase (ESBL) production in Enterobacteriaceae, i.e., the Phoenix Automated Microbiology System (BD Diagnostic Systems, Sparks, MD), the VITEK 2 System (bioMérieux, Marcy l'Etoile, France), and the MicroScan WalkAway-96 System (Dade Behring, Inc., West Sacramento, CA), using routine testing panels. One hundred fifty putative ESBL producers were distributed blindly to three participating laboratories. Conventional phenotypic confirmatory tests such as the disk approximation method, the CLSI double-disk synergy test, and the Etest ESBL were also evaluated. Biochemical and molecular characterization of beta-lactamases performed at an independent laboratory was used as the reference method. One hundred forty-seven isolates of Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Enterobacter aerogenes, Citrobacter freundii, Serratia marcescens, Proteus mirabilis, Proteus vulgaris, and Morganella morganii were investigated. Of these isolates, 85 were identified as ESBL producers by the reference method. The remaining isolates were identified as non-ESBL producers; they were either hyperproducers of their chromosomal AmpC, Koxy, or SHV enzymes or lacked any detectable beta-lactamase activity. The system with the highest sensitivity for the detection of ESBLs was the Phoenix (99%), followed by the VITEK 2 (86%) and the MicroScan (84%); however, specificity was more variable, ranging from 52% (Phoenix) to 78% (VITEK 2). The performance of the semiautomated systems differed widely with the species investigated. The sensitivities of the conventional test methods ranged from 93 to 94%. The double-disk synergy test showed the highest specificity and positive predictive value among all test methods, i.e., 97% and 98%, respectively. PMID:17287329

  3. Toxigenic genes, spoilage potential, and antimicrobial resistance of Bacillus cereus group strains from ice cream.

    PubMed

    Arslan, Seza; Eyi, Ayla; Küçüksarı, Rümeysa

    2014-02-01

    Bacillus spp. can be recovered from almost every environment. It is also found readily in foods, where it may cause food spoilage and/or food poisoning due to its toxigenic and pathogenic nature, and extracellular enzymes. In this study, 29 Bacillus cereus group strains from ice cream were examined for the presence of following virulence genes hblC, nheA, cytK and ces genes, and tested for a range of the extracellular enzymes, and antimicrobial susceptibility. The strains were found to produce extracellular enzymes: proteolytic and lipolytic activity, gelatin hydrolysis and lecithinase production (100%), DNase production (93.1%) and amylase activity (93.1%). Of 29 strains examined, 24 (82.8%) showed hemolytic activity on blood agar. Beta-lactamase enzyme was only produced by 20.7% of B. cereus group. Among 29 B. cereus group from ice cream, nheA was the most common virulence gene detected in 44.8% of the strains, followed by hblC gene with 17.2%. Four (13.8%) of the 29 strains were positive for both hblC gene and nheA gene. Contrarily, cytK and ces genes were not detected in any of the strains. Antimicrobial susceptibility of ice cream isolates was tested to 14 different antimicrobial agents using the disc diffusion method. We detected resistance to penicillin and ampicillin with the same rate of 89.7%. Thirty-one percent of the strains were multiresistant to three or more antibiotics. This study emphasizes that the presence of natural isolates of Bacillus spp. harboring one or more enterotoxin genes, producing extracellular enzymes which may cause spoilage and acquiring antibiotic resistance might hold crucial importance in the food safety and quality. PMID:24309214

  4. Epidemiology and molecular characterization of extended-spectrum beta-lactamase-producing Enterobacter spp., Pantoea agglomerans, and Serratia marcescens isolates from a Bulgarian hospital.

    PubMed

    Markovska, Rumyana Donkova; Stoeva, Temenuga Jekova; Bojkova, Kalina Dineva; Mitov, Ivan Gergov

    2014-04-01

    Forty-two extended-spectrum beta-lactamase (ESBL)-producing isolates of Enterobacter aerogenes, Enterobacter cloacae, Pantoea agglomerans, and Serratia marcescens, collected consecutively during the period January-November 2011 from the University Hospital in Varna, Bulgaria, were studied to characterize their ESBLs by isoelectric focusing, group-specific PCR, and sequencing. The epidemiological relationship was evaluated by random amplified polymorphic DNA analysis (RAPD). Transferability of ESBL genes was determined by conjugation experiments. Plasmid analysis was done by replicon typing and PstI fingerprinting. The overall rate of ESBL production was 20%. The most widespread enzyme was CTX-M-3, found in 64%. It was dominant in E. aerogenes (100%) and S. marcescens (83%). SHV-12, CTX-M-3, and CTX-M-15 were found among E. cloacae isolates in 50%, 35%, and 45%, respectively. Three main CTX-M-3-producing epidemic clones of E. aerogenes and S. marcescens have been detected. Among E. cloacae isolates, six different RAPD profiles were discerned. The plasmids harboring blaCTX-M-3 belonged to IncL/M type and demonstrated similar PstI fingerprinting profiles. IncFII plasmids were detected in two CTX-M-15-producing E. cloacae isolates. Our results demonstrate wide intrahospital dissemination of clonal E. aerogenes and S. marcescens isolates, carrying IncL/M conjugative plasmids. PMID:24171449

  5. Oral treatment options for ambulatory patients with urinary tract infections caused by extended-spectrum-beta-lactamase-producing Escherichia coli.

    PubMed

    Auer, Simon; Wojna, Alexandra; Hell, Markus

    2010-09-01

    An increase in extended-spectrum-beta-lactamase (ESBL)-producing Escherichia coli has been observed in outpatient settings. Consequently, 100 ESBL-positive E. coli isolates from ambulatory patients with clinically confirmed urinary tract infections were collected by a single laboratory between October 2004 and January 2008. Antimicrobial susceptibility testing was carried out using the oral antibiotics fosfomycin, pivmecillinam, and nitrofurantoin and the parenteral antibiotic ertapenem. Susceptibility rates indicate that fosfomycin (97%), nitrofurantoin (94%), and pivmecillinam (85%) could be considered important oral treatment options. PMID:20585127

  6. Varying high levels of faecal carriage of extended-spectrum beta-lactamase producing Enterobacteriaceae in rural villages in Shandong, China: implications for global health.

    PubMed

    Sun, Qiang; Tärnberg, Maria; Zhao, Lingbo; Stålsby Lundborg, Cecilia; Song, Yanyan; Grape, Malin; Nilsson, Maud; Tomson, Göran; Nilsson, Lennart E

    2014-01-01

    Antibiotic resistance is considered a major threat to global health and is affected by many factors, of which antibiotic use is probably one of the more important. Other factors include hygiene, crowding and travel. The rapid resistance spread in Gram-negative bacteria, in particular extended-spectrum beta-lactamase (ESBL) producing Enterobacteriaceae (ESBL-E), is a global challenge, leading to increased mortality, morbidity and health systems costs worldwide. Knowledge about resistance in commensal flora is limited, including in China. Our aim was to establish the faecal carriage rates of ESBL-E and find its association with known and suspected risk factors in rural residents of all ages in three socio-economically different counties in the Shandong Province, China. Faecal samples and risk-factor information (questionnaire) were collected in 2012. ESBL-E carriage was screened using ChromID ESBL agar. Risk factors were analysed using standard statistical methods. Data from 1000 individuals from three counties and in total 18 villages showed a high and varying level of ESBL-E carriage. Overall, 42% were ESBL-E carriers. At county level the carriage rates were 49%, 45% and 31%, respectively, and when comparing individual villages (n = 18) the rate varied from 22% to 64%. The high level of ESBL-E carriage among rural residents in China is an indication of an exploding global challenge in the years to come as resistance spreads among bacteria and travels around the world with the movement of people and freight. A high carriage rate of ESBL-E increases the risk of infection with multi-resistant bacteria, and thus the need for usage of last resort antibiotics, such as carbapenems and colistin, in the treatment of common infections. PMID:25405340

  7. First initial community-acquired meningitis due to extended-spectrum beta-lactamase producing Escherichia coli complicated with multiple aortic mycotic aneurysms.

    PubMed

    Weyrich, Pierre; Ettahar, Nicolas; Legout, Laurence; Meybeck, Agnes; Leroy, Olivier; Senneville, Eric

    2012-01-01

    We report the first case of extended-spectrum beta-lactamase producing E. coli community-acquired meningitis complicated with multiple aortic mycotic aneurysms. Because of the acute aneurysm expansion with possible impending rupture on 2 abdominal CT scan, the patient underwent prompt vascular surgery and broad spectrum antibiotic therapy but he died of a hemorrhagic shock. Extended-spectrum beta-lactamase producing E. coli was identified from both blood and cerebrospinal fluid culture before vascular treatment. The present case report does not however change the guidelines of Gram negative bacteria meningitis in adults. PMID:22321435

  8. Prevalence and Risk Factors associated with Extended Spectrum Beta Lactamase Producing Escherichia coli and Klebsiella pneumoniae Isolates in Hospitalized Patients in Kashan (Iran)

    PubMed Central

    Sharif, Mohammad Reza; Soltani, Babak; Moravveji, Alireza; Erami, Mahzad; Soltani, Nika

    2016-01-01

    Introduction Production of extended spectrum beta lactamase (ESBL) is an important mechanism of antimicrobial resistance in Escherichia coli (E. coli) and Klebsiella pneumoniae (K. pneumoniae) isolates. This study was performed to determine the prevalence and risk factors associated with ESBL producing strains of E. coli and K. pneumoniae. Methods In this cross-sectional study, 250 strains (134 E. coli and 116 K. pneumoniae) were obtained, and ESBL producing isolates were detected by the combination disk test in Shahid Beheshti Hospital in Kashan, Iran, from February 2012 to June 2013. Antimicrobial resistance was screened by the disk diffusion method and was confirmed by E-test. Furthermore, risk factors of ESBL producing E. coli and K. pneumoniae microorganisms were determined. Data were analyzed by SPSS version 16, using descriptive statistics, chi-squared, independent-samples t-test, and logistic regression analysis. Results One hundred and two (40.8%) of all strains were ESBL producers, of which 54 (52.9%) were E. coli and 48 (47.1%) were K. pneumoniae (p = 0.86). Furthermore, 40.3% of E. coli and 41.4% of K. pneumoniae isolates were ESBL producers (p = 0.86). The most antimicrobial resistance was to ampicillin, and no imipenem resistance was detected. Risk factors for ESBL producing E. coli included admission duration exceeding 7 days (p = 0.011) and antibiotic use in the last month (p < 0.001), and the associated risk factor for ESBL producing K. pneumoniae was antibiotic use during the recent month (p = 0.002). Conclusion This study identified a relatively high prevalence of ESBL production among E. coli and K. pneumoniae strains. Furthermore, anti-bimicrobial use and admission duration were risk factors for ESBL producing isolates. Therefore, more comprehensive investigations are needed for the development of new strategies to control the dissemination of these microbes. PMID:27123215

  9. Mechanism of inactivation of beta-lactamases by novel 6-methylidene penems elucidated using electrospray ionization mass spectrometry.

    PubMed

    Tabei, Keiko; Feng, Xidong; Venkatesan, Aranapakam M; Abe, Takao; Hideki, Ushirogochi; Mansour, Tarek S; Siegel, Marshall M

    2004-07-01

    The reactions of 6-methylidene penems 4-7 with beta-lactamases (TEM-1, SHV-1, Amp-C) were characterized by electrospray ionization mass spectrometry (ESI-MS). The kinetics of the reactions were monitored, demonstrating that only one penem molecule reacts to form an acyl-enzyme complex. For penem 5, the ESI-MS/MS spectrum of the hydrolysis product produced in the reaction was identical to the spectrum generated from a synthesized dihydro[1,4]thiazepine 10, confirming the rearrangement of the penem ring system to a seven-membered dihydro[1,4]thiazepine structure. Gas-phase ESI-MS/MS fragmentation data were rationalized due to tautomerization between imine and enamine substructures. ESI-MS/MS analysis of the T-6 trypsin-digested fragments of TEM-1 and SHV-1 demonstrated that the penems were only attached to Ser-70 of these class A beta-lactamases and that the penem ring structures were rearranged to seven-membered dihydro[1,4]thiazepines. PMID:15214794

  10. Structure-Based Design of Potent and Ligand-Efficient Inhibitors of CTX-M Class A [beta]-Lactamase

    SciTech Connect

    Nichols, Derek A.; Jaishankar, Priyadarshini; Larson, Wayne; Smith, Emmanuel; Liu, Guoqing; Beyrouthy, Racha; Bonnet, Richard; Renslo, Adam R.; Chen, Yu

    2012-07-11

    The emergence of CTX-M class A extended-spectrum {beta}-lactamases poses a serious health threat to the public. We have applied structure-based design to improve the potency of a novel noncovalent tetrazole-containing CTX-M inhibitor (K{sub i} = 21 {mu}M) more than 200-fold via structural modifications targeting two binding hot spots, a hydrophobic shelf formed by Pro167 and a polar site anchored by Asp240. Functional groups contacting each binding hot spot independently in initial designs were later combined to produce analogues with submicromolar potencies, including 6-trifluoromethyl-3H-benzoimidazole-4-carboxylic acid [3-(1H-tetrazol-5-yl)-phenyl]-amide, which had a K{sub i} value of 89 nM and reduced the MIC of cefotaxime by 64-fold in CTX-M-9 expressing Escherichia coli. The in vitro potency gains were accompanied by improvements in ligand efficiency (from 0.30 to 0.39) and LipE (from 1.37 to 3.86). These new analogues represent the first nM-affinity noncovalent inhibitors of a class A {beta}-lactamase. Their complex crystal structures provide valuable information about ligand binding for future inhibitor design.

  11. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides.

    PubMed

    Doi, Yohei; Arakawa, Yoshichika

    2007-07-01

    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  12. Metallo-beta-lactamase-producing gram-negative bacilli: laboratory-based surveillance in cooperation with 13 clinical laboratories in the Kinki region of Japan.

    PubMed

    Nishio, Hisaaki; Komatsu, Masaru; Shibata, Naohiro; Shimakawa, Kouichi; Sueyoshi, Noriyuki; Ura, Toshiro; Satoh, Kaori; Toyokawa, Masahiro; Nakamura, Tatsuya; Wada, Yasunao; Orita, Tamaki; Kofuku, Tomomi; Yamasaki, Katsutoshi; Sakamoto, Masako; Kinoshita, Shohiro; Aihara, Masanori; Arakawa, Yoshichika

    2004-11-01

    A total of 19,753 strains of gram-negative rods collected during two 6-month periods (October 2000 to March 2001 and November 2001 to April 2002) from 13 clinical laboratories in the Kinki region of Japan were investigated for the production of metallo-beta-lactamases (MBLs). MBLs were detected in 96 (0.5%) of the 19,753 isolates by the broth microdilution method, the 2-mercaptopropionic acid inhibition test, and PCR and DNA sequencing analyses. MBL-positive isolates were detected in 9 of 13 laboratories, with the rate of detection ranging between 0 and 2.6% for each laboratory. Forty-four of 1,429 (3.1%) Serratia marcescens, 22 of 6,198 (0.4%) Pseudomonas aeruginosa, 21 of 1,108 (1.9%) Acinetobacter spp., 4 of 544 (0.7%) Citrobacter freundii, 3 of 127 (2.4%) Providencia rettgeri, 1 of 434 (0.2%) Morganella morganii, and 1 of 1,483 (0.1%) Enterobacter cloacae isolates were positive for MBLs. Of these 96 MBL-positive strains, 87 (90.6%), 7 (7.3%), and 2 (2.1%) isolates carried the genes for IMP-1-group MBLs, IMP-2-group MBLs, and VIM-2-group MBLs, respectively. The class 1 integrase gene, intI1, was detected in all MBL-positive strains, and the aac (6')-Ib gene was detected in 37 (38.5%) isolates. Strains with identical PCR fingerprint profiles in a random amplified polymorphic DNA pattern analysis were isolated successively from five separate hospitals, suggesting the nosocomial spread of the organism in each hospital. In conclusion, many species of MBL-positive gram-negative rods are distributed widely in different hospitals in the Kinki region of Japan. The present findings should be considered during the development of policies and strategies to prevent the emergence and further spread of MBL-producing bacteria. PMID:15528723

  13. Bacterial cheating limits antibiotic resistance

    NASA Astrophysics Data System (ADS)

    Xiao Chao, Hui; Yurtsev, Eugene; Datta, Manoshi; Artemova, Tanya; Gore, Jeff

    2012-02-01

    The widespread use of antibiotics has led to the evolution of resistance in bacteria. Bacteria can gain resistance to the antibiotic ampicillin by acquiring a plasmid carrying the gene beta-lactamase, which inactivates the antibiotic. This inactivation may represent a cooperative behavior, as the entire bacterial population benefits from removing the antibiotic. The cooperative nature of this growth suggests that a cheater strain---which does not contribute to breaking down the antibiotic---may be able to take advantage of cells cooperatively inactivating the antibiotic. Here we find experimentally that a ``sensitive'' bacterial strain lacking the plasmid conferring resistance can invade a population of resistant bacteria, even in antibiotic concentrations that should kill the sensitive strain. We observe stable coexistence between the two strains and find that a simple model successfully explains the behavior as a function of antibiotic concentration and cell density. We anticipate that our results will provide insight into the evolutionary origin of phenotypic diversity and cooperative behaviors.

  14. Ceftriaxone-sulbactam combination in rabbit endocarditis caused by a strain of Klebsiella pneumoniae producing extended-broad-spectrum TEM-3 beta-lactamase.

    PubMed

    Caron, F; Gutmann, L; Bure, A; Pangon, B; Vallois, J M; Pechinot, A; Carbon, C

    1990-11-01

    We studied the activity of the combination of sulbactam and ceftriaxone against a Klebsiella pneumoniae strain producing TEM-3, a new extended-broad-spectrum beta-lactamase, in an endocarditis model. In vitro, ceftriaxone was strongly inactivated in the presence of TEM-3 (MBC, 128 micrograms/ml with an inoculum of 5 x 10(5) CFU/ml). A marked inoculum effect was demonstrated with sulbactam: effective concentrations of inhibitor needed to reduce the MIC and MBC of ceftriaxone to similar levels increased from 1 microgram/ml in the presence of an inoculum of 5 x 10(5) CFU/ml to 20 micrograms/ml in the presence of an inoculum of 1 x 10(7) CFU/ml. In vivo, sulbactam given at 200 mg/kg of body weight every 12 h, a dosage higher than that previously reported to be effective against rabbit endocarditis caused by other microorganisms, was not sufficient to restore the complete activity of ceftriaxone given at 30 mg/kg once daily for 4 days. This insufficient activity may be correlated with the presence of a high level of beta-lactamase inside the vegetations, as indicated by a quantitative in vitro assay of beta-lactamase activity in the cardiac vegetation, suggesting an insufficient inactivation of the extended-broad-spectrum beta-lactamase in vivo. PMID:2073099

  15. Empiric Piperacillin-Tazobactam versus Carbapenems in the Treatment of Bacteraemia Due to Extended-Spectrum Beta-Lactamase-Producing Enterobacteriaceae

    PubMed Central

    Harris, Patrick N. A.; De, Partha P.; Chow, Angela; Tambyah, Paul A.; Lye, David C.

    2016-01-01

    Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae are a common cause of bacteraemia in endemic countries and may be associated with high mortality; carbapenems are considered the drug of choice. Limited data suggest piperacillin-tazobactam could be equally effective. We aimed to compare 30-day mortality of patients treated empirically with piperacillin-tazobactam versus a carbapenem in a multi-centre retrospective cohort study in Singapore. Only patients with active empiric monotherapy with piperacillin-tazobactam or a carbapenem were included. A propensity score for empiric carbapenem therapy was derived and an adjusted multivariate analysis of mortality was conducted. A total of 394 patients had ESBL-Escherichia.coli and ESBL-Klebsiella pneumoniae bacteraemia of which 23.1% were community acquired cases. One hundred and fifty-one received initial active monotherapy comprising piperacillin-tazobactam (n = 94) or a carbapenem (n = 57). Patients who received carbapenems were less likely to have health-care associated risk factors and have an unknown source of bacteraemia, but were more likely to have a urinary source. Thirty-day mortality was comparable between those who received empiric piperacillin-tazobactam and a carbapenem (29 [30.9%] vs. 17 [29.8%]), P = 0.89). Those who received empiric piperacillin-tazobactam had a lower 30-day acquisition of multi-drug resistant and fungal infections (7 [7.4%] vs. 14 [24.6%]), P<0.01). After adjusting for confounders, use of empiric piperacillin-tazobactam was not associated with increased 30-day mortality (OR 1.00, 95% CI; 0.45–2.17). Empiric piperacillin-tazobactam was not associated with increased 30-day mortality and may result in fewer multi-drug resistant and fungal infections when compared with a carbapenem. PMID:27104951

  16. Prevalence of CTX-M extended-spectrum beta-lactamases and sequence type 131 in Korean blood, urine, and rectal Escherichia coli isolates.

    PubMed

    Graham, Sarah E; Zhang, Lixin; Ali, Ihsan; Cho, Yong Kyun; Ismail, Miriam D; Carlson, Heather A; Foxman, Betsy

    2016-07-01

    A high proportion of extended-spectrum beta-lactamase (ESBL) producing Escherichia coli are of the ST131 lineage, but there are few estimates of ST131 prevalence among ESBL-negative E. coli. Without this information, it is difficult to evaluate the contribution of the ST131 lineage to the emergence and spread of ESBL E. coli. A total of 1658 E. coli isolates were collected at Gachon University Gil Medical Center in Korea from 2006 to 2008. The antibiotic resistance profile was determined for all isolates, and ESBL-positive isolates were screened for the presence of CTX-M-type ESBLs. All ESBL-positive (n=84) and a representative sample of ESBL-negative (n=100) isolates were screened for O25b-ST131 using a PCR-based assay. The isolates were further classified on the basis of fumC and fimH types, which allowed for a comparison of the two typing methods. 5.7% of isolates were ESBL-positive, 87% of which contained CTX-M-type ESBLs. There was no significant difference in the prevalence of ST131 between ESBL-positive and -negative groups; 14% of ESBL-positive isolates and 9% of tested ESBL-negative isolates were ST131 by CH-typing. ST131-positive isolates harbored CTX-M-1-group ESBLs (including CTX-M-15) more frequently than other CTX-M types, and exhibited greater levels of antibiotic resistance than non-ST131 isolates. Furthermore, a number of isolates identified as O25b-ST131 by PCR corresponded to non-ST131 sequence types by CH-typing, emphasizing the need to consider the testing method when comparing reported prevalences of ST131. PMID:27101781

  17. Detection of Multi-drug Resistant Acinetobacter Lwoffii Isolated from Soil of Mink Farm.

    PubMed

    Sun, Na; Wen, Yong Jun; Zhang, Shu Qin; Zhu, Hong Wei; Guo, Li; Wang, Feng Xue; Chen, Qiang; Ma, Hong Xia; Cheng, Shi Peng

    2016-07-01

    There were 4 Acinetobacter lwoffii obtained from soil samples. The antimicrobial susceptibility of the strains to 16 antimicrobial agents was investigated using K-B method. Three isolates showed the multi-drug resistance. The presence of resistance genes and integrons was determined using PCR. The aadA1, aac(3')-IIc, aph(3')-VII, aac(6')-Ib, sul2, cat2, floR, and tet(K) genes were detected, respectively. Three class 1 integrons were obtained. The arr-3-aacA4 and blaPSE-1 gene cassette, which cause resistance to aminoglycoside and beta-lactamase antibiotics. Our results reported the detection of multi-drug resistant and carried resistant genes Acinetobacter lwoffii from soil. The findings suggested that we should pay close attention to the prevalence of multi-drug resistant bacterial species of environment. PMID:27554122

  18. Resistance gene capture.

    PubMed

    Rowe-Magnus, D A; Mazel, D

    1999-10-01

    Integrons are the primary mechanism for antibiotic-resistance gene capture and dissemination among Gram-negative bacteria. The recent finding of super-integron structures in the genomes of several bacterial species has expanded their role in genome evolution and suggests that they are the source of mobile multi-resistant integrons. PMID:10508722

  19. Metallo-beta-lactamases in clinical Pseudomonas isolates in Taiwan and identification of VIM-3, a novel variant of the VIM-2 enzyme.

    PubMed

    Yan, J J; Hsueh, P R; Ko, W C; Luh, K T; Tsai, S H; Wu, H M; Wu, J J

    2001-08-01

    A total of 209 clinical isolates of Pseudomonas (193 Pseudomonas aeruginosa, 10 P. putida, 4 P. stutzeri, and 2 P. fluorescens isolates) with reduced susceptibilities to imipenem and/or ceftazidime were subjected to PCR assays with primers specific for bla(IMP-1), bla(IMP-2), bla(VIM-1), and bla(VIM-2) and sequence analysis to identify the metallo-beta-lactamases (MBLs) prevalent among these organisms in Taiwan; and 21 isolates gave positive results. Five isolates including two P. putida and three P. stutzeri isolates were found to carry bla(IMP-1), and six isolates including five P. putida and one P. stutzeri isolates harbored bla(VIM-2). The remaining 10 isolates were P. aeruginosa, and all were found to carry a novel variant of bla(VIM-2), designated bla(VIM-3). There are only two nucleotide differences between bla(VIM-2) and bla(VIM-3), leading to two amino acid alterations. Our findings indicate that VIM-2 and its variant have become the most prevalent metalloenzymes in Pseudomonas in Taiwan. Southern hybridization with the bla(VIM-2)-, bla(VIM-3)-, and bla(IMP-1 )-specific probes revealed that only two VIM-2-producing P. putida isolates appeared to carry the MBL gene on plasmids. Pulsed-field gel electrophoresis showed that six VIM-3-producing P. aeruginosa isolates and two IMP-1-producing P. stutzeri isolates were genetically related, suggesting that the spread of these MBL genes in Taiwan could be due to clonal dissemination as well as genetic exchange between different clones. PMID:11451678

  20. The technical aspects and clinical significance of detecting extended-spectrum beta-lactamase-producing Enterobacteriaceae at a tertiary-care hospital in Kuwait.

    PubMed

    Mokaddas, E M; Abdulla, A A; Shati, S; Rotimi, V O

    2008-08-01

    Extended-spectrum beta-lactamase (ESBL) production by Enterobacteriaceae is an emerging problem. This 3-year prospective study was undertaken to determine the prevalence of such enzymes among the clinically significant isolates of the Enterobacteriaceae family gathered from patients, and to evaluate the different techniques for their detection as well as their clinical significance. Members of the Enterobacteriaceae family isolated from blood, inhibited by the third-generation cephalosporins with minimum inhibitory concentrations (MICs) of < or =2 microg/ml and MIC < or =8 microg/ml and isolates from other sources inhibited by MIC < or =8 microg/ml were also investigated for ESBL production by VITEK2 and E test. Their clinical significance in septicemic patients was analyzed. Out of 3,215 isolates, 1018 (31.7%) were ESBL-producers by both VITEK2 and E test. Of these, 428 (42%) were Klebsiella pneumoniae and 376 (37.0%) were Escherichia coli with overall prevalence rates of 13.3% and 11.7%, respectively. There were a total of 184 septicemic patients infected by ESBL-producing Enterobacteriaceae out of which 134 (73%) needed modification of therapy; most (58%) of these patients were initially on third-generation cephalosporin therapy. A total of 58 (31.5%) patients were infected by ESBL-producing blood isolates which were inhibited by cefotaxime/ceftriaxone at MICs =8 microg/ml (within the susceptibility range). Resistance to both aminoglycosides and quinolones were significantly higher among ESBLproducing isolates compared to non-producers (P <0.05). This study highlights a high prevalence of ESBL-producing Enterobacteriaceae in a major tertiary teaching hospital in our country and demonstrates that almost a third of the ESBL-producing Enterobacteriaceae blood isolates would have been released as susceptible by routine susceptibility testing; a finding inimical to optimal therapeutic success. PMID:18676224

  1. Protection of Salmonella by ampicillin-resistant Escherichia coli in the presence of otherwise lethal drug concentrations.

    PubMed

    Perlin, Michael H; Clark, Denise R; McKenzie, Courtney; Patel, Himati; Jackson, Nikki; Kormanik, Cecile; Powell, Cayse; Bajorek, Alexander; Myers, David A; Dugatkin, Lee A; Atlas, Ronald M

    2009-11-01

    Microbial systems have become the preferred testing grounds for experimental work on the evolution of traits that benefit other group members. This work, based on conceptual and theoretical models of frequency-dependent selection within populations, has proven fruitful in terms of understanding the dynamics of group beneficial or 'public goods' traits within species. Here, we expand the scope of microbial work on the evolution of group-beneficial traits to the case of multi-species communities, particularly those that affect human health. We examined whether beta-lactamase-producing Escherichia coli could protect ampicillin-sensitive cohorts of other species, particularly species that could cause human disease. Both beta-lactamase-secreting E. coli and, surprisingly, those engineered to retain it, allowed for survival of a large number of ampicillin-sensitive cohorts of Salmonella enterica serovar Typhimurium, including both laboratory and clinical isolates. The Salmonella survivors, however, remained sensitive to ampicillin when re-plated onto solid medium and there was no evidence of gene transfer. Salmonella survival did not even require direct physical contact with the resistant E. coli. The observed phenomenon appears to involve increased release of beta-lactamase from the E. coli when present with S. enterica. Significantly, these findings imply that resistant E. coli, that are not themselves pathogenic, may be exploited, even when they are normally selfish with respect to other E. coli. Thus, Salmonella can gain protection against antibiotics from E. coli without gene transfer, a phenomenon not previously known. As a consequence, antibiotic-resistant E. coli can play a decisive role in the survival of a species that causes disease and may thereby interfere with successful treatment. PMID:19656787

  2. Genetic analysis of faropenem-resistant Enterococcus faecalis in urinary isolates.

    PubMed

    Hiraga, Noriyuki; Muratani, Tetsuro; Naito, Seiji; Matsumoto, Tetsuro

    2008-04-01

    We isolated faropenem-resistant Enterococcus faecalis in urine specimens and studied the mechanisms of resistance to faropenem in these isolates. Three mechanisms of penicillin resistance have been reported in E. faecalis; (1) beta-lactamase production, (2) overproduction of penicillin-binding protein (PBP) 4 or PBP5, and (3) decreasing affinities of penicillins for PBP4 by the occurrence of point mutations of the penicillin-binding domain. None of the E. faecalis isolates examined produced beta-lactamase or overproduced any PBPs, but the affinities of faropenem for PBP4 were decreased in faropenem-insensitive and -resistant strains. We found single amino acid substitutions at positions 475, 520 or 605 in PBP4 in the insensitive strains and two amino acid substitutions at positions 520 and 605 in PBP4 in the resistant strains by sequencing the entire pbp4 gene from each isolate. We conclude that development of resistance to faropenem in E. faecalis is due to decreasing affinities for PBP4 that are the result of the occurrence of one or two point mutations. PMID:18503200

  3. Ambler Class A Extended-Spectrum Beta-Lactamase-Producing Escherichia coli and Klebsiella spp. in Canadian Hospitals

    PubMed Central

    Mulvey, Michael R.; Bryce, Elizabeth; Boyd, David; Ofner-Agostini, Marianna; Christianson, Sara; Simor, Andrew E.; Paton, Shirley

    2004-01-01

    This report describes a study carried out to gain baseline information on the molecular characteristics of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli and Klebsiella spp. in Canada. A total of 29,323 E. coli and 5,156 Klebsiella sp. isolates were screened at 12 participating sites. Of these, 505 clinically significant, nonrepeat isolates displaying reduced susceptibility to the NCCLS-recommended beta-lactams were submitted to a central laboratory over a 1-year period ending on 30 September 2000. A total of 116 isolates were confirmed to be ESBL producers. PCR and sequence analysis revealed the presence of TEM-11 (n = 1), TEM-12 (n = 1), TEM-29 (n = 1), TEM-52 (n = 4), CTX-M-13 (n = 1), CTX-M-14 (n = 15), CTX-M-15 (n = 11), SHV-2 (n = 2), SHV-2a (n = 12), SHV-5 (n = 6), SHV-12 (n = 45), and SHV-30 (n = 2). Five novel beta-lactamases were identified and designated TEM-115 (n = 2), TEM-120 (n = 1), SHV-40 (n = 2), SHV-41 (n = 4), and SHV-42 (n = 1). In addition, no molecular mechanism was identified for five isolates displaying an ESBL phenotype. Macrorestriction analysis of all ESBL isolates was conducted, as was restriction fragment length polymorphism analysis of plasmids harboring ESBLs. Although a “clonal” distribution of isolates was observed at some individual sites, there was very little evidence suggesting intrahospital spread. In addition, examples of identical or closely related plasmids that were identified at geographically distinct sites across Canada are given. However, there was considerable diversity with respect to plasmid types observed. PMID:15047521

  4. Mutational analysis of the two zinc-binding sites of the Bacillus cereus 569/H/9 metallo-beta-lactamase.

    PubMed Central

    de Seny, Dominique; Prosperi-Meys, Christelle; Bebrone, Carine; Rossolini, Gian Maria; Page, Michael I; Noel, Philippe; Frère, Jean-Marie; Galleni, Moreno

    2002-01-01

    The metallo-beta-lactamase BcII from Bacillus cereus 569/H/9 possesses a binuclear zinc centre. The mono-zinc form of the enzyme displays an appreciably high activity, although full efficiency is observed for the di-zinc enzyme. In an attempt to assign the involvement of the different zinc ligands in the catalytic properties of BcII, individual substitutions of selected amino acids were generated. With the exception of His(116)-->Ser (H116S), C221A and C221S, the mono- and di-zinc forms of all the other mutants were poorly active. The activity of H116S decreases by a factor of 10 when compared with the wild type. The catalytic efficiency of C221A and C221S was zinc-dependent. The mono-zinc forms of these mutants exhibited a low activity, whereas the catalytic efficiency of their respective di-zinc forms was comparable with that of the wild type. Surprisingly, the zinc contents of the mutants and the wild-type BcII were similar. These data suggest that the affinity of the beta-lactamase for the metal was not affected by the substitution of the ligand. The pH-dependence of the H196S catalytic efficiency indicates that the zinc ions participate in the hydrolysis of the beta-lactam ring by acting as a Lewis acid. The zinc ions activate the catalytic water molecule, but also polarize the carbonyl bond of the beta-lactam ring and stabilize the development of a negative charge on the carbonyl oxygen of the tetrahedral reaction intermediate. Our studies also demonstrate that Asn(233) is not directly involved in the interaction with the substrates. PMID:11964169

  5. Pharmacokinetic studies and renal dehydropeptidase stability of the new beta-lactamase inhibitor BRL 42715 in animals.

    PubMed Central

    Coleman, K; Griffin, D R; Upshon, P A

    1991-01-01

    BRL 42715 is a novel, highly potent beta-lactamase inhibitor with good activity against a broad range of beta-lactamases, including the class I enzymes of Enterobacter and Citrobacter spp. (K. Coleman, D.R.J. Griffin, J.W.J. Page, and P.A. Upshon, Antimicrob. Agents Chemother. 33:1580-1587, 1989). The pharmacokinetics of BRL 42715 were studied following oral and parenteral administration in mice, rats, rabbits, beagle dogs, and cynomolgus monkeys. The elimination half-life (t1/2) of BRL 42715 following intravenous administration was 7 min in rats, 6.2 min in rabbits, 11 min in dogs, and 18 min in cynomolgus monkeys; and interspecies scaling indicated a t1/2 of 31 min in humans. Urinary recovery was 24 to 43% in the three species studied. A linear relationship was observed between the dose and the theoretical concentration in blood at time zero and between the dose and area under the concentration-time curve following intravenous administration to mice. Extravascular dosing in mice, rats, and dogs resulted in an increase in t1/2, suggesting a depot effect. BRL 42715 was absorbed in mice following an oral dose (bioavailability of 0.2), but was not absorbed in rats, dogs, or cynomolgus monkeys to any significant extent. The binding of BRL 42715 in serum was 27 to 38% in mouse, rat, and dog sera but was somewhat higher (68 to 70%) in primate and human sera. BRL 42715 was not readily hydrolyzed by the renal dehydropeptidase enzymes of any of the five species studied. PMID:1952842

  6. Outbreak of Extended-Spectrum Beta-Lactamase Producing Enterobacter cloacae with High MICs of Quaternary Ammonium Compounds in a Hematology Ward Associated with Contaminated Sinks

    PubMed Central

    Chapuis, Angélique; Amoureux, Lucie; Bador, Julien; Gavalas, Arthur; Siebor, Eliane; Chrétien, Marie-Lorraine; Caillot, Denis; Janin, Marion; de Curraize, Claire; Neuwirth, Catherine

    2016-01-01

    Objective: To investigate an outbreak of extended-spectrum beta-lactamase (ESBL) producing Enterobacter cloacae that occurred in the Hematology ward (24-bed unit) of the François Mitterrand University Hospital (Dijon, France) between January 2011 and December 2013. The outbreak involved 43 patients (10 infected and 33 colonized). Design: We performed environmental analysis to detect multiresistant E. cloacae for comparison with clinical isolates (genotyping by pulsed-field gel electrophoresis and MLST as well as ESBL-typing) and determined the MICs of the quaternary ammonium compounds (QACs) alkyldimethylbenzylammonium chloride (ADBAC) and didecyldimethylammonium chloride (DDAC). A bleach-based cleaning-disinfection program was implemented in December 2012 after mechanical removal of the biofilm in all sinks. Results: We have detected 17 ESBL-producing E. cloacae in patients sink drains, shower drains and medical sink drains. Sequencing of the bla genes performed on 60 strains recovered from patients and environment (n = 43 clinical and n = 17 environmental) revealed that bla CTX−M15 was predominant (37 isolates) followed by bla CTX−M9 plus bla SHV−12 (20 isolates). We observed a great diversity among the isolates: 14 pulsotypes (11 STs) in clinical isolates and 9 pulsotypes (7 STs) in environmental isolates. Six pulsotypes were identical between clinical and environmental isolates. MICs of the quaternary ammonium compounds widely used for disinfection were very high in clinical and environmental isolates. Immediately after the implementation of the disinfection program we noticed a substantial fall in cases number. Our findings demonstrate the role of drains as important reservoir of ESBL-producing E. cloacae and highlight the necessity to settle drains accessible to achieve correct cleaning as well as to use disinfectant with proved activity against nosocomial pathogens. PMID:27462306

  7. Resistance to methicillin of coagulase-negative staphylococci (CNS) isolated from bovine mastitis.

    PubMed

    Bochniarz, M; Wawron, W; Szczubial, M

    2013-01-01

    The aim of this study was to determine the mechanisms of staphylococcal resistance to methicillin. CNS (n = 100 isolates) were prepared from the mammary inflammatory secretions of 86 cows from farms located in the Lublin region. Methicillin-resistant isolates constituted 20.0% of all CNS. Staphylococcus sciuri (n=8) and Staphylococcus xylosus (n=6) were most abundant, followed by Staphylococcus chromogenes (n=3), Staphylococcus haemolyticus (n=2) and Staphylococcus warned (n=1). The mecA gene was found in 50.0% of MRCNS (10.0% of all CNS isolates) belonging to two species: S. sciuri and S. xylosus. All mecA-positive isolates contained the protein of low affinity to penicillin (penicillin-binding protein 2a - PBP2a). The enzyme hydrolysing the beta-lactam ring in antibiotics was detected in 40.0% of MRCNS; 10.0% of MRCNS isolates were characterised by the presence of the mecA gene and ability to produce beta-lactamase. The remaining 20.0% of MRCNS isolates showing phenotypic resistance to methicillin were mecA gene-negative and were not able to produce beta-lactamase. PMID:24597303

  8. Bacterial Cheating Limits the Evolution of Antibiotic Resistance

    NASA Astrophysics Data System (ADS)

    Yurtsev, Eugene; Xiao Chao, Hui; Datta, Manoshi; Artemova, Tatiana; Gore, Jeff

    2012-02-01

    The emergence of antibiotic resistance in bacteria is a significant health concern. Bacteria can gain resistance to the antibiotic ampicillin by acquiring a plasmid carrying the gene beta-lactamase, which inactivates the antibiotic. This inactivation may represent a cooperative behavior, as the entire bacterial population benefits from removal of the antibiotic. The presence of a cooperative mechanism of resistance suggests that a cheater strain - which does not contribute to breaking down the antibiotic - may be able to take advantage of resistant cells. We find experimentally that a ``sensitive'' bacterial strain lacking the plasmid conferring resistance can invade a population of resistant bacteria, even in antibiotic concentrations that should kill the sensitive strain. We use a simple model in conjunction with difference equations to explain the observed population dynamics as a function of cell density and antibiotic concentration. Our experimental difference equations resemble the logistic map, raising the possibility of oscillations or even chaotic dynamics.

  9. Regulation of the cadA cadmium resistance determinant of Staphylococcus aureus plasmid pI258.

    PubMed Central

    Yoon, K P; Misra, T K; Silver, S

    1991-01-01

    Regulation of the cadA cadmium and zinc resistance determinant of Staphylococcus aureus plasmid pI258 was demonstrated by using gene fusions and direct measurements of transcription. In growth experiments, cells harboring the intact cadA operon were induced with different cations and challenged by an inhibitory concentration of ZnCl2, a substrate of the CadA resistance system. Uninduced cells did not grow for 8 h after Zn2+ addition, whereas induced cells grew in the presence Zn2+. Cd2+ was a strong inducer, and Bi3+ and Pb2+ also induced well; Co2+ and Zn2+ were weak inducers. A translational beta-lactamase fusion to the cadA gene showed the same induction specificity as that seen with growth experiments with the intact cadA operon. A short beta-lactamase transcriptional fusion to the cadC gene also showed the same pattern of induction, establishing that the cadC gene was not involved in regulation. In Northern (RNA) blot hybridization experiments, a cadmium-inducible, 2.6-kb, operon-length transcript was detected. Primer extension experiments determined that Cd(2+)-inducible transcription of the cadA operon begins at nucleotides 676 and 677 of the published sequence (G. Nucifora, L. Chu, T. K. Misra, and S. Silver, Proc. Natl. Acad. Sci. USA 86: 3544-3548, 1989). Images FIG. 6 FIG. 7 PMID:1938960

  10. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli

    PubMed Central

    El Mahdy, Taghrid S.; Shibl, Atef M.

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried blaCTX-M-15, and two isolates carried blaCTX-M-14 gene. Two CTX-M-positive E. coli isolates carried blaCMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  11. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli.

    PubMed

    Al-Agamy, Mohamed H; El Mahdy, Taghrid S; Shibl, Atef M

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried bla CTX-M-15, and two isolates carried bla CTX-M-14 gene. Two CTX-M-positive E. coli isolates carried bla CMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  12. Predictors of effect of ampicillin-sulbactam against TEM-1 beta-lactamase-producing Escherichia coli in an in vitro dynamic model: enzyme activity versus MIC.

    PubMed Central

    Firsov, A A; Savarino, D; Ruble, M; Gilbert, D; Manzano, B; Medeiros, A A; Zinner, S H

    1996-01-01

    The clinical outcome in patients treated with ampicillin-sulbactam may not always be predictable by disc susceptibility testing or with the MIC as determined with a constant level (4 micrograms/ml) of the beta-lactamase inhibitor (MIC1). The enzyme activities (EA) and the MICs estimated at a constant ratio of ampicillin to sulbactam of 2:1 (MIC2) for 15 TEM-1 beta-lactamase-producing strains of Escherichia coli were examined as alternatives to MIC1 as predictors of the antibacterial effects of this combined drug as studied in an in vitro model which simulates ampicillin-sulbactam pharmacokinetic profiles observed in human peripheral tissues. Integral parameters describing the area under the bacterial count-time curve (AUBC), the area between the normal growth curve, and the killing curve of bacteria exposed to antibiotic (ABBC), and the second parameter expressed as a percentage of its maximal hypothetical value (ABBC/ABBCmax) were calculated. All three parameters correlated well with EA (AUBC, r = 0.93; ABBC, r = -0.88; ABBC/ABBCmax, r = -0.91) and with MIC2 (r = 0.94, -0.94, and -0.95, respectively) but not with MIC1. Both EA and MIC2 can be considered reliable predictors of the antibacterial effect of ampicillin-sulbactam in an in vitro model. These correlations suggest that in vitro kinetic-dynamic models might be useful to reexamine established susceptibility breakpoints obtained with data based on the MIC1 (MICs obtained with constant levels of beta-lactamase inhibitors). These data also suggest that quantitative determinations of bacterial beta-lactamase production and MICs based on the component concentration ratio observed in vivo might be useful predictors of the effect of ampicillin-sulbactam and other beta-lactam-inhibitor combinations. PMID:8851602

  13. Emergence of imipenem resistance in clinical Escherichia coli during therapy.

    PubMed

    Oteo, Jesús; Delgado-Iribarren, Alberto; Vega, Dolores; Bautista, Verónica; Rodríguez, María Cruz; Velasco, María; Saavedra, José María; Pérez-Vázquez, María; García-Cobos, Silvia; Martínez-Martínez, Luis; Campos, José

    2008-12-01

    The molecular epidemiology and the mechanisms of resistance of Escherichia coli isolated from two patients infected by imipenem-resistant strains are reported in this study. From one patient, three closely related consecutive isolates of E. coli were recovered; the first was carbapenem-susceptible but acquired imipenem resistance after treatment with ertapenem, and the third isolate was again imipenem-susceptible. An additional imipenem-resistant isolate was recovered from another patient who received imipenem. The genetic relatedness of the E. coli isolates was determined by pulsed-field gel electrophoresis (PFGE) after digestion with XbaI. Standard polymerase chain reaction (PCR) conditions were used to amplify several beta-lactamase genes coding for carbapenemases, extended-spectrum beta-lactamases (ESBLs) and plasmid-mediated AmpC; the E. coli ampC gene promoter was also amplified and sequenced. Primers OmpF-F/OmpF-R and OmpC-F/OmpC-R were used to amplify the ompF and ompC genes. The outer membrane protein (OMP) profiles were studied by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Imipenem-resistant E. coli isolates did not produce carbapenemases but lacked the two major OMPs OmpF and OmpC and had ampC promoter mutations; in addition, one of the imipenem-resistant isolates produced the CMY-2 cephalosporinase, whilst the other produced the new CTX-M-67 ESBL. Carbapenem resistance in this study was associated with lack of expression of OmpF and OmpC porins. Additional mechanisms of beta-lactam resistance, such as plasmid-mediated AmpC and ESBL production, were also found. Development of carbapenem resistance in a CTX-M-67-producing E. coli is first described in this study. PMID:18775649

  14. Involvement of a Novel Class C Beta-Lactamase in the Transglutaminase Mediated Cross-Linking Cascade of Streptomyces mobaraensis DSM 40847

    PubMed Central

    Zindel, Stephan; Ehret, Vera; Ehret, Marina; Hentschel, Madeleine; Witt, Samantha; Krämer, Andreas; Fiebig, David; Jüttner, Norbert; Fröls, Sabrina; Pfeifer, Felicitas; Fuchsbauer, Hans-Lothar

    2016-01-01

    Streptomyces mobaraensis DSM 40847 secretes transglutaminase that cross-links proteins via γ-glutamyl-ε-lysine isopeptide bonds. Characterized substrates are inhibitory proteins acting against various serine, cysteine and metalloproteases. In the present study, the bacterial secretome was examined to uncover additional transglutaminase substrates. Fractional ethanol precipitation of the exported proteins at various times of culture growth, electrophoresis of the precipitated proteins, and sequencing of a 39 kDa protein by mass spectrometry revealed the novel beta-lactamase Sml-1. As indicated by biotinylated probes, Sml-1, produced in E. coli, exhibits glutamine and lysine residues accessible for transglutaminase. The chromogenic cephalosporin analogue, nitrocefin, was hydrolyzed by Sml-1 with low velocity. The obtained Km and kcat values of the recombinant enzyme were 94.3±1.8 μM and 0.39±0.03 s-1, respectively. Penicillin G and ampicillin proved to be weak inhibitors of nitrocefin hydrolysis (Ki of 0.1 mM and 0.18 mM). Negligible influence of metals on β-lactamase activity ruled out that Sml-1 is a Zn2+-dependent class B beta-lactamase. Rather, sequence motifs such as SITK, YSN, and HDG forming the active core in a hypothetical structure may be typical for class C beta-lactamases. Based on the results, we assume that the novel transglutaminase substrate ensures undisturbed growth of aerial hyphae in Streptomyces mobaraensis by trapping and inactivating hostile beta-lactam antibiotics. PMID:26886195

  15. Crystal structures of the class D beta-lactamase OXA-13 in the native form and in complex with meropenem.

    PubMed

    Pernot, L; Frénois, F; Rybkine, T; L'Hermite, G; Petrella, S; Delettré, J; Jarlier, V; Collatz, E; Sougakoff, W

    2001-07-20

    The therapeutic problems posed by class D beta-lactamases, a family of serine enzymes that hydrolyse beta-lactam antibiotics following an acylation-deacylation mechanism, are increased by the very low level of sensitivity of these enzymes to beta-lactamase inhibitors. To gain structural and mechanistic insights to aid the design of new inhibitors, we have determined the crystal structure of OXA-13 from Pseudomonas aeruginosa in the apo form and in complex with the carbapenem meropenem. The native form consisted of a dimer displaying an overall organisation similar to that found in the closely related enzyme OXA-10. In the acyl-enzyme complex, the positioning of the antibiotic appeared to be ensured mainly by (i) the covalent acyl bond and (ii) a strong salt-bridge involving the carboxylate moiety of the drug. Comparison of the structures of OXA-13 in the apo form and in complex with meropenem revealed an unsuspected flexibility in the region of the essential serine 115 residue, with possible consequences for the catalytic properties of the enzyme. In the apo form, the Ser115 side-chain is oriented outside the active site, whereas the general base Lys70 adopts a conformation that seems to be incompatible with the activation of the catalytic water molecule required for the deacylation step. In the OXA-13:meropenem complex, a 3.5 A movement of the backbone of the 114-116 loop towards the side-chain of Lys70 was observed, which seems to be driven by a displacement of the neighbouring 91-104 loop and which results in the repositioning of the side-chain hydroxyl group of Ser115 toward the catalytic centre. Concomitantly, the side-chain of Lys70 is forced to curve in the direction of the deacylating water molecule, which is then strongly bound and activated by this residue. However, a distance of ca 5 A separates the catalytic water molecule from the acyl carbonyl group of meropenem, a structural feature that accounts for the inhibition of OXA-13 by this drug. Finally

  16. Cooperative Bacterial Growth Dynamics Predict the Evolution of Antibiotic Resistance

    NASA Astrophysics Data System (ADS)

    Artemova, Tatiana; Gerardin, Ylaine; Hsin-Jung Li, Sophia; Gore, Jeff

    2011-03-01

    Since the discovery of penicillin, antibiotics have been our primary weapon against bacterial infections. Unfortunately, bacteria can gain resistance to penicillin by acquiring the gene that encodes beta-lactamase, which inactivates the antibiotic. However, mutations in this gene are necessary to degrade the modern antibiotic cefotaxime. Understanding the conditions that favor the spread of these mutations is a challenge. Here we show that bacterial growth in beta-lactam antibiotics is cooperative and that the nature of this growth determines the conditions in which resistance evolves. Quantitative analysis of the growth dynamics predicts a peak in selection at very low antibiotic concentrations; competition between strains confirms this prediction. We also find significant selection at higher antibiotic concentrations, close to the minimum inhibitory concentrations of the strains. Our results argue that an understanding of the evolutionary forces that lead to antibiotic resistance requires a quantitative understanding of the evolution of cooperation in bacteria.

  17. Multidrug-resistant Enterobacteriaceae from indoor air of an urban wastewater treatment plant.

    PubMed

    Teixeira, Juliana V; Cecílio, Pedro; Gonçalves, Daniela; Vilar, Vítor J P; Pinto, Eugénia; Ferreira, Helena N

    2016-07-01

    Wastewater treatment plants (WWTPs) have been recognized as sources of bioaerosols that may act as vehicles for dissemination of pathogens and multidrug-resistant (MDR) bacteria. The occurrence of MDR Enterobacteriaceae in indoor air of an urban WWTP was investigated. A possible airborne contamination with extended-spectrum beta-lactamase (ESBL) and carbapenemase-producing Enterobacteriaceae was also explored. Fourteen of 39 Enterobacteriaceae isolates were MDR. These isolates were found at all sampling sites, mainly at the secondary sedimentation settings. The highest levels of resistance were detected in three different species: Enterobacter cloacae, Escherichia coli, and Citrobacter freundii. Furthermore, one of the airborne E. coli isolates was phenotypically characterized as an ESBL producer. Additionally, five isolates showed non-susceptibility to at least one carbapenem tested. The presence of genes encoding relevant beta-lactamase types in these ESBL-producing and carbapenem-resistant Enterobacteriaceae isolates was investigated by PCR. Results showed amplification for bla CTX-M and bla OXA. These findings are relevant both in terms of occupational/public health and of environmental dissemination of MDR bacteria. PMID:27260528

  18. Crystallographic structure of a phosphonate derivative of the Enterobacter cloacae P99 cephalosporinase: mechanistic interpretation of a beta-lactamase transition-state analog.

    PubMed

    Lobkovsky, E; Billings, E M; Moews, P C; Rahil, J; Pratt, R F; Knox, J R

    1994-06-01

    The crystal structure of a complex formed on reaction of the Enterobacter cloacae P99 cephalosporinase (beta-lactamase) with a phosphonate monoester inhibitor, m-carboxyphenyl [[N-[(p-iodophenyl)acetyl]amino]methyl]phosphonate, has been obtained at 2.3-A resolution. The structure shows that the inhibitor has phosphonylated the active site serine (Ser64) with loss of the m-carboxyphenol leaving group. The inhibitor is positioned in the active site in a way that can be interpreted in terms of a transition-state analog. The arylacetamido side chain is placed as anticipated from analogous beta-lactamoyl complexes of penicillin-recognizing enzymes, with the amino group hydrogen-bonded to the backbone carbonyl of Ser318 (of the B3 beta-strand) and to the amides of Gln120 and Asn152. There is support in the asymmetry of the hydrogen bonding of this side chain to the protein and in the 2-fold disorder of the benzyl group for the considerable breadth in substrate specificity exhibited by class C beta-lactamases. One phosphonyl oxygen atom is in the oxyanion hole, hydrogen-bonded to main-chain NH groups of Ser318 and Ser64, while the other oxygen is solvated, not within hydrogen-bonding distance of any amino acid side chain. The closest active site functional group to the solvated oxygen atom is the Tyr150 hydroxyl group (3.4A); Lys67 and Lys315 are quite distant (4.3 and 5.7 A, respectively). Rather, Tyr150 and Lys67 are more closely associated with Ser64O gamma (2.9 and 3.3 A). This arrangement is interpreted in terms of the transition state for breakdown of the tetrahedral intermediate in the deacylation step of catalysis, where the Tyr150 phenol seems the most likely general acid. Thus, Tyr150, as the phenoxide anion, would be the general base catalyst in acylation, as proposed by Oefner et al. [Nature (1990) 343, 284-288]. The structure is compared with that of a similar phosphonate derivative of a class A beta-lactamase [Chen et al. (1993) J. Mol. Biol. 234, 165

  19. Comparison of host response mechanisms evoked by extended spectrum beta lactamase (ESBL)- and non-ESBL-producing uropathogenic E. coli

    PubMed Central

    2013-01-01

    Background Infections caused by extended spectrum beta-lactamases (ESBL)-producing bacteria have been emerging worldwide and the majority of ESBL-producing E. coli strains are isolated from patients with urinary tracts infections. The purpose of this study was to compare the host-response mechanisms in human polymorphonucleated leukocytes (PMN) and renal epithelial cells when stimulated by ESBL- or non-ESBL-producing uropathogenic E. coli (UPEC) isolates. The host-pathogen interaction of these ESBL-producing strains in the urinary tract is not well studied. Results The ability of ESBL strains to evoke ROS-production from PMN cells was significantly higher than that of the non-ESBL strains. The growth of ESBL strains was slightly suppressed in the presence of PMN compared to non-ESBL strains after 30 min and 2 h, but the opposite was observed after 5 and 6 h. The number of migrating PMN was significantly higher in response to ESBL strains compared to non-ESBL strains. Stimulation of A498 cells with ESBL strains elicited lower production of IL-6 and IL-8 compared to non-ESBL strains. Conclusion Significant differences in host-response mechanisms were identified when host cells were stimulated by ESBL- or non-ESBL producing strains. The obtained results on the early interactions of ESBL-producing strains with the host immune system may provide valuable information for management of these infections. PMID:24059789

  20. Sequential necrotizing fasciitis caused by the monomicrobial pathogens Streptococcus equisimilis and extended-spectrum beta-lactamase-producing Escherichia coli.

    PubMed

    Endo, Akiko; Matsuoka, Ryosuke; Mizuno, Yasushi; Doi, Asako; Nishioka, Hiroaki

    2016-08-01

    Necrotizing fasciitis is a rapidly progressing bacterial infection of the superficial fascia and subcutaneous tissue that is associated with a high mortality rate and is caused by a single species of bacteria or polymicrobial organisms. Escherichia coli is rarely isolated from patients with monomicrobial disease. Further, there are few reports of extended-spectrum beta-lactamase (ESBL)-producing E. coli associated with necrotizing fasciitis. We report here our treatment of an 85-year-old man who was admitted because of necrotizing fasciitis of his right thigh. Streptococcus equisimilis was detected as a monomicrobial pathogen, and the infection was cured by amputation of the patient's right leg and the administration of antibiotics. However, 5 days after discontinuing antibiotic therapy, he developed necrotizing fasciitis on his right upper limb and died. ESBL-producing E. coli was the only bacterial species isolated from blood and skin cultures. This case demonstrates that ESBL-producing E. coli can cause monomicrobial necrotizing fasciitis, particularly during hospitalization and that a different bacterial species can cause disease shortly after a previous episode. PMID:26912298

  1. Prevalence and Risk Factors for Extended Spectrum Beta-Lactamase-Producing Uropathogens in Patients with Urinary Tract Infection

    PubMed Central

    Lee, Dong Sup; Lee, Chung Bum

    2010-01-01

    Purpose The aim of this study was to determine the prevalence and risk factors of extended spectrum beta-lactamase (ESBL)-producing microorganisms in urinary tract infection. Materials and Methods total of 2,312 patients older than 25 years and diagnosed from January 2007 to December 2009 as having urinary tract infection were studied. The prevalence of ESBL-producing microorganisms including Escherichia coli and the antimicrobial susceptibility of E. coli were examined. Univariate analyses were performed with gender, age, inpatient status, previous hospitalization, recent history of urinary catheterization, recent exposure to specific antibiotics, and past history of urogenital organ operation as risk factors for the emergence of ESBL-producing microorganisms. Then, multivariate analysis was performed with all significant variables. Results In outpatient urinary tract infection, the antimicrobial susceptibility of E. coli to each of the third-generation cephalosporins, cefotaxime, ceftazidime, and ceftriaxone, was 87.6%, 93.4%, and 87.7%, respectively, and the prevalence of ESBL-producing E. coli was 12.1%. In inpatient urinary tract infection, the susceptibility of E. coli was 78%, 84.5%, and 76.9%, respectively, and the prevalence was 23.1%. Conclusions The overall prevalence of ESBL-producing microorganism was 12.6% and the risk appeared to be increased in cases with a previous hospitalization, a recent history of urinary catheterization, inpatient status, cefaclor medication, cefminox administration, and female gender. PMID:20664784

  2. Clavulanic acid: a competitive inhibitor of beta-lactamases with novel anxiolytic-like activity and minimal side effects.

    PubMed

    Kim, Deog J; King, Jean A; Zuccarelli, Lisa; Ferris, Craig F; Koppel, Gary A; Snowdon, Charles T; Ahn, Chang H

    2009-08-01

    Clavulanic acid is a member of the beta lactam family of antibiotics with little or no intrinsic antibacterial activity of its own; instead, it is used to enhance the activity of antibiotics by blocking bacterial beta-lactamases. Because clavulanic acid by itself is very safe, orally active and shows good brain penetrance, we sought to determine if it had any potential as a psychotherapeutic. Clavulanic acid was a tested across three mammalian species, hamsters, rats and cotton-top tamarin monkeys in a series of behavioral assays designed to screen for anxiolytic activity. In addition, several studies were done in rodents to compare the behavioral profile of clavulanic acid to the commonly prescribed benzodiazepines, particularly with respect to their unwanted side effects of motor depression, amnesia and neuroendocrine dysregulation. Our findings show that clavulanic acid is a highly potent anxiolytic in rodents without altering motor activity in the open field test, normal learning and memory in the Morris water maze, or normal stress hormone release. Orally administered clavulanic acid significantly reduces measures of anxiety in male/female pairs of cotton-top tamarins. In addition, male tamarins showed a highly significant increase in sexual arousal as measured by the number of penile erections. The fact clavulanic acid has anxiolytic activity in the tamarin holds the promise that this drug may be an effective therapeutic for the treatment of anxiety disorders in humans. PMID:19394358

  3. Staphylococcus aureus ampicillin-resistant from the odontological clinic environment.

    PubMed

    Bernardo, Wagner Luis de Carvalho; Boriollo, Marcelo Fabiano Gomes; Gonçalves, Reginaldo Bruno; Höfling, José Francisco

    2005-01-01

    The aim of this research was to evaluate the prevalence of Staphylococcus spp. and S. aureus in the odontological clinic environment (air), their production of beta-lactamase and antibacterial susceptibility to the major antibiotics utilized in medical particle. During 12 months of samples collect were isolated 9775 CFU by MSA medium suggesting a high amount of Staphylococcus spp. in the clinic environment which can appear through aerosols. A total of 3149 colonies (32.2%) were suggestive of pathogenic staphylococci. Gram coloration, catalase test, colony-mallow growing on chromogenic medium, and coagulase test confirmed the identity of 44 (0.45%) S. aureus isolates. Of these, 35 isolates (79.5%) showed production of beta-lactamase by Cefinase discs and resistance to ampicillin, erythromycin (7 isolates) and tetracycline (1 isolate) suggesting the existence of multiresistant isolates. The evaluation of the oxacillin MIC by Etest assays showed susceptibility patterns suggesting the inexistence of the mecA gene in chromosomal DNA. These results point out to the need of a larger knowledge on the contamination means and propagation of this microorganism into the odontological clinic. PMID:15729470

  4. Genetic Characterization of Carbapenem-Resistant Enterobacteriaceae and the Spread of Carbapenem-Resistant Klebsiella pneumonia ST340 at a University Hospital in Thailand.

    PubMed

    Netikul, Thidarat; Kiratisin, Pattarachai

    2015-01-01

    Carbapenem-resistant Enterobacteriaceae (CRE) has increasingly spread worldwide in the past decade. The prevalence and characteristics of CRE in Thailand are unknown. In this study, we conducted a 2-year surveillance of CRE among 12,741 clinical isolates of Enterobacteriaceae at the largest university hospital in Thailand with molecular characterization of beta-lactamase (bla) genes, including carbapenemase genes. The CRE prevalence was 1.4%. blaKPC-13 and blaIMP-14a were the only carbapenemase genes detected among these CRE isolates. blaKPC-13 gene was found in a single isolate of Escherichia coli, Enterobacter cloacae and Citrobacter freundii, and blaIMP-14a was found in four isolates of Klebsiella pneumoniae. Carbapenem-resistant K. pneumoniae (CRKP) isolates were resistant to multiple carbapenems at a higher ratio than other CRE species, and thus were further characterized for resistance phenotypes, bla genotypes and molecular epidemiology. Most CRKP isolates harboured multiple bla genes, especially those related to extended-spectrum beta-lactamases. Seven CRKP isolates were resistant to all tested carbapenems, and showed decreased ompK35 and/or ompK36 porin gene expression. Molecular typing of CRKP based on pulsed-field gel electrophoresis (PFGE) demonstrated several unrelated clones. Multilocus sequence typing (MLST) was partially concordant with PFGE results and revealed that ST340, a member of drug-resistant K. pneumoniae clonal complex 258, was the most predominant clone, followed by ST48, ST11 and ST273. The novel ST1645 was identified from this study. ST340 has neither been shown to be predominated among CRKP from other studies, nor been reported in Thailand. Therefore, it emphases a critical concern to monitor and control the spread of CRKP. PMID:26407326

  5. Genetic Characterization of Carbapenem-Resistant Enterobacteriaceae and the Spread of Carbapenem-Resistant Klebsiella pneumonia ST340 at a University Hospital in Thailand

    PubMed Central

    Netikul, Thidarat; Kiratisin, Pattarachai

    2015-01-01

    Carbapenem-resistant Enterobacteriaceae (CRE) has increasingly spread worldwide in the past decade. The prevalence and characteristics of CRE in Thailand are unknown. In this study, we conducted a 2-year surveillance of CRE among 12,741 clinical isolates of Enterobacteriaceae at the largest university hospital in Thailand with molecular characterization of beta-lactamase (bla) genes, including carbapenemase genes. The CRE prevalence was 1.4%. blaKPC-13 and blaIMP-14a were the only carbapenemase genes detected among these CRE isolates. blaKPC-13 gene was found in a single isolate of Escherichia coli, Enterobacter cloacae and Citrobacter freundii, and blaIMP-14a was found in four isolates of Klebsiella pneumoniae. Carbapenem-resistant K. pneumoniae (CRKP) isolates were resistant to multiple carbapenems at a higher ratio than other CRE species, and thus were further characterized for resistance phenotypes, bla genotypes and molecular epidemiology. Most CRKP isolates harboured multiple bla genes, especially those related to extended-spectrum beta-lactamases. Seven CRKP isolates were resistant to all tested carbapenems, and showed decreased ompK35 and/or ompK36 porin gene expression. Molecular typing of CRKP based on pulsed-field gel electrophoresis (PFGE) demonstrated several unrelated clones. Multilocus sequence typing (MLST) was partially concordant with PFGE results and revealed that ST340, a member of drug-resistant K. pneumoniae clonal complex 258, was the most predominant clone, followed by ST48, ST11 and ST273. The novel ST1645 was identified from this study. ST340 has neither been shown to be predominated among CRKP from other studies, nor been reported in Thailand. Therefore, it emphases a critical concern to monitor and control the spread of CRKP. PMID:26407326

  6. Plasmid-Mediated Resistance to Cephalosporins and Fluoroquinolones in Various Escherichia coli Sequence Types Isolated from Rooks Wintering in Europe

    PubMed Central

    Dolejska, Monika; Vojtech, Jiri; Guenther, Sebastian; Uricariu, Raluca; Drozdowska, Joanna; Papousek, Ivo; Pasekova, Katerina; Meissner, Wlodzimierz; Hordowski, Jozef; Cizek, Alois; Literak, Ivan

    2014-01-01

    Extended-spectrum-beta-lactamase (ESBL)-producing, AmpC beta-lactamase-producing, and plasmid-mediated quinolone resistance (PMQR) gene-positive strains of Escherichia coli were investigated in wintering rooks (Corvus frugilegus) from eight European countries. Fecal samples (n = 1,073) from rooks wintering in the Czech Republic, France, Germany, Italy, Poland, Serbia, Spain, and Switzerland were examined. Resistant isolates obtained from selective cultivation were screened for ESBL, AmpC, and PMQR genes by PCR and sequencing. Pulsed-field gel electrophoresis and multilocus sequence typing were performed to reveal their clonal relatedness. In total, from the 1,073 samples, 152 (14%) cefotaxime-resistant E. coli isolates and 355 (33%) E. coli isolates with reduced susceptibility to ciprofloxacin were found. Eighty-two (54%) of these cefotaxime-resistant E. coli isolates carried the following ESBL genes: blaCTX-M-1 (n = 39 isolates), blaCTX-M-15 (n = 25), blaCTX-M-24 (n = 4), blaTEM-52 (n = 4), blaCTX-M-14 (n = 2), blaCTX-M-55 (n = 2), blaSHV-12 (n = 2), blaCTX-M-8 (n = 1), blaCTX-M-25 (n = 1), blaCTX-M-28 (n = 1), and an unspecified gene (n = 1). Forty-seven (31%) cefotaxime-resistant E. coli isolates carried the blaCMY-2 AmpC beta-lactamase gene. Sixty-two (17%) of the E. coli isolates with reduced susceptibility to ciprofloxacin were positive for the PMQR genes qnrS1 (n = 54), qnrB19 (n = 4), qnrS1 and qnrB19 (n = 2), qnrS2 (n = 1), and aac(6′)-Ib-cr (n = 1). Eleven isolates from the Czech Republic (n = 8) and Serbia (n = 3) were identified to be CTX-M-15-producing E. coli clone B2-O25b-ST131 isolates. Ninety-one different sequence types (STs) among 191 ESBL-producing, AmpC-producing, and PMQR gene-positive E. coli isolates were determined, with ST58 (n = 15), ST10 (n = 14), and ST131 (n = 12) predominating. The widespread occurrence of highly diverse ESBL- and AmpC-producing and PMQR gene-positive E. coli isolates, including the clinically important

  7. Plasmid-mediated resistance to cephalosporins and fluoroquinolones in various Escherichia coli sequence types isolated from rooks wintering in Europe.

    PubMed

    Jamborova, Ivana; Dolejska, Monika; Vojtech, Jiri; Guenther, Sebastian; Uricariu, Raluca; Drozdowska, Joanna; Papousek, Ivo; Pasekova, Katerina; Meissner, Wlodzimierz; Hordowski, Jozef; Cizek, Alois; Literak, Ivan

    2015-01-01

    Extended-spectrum-beta-lactamase (ESBL)-producing, AmpC beta-lactamase-producing, and plasmid-mediated quinolone resistance (PMQR) gene-positive strains of Escherichia coli were investigated in wintering rooks (Corvus frugilegus) from eight European countries. Fecal samples (n = 1,073) from rooks wintering in the Czech Republic, France, Germany, Italy, Poland, Serbia, Spain, and Switzerland were examined. Resistant isolates obtained from selective cultivation were screened for ESBL, AmpC, and PMQR genes by PCR and sequencing. Pulsed-field gel electrophoresis and multilocus sequence typing were performed to reveal their clonal relatedness. In total, from the 1,073 samples, 152 (14%) cefotaxime-resistant E. coli isolates and 355 (33%) E. coli isolates with reduced susceptibility to ciprofloxacin were found. Eighty-two (54%) of these cefotaxime-resistant E. coli isolates carried the following ESBL genes: blaCTX-M-1 (n = 39 isolates), blaCTX-M-15 (n = 25), blaCTX-M-24 (n = 4), blaTEM-52 (n = 4), blaCTX-M-14 (n = 2), blaCTX-M-55 (n = 2), blaSHV-12 (n = 2), blaCTX-M-8 (n = 1), blaCTX-M-25 (n = 1), blaCTX-M-28 (n = 1), and an unspecified gene (n = 1). Forty-seven (31%) cefotaxime-resistant E. coli isolates carried the blaCMY-2 AmpC beta-lactamase gene. Sixty-two (17%) of the E. coli isolates with reduced susceptibility to ciprofloxacin were positive for the PMQR genes qnrS1 (n = 54), qnrB19 (n = 4), qnrS1 and qnrB19 (n = 2), qnrS2 (n = 1), and aac(6')-Ib-cr (n = 1). Eleven isolates from the Czech Republic (n = 8) and Serbia (n = 3) were identified to be CTX-M-15-producing E. coli clone B2-O25b-ST131 isolates. Ninety-one different sequence types (STs) among 191 ESBL-producing, AmpC-producing, and PMQR gene-positive E. coli isolates were determined, with ST58 (n = 15), ST10 (n = 14), and ST131 (n = 12) predominating. The widespread occurrence of highly diverse ESBL- and AmpC-producing and PMQR gene-positive E. coli isolates, including the clinically important multiresistant

  8. Epidemiology of extended spectrum beta-lactamase E. coli (CTX-M-15) on a commercial dairy farm.

    PubMed

    Watson, Eamon; Jeckel, Sonja; Snow, Lucy; Stubbs, Rebecca; Teale, Chris; Wearing, Heather; Horton, Robert; Toszeghy, Monique; Tearne, Oliver; Ellis-Iversen, Joey; Coldham, Nick

    2012-01-27

    The epidemiology of an extended spectrum beta-lactamase Escherichia coli (CTX-M-15) was observed and described on a commercial dairy farm located in the United Kingdom. During 2008 longitudinal sampling of faecal pat samples from different cattle groups comprising milking and non-milking cows, calving cows, calves, and the environment was carried out. The proportion of CTX-M-15 E. coli positive samples was significantly (p<0.0.01) higher in milking cows (30.3%, CI(95%) 26.8; 33.8) than in the herd as a whole (17.0%, CI(95%) 14.9; 19.0). In 2008 95.6% of sampled calves tested positive for CTX-M-15 E. coli at two days of age. A more detailed investigation in 2009 revealed that cows and heifers were approximately eight times more likely to test positive in the 10 days after calving than the 9 days before (OR 7.6, CI(95%) 2.32; 24.9). The CTX-M15 E. coli was also readily isolated from the immediate calving pen environment, including the water troughs. A cyclic pattern was apparent where cows immediately after calving and as high yielders were highly positive, but where the prevalence decreased during the dry period. The increased prevalence of the CTX-M-15 E. coli in certain cattle groups and farm environments including calving pens suggested that husbandry, antimicrobial usage and hygiene may play a significant role on a farm with regards to the epidemiology of CTX-M-15. This may offer a practical opportunity to reduce further dissemination through good practice and hygiene around calving. PMID:21840142

  9. Diversity of Escherichia coli strains producing extended-spectrum beta-lactamases in Spain: second nationwide study.

    PubMed

    Díaz, Miguel A; Hernández-Bello, José R; Rodríguez-Baño, Jesús; Martínez-Martínez, Luis; Calvo, Jorge; Blanco, Jorge; Pascual, Alvaro

    2010-08-01

    The prevalence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli (ESBLEC) in Spain increased 8-fold from 2000 to 2006. ESBL type, clonal relationship, antimicrobial susceptibility, and clinical data about infections caused by ESBLEC are evaluated in a second nationwide study developed in 2006. From 1008 clinical isolates obtained over 2 months from 44 hospitals, 254 were used for further analysis. ESBL production was evaluated by synergy testing, PCR, and sequencing. Antimicrobial activity was evaluated by microdilution. The clonal relationship was evaluated by repetitive extragenic palindromic-PCR (REP-PCR). The O25b subtype and the new afa operon FM955459 were determined by triplex PCR in isolates producing CTX-M-15. Multilocus sequence typing was performed on these isolates. A total of 72% of all ESBLs were of the CTX-M type, 26.8% were of the SHV type, and 1.2% were of the TEM type. The most prevalent ESBLs were CTX-M-14 (119 isolates), SHV-12 (68 isolates), CTX-M-15 (37 isolates), and CTX-M-9 (21 isolates). By REP-PCR, 214 clones were detected. All but five CTX-M-15 ESBLEC isolates corresponded to the international O25b/ST131 clone. This clone had not been detected in the first study (published in 2000). Epidemiological and clinical features were studied in 304 representative patients. A total of 60% of the patients were older than 60 and had nonfatal underlying diseases, and 55% had recently received antibiotics. Urinary tract infections accounted for 71% of cases, and 9% were bacteremic. There has been a significant increase in the prevalence of ESBLEC in Spain, with most of these strains being CTX-M-producing isolates, including the pandemic O25b-ST131. SHV-12-producing E. coli remains an important cause of community-acquired infection. PMID:20519460

  10. Extended-Spectrum-Beta-Lactamase Producing Bacteria Related Urinary Tract Infection in Renal Transplant Recipients and Effect on Allograft Function

    PubMed Central

    Ramadas, Poornima; Rajendran, Prejith P.; Krishnan, Prathik; Alex, Asha; Siskind, Eric; Kadiyala, Aditya; Jayaschandran, Vivek; Basu, Amit; Bhaskaran, Madhu; Molmenti, Ernesto P.

    2014-01-01

    Background Urinary tract infection (UTI) is a well-recognized early complication in renal transplant recipients (RTR) and can have significant bearing on their outcome. The recent rise in incidence of extended spectrum beta lactamase (ESBL) producing bacteria causing UTI among RTR poses new and significant challenges in terms of management and outcome. Our aim is to analyze the effect of ESBL producing bacteria causing UTI in these patients and its impact on allograft function. Methods We reviewed the medical records of 147 RTR who were followed at a tertiary care hospital affiliated transplant center between January 2007 and May 2013 and noted five RTR who developed episodes of ESBL producing bacteria related UTI during follow up. Multiple patient characteristics including demographics, immunosuppression, recurrences, allograft function and outcome were analyzed. Results Five patients (3.4%) out of 147 had ESBL producing bacteria related UTI. We found all patients to be above 60 years of age, with three out of five being females, and all five patients had diabetes mellitus. We identified a total of 37 episodes of UTI among these five patients during this period. Two of these patients had elevated creatinine values during the episodes of UTI and three of them developed bacteremia. Of the five patients, four of them had a favorable outcome except for one patient who developed persistent allograft dysfunction. Conclusion RTR are at a higher risk for developing ESBL producing bacteria associated UTI. Early diagnosis along with appropriate and judicious use of antibiotics will ensure long term success in allograft and patient outcome. PMID:24637786

  11. Emergence of uropathogenic extended-spectrum beta lactamases-producing Escherichia coli strains in the community.

    PubMed

    Marijan, Tatjana; Vranes, Jasmina; Bedenić, Branka; Mlinarić-Dzepina, Ana; Plecko, Vanda; Kalenić, Smilja

    2007-03-01

    The aim of this study was to determine the virulence characteristics and resistance pattern of the extended-spectrum/lactamases (ESBLs)-producing Escherichia coli strains isolated from urine of outpatients in the Zagreb region during a five-month period, and to compare them with the non ESBLs-producing E. coli strains isolated in the same period. Out of 2451 E. coli strains isolated from urine of nonhospitalized patients with significant bacteriuria, a total of 39 ESBLs-producing strains (1.59%) were detected by a double-disk diffusion technique and by the broth-dilution minimal inhibitory concentration reduction method. The 45 non ESBLs-producing strains were randomly chosen, and phenotype of the two groups of strains was characterized and compared. Serogroup O4, hemolysin production, expression of P- and type 1 fimbriae as well as resistance to gentamicin and amikacin were significantly more prevalent characteristics among the ESBLs-producing strains than among non ESBLs-producing strains (p < 0.01), while higher prevalence of trimethoprim-sulfamethoxazole resistance among ESBLs-producing strains was not statistically significant (p > 0.05). Chromosomal DNA analysis by pulsed-field gel electrophoresis exhibited a great genomic similarity among ESBLs-producing strains and revealed that those highly virulent and resistant E. coli strains isolated from urine of outpatients in the Zagreb region had a clonal propagation. PMID:17598406

  12. Effects of CO2 and pH on inhibition of TEM-1 and other beta-lactamases by penicillanic acid sulfones.

    PubMed Central

    Livermore, D M; Corkill, J E

    1992-01-01

    Incubation in 5% CO2 reduced the inhibition zones of piperacillin-tazobactam (75/10 micrograms) disks for Escherichia coli strains with TEM-1, TEM-2, and SHV-1 beta-lactamases. Similarly, MICs of piperacillin-tazobactam and other penicillin-sulfone combinations for TEM producers were up to 500-fold higher at pH 6.5 than at pH 8.0. This effect was greatest for organisms with high levels of enzyme activity. CO2 and mild acidity did not affect the susceptibility of beta-lactamase-negative strains to penicillin-sulfone combinations, and the effects of these conditions were variable for organisms with beta-lactamases other than TEM-1, TEM-2, and SHV-1. These last observations discounted acid-mediated inactivation of piperacillin or tazobactam. MICs of amoxicillin or piperacillin alone or with clavulanate for TEM and SHV producers were affected only less than or equal to 16-fold by 5% CO2 or acidity, indicating that the greater effects seen with the penicillin-sulfone combinations depended on the behavior of the sulfones and not on that of the penicillins. This pH effect was studied in detail for TEM-1 enzyme. Inhibition of this enzyme by sulfones but not clavulanate varied grossly with pH, with 50% inhibitory concentrations of tazobactam and sulbactam up to 300-fold higher at pH 6.5 than at 8.0. By contrast, the hydrolytic activity of TEM-1 enzyme for substrates and its level of production varied threefold or less between pH 6.5 and pH 8.0. Increased inhibition at pH 8.0 reflected sequestration of the enzyme into a secondary noncovalent complex rather than increased irreversible inactivation. PMID:1329633

  13. Structural and Biochemical Evidence That a TEM-1 [beta]-Lactamase N170G Active Site Mutant Acts via Substrate-assisted Catalysis

    SciTech Connect

    Brown, Nicholas G.; Shanker, Sreejesh; Prasad, B.V. Venkataram; Palzkill, Timothy

    2010-03-12

    TEM-1 {beta}-lactamase is the most common plasmid-encoded {beta}-lactamase in Gram-negative bacteria and is a model class A enzyme. The active site of class A {beta}-lactamases share several conserved residues including Ser{sup 70}, Glu{sup 166}, and Asn{sub 170} that coordinate a hydrolytic water involved in deacylation. Unlike Ser{sup 70} and Glu{sup 166}, the functional significance of residue Asn{sup 170} is not well understood even though it forms hydrogen bonds with both Glu{sup 166} and the hydrolytic water. The goal of this study was to examine the importance of Asn{sup 170} for catalysis and substrate specificity of {beta}-lactam antibiotic hydrolysis. The codon for position 170 was randomized to create a library containing all 20 possible amino acids. The random library was introduced into Escherichia coli, and functional clones were selected on agar plates containing ampicillin. DNA sequencing of the functional clones revealed that only asparagine (wild type) and glycine at this position are consistent with wild-type function. The determination of kinetic parameters for several substrates revealed that the N170G mutant is very efficient at hydrolyzing substrates that contain a primary amine in the antibiotic R-group that would be close to the Asn{sup 170} side chain in the acyl-intermediate. In addition, the x-ray structure of the N170G enzyme indicated that the position of an active site water important for deacylation is altered compared with the wild-type enzyme. Taken together, the results suggest the N170G TEM-1 enzyme hydrolyzes ampicillin efficiently because of substrate-assisted catalysis where the primary amine of the ampicillin R-group positions the hydrolytic water and allows for efficient deacylation.

  14. Structure of GES-1 at Atomic Resolution: Insights Into the Evolution of Carbapenamase Activity in the Class a Extended-Spectrum Beta-Lactamases

    SciTech Connect

    Smith, C.A.; Caccamo, M.; Kantardjieff, K.A.; Vakulenko, S.; /Notre Dame U.

    2007-10-08

    The structure of the class A extended-spectrum {beta}-lactamase GES-1 from Klebsiella pneumoniae has been determined to 1.1 Angstrom resolution. GES-1 has the characteristic active-site disulfide bond of the carbapenemase family of {beta}-lactamases and has a structure that is very similar to those of other known carbapenemases, including NMC-A, SME-1 and KPC-2. Most residues implicated in the catalytic mechanism of this class of enzyme are present in the GES-1 active site, including Ser70, which forms a covalent bond with the carbonyl C atom of the {beta}-lactam ring of the substrate during the formation of an acyl-enzyme intermediate, Glu166, which is implicated as both the acylation and deacylation base, and Lys73, which is also implicated as the acylation base. A water molecule crucial to catalysis is observed in an identical location as in other class A {beta}-lactamases, interacting with the side chains of Ser70 and Glu166. One important residue, Asn170, also normally a ligand for the hydrolytic water, is missing from the GES-1 active site. This residue is a glycine in GES-1 and the enzyme is unable to hydrolyze imipenem. This points to this residue as being critically important in the hydrolysis of this class of {beta}-lactam substrate. This is further supported by flexible-docking studies of imipenem with in silico-generated Gly170Asn and Gly170Ser mutant GES-1 enzymes designed to mimic the active sites of imipenem-hydrolyzing point mutants GES-2 and GES-5.

  15. Unanticipated inhibition of the metallo-beta-lactamase from Bacteroides fragilis by 4-morpholineethanesulfonic acid (MES): a crystallographic study at 1.85-A resolution.

    PubMed

    Fitzgerald, P M; Wu, J K; Toney, J H

    1998-05-12

    As part of a structure-aided effort to design clinically useful inhibitors of metallo-beta-lactamases, the X-ray crystal structure of a complex between the metallo-beta-lactamase from Bacteroides fragilis and 4-morpholinoethanesulfonic acid (MES) has been determined and a model for the structure has been refined to a crystallographic R-factor of 0.151 for data between 10.0- and 1.85-A resolution. Although the binding of MES was an adventitious result of the use of MES as a buffer in the crystallization mixture, MES was subsequently shown to be a competitive inhibitor of the enzyme, with a Ki of 23 +/- 5 mM. MES binds in the same fashion to both of the molecules in the crystallographic asymmetric unit; both direct and solvent-mediated hydrogen bonds to the protein and to the binuclear zinc cluster are observed, involving the oxygens of the sulfonic acid group and the nitrogen of the morpholino ring. In addition, there are hydrophobic interactions between the morpholino ring and residues in the flexible beta-strand of the enzyme between residues 26 and 36. Comparison of this structure with the previously reported unliganded structures of the same enzyme [Concha, N. O., Rasmussen, B. A., Bush, K., and Herzberg, O. (1996) Structure 4, 823-836; Carfi, A., Duée, E., Paul-Soto, R., Galleni, M., Frère, J. -M., and Dideberg, O. (1998) Acta Crystallogr. D54, 47-57] reveals that although the overall conservation of structure in the three different crystal lattices is very high, binding of MES is correlated with a significant change in the conformation of this beta-strand. The flexibility of this beta-strand will be an important consideration in the design of inhibitors of the metallo-beta-lactamases. PMID:9578564

  16. Comparison of the activity of imipenem and beta-lactams combined with sulbactam and clavulanic acid in beta-lactamase-producing strains of Bacteroides fragilis.

    PubMed

    Martín, M A; Castillo, A M; Liébana, J; Marín, A; Alados, J C; Piédrola, G

    1991-01-01

    We compared the "in vitro" activity of imipenem with 14 beta-lactams, both alone and in combination with clavulanic acid, and sulbactam against 110 beta-lactamase-producing strains of Bacteroides fragilis. The following antibiotics were tested: amoxycillin, penicillin, mezlocillin, piperacillin, cephalothin, cephazolin, cefamandole, cefmetazole, cefonicid, cefoxitin, cefotaxime, ceftazidime, ceftizoxime, and ceftriaxone. In all cases, except those of cefoxitin and cefmetazole, these combinations showed a statistically significant increase in beta-lactam activity, which was, however, never higher than that of imipenem, the antibiotic which performed best against Bacteroides fragilis. PMID:1940333

  17. Chromophoric spin-labeled beta-lactam antibiotics for ENDOR structural characterization of reaction intermediates of class A and class C beta-lactamases.

    PubMed

    Mustafi, Devkumar; Hofer, Jennifer E; Huang, Wanzhi; Palzkill, Timothy; Makinen, Marvin W

    2004-05-01

    The chromophoric spin-label substrate 6-N-[3-(2,2,5,5-tetramethyl-1-oxypyrrolin-3-yl)-propen-2-oyl]penicillanic acid (SLPPEN) was synthesized by acylation of 6-aminopenicillanic acid with the acid chloride of 3-(2,2,5,5-tetramethyl-1-oxypyrrolinyl)-2-propenoic acid and characterized by physical methods. By application of angle-selected electron nuclear double resonance (ENDOR), we have determined the molecular structure of SLPPEN in solution. SLPPEN exhibited UV absorption properties that allowed accurate monitoring of the kinetics of its enzyme-catalyzed hydrolysis. The maximum value of the (substrate-product) difference extinction coefficient was 2824 M(-1) cm(-1) at 275 nm compared to 670 M(-1) cm(-1) at 232 nm for SLPEN [J. Am. Chem. Soc. 117 (1995) 6739]. For SLPPEN, the steady-state kinetic parameters kcat and kcat/KM, determined under initial velocity conditions, were 637 +/- 36 s(-1) and 13.8 +/- 1.4 x 10(6) M(-1) s(-1), respectively, for hydrolysis catalyzed by TEM-1 beta-lactamase of E. coli, and 0.5 +/- 0.04 s(-1) and 3.9 +/- 0.4 x 10(4) M(-1) s(-1) for hydrolysis catalyzed by the beta-lactamase of Enterobacter cloacae P99. We have also observed "burst kinetics" for the hydrolysis of SLPPEN with P99 beta-lactamase, indicative of formation of an acylenzyme reaction intermediate. In DMSO:H2O (30:70, v:v) cryosolvent mixtures buffered to pH* 7.0, the half-life of the acylenzyme intermediate formed with the P99 enzyme at -5 degrees C was > or = 3 min, suitable for optical characterization. The observation of burst kinetics in the hydrolysis of SLPPEN catalyzed by P99 beta-lactamase suggests that this chromophoric spin-labeled substrate is differentially sensitive to active site interactions underlying the cephalosporinase and penicillinase reactivity of this class C enzyme. PMID:15134725

  18. Clonal dissemination of highly virulent extended-spectrum beta-lactamase-producing Escherichia coli strains isolated from the urine of non-hospitalised patients in Zagreb region.

    PubMed

    Vranes, Jasmina; Marijan, Tatjana; Bedenic, Branka; Mlinaric-Dzepina, Ana; Katic, Stjepan; Kalenic, Smilja

    2008-02-01

    Recent data suggest that extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli is an emergent cause of urinary tract infections in non-hospitalised patients in different countries. The aim of this study was to characterise ESBL-producing E. coli strains isolated from the urine of outpatients in the Zagreb region of Croatia. During the 5-month study period, a total of 2451 E. coli strains were isolated from the urine of non-hospitalised patients with significant bacteriuria. A total of 39 ESBL-producing E. coli strains (1.59%) were collected and characterised. PMID:17936594

  19. PCR amplfication on a microarray of gel-immobilized oligonucleotides : detection of bacterial toxin- and drug-resistent genes and their mutations.

    SciTech Connect

    Strizhkov, B. N.; Drobyshev, A. L.; Mikhailovich, V. M.; Mirzabekov, A. D.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology

    2000-10-01

    PCR amplification on a microarray of gel-immobilized primers (microchip) has been developed. One of a pair of PCR primers was immobilized inside a separate microchip polyacrylamide porous gel pad of 0.1 x 0.1 x 0.02 (or 0.04) micron in size and 0.2 (or 0.4) nL in volume. The amplification was carried out simultaneously both in solution covering the microchip array and inside gel pads. Each gel pad contained the immobilized forward primers, while the fluorescently labeled reverse primers, as well as all components of the amplification reaction, diffused into the gel pads from the solution. To increase the amplification efficiency, the forward primers were also added into the solution. The kinetics of amplification was measured in real time in parallel for all gel pads with a fluorescent microscope equipped with a charge-coupled device (CCD) camera. The accuracy of the amplification was assessed by using the melting curves obtained for the duplexes formed by the labeled amplification product and the gel-immobilized primers during the amplification process; alternatively, the duplexes were produced by hybridization of the extended immobilized primers with labeled oligonucleotide probes. The on-chip amplification was applied to detect the anthrax toxin genes and the plasmid-borne beta-lactamase gene responsible for bacterial ampicillin resistance. The allele-specific type of PCR amplification was used to identify the Shiga toxin gene and discriminate it from the Shiga-like one. The genomic mutations responsible for rifampicin resistance of the Mycobacterium tuberculosis strains were detected by the same type of PCR amplification of the rpoB gene fragment isolated from sputum of tuberculosis patients. The on-chip PCR amplification has been shown to be a rapid, inexpensive and powerful tool to test genes responsible for bacterial toxin production and drug resistance, as well as to reveal point nucleotide mutations.

  20. [Investigation of plasmid-mediated quinolone resistance genes in quinolone-resistant Escherichia coli and Klebsiella spp. isolates from bloodstream infections].

    PubMed

    Buruk, Celal Kurtuluş; Öztel Ocak, Hikmet; Bayramoğlu, Gülçin; Aydın, Faruk

    2016-04-01

    One of the treatment options of Escherichia coli and Klebsiella spp. infections which are the most common opportunistic pathogens of gram-negative sepsis is quinolones. Resistance to quinolones which act by disrupting DNA synthesis has been increasing. Horizontal transfer of plasmid-mediated quinolone resistance (PMQR) genes play an important role in the spread of resistance. The data about the prevalence of PMQR genes in our country is quite limited. The aim of this study was to investigate the presence of known PMQR genes namely qnrA, qnrB, qnrC, qnrS, qnrD, aac(6')-Ib-cr, qepA and oqxAB amongst quinolone-resistant E. coli and Klebsiella spp. strains isolated from blood cultures. One hundred twenty seven E.coli and 66 Klebsiella isolates detected as nalidixic acid- and/or ciprofloxacin-resistant by phenotypical methods, from 193 blood samples of 187 patients admitted to Karadeniz Technical University, Faculty of Medicine, Department of Medical Microbiology, Bacteriology Unit of Patient Service Laboratory between January 2012 to August 2013 were included in the study. The presence of PMQR genes were investigated by polymerase chain reaction (PCR) and for the detection of aac(6')-Ib-cr variants PCR-restriction fragment length polymorphism (PCR-RFLP) method was used. The positive bands were sequenced using the same primers, and aligned with formerly defined resistance gene sequences, and confirmed. In the study, 56.7% (72/127) of E.coli and 19.7% (13/66) of Klebsiella spp. isolates, with a total of 44% (85/193) of all the isolates were found to be phenotypically resistant to quinolones. Of the 13 resistant Klebsiella isolates, 11 were K.pneumoniae, and two were K.oxytoca. Extended-spectrum beta-lactamase (ESBL)-producing isolates showed higher resistance (50/80, 62.5%) to quinolones than the negative ones (35/113, 30.9%). The prevalence of quinolone resistance genes among resistant E. coli and Klebsiella spp. isolates was determined as qnrA, 1.4% and 15.4%; qnrB, 4

  1. [Extended-spectrum beta-lactamase production by Enterobacteriaceae isolates from urine cultures of outpatients: results of a 7-year follow-up].

    PubMed

    Çelikbilek, Nevreste; Gözalan, Ayşegül; Özdem, Birsen; Kırca, Fisun; Açıkgöz, Ziya Cibali

    2015-04-01

    The aim of the study was to evaluate the change of the frequency of extended-spectrum beta-lactamase (ESBL) producing Enterobacteriaceae isolates from urine samples of outpatients in years and to analyse the antibiotic resistance profiles for a rational drug use. The urine samples cultured in our laboratory from the patients who were admitted to outpatient clinics of our hospital between years 2007-2013 were included in this study. Enterobacteriaceae strains were isolated and identified by conventional methods and API 20E system (BioMérieux, France). The standard antimicrobial susceptibility tests were performed by Kirby Bauer disk diffusion method. ESBL production were screened by double-disk synergy method according to CLSI guidelines. E-test method (BioMérieux, France) were used for the verification of suspicious ESBL production. The identification and antimicrobial susceptibility testing were performed for a total of 12.535 isolates. Of the isolates 8716 were identified as Escherichia coli (69.3%), 1514 were Klebsiella pneumoniae/oxytoca (12.1%), 257 were Proteus mirabilis (2.1%), 345 were other Enterobacteriae members (8%), 411 were various non-fermentative gram-negative bacteria (3.3%) and 1292 were various gram-positive bacteria (10.3%). The total positivity rate of ESBL was found as 21.8% (2.283/10.487), and the ESBL positive rates for E.coli, K.pneumoniae/oxytoca and P.mirabilis were 21.2%, 28.2% and 4.7%, respectively. Other Enterobacteriaceae isolates were not evaluated because of the absence of standardized methods and breakpoint values. There was no statistically significant difference among ESBL producing isolates within seven years (p= 0.364). The antibiotic resistance rates of the ESBL-positive isolates were statistically higher than ESBL-negative isolates [amoxicillin-clavulanate (73.1%/11.3%), trimethoprim-sulfamethoxazole (63.1%/31.0%), nitrofurantoin (17.3%/8.6%), gentamicin (42.2%/10.1%), amikacin (3.5%/0.9%), tobramisin (56

  2. Classification of Beta-Lactamases and Penicillin Binding Proteins Using Ligand-Centric Network Models

    PubMed Central

    Öztürk, Hakime; Ozkirimli, Elif; Özgür, Arzucan

    2015-01-01

    β-lactamase mediated antibiotic resistance is an important health issue and the discovery of new β-lactam type antibiotics or β-lactamase inhibitors is an area of intense research. Today, there are about a thousand β-lactamases due to the evolutionary pressure exerted by these ligands. While β-lactamases hydrolyse the β-lactam ring of antibiotics, rendering them ineffective, Penicillin-Binding Proteins (PBPs), which share high structural similarity with β-lactamases, also confer antibiotic resistance to their host organism by acquiring mutations that allow them to continue their participation in cell wall biosynthesis. In this paper, we propose a novel approach to include ligand sharing information for classifying and clustering β-lactamases and PBPs in an effort to elucidate the ligand induced evolution of these β-lactam binding proteins. We first present a detailed summary of the β-lactamase and PBP families in the Protein Data Bank, as well as the compounds they bind to. Then, we build two different types of networks in which the proteins are represented as nodes, and two proteins are connected by an edge with a weight that depends on the number of shared identical or similar ligands. These models are analyzed under three different edge weight settings, namely unweighted, weighted, and normalized weighted. A detailed comparison of these six networks showed that the use of ligand sharing information to cluster proteins resulted in modules comprising proteins with not only sequence similarity but also functional similarity. Consideration of ligand similarity highlighted some interactions that were not detected in the identical ligand network. Analysing the β-lactamases and PBPs using ligand-centric network models enabled the identification of novel relationships, suggesting that these models can be used to examine other protein families to obtain information on their ligand induced evolutionary paths. PMID:25689853

  3. Environmental microbiota represents a natural reservoir for dissemination of clinically relevant metallo-beta-lactamases.

    PubMed

    Scotta, Claudia; Juan, Carlos; Cabot, Gabriel; Oliver, Antonio; Lalucat, Jorge; Bennasar, Antonio; Albertí, Sebastián

    2011-11-01

    A total of 10 metallo-β-lactamase-producing isolates of six different species, including Brevundimonas diminuta (n = 3), Rhizobium radiobacter (n = 2), Pseudomonas monteilii (n = 1), Pseudomonas aeruginosa (n = 2), Ochrobactrum anthropi (n = 1), and Enterobacter ludwigii (n = 1), were detected in the sewage water of a hospital. The presence of bla(VIM-13) associated with a Tn1721-class 1 integron structure was detected in all but one of the isolates (E. ludwigii, which produced VIM-2), and in two of them (R. radiobacter), this structure was located on a plasmid, suggesting that environmental bacteria represent a reservoir for the dissemination of clinically relevant metallo-β-lactamase genes. PMID:21859934

  4. Catalytic mechanism of active-site serine beta-lactamases: role of the conserved hydroxy group of the Lys-Thr(Ser)-Gly triad.

    PubMed Central

    Dubus, A; Wilkin, J M; Raquet, X; Normark, S; Frère, J M

    1994-01-01

    The role of the conserved hydroxy group of the Lys-Thr(Ser)-Gly [KT(S)G] triad has been studied for a class A and a class C beta-lactamase by site-directed mutagenesis. Surprisingly, the disappearance of this functional group had little impact on the penicillinase activity of both enzymes. The cephalosporinase activity was much more affected for the class A S235A (Ser235-->Ala) and the class C T316V (Thr315-->Val) mutants, but the class C T316A mutant was less impaired. Studies were extended to beta-lactams, where the carboxy group on C-3 of penicillins or C-4 of cephalosporins had been modified. The effects of the mutations were the same on these compounds as on the unmodified regular penicillins and cephalosporins. The results are compared with those obtained with a similar mutant (T299V) of the Streptomyces R61 DD-peptidase. With this enzyme the mutation also affected the interactions with penicillins and severely decreased the peptidase activity. The strict conservation of the hydroxy group on the second residue of the KT(S)G triad is thus much more easy to understand for the DD-peptidase and the penicillin-binding proteins than for beta-lactamases, especially those of class C. Images Figure 1 PMID:8042993

  5. Comparison of BDPhoenix and VITEK2 automated antimicrobial susceptibility test systems for extended-spectrum beta-lactamase detection in Escherichia coli and Klebsiella species clinical isolates.

    PubMed

    Stürenburg, Enno; Sobottka, Ingo; Feucht, Heinz-Hubert; Mack, Dietrich; Laufs, Rainer

    2003-01-01

    The present study compares the ability to detect extended-spectrum beta-lactamases (ESBL) among a collection of 34 ESBL producing clinical isolates belonging to Escherichia coli and Klebsiella species with two new rapid susceptibility and identification instruments-VITEK2 (bioMérieux, Marcy l'Etoile, France) vs. BDPhoenix (BD Biosciences, Sparks, MD). ESBL content in these isolates was previously characterized on the basis of PCR amplification and sequencing results which were used as the reference method in our evaluation. BDPhoenix correctly determined the ESBL outcome for all strains tested (100% detection rate), whereas VITEK2 was not able to detect the ESBL status in 5 isolates (85% detection rate). Detailed analysis revealed that the discrepancies were mainly observed with 'difficult-to-detect' strains. Misidentification was either due to low oximino cephalosporin MIC in these strains or was associated with pronounced 'cefotaximase' or 'ceftazidimase' phenotypes. Klebsiella oxytoca chromosomal beta-lactamase (K1) is phenotypically quite similar to ESBL enzymes. In order to evaluate whether the K1 and ESBL enzymes could be discriminated, we expanded our analysis by 8 clinical K. oxytoca strains with K1 phenotypes. VITEK2 gave excellent identification of these strains whereas 7 out of 8 were falsely labeled ESBL-positive by the BDPhoenix system. PMID:12573548

  6. [Extended-spectrum beta-lactamases in enterobacteria other than Escherichia coli and Klebsiella].

    PubMed

    Seral García, Cristina; Pardos de la Gándara, María; Castillo García, Francisco Javier

    2010-01-01

    Methods for detecting ESBL-producing Enterobacteriaceae begin by a correct interpretation of the susceptibility profiles, applying the usual criteria for interpretative reading of the antibiogram. Appropriate confirmatory methods will be consequently chosen, based on the inhibition of the enzyme by betalactamases inhibitors, generally clavulanic acid. In case of non-AmpC-producing Enterobacteriaceae, at least two substrates should be used -cefotaxime or ceftriaxone and ceftazidime- to detect enzymes with a low hydrolytic activity against both substrates. Cefepime or AmpC-inhibitors should be recommended for AmpC-producing microorganisms. The identification of the enzymes responsible for the confirmed ESBL phenotype can be performed, either in the clinical laboratory or in reference centres, following a protocol of biochemical and molecular reactions able to detect and characterize, at least, those genes more frequently related to the predominant phenotypic profiles in our region. It is important to know which are the most prevalent combinations enzyme-microorganism, the vehicles for the genetic transmission involved in their dissemination, and the main epidemiological characteristics of the infections that they produce, in order to establish the dimensions of the problem and conduct surveillance studies, with the aim of achieving measures to control the wide spread. PMID:20172418

  7. Genome Evolution and Plasticity of Serratia marcescens, an Important Multidrug-Resistant Nosocomial Pathogen

    PubMed Central

    Iguchi, Atsushi; Nagaya, Yutaka; Pradel, Elizabeth; Ooka, Tadasuke; Ogura, Yoshitoshi; Katsura, Keisuke; Kurokawa, Ken; Oshima, Kenshiro; Hattori, Masahira; Parkhill, Julian; Sebaihia, Mohamed; Coulthurst, Sarah J.; Gotoh, Naomasa; Thomson, Nicholas R.; Ewbank, Jonathan J.; Hayashi, Tetsuya

    2014-01-01

    Serratia marcescens is an important nosocomial pathogen that can cause an array of infections, most notably of the urinary tract and bloodstream. Naturally, it is found in many environmental niches, and is capable of infecting plants and animals. The emergence and spread of multidrug-resistant strains producing extended-spectrum or metallo beta-lactamases now pose a threat to public health worldwide. Here we report the complete genome sequences of two carefully selected S. marcescens strains, a multidrug-resistant clinical isolate (strain SM39) and an insect isolate (strain Db11). Our comparative analyses reveal the core genome of S. marcescens and define the potential metabolic capacity, virulence, and multidrug resistance of this species. We show a remarkable intraspecies genetic diversity, both at the sequence level and with regards genome flexibility, which may reflect the diversity of niches inhabited by members of this species. A broader analysis with other Serratia species identifies a set of approximately 3,000 genes that characterize the genus. Within this apparent genetic diversity, we identified many genes implicated in the high virulence potential and antibiotic resistance of SM39, including the metallo beta-lactamase and multiple other drug resistance determinants carried on plasmid pSMC1. We further show that pSMC1 is most closely related to plasmids circulating in Pseudomonas species. Our data will provide a valuable basis for future studies on S. marcescens and new insights into the genetic mechanisms that underlie the emergence of pathogens highly resistant to multiple antimicrobial agents. PMID:25070509

  8. High prevalence and variability of CTX-M-15-producing and fluoroquinolone-resistant Escherichia coli observed in stray dogs in rural Angola.

    PubMed

    Albrechtova, Katerina; Kubelova, Michaela; Mazancova, Jana; Dolejska, Monika; Literak, Ivan; Cizek, Alois

    2014-08-01

    Antimicrobial resistance (AMR) represents a serious problem globally, but it is especially pronounced in the tropics, where pressure of infectious diseases is high. We examined resistance in Escherichia coli colonizing gastrointestinal tracts of 17 dogs which have never received antimicrobial treatment, living in central rural Angola. Emphasis was placed on extended-spectrum beta-lactamases (ESBL) and plasmid-mediated quinolone resistance (PMQR). Resistance-carrying plasmids were characterized in size, group of incompatibility and ability to conjugate. Isolates were compared by their pulsed-field gel electrophoresis (PFGE) profiles. Detailed description of 19 E. coli isolates with either ESBL or PMQR genes carried on multiresistant plasmids of different groups of incompatibility indicates that dogs, despite never being treated by antibiotics, are important reservoirs and transmitters of AMR in the study area. PMID:24568119

  9. Crystal Structures of KPC-2[beta]-Lactamase in Complex with 3-Nitrophenyl Boronic Acid and the Penam Sulfone PSR-3-226

    SciTech Connect

    Ke, Wei; Bethel, Christopher R.; Papp-Wallace, Krisztina M.; Pagadala, Sundar Ram Reddy; Nottingham, Micheal; Fernandez, Daniel; Buynak, John D.; Bonomo, Robert A.; van den Akker, Focco

    2012-08-01

    Class A carbapenemases are a major threat to the potency of carbapenem antibiotics. A widespread carbapenemase, KPC-2, is not easily inhibited by {beta}-lactamase inhibitors (i.e., clavulanic acid, sulbactam, and tazobactam). To explore different mechanisms of inhibition of KPC-2, we determined the crystal structures of KPC-2 with two {beta}-lactamase inhibitors that follow different inactivation pathways and kinetics. The first complex is that of a small boronic acid compound, 3-nitrophenyl boronic acid (3-NPBA), bound to KPC-2 with 1.62-{angstrom} resolution. 3-NPBA demonstrated a Km value of 1.0 {+-} 0.1 {micro}M (mean {+-} standard error) for KPC-2 and blocks the active site by making a reversible covalent interaction with the catalytic S70 residue. The two boron hydroxyl atoms of 3-NPBA are positioned in the oxyanion hole and the deacylation water pocket, respectively. In addition, the aromatic ring of 3-NPBA provides an edge-to-face interaction with W105 in the active site. The structure of KPC-2 with the penam sulfone PSR-3-226 was determined at 1.26-{angstrom} resolution. PSR-3-226 displayed a K{sub m} value of 3.8 {+-} 0.4 {micro}M for KPC-2, and the inactivation rate constant (kinact) was 0.034 {+-} 0.003 s{sup -1}. When covalently bound to S70, PSR-3-226 forms a trans-enamine intermediate in the KPC-2 active site. The predominant active site interactions are generated via the carbonyl oxygen, which resides in the oxyanion hole, and the carboxyl moiety of PSR-3-226, which interacts with N132, N170, and E166. 3-NPBA and PSR-3-226 are the first {beta}-lactamase inhibitors to be trapped as an acyl-enzyme complex with KPC-2. The structural and inhibitory insights gained here could aid in the design of potent KPC-2 inhibitors.

  10. Epidemiology and virulence of VIM-4 metallo-beta-lactamase-producing Pseudomonas aeruginosa isolated from burn patients in eastern Algeria.

    PubMed

    Meradji, Samah; Barguigua, Abouddihaj; Bentakouk, Mohamed Cherif; Nayme, Kaotar; Zerouali, Khalid; Mazouz, Dekhil; Chettibi, Houria; Timinouni, Mohammed

    2016-06-01

    In this study, we investigated the prevalence of carbapenem-resistant Pseudomonas aeruginosa (CRPA) in burn patients from eastern Algeria, CRPA virulence factors and the molecular epidemiology of CRPA. The overall prevalence of CRPA was 48.38%. Seven (46.66%) isolates were metallo-β-lactamases (MBL) producers and contained the MBL genes blaVIM-4 (n=6) and blaVIM-2 (n=1). Risk factors for CRPA infection were urinary catheter use and intubation (p=0.008). A high percentage of virulence factors (86.6% of these isolates were able to produce protease; 73.3% of isolates has DNase; and 66.6% were haemolysin positive) was observed in CRPA isolates. Among the seven MBL-producing isolates, four had the same clonal profile. The class 1 integrons, which contained the aadA7 gene cassette, were detected in six isolates. The 16SrRNA methylase gene, rmtB, was detected in one strain. All CRPA isolates were biofilm formers. A study on the kinetics of biofilm production revealed that biofilm production increased when the concentration of imipenem or ciprofloxacin and the incubation time increased. This is the first study to report the presence of VIM-4-producing P. aeruginosa from North Africa and also of the high prevalence of CRPA isolates. Based on our study of burn unit patients, the high percentage of P. aeruginosa with virulence factors and multi-drug resistance is alarming. PMID:27156788

  11. Use of ampicillin-sulbactam for treatment of experimental meningitis caused by a beta-lactamase-producing strain of Escherichia coli K-1.

    PubMed

    Guerra-Romero, L; Kennedy, S L; Fournier, M A; Tureen, J H; Täuber, M G

    1991-10-01

    We evaluated the pharmacokinetics and therapeutic efficacy of ampicillin combined with sulbactam in a rabbit model of meningitis due to a beta-lactamase-producing strain of Escherichia coli K-1. Ceftriaxone was used as a comparison drug. The MIC and MBC were 32 and greater than 64 micrograms/ml (ampicillin), greater than 256 and greater than 256 micrograms/ml (sulbactam), 2.0 and 4.0 micrograms/ml (ampicillin-sulbactam [2:1 ratio, ampicillin concentration]) and 0.125 and 0.25 micrograms/ml (ceftriaxone). All antibiotics were given by intravenous bolus injection in a number of dosing regimens. Ampicillin and sulbactam achieved high concentrations in cerebrospinal fluid (CSF) with higher dose regimens, but only moderate bactericidal activity compared with that of ceftriaxone was obtained. CSF bacterial titers were reduced by 0.6 +/- 0.3 log10 CFU/ml/h with the highest ampicillin-sulbactam dose used (500 and 500 mg/kg of body weight, two doses). This was similar to the bactericidal activity achieved by low-dose ceftriaxone (10 mg/kg), while a higher ceftriaxone dose (100 mg/kg) produced a significant increase in bactericidal activity (1.1 +/- 0.4 log10 CFU/ml/h). It appears that ampicillin-sulbactam, despite favorable CSF pharmacokinetics in animals with meningitis, may be of limited value in the treatment of difficult-to-treat beta-lactamase-producing bacteria, against which the combination shows only moderate in vitro activity. PMID:1759824

  12. Sepsis Caused by Extended-Spectrum Beta-Lactamase (ESBL)-Positive K. pneumoniae and E. coli: Comparison of Severity of Sepsis, Delay of Anti-Infective Therapy and ESBL Genotype.

    PubMed

    Sakellariou, Christian; Gürntke, Stephan; Steinmetz, Ivo; Kohler, Christian; Pfeifer, Yvonne; Gastmeier, Petra; Schwab, Frank; Kola, Axel; Deja, Maria; Leistner, Rasmus

    2016-01-01

    Infections with extended-spectrum beta-lactamase-producing Enterobacteriaceae (ESBL-E) are associated with increased mortality. Outcome differences due to various species of ESBL-E or ESBL genotypes are not well investigated. We conducted a cohort study to assess risk factors for mortality in cases of ESBL-E bacteremia (K. pneumoniae or E. coli) and the risk factors for sepsis with organ failure. All consecutive patients of our institution from 2008 to 2011 with bacteremia due to ESBL-E were included. Basic epidemiological data, underlying comorbidities, origin of bacteremia, severity of sepsis and delay of appropriate anti-infective treatment were collected. Isolates were PCR-screened for the presence of ESBL genes and plasmid-mediated AmpC β-lactamases. Cox proportional hazard regression on mortality and multivariable logistic regression on risk factors for sepsis with organ failure was conducted. 219 cases were included in the analysis: 73.1% due to E. coli, 26.9% due to K. pneumoniae. There was no significant difference in hospital mortality (ESBL-E. coli, 23.8% vs. ESBL-K. pneumoniae 27.1%, p = 0.724). However, the risk of sepsis with organ failure was associated in cases of K. pneumoniae bacteremia (OR 4.5, p<0.001) and patients with liver disease (OR 3.4, p = 0.004) or renal disease (OR 6.8, p<0.001). We found significant differences in clinical presentation of ESBL-E bacteremia due to K. pneumoniae compared to E. coli. As K. pneumoniae cases showed a more serious clinical presentation as E. coli cases and were associated with different risk factors, treatment and prevention strategies should be adjusted accordingly. PMID:27442425

  13. Sepsis Caused by Extended-Spectrum Beta-Lactamase (ESBL)-Positive K. pneumoniae and E. coli: Comparison of Severity of Sepsis, Delay of Anti-Infective Therapy and ESBL Genotype

    PubMed Central

    Steinmetz, Ivo; Kohler, Christian; Pfeifer, Yvonne; Gastmeier, Petra; Schwab, Frank; Kola, Axel; Deja, Maria; Leistner, Rasmus

    2016-01-01

    Infections with extended-spectrum beta-lactamase-producing Enterobacteriaceae (ESBL-E) are associated with increased mortality. Outcome differences due to various species of ESBL-E or ESBL genotypes are not well investigated. We conducted a cohort study to assess risk factors for mortality in cases of ESBL-E bacteremia (K. pneumoniae or E. coli) and the risk factors for sepsis with organ failure. All consecutive patients of our institution from 2008 to 2011 with bacteremia due to ESBL-E were included. Basic epidemiological data, underlying comorbidities, origin of bacteremia, severity of sepsis and delay of appropriate anti-infective treatment were collected. Isolates were PCR-screened for the presence of ESBL genes and plasmid-mediated AmpC β-lactamases. Cox proportional hazard regression on mortality and multivariable logistic regression on risk factors for sepsis with organ failure was conducted. 219 cases were included in the analysis: 73.1% due to E. coli, 26.9% due to K. pneumoniae. There was no significant difference in hospital mortality (ESBL-E. coli, 23.8% vs. ESBL-K. pneumoniae 27.1%, p = 0.724). However, the risk of sepsis with organ failure was associated in cases of K. pneumoniae bacteremia (OR 4.5, p<0.001) and patients with liver disease (OR 3.4, p = 0.004) or renal disease (OR 6.8, p<0.001). We found significant differences in clinical presentation of ESBL-E bacteremia due to K. pneumoniae compared to E. coli. As K. pneumoniae cases showed a more serious clinical presentation as E. coli cases and were associated with different risk factors, treatment and prevention strategies should be adjusted accordingly. PMID:27442425

  14. Cationic compounds with activity against multidrug-resistant bacteria: interest of a new compound compared with two older antiseptics, hexamidine and chlorhexidine.

    PubMed

    Grare, M; Dibama, H Massimba; Lafosse, S; Ribon, A; Mourer, M; Regnouf-de-Vains, J-B; Finance, C; Duval, R E

    2010-05-01

    Use of antiseptics and disinfectants is essential in infection control practices in hospital and other healthcare settings. In this study, the in vitro activity of a new promising compound, para-guanidinoethylcalix[4]arene (Cx1), has been evaluated in comparison with hexamidine (HX) and chlorhexidine (CHX), two older cationic antiseptics. The MICs for 69 clinical isolates comprising methicillin-resistant Staphylococcus aureus, methicillin-sensitive S. aureus, coagulase-negative staphylococci (CoNS) (with or without mecA), vancomycin-resistant enterococci, Enterobacteriaceae producing various beta-lactamases and non-fermenting bacilli (Pseudomonas aeruginosa, Acinetobacter baumanii, Stenotrophomonas maltophilia) were determined. Cx1 showed similar activity against S. aureus, CoNS and Enterococcus spp., irrespective of the presence of mecA or van genes, or associated resistance genes, with very good activity against CoNS (MIC <1 mg/L). Variable activities were observed against Enterobacteriaceae; the MICs determined seemed to be dependent both on the genus (MICs of 2, 8 and 64 mg/L for Escherichia coli, Klebsiella pneumoniae and Yersinia enterocolitica, respectively) and on the resistance phenotype production of [Extended Spectrum beta-Lactase (ESBLs) or other beta-lactamases; overproduction of AmpC]. Poor activity was found against non-fermenting bacilli, irrespective of the resistance phenotype. CHX appeared to be the most active compound against all strains, with broad-spectrum and conserved activity against multidrug-resistant strains. HX showed a lower activity, essentially against Gram-positive strains. Consequently, the differences observed with respect to Cx1 suggest that they are certainly not the consequence of antibiotic resistance phenotypes, but rather the result of membrane composition modifications (e.g. of lipopolysaccharide), or of the presence of (activated) efflux-pumps. These results raise the possibility that Cx1 may be a potent new antibacterial

  15. [Extended spectrum beta lactamases (ESBL) production in Acinetobacter baumannii strains isolated from Chilean hospitals belonging to VIII Region].

    PubMed

    Pino I, Carolina; Domínguez Y, Mariana; González R, Gerardo; Bello T, Helia; Sepúlveda A, Marcela; Mella M, Sergio; Zemelman M, Claudia; Zemelman Z, Raúl

    2007-04-01

    The resistance of Acinetobacter baumannii to ss-lactam antibiotics is mainly due to the synthesis of ss-lactamases. From a clinical point of view, this bacteria and others, grouped under the acronym SPACE (S: Serratia, P: Pseudomonas, A: Acinetobacter, C: Citrobacter, E: Enterobacter) are essentially Amp-C ss-lactamases producers. There is no local information about ESBL presence in Acinetobacter. We studied ESBL production using the Ho and col. technique modified by adding cloxacillin as chromosomal ss-lactamases inhibitor. From 69 isolates, with resistance to at least one third generation cephalosporin, only 7 showed positive synergy test. Four of these amplified for TEM family gene, and one of these amplified also for the OXA family. Our study found a low ESBL production percentage, which agrees with the premise of Amp-C as the main mechanism of resistance to ss-lactam antibiotics in A. baumannii. However, the ESBL description in these bacteria emphasizes the capacity of expressing multiple resistance mechanisms. PMID:17453072

  16. Microarray Evaluation of Antimicrobial Resistance and Virulence of Escherichia coli Isolates from Portuguese Poultry.

    PubMed

    Mendonça, Nuno; Figueiredo, Rui; Mendes, Catarina; Card, Roderick M; Anjum, Muna F; da Silva, Gabriela Jorge

    2016-01-01

    The presence of antimicrobial resistance and virulence factors of 174 Escherichia coli strains isolated from healthy Portuguese Gallus gallus was evaluated. Resistance profiles were determined against 33 antimicrobials by microbroth dilution. Resistance was prevalent for tetracycline (70%) and ampicillin (63%). Extended-spectrum beta-lactamase (ESBL) phenotype was observed in 18% of the isolates. Multidrug resistance was found in 56% of isolates. A subset of 74 isolates were screened by DNA microarrays for the carriage of 88 antibiotic resistance genes and 62 virulence genes. Overall, 37 different resistance genes were detected. The most common were tet(A) (72%), blaTEM (68%), and sul1 (47%), while 21% isolates harbored an ESBL gene (blaCTX-M group 1, group 2, or group 9). Of these, 96% carried the increased serum survival (iss) virulence gene, while 89% presented the enterobactin siderophore receptor protein (iroN), 70% the temperature-sensitive hemagglutinin (tsh), and 68% the long polar fimbriae (lpfA) virulence genes associated with extraintestinal pathogenic E. coli. In conclusion, prevalence of antibiotic resistant E. coli from the microbiota of Portuguese chickens was high, including to extended spectrum cephalosporins. The majority of isolates seems to have the potential to trigger extraintestinal human infection due to the presence of some virulence genes. However, the absence of genes specific for enteropathogenic E. coli reduces the risk for human intestinal infection. PMID:27025519

  17. Microarray Evaluation of Antimicrobial Resistance and Virulence of Escherichia coli Isolates from Portuguese Poultry

    PubMed Central

    Mendonça, Nuno; Figueiredo, Rui; Mendes, Catarina; Card, Roderick M.; Anjum, Muna F.; da Silva, Gabriela Jorge

    2016-01-01

    The presence of antimicrobial resistance and virulence factors of 174 Escherichia coli strains isolated from healthy Portuguese Gallus gallus was evaluated. Resistance profiles were determined against 33 antimicrobials by microbroth dilution. Resistance was prevalent for tetracycline (70%) and ampicillin (63%). Extended-spectrum beta-lactamase (ESBL) phenotype was observed in 18% of the isolates. Multidrug resistance was found in 56% of isolates. A subset of 74 isolates were screened by DNA microarrays for the carriage of 88 antibiotic resistance genes and 62 virulence genes. Overall, 37 different resistance genes were detected. The most common were tet(A) (72%), blaTEM (68%), and sul1 (47%), while 21% isolates harbored an ESBL gene (blaCTX-M group 1, group 2, or group 9). Of these, 96% carried the increased serum survival (iss) virulence gene, while 89% presented the enterobactin siderophore receptor protein (iroN), 70% the temperature-sensitive hemagglutinin (tsh), and 68% the long polar fimbriae (lpfA) virulence genes associated with extraintestinal pathogenic E. coli. In conclusion, prevalence of antibiotic resistant E. coli from the microbiota of Portuguese chickens was high, including to extended spectrum cephalosporins. The majority of isolates seems to have the potential to trigger extraintestinal human infection due to the presence of some virulence genes. However, the absence of genes specific for enteropathogenic E. coli reduces the risk for human intestinal infection. PMID:27025519

  18. Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England

    PubMed Central

    2010-01-01

    Background Escherichia coli isolates of equine faecal origin were investigated for antibiotic resistance, resistance genes and their ability to perform horizontal transfer. Methods In total, 264 faecal samples were collected from 138 horses in hospital and community livery premises in northwest England, yielding 296 resistant E. coli isolates. Isolates were tested for susceptibility to antimicrobial drugs by disc diffusion and agar dilution methods in order to determine minimum inhibitory concentrations (MIC). PCR amplification was used to detect genes conferring resistance to: ampicillin (TEM and SHV beta-lactamase), chloramphenicol (catI, catII, catIII and cml), tetracycline (tetA, tetB, tetC, tetD, tet E and tetG), and trimethoprim (dfrA1, dfrA9, dfrA12, dfrA13, dfr7, and dfr17). Results The proportion of antibiotic resistant isolates, and multidrug resistant isolates (MDR) was significantly higher in hospital samples compared to livery samples (MDR: 48% of hospital isolates; 12% of livery isolates, p < 0.001). Resistance to ciprofloxacin and florfenicol were identified mostly within the MDR phenotypes. Resistance genes included dfr, TEM beta-lactamase, tet and cat, conferring resistance to trimethoprim, ampicillin, tetracycline and chloramphenicol, respectively. Within each antimicrobial resistance group, these genes occurred at frequencies of 93% (260/279), 91%, 86.8% and 73.5%, respectively; with 115/296 (38.8%) found to be MDR isolates. Conjugation experiments were performed on selected isolates and MDR phenotypes were readily transferred. Conclusions Our findings demonstrate that E. coli of equine faecal origin are commonly resistant to antibiotics used in human and veterinary medicine. Furthermore, our results suggest that most antibiotic resistance observed in equine E. coli is encoded by well-known and well-characterized resistant genes common to E. coli from man and domestic animals. These data support the ongoing concern about antimicrobial resistance

  19. Detection of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Market-Ready Chickens in Zambia

    PubMed Central

    Chishimba, K.; Hang'ombe, B. M.; Muzandu, K.; Mshana, S. E.; Matee, M. I.; Nakajima, C.; Suzuki, Y.

    2016-01-01

    The frequent administering of antibiotics in the treatment of poultry diseases may contribute to emergence of antimicrobial-resistant strains. The objective of this study was to detect the presence of extended-spectrum β-lactamase- (ESBL-) producing Escherichia coli in poultry in Zambia. A total of 384 poultry samples were collected and analyzed for ESBL-producing Escherichia coli. The cultured E. coli isolates were subjected to antimicrobial susceptibility tests and the polymerase chain reaction for detection of blaCTX-M, blaSHV, and blaTEM genes. Overall 20.1%, 77/384, (95% CI; 43.2–65.5%) of total samples analyzed contained ESBL-producing Escherichia coli. The antimicrobial sensitivity test revealed that 85.7% (66/77; CI: 75.7–92) of ESBL-producing E. coli isolates conferred resistance to beta-lactam and other antimicrobial agents. These results indicate that poultry is a potential reservoir for ESBL-producing Escherichia coli. The presence of ESBL-producing Escherichia coli in poultry destined for human consumption requires strengthening of the antibiotic administering policy. This is important as antibiotic administration in food animals is gaining momentum for improved animal productivity in developing countries such as Zambia. PMID:27190518

  20. Detection of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Market-Ready Chickens in Zambia.

    PubMed

    Chishimba, K; Hang'ombe, B M; Muzandu, K; Mshana, S E; Matee, M I; Nakajima, C; Suzuki, Y

    2016-01-01

    The frequent administering of antibiotics in the treatment of poultry diseases may contribute to emergence of antimicrobial-resistant strains. The objective of this study was to detect the presence of extended-spectrum β-lactamase- (ESBL-) producing Escherichia coli in poultry in Zambia. A total of 384 poultry samples were collected and analyzed for ESBL-producing Escherichia coli. The cultured E. coli isolates were subjected to antimicrobial susceptibility tests and the polymerase chain reaction for detection of bla CTX-M, bla SHV, and bla TEM genes. Overall 20.1%, 77/384, (95% CI; 43.2-65.5%) of total samples analyzed contained ESBL-producing Escherichia coli. The antimicrobial sensitivity test revealed that 85.7% (66/77; CI: 75.7-92) of ESBL-producing E. coli isolates conferred resistance to beta-lactam and other antimicrobial agents. These results indicate that poultry is a potential reservoir for ESBL-producing Escherichia coli. The presence of ESBL-producing Escherichia coli in poultry destined for human consumption requires strengthening of the antibiotic administering policy. This is important as antibiotic administration in food animals is gaining momentum for improved animal productivity in developing countries such as Zambia. PMID:27190518

  1. Molecular evolution of beta-lactam-resistant Haemophilus influenzae: 9-year surveillance of penicillin-binding protein 3 mutations in isolates from Japan.

    PubMed

    Sanbongi, Yumiko; Suzuki, Takahisa; Osaki, Yumi; Senju, Nami; Ida, Takashi; Ubukata, Kimiko

    2006-07-01

    A total of 621 clinical isolates of Haemophilus influenzae collected in Japan between 1995 and 2003 were studied for their susceptibilities to several antimicrobial agents, beta-lactamase production, and amino acid substitutions in penicillin-binding protein 3 (PBP 3). Over the four study periods (first period, 1995 to 1996; second period, 1997 to 1998; third period, 2000 to 2001; fourth period, 2002 to 2003), the susceptibilities to beta-lactam agents decreased and the incidence of isolates with substitutions at positions 377, 385, 389, 517, and/or 526 in PBP 3 increased from 28.8% to 52.0%. Five hundred seventy-one beta-lactamase-nonproducing isolates were grouped into 18 classes, based on the pattern of the five mutations in PBP 3. The Asp526Lys substitution led to 6.0-, 4.3-, 2.4-, and 5.4-fold increases in amoxicillin-clavulanic acid, cefdinir, cefditoren, and faropenem resistance, respectively. PBP 3 with multiple substitutions (Met377Ile, Ser385Thr, and/or Leu389Phe) together with Asp526Lys resulted in increased resistance compared to that for PBP 3 with the Asp526Lys substitution alone. These results indicate that mutations at these five positions increased resistance to most beta-lactams. Although a significant change in the prevalence of beta-lactamase-producing strains was not observed, the proportions of those possessing both PBP 3 alterations and beta-lactamase production have slightly increased (from 1.4% to 5.0%). The ROB-1 beta-lactamase was rare, but this is the first report of this beta-lactamase in Japan. PMID:16801430

  2. Degradation of beta-lactam antibiotics in the presence of Zn2+ and 2-amino-2-hydroxymethylpropane-1,3-diol (Tris). A hypothetical non-enzymic model of beta-lactamases.

    PubMed

    Company, M; Benitez, M J; Jiménez, J S

    1991-08-01

    The system composed of 2-amino-2-hydroxymethylpropane-1,3-diol (Tris) and Zn2+ catalyses the degradation of cephalosporins. The beta-lactam opening fits to a first-order process, with a constant directly proportional to the zinc ion concentration. The pH and Tris concentration dependency displayed by the first-order constant, as well as the nature of the degradation products point to a mechanism that can be considered as an extension of that proposed for the benzylpenicillin degradation. The mechanism proposed here, and the values of the kinetic constants calculated, as compared with those of beta-lactamases, lead to the conclusion that the Tris-Zn2+ system simulates the catalytic action of the serine beta-lactamases rather than the action of the Zn(2+)-dependent type of enzymes. PMID:1777429

  3. Sensitive and Specific Modified Hodge Test for KPC and Metallo-Beta- Lactamase Detection in Pseudomonas aeruginosa by Use of a Novel Indicator Strain, Klebsiella pneumoniae ATCC 700603 ▿

    PubMed Central

    Pasteran, Fernando; Veliz, Omar; Rapoport, Melina; Guerriero, Leonor; Corso, Alejandra

    2011-01-01

    We evaluated the ability of the modified Hodge test to discriminate between KPC- and metallo-beta-lactamase (MBL)-producing Pseudomonas aeruginosa isolates and carbapenemase nonproducers. With Escherichia coli ATCC 25922 as the indicator strain, the MHT resulted in low sensitivity, specificity, and repeatability. Replacing the indicator strain with Klebsiella pneumoniae ATCC 700603 led to an improved performance (100%, 97%, 0%, and 100% sensitivity, specificity, indeterminate results and repeatability, respectively). PMID:22012019

  4. Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae

    PubMed Central

    Al-Marzooq, Farah; Mohd Yusof, Mohd Yasim; Tay, Sun Tee

    2015-01-01

    Infections caused by multidrug resistant Klebsiella pneumoniae have been increasingly reported in many parts of the world. A total of 93 Malaysian multidrug resistant K. pneumoniae isolated from patients attending to University of Malaya Medical Center, Kuala Lumpur, Malaysia from 2010-2012 were investigated for antibiotic resistance determinants including extended-spectrum beta-lactamases (ESBLs), aminoglycoside and trimethoprim/sulfamethoxazole resistance genes and plasmid replicons. CTX-M-15 (91.3%) was the predominant ESBL gene detected in this study. aacC2 gene (67.7%) was the most common gene detected in aminoglycoside-resistant isolates. Trimethoprim/sulfamethoxazole resistance (90.3%) was attributed to the presence of sul1 (53.8%) and dfrA (59.1%) genes in the isolates. Multiple plasmid replicons (1-4) were detected in 95.7% of the isolates. FIIK was the dominant replicon detected together with 13 other types of plasmid replicons. Conjugative plasmids (1-3 plasmids of ~3-100 kb) were obtained from 27 of 43 K. pneumoniae isolates. An ESBL gene (either CTX-M-15, CTX-M-3 or SHV-12) was detected from each transconjugant. Co-detection with at least one of other antibiotic resistance determinants [sul1, dfrA, aacC2, aac(6ˊ)-Ib, aac(6ˊ)-Ib-cr and qnrB] was noted in most conjugative plasmids. The transconjugants were resistant to multiple antibiotics including β-lactams, gentamicin and cotrimoxazole, but not ciprofloxacin. This is the first study describing the characterization of plasmids circulating in Malaysian multidrug resistant K. pneumoniae isolates. The results of this study suggest the diffusion of highly diverse plasmids with multiple antibiotic resistance determinants among the Malaysian isolates. Effective infection control measures and antibiotic stewardship programs should be adopted to limit the spread of the multidrug resistant bacteria in healthcare settings. PMID:26203651

  5. Effect of carbapenem administration on establishment of intestinal colonization by vancomycin-resistant enterococci and Klebsiella pneumoniae in mice.

    PubMed

    Stiefel, Usha; Pultz, Nicole J; Donskey, Curtis J

    2007-01-01

    In a mouse model, ertapenem inhibited the anaerobic intestinal microflora and promoted overgrowth of enterococci, whereas imipenem-cilastatin had no effect on the indigenous microflora. Ertapenem, but not imipenem-cilastatin, promoted modest overgrowth of vancomycin-resistant enterococci when exposure occurred during treatment. Neither agent promoted colonization with extended-spectrum beta-lactamase-producing Klebsiella pneumoniae. PMID:17043115

  6. Comparative kill and growth rates determined with cefdinir and cefaclor and with Streptococcus pneumoniae and beta-lactamase-producing Haemophilus influenzae.

    PubMed Central

    Yourassowsky, E; Van der Linden, M P; Crokaert, F

    1992-01-01

    The relationship between the growth rate and the kill rate was used to evaluate and to compare the in vitro bactericidal activities of cefdinir, a new oral cephalosporin, and cefaclor against Streptococcus pneumoniae and beta-lactamase-producing strains of Haemophilus influenzae. These frequently encountered pathogens of community-acquired respiratory tract infections are usually susceptible to both drugs. The MIC ranges for cefdinir and cefaclor were, respectively, 0.03 to 0.06 and 0.25 to 0.5 micrograms/ml for S. pneumoniae and 0.25 and 4 to 8 micrograms/ml for H. influenzae. The colony counts (CFU per milliliter) measured after 6 h of exposure to a range of antibiotic concentrations in broth were plotted against the colony count of the control culture over the same period of time. Higher kill rates versus bacterial growth rates were noted for S. pneumoniae for both drugs (positive balance). Conversely, lower kill rates versus growth rates were noted for H. influenzae for both drugs (negative balance). In conclusion, the bactericidal activities of both drugs against S. pneumoniae and H. influenzae were similar when expressed by the relationship between the growth rate and the kill rate at 6 h, but cefdinir was more active at lower concentrations. PMID:1590698

  7. Clonal relatedness and conserved integron structures in epidemiologically unrelated Pseudomonas aeruginosa strains producing the VIM-1 metallo-{beta}-lactamase from different Italian hospitals.

    PubMed

    Riccio, Maria Letizia; Pallecchi, Lucia; Docquier, Jean-Denis; Cresti, Stefania; Catania, Maria Rosaria; Pagani, Laura; Lagatolla, Cristina; Cornaglia, Giuseppe; Fontana, Roberta; Rossolini, Gian Maria

    2005-01-01

    Three epidemiologically independent Pseudomonas aeruginosa isolates, representative of the first VIM-1 metallo-beta-lactamase producers detected at three different hospitals in northern Italy, were investigated to determine their genomic relatedness and to compare the structures of the genetic supports for the VIM-1 determinants. The three isolates, all of serotype O11, appeared to be clonally related according to the results of genotyping by macrorestriction analysis of genomic DNA by pulsed-field gel electrophoresis and random amplification of polymorphic DNA. Investigation of the genetic support for the bla(VIM-1) determinant revealed that it was carried on identical or almost identical integrons (named In70.2 and In70.3) located within a conserved genomic context. The integrons were structurally related to In70 and In110, two plasmid-borne bla(VIM-1)-containing integrons from Achromobacter xylosoxidans and Pseudomonas putida isolates, respectively, from the same geographic area (northern Italy) and were found to be inserted close to the res site of a Tn5051-like transposon, different from any of those described previously, that was apparently carried on the bacterial chromosome. The present findings suggest that the three VIM-1-producing isolates are members of the same clonal complex which have been spreading in hospitals in northern Italy since the late 1990s and point to a common ancestry of their bla(VIM-1)-containing integrons. PMID:15616282

  8. Silver nanoparticle production by Rhizopus stolonifer and its antibacterial activity against extended spectrum {beta}-lactamase producing (ESBL) strains of Enterobacteriaceae

    SciTech Connect

    Banu, Afreen; Rathod, Vandana; Ranganath, E.

    2011-09-15

    Highlights: {yields} Silver nanoparticle production by using Rhizopus stolonifer. {yields} Antibacterial activity of silver nanoparticles against extended spectrum {beta}-lactamase producing (ESBL) strains of Enterobacteriaceae. {yields} Synergistic effect of antibiotics with silver nanoparticles towards ESBL-strains. {yields} Characterization of silver nanoparticles made by UV-vis spectra, scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transformed infrared (FTIR) spectroscopy, atomic force microscopy (AFM). -- Abstract: This report focuses on the synthesis of silver nanoparticles using the fungus, Rhizopus stolonifer and its antimicrobial activity. Research in nanotechnology highlights the possibility of green chemistry pathways to produce technologically important nanomaterials. Characterization of newly synthesized silver nanoparticles was made by UV-visible absorption spectroscopy, scanning electron microscope (SEM), transmission electron microscope (TEM), Fourier transform infrared (FTIR) spectroscopy and atomic force microscope (AFM). TEM micrograph revealed the formation of spherical nanoparticles with size ranging between 3 and 20 nm. The biosynthesized silver nanoparticles (AgNPs) showed excellent antibacterial activity against ESBL-strains which includes E. coli, Proteus. sp. and Klebsiella sp.

  9. Clinical and Molecular Epidemiology of Extended-Spectrum Beta-Lactamase-Producing Klebsiella spp.: A Systematic Review and Meta-Analyses

    PubMed Central

    Hendrik, Tirza C.; Voor in ‘t holt, Anne F.; Vos, Margreet C.

    2015-01-01

    Healthcare-related infections caused by extended-spectrum beta-lactamase (ESBL)-producing Klebsiella spp. are of major concern. To control transmission, deep understanding of the transmission mechanisms is needed. This systematic review aimed to identify risk factors and sources, clonal relatedness using molecular techniques, and the most effective control strategies for ESBL-producing Klebsiella spp. A systematic search of PubMed, Embase, and Outbreak Database was performed. We identified 2771 articles from November 25th, 1960 until April 7th, 2014 of which 148 were included in the systematic review and 23 in a random-effects meta-analysis study. The random-effects meta-analyses showed that underlying disease or condition (odds ratio [OR] = 6.25; 95% confidence interval [CI] = 2.85 to 13.66) generated the highest pooled estimate. ESBL-producing Klebsiella spp. were spread through person-to-person contact and via sources in the environment; we identified both monoclonal and polyclonal presence. Multi-faceted interventions are needed to prevent transmission of ESBL-producing Klebsiella spp. PMID:26485570

  10. Resistance Gene Analogs in Cherries (Prunus spp.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic studies have shown that NBS-LRR Resistance Gene Analogs (RGAs) tend to occur in clusters and often map to major resistances gene or QTL. The identification and use of specific RGAs as molecular markers among plant material displaying differential resistance phenotypes has the potential to di...

  11. Investigation of the antibiotic resistance and biofilm formation of Staphylococcus aureus strains isolated from gangrenous mastitis of ewes.

    PubMed

    Tel, Osman Yaşar; Aslantaş, Ozkan; Keskin, Oktay; Yilmaz, Ebru Sebnem; Demir, Cemil

    2012-06-01

    In this study, Staphylococcus aureus strains (n = 110) isolated from seven ewe flocks in Sanliurfa, Turkey were screened for antibiotic resistance and biofilmforming ability as well as for genes associated with antibiotic resistance and biofilm-forming ability. All isolates were found to be susceptible to oxacillin, gentamicin, clindamycin, cefoxitin, tetracycline, vancomycin, amoxicillin-clavulanic acid, ciprofloxacin and sulphamethoxazole-trimethoprim. The percent proportions of strains resistant to penicillin G, ampicillin and erythromycin were 27.2% (n = 30), 25.4% (n = 28) and 6.3% (n = 7), respectively. Regarding the antibiotic resistance genes, 32 (29%) isolates carried the blaZ and 8 (7.2%) the ermC gene. Other resistance genes were not detected in the isolates. All isolates showed biofilm-forming ability on Congo red agar (CRA), while 108 (98.18%) and 101 (91.81%) of them were identified as biofilm producers by the use of standard tube (ST) and microplate (MP) methods, respectively. All isolates carried the icaA and icaD genes but none of them harboured the bap gene. The results demonstrated that S. aureus isolates from gangrenous mastitis were mainly resistant to penicillins (which are susceptible to the staphylococcal beta-lactamase enzyme), and less frequently to erythromycin. Furthermore, all of the S. aureus isolates produced biofilm which was considered a potential virulence factor in the pathogenesis of staphylococcal mastitis. PMID:22609990

  12. First report of extended-spectrum-beta-lactamase-producing Salmonella enterica serovar Kentucky isolated from poultry in Ireland.

    PubMed

    Boyle, F; Morris, D; O'Connor, J; Delappe, N; Ward, J; Cormican, M

    2010-01-01

    Therapy of invasive human salmonellosis is complicated by increasing antimicrobial resistance. Food animals are the principal source of infection with nontyphoid Salmonella. We report the emergence of broad-spectrum-cephalosporin resistance in Salmonella enterica serovar Kentucky in poultry in Ireland. PMID:19884382

  13. Transferable imipenem resistance in Pseudomonas aeruginosa.

    PubMed Central

    Watanabe, M; Iyobe, S; Inoue, M; Mitsuhashi, S

    1991-01-01

    We isolated an imipenem-resistant strain, GN17203, of Pseudomonas aeruginosa. The strain produced a beta-lactamase that hydrolyzed imipenem. The beta-lactamase was encoded by a 31-MDa plasmid, pMS350, which belongs to incompatibility group P-9. The plasmic conferred resistance to beta-lactams, gentamicin, and sulfonamide and was transferable by conjugation to P. aeruginosa but not to Escherichia coli. The molecular weight of the purified enzyme was estimated to be 28,000, and the isoelectric point was 9.0. The enzyme showed a broad substrate profile, hydrolyzing imipenem, oxyiminocephalosporins, 7-methoxycephalosporins, and penicillins. The enzyme activity was inhibited by EDTA, iodine, p-chloromercuribenzoate, CuSO4, and HgCl2 but not by clavulanic acid or sulbactam. Images PMID:1901695

  14. Steady-state kinetics of the binding of beta-lactams and penicilloates to the second binding site of the Enterobacter cloacae P99 beta-lactamase.

    PubMed

    Dryjanski, M; Pratt, R F

    1995-03-21

    Previous research has shown that the class C beta-lactamase of Enterobacter cloacae P99 is able to catalyze the hydrolysis and aminolysis of acyclic depsipeptides. The steady kinetics of these reactions are complicated by the presence of an additional (depsi)peptide binding site in addition to the active site [Pazhanisamy, S., & Pratt, R. F. (1989) Biochemistry 28, 6875-6882]. The present paper presents a steady-state kinetic analysis of the inhibition of depsipeptide hydrolysis by sodium benzylpenicilloate, methyl benzylpenicilloate, 6-aminopenicillanic acid, and 7-aminocephalosporanic acid. The two beta-lactams are considerably poorer substrates than the depsipeptide employed, m-[[(phenylacetyl)glycyl]oxy]benzoic acid. The aim was to determine the relative affinity of these ligands for the active site and the second site. Three types of experiments were employed: (i) measurements of direct inhibition of depsipeptide hydrolysis, (ii) measurements of the effect of an active-site-directed inhibitor, m-(dansylamidophenyl)-boronic acid, on the effectiveness of the ligands as inhibitors, and (iii) measurements of the effect of a preferential second site ligand, N-(phenylacetyl)glycyl-D-phenylalanine, on the effectiveness of the ligands as inhibitors. The results suggest that all four ligands preferentially bind to the active site, with weaker binding at the second site. The necessarily weaker binding of a ligand to the second site when the active site is occupied by a transition-state analog inhibitor was analyzed. Perhaps surprisingly, the intact beta-lactams appeared to bind more firmly to the alternative site than do the flexible penicilloates.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7893652

  15. Detection of Healthcare-Related Extended-Spectrum Beta-Lactamase-Producing Escherichia coli Transmission Events Using Combined Genetic and Phenotypic Epidemiology

    PubMed Central

    Boers, Stefan A.; Jansen, Ruud; Hays, John P.; Goessens, Wil H. F.; Vos, Margreet C.

    2016-01-01

    Background Since the year 2000 there has been a sharp increase in the prevalence of healthcare-related infections caused by extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli. However, the high community prevalence of ESBL-producing E. coli isolates means that many E. coli typing techniques may not be suitable for detecting E. coli transmission events. Therefore, we investigated if High-throughput MultiLocus Sequence Typing (HiMLST) and/or Raman spectroscopy were suitable techniques for detecting recent E. coli transmission events. Methods This study was conducted from January until December 2010 at Erasmus University Medical Center, Rotterdam, the Netherlands. Isolates were typed using HiMLST and Raman spectroscopy. A genetic cluster was defined as two or more patients carrying identical isolates. We used predefined definitions for epidemiological relatedness to assess healthcare-related transmission. Results We included 194 patients; strains of 112 patients were typed using HiMLST and strains of 194 patients were typed using Raman spectroscopy. Raman spectroscopy identified 16 clusters while HiMLST identified 10 clusters. However, no healthcare-related transmission events were detected. When combining data from both typing techniques, we identified eight clusters (n = 34 patients), as well as 78 patients with a non-cluster isolate. However, we could not detect any healthcare-related transmission in these 8 clusters. Conclusions Although clusters were genetically detected using HiMLST and Raman spectroscopy, no definite epidemiological relationships could be demonstrated which makes the possibility of healthcare-related transmission events highly unlikely. Our results suggest that typing of ESBL-producing E. coli using HiMLST and/or Raman spectroscopy is not helpful in detecting E. coli healthcare-related transmission events. PMID:27463231

  16. Mutational analysis of the zinc- and substrate-binding sites in the CphA metallo-beta-lactamase from Aeromonas hydrophila.

    PubMed

    Bebrone, Carine; Anne, Christine; Kerff, Frédéric; Garau, Gianpiero; De Vriendt, Kris; Lantin, Raphaël; Devreese, Bart; Van Beeumen, Jozef; Dideberg, Otto; Frère, Jean-Marie; Galleni, Moreno

    2008-08-15

    The subclass B2 CphA (Carbapenemase hydrolysing Aeromonas) beta-lactamase from Aeromonas hydrophila is a Zn(2+)-containing enzyme that specifically hydrolyses carbapenems. In an effort to evaluate residues potentially involved in metal binding and/or catalysis (His(118), Asp(120), His(196) and His(263)) and in substrate specificity (Val(67), Thr(157), Lys(224) and Lys(226)), site-directed mutants of CphA were generated and characterized. Our results confirm that the first zinc ion is in interaction with Asp(120) and His(263), and thus is located in the 'cysteine' zinc-binding site. His(118) and His(196) residues seem to be interacting with the second zinc ion, as their replacement by alanine residues has a negative effect on the affinity for this second metal ion. Val(67) plays a significant role in the binding of biapenem and benzylpenicillin. The properties of a mutant with a five residue (LFKHV) insertion just after Val(67) also reveals the importance of this region for substrate binding. This latter mutant has a higher affinity for the second zinc ion than wild-type CphA. The T157A mutant exhibits a significantly modified activity spectrum. Analysis of the K224Q and N116H/N220G/K224Q mutants suggests a significant role for Lys(224) in the binding of substrate. Lys(226) is not essential for the binding and hydrolysis of substrates. Thus the present paper helps to elucidate the position of the second zinc ion, which was controversial, and to identify residues important for substrate binding. PMID:18498253

  17. Nosocomial urinary tract infections caused by extended-spectrum beta-lactamase uropathogens: Prevalence, pathogens, risk factors, and strategies for infection control

    PubMed Central

    Bouassida, Khaireddine; Jaidane, Mehdi; Bouallegue, Olfa; Tlili, Ghassen; Naija, Habiba; Mosbah, Ali Tahar

    2016-01-01

    Introduction: Our goal was to investigate the prevalence and antibiogram pattern of extended spectrum beta-lactamase (ESBL) production among uropathogens using isolates from urine samples collected at the Department of Urology in the Sahloul Hospital, Tunisia We also aimed to identify the risk factors for nosocomial urinary tract infections (UTIs) in patients who underwent transurethral resection of the prostate (TURP) and the measures for infection control. Methods: Laboratory records of a five-year period from January 2004 to December 2008 were submitted for retrospective analysis to determine the incidence of ESBL infections. A total of 276 isolates were collected. A case-control study involving comparisons between two groups of patients who underwent TURP was performed to determine the risk factors for ESBL infection. Group 1, designated case subjects, included 51 patients with nosocomial UTI after TURP. Group 2, designated control subjects, consisted of 58 randomly selected patients who underwent TURP without nosocomial UTI in the same period. Factors suspected to be implicated in the emergence of ESBL infection were compared between the two groups in order to identify risk factors for infection. A univariate regression analysis was performed, followed by a multivariate one. Results: The annual prevalence of ESBL infection ranged from 1.3–2.5%. After performing univariate and multivariate regression analysis, the main risk factors for ESBL infections were identified as: use of antibiotics the year preceding the admission, duration of catheter use, and bladder washout (p=0.012, p=0.019, and p<0.001. Conclusions: Urologists have to perform a good hemostasis, especially in endoscopic resections, in order to avoid bladder irrigation and bladder washout and to reduce the time of bladder catheterization, which is a strong risk factor of nosocomial UTIs. PMID:27330585

  18. Prevalence of extended spectrum beta-lactamase production among uropathogens in south Mumbai and its antibiogram pattern

    PubMed Central

    Aruna, K.; Mobashshera, T.

    2012-01-01

    β-lactams are the most widely used group of antimicrobials. However, increasing resistance to these valuable drugs in uropathogens, mediated principally by β-lactamases, has become a major concern. The present study was undertaken to determine the prevalence of Extended Spectrum β-Lactamase (ESBL) producers in clinical isolates of urine specimens, collected from various healthcare centres across south Mumbai. A total of 195 gram negative urine isolates were identified as Pseudomonas aeruginosa (13), Proteus mirabilis (21), Klebsiella pneumoniae (29), Escherichia coli (96), Enterobacter aerogenes (1), Enterobacter cloacae (1), Enterococcus fecalis (1), Morganella morganii (1), Citrobacter diversus (16), Citrobacter amalonaticus (5) and Proteus vulgaris (11). Antimicrobial Susceptibility Testing (AST) by Kirby-Bauer method showed 43.07 % (84/195) of the isolates were resistant to more than 70 % of the antibiotics used. Confirmatory screening using a combination of Double Disk Synergy Test (DDST), Phenotypic Confirmatory Disc Diffusion Test (PCDDT) and E-test revealed the overall prevalence of ESBL producers to be 34.71 % (68/195). The study showed 72.05 % of the ESBL producers to be resistant to fluoroquinolones, highlighting its extensive use in the region of south Mumbai. All ESBL producers were found to be sensitive to Imipenem whereas 82.36 % showed susceptibility to Amikacin making these 2 antibiotics the most effective choice of drug against ESBLs. In order to ensure rational treatment of highly resistant pathogens, the occurrence of ESBL and its primary studies may serve as a base for further research and findings.

  19. Molecular characterization of antimicrobial resistance in enterococci and Escherichia coli isolates from European wild rabbit (Oryctolagus cuniculus).

    PubMed

    Silva, Nuno; Igrejas, Gilberto; Figueiredo, Nicholas; Gonçalves, Alexandre; Radhouani, Hajer; Rodrigues, Jorge; Poeta, Patrícia

    2010-09-15

    A total of 44 Escherichia coli and 64 enterococci recovered from 77 intestinal samples of wild European rabbits in Portugal were analyzed for resistance to antimicrobial agents. Resistance in E. coli isolates was observed for ampicillin, tetracycline, sulfamethoxazole/trimethoprim, streptomycin, gentamicin, tobramycin, nalidixic acid, ciprofloxacin and chloramphenicol. None of the E. coli isolates produced extended-spectrum beta-lactamases (ESBLs). The bla(TEM), aadA, aac(3)-II, tet(A) and/or tet(B), and the catA genes were demonstrated in all ampicillin, streptomycin, gentamicin, tetracycline, and chloramphenicol-resistant isolates respectively, and the sul1 and/or sul2 and/or sul3 genes in 4 of 5 sulfamethoxazole/trimethoprim resistant isolates. Of the enterococcal isolates, Enterococcus faecalis was the most prevalent detected species (39 isolates), followed by E. faecium (21 isolates) and E. hirae (4 isolates). More than one-fourth (29.7%) of the isolates were resistant to tetracycline; 20.3% were resistant to erythromycin, 14.1% were resistant to ciprofloxacin and 10.9% were resistant to high-level-kanamycin. Lower level of resistance (<10%) was detected for ampicillin, quinupristin/dalfopristin and high-level-gentamicin, -streptomycin. No vancomycin-resistance was detected in the enterococci isolates. Resistance genes detected included aac(6')-aph(2''), ant(6)-Ia, tet(M) and/or tet(L) in all gentamicin, streptomycin and tetracycline-resistant isolates respectively. The aph(3')-IIIa gene was detected in 6 of 7 kanamycin-resistant isolates, the erm(B) gene in 11 of 13 erythromycin-resistant isolates and the vat(D) gene in the quinupristin/dalfopristin-resistant E. faecium isolate. This survey showed that faecal bacteria such as E. coli and enterococci of wild rabbits could be a reservoir of antimicrobial resistance genes. PMID:20624632

  20. Mechanisms of antimicrobial resistance in Gram-negative bacilli.

    PubMed

    Ruppé, Étienne; Woerther, Paul-Louis; Barbier, François

    2015-12-01

    The burden of multidrug resistance in Gram-negative bacilli (GNB) now represents a daily issue for the management of antimicrobial therapy in intensive care unit (ICU) patients. In Enterobacteriaceae, the dramatic increase in the rates of resistance to third-generation cephalosporins mainly results from the spread of plasmid-borne extended-spectrum beta-lactamase (ESBL), especially those belonging to the CTX-M family. The efficacy of beta-lactam/beta-lactamase inhibitor associations for severe infections due to ESBL-producing Enterobacteriaceae has not been adequately evaluated in critically ill patients, and carbapenems still stands as the first-line choice in this situation. However, carbapenemase-producing strains have emerged worldwide over the past decade. VIM- and NDM-type metallo-beta-lactamases, OXA-48 and KPC appear as the most successful enzymes and may threaten the efficacy of carbapenems in the near future. ESBL- and carbapenemase-encoding plasmids frequently bear resistance determinants for other antimicrobial classes, including aminoglycosides (aminoglycoside-modifying enzymes or 16S rRNA methylases) and fluoroquinolones (Qnr, AAC(6')-Ib-cr or efflux pumps), a key feature that fosters the spread of multidrug resistance in Enterobacteriaceae. In non-fermenting GNB such as Pseudomonas aeruginosa, Acinetobacter baumannii and Stenotrophomonas maltophilia, multidrug resistance may emerge following the sole occurrence of sequential chromosomal mutations, which may lead to the overproduction of intrinsic beta-lactamases, hyper-expression of efflux pumps, target modifications and permeability alterations. P. aeruginosa and A. baumannii also have the ability to acquire mobile genetic elements encoding resistance determinants, including carbapenemases. Available options for the treatment of ICU-acquired infections due to carbapenem-resistant GNB are currently scarce, and recent reports emphasizing the spread of colistin resistance in environments with high

  1. Gene flow from glyphosate-resistant crops.

    PubMed

    Mallory-Smith, Carol; Zapiola, Maria

    2008-04-01

    Gene flow from transgenic glyphosate-resistant crops can result in the adventitious presence of the transgene, which may negatively impact markets. Gene flow can also produce glyphosate-resistant plants that may interfere with weed management systems. The objective of this article is to review the gene flow literature as it pertains to glyphosate-resistant crops. Gene flow is a natural phenomenon not unique to transgenic crops and can occur via pollen, seed and, in some cases, vegetative propagules. Gene flow via pollen can occur in all crops, even those that are considered to be self-pollinated, because all have low levels of outcrossing. Gene flow via seed or vegetative propagules occurs when they are moved naturally or by humans during crop production and commercialization. There are many factors that influence gene flow; therefore, it is difficult to prevent or predict. Gene flow via pollen and seed from glyphosate-resistant canola and creeping bentgrass fields has been documented. The adventitious presence of the transgene responsible for glyphosate resistance has been found in commercial seed lots of canola, corn and soybeans. In general, the glyphosate-resistant trait is not considered to provide an ecological advantage. However, regulators should consider the examples of gene flow from glyphosate-resistant crops when formulating rules for the release of crops with traits that could negatively impact the environment or human health. PMID:18181145

  2. Enhancing Plant Disease Resistance without R Genes.

    PubMed

    Sarma, Birinchi Kumar; Singh, Harikesh Bahadur; Fernando, Dilantha; Silva, Roberto Nascimento; Gupta, Vijai Kumar

    2016-07-01

    Crop plants encounter constant biotic challenges, and these challenges have historically been best managed with resistance (R) genes. However, the rapid evolution of new pathogenic strains along with the nonavailability or nonidentification of R genes in cultivated crop species against a large number of plant pathogens have led researchers to think beyond R genes. Biotechnological tools have shown promise in dealing with such challenges. Technologies such as transgenerational plant immunity, interspecies transfer of pattern recognition receptors (PRRs), pathogen-derived resistance (PDR), gene regulation, and expression of