Science.gov

Sample records for binds negatively charged

  1. Binding of monovalent alkali metal ions with negatively charged phospholipid membranes.

    PubMed

    Maity, Pabitra; Saha, Baishakhi; Kumar, Gopinatha Suresh; Karmakar, Sanat

    2016-04-01

    We have systematically investigated the effect of various alkali metal ions with negatively charged phospholipid membranes. Size distributions of large unilamellar vesicles have been confirmed using dynamic light scattering. Zeta potential and effective charges per vesicle in the presence of various alkali metal ions have been estimated from the measured electrophoretic mobility. We have determined the intrinsic binding constant from the zeta potential using electrostatic double layer theory. The reasonable and consistent value of the intrinsic binding constant of Na(+), found at moderate NaCl concentration (10-100 mM), indicates that the Gouy-Chapman theory cannot be applied for very high (> 100mM) and very low (< 10 mM) electrolyte concentrations. The isothermal titration calorimetry study has revealed that the net binding heat of interaction of the negatively charged vesicles with monovalent alkali metal ions is small and comparable to those obtained from neutral phosphatidylcholine vesicles. The overall endothermic response of binding heat suggests that interaction is primarily entropy driven. The entropy gain might arise due to the release of water molecules from the hydration layer vicinity of the membranes. Therefore, the partition model which does not include the electrostatic contribution suffices to describe the interaction. The binding constant of Na(+) (2.4 ± 0.1 M(-1)), obtained from the ITC, is in agreement with that estimated from the zeta potential (-2.0 M(-1)) at moderate salt concentrations. Our results suggest that hydration dynamics may play a vital role in the membrane solution interface which strongly affects the ion-membrane interaction. PMID:26802251

  2. The Negatively Charged Regions of Lactoferrin Binding Protein B, an Adaptation against Anti-Microbial Peptides

    PubMed Central

    Morgenthau, Ari; Beddek, Amanda; Schryvers, Anthony B.

    2014-01-01

    Lactoferrin binding protein B (LbpB) is a bi-lobed membrane bound lipoprotein that is part of the lactoferrin receptor complex in a variety of Gram-negative pathogens. Despite high sequence diversity among LbpBs from various strains and species, a cluster of negatively charged amino acids is invariably present in the protein’s C-terminal lobe in all species except Moraxella bovis. The function of LbpB in iron acquisition has yet to be experimentally demonstrated, whereas in vitro studies have shown that LbpB confers protection against lactoferricin, a short cationic antimicrobial peptide released from the N- terminus of lactoferrin. In this study we demonstrate that the negatively charged regions can be removed from the Neisseria meningitidis LbpB without compromising stability, and this results in the inability of LbpB to protect against the bactericidal effects of lactoferricin. The release of LbpB from the cell surface by the autotransporter NalP reduces the protection against lactoferricin in the in vitro killing assay, attributed to removal of LbpB during washing steps, but is unlikely to have a similar impact in vivo. The protective effect of the negatively charged polysaccharide capsule in the killing assay was less than the protection conferred by LbpB, suggesting that LbpB plays a major role in protection against cationic antimicrobial peptides in vivo. The selective release of LbpB by NalP has been proposed to be a mechanism for evading the adaptive immune response, by reducing the antibody binding to the cell surface, but may also provide insights into the primary function of LbpB in vivo. Although TbpB and LbpB have been shown to be major targets of the human immune response, the selective release of LbpB suggests that unlike TbpB, LbpB may not be essential for iron acquisition, but important for protection against cationic antimicrobial peptides. PMID:24465982

  3. The negatively charged regions of lactoferrin binding protein B, an adaptation against anti-microbial peptides.

    PubMed

    Morgenthau, Ari; Beddek, Amanda; Schryvers, Anthony B

    2014-01-01

    Lactoferrin binding protein B (LbpB) is a bi-lobed membrane bound lipoprotein that is part of the lactoferrin receptor complex in a variety of Gram-negative pathogens. Despite high sequence diversity among LbpBs from various strains and species, a cluster of negatively charged amino acids is invariably present in the protein's C-terminal lobe in all species except Moraxella bovis. The function of LbpB in iron acquisition has yet to be experimentally demonstrated, whereas in vitro studies have shown that LbpB confers protection against lactoferricin, a short cationic antimicrobial peptide released from the N- terminus of lactoferrin. In this study we demonstrate that the negatively charged regions can be removed from the Neisseria meningitidis LbpB without compromising stability, and this results in the inability of LbpB to protect against the bactericidal effects of lactoferricin. The release of LbpB from the cell surface by the autotransporter NalP reduces the protection against lactoferricin in the in vitro killing assay, attributed to removal of LbpB during washing steps, but is unlikely to have a similar impact in vivo. The protective effect of the negatively charged polysaccharide capsule in the killing assay was less than the protection conferred by LbpB, suggesting that LbpB plays a major role in protection against cationic antimicrobial peptides in vivo. The selective release of LbpB by NalP has been proposed to be a mechanism for evading the adaptive immune response, by reducing the antibody binding to the cell surface, but may also provide insights into the primary function of LbpB in vivo. Although TbpB and LbpB have been shown to be major targets of the human immune response, the selective release of LbpB suggests that unlike TbpB, LbpB may not be essential for iron acquisition, but important for protection against cationic antimicrobial peptides. PMID:24465982

  4. Photodetachment of gaseous multiply charged anions, copper phthalocyanine tetrasulfonate tetraanion: Tuning molecular electronic energy levels by charging and negative electron binding

    SciTech Connect

    Wang, X.B.; Ferris, K.; Wang, L.S.

    2000-01-13

    The authors report photodetachment photoelectron spectroscopy (PES) of gaseous copper phthalocyanine (CuPc) tetrasulfonate quadruply charged anions, [CuPc(SO{sub 3}){sub 4}]{sup 4{minus}}, and its monoprotonated and -sodiumated triply charged anions, [CuPc(SO{sub 3}){sub 4}H]{sup 3{minus}} and [CuPc(SO{sub 3}){sub 4}Na]{sup 3{minus}}. The [CuPc(SO{sub 3}){sub 4}]{sup 4{minus}} tetraanion was found to possess a negative electron binding energy of {minus}0.9 eV, whereas the trianions have binding energies of 1.0 and 1.2 eV for the sodiumated and protonated species, respectively. The PES spectral features of the three multiply charged anions were observed to be similar to that of the parent CuPc neutral molecule, except that the anions have lower binding energies due to the presence of the negative charges ({minus}SO{sub 3}{sup {minus}}). The data thus suggested a stepwise tuning of the molecular electronic energy levels of the CuPc molecule through charging, wherein the molecular orbital energies of the parent molecule were systematically pushed up by the negative charges. The authors further carried out semiempirical calculations, which provided insight into the nature of the localized charges on the peripheral {minus}SO{sub 3}{sup {minus}} groups and the intramolecular electrostatic interactions in the multiply charged anions and confirmed the interpretation of the stepwise tuning of molecular energy levels by charging. Photon energy-dependent studies revealed the effects of the repulsive Coulomb barriers on the photodetachment PES spectra of the multiply charged anions. The barrier heights were estimated to be about 3.5 and 2.5 eV for the tetra- and trianions, respectively. The authors also observed excited states for the multiply charged anions and resonant tunneling through the repulsive Coulomb barriers via the excited states.

  5. Bid binding to negatively charged phospholipids may not be required for its pro-apoptotic activity in vivo

    PubMed Central

    Manara, Anna; Lindsay, Jennefer; Marchioretto, Marta; Astegno, Alessandra; Gilmore, Andrew P.; Esposti, Mauro Degli; Crimi, Massimo

    2010-01-01

    Bid is a ubiquitous pro-apoptotic member of the Bcl-2 family that has been involved in a variety of pathways of cell death. Unique among pro-apoptotic proteins, Bid is activated after cleavage by the apical caspases of the extrinsic pathway; subsequently it moves to mitochondria, where it promotes the release of apoptogenic proteins in concert with other Bcl-2 family proteins like Bak. Diverse factors appear to modulate the pro-apoptotic action of Bid, from its avid binding to mitochondrial lipids (in particular, cardiolipin) to multiple phosphorylations at sites that can modulate its caspase cleavage. This work addresses the question of how the lipid interactions of Bid that are evident in vitro actually impact on its pro-apoptotic action within cells. Using site-directed mutagenesis, we identified mutations that reduced mouse Bid lipid binding in vitro. Mutation of the conserved residue Lys157 specifically decreased the binding to negatively charged lipids related to cardiolipin and additionally affected the rate of caspase cleavage. However, this lipid-binding mutant had no discernable effect on Bid pro-apoptotic function in vivo. The results are interpreted in relation to an underlying interaction of Bid with lysophosphatidylcholine, which is not disrupted in any mutant retaining pro-apoptotic function both in vitro and in vivo. PMID:19463967

  6. Hydrogen Bonding and Binding of Polybasic Residues with Negatively Charged Mixed Lipid Monolayers

    SciTech Connect

    Lorenz, C.; Feraudo, J.; Travesset, A.

    2008-01-23

    Phosphoinositides, phosphorylated products of phosphatidylinositol, are a family of phospholipids present in tiny amounts (1% or less) in the cytosolic surface of cell membranes, yet they play an astonishingly rich regulatory role, particularly in signaling processes. In this letter, we use molecular dynamics simulations on a model system of mixed lipid monolayers to investigate the interaction of phosphatidylinositol 4,5-bisphosphate (PIP{sub 2}), the most common of the phosphoinositides, with a polybasic peptide consisting of 13 lysines. Our results show that the polybasic peptide sequesters three PIP{sub 2} molecules, forming a complex stabilized by the formation of multiple hydrogen bonds between PIP{sub 2} and the Lys residues. We also show that the polybasic peptide does not sequester other charged phospholipids such as phosphatidylserine because of the inability to form long-lived stable hydrogen bonds.

  7. Cationic Cell-Penetrating Peptide Binds to Planar Lipid Bilayers Containing Negatively Charged Lipids but does not Induce Conductive Pores

    PubMed Central

    Gurnev, Philip A.; Yang, Sung-Tae; Melikov, Kamran C.; Chernomordik, Leonid V.; Bezrukov, Sergey M.

    2013-01-01

    Using a cation-selective gramicidin A channel as a sensor of the membrane surface charge, we studied interactions of oligoarginine peptide R9C, a prototype cationic cell-penetrating peptide (CPP), with planar lipid membranes. We have found that R9C sorption to the membrane depends strongly on its lipid composition from virtually nonexistent for membranes made of uncharged lipids to very pronounced for membranes containing negatively charged lipids, with charge overcompensation at R9C concentrations exceeding 1 μM. The sorption was reversible as it was removed by addition of polyanionic dextran sulfate to the membrane bathing solution. No membrane poration activity of R9C (as would be manifested by increased bilayer conductance) was detected in the charged or neutral membranes, including those with asymmetric negative/neutral and negative/positive lipid leaflets. We conclude that interaction of R9C with planar lipid bilayers does not involve pore formation in all studied lipid combinations up to 20 μM peptide concentration. However, R9C induces leakage of negatively charged but not neutral liposomes in a process that involves lipid mixing between liposomes. Our findings suggest that direct traversing of CPPs through the uncharged outer leaflet of the plasma membrane bilayer is unlikely and that permeabilization necessarily involves both anionic lipids and CPP-dependent fusion between opposing membranes. PMID:23663836

  8. Linear free energy relationships for metal-ligand complexation: Bidentate binding to negatively-charged oxygen donor atoms

    NASA Astrophysics Data System (ADS)

    Carbonaro, Richard F.; Atalay, Yasemin B.; Di Toro, Dominic M.

    2011-05-01

    Stability constants for metal complexation to bidentate ligands containing negatively-charged oxygen donor atoms can be estimated from the following linear free energy relationship (LFER): log KML = χOO( αO log KHL,1 + αO log KHL,2) where KML is the metal-ligand stability constant for a 1:1 complex, KHL,1 and KHL,2 are the proton-ligand stability constants (the ligand p Ka values), and αO is the Irving-Rossotti slope. The parameter χOO is metal specific and has slightly different values for five and six membered chelate rings. LFERs are presented for 21 different metal ions and are accurate to within approximately 0.30 log units in predictions of log KML values. Ligands selected for use in LFER development include dicarboxylic acids, carboxyphenols, and ortho-diphenols. For ortho-hydroxybenzaldehydes, α-hydroxycarboxylic acids, and α-ketocarboxylic acids, a modification of the LFER where log KHL,2 is set equal to zero is required. The chemical interpretation of χOO is that it accounts for the extra stability afforded to metal complexes by the chelate effect. Cu-NOM binding constants calculated from the bidentate LFERs are similar in magnitude to those used in WHAM 6. This LFER can be used to make log KML predictions for small organic molecules. Since natural organic matter (NOM) contains many of the same functional groups (i.e. carboxylic acids, phenols, alcohols), the LFER log KML predictions shed light on the range of appropriate values for use in modeling metal partitioning in natural systems.

  9. Water Dispersible, Positively and Negatively Charged MoS2 Nanosheets: Surface Chemistry and the Role of Surfactant Binding.

    PubMed

    Gupta, Amit; Arunachalam, Vaishali; Vasudevan, Sukumaran

    2015-02-19

    Stable aqueous dispersions of atomically thin layered MoS2 nanosheets have been obtained by sonication in the presence of ionic surfactants. The dispersions are stabilized by electrostatic repulsion between the sheets, and we show that the sign of the charge on the MoS2 nanosheets, either positive or negative, can be can be controlled by the choice of the surfactant. Using techniques from solution NMR, we show that the surfactant chains are weakly bound to the MoS2 sheets and undergo rapid exchange with free surfactant chains present in the dispersion. In situ nuclear Overhauser effect spectroscopic measurements provide direct evidence that the surfactant chains lie flat, arranged randomly on the basal plane of the MoS2 nanosheets with their charged headgroup exposed. These results provide a chemical perspective for understanding the stability of these inorganic nanosheets in aqueous dispersions and the origin of the charge on the sheets. PMID:26262496

  10. Selective binding of IgG4 and other negatively charged plasma proteins in normal and diabetic human kidneys.

    PubMed Central

    Melvin, T.; Kim, Y.; Michael, A. F.

    1984-01-01

    Renal tissue from 9 patients with diabetes mellitus (4 with mild and 5 with end-stage disease) and 3 with antiglomerular basement membrane (GBM) nephritis, as well as 5 normal human kidneys, were examined by immunofluorescence microscopy for the presence of plasma proteins of varying isoelectric point (pI). In normal and diabetic kidneys, IgG deposition in basement membranes was restricted to IgG4 (pI 5.5-6.0), the subclass present in lowest concentration in human plasma. IgG1, IgG2, and IgG3 (pI 7.0-9.5) were not detected. In contrast, in anti-GBM nephritis, all four subclasses were present in a linear pattern in GBM. Other plasma proteins of low isoelectric point were detected in basement membranes: albumin (pI 4.9), alpha-1-acid glycoprotein (pI 2.7), amyloid P (pI 3.9-4.8), and alpha-1-antitrypsin (pI 4.5). These studies are consistent with the hypothesis that circulating anionic plasma proteins are electrostatically bound in vivo to positively charged moieties in normal and especially diabetic basement membranes. Images Figure 1 PMID:6375393

  11. Structural basis of UDP-galactose binding by alpha-1,3-galactosyltransferase (alpha3GT): role of negative charge on aspartic acid 316 in structure and activity.

    PubMed

    Tumbale, Percy; Jamaluddin, Haryati; Thiyagarajan, Nethaji; Brew, Keith; Acharya, K Ravi

    2008-08-19

    alpha-1,3-Galactosyltransferase (alpha3GT) catalyzes the transfer of galactose from UDP-galactose to form an alpha 1-3 link with beta-linked galactosides; it is part of a family of homologous retaining glycosyltransferases that includes the histo-blood group A and B glycosyltransferases, Forssman glycolipid synthase, iGb3 synthase, and some uncharacterized prokaryotic glycosyltransferases. In mammals, the presence or absence of active forms of these enzymes results in antigenic differences between individuals and species that modulate the interplay between the immune system and pathogens. The catalytic mechanism of alpha3GT is controversial, but the structure of an enzyme complex with the donor substrate could illuminate both this and the basis of donor substrate specificity. We report here the structure of the complex of a low-activity mutant alpha3GT with UDP-galactose (UDP-gal) exhibiting a bent configuration stabilized by interactions of the galactose with multiple residues in the enzyme including those in a highly conserved region (His315 to Ser318). Analysis of the properties of mutants containing substitutions for these residues shows that catalytic activity is strongly affected by His315 and Asp316. The negative charge of Asp316 is crucial for catalytic activity, and structural studies of two mutants show that its interaction with Arg202 is needed for an active site structure that facilitates the binding of UDP-gal in a catalytically competent conformation. PMID:18651752

  12. Architecture and RNA binding of the human negative elongation factor

    PubMed Central

    Vos, Seychelle M; Pöllmann, David; Caizzi, Livia; Hofmann, Katharina B; Rombaut, Pascaline; Zimniak, Tomasz; Herzog, Franz; Cramer, Patrick

    2016-01-01

    Transcription regulation in metazoans often involves promoter-proximal pausing of RNA polymerase (Pol) II, which requires the 4-subunit negative elongation factor (NELF). Here we discern the functional architecture of human NELF through X-ray crystallography, protein crosslinking, biochemical assays, and RNA crosslinking in cells. We identify a NELF core subcomplex formed by conserved regions in subunits NELF-A and NELF-C, and resolve its crystal structure. The NELF-AC subcomplex binds single-stranded nucleic acids in vitro, and NELF-C associates with RNA in vivo. A positively charged face of NELF-AC is involved in RNA binding, whereas the opposite face of the NELF-AC subcomplex binds NELF-B. NELF-B is predicted to form a HEAT repeat fold, also binds RNA in vivo, and anchors the subunit NELF-E, which is confirmed to bind RNA in vivo. These results reveal the three-dimensional architecture and three RNA-binding faces of NELF. DOI: http://dx.doi.org/10.7554/eLife.14981.001 PMID:27282391

  13. Iodide uptake by negatively charged clay interlayers?

    PubMed

    Miller, Andrew; Kruichak, Jessica; Mills, Melissa; Wang, Yifeng

    2015-09-01

    Understanding iodide interactions with clay minerals is critical to quantifying risk associated with nuclear waste disposal. Current thought assumes that iodide does not interact directly with clay minerals due to electrical repulsion between the iodide and the negatively charged clay layers. However, a growing body of work indicates a weak interaction between iodide and clays. The goal of this contribution is to report a conceptual model for iodide interaction with clays by considering clay mineral structures and emergent behaviors of chemical species in confined spaces. To approach the problem, a suite of clay minerals was used with varying degrees of isomorphic substitution, chemical composition, and mineral structure. Iodide uptake experiments were completed with each of these minerals in a range of swamping electrolyte identities (NaCl, NaBr, KCl) and concentrations. Iodide uptake behaviors form distinct trends with cation exchange capacity and mineral structure. These trends change substantially with electrolyte composition and concentration, but do not appear to be affected by solution pH. The experimental results suggest that iodide may directly interact with clays by forming ion-pairs (e.g., NaI(aq)) which may concentrate within the interlayer space as well as the thin areas surrounding the clay particle where water behavior is more structured relative to bulk water. Ion pairing and iodide concentration in these zones is probably driven by the reduced dielectric constant of water in confined space and by the relatively high polarizability of the iodide species. PMID:26057987

  14. The formation of negatively charged particles in thermoemission plasmas

    SciTech Connect

    Vishnyakov, V. I. Dragan, G. S.; Florko, A. V.

    2008-01-15

    The results of measuring the charges of the magnesium oxide particles formed near a block of metallic magnesium burning in air are presented. It has been found that, apart from positively charged magnesium oxide particles, there are negatively charged particles in the thermoemission plasma of the burning products. It has been shown that within the framework of the model of neutralizing charges, the oxide particles can acquire unlike charges in the thermoemission plasma. The calculations agree with the experimental data.

  15. The formation of negatively charged particles in thermoemission plasmas

    NASA Astrophysics Data System (ADS)

    Vishnyakov, V. I.; Dragan, G. S.; Florko, A. V.

    2008-01-01

    The results of measuring the charges of the magnesium oxide particles formed near a block of metallic magnesium burning in air are presented. It has been found that, apart from positively charged magnesium oxide particles, there are negatively charged particles in the thermoemission plasma of the burning products. It has been shown that within the framework of the model of neutralizing charges, the oxide particles can acquire unlike charges in the thermoemission plasma. The calculations agree with the experimental data.

  16. Is the negative glow plasma of a direct current glow discharge negatively charged?

    NASA Astrophysics Data System (ADS)

    Bogdanov, E. A.; Demidov, V. I.; Kudryavtsev, A. A.; Saifutdinov, A. I.

    2015-02-01

    A classic problem in gas discharge physics is discussed: what is the sign of charge density in the negative glow region of a glow discharge? It is shown that traditional interpretations in text-books on gas discharge physics that states a negative charge of the negative glow plasma are based on analogies with a simple one-dimensional model of discharge. Because the real glow discharges with a positive column are always two-dimensional, the transversal (radial) term in divergence with the electric field can provide a non-monotonic axial profile of charge density in the plasma, while maintaining a positive sign. The numerical calculation of glow discharge is presented, showing a positive space charge in the negative glow under conditions, where a one-dimensional model of the discharge would predict a negative space charge.

  17. Is the negative glow plasma of a direct current glow discharge negatively charged?

    SciTech Connect

    Bogdanov, E. A.; Saifutdinov, A. I.; Demidov, V. I.; Kudryavtsev, A. A.

    2015-02-15

    A classic problem in gas discharge physics is discussed: what is the sign of charge density in the negative glow region of a glow discharge? It is shown that traditional interpretations in text-books on gas discharge physics that states a negative charge of the negative glow plasma are based on analogies with a simple one-dimensional model of discharge. Because the real glow discharges with a positive column are always two-dimensional, the transversal (radial) term in divergence with the electric field can provide a non-monotonic axial profile of charge density in the plasma, while maintaining a positive sign. The numerical calculation of glow discharge is presented, showing a positive space charge in the negative glow under conditions, where a one-dimensional model of the discharge would predict a negative space charge.

  18. Evaluating the Effect of Ionic Strength on Duplex Stability for PNA Having Negatively or Positively Charged Side Chains

    PubMed Central

    De Costa, N. Tilani S.; Heemstra, Jennifer M.

    2013-01-01

    The enhanced thermodynamic stability of PNA:DNA and PNA:RNA duplexes compared with DNA:DNA and DNA:RNA duplexes has been attributed in part to the lack of electrostatic repulsion between the uncharged PNA backbone and negatively charged DNA or RNA backbone. However, there are no previously reported studies that systematically evaluate the effect of ionic strength on duplex stability for PNA having a charged backbone. Here we investigate the role of charge repulsion in PNA binding by synthesizing PNA strands having negatively or positively charged side chains, then measuring their duplex stability with DNA or RNA at varying salt concentrations. At low salt concentrations, positively charged PNA binds more strongly to DNA and RNA than does negatively charged PNA. However, at medium to high salt concentrations, this trend is reversed, and negatively charged PNA shows higher affinity for DNA and RNA than does positively charged PNA. These results show that charge screening by counterions in solution enables negatively charged side chains to be incorporated into the PNA backbone without reducing duplex stability with DNA and RNA. This research provides new insight into the role of electrostatics in PNA binding, and demonstrates that introduction of negatively charged side chains is not significantly detrimental to PNA binding affinity at physiological ionic strength. The ability to incorporate negative charge without sacrificing binding affinity is anticipated to enable the development of PNA therapeutics that take advantage of both the inherent benefits of PNA and the multitude of charge-based delivery technologies currently being developed for DNA and RNA. PMID:23484047

  19. Evaluating the effect of ionic strength on duplex stability for PNA having negatively or positively charged side chains.

    PubMed

    De Costa, N Tilani S; Heemstra, Jennifer M

    2013-01-01

    The enhanced thermodynamic stability of PNA:DNA and PNA:RNA duplexes compared with DNA:DNA and DNA:RNA duplexes has been attributed in part to the lack of electrostatic repulsion between the uncharged PNA backbone and negatively charged DNA or RNA backbone. However, there are no previously reported studies that systematically evaluate the effect of ionic strength on duplex stability for PNA having a charged backbone. Here we investigate the role of charge repulsion in PNA binding by synthesizing PNA strands having negatively or positively charged side chains, then measuring their duplex stability with DNA or RNA at varying salt concentrations. At low salt concentrations, positively charged PNA binds more strongly to DNA and RNA than does negatively charged PNA. However, at medium to high salt concentrations, this trend is reversed, and negatively charged PNA shows higher affinity for DNA and RNA than does positively charged PNA. These results show that charge screening by counterions in solution enables negatively charged side chains to be incorporated into the PNA backbone without reducing duplex stability with DNA and RNA. This research provides new insight into the role of electrostatics in PNA binding, and demonstrates that introduction of negatively charged side chains is not significantly detrimental to PNA binding affinity at physiological ionic strength. The ability to incorporate negative charge without sacrificing binding affinity is anticipated to enable the development of PNA therapeutics that take advantage of both the inherent benefits of PNA and the multitude of charge-based delivery technologies currently being developed for DNA and RNA. PMID:23484047

  20. Electrostatic Power Generation from Negatively Charged, Simulated Lunar Regolith

    NASA Technical Reports Server (NTRS)

    Choi, Sang H.; King, Glen C.; Kim, Hyun-Jung; Park, Yeonjoon

    2010-01-01

    Research was conducted to develop an electrostatic power generator for future lunar missions that facilitate the utilization of lunar resources. The lunar surface is known to be negatively charged from the constant bombardment of electrons and protons from the solar wind. The resulting negative electrostatic charge on the dust particles, in the lunar vacuum, causes them to repel each other minimizing the potential. The result is a layer of suspended dust about one meter above the lunar surface. This phenomenon was observed by both Clementine and Surveyor spacecrafts. During the Apollo 17 lunar landing, the charged dust was a major hindrance, as it was attracted to the astronauts' spacesuits, equipment, and the lunar buggies. The dust accumulated on the spacesuits caused reduced visibility for the astronauts, and was unavoidably transported inside the spacecraft where it caused breathing irritation [1]. In the lunar vacuum, the maximum charge on the particles can be extremely high. An article in the journal "Nature", titled "Moon too static for astronauts?" (Feb 2, 2007) estimates that the lunar surface is charged with up to several thousand volts [2]. The electrostatic power generator was devised to alleviate the hazardous effects of negatively charged lunar soil by neutralizing the charged particles through capacitive coupling and thereby simultaneously harnessing power through electric charging [3]. The amount of power generated or collected is dependent on the areal coverage of the device and hovering speed over the lunar soil surface. A thin-film array of capacitors can be continuously charged and sequentially discharged using a time-differentiated trigger discharge process to produce a pulse train of discharge for DC mode output. By controlling the pulse interval, the DC mode power can be modulated for powering devices and equipment. In conjunction with a power storage system, the electrostatic power generator can be a power source for a lunar rover or other

  1. Arabinogalactan proteins are incorporated in negatively charged coffee brew melanoidins.

    PubMed

    Bekedam, E Koen; De Laat, Marieke P F C; Schols, Henk A; Van Boekel, Martinus A J S; Smit, Gerrit

    2007-02-01

    The charge properties of melanoidins in high molecular weight (HMw) coffee brew fractions, isolated by diafiltration and membrane dialysis, were studied. Ion exchange chromatography experiments with the HMw fractions showed that coffee brew melanoidins were negatively charged whereas these molecules did not expose any positive charge at the pH of coffee brew. Fractions with different ionic charges were isolated and subsequently characterized by means of the specific extinction coefficient (K(mix 405nm)), sugar composition, phenolic group content, nitrogen content, and the arabinogalactan protein (AGP) specific Yariv gel-diffusion assay. The isolated fractions were different in composition and AGP was found to be present in one of the HMw fractions. The AGP accounted for 6% of the coffee brew dry matter and had a moderate negative charge, probably caused by the presence of uronic acids. As the fraction that precipitated with Yariv was brown (K(mix 405nm) = 1.2), compared to a white color in the green bean, it was concluded that these AGPs had undergone Maillard reaction resulting in an AGP-melanoidin complex. The presence of mannose (presumably from galactomannan) indicates the incorporation of galactomannans in the AGP-melanoidin complex. As the uronic acid content in the more negatively charged melanoidin-rich, AGP-poor HMw fractions decreased, it was hypothesized that acidic groups are formed or incorporated during melanoidin formation. PMID:17263472

  2. How Do Distance and Solvent Affect Halogen Bonding Involving Negatively Charged Donors?

    PubMed

    Chen, Zhaoqiang; Wang, Guimin; Xu, Zhijian; Wang, Jinan; Yu, Yuqi; Cai, Tingting; Shao, Qiang; Shi, Jiye; Zhu, Weiliang

    2016-09-01

    It was reported that negatively charged donors can form halogen bonding, which is stable, especially, in a polar environment. On the basis of a survey of the Protein Data Bank, we noticed that the distance between the negative charge center and the halogen atom of an organohalogen may vary greatly. Therefore, a series of model systems, composed of 4-halophenyl-conjugated polyene acids and ammonia, were designed to explore the potential effect of distance on halogen bonding in different solvents. Quantum mechanics (QM) calculations demonstrated that the longer the distance, the stronger the bonding. The energy decomposition analysis on all of the model systems demonstrated that electrostatic interaction contributes the most (44-56%) to the overall binding, followed by orbital interaction (42-36%). Natural bond orbital calculations showed that electron transfer takes place from the acceptor to the donor, whereas the halogen atom becomes more positive during the bonding, which is in agreement with the result of neutral halogen bonding. QM/molecular mechanics calculations demonstrated that the polarity of binding pockets makes all of the interactions attractive in a protein system. Hence, the strength of halogen bonding involving negatively charged donors could be adjusted by changing the distance between the negative charge center and halogen atom and the environment in which the bonding exists, which may be applied in material and drug design for tuning their function and activity. PMID:27504672

  3. Space Charge Neutralization in the ITER Negative Ion Beams

    SciTech Connect

    Surrey, Elizabeth

    2007-08-10

    A model of the space charge neutralization of negative ion beams, developed from the model due to Holmes, is applied to the ITER heating and diagnostic beams. The Holmes model assumed that the plasma electron temperature was derived from the stripped electrons. This is shown to be incorrect for the ITER beams and the plasma electron temperature is obtained from the average creation energy upon ionization. The model shows that both ITER beams will be fully space charge compensated in the drift distance between the accelerator and the neutralizer. Inside the neutralizer, the plasma over compensates the space charge to the extent that a significant focusing force is predicted. At a certain position in the neutraliser this force balances the defocusing force due to the ions' transverse energy. Under these conditions the beam distribution function can change from Gaussian to Bennett and evidence of such a distribution observed in a multi-aperture, neutralized negative ion beam is presented.

  4. Increased negatively charged nitrogen-vacancy centers in fluorinated diamond

    SciTech Connect

    Cui, Shanying; Hu, Evelyn L.

    2013-07-29

    We investigated the effect of fluorine-terminated diamond surface on the charged state of shallow nitrogen vacancy defect centers (NVs). Fluorination is achieved with CF{sub 4} plasma, and the surface chemistry is confirmed with x-ray photoemission spectroscopy. Photoluminescence of these ensemble NVs reveals that fluorine-treated surfaces lead to a higher and more stable negatively charged nitrogen vacancy (NV{sup −}) population than oxygen-terminated surfaces. NV{sup −} population is estimated by the ratio of negative to neutral charged NV zero-phonon lines. Surface chemistry control of NV{sup −} density is an important step towards improving the optical and spin properties of NVs for quantum information processing and magnetic sensing.

  5. Membrane Permeabilization Induced by Sphingosine: Effect of Negatively Charged Lipids

    PubMed Central

    Jiménez-Rojo, Noemi; Sot, Jesús; Viguera, Ana R.; Collado, M. Isabel; Torrecillas, Alejandro; Gómez-Fernández, J.C.; Goñi, Félix M.; Alonso, Alicia

    2014-01-01

    Sphingosine [(2S, 3R, 4E)-2-amino-4-octadecen-1, 3-diol] is the most common sphingoid long chain base in sphingolipids. It is the precursor of important cell signaling molecules, such as ceramides. In the last decade it has been shown to act itself as a potent metabolic signaling molecule, by activating a number of protein kinases. Moreover, sphingosine has been found to permeabilize phospholipid bilayers, giving rise to vesicle leakage. The present contribution intends to analyze the mechanism by which this bioactive lipid induces vesicle contents release, and the effect of negatively charged bilayers in the release process. Fluorescence lifetime measurements and confocal fluorescence microscopy have been applied to observe the mechanism of sphingosine efflux from large and giant unilamellar vesicles; a graded-release efflux has been detected. Additionally, stopped-flow measurements have shown that the rate of vesicle permeabilization increases with sphingosine concentration. Because at the physiological pH sphingosine has a net positive charge, its interaction with negatively charged phospholipids (e.g., bilayers containing phosphatidic acid together with sphingomyelins, phosphatidylethanolamine, and cholesterol) gives rise to a release of vesicular contents, faster than with electrically neutral bilayers. Furthermore, phosphorous 31-NMR and x-ray data show the capacity of sphingosine to facilitate the formation of nonbilayer (cubic phase) intermediates in negatively charged membranes. The data might explain the pathogenesis of Niemann-Pick type C1 disease. PMID:24940775

  6. Targeting Negative Surface Charges of Cancer Cells by Multifunctional Nanoprobes.

    PubMed

    Chen, Bingdi; Le, Wenjun; Wang, Yilong; Li, Zhuoquan; Wang, Dong; Ren, Lei; Lin, Ling; Cui, Shaobin; Hu, Jennifer J; Hu, Yihui; Yang, Pengyuan; Ewing, Rodney C; Shi, Donglu; Cui, Zheng

    2016-01-01

    A set of electrostatically charged, fluorescent, and superparamagnetic nanoprobes was developed for targeting cancer cells without using any molecular biomarkers. The surface electrostatic properties of the established cancer cell lines and primary normal cells were characterized by using these nanoprobes with various electrostatic signs and amplitudes. All twenty two randomly selected cancer cell lines of different organs, but not normal control cells, bound specifically to the positively charged nanoprobes. The relative surface charges of cancer cells could be quantified by the percentage of cells captured magnetically. The activities of glucose metabolism had a profound impact on the surface charge level of cancer cells. The data indicate that an elevated glycolysis in the cancer cells led to a higher level secretion of lactate. The secreted lactate anions are known to remove the positive ions, leaving behind the negative changes on the cell surfaces. This unique metabolic behavior is responsible for generating negative cancer surface charges in a perpetuating fashion. The metabolically active cancer cells are shown to a unique surface electrostatic pattern that can be used for recovering cancer cells from the circulating blood and other solutions. PMID:27570558

  7. Targeting Negative Surface Charges of Cancer Cells by Multifunctional Nanoprobes

    PubMed Central

    Chen, Bingdi; Le, Wenjun; Wang, Yilong; Li, Zhuoquan; Wang, Dong; Ren, Lei; Lin, Ling; Cui, Shaobin; Hu, Jennifer J.; Hu, Yihui; Yang, Pengyuan; Ewing, Rodney C.; Shi, Donglu; Cui, Zheng

    2016-01-01

    A set of electrostatically charged, fluorescent, and superparamagnetic nanoprobes was developed for targeting cancer cells without using any molecular biomarkers. The surface electrostatic properties of the established cancer cell lines and primary normal cells were characterized by using these nanoprobes with various electrostatic signs and amplitudes. All twenty two randomly selected cancer cell lines of different organs, but not normal control cells, bound specifically to the positively charged nanoprobes. The relative surface charges of cancer cells could be quantified by the percentage of cells captured magnetically. The activities of glucose metabolism had a profound impact on the surface charge level of cancer cells. The data indicate that an elevated glycolysis in the cancer cells led to a higher level secretion of lactate. The secreted lactate anions are known to remove the positive ions, leaving behind the negative changes on the cell surfaces. This unique metabolic behavior is responsible for generating negative cancer surface charges in a perpetuating fashion. The metabolically active cancer cells are shown to a unique surface electrostatic pattern that can be used for recovering cancer cells from the circulating blood and other solutions. PMID:27570558

  8. Negatively cooperative binding of melittin to neutral phospholipid vesicles

    NASA Astrophysics Data System (ADS)

    Torrens, Francisco; Castellano, Gloria; Campos, Agustín; Abad, Concepción

    2007-05-01

    The association of basic amphipathic peptides to neutral phospholipid membranes is investigated in terms of binding and partition models. The binding of native and modified melittin to egg-yolk phosphatidylcholine vesicles is studied by steady-state fluorescence spectroscopy. The effect of the ionic strength shows an enhancement of the association as the ionic strength increases. After correction for electrostatic effects by the Gouy-Chapman theory, the melittin binding isotherms could be described by a partition model. In terms of conventional binding mechanisms, which do not take into account electrostatic effects, this would correspond to a negative cooperativity. A plausible way in which the interaction occurs is proposed, based on the calculated Hill coefficient.

  9. Positive Charge of “Sticky” Peptides and Proteins Impedes Release From Negatively Charged PLGA Matrices

    PubMed Central

    Balmert, Stephen C.; Zmolek, Andrew C.; Glowacki, Andrew J.; Knab, Timothy D.; Rothstein, Sam N.; Wokpetah, Joseph M.; Fedorchak, Morgan V.; Little, Steven R.

    2015-01-01

    The influence of electrostatic interactions and/or acylation on release of charged (“sticky”) agents from biodegradable polymer matrices was systematically characterized. We hypothesized that release of peptides with positive charge would be hindered from negatively charged poly(lactic-co-glycolic acid) (PLGA) microparticles. Thus, we investigated release of peptides with different degrees of positive charge from several PLGA microparticle formulations, with different molecular weights and/or end groups (acid- or ester-terminated). Indeed, release studies revealed distinct inverse correlations between the amount of positive charge on peptides and their release rates from each PLGA microparticle formulation. Furthermore, we examined the case of peptides with net charge that changes from negative to positive within the pH range observed in degrading microparticles. These charge changing peptides displayed counterintuitive release kinetics, initially releasing faster from slower degrading (less acidic) microparticles, and releasing slower from the faster degrading (more acidic) microparticles. Importantly, trends between agent charge and release rates for model peptides also translated to larger, therapeutically relevant proteins and oligonucleotides. The results of these studies may improve future design of controlled release systems for numerous therapeutic biomolecules exhibiting positive charge, ultimately reducing time-consuming and costly trial and error iterations of such formulations. PMID:26085928

  10. Study on space charge compensation in negative hydrogen ion beam

    NASA Astrophysics Data System (ADS)

    Zhang, A. L.; Peng, S. X.; Ren, H. T.; Zhang, T.; Zhang, J. F.; Xu, Y.; Guo, Z. Y.; Chen, J. E.

    2016-02-01

    Negative hydrogen ion beam can be compensated by the trapping of ions into the beam potential. When the beam propagates through a neutral gas, these ions arise due to gas ionization by the beam ions. However, the high neutral gas pressure may cause serious negative hydrogen ion beam loss, while low neutral gas pressure may lead to ion-ion instability and decompensation. To better understand the space charge compensation processes within a negative hydrogen beam, experimental study and numerical simulation were carried out at Peking University (PKU). The simulation code for negative hydrogen ion beam is improved from a 2D particle-in-cell-Monte Carlo collision code which has been successfully applied to H+ beam compensated with Ar gas. Impacts among ions, electrons, and neutral gases in negative hydrogen beam compensation processes are carefully treated. The results of the beam simulations were compared with current and emittance measurements of an H- beam from a 2.45 GHz microwave driven H- ion source in PKU. Compensation gas was injected directly into the beam transport region to modify the space charge compensation degree. The experimental results were in good agreement with the simulation results.

  11. Study on space charge compensation in negative hydrogen ion beam.

    PubMed

    Zhang, A L; Peng, S X; Ren, H T; Zhang, T; Zhang, J F; Xu, Y; Guo, Z Y; Chen, J E

    2016-02-01

    Negative hydrogen ion beam can be compensated by the trapping of ions into the beam potential. When the beam propagates through a neutral gas, these ions arise due to gas ionization by the beam ions. However, the high neutral gas pressure may cause serious negative hydrogen ion beam loss, while low neutral gas pressure may lead to ion-ion instability and decompensation. To better understand the space charge compensation processes within a negative hydrogen beam, experimental study and numerical simulation were carried out at Peking University (PKU). The simulation code for negative hydrogen ion beam is improved from a 2D particle-in-cell-Monte Carlo collision code which has been successfully applied to H(+) beam compensated with Ar gas. Impacts among ions, electrons, and neutral gases in negative hydrogen beam compensation processes are carefully treated. The results of the beam simulations were compared with current and emittance measurements of an H(-) beam from a 2.45 GHz microwave driven H(-) ion source in PKU. Compensation gas was injected directly into the beam transport region to modify the space charge compensation degree. The experimental results were in good agreement with the simulation results. PMID:26932087

  12. Electron interactions with positively and negatively multiply charged biomolecular clusters

    NASA Astrophysics Data System (ADS)

    Feketeová, Linda

    2012-07-01

    Interactions of positively and negatively multiply charged biomolecular clusters with low-energy electrons, from ~ 0 up to 50 eV of electron energy, were investigated in a high resolution Fourier-Transform Ion Cyclotron Resonance mass spectrometer equipped with an electrospray ionisation source. Electron-induced dissociation reactions of these clusters depend on the energy of the electrons, the size and the charge state of the cluster. The positively charged clusters [Mn+2H]2+ of zwitterionic betaines, M = (CH3)2XCH2CO2 (X = NCH3 and S), do capture an electron in the low electron energy region (< 10 eV). At higher electron energies neutral evaporation from the cluster becomes competitive with Coulomb explosion. In addition, a series of singly charged fragments arise from bond cleavage reactions, including decarboxylation and CH3 group transfer, due to the access of electronic excited states of the precursor ions. These fragmentation reactions depend on the type of betaine (X = NCH3 or S). For the negative dianionic clusters of tryptophan [Trp9-2H]2-, the important channel at low electron energies is loss of a neutral. Coulomb explosion competes from 19.8 eV and dominates at high electron energies. A small amount of [Trp2-H-NH3]- is observed at 21.8 eV.

  13. Binding of polymyxin B nonapeptide to gram-negative bacteria.

    PubMed Central

    Vaara, M; Viljanen, P

    1985-01-01

    The binding of the outer membrane-disorganizing peptide polymyxin B nonapeptide (PMBN) to gram-negative bacteria was studied by using tritium-labeled PMBN. Smooth Salmonella typhimurium had a binding capacity of ca. 6 nmol of PMBN per mg (dry weight) of bacteria, which corresponds to ca. 1 X 10(6) to 2 X 10(6) molecules of PMBN per single cell. The binding was of relatively high affinity (Kd, 1.3 microM). The isolated outer membrane of S. typhimurium bound ca. 100 nmol of PMBN per mg of outer membrane protein (Kd, 1.1 microM), whereas the cytoplasmic membrane bound 9 to 10 times less. Other bacteria which are susceptible to the action of PMBN (Escherichia coli strains, Pseudomonas aeruginosa, Haemophilus influenzae) also bound large amounts of PMBN. The S. typhimurium pmrA mutant, Neisseria gonorrhoeae, and Proteus mirabilis (all known as resistant to polymyxin and PMBN) bound 3.3, 4, and 12 times less than S. typhimurium, respectively. The binding of PMBN to S. typhimurium was effectively inhibited by low concentrations of polymyxin B, compound EM49 (octapeptin), polylysine, and protamine. Spermine, Ca2+, and Mg2+ also inhibited the PMBN binding although they were ca. 160, 700, and 2,400 times less active (based on molarity) than polymyxin B, respectively. No binding inhibition was found at the tested concentrations of streptomycin, tetralysine, spermidine, or cadaverine. PMID:2988430

  14. A negatively charged transmembrane aspartate residue controls activation of the relaxin-3 receptor RXFP3.

    PubMed

    Liu, Yu; Zhang, Lei; Shao, Xiao-Xia; Hu, Meng-Jun; Liu, Ya-Li; Xu, Zeng-Guang; Guo, Zhan-Yun

    2016-08-15

    Relaxin-3 is an insulin/relaxin superfamily neuropeptide involved in the regulation of food intake and stress response via activation of its cognate receptor RXFP3, an A-class G protein-coupled receptor (GPCR). In recent studies, a highly conserved ExxxD motif essential for binding of relaxin-3 has been identified at extracellular end of the second transmembrane domain (TMD2) of RXFP3. For most of the A-class GPCRs, a highly conserved negatively charged Asp residue (Asp(2.50) using Ballesteros-Weinstein numbering and Asp128 in human RXFP3) is present at the middle of TMD2. To elucidate function of the conserved transmembrane Asp128, in the present work we replaced it with other residues and the resultant RXFP3 mutants all retained quite high ligand-binding potency, but their activation and agonist-induced internalization were abolished or drastically decreased. Thus, the negatively charged transmembrane Asp128 controlled transduction of agonist-binding information from the extracellular region to the intracellular region through maintaining RXFP3 in a metastable state for efficient conformational change induced by binding of an agonist. PMID:27353281

  15. Cation specific binding with protein surface charges.

    PubMed

    Hess, Berk; van der Vegt, Nico F A

    2009-08-11

    Biological organization depends on a sensitive balance of noncovalent interactions, in particular also those involving interactions between ions. Ion-pairing is qualitatively described by the law of "matching water affinities." This law predicts that cations and anions (with equal valence) form stable contact ion pairs if their sizes match. We show that this simple physical model fails to describe the interaction of cations with (molecular) anions of weak carboxylic acids, which are present on the surfaces of many intra- and extracellular proteins. We performed molecular simulations with quantitatively accurate models and observed that the order K(+) < Na(+) < Li(+) of increasing binding affinity with carboxylate ions is caused by a stronger preference for forming weak solvent-shared ion pairs. The relative insignificance of contact pair interactions with protein surfaces indicates that thermodynamic stability and interactions between proteins in alkali salt solutions is governed by interactions mediated through hydration water molecules. PMID:19666545

  16. Negatively Charged Lipid Membranes Catalyze Supramolecular Hydrogel Formation.

    PubMed

    Versluis, Frank; van Elsland, Daphne M; Mytnyk, Serhii; Perrier, Dayinta L; Trausel, Fanny; Poolman, Jos M; Maity, Chandan; le Sage, Vincent A A; van Kasteren, Sander I; van Esch, Jan H; Eelkema, Rienk

    2016-07-20

    In this contribution we show that biological membranes can catalyze the formation of supramolecular hydrogel networks. Negatively charged lipid membranes can generate a local proton gradient, accelerating the acid-catalyzed formation of hydrazone-based supramolecular gelators near the membrane. Synthetic lipid membranes can be used to tune the physical properties of the resulting multicomponent gels as a function of lipid concentration. Moreover, the catalytic activity of lipid membranes and the formation of gel networks around these supramolecular structures are controlled by the charge and phase behavior of the lipid molecules. Finally, we show that the insights obtained from synthetic membranes can be translated to biological membranes, enabling the formation of gel fibers on living HeLa cells. PMID:27359373

  17. Negative ion-uranium hexafluoride charge transfer reactions

    NASA Astrophysics Data System (ADS)

    Streit, Gerald E.; Newton, T. W.

    1980-10-01

    The flowing afterglow technique has been used to study the process of charge transfer from selected negative ions (F-, Cl-, Br-, I-, SF6-) to UF6. The sole ionic product in all cases was observed to be UF6-. Data analysis was complicated by an unexpected coupling of chemical and diffusive ion loss processes when UF6- product ions were present. The rate coefficients for the charge transfer processes are (k in 10-9 cm3 molecule-1 s-1) F-, 1.3; Cl-, 1.1; Br-, 0.93; I-, 0.77; and SF6-, 0.69. The rate constants agree quite well with the classical Langevin predictions.

  18. Solutions of negatively charged graphene sheets and ribbons.

    PubMed

    Vallés, Cristina; Drummond, Carlos; Saadaoui, Hassan; Furtado, Clascidia A; He, Maoshuai; Roubeau, Olivier; Ortolani, Luca; Monthioux, Marc; Pénicaud, Alain

    2008-11-26

    Negatively charged graphene layers from a graphite intercalation compound spontaneously dissolve in N-methylpyrrolidone, without the need for any sonication, yielding stable, air-sensitive, solutions of laterally extended atom-thick graphene sheets and ribbons with dimensions over tens of micrometers. These can be deposited on a variety of substrates. Height measurements showing single-atom thickness were performed by STM, AFM, multiple beam interferometry, and optical imaging on Sarfus wafers, demonstrating deposits of graphene flakes and ribbons. AFM height measurements on mica give the actual height of graphene (ca. 0.4 nm). PMID:18975900

  19. Negative Differential Conductance from Space Charge Limited Currents in Semiconductors

    NASA Astrophysics Data System (ADS)

    Brooks, Andrew; Zhang, Xiaoguang

    Applying the theory of space charge limited currents (SCLC), we show that negative differential conductance can arise from doubly occupied traps that are nearly degenerate with the bottom of the conduction band. Using degenerate state perturbation theory, the Coulomb energy of the doubly occupied traps is shown to depend on the hybridization with the conduction band states. Initially, when carriers are injected into the solid, traps begin to fill while the conduction band states stay relatively empty and thus accessible to trapped electrons via hopping. Trap and conduction states continue to be filled as current is increased, and the energy of trapped electrons begins to rise. A critical current is reached whereupon a further increase in current leads to a reduction of filled traps (i.e. a reduction of space charge in the solid), and thus a corresponding decrease in voltage. This trend in the current-voltage characteristic curves persists until the bottom of the conduction band has been filled, then voltage rises with current.

  20. Laboratory infrared spectroscopy of gaseous negatively charged polyaromatic hydrocarbons

    SciTech Connect

    Gao, Juehan; Berden, Giel; Oomens, Jos

    2014-06-01

    Based largely on infrared spectroscopic evidence, polycyclic aromatic hydrocarbon (PAH) molecules are now widely accepted to occur abundantly in the interstellar medium. Laboratory infrared spectra have been obtained for a large variety of neutral and cationic PAHs, but data for anionic PAHs are scarce. Nonetheless, in regions with relatively high electron densities and low UV photon fluxes, PAHs have been suggested to occur predominantly as negatively charged ions (anions), having substantial influence on cloud chemistry. While some matrix spectra have been reported for radical anion PAHs, no data is available for even-electron anions, which are more stable against electron detachment. Here we present the first laboratory infrared spectra of deprotonated PAHs ([PAH-H]{sup –}) in the wavelength ranges between 6 and 16 μm and around 3 μm. Wavelength-dependent infrared multiple-photon electron detachment is employed to obtain spectra for deprotonated naphthalene, anthracene, and pyrene in the gas phase. Spectra are compared with theoretical spectra computed at the density functional theory level. We show that the relative band intensities in different ranges of the IR spectrum deviate significantly from those of neutral and positively charged PAHs, and moreover from those of radical anion PAHs. These relative band intensities are, however, well reproduced by theory. An analysis of the frontier molecular orbitals of the even- and odd-electron anions reveals a high degree of charge localization in the deprotonated systems, qualitatively explaining the observed differences and suggesting unusually high electric dipole moments for this class of PAH molecules.

  1. Charge transfer and negative curvature energy in magnesium boride nanotubes

    NASA Astrophysics Data System (ADS)

    Tang, Hui; Ismail-Beigi, Sohrab

    2016-07-01

    Using first-principles calculations based on density functional theory, we study the energetics and charge transfer effects in MgBx nanotubes and two-dimensional (2D) sheets. The behavior of adsorbed Mg on 2D boron sheets is found to depend on the amount of electron transfer between the two subsystems. The amount is determined by both the density of adsorbed Mg as well as the atomic-scale structure of the boron subsystem. The degree of transfer can lead to repulsive or attractive Mg-Mg interactions. In both cases, model MgBx nanotubes built from 2D MgBx sheets can display negative curvature energy: a relatively unusual situation in nanosystems where the energy cost to curve the parent 2D sheet into a small-diameter nanotube is negative. Namely, the small-diameter nanotube is energetically preferred over the corresponding flat sheet. We also discuss how these findings may manifest themselves in experimentally synthesized MgBx nanotubes.

  2. Excited states and valley effects in a negatively charged impurity in a silicon FinFET.

    SciTech Connect

    Hollenberg, Lloyd; Klimeck, Gerhard; Carroll, Malcolm S.; Rahman, Rajib; Muller, Richard Partain; Rogge, Sven; Verduijn, Arjan; Lansbergen, Gabriel

    2010-07-01

    The observation and characterization of a single atom system in silicon is a significant landmark in half a century of device miniaturization, and presents an important new laboratory for fundamental quantum and atomic physics. We compare with multi-million atom tight binding (TB) calculations the measurements of the spectrum of a single two-electron (2e) atom system in silicon - a negatively charged (D-) gated Arsenic donor in a FinFET. The TB method captures accurate single electron eigenstates of the device taking into account device geometry, donor potentials, applied fields, interfaces, and the full host bandstructure. In a previous work, the depths and fields of As donors in six device samples were established through excited state spectroscopy of the D0 electron and comparison with TB calculations. Using self-consistent field (SCF) TB, we computed the charging energies of the D- electron for the same six device samples, and found good agreement with the measurements. Although a bulk donor has only a bound singlet ground state and a charging energy of about 40 meV, calculations show that a gated donor near an interface can have a reduced charging energy and bound excited states in the D- spectrum. Measurements indeed reveal reduced charging energies and bound 2e excited states, at least one of which is a triplet. The calculations also show the influence of the host valley physics in the two-electron spectrum of the donor.

  3. Astronomers Discover First Negatively-charged Molecule in Space

    NASA Astrophysics Data System (ADS)

    2006-12-01

    Cambridge, MA - Astronomers have discovered the first negatively charged molecule in space, identifying it from radio signals that were a mystery until now. While about 130 neutral and 14 positively charged molecules are known to exist in interstellar space, this is the first negative molecule, or anion, to be found. "We've spotted a rare and exotic species, like the white tiger of space," said astronomer Michael McCarthy of the Harvard-Smithsonian Center for Astrophysics (CfA). By learning more about the rich broth of chemicals found in interstellar space, astronomers hope to explain how the young Earth converted these basic ingredients into the essential chemicals for life. This new finding helps to advance scientists' understanding of the chemistry of the interstellar medium, and hence the birthplaces of planets. McCarthy worked with CfA colleagues Carl Gottlieb, Harshal Gupta (also from the Univ. of Texas), and Patrick Thaddeus to identify the molecular anion known as C6H-: a linear chain of six carbon atoms with one hydrogen atom at the end and an "extra" electron. Such molecules were thought to be extremely rare because ultraviolet light that suffuses space easily knocks electrons off molecules. The large size of C6H-, larger than most neutral and all positive molecules known in space, may increase its stability in the harsh cosmic environment. "The discovery of C6H- resolves a long-standing enigma in astrochemistry: the apparent lack of negatively charged molecules in space," stated Thaddeus. The team first conducted laboratory experiments to determine exactly what radio frequencies to use in their search. Then, they used the National Science Foundation's Robert C. Byrd Green Bank Telescope to hunt for C6H- in celestial objects. In particular, they targeted locations in which previous searches had spotted unidentified radio signals at the appropriate frequencies. They found C6H- in two very different locations-a shell of gas surrounding the evolved red giant

  4. First-Principle Framework for Total Charging Energies in Electrocatalytic Materials and Charge-Responsive Molecular Binding at Gas-Surface Interfaces.

    PubMed

    Tan, Xin; Tahini, Hassan A; Seal, Prasenjit; Smith, Sean C

    2016-05-01

    Heterogeneous charge-responsive molecular binding to electrocatalytic materials has been predicted in several recent works. This phenomenon offers the possibility of using voltage to manipulate the strength of the binding interaction with the target gas molecule and thereby circumvent thermochemistry constraints, which inhibit achieving both efficient binding and facile release of important targets such as CO2 and H2. Stability analysis of such charge-induced molecular adsorption has been beyond the reach of existing first-principle approaches. Here, we draw on concepts from semiconductor physics and density functional theory to develop a first principle theoretical approach that allows calculation of the change in total energy of the supercell due to charging. Coupled with the calculated adsorption energy of gas molecules at any given charge, this allows a complete description of the energetics of the charge-induced molecular adsorption process. Using CO2 molecular adsorption onto negatively charged h-BN (wide-gap semiconductor) and g-C4N3 (half metal) as example cases, our analysis reveals that - while adsorption is exothermic after charge is introduced - the overall adsorption processes are not intrinsically spontaneous due to the energetic cost of charging the materials. The energies needed to overcome the barriers of these processes are 2.10 and 0.43 eV for h-BN and g-C4N3, respectively. This first principle approach opens up new pathways for a more complete description of charge-induced and electrocatalytic processes. PMID:27067063

  5. The mobility of negative charges in liquid hydrogen

    NASA Astrophysics Data System (ADS)

    Lerner, P. B.; Sokolov, I. M.

    1994-06-01

    There is a great difference in behavior of e- in liquid hydrogen and helium despite the fact that the adopted theories of the mobility are quite similar. Recently, Levchenko and Mezhov-Deglin (Journal of Low Temperature Physics, 89, 457 (1992)) reported large discrepancies of the mobility of the electrons in liquid hydrogen from estimates based on the theory that the electrons are trapped in bubbles forming atomlike structures (“bubblonium”). They properly suggested that these deviations are related to the existence in liquid hydrogen of another, metastable type of negative charge carrier. The subject of the current paper is the physical explanation of the existence of two types of carriers in liquid hydrogen. We attribute the second type of carriers to the cluster ion H - ( H 2 ) x , which is created by the formation of solid hydrogen around a bound state of a hydride ion. We provide estimates for the radius and the kinetics of degradation of the “snowball” formed around the H - ion on the basis of energy diagrams for a hydride ion submerged in liquid hydrogen.

  6. Negatively Charged Lipids as a Potential Target for New Amphiphilic Aminoglycoside Antibiotics: A BIOPHYSICAL STUDY.

    PubMed

    Sautrey, Guillaume; El Khoury, Micheline; Dos Santos, Andreia Giro; Zimmermann, Louis; Deleu, Magali; Lins, Laurence; Décout, Jean-Luc; Mingeot-Leclercq, Marie-Paule

    2016-06-24

    Bacterial membranes are highly organized, containing specific microdomains that facilitate distinct protein and lipid assemblies. Evidence suggests that cardiolipin molecules segregate into such microdomains, probably conferring a negative curvature to the inner plasma membrane during membrane fission upon cell division. 3',6-Dinonyl neamine is an amphiphilic aminoglycoside derivative active against Pseudomonas aeruginosa, including strains resistant to colistin. The mechanisms involved at the molecular level were identified using lipid models (large unilamellar vesicles, giant unilamelllar vesicles, and lipid monolayers) that mimic the inner membrane of P. aeruginosa The study demonstrated the interaction of 3',6-dinonyl neamine with cardiolipin and phosphatidylglycerol, two negatively charged lipids from inner bacterial membranes. This interaction induced membrane permeabilization and depolarization. Lateral segregation of cardiolipin and membrane hemifusion would be critical for explaining the effects induced on lipid membranes by amphiphilic aminoglycoside antibiotics. The findings contribute to an improved understanding of how amphiphilic aminoglycoside antibiotics that bind to negatively charged lipids like cardiolipin could be promising antibacterial compounds. PMID:27189936

  7. Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

    NASA Astrophysics Data System (ADS)

    Teyssedre, G.; Vu, T. T. N.; Laurent, C.

    2015-12-01

    Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30-60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10-14-10-13 m2 V-1 s-1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

  8. Negative-charge driven fragmentations for evidencing zwitterionic forms from doubly charged coppered peptides.

    PubMed

    Boutin, Michel; Bich, Claudia; Afonso, Carlos; Fournier, Françoise; Tabet, Jean-Claude

    2007-01-01

    In aqueous solution, amino acids (AA) and peptides are known to exist as zwitterions over a large pH range. However, in the gas phase, i.e. in electrospray (ESI), the zwitterionic form becomes unfavorable owing to the absence of stabilizing effects from intermolecular solvation. Nevertheless, during mass spectrometry experiments, the presence of a metallic cation can reinforce the zwitterionic character of the molecule and thus influence its fragmentation under low energy collision-induced dissociation (CID) conditions. The [M + Cu(II)](2+) complexes of six pentapeptides (YGGFL, YGGFL(NH(2)), YGGFK, YGGFQ, KYGGF and QYGGF) were analyzed by collision to highlight the presence of zwitterions. The experiments were performed on a 3D-ion trap equipped with an orthogonal ESI source. For each peptides studied, negative-charge driven fragmentations on globally positively charged ions were observed. These fragmentation mechanisms, generally observed in the negative mode, suggest the competitive deprotonation of the C-terminal carboxylic acid or of the tyrosine side-chain residue for each peptide studied and thus a zwitterionic form to preserve the charge balance. Moreover, the specific loss of (CH(3)--C(6)H(4)--O)(*) characterizes YGGFK compared to YGGFQ and the specific loss of styrene characterizes KYGGF compared to QYGGF. These results allow the differentiation of the two couples of isobaric pentapeptides. An unusual loss of NH(4) (+), which occurred from the N-terminus, was also observed for YGGFL, YGGFL(NH(2)), YGGFK and YGGFQ. Finally, the reduction of Cu(II) to Cu(I), concomitant with the (CH(3)--C(6)H(4)--O)(*) release, was pointed out for YGGFK. PMID:17149792

  9. Experimental evidence on removing copper and light-induced degradation from silicon by negative charge

    SciTech Connect

    Boulfrad, Yacine Lindroos, Jeanette; Yli-Koski, Marko; Savin, Hele; Wagner, Matthias; Wolny, Franziska

    2014-11-03

    In addition to boron and oxygen, copper is also known to cause light-induced degradation (LID) in silicon. We have demonstrated previously that LID can be prevented by depositing negative corona charge onto the wafer surfaces. Positively charged interstitial copper ions are proposed to diffuse to the negatively charged surface and consequently empty the bulk of copper. In this study, copper out-diffusion was confirmed by chemical analysis of the near surface region of negatively/positively charged silicon wafer. Furthermore, LID was permanently removed by etching the copper-rich surface layer after negative charge deposition. These results demonstrate that (i) copper can be effectively removed from the bulk by negative charge, (ii) under illumination copper forms a recombination active defect in the bulk of the wafer causing severe light induced degradation.

  10. Magnetic field dependence of the energy of negatively charged excitons in semiconductor quantum wells

    SciTech Connect

    Riva, C.; Peeters, F. M.; Varga, K.

    2001-03-15

    We present a variational calculation of the spin-singlet and spin-triplet states of a negatively charged exciton (trion) confined to a single quantum well in the presence of a perpendicular magnetic field. We calculated the probability density and the pair correlation function of the singlet and triplet trion states. The dependence of the energy levels and of the binding energy on the well width and on the magnetic field strength was investigated. We compared our results with the available experimental data on GaAs/AlGaAs quantum wells and find that in the low-magnetic-field region (B<18 T) the observed transitions are those of the singlet and the dark triplet trion (with angular momentum L{sub z}=-1), while for high magnetic fields (B>25 T) the dark trion becomes optically inactive and possibly a transition to a bright triplet trion (angular momentum L{sub z}=0) state is observed.

  11. An analysis of five negative sprite-parent discharges and their associated thunderstorm charge structures

    NASA Astrophysics Data System (ADS)

    Boggs, Levi D.; Liu, Ningyu; Splitt, Michael; Lazarus, Steven; Glenn, Chad; Rassoul, Hamid; Cummer, Steven A.

    2016-01-01

    In this study we analyze the discharge morphologies of five confirmed negative sprite-parent discharges and the associated charge structures of the thunderstorms that produced them. The negative sprite-parent lightning took place in two thunderstorms that were associated with a tropical disturbance in east central and south Florida. The first thunderstorm, which moved onshore in east central Florida, produced four of the five negative sprite-parent discharges within a period of 17 min, as it made landfall from the Atlantic Ocean. These negative sprite-parents were composed of bolt-from-the-blue (BFB), hybrid intracloud-negative cloud-to-ground (IC-NCG), and multicell IC-NCGs discharges. The second thunderstorm, which occurred inland over south Florida, produced a negative sprite-parent that was a probable hybrid IC-NCG discharge and two negative gigantic jets (GJs). Weakened upper positive charge with very large midlevel negative charge was inferred for both convective cells that initiated the negative-sprite-parent discharges. Our study suggests tall, intense convective systems with high wind shear at the middle to upper regions of the cloud accompanied by low cloud-to-ground (CG) flash rates promote these charge structures. The excess amount of midlevel negative charge results in these CG discharges transferring much more charge to ground than typical negative CG discharges. We find that BFB discharges prefer an asymmetrical charge structure that brings the negative leader exiting the upper positive charge region closer to the lateral positive screening charge layer. This may be the main factor in determining whether a negative leader exiting the upper positive region of the thundercloud forms a BFB or GJ.

  12. Negatively charged lipid membranes promote a disorder-order transition in the Yersinia YscU protein.

    PubMed

    Weise, Christoph F; Login, Frédéric H; Ho, Oanh; Gröbner, Gerhard; Wolf-Watz, Hans; Wolf-Watz, Magnus

    2014-10-21

    The inner membrane of Gram-negative bacteria is negatively charged, rendering positively charged cytoplasmic proteins in close proximity likely candidates for protein-membrane interactions. YscU is a Yersinia pseudotuberculosis type III secretion system protein crucial for bacterial pathogenesis. The protein contains a highly conserved positively charged linker sequence that separates membrane-spanning and cytoplasmic (YscUC) domains. Although disordered in solution, inspection of the primary sequence of the linker reveals that positively charged residues are separated with a typical helical periodicity. Here, we demonstrate that the linker sequence of YscU undergoes a largely electrostatically driven coil-to-helix transition upon binding to negatively charged membrane interfaces. Using membrane-mimicking sodium dodecyl sulfate micelles, an NMR derived structural model reveals the induction of three helical segments in the linker. The overall linker placement in sodium dodecyl sulfate micelles was identified by NMR experiments including paramagnetic relaxation enhancements. Partitioning of individual residues agrees with their hydrophobicity and supports an interfacial positioning of the helices. Replacement of positively charged linker residues with alanine resulted in YscUC variants displaying attenuated membrane-binding affinities, suggesting that the membrane interaction depends on positive charges within the linker. In vivo experiments with bacteria expressing these YscU replacements resulted in phenotypes displaying significantly reduced effector protein secretion levels. Taken together, our data identify a previously unknown membrane-interacting surface of YscUC that, when perturbed by mutations, disrupts the function of the pathogenic machinery in Yersinia. PMID:25418176

  13. Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

    SciTech Connect

    Teyssedre, G. Laurent, C.; Vu, T. T. N.

    2015-12-21

    Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10{sup −14}–10{sup −13} m{sup 2} V{sup −1} s{sup −1} for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

  14. Interaction of Bee Venom Melittin with Zwitterionic and Negatively Charged Phospholipid Bilayers

    PubMed Central

    Kleinschmidt, Jörg H.; Mahaney, James E.; Thomas, David D.; Marsh, Derek

    1997-01-01

    Electron spin resonance (ESR) spectroscopy was used to study the penetration and interaction of bee venom melittin with dimyristoylphosphatidylcholine (DMPC) and ditetradecylphosphatidylglycerol (DTPG) bilayer membranes. Melittin is a surface-active, amphipathic peptide and serves as a useful model for a variety of membrane interactions, including those of presequences and signal peptides, as well as the charged subdomain of the cardiac regulatory protein phospholamban. Derivatives of phosphatidylcholine and phosphatidylglycerol spin-labeled at various positions along the sn-2 acyl chain were used to establish the chain flexibility gradient for the two membranes in the presence and absence of melittin. Negatively charged DTPG bilayer membranes showed a higher capacity for binding melittin without bilayer disruption than did membranes formed by the zwitterionic DMPC, demonstrating the electrostatic neutralization of bound melittin by DTPG. The temperature dependence of the ESR spectra showed that the gel-to-liquid crystalline phase transition is eliminated by binding melittin to DTPG bilayers, whereas a very broad transition remains in the case of DMPC bilayers. None of the spin labels used showed a two-component spectrum characteristic of a specific restriction of their chain motion by melittin, but the outer hyperfine splittings and effective chain order parameters were increased for all labels upon binding melittin. This indicates a reduced flexibility of the lipid chains induced by a surface orientation of the bound melittin. Whereas the characteristic shape of the chain flexibility gradient was maintained upon melittin addition to DMPC bilayers, the chain flexibility profile in DTPG bilayers was much more strongly perturbed. It was found that the steepest change in segmental flexibility was shifted toward the bilayer interior when melittin was bound to DTPG membranes, indicating a greater depth of penetration than in DMPC membranes. pH titration of stearic acid

  15. Unveiling Residual Molecular Binding in Triply Charged Hydrogen Bromide

    SciTech Connect

    Penent, F.; Lablanquie, P.; Palaudoux, J.; Gamblin, G.; Carniato, S.; Andric, L.; Hikosaka, Y.; Ito, K.

    2011-03-11

    We present an experimental and theoretical study of triply charged hydrogen bromide ions formed by photoionization of the inner 3d shell of Br. The experimental results, obtained by detecting the 3d photoelectron in coincidence with the two subsequent Auger electrons, are analyzed using calculated potential energy curves of HBr{sup 3+}. The competition between the short-range chemical binding potential and the Coulomb repulsion in the dissociative process is shown. Two different mechanisms are observed for double Auger decay: one, a direct process with simultaneous ejection of two Auger electrons to final HBr{sup 3+} ionic states and the other, a cascade process involving double Auger decay characterized by the autoionization of Br*{sup +} ion subsequent to the HBr{sup 2+} fragmentation.

  16. New effects of a long-lived negatively charged massive particle on big bang nucleosynthesis

    SciTech Connect

    Kusakabe, Motohiko; Kim, K. S.; Cheoun, Myung-Ki; Kajino, Toshitaka; Kino, Yasushi; Mathews, Grant J.

    2014-05-02

    Primordial {sup 7}Li abundance inferred from observations of metal-poor stars is a factor of about 3 lower than the theoretical value of standard big bang nucleosynthesis (BBN) model. One of the solutions to the Li problem is {sup 7}Be destruction during the BBN epoch caused by a long-lived negatively charged massive particle, X{sup −}. The particle can bind to nuclei, and X-bound nuclei (X-nuclei) can experience new reactions. The radiative X{sup −} capture by {sup 7}Be nuclei followed by proton capture of the bound state of {sup 7}Be and X{sup −} ({sup 7}Be{sub x}) is a possible {sup 7}Be destruction reaction. Since the primordial abundance of {sup 7}Li originates mainly from {sup 7}Li produced via the electron capture of {sup 7}Be after BBN, the {sup 7}Be destruction provides a solution to the {sup 7}Li problem. We suggest a new route of {sup 7}Be{sub x} formation, that is the {sup 7}Be charge exchange at the reaction of {sup 7}Be{sup 3+} ion and X{sup −}. The formation rate depends on the ionization fraction of {sup 7}Be{sup 3+} ion, the charge exchange cross section of {sup 7}Be{sup 3+}, and the probability that excited states {sup 7}Be{sub x}* produced at the charge exchange are converted to the ground state. We find that this reaction can be equally important as or more important than ordinary radiative recombination of {sup 7}Be and X{sup −}. The effect of this new route is shown in a nuclear reaction network calculation.

  17. Maximizing Ion Current by Space Charge Neutralization using Negative Ions and Dust Particles

    SciTech Connect

    A. Smirnov; Y. Raitses; N.J. Fisch

    2005-01-25

    Ion current extracted from an ion source (ion thruster) can be increased above the Child-Langmuir limit if the ion space charge is neutralized. Similarly, the limiting kinetic energy density of the plasma flow in a Hall thruster might be exceeded if additional mechanisms of space charge neutralization are introduced. Space charge neutralization with high-mass negative ions or negatively charged dust particles seems, in principle, promising for the development of a high current or high energy density source of positive light ions. Several space charge neutralization schemes that employ heavy negatively charged particles are considered. It is shown that the proposed neutralization schemes can lead, at best, only to a moderate but nonetheless possibly important increase of the ion current in the ion thruster and the thrust density in the Hall thruster.

  18. Maximizing ion current by space-charge neutralization using negative ions and dust particles

    SciTech Connect

    Smirnov, A.; Raitses, Y.; Fisch, N.J.

    2005-05-15

    Ion current extracted from an ion source (ion thruster) can be increased above the Child-Langmuir limit if the ion space charge is neutralized. Similarly, the limiting kinetic energy density of the plasma flow in a Hall thruster might be exceeded if additional mechanisms of space-charge neutralization are introduced. Space-charge neutralization with high-mass negative ions or negatively charged dust particles seems, in principle, promising for the development of a high current or high energy density source of positive light ions. Several space-charge neutralization schemes that employ heavy negatively charged particles are considered. It is shown that the proposed neutralization schemes can lead, at best, only to a moderate but nonetheless possibly important increase of the ion current in the ion thruster and the thrust density in the Hall thruster.

  19. Maximizing ion current by space-charge neutralization using negative ions and dust particles

    NASA Astrophysics Data System (ADS)

    Smirnov, A.; Raitses, Y.; Fisch, N. J.

    2005-05-01

    Ion current extracted from an ion source (ion thruster) can be increased above the Child-Langmuir limit if the ion space charge is neutralized. Similarly, the limiting kinetic energy density of the plasma flow in a Hall thruster might be exceeded if additional mechanisms of space-charge neutralization are introduced. Space-charge neutralization with high-mass negative ions or negatively charged dust particles seems, in principle, promising for the development of a high current or high energy density source of positive light ions. Several space-charge neutralization schemes that employ heavy negatively charged particles are considered. It is shown that the proposed neutralization schemes can lead, at best, only to a moderate but nonetheless possibly important increase of the ion current in the ion thruster and the thrust density in the Hall thruster.

  20. Charging-delay induced dust acoustic collisionless shock wave: Roles of negative ions

    SciTech Connect

    Ghosh, Samiran; Bharuthram, R.; Khan, Manoranjan; Gupta, M. R.

    2006-11-15

    The effects of charging-delay and negative ions on nonlinear dust acoustic waves are investigated. It has been found that the charging-delay induced anomalous dissipation causes generation of dust acoustic collisionless shock waves in an electronegative dusty plasma. The small but finite amplitude wave is governed by a Korteweg-de Vries Burger equation in which the Burger term arises due to the charging-delay. Numerical investigations reveal that the charging-delay induced dissipation and shock strength decreases (increases) with the increase of negative ion concentration (temperature)

  1. Ion beam driven ion-acoustic waves in a plasma cylinder with negatively charged dust grains

    SciTech Connect

    Sharma, Suresh C.; Walia, Ritu; Sharma, Kavita

    2012-07-15

    An ion beam propagating through a magnetized potassium plasma cylinder having negatively charged dust grains drives electrostatic ion-acoustic waves to instability via Cerenkov interaction. The phase velocity of sound wave increases with the relative density of negatively charged dust grains. The unstable wave frequencies and the growth rate increase, with the relative density of negatively charged dust grains. The growth rate of the unstable mode scales as one-third power of the beam density. The real part of frequency of the unstable mode increases with the beam energy and scales as almost the one-half power of the beam energy.

  2. Production of intense beams of polarized negative hydrogen ions by double charge exchange in alkali vapour

    NASA Astrophysics Data System (ADS)

    Gruëbler, W.; Schmelzbach, P. A.

    1983-07-01

    The intensity of the polarized negative hydrogen ion beam of the ETHZ atomic beam polarized ion source has been substantially improved by a new double charge exchange device. Increasing the diameter of the charge exchange canal to 1.4 cm results in a beam output of the source of 6 μA of polarized negative hydrogen ions. Further improvements of the charge exchanger are proposed and discussed. With an updated design of the atomic beam apparatus, beams of 0.5 mA polarized negative hydrogen ions may be obtained from such a source.

  3. Hyperactive Arg39Lys mutated mnemiopsin: implication of positively charged residue in chromophore binding cavity.

    PubMed

    Mahdavi, Atiyeh; Sajedi, Reza H; Hosseinkhani, Saman; Taghdir, Majid

    2015-04-01

    Mnemiopsin, a Ca(2+)-regulated photoprotein isolated from Mnemiopsis leidyi, belongs to the family of ctenophore photoproteins. These proteins emit blue light from a chromophore, which is tightly but non-covalently bound in their central hydrophobic core that contains 21 conserved residues. In an effort to investigate the role of Arg39 (the sole charged residue in coelenterazine binding cavity of ctenophore photoproteins) in bioluminescence properties of these photoproteins, three mutated forms of mnemiopsin 1 (R39E, R39K and R39M) were constructed and characterized. The results indicate that while the luminescence activity of R39K mutated mnemiopsin has increased about nine fold compared to the wild type, R39M and R39E mutated mnemiopsins have entirely lost their activities. The most distinguished properties of R39K mutated photoprotein are its high activity, slow rate of luminescence decay and broad pH profile compared to the wild type. The complete loss of bioluminescence activity in mutated photoproteins with negatively charged and aliphatic residues (R39E and R39M, respectively) shows that the presence of a positively charged residue at this position is necessary. The results of spectroscopic studies, including CD, intrinsic and extrinsic fluorescence measurements and acrylamide quenching studies show that, while the substitutions lead to structural rigidity in R39E and R39M mutated mnemiopsins, structural flexibility is obvious in R39K mutated mnemiopsin. The presence of a more localized positive charge on ε-amino group of Lys compared to guanidinium group of Arg residue in close proximity to the choromophre might affect its fixation in the binding cavity and result in increased bioluminescence activity in this mutated photoprotein. It appears that the polarity and flexibility of positively charged residue at this position finely tunes the luminescence properties of ctenophore photoproteins. PMID:25635518

  4. Negatively charged nanoparticles produced by splashing of water

    NASA Astrophysics Data System (ADS)

    Tammet, H.; Hõrrak, U.; Kulmala, M.

    2009-01-01

    The production of splashing-generated balloelectric intermediate ions was studied by means of mobility spectrometry in the atmosphere during the rain and in a laboratory experiment simulating the heavy rain. The partial neutralization of intermediate ions with cluster ions generated by beta rays suppressed the space charge of intermediate ions but preserved the shape of the mobility distribution. The balloelectric ions produced from the waterworks water of high TDS (Total Dissolved Solids) had about the same mobilities as the ions produced from the rainwater of low TDS. This suggests that the balloelectric ions can be considered as singly charged water nanoparticles. By different measurements, the diameter mode of these particles was 2.2-2.7 nm, which is close to the diameter of 2.5 nm of the Chaplin's 280-molecule magic icosahedron superclusters. The measurements can be explained by a hypothesis that the pressure of saturated vapor over the nanoparticle surface is suppressed by a number of magnitudes due to the internal structure of the particles near the size of 2.5 nm. The records of the concentration bursts of balloelectric ions in the atmosphere are formally similar to the records of the nucleation bursts but they cannot be qualified as nucleation bursts because the particles are not growing but shrinking.

  5. Negatively charged nanoparticles produced by splashing of water

    NASA Astrophysics Data System (ADS)

    Tammet, H.; Hõrrak, U.; Kulmala, M.

    2008-09-01

    The production of splashing-generated balloelectric intermediate ions was studied by means of mobility spectrometry in the atmosphere during the rain and in a laboratory experiment simulating the heavy rain. The partial neutralization of intermediate ions with cluster ions generated by beta rays suppressed the space charge of intermediate ions but preserved the shape of the mobility distribution. The balloelectric ions produced from the waterworks water of high TDS (Total Dissolved Solids) had about the same mobilities as the ions produced from the rainwater of low TDS. This suggests that the balloelectric ions can be considered as singly charged water nanodroplets. By different measurements, the diameter mode of these droplets was 2.2 2.7 nm, which is close to the diameter of 2.5 nm of the Chaplin's 280-molecule magic icosahedron superclusters. The measurements can be explained by a hypothesis that the pressure of saturated vapor over the nanodroplet surface is suppressed by a number of magnitudes due to the internal structure of the droplets near the size of 2.5 nm. The records of the concentration bursts of balloelectric ions in the atmosphere are formally similar to the records of the nucleation bursts but they cannot be qualified as nucleation bursts because the particles are not growing but shrinking.

  6. The Combining Sites of Anti-lipid A Antibodies Reveal a Widely Utilized Motif Specific for Negatively Charged Groups.

    PubMed

    Haji-Ghassemi, Omid; Müller-Loennies, Sven; Rodriguez, Teresa; Brade, Lore; Grimmecke, Hans-Dieter; Brade, Helmut; Evans, Stephen V

    2016-05-01

    Lipopolysaccharide dispersed in the blood by Gram-negative bacteria can be a potent inducer of septic shock. One research focus has been based on antibody sequestration of lipid A (the endotoxic principle of LPS); however, none have been successfully developed into a clinical treatment. Comparison of a panel of anti-lipid A antibodies reveals highly specific antibodies produced through distinct germ line precursors. The structures of antigen-binding fragments for two homologous mAbs specific for lipid A, S55-3 and S55-5, have been determined both in complex with lipid A disaccharide backbone and unliganded. These high resolution structures reveal a conserved positively charged pocket formed within the complementarity determining region H2 loops that binds the terminal phosphates of lipid A. Significantly, this motif occurs in unrelated antibodies where it mediates binding to negatively charged moieties through a range of epitopes, including phosphorylated peptides used in diagnostics and therapeutics. S55-3 and S55-5 have combining sites distinct from anti-lipid A antibodies previously described (as a result of their separate germ line origin), which are nevertheless complementary both in shape and charge to the antigen. S55-3 and S55-5 display similar avidity toward lipid A despite possessing a number of different amino acid residues in their combining sites. Binding of lipid A occurs independent of the acyl chains, although the GlcN-O6 attachment point for the core oligosaccharide is buried in the combining site, which explains their inability to recognize LPS. Despite their lack of therapeutic potential, the observed motif may have significant immunological implications as a tool for engineering recombinant antibodies. PMID:26933033

  7. Interactions of PAMAM dendrimers with negatively charged model biomembranes.

    PubMed

    Yanez Arteta, Marianna; Ainalem, Marie-Louise; Porcar, Lionel; Martel, Anne; Coker, Helena; Lundberg, Dan; Chang, Debby P; Soltwedel, Olaf; Barker, Robert; Nylander, Tommy

    2014-11-13

    We have investigated the interactions between cationic poly(amidoamine) (PAMAM) dendrimers of generation 4 (G4), a potential gene transfection vector, with net-anionic model biomembranes composed of different ratios of zwitterionic phosphocholine (PC) and anionic phospho-L-serine (PS) phospholipids. Two types of model membranes were used: solid-supported bilayers, prepared with lipids carrying palmitoyl-oleoyl (PO) and diphytanoyl (DPh) acyl chains, and free-standing bilayers, formed at the interface between two aqueous droplets in oil (droplet interface bilayers, DIBs) using the DPh-based lipids. G4 dendrimers were found to translocate through POPC:POPS bilayers deposited on silica surfaces. The charge density of the bilayer affects translocation, which is reduced when the ionic strength increases. This shows that the dendrimer-bilayer interactions are largely controlled by their electrostatic attraction. The structure of the solid-supported bilayers remains intact upon translocation of the dendrimer. However, the amount of lipids in the bilayer decreases and dendrimer/lipid aggregates are formed in bulk solution, which can be deposited on the interfacial layers upon dilution of the system with dendrimer-free solvent. Electrophysiology measurements on DIBs confirm that G4 dendrimers cross the lipid membranes containing PS, which then become more permeable to ions. The obtained results have implications for PAMAM dendrimers as delivery vehicles to cells. PMID:25310456

  8. Structural Basis for Negative Cooperativity in Growth Factor Binding to an EGF Receptor

    SciTech Connect

    Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.

    2010-09-27

    Transmembrane signaling by the epidermal growth factor receptor (EGFR) involves ligand-induced dimerization and allosteric regulation of the intracellular tyrosine kinase domain. Crystallographic studies have shown how ligand binding induces dimerization of the EGFR extracellular region but cannot explain the high-affinity and low-affinity classes of cell-surface EGF-binding sites inferred from curved Scatchard plots. From a series of crystal structures of the Drosophila EGFR extracellular region, we show here how Scatchard plot curvature arises from negatively cooperative ligand binding. The first ligand-binding event induces formation of an asymmetric dimer with only one bound ligand. The unoccupied site in this dimer is structurally restrained, leading to reduced affinity for binding of the second ligand, and thus negative cooperativity. Our results explain the cell-surface binding characteristics of EGF receptors and suggest how individual EGFR ligands might stabilize distinct dimeric species with different signaling properties.

  9. Ligand binding to WW tandem domains of YAP2 transcriptional regulator is under negative cooperativity.

    PubMed

    Schuchardt, Brett J; Mikles, David C; Hoang, Lawrence M; Bhat, Vikas; McDonald, Caleb B; Sudol, Marius; Farooq, Amjad

    2014-12-01

    YES-associated protein 2 (YAP2) transcriptional regulator drives a multitude of cellular processes, including the newly discovered Hippo tumor suppressor pathway, by virtue of the ability of its WW domains to bind and recruit PPXY-containing ligands to specific subcellular compartments. Herein, we employ an array of biophysical tools to investigate allosteric communication between the WW tandem domains of YAP2. Our data show that the WW tandem domains of YAP2 negatively cooperate when binding to their cognate ligands. Moreover, the molecular origin of such negative cooperativity lies in an unfavorable entropic contribution to the overall free energy relative to ligand binding to isolated WW domains. Consistent with this notion, the WW tandem domains adopt a fixed spatial orientation such that the WW1 domain curves outwards and stacks onto the binding groove of the WW2 domain, thereby sterically hindering ligand binding to both itself and its tandem partner. Although ligand binding to both WW domains disrupts such interdomain stacking interaction, they reorient themselves and adopt an alternative fixed spatial orientation in the liganded state by virtue of their ability to engage laterally so as to allow their binding grooves to point outwards and away from each other. In short, while the ability of WW tandem domains to aid ligand binding is well documented, our demonstration that they may also be subject to negative binding cooperativity represents a paradigm shift in our understanding of the molecular action of this ubiquitous family of protein modules. PMID:25283809

  10. Ligand Binding to WW Tandem Domains of YAP2 Transcriptional Regulator Is Under Negative Cooperativity

    PubMed Central

    Schuchardt, Brett J.; Mikles, David C.; Hoang, Lawrence M.; Bhat, Vikas; McDonald, Caleb B.; Sudol, Marius; Farooq, Amjad

    2014-01-01

    YAP2 transcriptional regulator drives a multitude of cellular processes, including the newly discovered Hippo tumor suppressor pathway, by virtue of the ability of its WW domains to bind and recruit PPXY-containing ligands to specific subcellular compartments. Herein, we employ an array of biophysical tools to investigate allosteric communication between the WW tandem domains of YAP2. Our data show that the WW tandem domains of YAP2 negatively cooperate when binding to their cognate ligands. Moreover, the molecular origin of such negative cooperativity lies in an unfavorable entropic contribution to the overall free energy relative to ligand binding to isolated WW domains. Consistent with this notion, the WW tandem domains adopt a fixed spatial orientation such that the WW1 domain curves outwards and stacks onto the binding groove of WW2 domain, thereby sterically hindering ligand binding to both itself and its tandem partner. Although ligand binding to both WW domains disrupts such interdomain stacking interaction, they reorient themselves and adopt an alternative fixed spatial orientation in the liganded state by virtue of their ability to engage laterally so as to allow their binding grooves to point outwards and away from each other. In short, while the ability of WW tandem domains to aid ligand binding is well-documented, our demonstration that they may also be subject to negative binding cooperativity represents a paradigm shift in our understanding of the molecular action of this ubiquitous family of protein modules. PMID:25283809

  11. Measurement of positively and negatively charged particles inside PMSE during MIDAS SOLSTICE 2001

    NASA Astrophysics Data System (ADS)

    Smiley, B.; Robertson, S.; HoráNyi, M.; Blix, T.; Rapp, M.; Latteck, R.; Gumbel, J.

    2003-04-01

    A magnetically shielded, charge collecting rocket probe was used on two flights in the MIddle Atmosphere Dynamics and Structure (MIDAS) Studies of Layered STructures and ICE (SOLSTICE) 2001 rocket campaign over Andøya, Norway. The probe was a graphite collection surface with a permanent magnet underneath to deflect electrons. The first MIDAS was launched 17 June 2001 into a strong, multiply layered PMSE. The probe measured negative particles inside an electron biteout within the PMSE, having a peak charge number density of -1500 charges per cubic centimeter. The second MIDAS was launched 24 June 2001 into another strong, multiply layered PMSE. The probe saw a band of positive particles centered in the lowest radar echo maximum, and a negative particle layer accompanied by a positive ion excess. The charge number densities for the positive and negative PMSE particles were several thousand charges per cubic centimeter. Unexpectedly, 2 km beneath the PMSE, the probe also found a very pronounced negative layer, which was probably an NLC. Computer simulations of incoming, negatively charged ice grains were performed using a rarefied flow field representative of the MIDAS payload at zero angle of attack. Ice grains ≤1 nm in radius were diverted by the leading shock front, indicating the smallest detectable ice particle by this probe.

  12. Toward a Molecular Understanding of Protein Solubility: Increased Negative Surface Charge Correlates with Increased Solubility

    PubMed Central

    Kramer, Ryan M.; Shende, Varad R.; Motl, Nicole; Pace, C. Nick; Scholtz, J. Martin

    2012-01-01

    Protein solubility is a problem for many protein chemists, including structural biologists and developers of protein pharmaceuticals. Knowledge about how intrinsic factors influence solubility is limited due to the difficulty of obtaining quantitative solubility measurements. Solubility measurements in buffer alone are difficult to reproduce, because gels or supersaturated solutions often form, making it impossible to determine solubility values for many proteins. Protein precipitants can be used to obtain comparative solubility measurements and, in some cases, estimations of solubility in buffer alone. Protein precipitants fall into three broad classes: salts, long-chain polymers, and organic solvents. Here, we compare the use of representatives from two classes of precipitants, ammonium sulfate and polyethylene glycol 8000, by measuring the solubility of seven proteins. We find that increased negative surface charge correlates strongly with increased protein solubility and may be due to strong binding of water by the acidic amino acids. We also find that the solubility results obtained for the two different precipitants agree closely with each other, suggesting that the two precipitants probe similar properties that are relevant to solubility in buffer alone. PMID:22768947

  13. Gram-negative trimeric porins have specific LPS binding sites that are essential for porin biogenesis.

    PubMed

    Arunmanee, Wanatchaporn; Pathania, Monisha; Solovyova, Alexandra S; Le Brun, Anton P; Ridley, Helen; Baslé, Arnaud; van den Berg, Bert; Lakey, Jeremy H

    2016-08-23

    The outer membrane (OM) of gram-negative bacteria is an unusual asymmetric bilayer with an external monolayer of lipopolysaccharide (LPS) and an inner layer of phospholipids. The LPS layer is rigid and stabilized by divalent cation cross-links between phosphate groups on the core oligosaccharide regions. This means that the OM is robust and highly impermeable to toxins and antibiotics. During their biogenesis, OM proteins (OMPs), which function as transporters and receptors, must integrate into this ordered monolayer while preserving its impermeability. Here we reveal the specific interactions between the trimeric porins of Enterobacteriaceae and LPS. Isolated porins form complexes with variable numbers of LPS molecules, which are stabilized by calcium ions. In earlier studies, two high-affinity sites were predicted to contain groups of positively charged side chains. Mutation of these residues led to the loss of LPS binding and, in one site, also prevented trimerization of the porin, explaining the previously observed effect of LPS mutants on porin folding. The high-resolution X-ray crystal structure of a trimeric porin-LPS complex not only helps to explain the mutagenesis results but also reveals more complex, subtle porin-LPS interactions and a bridging calcium ion. PMID:27493217

  14. Characterization of a highly negative and labile binding protein induced in Euglena gracilis by cadmium

    SciTech Connect

    Gingrich, D.J.; Weber, D.N.; Shaw, C.F.; Garvey, J.S.; Petering, D.H.

    1986-03-01

    The physiochemical properties and physiological significance of the cadmium-binding protein (CdBP) of the algae Euglena gracilis have been studied. Following in vivo exposure of cells to 0.4 or 1.3 ..mu..g/mL of Cd/sup 2 +/, all the cytosolic Cd is bound to high molecular weight species. At 4.7 ..mu..g/mL, appreciable CdBP has formed in cells grown under illumination or in the dark. The large pool of very low molecular weight zinc species previously reported is increased when cells are exposed to high cadmium levels. Two distinct species, BP-1 and BP-2 are resolved by ion-exchange chromatography on DEAE-Sephadex. Unusually high conductivities are required to displace them, indicating that they are very negatively charged proteins at pH 8.6. The pH for half-titration of bound Cd/sup 2 +/ is between 5 and 6. Neither form of the CdBP cross-reacts with antibodies to rat liver metallothionein (MT) antibodies. The structural, chemical, and functional differences between the Euglena CdBPs and mammalian MTs are discussed. When cells are exposed to high levels of Cu, a CuBP is induced, and the very low molecular weight zinc band is depleted.

  15. The influence of negative charged centers on the hole transport in a typical molecularly doped polymer

    NASA Astrophysics Data System (ADS)

    Tyutnev, Andrey P.; Ikhsanov, Renat Sh.; Saenko, Vladimir S.; Pozhidaev, Evgenii D.

    2014-03-01

    We have studied effects of the negative charged centers on the time of flight (TOF) curves measured in a typical hole-conducting molecularly doped polymer. The main effects are the unusual TOF (surface generation) current rise in the preflight region (be it a flat plateau or a cusp) due to the accumulated space charge and the current reduction at all times because of the monomolecular recombination. TOF-2 (bulk generation) transients are less sensitive to charged centers. Analysis of these effects has proved that charged centers do not change the carrier mobility provided that the space charge field and bimolecular recombination are properly accounted for in terms of the proposed two-layer MT model. We have shown that combination of TOF, TOF-1a and TOF-2 variants of the electron-gun based technique allows one to establish definitively the character of the charge carrier transport in MDPs.

  16. The Role of Negative Charge in the Delivery of Quantum Dots to Neurons

    PubMed Central

    Walters, Ryan; Medintz, Igor L.; Delehanty, James B.; Stewart, Michael H.; Susumu, Kimihiro; Huston, Alan L.; Dawson, Philip E.

    2015-01-01

    Despite our extensive knowledge of the structure of negatively charged cell surface proteoglycans and sialoglycoconjugates in the brain, we have little understanding of how their negative charge contributes to brain function. We have previously shown that intensely photoluminescent 9-nm diameter quantum dots (QDs) with a CdSe core, a ZnS shell, and a negatively charged compact molecular ligand coating (CL4) selectively target neurons rather than glia. We now provide an explanation for this selective neuronal delivery. In this study, we compared three zwitterionic QD coatings differing only in their regions of positive or negative charge, as well as a positively charged (NH2) polyethylene glycol (PEG) coat, for their ability to deliver the cell-membrane-penetrating chaperone lipopeptide JB577 (WG(Palmitoyl)VKIKKP9G2H6) to individual cells in neonatal rat hippocampal slices. We confirm both that preferential uptake in neurons, and the lack of uptake in glia, is strongly associated with having a region of greater negative charge on the QD coating. In addition, the role of negatively charged chondroitin sulfate of the extracellular matrix (ECM) in restricting uptake was further suggested by digesting neonatal rat hippocampal slices with chondroitinase ABC and showing increased uptake of QDs by oligodendrocytes. Treatment still did not affect uptake in astrocytes or microglia. Finally, the future potential of using QDs as vehicles for trafficking proteins into cells continues to show promise, as we show that by administering a histidine-tagged green fluorescent protein (eGFP-His6) to hippocampal slices, we can observe neuronal uptake of GFP. PMID:26243591

  17. The Role of Negative Charge in the Delivery of Quantum Dots to Neurons.

    PubMed

    Walters, Ryan; Medintz, Igor L; Delehanty, James B; Stewart, Michael H; Susumu, Kimihiro; Huston, Alan L; Dawson, Philip E; Dawson, Glyn

    2015-01-01

    Despite our extensive knowledge of the structure of negatively charged cell surface proteoglycans and sialoglycoconjugates in the brain, we have little understanding of how their negative charge contributes to brain function. We have previously shown that intensely photoluminescent 9-nm diameter quantum dots (QDs) with a CdSe core, a ZnS shell, and a negatively charged compact molecular ligand coating (CL4) selectively target neurons rather than glia. We now provide an explanation for this selective neuronal delivery. In this study, we compared three zwitterionic QD coatings differing only in their regions of positive or negative charge, as well as a positively charged (NH2) polyethylene glycol (PEG) coat, for their ability to deliver the cell-membrane-penetrating chaperone lipopeptide JB577 (WG(Palmitoyl)VKIKKP9G2H6) to individual cells in neonatal rat hippocampal slices. We confirm both that preferential uptake in neurons, and the lack of uptake in glia, is strongly associated with having a region of greater negative charge on the QD coating. In addition, the role of negatively charged chondroitin sulfate of the extracellular matrix (ECM) in restricting uptake was further suggested by digesting neonatal rat hippocampal slices with chondroitinase ABC and showing increased uptake of QDs by oligodendrocytes. Treatment still did not affect uptake in astrocytes or microglia. Finally, the future potential of using QDs as vehicles for trafficking proteins into cells continues to show promise, as we show that by administering a histidine-tagged green fluorescent protein (eGFP-His6) to hippocampal slices, we can observe neuronal uptake of GFP. PMID:26243591

  18. Nanotribological Properties of Positively and Negatively charged nanodiamonds as additives to solutions

    NASA Astrophysics Data System (ADS)

    Liu, Zijian; Corley, Steven; Shenderova, Olga; Brenner, Donald; Krim, Jacqueline

    2013-03-01

    Nano-diamond (ND) particles are known to be beneficial for wear and friction reduction when used as additives in liquids, but the fundamental origins of the improvement in tribological properties has not been established. In order to explore this issue, we have investigated the nanotribological properties of ND coated with self-assembled monolayers (SAM) as additives to solutions, employing gold/chrome coated quartz crystal microbalances (QCM). Measurements were performed with the QCM initially immersed in deionized water. ND particles with positively and negatively charged SAM end groups were then added to the water, while the frequency and amplitude of the QCM were monitored. Negative shifts in both the QCM frequency and amplitude were observed when ND with positively charged SAM end groups were added, while positive shifts in both the QCM frequency and amplitude were observed when ND with negatively charged ND end groups were added. The results are consistent with a lubricating effect for the negatively charged ND, but were only observed for sufficiently small negative ND particle size. Experiments on QCM surfaces with differing textures and roughness are in progress, to determine the separate contributing effects of surface roughness charge-water interactions. Funding provided by NSF DMR.

  19. Influence of bismuth on the charging ability of negative plates in lead-acid batteries

    NASA Astrophysics Data System (ADS)

    Lam, L. T.; Ceylan, H.; Haigh, N. P.; Manders, J. E.

    To examine the influence of bismuth on the charging ability of negative plates in lead-acid batteries, plates are made from three types of oxides: (i) leady oxide of high quality which contains virtually no bismuth (termed 'control oxide'); (ii) control oxide in which bismuth oxide is blended at bismuth levels from 0.01 to 0.12 wt.%; (iii) leady oxide produced from Pasminco VRLA Refined™ lead (0.05-0.06 wt.%Bi). An experimental tool—the 'conversion indicator'—is developed to assess the charging ability of the test negative plates when cycling under either zero percent state-of-charge (SoC)/full-charge or partial state-of-charge (PSoC) duty. Although the conversion indicator is not the true charging efficiency, the two parameters have a close relationship, namely, the higher the conversion indicator, the greater the charging efficiency. Little difference is found in the charging ability, irrespective of bismuth content and discharge rate, when the plates are subjected to zero percent SoC/full-charge duty; the conversion indicator lies in the range 81-84%. By contrast, there is a marked difference when the negative plates are subjected to PSoC duty, i.e. consecutive cycling through 90-60, 70-40, 80-40 and 90-40% SoC windows. Up to 0.06 wt.%Bi improves the charging ability, especially with a low and narrow PSoC window (40-70% SoC) of the type that will be experienced in 42 V powernet automobile and hybrid electric duties. To maximize this beneficial effect, bismuth must be distributed uniformly in the plates. This is best achieved by using VRLA Refined™ lead for oxide production.

  20. Ionic Surfactant Binding to pH-Responsive Polyelectrolyte Brush-Grafted Nanoparticles in Suspension and on Charged Surfaces.

    PubMed

    Riley, John K; An, Junxue; Tilton, Robert D

    2015-12-29

    The interactions between silica nanoparticles grafted with a brush of cationic poly(2-(dimethylamino) ethyl methacrylate) (SiO2-g-PDMAEMA) and anionic surfactant sodium dodecyl sulfate (SDS) is investigated by dynamic light scattering, electrophoretic mobility, quartz crystal microbalance with dissipation, ellipsometry, and atomic force microscopy. SiO2-g-PDMAEMA exhibits pH-dependent charge and size properties which enable the SDS binding to be probed over a range of electrostatic conditions and brush conformations. SDS monomers bind irreversibly to SiO2-g-PDMAEMA at low surfactant concentrations (∼10(-4) M) while exhibiting a pH-dependent threshold above which cooperative, partially reversible SDS binding occurs. At pH 5, SDS binding induces collapse of the highly charged and swollen brush as observed in the bulk by DLS and on surfaces by QCM-D. Similar experiments at pH 9 suggest that SDS binds to the periphery of the weakly charged and deswollen brush and produces SiO2-g-PDMAEMA/SDS complexes with a net negative charge. SiO2-g-PDMAEMA brush collapse and charge neutralization is further confirmed by colloidal probe AFM measurements, where reduced electrosteric repulsions and bridging adhesion are attributed to effects of the bound SDS. Additionally, sequential adsorption schemes with SDS and SiO2-g-PDMAEMA are used to enhance deposition relative to SiO2-g-PDMAEMA direct adsorption on silica. This work shows that the polyelectrolyte brush configuration responds in a more dramatic fashion to SDS than to pH-induced changes in ionization, and this can be exploited to manipulate the structure of adsorbed layers and the corresponding forces of compression and friction between opposing surfaces. PMID:26649483

  1. Process for preparing negative plates for use in a dry charge battery

    SciTech Connect

    Wegner, P.C.

    1986-02-11

    This patent describes a process for the production of lead-containing negative plates for use in a dry charge battery. The process cnsists of drying wet negative plates while protecting them from oxidation. This improvement is accomplished by treating the wet negative plates prior to the drying operation with an aqueous soluton of an oxidation inhibiting agent selected from salicylic acid, and 2-naphtol. The plates are then protected against oxidation during drying; and dry negative plates are obtained which are resistant to the absorption of water from the atmosphere on storage but are wet immediately by battery acid in use.

  2. Quantum mechanical investigations on the role of neutral and negatively charged enamine intermediates in organocatalyzed reactions

    NASA Astrophysics Data System (ADS)

    Hubin, Pierre O.; Jacquemin, Denis; Leherte, Laurence; Vercauteren, Daniel P.

    2014-04-01

    The proline-catalyzed aldol reaction is the seminal example of asymmetric organocatalysis. Previous theoretical and experimental studies aimed at identifying its mechanism in order to rationalize the outcome of this reaction. Here, we focus on key steps with modern first principle methods, i.e. the M06-2X hybrid exchange-correlation functional combined to the solvation density model to account for environmental effects. In particular, different pathways leading to the formation of neutral and negatively charged enamine intermediates are investigated, and their reactivity towards two electrophiles, i.e. an aldehyde and a benzhydrylium cation, are compared. Regarding the self-aldol reaction, our calculations confirm that the neutral enamine intermediate is more reactive than the negatively charged one. For the reaction with benzhydrylium cations however, the negatively charged enamine intermediate is more reactive.

  3. Dust acoustic solitary wave with variable dust charge: Role of negative ions

    SciTech Connect

    Ghosh, Samiran

    2005-09-15

    The role of negative ions on small but finite amplitude dust acoustic solitary wave including the effects of high and low charging rates of dust grains compared to the dust oscillation frequency in electronegative dusty plasma is investigated. In the case of high charging rate, the solitary wave is governed by Korteweg-de Vries (KdV) equation, but in the case of low charging rate, it is governed by KdV equation with a linear damping term. Numerical investigations reveal that in both cases dust acoustic soliton sharpens (flatens) and soliton width decreases (increases) with the increase of negative-ion number density (temperature). Also, the negative ions reduce the damping rate.

  4. Negative space charge effects in photon-enhanced thermionic emission solar converters

    SciTech Connect

    Segev, G.; Weisman, D.; Rosenwaks, Y.; Kribus, A.

    2015-07-06

    In thermionic energy converters, electrons in the gap between electrodes form a negative space charge and inhibit the emission of additional electrons, causing a significant reduction in conversion efficiency. However, in Photon Enhanced Thermionic Emission (PETE) solar energy converters, electrons that are reflected by the electric field in the gap return to the cathode with energy above the conduction band minimum. These electrons first occupy the conduction band from which they can be reemitted. This form of electron recycling makes PETE converters less susceptible to negative space charge loss. While the negative space charge effect was studied extensively in thermionic converters, modeling its effect in PETE converters does not account for important issues such as this form of electron recycling, nor the cathode thermal energy balance. Here, we investigate the space charge effect in PETE solar converters accounting for electron recycling, with full coupling of the cathode and gap models, and addressing conservation of both electric and thermal energy. The analysis shows that the negative space charge loss is lower than previously reported, allowing somewhat larger gaps compared to previous predictions. For a converter with a specific gap, there is an optimal solar flux concentration. The optimal solar flux concentration, the cathode temperature, and the efficiency all increase with smaller gaps. For example, for a gap of 3 μm the maximum efficiency is 38% and the optimal flux concentration is 628, while for a gap of 5 μm the maximum efficiency is 31% and optimal flux concentration is 163.

  5. Bactericidal action mechanism of negatively charged food grade clove oil nanoemulsions.

    PubMed

    Majeed, Hamid; Liu, Fei; Hategekimana, Joseph; Sharif, Hafiz Rizwan; Qi, Jing; Ali, Barkat; Bian, Yuan-Yuan; Ma, Jianguo; Yokoyama, Wallace; Zhong, Fang

    2016-04-15

    Clove oil (CO) anionic nanoemulsions were prepared with varying ratios of CO to canola oil (CA), emulsified and stabilized with purity gum ultra (PGU), a newly developed succinylated waxy maize starch. Interfacial tension measurements showed that CO acted as a co-surfactant and there was a gradual decrease in interfacial tension which favored the formation of small droplet sizes on homogenization until a critical limit (5:5% v/v CO:CA) was reached. Antimicrobial activity of the negatively charged CO nanoemulsion was determined against Gram positive GPB (Listeria monocytogenes and Staphylococcus aureus) and Gram negative GNB (Escherichia coli) bacterial strains using minimum inhibitory concentration (MIC) and a time kill dynamic method. Negatively charged PGU emulsified CO nanoemulsion showed prolonged antibacterial activities against Gram positive bacterial strains. We concluded that negatively charged CO nanoemulsion droplets self-assemble with GPB cell membrane, and facilitated interaction with cellular components of bacteria. Moreover, no electrostatic interaction existed between negatively charged droplets and the GPB membrane. PMID:26616926

  6. Binding constraints on the evolution of enzymes and signalling proteins: the important role of negative pleiotropy.

    PubMed

    Liberles, David A; Tisdell, Makayla D M; Grahnen, Johan A

    2011-07-01

    A number of biophysical and population-genetic processes influence amino acid substitution rates. It is commonly recognized that proteins must fold into a native structure with preference over an unfolded state, and must bind to functional interacting partners favourably to function properly. What is less clear is how important folding and binding specificity are to amino acid substitution rates. A hypothesis of the importance of binding specificity in constraining sequence and functional evolution is presented. Examples include an evolutionary simulation of a population of SH2 sequences evolved by threading through the structure and binding to a native ligand, as well as SH3 domain signalling in yeast and selection for specificity in enzymatic reactions. An example in vampire bats where negative pleiotropy appears to have been adaptive is presented. Finally, considerations of compartmentalization and macromolecular crowding on negative pleiotropy are discussed. PMID:21490020

  7. Aspects of lead/acid battery technology 5. Dry charging of formed negative plates

    NASA Astrophysics Data System (ADS)

    Prout, L.

    The objective in the dry charging of formed negative plates in lead/acid batteries is to preserve the highly active sponge lead material from attack by atmospheric oxygen until the dry and unfilled charged battery is put into service. This review discusses the following methods that are commonly used for dry charging: (i) drying in a vacuum; (ii) drying by direct application of superheated steam; (iii) drying in an inert-gas atmosphere; (iv) removal of water by hot kerosene and subsequent drying in a closed kerosene vapour chamber and (v) drying in the presence of anti-oxidants. The protection of dry-charge characteristics, rapid evaluation of dry-charge quality and testing for excess wax or oil inhibitors are also described.

  8. Sprite produced by consecutive impulse charge transfers following a negative stroke: Observation and simulation

    NASA Astrophysics Data System (ADS)

    Lu, Gaopeng; Cummer, Steven A.; Tian, Ye; Zhang, Hongbo; Lyu, Fanchao; Wang, Tao; Stanley, Mark A.; Yang, Jing; Lyons, Walter A.

    2016-04-01

    On the morning of 5 June 2013, two cameras of the SpriteCam network concurrently captured a red sprite with diffuse halo over a mesoscale convective system (MCS) passing the panhandle area of Oklahoma. This sprite was produced by a negative cloud-to-ground (CG) stroke with peak current of -103 kA in a manner different from previous observations in several aspects. First of all, the causative stroke of sprite is located by the National Lightning Detection Network (NLDN) in the trailing stratiform of MCS, instead of the deep convection typically for negative sprites. Second, the sprite-producing stroke was likely the first stroke of a multistroke negative CG flash (with ≥6 CG strokes) whose evolution was mainly confined in the lower part of thunderstorm; although the parent flash of sprite might contain relatively long in-cloud evolution prior to the first stroke, there is no evidence that the negative leader had propagated into the upper positive region of thundercloud as typically observed for the sprite-producing/class negative CG strokes. Third, as shown by the simulation with a two-dimensional full-wave electrodynamic model, although the impulse charge moment change (-190 C km) produced by the main stroke was not sufficient to induce conventional breakdown in the mesosphere, a second impulse charge transfer occurred with ~2 ms delay to cause a substantial charge transfer (-290 C km) so that the overall charge moment change (-480 C km) exceeded the threshold for sprite production; this is a scenario different from the typical case discussed by Li et al. (2012). As for the source of the second current pulse that played a critical role to produce the sprite, it could be an M component whose charge source was at least 9 km horizontally displaced from the main stroke or a negative CG stroke (with weak peak current for the return stroke) that was not detected by the NLDN.

  9. Drosophila transcriptional repressor protein that binds specifically to negative control elements in fat body enhancers.

    PubMed Central

    Falb, D; Maniatis, T

    1992-01-01

    Expression of the Drosophila melanogaster Adh gene in adults requires a fat body-specific enhancer called the Adh adult enhancer (AAE). We have identified a protein in Drosophila nuclear extracts that binds specifically to a site within the AAE (adult enhancer factor 1 [AEF-1]). In addition, we have shown that AEF-1 binds specifically to two other Drosophila fat body enhancers. Base substitutions in the AEF-1 binding site that disrupt AEF-1 binding in vitro result in a significant increase in the level of Adh expression in vivo. Thus, the AEF-1 binding site is a negative regulatory element within the AAE. A cDNA encoding the AEF-1 protein was isolated and shown to act as a repressor of the AAE in cotransfection studies. The AEF-1 protein contains four zinc fingers and an alanine-rich sequence. The latter motif is found in other eukaryotic proteins known to be transcriptional repressors. Images PMID:1508206

  10. Dynamic secondary electron emission characteristics of polymers in negative charging process

    NASA Astrophysics Data System (ADS)

    Weng, Ming; Hu, Tian-Cun; Zhang, Na; Cao, Meng

    2016-04-01

    We studied the dynamic secondary electron emission (SEE) characteristics of a polyimide sample in negative charging process under electron bombardment. The time evolution of secondary electron yield (SEY) has been measured with a pulsed electron gun. The dynamic SEY, as well as the surface potential have been analyzed using a capacitance model. The shift in surface potential caused by the negative charge accumulation on the sample reduces the landing energy of the primary electrons (PEs), which in turn alters the SEY. The charging process tends to be stable when the landing energy of PEs reaches the secondary crossover energy where the corresponding SEY is 1. The surface potential has an approximately negative exponential relationship with the irradiation time. The total accumulated charge at the stable state is found to be proportional to the product of the sample capacitance and the difference between initial incident energy and the secondary crossover energy. The time constant of the exponential function is proportional to the ratio of final accumulated charge to the incident current.

  11. Crystallographic Study of Novel Transthyretin Ligands Exhibiting Negative-Cooperativity between Two Thyroxine Binding Sites

    PubMed Central

    Singh, Rajiv Ranjan; Mishra, Satyendra; Gupta, Sarika; Surolia, Avadhesha; Salunke, Dinakar M.

    2012-01-01

    Background Transthyretin (TTR) is a homotetrameric serum and cerebrospinal fluid protein that transports thyroxine (T4) and retinol by binding to retinol binding protein. Rate-limiting tetramer dissociation and rapid monomer misfolding and disassembly of TTR lead to amyloid fibril formation in different tissues causing various amyloid diseases. Based on the current understanding of the pathogenesis of TTR amyloidosis, it is considered that the inhibition of amyloid fibril formation by stabilization of TTR in native tetrameric form is a viable approach for the treatment of TTR amyloidosis. Methodology and Principal Findings We have examined interactions of the wtTTR with a series of compounds containing various substitutions at biphenyl ether skeleton and a novel compound, previously evaluated for binding and inhibiting tetramer dissociation, by x-ray crystallographic approach. High resolution crystal structures of five ligands in complex with wtTTR provided snapshots of negatively cooperative binding of ligands in two T4 binding sites besides characterizing their binding orientations, conformations, and interactions with binding site residues. In all complexes, the ligand has better fit and more potent interactions in first T4 site i.e. (AC site) than the second T4 site (BD site). Together, these results suggest that AC site is a preferred ligand binding site and retention of ordered water molecules between the dimer interfaces further stabilizes the tetramer by bridging a hydrogen bond interaction between Ser117 and its symmetric copy. Conclusion Novel biphenyl ether based compounds exhibit negative-cooperativity while binding to two T4 sites which suggests that binding of only single ligand molecule is sufficient to inhibit the TTR tetramer dissociation. PMID:22973437

  12. Ion-exchange molecularly imprinted polymer for the extraction of negatively charged acesulfame from wastewater samples.

    PubMed

    Zarejousheghani, Mashaalah; Schrader, Steffi; Möder, Monika; Lorenz, Pierre; Borsdorf, Helko

    2015-09-11

    Acesulfame is a known indicator that is used to identify the introduction of domestic wastewater into water systems. It is negatively charged and highly water-soluble at environmental pH values. In this study, a molecularly imprinted polymer (MIP) was synthesized for negatively charged acesulfame and successfully applied for the selective solid phase extraction (SPE) of acesulfame from influent and effluent wastewater samples. (Vinylbenzyl)trimethylammonium chloride (VBTA) was used as a novel phase transfer reagent, which enhanced the solubility of negatively charged acesulfame in the organic solvent (porogen) and served as a functional monomer in MIP synthesis. Different molecularly imprinted polymers were synthesized to optimize the extraction capability of acesulfame. The different materials were evaluated using equilibrium rebinding experiments, selectivity experiments and scanning electron microscopy (SEM). The most efficient MIP was used in a molecularly imprinted-solid phase extraction (MISPE) protocol to extract acesulfame from wastewater samples. Using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS-MS) analysis, detection and quantification limits were achieved at 0.12μgL(-1) and 0.35μgL(-1), respectively. Certain cross selectivity for the chemical compounds containing negatively charged sulfonamide functional group was observed during selectivity experiments. PMID:26256920

  13. Charged particle flows in the beam extraction region of a negative ion source for NBI

    NASA Astrophysics Data System (ADS)

    Geng, S.; Tsumori, K.; Nakano, H.; Kisaki, M.; Ikeda, K.; Osakabe, M.; Nagaoka, K.; Takeiri, Y.; Shibuya, M.; Kaneko, O.

    2016-02-01

    Experiments by a four-pin probe and photodetachment technique were carried out to investigate the charged particle flows in the beam extraction region of a negative hydrogen ion source for neutral beam injector. Electron and positive ion flows were obtained from the polar distribution of the probe saturation current. Negative hydrogen ion flow velocity and temperature were obtained by comparing the recovery times of the photodetachment signals at opposite probe tips. Electron and positive ions flows are dominated by crossed field drift and ambipolar diffusion. Negative hydrogen ion temperature is evaluated to be 0.12 eV.

  14. Charged particle flows in the beam extraction region of a negative ion source for NBI.

    PubMed

    Geng, S; Tsumori, K; Nakano, H; Kisaki, M; Ikeda, K; Osakabe, M; Nagaoka, K; Takeiri, Y; Shibuya, M; Kaneko, O

    2016-02-01

    Experiments by a four-pin probe and photodetachment technique were carried out to investigate the charged particle flows in the beam extraction region of a negative hydrogen ion source for neutral beam injector. Electron and positive ion flows were obtained from the polar distribution of the probe saturation current. Negative hydrogen ion flow velocity and temperature were obtained by comparing the recovery times of the photodetachment signals at opposite probe tips. Electron and positive ions flows are dominated by crossed field drift and ambipolar diffusion. Negative hydrogen ion temperature is evaluated to be 0.12 eV. PMID:26931985

  15. Negative Ion CID Fragmentation of O-linked Oligosaccharide Aldoses—Charge Induced and Charge Remote Fragmentation

    NASA Astrophysics Data System (ADS)

    Doohan, Roisin A.; Hayes, Catherine A.; Harhen, Brendan; Karlsson, Niclas Göran

    2011-06-01

    Collision induced dissociation (CID) fragmentation was compared between reducing and reduced sulfated, sialylated, and neutral O-linked oligosaccharides. It was found that fragmentation of the [M - H]- ions of aldoses with acidic residues gave unique Z-fragmentation of the reducing end GalNAc containing the acidic C-6 branch, where the entire C-3 branch was lost. This fragmentation pathway, which is not seen in the alditols, showed that the process involved charge remote fragmentation catalyzed by a reducing end acidic anomeric proton. With structures containing sialic acid on both the C-3 and C-6 branch, the [M - H]- ions were dominated by the loss of sialic acid. This fragmentation pathway was also pronounced in the [M - 2H]2- ions revealing both the C-6 Z-fragment plus its complementary C-3 C-fragment in addition to glycosidic and cross ring fragmentation. This generation of the Z/C-fragment pairs from GalNAc showed that the charges were not participating in their generation. Fragmentation of neutral aldoses showed pronounced Z-fragmentation believed to be generated by proton migration from the C-6 branch to the negatively charged GalNAc residue followed by charge remote fragmentation similar to the acidic oligosaccharides. In addition, A-type fragments generated by charge induced fragmentation of neutral oligosaccharides were observed when the charge migrated from C-1 of the GalNAc to the GlcNAc residue followed by rearrangement to accommodate the 0,2A-fragmentation. LC-MS also showed that O-linked aldoses existed as interchangeable α/β pyranose anomers, in addition to a third isomer (25% of the total free aldose) believed to be the furanose form.

  16. Photodissociation and charge transfer dynamics of negative ions studied with femtosecond photoelectron spectroscopy

    SciTech Connect

    Zanni, Martin T.

    1999-12-17

    This dissertation presents studies aimed at understanding the potential energy surfaces and dynamics of isolated negative ions, and the effects of solvent on each. Although negative ions play important roles in atmospheric and solution phase chemistry, to a large extent the ground and excited state potential energy surfaces of gas phase negative ions are poorly characterized, and solvent effects even less well understood. In an effort to fill this gap, the author's coworkers and the author have developed a new technique, anion femtosecond photoelectron spectroscopy, and applied it to gas phase photodissociation and charge transfer processes. Studies are presented that (1) characterize the ground and excited states of isolated and clustered anions, (2) monitor the photodissociation dynamics of isolated and clustered anions, and (3) explore the charge-transfer-to-solvent states of atomic iodide clustered with polar and non-polar solvents.

  17. Heterostructured magnetite-titanate nanosheets for prompt charge selective binding and magnetic separation of mixed proteins.

    PubMed

    Zhou, Qinhua; Lu, Zhufeng; Cao, Xuebo

    2014-02-01

    We reported the prompt charge selective binding and magnetic separation of mixed proteins by utilizing heterostructured Fe3O4-Na2Ti3O7 nanosheets. Fe3O4-Na2Ti3O7 nanosheets are found to combine a variety of structure and property merits, such as the increased interlayer galleries, exposed exchange sites, flexible framework, and magnetic manipulability. Probing the dissociation dynamics of Na(+) inside the nanosheets reveals that they possess remarkably enhanced Na(+) dissociation capability and the dissociation rate of Na(+) reaches 7.9×10(-)(6)mol g(-)(1)s(-)(1), much superior to titanate nanotubes. In model protein separation experiments, we utilize mixed proteins containing albumin and hemoglobin to assess Fe3O4-Na2Ti3O7 nanosheets. It is found that, by controlling the pH of the sample at 6, positively charged hemoglobin and negatively charged albumin are immediately separated (∼5s) by the nanosheets and the saturated loading capacity of hemoglobin on the nanosheets reaches 4.7±0.61g g(-)(1). Furthermore, hemoglobin bound to the nanosheets can be readily released after buffer wash and is not damaged, while the nanosheets are recyclable and maintain their high efficiency. The outstanding performance of Fe3O4-Na2Ti3O7 nanosheets in separating mixed proteins is attributed to the ultrafast Na(+) dissociation rate, flexible titanate framework, open geometry, and aqueous-like environment to stabilize proteins. These merits, together with the recyclability and cost effectiveness, should make Fe3O4-Na2Ti3O7 nanosheets ideal candidates for biological recognition, isolation, and purification under technologically useful conditions. PMID:24267329

  18. Membrane binding of peptide models for early stages of amyloid formation: Lipid packing counts more than charge.

    PubMed

    Hoernke, Maria; Tassler, Stephanie; Koksch, Beate; Brezesinski, Gerald

    2016-06-01

    Amyloid formation is related to neurodegenerative diseases like Alzheimer's disease or Parkinson's disease. In the molecular onset of the diseases, soluble peptides adopt conformations that are rich in β-sheet and ultimately form aggregates. How this process is triggered or influenced by membrane binding, or how the membrane integrity is disturbed by the peptide binding and conformational transition is still under debate. In the present study, we systematically examine the effects of β-sheet prone model peptides on zwitterionic and negatively charged lipids in both mono- and bilayers and in various lipid phase states by infrared reflection absorption spectroscopy, grazing incidence X-ray diffraction, and small and wide angle X-ray scattering. No difference in the interaction of the peptides with zwitterionic or negatively charged lipids was observed. Furthermore, the interaction of β-sheet prone model peptides leaves the lipid structure largely unaffected. However, the lipid phase state decides upon the mode of interaction. Peptides insert into liquid-expanded layers and interact only with the head groups of liquid-condensed lipid layers. Using a zoo of complementary techniques and critically examining preparation procedures we are able to obtain an unambiguous picture of peptide binding to membranes. PMID:27134131

  19. Efficient in vivo gene delivery by the negatively charged complexes of cationic liposomes and plasmid DNA.

    PubMed

    Son, K K; Tkach, D; Hall, K J

    2000-09-29

    We examined changes in zeta potential (the surface charge density, zeta) of the complexes of liposome (nmol)/DNA (microg) (L/D) formed in water at three different ratios (L/D=1, 10 and 20) by changing the ionic strength or pH to find an optimum formulation for in vivo gene delivery. At high DNA concentrations, zeta of the complexes formed in water at L/D=10 was significantly lowered by adding NaCl (zeta=+8.44+/-3.1 to -27.6+/-3.5 mV) or increasing pH from 5 (zeta=+15.3+/-1.0) to 9 (zeta=-22.5+/-2.5 mV). However, the positively charged complexes formed at L/D=20 (zeta=+6.2+/-3.5 mV) became negative as NaCl was added at alkaline pH as observed in medium (zeta=-19.7+/-9.9 mV). Thus, the complexes formed in water under the optimum condition were stable and largely negatively charged at L/D=1 (zeta=-58.1+/-3.9 mV), unstable and slightly positively charged at L/D=10 (zeta=+8.44+/-3.7 mV), and unstable and largely positively charged at L/D=20 (zeta=+24.3+/-3.6 mV). The negatively charged complexes efficiently delivered DNA into both solid and ascitic tumor cells. However, the positively charged complexes were very poor in delivering DNA into solid tumors, yet were efficient in delivering DNA into ascitic tumors grown in the peritoneum regardless of complex size. This slightly lower gene transfer efficiency of the negatively charged complexes can be as efficient as the positively charged ones when an injection is repeated (at least two injections), which is the most common case for therapy regimes. The results indicate that optimum in vivo lipofection may depend on the site of tumor growth. PMID:11018645

  20. Ionization Efficiency of Doubly Charged Ions Formed from Polyprotic Acids in Electrospray Negative Mode.

    PubMed

    Liigand, Piia; Kaupmees, Karl; Kruve, Anneli

    2016-07-01

    The ability of polyprotic acids to give doubly charged ions in negative mode electrospray was studied and related to physicochemical properties of the acids via linear discriminant analysis (LDA). It was discovered that the compound has to be strongly acidic (low pK a1 and pK a2) and to have high hydrophobicity (logP ow) to become multiply charged. Ability to give multiply charged ions in ESI/MS cannot be directly predicted from the solution phase acidities. Therefore, for the first time, a quantitative model to predict the charge state of the analyte in ESI/MS is proposed and validated for small anions. Also, a model to predict ionization efficiencies of these analytes was developed. Results indicate that acidity of the analyte, its octanol-water partition coefficient, and charge delocalization are important factors that influence ionization efficiencies as well as charge states of the analytes. The pH of the solvent was also found to be an important factor influencing the ionization efficiency of doubly charged ions. Graphical Abstract ᅟ. PMID:27044024

  1. Ionization Efficiency of Doubly Charged Ions Formed from Polyprotic Acids in Electrospray Negative Mode

    NASA Astrophysics Data System (ADS)

    Liigand, Piia; Kaupmees, Karl; Kruve, Anneli

    2016-07-01

    The ability of polyprotic acids to give doubly charged ions in negative mode electrospray was studied and related to physicochemical properties of the acids via linear discriminant analysis (LDA). It was discovered that the compound has to be strongly acidic (low p K a1 and p K a2) and to have high hydrophobicity (log P ow) to become multiply charged. Ability to give multiply charged ions in ESI/MS cannot be directly predicted from the solution phase acidities. Therefore, for the first time, a quantitative model to predict the charge state of the analyte in ESI/MS is proposed and validated for small anions. Also, a model to predict ionization efficiencies of these analytes was developed. Results indicate that acidity of the analyte, its octanol-water partition coefficient, and charge delocalization are important factors that influence ionization efficiencies as well as charge states of the analytes. The pH of the solvent was also found to be an important factor influencing the ionization efficiency of doubly charged ions.

  2. Simulation of space charge compensation in a multibeamlet negative ion beam.

    PubMed

    Sartori, E; Maceina, T J; Veltri, P; Cavenago, M; Serianni, G

    2016-02-01

    Ion beam space charge compensation occurs by cumulating in the beam potential well charges having opposite polarity, usually generated by collisional processes. In this paper we investigate the case of a H(-) ion beam drift, in a bi-dimensional approximation of the NIO1 (Negative Ion Optimization phase 1) negative ion source. H(-) beam ion transport and plasma formation are studied via particle-in-cell simulations. Differential cross sections are sampled to determine the velocity distribution of secondary particles generated by ionization of the residual gas (electrons and slow H2 (+) ions) or by stripping of the beam ions (electrons, H, and H(+)). The simulations include three beamlets of a horizontal section, so that multibeamlet space charge and secondary particle diffusion between separate generation regions are considered, and include a repeller grid biased at various potentials. Results show that after the beam space charge is effectively screened by the secondary plasma in about 3 μs (in agreement with theoretical expectations), a plasma grows across the beamlets with a characteristic time three times longer, and a slight overcompensation of the electric potential is verified as expected in the case of negative ions. PMID:26932089

  3. Simulation of space charge compensation in a multibeamlet negative ion beam

    NASA Astrophysics Data System (ADS)

    Sartori, E.; Maceina, T. J.; Veltri, P.; Cavenago, M.; Serianni, G.

    2016-02-01

    Ion beam space charge compensation occurs by cumulating in the beam potential well charges having opposite polarity, usually generated by collisional processes. In this paper we investigate the case of a H- ion beam drift, in a bi-dimensional approximation of the NIO1 (Negative Ion Optimization phase 1) negative ion source. H- beam ion transport and plasma formation are studied via particle-in-cell simulations. Differential cross sections are sampled to determine the velocity distribution of secondary particles generated by ionization of the residual gas (electrons and slow H2+ ions) or by stripping of the beam ions (electrons, H, and H+). The simulations include three beamlets of a horizontal section, so that multibeamlet space charge and secondary particle diffusion between separate generation regions are considered, and include a repeller grid biased at various potentials. Results show that after the beam space charge is effectively screened by the secondary plasma in about 3 μs (in agreement with theoretical expectations), a plasma grows across the beamlets with a characteristic time three times longer, and a slight overcompensation of the electric potential is verified as expected in the case of negative ions.

  4. Distinctive Binding of Avibactam to Penicillin-Binding Proteins of Gram-Negative and Gram-Positive Bacteria

    PubMed Central

    Asli, Abdelhamid; Brouillette, Eric; Krause, Kevin M.; Nichols, Wright W.

    2015-01-01

    Avibactam is a novel non-β-lactam β-lactamase inhibitor that covalently acylates a variety of β-lactamases, causing inhibition. Although avibactam presents limited antibacterial activity, its acylation ability toward bacterial penicillin-binding proteins (PBPs) was investigated. Staphylococcus aureus was of particular interest due to the reported β-lactamase activity of PBP4. The binding of avibactam to PBPs was measured by adding increasing concentrations to membrane preparations of a variety of Gram-positive and Gram-negative bacteria prior to addition of the fluorescent reagent Bocillin FL. Relative binding (measured here as the 50% inhibitory concentration [IC50]) to PBPs was estimated by quantification of fluorescence after gel electrophoresis. Avibactam was found to selectively bind to some PBPs. In Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, and S. aureus, avibactam primarily bound to PBP2, with IC50s of 0.92, 1.1, 3.0, and 51 μg/ml, respectively, whereas binding to PBP3 was observed in Streptococcus pneumoniae (IC50, 8.1 μg/ml). Interestingly, avibactam was able to significantly enhance labeling of S. aureus PBP4 by Bocillin FL. In PBP competition assays with S. aureus, where avibactam was used at a fixed concentration in combination with varied amounts of ceftazidime, the apparent IC50 of ceftazidime was found to be very similar to that determined for ceftazidime when used alone. In conclusion, avibactam is able to covalently bind to some bacterial PBPs. Identification of those PBP targets may allow the development of new diazabicyclooctane derivatives with improved affinity for PBPs or new combination therapies that act on multiple PBP targets. PMID:26574008

  5. Distinctive Binding of Avibactam to Penicillin-Binding Proteins of Gram-Negative and Gram-Positive Bacteria.

    PubMed

    Asli, Abdelhamid; Brouillette, Eric; Krause, Kevin M; Nichols, Wright W; Malouin, François

    2016-02-01

    Avibactam is a novel non-β-lactam β-lactamase inhibitor that covalently acylates a variety of β-lactamases, causing inhibition. Although avibactam presents limited antibacterial activity, its acylation ability toward bacterial penicillin-binding proteins (PBPs) was investigated. Staphylococcus aureus was of particular interest due to the reported β-lactamase activity of PBP4. The binding of avibactam to PBPs was measured by adding increasing concentrations to membrane preparations of a variety of Gram-positive and Gram-negative bacteria prior to addition of the fluorescent reagent Bocillin FL. Relative binding (measured here as the 50% inhibitory concentration [IC50]) to PBPs was estimated by quantification of fluorescence after gel electrophoresis. Avibactam was found to selectively bind to some PBPs. In Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, and S. aureus, avibactam primarily bound to PBP2, with IC50s of 0.92, 1.1, 3.0, and 51 μg/ml, respectively, whereas binding to PBP3 was observed in Streptococcus pneumoniae (IC50, 8.1 μg/ml). Interestingly, avibactam was able to significantly enhance labeling of S. aureus PBP4 by Bocillin FL. In PBP competition assays with S. aureus, where avibactam was used at a fixed concentration in combination with varied amounts of ceftazidime, the apparent IC50 of ceftazidime was found to be very similar to that determined for ceftazidime when used alone. In conclusion, avibactam is able to covalently bind to some bacterial PBPs. Identification of those PBP targets may allow the development of new diazabicyclooctane derivatives with improved affinity for PBPs or new combination therapies that act on multiple PBP targets. PMID:26574008

  6. Discharges on a negatively biased solar array in a charged particle environment

    NASA Technical Reports Server (NTRS)

    Snyder, D. B.

    1983-01-01

    The charging behavior of a negatively biased solar cell array when subjected to a charged particle environment is studied in the ion density range from 200 to 12 000 ions/sq cm with the applied bias range of -500 to -1400 V. The profile of the surface potentials across the array is related to the presence of discharges. At the low end of the ion density range the solar cell cover slides charge to from 0 to +5 volts independent of the applied voltage. No discharges are seen at bias voltages as large as -1400 V. At the higher ion densities the cover slide potential begins to fluctuate, and becomes significantly negative. Under these conditions discharges can occur. The threshold bias voltage for discharges decreases with increasing ion density. A condition for discharges emerging from the experimental observations is that the average coverslide potential must be more negative than -4 V. The observations presented suggest that the plasma potential near the array becomes negative before a discharge occurs. This suggests that discharges are driven by an instability in the plasma.

  7. Discharges on a negatively biased solar cell array in a charged-particle environment

    NASA Astrophysics Data System (ADS)

    Snyder, D. B.

    1985-03-01

    The charging behavior of a negatively biased solar cell array when subjected to a charged particle environment is studied in the ion density range from 200 to 12,000 ions/sq cm with the applied bias range of -500 to -1400 V. The profile of the surface potentials across the array is related to the presence of discharges. At the low end of the ion density range the solar cell cover slides charge to from 0 to +5 volts independent of the applied voltage. No discharges are seen at bias voltages as large as -1400 V. At the higher ion densities the cover slide potential begins to fluctuate, and becomes significantly negative. Under these conditions discharges can occur. The threshold bias voltage for discharges decreases with increasing ion density. A condition for discharges emerging from the experimental observations is that the average coverslide potential must be more negative than -4 V. The observations presented suggest that the plasma potential near the array becomes negative before a discharge occurs. This suggests that discharges are driven by an instability in the plasma.

  8. Characteristics of EMI generated by negative metal-positive dielectric voltage stresses due to spacecraft charging

    NASA Technical Reports Server (NTRS)

    Chaky, R. C.; Inouye, G. T.

    1985-01-01

    Charging of spacecraft surfaces by the environmental plasma can result in differential potentials between metallic structure and adjacent dielectric surfaces in which the relative polarity of the voltage stress is either negative dielectric/positive metal or negative metal/positive dielectric. Negative metal/positive dielectric is a stress condition that may arise if relatively large areas of spacecraft surface metals are shadowed from solar UV and/or if the UV intensity is reduced as in the situation in which the spacecraft is entering into or leaving eclipse. The results of experimental studies of negative metal/positive dielectric systems are given. Information is given on: enhanced electron emission I-V curves; e(3) corona noise vs e(3) steady-state current; the localized nature of e(3) and negative metal arc discharge currents; negative metal arc discharges at stress thresholds below 1 kilovolt; negative metal arc discharge characteristics; dependence of blowoff arc discharge current on spacecraft capacitance to space (linear dimension); and damage to second surface mirrors due to negative metal arcs.

  9. Characteristics of EMI generated by negative metal-positive dielectric voltage stresses due to spacecraft charging

    NASA Astrophysics Data System (ADS)

    Chaky, R. C.; Inouye, G. T.

    1985-03-01

    Charging of spacecraft surfaces by the environmental plasma can result in differential potentials between metallic structure and adjacent dielectric surfaces in which the relative polarity of the voltage stress is either negative dielectric/positive metal or negative metal/positive dielectric. Negative metal/positive dielectric is a stress condition that may arise if relatively large areas of spacecraft surface metals are shadowed from solar UV and/or if the UV intensity is reduced as in the situation in which the spacecraft is entering into or leaving eclipse. The results of experimental studies of negative metal/positive dielectric systems are given. Information is given on: enhanced electron emission I-V curves; e(3) corona noise vs e(3) steady-state current; the localized nature of e(3) and negative metal arc discharge currents; negative metal arc discharges at stress thresholds below 1 kilovolt; negative metal arc discharge characteristics; dependence of blowoff arc discharge current on spacecraft capacitance to space (linear dimension); and damage to second surface mirrors due to negative metal arcs.

  10. Donor bound or negatively charged excitons in thin CdTe/Cd1-xMnxTe quantum wells

    NASA Astrophysics Data System (ADS)

    Paganotto, N.; Siviniant, J.; Coquillat, D.; Scalbert, D.; Lascaray, J.-P.; Kavokin, A. V.

    1998-08-01

    Magnetophotoluminescence spectroscopy of unintentionally doped thin CdTe/(Cd,Mn)Te single and double quantum wells (QW's) revealed a pronounced excitonic transition that can be associated with either an exciton bound to a neutral donor (D0X) or a negatively charged exciton (X-). Comparative experimental study and theoretical analysis of this transition in quantum wells of different thicknesses allowed us to attribute it to the D0X complex in a single QW and to the X- state in the double QW. A record X- binding energy of 3.7 meV has been detected. The double QW structure was shown to be favorable for the formation of X- in the wide well due to the efficient interwell electron tunneling.

  11. Anomalous charge and negative-charge-transfer insulating state in cuprate chain compound KCuO2

    NASA Astrophysics Data System (ADS)

    Choudhury, D.; Rivero, P.; Meyers, D.; Liu, X.; Cao, Y.; Middey, S.; Whitaker, M. J.; Barraza-Lopez, S.; Freeland, J. W.; Greenblatt, M.; Chakhalian, J.

    2015-11-01

    Using a combination of x-ray absorption spectroscopy (XAS) experiments and first-principles calculations, we demonstrate that insulating KCuO2 contains Cu in an unusually high formal 3+ valence state, and the ligand-to-metal (O-to-Cu) charge-transfer energy is intriguingly negative (Δ ˜-1.5 eV) and has a dominant (˜60 % ) ligand-hole character in the ground state akin to the high Tc cuprate Zhang-Rice state. Unlike most other formal Cu3 + compounds, the Cu 2 p XAS spectra of KCuO2 exhibit pronounced 3 d8 (Cu3 +) multiplet structures, which account for ˜40 % of its ground state wave function. Ab initio calculations elucidate the origin of the band gap in KCuO2 as arising primarily from strong intracluster Cu 3 d -O 2 p hybridizations (tpd); the value of the band gap decreases with a reduced value of tpd. Further, unlike conventional negative-charge-transfer insulators, the band gap in KCuO2 persists even for vanishing values of Coulomb repulsion U , underscoring the importance of single-particle band-structure effects connected to the one-dimensional nature of the compound.

  12. Charge moment change and lightning-driven electric fields associated with negative sprites and halos

    NASA Astrophysics Data System (ADS)

    Li, Jingbo; Cummer, Steven; Lu, Gaopeng; Zigoneanu, Lucian

    2012-09-01

    Sprites are structured high altitude optical emissions produced by lightning-driven electric fields. Both strong positive and negative cloud to ground flashes (CGs) are capable of initiating sprites. However, reported sprites are almost exclusively produced by +CGs. The very limited number of negative polarity sprites makes it difficult to reveal their morphologies and mechanisms. Since 2008, we have operated low light cameras at 5 locations in the United States to detect lightning-driven transient luminous events (TLEs). At Duke University, two pairs of magnetic sensors simultaneously record lightning-radiated magnetic fields. During 4 years of observations, the low light cameras collectively captured 1651 sprite events. Among them, 6 were produced by -CG lightning, which was confirmed by both the National Lightning Detection Network (NLDN) and magnetic field measurements. All of these negative sprites show similar features in their morphology, lightning source current, and lightning-driven ambient electric fields. They all initiate within a few ms from their parent lightning discharges and always are accompanied by sprite halos. Compared to positive sprites, the downward streamers in negative sprites terminate at higher altitudes, about 55-60 km. The extracted source current of their parent lightning discharges is very impulsive and produces at least 450 C km charge moment change in 0.5 ms or less. Unlike most +CG strokes, essentially no continuing current follows these -CGs. Thus the uniformity of negative sprite morphology appears to reflect the uniformity of the characteristics of high charge transfer negative strokes. Numerical simulation shows these impulsive source currents produce very high (>2 Ek, where Ek is the local air breakdown field) but short-lived electric fields at halo altitudes between 70 km and 90 km. At streamer termination altitudes, the inferred background electric field is 0.2-0.3 Ek, which is close to but below the critical field (0.4 Ek

  13. Equilibrium negative-charge fractions in swift proton beams emerging from freshly evaporated metal films

    NASA Astrophysics Data System (ADS)

    Almeida, D. P.; de Castro Faria, N. V.; Freire, F. L., Jr.; Kirsch, R.; de Pinho, A. G.

    1988-05-01

    The equilibrium fraction of negative ions in a beam of proton or deuteron projectiles (0.2-3.5 MeV/u) which have penetrated thin metallic targets has been measured for the first time. Pure beryllium, copper, and gold were evaporated in situ on the exit surface of carbon foils. In this energy interval the equilibrium fractions depend strongly on the atomic number of the last surface layers. The measured equilibrium fractions are compared with those obtained with carbon foils and noble gases, and it is shown that they can be interpreted considering the solid to be a dense atomic gas. Even some subtle details of the atomic charge-changing cross sections become transparent in the solid equilibrium negative-charge fractions.

  14. Catalytic Water Oxidation by Ruthenium Complexes Containing Negatively Charged Ligand Frameworks.

    PubMed

    Kärkäs, Markus D; Åkermark, Björn

    2016-04-01

    Artificial photosynthesis represents an attractive way of converting solar energy into storable chemical energy. The H2O oxidation half-reaction, which is essential for producing the necessary reduction equivalents, is an energy-demanding transformation associated with a high kinetic barrier. Herein we present a couple of efficient Ru-based catalysts capable of mediating this four-proton-four-electron oxidation. We have focused on the incorporation of negatively charged ligands, such as carboxylate, phenol, and imidazole, into the catalysts to decrease the redox potentials. This account describes our work in designing Ru catalysts based on this idea. The presence of the negatively charged ligands is crucial for stabilizing the metal centers, allowing for light-driven H2O oxidation. Mechanistic details associated with the designed catalysts are also presented. PMID:26991306

  15. Optimizing charge neutralization for a magnetic sector SIMS instrument in negative mode

    SciTech Connect

    Pivovarov, Alexander L.; Guryanov, Georgiy M.

    2012-07-15

    Successful self-adjusted charge compensation was demonstrated for a CAMECA magnetic-sector secondary ion mass spectrometer applied in negative mode. Operation with the normal-incidence electron gun (NEG) potential positively biased relative to a sample potential enables substantial broadening of the Cs primary-ion-current density range available for analysis of insulators. The decrease of the negative NEG potential by 30 V allows the highest value of primary current density used for the analysis of a silica sample to increase by a factor of more than 6. By applying the improved charge neutralization technique, accurate Na depth profiles for SiO{sub 2} samples were obtained within detection limits of {approx}3 Multiplication-Sign 10{sup 15} atoms/cm{sup 3}.

  16. Space charge compensation in the Linac4 low energy beam transport line with negative hydrogen ions

    SciTech Connect

    Valerio-Lizarraga, Cristhian A.; Lallement, Jean-Baptiste; Lettry, Jacques; Scrivens, Richard; Leon-Monzon, Ildefonso; Midttun, Øystein

    2014-02-15

    The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Transport using the package IBSimu [T. Kalvas et al., Rev. Sci. Instrum. 81, 02B703 (2010)], which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H{sup −} beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.

  17. Modeling the selective partitioning of cations into negatively charged nanopores in water

    NASA Astrophysics Data System (ADS)

    Yang, Lu; Garde, Shekhar

    2007-02-01

    Partitioning and transport of water and small solutes into and through nanopores are important to a variety of chemical and biological processes and applications. Here we study water structure in negatively charged model cylindrical [carbon nanotube (CNT)-like] nanopores, as well as the partitioning of positive ions of increasing size (Na+, K+, and Cs+) into the pore interior using extensive molecular dynamics simulations. Despite the simplicity of the simulation system—containing a short CNT-like nanopore in water carrying a uniformly distributed charge of qpore=-ne surrounded by n (=0,…,8) cations, making the overall system charge neutral—the results provide new and useful insights on both the pore hydration and ion partitioning. For n =0, that is, for a neutral nanopore, water molecules partition into the pore and form single-file hydrogen-bonded wire spanning the pore length. With increasing n, water molecules enter the pore from both ends with preferred orientations, resulting in a mutual repulsion between oriented water molecules at the pore center and creating a cavity-like low density region at the center. For low negative charge densities on the pore, the driving force for partitioning of positive ions into the pore is weak, and no partitioning is observed. Increasing the pore charge gradually leads to partitioning of positive ions into the pore. Interestingly, over a range of intermediate negative charge densities, nanopores display both thermodynamic as well as kinetic selectivity toward partitioning of the larger K+ and Cs+ ions into their interior over the smaller Na+ ions. Specifically, the driving force is in the order K+>Cs+>Na+, and K+ and Cs+ ions enter the pore much more rapidly than Na+ ions. At higher charge densities, the driving force for partitioning increases for all cations—it is highest for K+ ions—and becomes similar for Na+ and Cs+ ions. The variation of thermodynamic driving force and the average partitioning time with the

  18. Associating a negatively charged GdDOTA-derivative to the Pittsburgh compound B for targeting Aβ amyloid aggregates.

    PubMed

    Martins, André F; Oliveira, Alexandre C; Morfin, Jean-François; Laurents, Douglas V; Tóth, Éva; Geraldes, Carlos F G C

    2016-03-01

    We have conjugated the tetraazacyclododecane-tetraacetate (DOTA) chelator to Pittsburgh compound B (PiB) forming negatively charged lanthanide complexes, Ln(L4), with targeting capabilities towards aggregated amyloid peptides. The amphiphilic Gd(L4) chelate undergoes micellar aggregation in aqueous solution, with a critical micellar concentration of 0.68 mM, lower than those for the neutral complexes of similar structure. A variable temperature (17)O NMR and NMRD study allowed the assessment of the water exchange rate, k ex (298) = 9.7 × 10(6) s(-1), about the double of GdDOTA, and for the description of the rotational dynamics for both the monomeric and the micellar forms of Gd(L4). With respect to the analogous neutral complexes, the negative charge induces a significant rigidity of the micelles formed, which is reflected by slower and more restricted local motion of the Gd(3+) centers as evidenced by higher relaxivities at 20-60 MHz. Surface Plasmon Resonance results indicate that the charge does not affect significantly the binding strength to Aβ1-40 [K d = 194 ± 11 μM for La(L4)], but it does enhance the affinity constant to human serum albumin [K a = 6530 ± 68 M(-1) for Gd(L4)], as compared to neutral counterparts. Protein-based NMR points to interaction of Gd(L4) with Aβ1-40 in the monomer state as well, in contrast to neutral complexes interacting only with the aggregated form. Circular dichroism spectroscopy monitored time- and temperature-dependent changes of the Aβ1-40 secondary structure, indicating that Gd(L4) stabilizes the random coil relative to the α-helix and β-sheet. TEM images confirm that the Gd(L4) complex reduces the formation of aggregated fibrils. PMID:26613605

  19. Location-specific nanoplasmonic sensing of biomolecular binding to lipid membranes with negative curvature

    NASA Astrophysics Data System (ADS)

    Junesch, Juliane; Emilsson, Gustav; Xiong, Kunli; Kumar, Shailabh; Sannomiya, Takumi; Pace, Hudson; Vörös, Janos; Oh, Sang-Hyun; Bally, Marta; Dahlin, Andreas B.

    2015-09-01

    The biochemical processes of cell membranes are sensitive to the geometry of the lipid bilayer. We show how plasmonic ``nanowells'' provide label-free real-time analysis of molecules on membranes with detection of preferential binding at negative curvature. It is demonstrated that norovirus accumulate in invaginations due to multivalent interactions with glycosphingolipids.The biochemical processes of cell membranes are sensitive to the geometry of the lipid bilayer. We show how plasmonic ``nanowells'' provide label-free real-time analysis of molecules on membranes with detection of preferential binding at negative curvature. It is demonstrated that norovirus accumulate in invaginations due to multivalent interactions with glycosphingolipids. Electronic supplementary information (ESI) available: Additional plasmonic sensing results, numerical electromagnetic simulations, quartz crystal microbalance data, fluorescence recovery after photobleaching, additional electron microscopy images, experimental methodology and materials used. See DOI: 10.1039/c5nr04208a

  20. Influence of Corona Structure on Binding of an Ionic Surfactant in Oppositely Charged Amphiphilic Polyelectrolyte Micelles.

    PubMed

    Delisavva, Foteini; Uchman, Mariusz; Škvarla, Juraj; Woźniak, Edyta; Pavlova, Ewa; Šlouf, Miroslav; Garamus, Vasil M; Procházka, Karel; Štěpánek, Miroslav

    2016-04-26

    Interaction of polystyrene-block-poly(methacrylic acid) micelles (PS-PMAA) with cationic surfactant N-dodecylpyridinium chloride (DPCl) in alkaline aqueous solutions was studied by static and dynamic light scattering, SAXS, cryogenic transmission electron microscopy (cryo-TEM), isothermal titration calorimetry (ITC), and time-resolved fluorescence spectroscopy. ITC and fluorescence measurements show that there are two distinct regimes of surfactant binding in the micellar corona (depending on the DPCl content) caused by different interactions of DPCl with PMAA in the inner and outer parts of the corona. The compensation of the negative charge of the micellar corona by DPCl leads to the aggregation of PS-PMAA micelles, and the micelles form colloidal aggregates at a certain critical surfactant concentration. SAXS shows that the aggregates are formed by individual PS-PMAA micelles with intact cores and collapsed coronas interconnected with surfactant micelles by electrostatic interactions. Unlike polyelectrolyte-surfactant complexes formed by free polyelectrolyte chains, the PMAA/DPCl complex with collapsed corona does not contain surfactant micelles. PMID:27054848

  1. An experimental test of the discreteness-of-charge effect in positive and negative lipid bilayers.

    PubMed

    Winiski, A P; McLaughlin, A C; McDaniel, R V; Eisenberg, M; McLaughlin, S

    1986-12-16

    The electrostatic properties of charged bilayers and the bilayer component of biological membranes are often described theoretically by assuming the charge is smeared uniformly over the surface. This is one of the fundamental assumptions in the Gouy-Chapman-Stern (GCS) theory. However, the average distance between the charged phospholipids in a typical biological membrane is 2-3 nm, which is 2-3 times the Debye length in a 0.1 M salt solution. Existing discreteness-of-charge theories predict significant deviations from the GCS theory for the adsorption of ions to such membranes. We considered the predictions of the simplest discreteness-of-charge theory [Nelson, A. P., & McQuarrie, D. A. (1975) J. Theor. Biol. 55, 13-27], in which the charges are assumed to be fixed in a square lattice and the potential is described by the linearized Poisson-Boltzmann relation. This theory predicts deviations that are larger for counterions than for co-ions and much larger for divalent than for monovalent counterions. We tested these predictions by measuring the adsorption of a fluorescent monovalent anion and a paramagnetic divalent cation to both positive and negative membranes, which we demonstrated experimentally had the same average surface potential. All our experimental results with probes, including those obtained on membranes in the gel rather than in the liquid-crystalline state, agreed with the predictions of the GCS theory rather than with the discreteness-of-charge theory. A simple calculation indicates that the agreement between the experimental results and the predictions of the GCS theory could be due to the finite size of the lipids. PMID:3814579

  2. Nanostructures formed by self-assembly of negatively charged polymer and cationic surfactants.

    PubMed

    Nizri, G; Makarsky, A; Magdassi, S; Talmon, Y

    2009-02-17

    The formation of nanoparticles by interaction of an anionic polyelectrolyte, sodium polyacrylate (NaPA), was studied with a series of oppositely charged surfactants with different chain lengths, alkyltrimethylammonium bromide (CnTAB). The binding and formation of nanoparticles was characterized by dynamic light scattering, zeta-potential, and self-diffusion NMR. The inner nanostructure of the particles was observed by direct-imaging cryogenic-temperature transmission electron microscopy (cryo-TEM), indicating aggregates of hexagonal liquid crystal with nanometric size. PMID:19143559

  3. High flux and antifouling properties of negatively charged membrane for dyeing wastewater treatment by membrane distillation.

    PubMed

    An, Alicia Kyoungjin; Guo, Jiaxin; Jeong, Sanghyun; Lee, Eui-Jong; Tabatabai, S Assiyeh Alizadeh; Leiknes, TorOve

    2016-10-15

    This study investigated the applicability of membrane distillation (MD) to treat dyeing wastewater discharged by the textile industry. Four different dyes containing methylene blue (MB), crystal violet (CV), acid red 18 (AR18), and acid yellow 36 (AY36) were tested. Two types of hydrophobic membranes made of polytetrafluoroethylene (PTFE) and polyvinylidene fluoride (PVDF) were used. The membranes were characterized by testing against each dye (foulant-foulant) and the membrane-dye (membrane-foulant) interfacial interactions and their mechanisms were identified. The MD membranes possessed negative charges, which facilitated the treatment of acid and azo dyes of the same charge and showed higher fluxes. In addition, PTFE membrane reduced the wettability with higher hydrophobicity of the membrane surface. The PTFE membrane evidenced especially its resistant to dye absorption, as its strong negative charge and chemical structure caused a flake-like (loose) dye-dye structure to form on the membrane surface rather than in the membrane pores. This also enabled the recovery of flux and membrane properties by water flushing (WF), thereby direct-contact MD with PTFE membrane treating 100 mg/L of dye mixtures showed stable flux and superior color removal during five days operation. Thus, MD shows a potential for stable long-term operation in conjunction with a simple membrane cleaning process, and its suitability in dyeing wastewater treatment. PMID:27486044

  4. Preparation and characterization of negatively charged poly(lactic-co-glycolic acid) microspheres.

    PubMed

    Xu, Qingguo; Crossley, Alison; Czernuszka, Jan

    2009-07-01

    Negatively charged poly(lactic-co-glycolic acid) (PLGA) microspheres encapsulated with hydrophilic drugs have been successfully prepared by a solid-in-oil-in-water (s/o/w) solvent evaporation method in the presence of anionic surfactants, sodium dodecyl sulfate (SDS), and dioctyl sodium sulfosuccinate (DSS), and nonionic surfactant polyvinyl alcohol (PVA). The effects of microencapsulation methods, surfactants types, and surfactant concentrations on the properties of microspheres were studied. Amoxicillin (AMX) was chosen as a hydrophilic model drug, and its encapsulation efficiency (EE) and in vitro release profiles were measured. The s/o/w method achieved higher EE of 40% in PLGA microspheres using surfactant SDS compared with the conventional water-in-oil-in-water (w/o/w) method (about 2%). Triphasic release profiles were observed for all PLGA microspheres (s/o/w) with slight drug burst, a slow diffusion-controlled release within the period of about 7 days and followed by the degradation-controlled sustained release for further 30 days. Smaller particle size and surface charge were achieved for s/o/w method than w/o/w method using the same anionic surfactants, and smooth surface and less porous interior matrix. The s/o/w method effectively encapsulated AMX into anionic PLGA microspheres using anionic surfactants, and these negatively charged PLGA microspheres represented an attractive approach for the controlled release of hydrophilic drugs. PMID:19009589

  5. A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

    SciTech Connect

    Du Yuzhe; Song Weizhong; Groome, James R.; Nomura, Yoshiko; Luo Ningguang; Dong Ke

    2010-08-15

    Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.

  6. A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

    PubMed Central

    Du, Yuzhe; Song, Weizhong; Groome, James R.; Nomura, Yoshiko; Luo, Ningguang; Dong, Ke

    2011-01-01

    Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids. PMID:20561903

  7. A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides.

    PubMed

    Du, Yuzhe; Song, Weizhong; Groome, James R; Nomura, Yoshiko; Luo, Ningguang; Dong, Ke

    2010-08-15

    Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids. PMID:20561903

  8. Charged Nonclassical Antifolates with Activity Against Gram-Positive and Gram-Negative Pathogens.

    PubMed

    Scocchera, Eric; Reeve, Stephanie M; Keshipeddy, Santosh; Lombardo, Michael N; Hajian, Behnoush; Sochia, Adrienne E; Alverson, Jeremy B; Priestley, Nigel D; Anderson, Amy C; Wright, Dennis L

    2016-07-14

    Although classical, negatively charged antifolates such as methotrexate possess high affinity for the dihydrofolate reductase (DHFR) enzyme, they are unable to penetrate the bacterial cell wall, rendering them poor antibacterial agents. Herein, we report a new class of charged propargyl-linked antifolates that capture some of the key contacts common to the classical antifolates while maintaining the ability to passively diffuse across the bacterial cell wall. Eight synthesized compounds exhibit extraordinary potency against Gram-positive S. aureus with limited toxicity against mammalian cells and good metabolic profile. High resolution crystal structures of two of the compounds reveal extensive interactions between the carboxylate and active site residues through a highly organized water network. PMID:27437079

  9. Optical spectra and intensities of graphene magnetic dot bound to a negatively charged Coulomb impurity

    SciTech Connect

    Lee, C. M. E-mail: apkschan@cityu.edu.hk; Chan, K. S. E-mail: apkschan@cityu.edu.hk

    2014-07-28

    Employing numerical diagonalization, we study the optical properties of an electron in a monolayer-graphene magnetic dot bound to an off-center negatively charged Coulomb impurity based on the massless Dirac-Weyl model. Numerical results show that, since the electron-hole symmetry is broken by the Coulomb potential, the optical absorption spectra of the magnetic dot in the presence of a Coulomb impurity are different between the electron states and the hole states. Effects of both the magnetic field and the dot size on the absorption coefficient are presented as functions of the incident photon energies.

  10. Atomistic simulations of negatively charged donor states probed in STM experiments

    NASA Astrophysics Data System (ADS)

    Tankasala, Archana; Salfi, Joe; Rogge, Sven; Klimeck, Gerhard; Rahman, Rajib

    A single donor in silicon binding two electrons (D-) is important for electron spin readout and two-qubit operations in a donor based silicon (Si) quantum computer, and has recently been probed in Scanning Tunneling Microscope (STM) experiments for sub-surface dopants. In this work, atomistic configuration interaction technique is used to compute the two-electron states of the donor taking into account the geometry of the STM-vacuum-silicon-reservoir device. While 45 meV charging energy is obtained for D- in bulk Si, the electrostatics of the device reduces the charging energy to 30 meVs. It is also shown that the reduced charging energy enables spin triplet states to be bound to the donor. The exchange splitting between the singlet and triplet states can be tuned by an external electric field. The computed wavefunctions of the D- state helps to understand how the contribution of the momentum space valley states change with donor depth and electric field.

  11. Transient performance estimation of charge plasma based negative capacitance junctionless tunnel FET

    NASA Astrophysics Data System (ADS)

    Singh, Sangeeta; Kondekar, P. N.; Pal, Pawan

    2016-02-01

    We investigate the transient behavior of an n-type double gate negative capacitance junctionless tunnel field effect transistor (NC-JLTFET). The structure is realized by using the work-function engineering of metal electrodes over a heavily doped n+ silicon channel and a ferroelectric gate stack to get negative capacitance behavior. The positive feedback in the electric dipoles of ferroelectric materials results in applied gate bias boosting. Various device transient parameters viz. transconductance, output resistance, output conductance, intrinsic gain, intrinsic gate delay, transconductance generation factor and unity gain frequency are analyzed using ac analysis of the device. To study the impact of the work-function variation of control and source gate on device performance, sensitivity analysis of the device has been carried out by varying these parameters. Simulation study reveals that it preserves inherent advantages of charge-plasma junctionless structure and exhibits improved transient behavior as well.

  12. Negative-ion injection by charge exchange at 2.4 GeV

    SciTech Connect

    Ruggiero, A.G.

    1995-09-01

    The present technical note describes multi-turn injection by charge exchange of 2.4-GeV negative ions in a Accumulator Ring used as an intense Pulsed Spallation Neutron Source. The major concern of beam loss due to magnetic stripping of the negative ions is addressed. It is demonstrated that, despite the high energy of the ions and the limitation on the magnitude of the magnetic field, it is possible to control the amount of beam losses to a fractional value of better than 10{sup {minus}5}, as it is required to avoid latent activation of the accelerator components. The injection magnet system which accomplish this is described. The paper addresses also the concern of beam loss due to the same effect in the 2.4-GeV injector linear accelerator, and in the transport from the Linac to the Accumulator Ring.

  13. Chondroitin sulfate addition to CD44H negatively regulates hyaluronan binding

    SciTech Connect

    Ruffell, Brian; Johnson, Pauline . E-mail: pauline@interchange.ubc.ca

    2005-08-26

    CD44 is a widely expressed cell adhesion molecule that binds hyaluronan, an extracellular matrix glycosaminoglycan, in a tightly regulated manner. This regulated interaction has been implicated in inflammation and tumor metastasis. CD44 exists in the standard form, CD44H, or as higher molecular mass isoforms due to alternative splicing. Here, we identify serine 180 in human CD44H as the site of chondroitin sulfate addition and show that lack of chondroitin sulfate addition at this site enhances hyaluronan binding by CD44. A CD44H-immunoglobulin fusion protein expressed in HEK293 cells, and CD44H expressed in murine L fibroblast cells were modified by chondroitin sulfate, as determined by reduced sulfate incorporation after chondroitinase ABC treatment. Mutation of serine 180 or glycine 181 in CD44H reduced chondroitin sulfate addition and increased hyaluronan binding, indicating that serine 180 is the site for chondroitin sulfate addition in CD44H and that this negatively regulates hyaluronan binding.

  14. MDM1 is a microtubule-binding protein that negatively regulates centriole duplication

    PubMed Central

    Van de Mark, Daniel; Kong, Dong; Loncarek, Jadranka; Stearns, Tim

    2015-01-01

    Mouse double-minute 1 (Mdm1) was originally identified as a gene amplified in transformed mouse cells and more recently as being highly up-regulated during differentiation of multiciliated epithelial cells, a specialized cell type having hundreds of centrioles and motile cilia. Here we show that the MDM1 protein localizes to centrioles of dividing cells and differentiating multiciliated cells. 3D-SIM microscopy showed that MDM1 is closely associated with the centriole barrel, likely residing in the centriole lumen. Overexpression of MDM1 suppressed centriole duplication, whereas depletion of MDM1 resulted in an increase in granular material that likely represents early intermediates in centriole formation. We show that MDM1 binds microtubules in vivo and in vitro. We identified a repeat motif in MDM1 that is required for efficient microtubule binding and found that these repeats are also present in CCSAP, another microtubule-binding protein. We propose that MDM1 is a negative regulator of centriole duplication and that its function is mediated through microtubule binding. PMID:26337392

  15. Direct stimulation of transcription by negative cofactor 2 (NC2) through TATA-binding protein (TBP)

    PubMed Central

    Cang, Yong; Prelich, Gregory

    2002-01-01

    Negative cofactor 2 (NC2) is an evolutionarily conserved transcriptional regulator that was originally identified as an inhibitor of basal transcription. Its inhibitory mechanism has been extensively characterized; NC2 binds to the TATA-binding protein (TBP), blocking the recruitment of TFIIA and TFIIB, and thereby inhibiting preinitiation complex assembly. NC2 is also required for expression of many yeast genes in vivo and stimulates TATA-less transcription in a Drosophila in vitro transcription system, but the mechanism responsible for the NC2-mediated stimulation of transcription is not understood. Here we establish that yeast NC2 can directly stimulate activated transcription from TATA-driven promoters both in vivo and in vitro, and moreover that this positive role requires the same surface of TBP that mediates the NC2 repression activity. On the basis of these results, we propose a model to explain how NC2 can mediate both repression and activation through the same surface of TBP. PMID:12237409

  16. Influence of surface charge, binding site residues and glycosylation on Thielavia terrestris cutinase biochemical characteristics.

    PubMed

    Shirke, Abhijit N; Basore, Danielle; Holton, Samantha; Su, An; Baugh, Evan; Butterfoss, Glenn L; Makhatadze, George; Bystroff, Christopher; Gross, Richard A

    2016-05-01

    Cutinases are esterases of industrial importance for applications in recycling and surface modification of polyesters. The cutinase from Thielavia terrestris (TtC) is distinct in terms of its ability to retain its stability and activity in acidic pH. Stability and activity in acidic pHs are desirable for esterases as the pH of the reaction tends to go down with the generation of acid. The pH stability and activity are governed by the charged state of the residues involved in catalysis or in substrate binding. In this study, we performed the detailed structural and biochemical characterization of TtC coupled with surface charge analysis to understand its acidic tolerance. The stability of TtC in acidic pH was rationalized by evaluating the contribution of charge interactions to the Gibbs free energy of unfolding at varying pHs. The activity of TtC was found to be limited by substrate binding affinity, which is a function of the surface charge. Additionally, the presence of glycosylation affects the biochemical characteristics of TtC owing to steric interactions with residues involved in substrate binding. PMID:26758295

  17. The negatively charged carboxy-terminal tail of β-tubulin promotes proper chromosome segregation

    PubMed Central

    Fees, Colby P.; Aiken, Jayne; O’Toole, Eileen T.; Giddings, Thomas H.; Moore, Jeffrey K.

    2016-01-01

    Despite the broadly conserved role of microtubules in chromosome segregation, we have a limited understanding of how molecular features of tubulin proteins contribute to the underlying mechanisms. Here we investigate the negatively charged carboxy-terminal tail domains (CTTs) of α- and β-tubulins, using a series of mutants that alter or ablate CTTs in budding yeast. We find that ablating β-CTT causes elevated rates of chromosome loss and cell cycle delay. Complementary live-cell imaging and electron tomography show that β-CTT is necessary to properly position kinetochores and organize microtubules within the assembling spindle. We identify a minimal region of negatively charged amino acids that is necessary and sufficient for proper chromosome segregation and provide evidence that this function may be conserved across species. Our results provide the first in vivo evidence of a specific role for tubulin CTTs in chromosome segregation. We propose that β-CTT promotes the ordered segregation of chromosomes by stabilizing the spindle and contributing to forces that move chromosomes toward the spindle poles. PMID:27053662

  18. Negative-charge-functionalized mesoporous silica nanoparticles as drug vehicles targeting hepatocellular carcinoma.

    PubMed

    Xie, Meng; Xu, Yuanguo; Shen, Haijun; Shen, Song; Ge, Yanru; Xie, Jimin

    2014-10-20

    In this paper, a series of doxorubicin-loaded and negative-charge-functionalized mesoporous silica nanoparticles (DOX-MSN/COOH) was successfully prepared and used for imaging and targeting therapy of hepatocellular carcinoma. The nanoparticles were uniform and negatively charged, with a diameter of about 55 nm, and a zeta potential of -20 mV. In vitro study showed that the nanoparticles could easily be endocytosed by liver cancer cells (HepG2) and were well-accumulated in the liver by passive targeting. In vivo study proved the ability of DOX-MSN/COOH to inhibit the tumor growth and prolong the survival time of mice bearing hepatocellular carcinoma in situ, giving better results than free DOX. More importantly, histological examination showed no histopathological abnormalities of normal liver cells and heart cells after the administration of DOX-MSN/COOH, while the treatment with free DOX caused damage to those cells. In conclusion, DOX-MSN/COOH exhibited enhanced antitumor efficacy as well as reduced side effects for liver cancer therapy. PMID:25149125

  19. Activation energy of negative fixed charges in thermal ALD Al2O3

    NASA Astrophysics Data System (ADS)

    Kühnhold-Pospischil, S.; Saint-Cast, P.; Richter, A.; Hofmann, M.

    2016-08-01

    A study of the thermally activated negative fixed charges Qtot and the interface trap densities Dit at the interface between Si and thermal atomic-layer-deposited amorphous Al2O3 layers is presented. The thermal activation of Qtot and Dit was conducted at annealing temperatures between 220 °C and 500 °C for durations between 3 s and 38 h. The temperature-induced differences in Qtot and Dit were measured using the characterization method called corona oxide characterization of semiconductors. Their time dependency were fitted using stretched exponential functions, yielding activation energies of EA = (2.2 ± 0.2) eV and EA = (2.3 ± 0.7) eV for Qtot and Dit, respectively. For annealing temperatures from 350 °C to 500 °C, the changes in Qtot and Dit were similar for both p- and n-type doped Si samples. In contrast, at 220 °C the charging process was enhanced for p-type samples. Based on the observations described in this contribution, a charging model leading to Qtot based on an electron hopping process between the silicon and Al2O3 through defects is proposed.

  20. A Hypersweet Protein: Removal of The Specific Negative Charge at Asp21 Enhances Thaumatin Sweetness

    PubMed Central

    Masuda, Tetsuya; Ohta, Keisuke; Ojiro, Naoko; Murata, Kazuki; Mikami, Bunzo; Tani, Fumito; Temussi, Piero Andrea; Kitabatake, Naofumi

    2016-01-01

    Thaumatin is an intensely sweet-tasting protein that elicits sweet taste at a concentration of 50 nM, a value 100,000 times larger than that of sucrose on a molar basis. Here we attempted to produce a protein with enhanced sweetness by removing negative charges on the interacting side of thaumatin with the taste receptor. We obtained a D21N mutant which, with a threshold value 31 nM is much sweeter than wild type thaumatin and, together with the Y65R mutant of single chain monellin, one of the two sweetest proteins known so far. The complex model between the T1R2-T1R3 sweet receptor and thaumatin, derived from tethered docking in the framework of the wedge model, confirmed that each of the positively charged residues critical for sweetness is close to a receptor residue of opposite charge to yield optimal electrostatic interaction. Furthermore, the distance between D21 and its possible counterpart D433 (located on the T1R2 protomer of the receptor) is safely large to avoid electrostatic repulsion but, at the same time, amenable to a closer approach if D21 is mutated into the corresponding asparagine. These findings clearly confirm the importance of electrostatic potentials in the interaction of thaumatin with the sweet receptor. PMID:26837600

  1. Space Charge Neutralization of DEMO Relevant Negative Ion Beams at Low Gas Density

    SciTech Connect

    Surrey, Elizabeth; Porton, Michael

    2011-09-26

    The application of neutral beams to future power plant devices (DEMO) is dependent on achieving significantly improved electrical efficiency and the most promising route to achieving this is by implementing a photoneutralizer in place of the traditional gas neutralizer. A corollary of this innovation would be a significant reduction in the background gas density through which the beam is transported between the accelerator and the neutralizer. This background gas is responsible for the space charge neutralization of the beam, enabling distances of several metres to be traversed without significant beam expansion. This work investigates the sensitivity of a D{sup -} beam to reduced levels of space charge compensation for energies from 100 keV to 1.5 MeV, representative of a scaled prototype experiment, commissioning and full energy operation. A beam transport code, following the evolution of the phase space ellipse, is employed to investigate the effect of space charge on the beam optics. This shows that the higher energy beams are insensitive to large degrees of under compensation, unlike the lower energies. The probable degree of compensation at low gas density is then investigated through a simple, two component beam-plasma model that allows the potential to be negative. The degree of under-compensation is dependent on the positive plasma ion energy, one source of which is dissociation of the gas by the beam. The subsequent space charge state of the beam is shown to depend upon the relative times for equilibration of the dissociation energy and ionization by the beam ions.

  2. Dust-ion acoustic shock waves in a dusty multi-ion plasma with negatively dust-charge fluctuation

    NASA Astrophysics Data System (ADS)

    Wang, Hongyan; Zhang, Kaibiao

    2015-01-01

    The nonlinear propagation of dust-ion acoustic shock waves in a collisionless, unmagnetized multi-ion dusty plasma contains Botlzemann-distributed electrons, negative and positive ions with extremely massive and stationary negative charge dust grains with dust charge fluctuations is investigated. By employing the reductive perturbation method, we obtain a Burgers equation that describes the two-ion fluid dynamics. The dust charge variation is found to play an important role in the formation of such dust-ion acoustic shock structures. The viscosity only affects the thickness of the shock waves. The dependences of the shock wave's velocity, height and thickness on the system parameters are investigated.

  3. Selective binding of proteins on functional nanoparticles via reverse charge parity model: an in vitro study

    NASA Astrophysics Data System (ADS)

    Ghosh, Goutam; Panicker, Lata; Barick, K. C.

    2014-03-01

    The conformation of proteins absorbed on nanoparticles surface plays a crucial role in applications of nanoparticles in biomedicine. The surface protein conformation depends on several factors, namely, nature of protein-nanoparticles interaction, chemical composition of the surface of nanoparticles etc. A model of the electrostatic binding of proteins on charged surface nanoparticles has been proposed earlier (Ghosh et al 2013 Colloids Surf. B 103 267). Also, the irreversible denaturation of the protein conformation due to binding of counterions was reported. In this paper, we have used this model, involving reverse charge parity, to show selective binding of proteins on charged surface iron oxide nanoparticles (IONPs). IONPs were surface functionalized with cetylpyridinium chloride (CPC), cetyl(trimethyl)ammonium bromide (CTAB) and cetylpyridinium iodide (CPI). The effect of counterions (Cl-, Br- and I-) on protein conformation has also been investigated. Several proteins such as α-lactalbumin (ALA), β-lactoglobulin (BLG), ovalbumin (OVA), bovin serum albumin (BSA) and HEWL were chosen for this investigation.

  4. Higher stabilities of positive and negative charge on tetrafluoroethylene-hexafluoropropylene copolymer (FEP) electrets treated with titanium-tetrachloride vapor

    NASA Astrophysics Data System (ADS)

    Rychkov, D.; Rychkov, A.; Efimov, N.; Malygin, A.; Gerhard, R.

    2013-08-01

    Tetrafluoroethylene-hexafluoropropylene copolymer (FEP) films were treated with titanium-tetrachloride vapor in a molecular-layer deposition process. As a result of the surface treatment, significant improvements of the thermal and temporal charge stability were observed. Charge-decay measurements revealed enhancements of the half-value temperatures and the relaxation times of positively charged FEP electrets by at least 120 °C and two orders of magnitude, respectively. Beyond previous publications on fluoropolymer electrets with surface modification, we here report enhanced charge stabilities of the FEP films charged in negative as well as in positive corona discharges. Even though the improvement for negatively charged FEP films is moderate (half-value temperature about 20 °C higher), our experiments show that the asymmetry in positive and negative charge stability that is typical for FEP electrets can be overcome by means of chemical surface treatments. The results are discussed in the context of the formation of modified surface layers with enhanced charge-trapping properties.

  5. Transient negative photoconductance in a charge transfer double quantum well under optical intersubband excitation

    NASA Astrophysics Data System (ADS)

    Rüfenacht, M.; Tsujino, S.; Sakaki, H.

    1998-06-01

    Recently, it was shown that an electron-hole radiative recombination is induced by a mid-infrared light exciting an intersubband transition in a charge transfer double quantum well (CTDQW). This recombination was attributed to an upstream transfer of electrons from an electron-rich well to a hole-rich well. In this study, we investigated the electrical response of a CTDQW under intersubband optical excitation, and found that a positive photocurrent, opposite in sign and proportional to the applied electric field, accompanies the intersubband-transition-induced luminescence (ITIL) signal. A negative photocurrent component was also observed and attributed to heating processes. This work brings a further evidence of the ITIL process and shows that an important proportion of the carriers are consumed by the transfer of electrons.

  6. Stroke multiplicity and horizontal scale of negative charge regions in thunderclouds

    NASA Astrophysics Data System (ADS)

    Williams, Earle R.; Mattos, Enrique V.; Machado, Luiz A. T.

    2016-05-01

    An X-band polarimetric radar and multiple lightning detection systems are used to document the initial cloud-to-ground lightning flash in a large number (46 cases) of incipient thunderstorms, as part of the CHUVA-Vale field campaign during the 2011/2012 spring-summer in southeast Brazil. The results show an exceptionally low stroke multiplicity (87% of flashes with single stroke) in the initial ground flashes, a finding consistent with the limited space available for the positive leader extension into new regions of negative space charge in compact cells. The results here are contrasted with the behavior of ground flashes in mesoscale thunderstorms in previous studies. Additionally, we found evidence for a minimum scale (radar echo >20 dBZ) for lightning initiation (>3 km in radius) and that the peak currents of initial cloud-to-ground flashes in these compact thunderstorms are only half as large as return stroke peak currents in general.

  7. Polymerization on the rocks: negatively-charged alpha-amino acids

    NASA Technical Reports Server (NTRS)

    Hill, A. R. Jr; Bohler, C.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1998-01-01

    Oligomers of the negatively-charged amino acids, glutamic acid, aspartic acid, and O-phospho-L-serine are adsorbed by hydroxylapatite and illite with affinities that increase with oligomer length. In the case of oligo-glutamic acids adsorbed on hydroxylapatite, addition of an extra residue results in an approximately four-fold increase in the strength of adsorption. Oligomers much longer than the 7-mer are retained tenaciously by the mineral. Repeated incubation of short oligo-glutamic acids adsorbed on hydroxylapatite or illite with activated monomer leads to the accumulation of oligomers at least 45 units long. The corresponding reactions of aspartic acid and O-phospho-L-serine on hydroxylapatite are less effective in generating long oligomers, while illite fails to accumulate substantial amounts of long oligomers of aspartic acid or of O-phospho-L-serine.

  8. Dynamic Jahn-Teller Effect in Negatively Charged Nitrogen-Vacancy Center in Diamond

    NASA Astrophysics Data System (ADS)

    Abtew, Tesfaye; Zhang, Peihong

    2011-03-01

    The negatively charged nitrogen-vacancy (NV) center in diamond has attracted much research interest recently owing to its desirable optical properties and long spin coherent lifetime. The ground state of NV- center has a 3 A2 symmetry, which can be optically excited, to a 3 E state. The excited state is orbitally degenerate therefore should experience either static or dynamic Jahn-Teller (JT) effects. We use accurate first-principles methods to study structural and electronic properties of the NV- center in diamond both in the ground and excited states. Our results indicate that the excited state of the NV- center is indeed a dynamic JT system. We acknowledge the Center for Computational Research at the University at Buffalo, SUNY. This work is supported by the National Science Foundation under Grant No. DMR-0946404 and by the Department of Energy under GrantNo. DE-SC0002623.

  9. Saccharification of natural lignocellulose biomass and polysaccharides by highly negatively charged heteropolyacids in concentrated aqueous solution.

    PubMed

    Ogasawara, Yoshiyuki; Itagaki, Shintaro; Yamaguchi, Kazuya; Mizuno, Noritaka

    2011-04-18

    Highly negatively charged heteropolyacids (HPAs), in particular H(5) BW(12) O(40) , efficiently promoted saccharification of crystalline cellulose into water-soluble saccharides in concentrated aqueous solutions (e.g., 82 % total yield and 77 % glucose yield, based on cellulose with a 0.7 M H(5) BW(12) O(40) solution); the performance was much better than those of previously reported systems with commonly utilized mineral acids (e.g., H(2) SO(4) and HCl) and HPAs (e.g., H(3) PW(12) O(40) and H(4) SiW(12) O(40)). Besides crystalline cellulose, the present system was applicable to the selective transformation of cellobiose, starch, and xylan to the corresponding monosaccharides such as glucose and xylose. In addition, one-pot synthesis of levulinic acid and sorbitol directly from cellulose was realized by using concentrated HPA solutions. The present system, concentrated aqueous solutions of highly negatively charged HPAs, was further applicable to saccharification of natural (non-purified) lignocellulose biomass, such as "rice plant straw", "oil palm empty fruit bunch (palm EFB) fiber", and "Japanese cedar sawdust", giving a mixture of the corresponding water-soluble saccharides, such as glucose (main product), galactose, mannose, xylose, arabinose, and cellobiose, in high yields (≥77 % total yields of saccharides based on holocellulose). Separation of the saccharides and H(5) BW(12) O(40) was easy, and the retrieved H(5) BW(12) O(40) could repeatedly be used without appreciable loss of the high performance. PMID:21404445

  10. Speciation dynamics of metals in dispersion of nanoparticles with discrete distribution of charged binding sites.

    PubMed

    Polyakov, Pavel D; Duval, Jérôme F L

    2014-02-01

    We report a comprehensive theory to evaluate the kinetics of complex formation between metal ions and charged spherical nanoparticles. The latter consist of an ion-impermeable core surrounded by a soft shell layer characterized by a discrete axisymmetric 2D distribution of charged sites that bind metal ions. The theory explicitly integrates the conductive diffusion of metal ions from bulk solution toward the respective locations of the reactive sites within the particle shell volume. The kinetic constant k for outer-sphere nanoparticle-metal association is obtained from the sum of the contributions stemming from all reactive sites, each evaluated from the corresponding incoming flux of metal ions derived from steady-state Poisson-Nernst-Planck equations. Illustrations are provided to capture the basic intertwined impacts of particle size, overall particle charge, spatial heterogeneity in site distribution, type of particle (hard, core-shell or porous) and concentration of the background electrolyte on k. As a limit, k converges with predictions from previously reported analytical expressions derived for porous particles with low and high charge density, cases that correspond to coulombic and mean-field (smeared-out) electrostatic treatments, respectively. The conditions underlying the applicability of these latter approaches are rigorously identified in terms of (i) the extent of overlap between electric double layers around charged neighbouring sites, and (ii) the magnitude of the intraparticulate metal concentration gradient. For the first time, the proposed theory integrates the differentiated impact of the local potential around the charged binding sites amidst the overall particle field, together with that of the so-far discarded intraparticulate flux of metal ions. PMID:24336523

  11. Molecular Statics Calculations of Proton Binding to Goethite Surfaces: Thermodynamic Modeling of the Surface Charging and Protonation of Goethite in Aqueous Solution

    NASA Astrophysics Data System (ADS)

    Felmy, Andrew R.; Rustad, James R.

    1998-01-01

    Molecular statics calculations of proton binding at the hydroxylated faces of goethite are used to guide the development of a thermodynamic model which describes the surface charging properties of goethite in electrolyte solutions. The molecular statics calculations combined with a linear free energy relation between the energies of the hydroxylated surface and the aqueous solvated surface predict that the acidity constants for most singly (aqua or hydroxo), doubly (μ-hydroxo), and triply (μ 3-hydroxo or μ 3-oxo) coordinated surface sites all have similar values. This model which binds protons to the goethite 110 and 021 faces satisfactorily describes the surface charging behavior of goethite, if pair formation between bulk electrolyte species, i.e., Na +, Cl -, and NO 3-, is included in the model. Inclusion of minor species of quite different charging behavior (designed to describe the possible presence of defect species) did not improve our predictions of surface charge since the protonation of the major surface sites changed when these minor species were introduced into the calculations thereby negating the effect of small amounts of defect species on the overall charging behavior. The final thermodynamic model is shown to be consistent with the surface charging properties of goethite over a range of pH values, NaNO 3, and NaCl concentrations.

  12. Kinking the coiled coil--negatively charged residues at the coiled-coil interface.

    PubMed

    Straussman, Ravid; Ben-Ya'acov, Ami; Woolfson, Derek N; Ravid, Shoshana

    2007-03-01

    The coiled coil is one of the most common protein-structure motifs. It is believed to be adopted by 3-5% of all amino acids in proteins. It comprises two or more alpha-helical chains wrapped around one another. The sequences of most coiled coils are characterized by a seven-residue (heptad) repeat, denoted (abcdefg)(n). Residues at the a and d positions define the helical interface (core) and are usually hydrophobic, though about 20% are polar or charged. We show that parallel coiled-coils have a unique pattern of their negatively charged residues at the core positions: aspartic acid is excluded from these positions while glutamic acid is not. In contrast the antiparallel structures are more permissive in their amino acid usage. We show further, and for the first time, that incorporation of Asp but not Glu into the a positions of a parallel coiled coil creates a flexible hinge and that the maximal hinge angle is being directly related to the number of incorporated mutations. These new computational and experimental observations will be of use in improving protein-structure predictions, and as rules to guide rational design of novel coiled-coil motifs and coiled coil-based materials. PMID:17207815

  13. Synthesis of positively and negatively charged silver nanoparticles and their deposition on the surface of titanium

    NASA Astrophysics Data System (ADS)

    Sharonova, A.; Loza, K.; Surmeneva, M.; Surmenev, R.; Prymak, O.; Epple, M.

    2016-02-01

    Bacterial infections related to dental implants are currently a significant complication. A good way to overcome this challenge is functionalization of implant surface with Ag nanoparticles (NPs) as antibacterial agent. This article aims at review the synthesis routes, size and electrical properties of AgNPs. Polyvinyl pyrrolidone (PVP) and polyethyleneimine (PEI) were used as stabilizers. Dynamic Light Scattering, Nanoparticle Tracking Analysis, X-ray diffraction (XRD), scanning electron microscopy (SEM), and energy dispersive spectroscopy (EDX) have been used to characterize the prepared AgNPs. Two types of NPs were synthesized in aqueous solutions: PVP-stabilized NPs with a diameter of the metallic core of 70 ± 20 nm, and negative charge of -20 mV, PEI-stabilized NPs with the size of the metallic core of 50 ± 20 nm and positive charge of +55 mV. According to SEM results, all the NPs have a spherical shape. Functionalization of the titanium substrate surface with PVP and PEI-stabilized AgNPs was carried out by dropping method. XRD patterns revealed that the AgNPs are crystalline with the crystallite size of 14 nm.

  14. Gap state charge induced spin-dependent negative differential resistance in tunnel junctions

    NASA Astrophysics Data System (ADS)

    Jiang, Jun; Zhang, X.-G.; Han, X. F.

    2016-04-01

    We propose and demonstrate through first-principles calculation a new spin-dependent negative differential resistance (NDR) mechanism in magnetic tunnel junctions (MTJ) with cubic cation disordered crystals (CCDC) AlO x or Mg1‑x Al x O as barrier materials. The CCDC is a class of insulators whose band gap can be changed by cation doping. The gap becomes arched in an ultrathin layer due to the space charge formed from metal-induced gap states. With an appropriate combination of an arched gap and a bias voltage, NDR can be produced in either spin channel. This mechanism is applicable to 2D and 3D ultrathin junctions with a sufficiently small band gap that forms a large space charge. It provides a new way of controlling the spin-dependent transport in spintronic devices by an electric field. A generalized Simmons formula for tunneling current through junction with an arched gap is derived to show the general conditions under which ultrathin junctions may exhibit NDR.

  15. Negatively-charged NV-center in SiC: Electronic structure properties

    NASA Astrophysics Data System (ADS)

    Dev, Pratibha; Economou, Sophia

    Deep defects with high-spin states in semiconductors are promising candidates as solid-state systems for quantum computing applications. The charged NV-center in diamond is the best-known and most-studied defect center, and has proven to be a good proof-of-principle structure for demonstrating the use of such defects in quantum technologies. Increasingly, however, there is an interest in exploring deep defects in alternative semiconductors such as SiC. This is due to the challenges posed by diamond as host material for defects, as well as the attractive properties of SiC. In this density functional theory work, we study the spin-1 structure of the negatively charged NV-center in two polytypes: 3C-SiC and 4H-SiC. The calculated zero phonon line for the excited state of the defect is in telecom range (0.90eV), making it a very good candidate for quantum technologies. This work provides basic ingredients required to understand the physics of this color center at a quantitative and qualitative level. We also design quantum information applications, such as a spin-photon interface and multi-photon entanglement.

  16. Negatively charged hyperbranched polyglycerol grafted membranes for osmotic power generation from municipal wastewater.

    PubMed

    Li, Xue; Cai, Tao; Chen, Chunyan; Chung, Tai-Shung

    2016-02-01

    Osmotic power holds great promise as a clean, sustainable and largely unexploited energy resource. Recent membrane development for pressure-retarded osmosis (PRO) is making the osmotic power generation more and more realistic. However, severe performance declines have been observed because the porous layer of PRO membranes is fouled by the feed stream. To overcome it, a negatively charged antifouling PRO hollow fiber membrane has been designed and studied in this work. An antifouling polymer, derived from hyperbranched polyglycerol and functionalized by α-lipoic acid and succinic anhydride, was synthesized and grafted onto the polydopamine (PDA) modified poly(ether sulfone) (PES) hollow fiber membranes. In comparison to unmodified membranes, the charged hyperbranched polyglycerol (CHPG) grafted membrane is much less affected by organic deposition, such as bovine serum albumin (BSA) adsorption, and highly resistant to microbial growths, demonstrated by Escherichia coli adhesion and Staphylococcus aureus attachment. CHPG-g-TFC was also examined in PRO tests using a concentrated wastewater as the feed. Comparing to the plain PES-TFC and non-charged HPG-g-TFC, the newly developed membrane exhibits not only the smallest decline in water flux but also the highest recovery rate. When using 0.81 M NaCl and wastewater as the feed pair in PRO tests at 15 bar, the average power density remains at 5.6 W/m(2) in comparison to an average value of 3.6 W/m(2) for unmodified membranes after four PRO runs. In summary, osmotic power generation may be sustained by properly designing and anchoring the functional polymers to PRO membranes. PMID:26630043

  17. Internal configuration and electric potential in planar negatively charged lipid head group region in contact with ionic solution.

    PubMed

    Lebar, Alenka Maček; Velikonja, Aljaž; Kramar, Peter; Iglič, Aleš

    2016-10-01

    The lipid bilayer composed of negatively charged lipid 1-palmitoyl-3-oleoyl-sn-glycero-3-phosphatidylserine (POPS) in contact with an aqueous solution of monovalent salt ions was studied theoretically by using the mean-field modified Langevin-Poisson-Boltzmann (MLPB) model. The MLPB results were tested by using molecular dynamic (MD) simulations. In the MLPB model the charge distribution of POPS head groups is theoretically described by the negatively charged surface which accounts for negatively charged phosphate groups, while the positively charged amino groups and negatively charged carboxylate groups are assumed to be fixed on the rod-like structures with rotational degree of freedom. The spatial variation of relative permittivity, which is not considered in the well-known Gouy-Chapman (GC) model or in MD simulations, is thoroughly derived within a strict statistical mechanical approach. Therefore, the spatial dependence and magnitude of electric potential within the lipid head group region and its close vicinity are considerably different in the MLPB model from the GC model. The influence of the bulk salt concentration and temperature on the number density profiles of counter-ions and co-ions in the lipid head group region and aqueous solution along with the probability density function for the lipid head group orientation angle was compared and found to be in qualitative agreement in the MLPB and MD models. PMID:27209203

  18. Simultaneous Separation of Negatively and Positively Charged Species in Dynamic Field Gradient Focusing Using a Dual Polarity Electric Field

    PubMed Central

    Burke, Jeffrey M.; Huang, Zheng; Ivory, Cornelius F.

    2011-01-01

    Dynamic field gradient focusing (DFGF) utilizes an electric field gradient established by a computer-controlled electrode array to separate and concentrate charged analytes at unique axial positions. Traditionally, DFGF has been restricted to the analysis of negatively charged species due to limitations in the software of our voltage controller. This paper introduces a new voltage controller capable of operating under normal polarity (positive potentials applied to the electrode array) and reversed polarity (negative potentials applied to the electrode array) for the separation of negatively and positively charged analytes, respectively. The experiments conducted under normal polarity and reversed polarity illustrate the utility of the new controller to perform reproducible DFGF separations (elution times showing less than 1% run-to-run variation) over a wide pH range (3.08 to 8.5) regardless of the protein charge. A dual polarity experiment is then shown in which the separation channel has been divided into normal polarity and reversed polarity regions. This simultaneous separation of negatively charged R-phycoerythrin (R-PE) and positively charged cytochrome c (CYTC) within the same DFGF apparatus is shown. PMID:19722517

  19. The Dishevelled-binding protein CXXC5 negatively regulates cutaneous wound healing

    PubMed Central

    Lee, Soung-Hoon; Kim, Mi-Yeon; Kim, Hyun-Yi; Lee, Young-Mi; Kim, Heesu; Nam, Kyoung Ae; Roh, Mi Ryung; Min, Do Sik; Chung, Kee Yang

    2015-01-01

    Wnt/β-catenin signaling plays important roles in cutaneous wound healing and dermal fibrosis. However, its regulatory mechanism has not been fully elucidated, and a commercially available wound-healing agent targeting this pathway is desirable but currently unavailable. We found that CXXC-type zinc finger protein 5 (CXXC5) serves as a negative feedback regulator of the Wnt/β-catenin pathway by interacting with the Dishevelled (Dvl) protein. In humans, CXXC5 protein levels were reduced in epidermal keratinocytes and dermal fibroblasts of acute wounds. A differential regulation of β-catenin, α-smooth muscle actin (α-SMA), and collagen I by overexpression and silencing of CXXC5 in vitro indicated a critical role for this factor in myofibroblast differentiation and collagen production. In addition, CXXC5−/− mice exhibited accelerated cutaneous wound healing, as well as enhanced keratin 14 and collagen synthesis. Protein transduction domain (PTD)–Dvl-binding motif (DBM), a competitor peptide blocking CXXC5-Dvl interactions, disrupted this negative feedback loop and activated β-catenin and collagen production in vitro. Co-treatment of skin wounds with PTD-DBM and valproic acid (VPA), a glycogen synthase kinase 3β (GSK3β) inhibitor which activates the Wnt/β-catenin pathway, synergistically accelerated cutaneous wound healing in mice. Together, these data suggest that CXXC5 would represent a potential target for future therapies aimed at improving wound healing. PMID:26056233

  20. The Dishevelled-binding protein CXXC5 negatively regulates cutaneous wound healing.

    PubMed

    Lee, Soung-Hoon; Kim, Mi-Yeon; Kim, Hyun-Yi; Lee, Young-Mi; Kim, Heesu; Nam, Kyoung Ae; Roh, Mi Ryung; Min, Do Sik; Chung, Kee Yang; Choi, Kang-Yell

    2015-06-29

    Wnt/β-catenin signaling plays important roles in cutaneous wound healing and dermal fibrosis. However, its regulatory mechanism has not been fully elucidated, and a commercially available wound-healing agent targeting this pathway is desirable but currently unavailable. We found that CXXC-type zinc finger protein 5 (CXXC5) serves as a negative feedback regulator of the Wnt/β-catenin pathway by interacting with the Dishevelled (Dvl) protein. In humans, CXXC5 protein levels were reduced in epidermal keratinocytes and dermal fibroblasts of acute wounds. A differential regulation of β-catenin, α-smooth muscle actin (α-SMA), and collagen I by overexpression and silencing of CXXC5 in vitro indicated a critical role for this factor in myofibroblast differentiation and collagen production. In addition, CXXC5(-/-) mice exhibited accelerated cutaneous wound healing, as well as enhanced keratin 14 and collagen synthesis. Protein transduction domain (PTD)-Dvl-binding motif (DBM), a competitor peptide blocking CXXC5-Dvl interactions, disrupted this negative feedback loop and activated β-catenin and collagen production in vitro. Co-treatment of skin wounds with PTD-DBM and valproic acid (VPA), a glycogen synthase kinase 3β (GSK3β) inhibitor which activates the Wnt/β-catenin pathway, synergistically accelerated cutaneous wound healing in mice. Together, these data suggest that CXXC5 would represent a potential target for future therapies aimed at improving wound healing. PMID:26056233

  1. Strong Electrostatic Interactions Lead to Entropically Favorable Binding of Peptides to Charged Surfaces.

    PubMed

    Sprenger, K G; Pfaendtner, Jim

    2016-06-01

    Thermodynamic analyses can provide key insights into the origins of protein self-assembly on surfaces, protein function, and protein stability. However, obtaining quantitative measurements of thermodynamic observables from unbiased classical simulations of peptide or protein adsorption is challenging because of sampling limitations brought on by strong biomolecule/surface binding forces as well as time scale limitations. We used the parallel tempering metadynamics in the well-tempered ensemble (PTMetaD-WTE) enhanced sampling method to study the adsorption behavior and thermodynamics of several explicitly solvated model peptide adsorption systems, providing new molecular-level insight into the biomolecule adsorption process. Specifically studied were peptides LKα14 and LKβ15 and trpcage miniprotein adsorbing onto a charged, hydrophilic self-assembled monolayer surface functionalized with a carboxylic acid/carboxylate headgroup and a neutral, hydrophobic methyl-terminated self-assembled monolayer surface. Binding free energies were calculated as a function of temperature for each system and decomposed into their respective energetic and entropic contributions. We investigated how specific interfacial features such as peptide/surface electrostatic interactions and surface-bound ion content affect the thermodynamic landscape of adsorption and lead to differences in surface-bound conformations of the peptides. Results show that upon adsorption to the charged surface, configurational entropy gains of the released solvent molecules dominate the configurational entropy losses of the bound peptide. This behavior leads to an apparent increase in overall system entropy upon binding and therefore to the surprising and seemingly nonphysical result of an apparent increased binding free energy at elevated temperatures. Opposite effects and conclusions are found for the neutral surface. Additional simulations demonstrate that by adjusting the ionic strength of the solution

  2. Highly efficient bioinspired molecular Ru water oxidation catalysts with negatively charged backbone ligands.

    PubMed

    Duan, Lele; Wang, Lei; Li, Fusheng; Li, Fei; Sun, Licheng

    2015-07-21

    The oxygen evolving complex (OEC) of the natural photosynthesis system II (PSII) oxidizes water to produce oxygen and reducing equivalents (protons and electrons). The oxygen released from PSII provides the oxygen source of our atmosphere; the reducing equivalents are used to reduce carbon dioxide to organic products, which support almost all organisms on the Earth planet. The first photosynthetic organisms able to split water were proposed to be cyanobacteria-like ones appearing ca. 2.5 billion years ago. Since then, nature has chosen a sustainable way by using solar energy to develop itself. Inspired by nature, human beings started to mimic the functions of the natural photosynthesis system and proposed the concept of artificial photosynthesis (AP) with the view to creating energy-sustainable societies and reducing the impact on the Earth environments. Water oxidation is a highly energy demanding reaction and essential to produce reducing equivalents for fuel production, and thereby effective water oxidation catalysts (WOCs) are required to catalyze water oxidation and reduce the energy loss. X-ray crystallographic studies on PSII have revealed that the OEC consists of a Mn4CaO5 cluster surrounded by oxygen rich ligands, such as oxyl, oxo, and carboxylate ligands. These negatively charged, oxygen rich ligands strongly stabilize the high valent states of the Mn cluster and play vital roles in effective water oxidation catalysis with low overpotential. This Account describes our endeavors to design effective Ru WOCs with low overpotential, large turnover number, and high turnover frequency by introducing negatively charged ligands, such as carboxylate. Negatively charged ligands stabilized the high valent states of Ru catalysts, as evidenced by the low oxidation potentials. Meanwhile, the oxygen production rates of our Ru catalysts were improved dramatically as well. Thanks to the strong electron donation ability of carboxylate containing ligands, a seven

  3. Excitation of dust acoustic waves by an ion beam in a plasma cylinder with negatively charged dust grains

    SciTech Connect

    Sharma, Suresh C.; Kaur, Daljeet; Gahlot, Ajay; Sharma, Jyotsna

    2014-10-15

    An ion beam propagating through a plasma cylinder having negatively charged dust grains drives a low frequency electrostatic dust acoustic wave (DAW) to instability via Cerenkov interaction. The unstable wave frequencies and the growth rate increase with the relative density of negatively charged dust grains. The growth rate of the unstable mode scales to the one-third power of the beam density. The real part of the frequency of the unstable mode increases with the beam energy and scales to almost one-half power of the beam energy. The phase velocity, frequency, and wavelength results of the unstable mode are in compliance with the experimental observations.

  4. Negatively charged subnanometer-sized silicon clusters and their reversible migration into AFI zeolite pores studied with X-ray photoelectron spectroscopy and ultraviolet photoelectron spectroscopy

    NASA Astrophysics Data System (ADS)

    Choo, Cheow-keong; Sakamoto, Takashi; Tanaka, Katsumi; Nakata, Ryouhei; Asakawa, Tetsuo

    1999-02-01

    Subnanometer sized silicon clusters were deposited on AFI zeolite (AlPO 4-5: one-dimensional channel diameter <0.73 nm) by pulsed laser ablation of silicon wafer. Their electronic structures were elucidated in situ by X-ray photoelectron spectroscopy (XPS) and ultraviolet photoelectron spectroscopy (UPS). Core level Si 2p spectra were analyzed into five components, Si(I) to Si(V). Si(I) and Si(II) species selectively increased with a constant ratio during pulsed laser silicon ablation. Their binding energies (BEs) were below 99.5 eV implying negatively charged states. Charge transfer occurred between silicon clusters and framework oxygen and phosphor ions. It was interpreted that the stability of negative charge is due to large electron affinity of silicon clusters. The intensity of XPS signals decreased as a function of time and at the same time the channels were blocked. These results were interpreted due to migration of silicon clusters into zeolite pores. The estimated activation energy (57 kJ/mol) suggests that rate-determining step of the migration is reflected by a weak adsorbed state of silicon clusters similar to physisorbed state. The silicon clusters were partially oxidized at 573 K, which was interpreted as a driving force of backward migration from zeolite pores to the external surface. The composition of silicon cluster was discussed based on homogeneous dispersion of single species.

  5. Accurate vibrational frequencies using the self-consistent-charge density-functional tight-binding method

    NASA Astrophysics Data System (ADS)

    Małolepsza, Edyta; Witek, Henryk A.; Morokuma, Keiji

    2005-09-01

    An optimization technique for enhancing the quality of repulsive two-body potentials of the self-consistent-charge density-functional tight-binding (SCC-DFTB) method is presented and tested. The new, optimized potentials allow for significant improvement of calculated harmonic vibrational frequencies. Mean absolute deviation from experiment computed for a group of 14 hydrocarbons is reduced from 59.0 to 33.2 cm -1 and maximal absolute deviation, from 436.2 to 140.4 cm -1. A drawback of the new family of potentials is a lower quality of reproduced geometrical and energetic parameters.

  6. Statistical mechanics of dust charging in a multi-ion plasma with negative and positive ionic species

    SciTech Connect

    Mishra, S. K.; Misra, Shikha

    2015-02-15

    On the basis of statistical mechanics and charging kinetics, the charge distribution over uniform size spherical dust particles in a multi-ion plasma comprising of multiple charged negative and positive ions is investigated. Two specific situations where the complex plasma is viz., (i) dark (no emission from dust) and (ii) irradiated by laser light (causing photoemission from dust) have been taken into account. The analytical formulation includes the population balance equation for the charged dust particles along with number and energy balance of the complex plasma constituents. The departure of the results for multi-ion plasma from that in case of usual singly charged positive ion plasma is graphically illustrated and discussed. In contrast to electron-ion plasma, significant number of particles is seen to acquire opposite charge in case of pure positive-negative ion plasma, even in the absence of electron emission from the dust grains. The effects of various plasma parameters viz., number density, particle size, and work function of dust on charge distribution have also been examined.

  7. Statistical mechanics of dust charging in a multi-ion plasma with negative and positive ionic species

    NASA Astrophysics Data System (ADS)

    Mishra, S. K.; Misra, Shikha

    2015-02-01

    On the basis of statistical mechanics and charging kinetics, the charge distribution over uniform size spherical dust particles in a multi-ion plasma comprising of multiple charged negative and positive ions is investigated. Two specific situations where the complex plasma is viz., (i) dark (no emission from dust) and (ii) irradiated by laser light (causing photoemission from dust) have been taken into account. The analytical formulation includes the population balance equation for the charged dust particles along with number and energy balance of the complex plasma constituents. The departure of the results for multi-ion plasma from that in case of usual singly charged positive ion plasma is graphically illustrated and discussed. In contrast to electron-ion plasma, significant number of particles is seen to acquire opposite charge in case of pure positive-negative ion plasma, even in the absence of electron emission from the dust grains. The effects of various plasma parameters viz., number density, particle size, and work function of dust on charge distribution have also been examined.

  8. Negatively charged nano-grains at 67P/Churyumov-Gerasimenko

    NASA Astrophysics Data System (ADS)

    Gombosi, T. I.; Burch, J. L.; Horányi, M.

    2015-11-01

    Shortly after the Rosetta mission's rendezvous with 67P/Churyumov-Gerasimenko the RPC/IES instrument intermittently detected negative particles that were identified as singly charged nano-dust grains. These grains were recorded as a nearly mono-energetic beam of particles in the 200-500 eV range arriving from the direction of the comet. Occasionally, another population of particles in the energy range of 1-20 keV were also noticed arriving from the approximate direction of the Sun. In this paper we review the processes that can explain the energization and the directionality of the observed nano-dust populations. We show that the observations are consistent with gas-drag acceleration of the outflowing particles with radii of 3-4 nm, and with the returning fragments of bigger particles accelerated by radiation pressure with approximate radii of 30-80 nm. In addition to gas drag and radiation pressure, we also examine the role of the solar wind induced motional electric field, and its possible role in explaining the intermittency of the detection of a nano-grain population arriving from the solar direction.

  9. Protein PEGylation attenuates adsorption and aggregation on a negatively charged and moderately hydrophobic polymer surface.

    PubMed

    Pai, Sheetal S; Przybycien, Todd M; Tilton, Robert D

    2010-12-01

    Covalent grafting of poly(ethylene glycol) chains to proteins ("PEGylation") is emerging as an effective technique to increase the in vivo circulation time and efficacy of protein drugs. PEGylated protein adsorption at a variety of solid/aqueous interfaces is a critical aspect of their manufacture, storage, and delivery. A special category of block copolymer, PEGylated proteins have one or more water-soluble linear polymer (PEG) blocks and a single globular protein block that each exert distinct intermolecular and surface interaction forces. We report the impact of PEGylation on protein adsorption at the interface between aqueous solutions and solid films of poly(lactide-co-glycolide) (PLG), a moderately hydrophobic and negatively charged polymer. Using the model protein lysozyme with controlled degrees of PEGylation, we employ total internal reflection fluorescence techniques to measure adsorption isotherms, adsorption reversibility, and the extent of surface-induced aggregation. Lysozyme PEGylation reduces the extent of protein adsorption and surface-induced aggregation and increases the reversibility of adsorption compared to the unconjugated protein. Results are interpreted in terms of steric forces among grafted PEG chains and their effects on protein-protein interactions and protein orientation on the surface. PMID:21067142

  10. Photoluminescence Studies of Both the Neutral and Negatively Charged Nitrogen-Vacancy Center in Diamond.

    PubMed

    Wang, Kaiyue; Steeds, John W; Li, Zhihong; Tian, Yuming

    2016-02-01

    In this study low temperature micro-photoluminescence technology was employed to investigate effects of the irradiation and nitrogen concentration on nitrogen-vacancy (NV) luminescence, with the photochromic and vibronic properties of the NV defects. Results showed that the NV luminescence was weakened due to recombination of self-interstitials created by electron irradiation in diamond and the vacancies within the structure of NV centers. For very pure diamond, the vacancies migrated the long distance to get trapped by N atoms only after sufficient high temperature annealing. As with the increase in nitrogen content, the migration distance of vacancies got smaller. The nitrogen also favored the formation of negatively charged NV centers with the donating electrons. Under the high-energy ultraviolet laser excitation, the photochromic property of the NV- center was also observed, though it was not stable. Besides, the NV centers showed very strong broad sidebands, and the vibrations involved one phonon with energy of ~42 meV and another with ~67 meV energy. PMID:26758647

  11. Temperature-controlled interaction of thermosensitive polymer-modified cationic liposomes with negatively charged phospholipid membranes.

    PubMed

    Kono, K; Henmi, A; Takagishi, T

    1999-09-21

    To obtain cationic liposomes of which affinity to negatively charged membranes can be controlled by temperature, cationic liposomes consisting of 3beta-[N-(N', N'-dimethylaminoethane)carbamoyl]cholesterol and dioleoylphosphatidylethanolamine were modified with poly(N-acryloylpyrrolidine), which is a thermosensitive polymer exhibiting a lower critical solution temperature (LCST) at ca. 52 degrees C. The unmodified cationic liposomes did not change its zeta potential between 20-60 degrees C. The polymer-modified cationic liposomes revealed much lower zeta potential values below the LCST of the polymer than the unmodified cationic liposomes. However, their zeta potential increased significantly above this temperature. The unmodified cationic liposomes formed aggregates and fused intensively with anionic liposomes consisting of egg yolk phosphatidylcholine and phosphatidic acid in the region of 20-60 degrees C, due to the electrostatic interaction. In contrast, aggregation and fusion of the polymer-modified cationic liposomes with the anionic liposomes were strongly suppressed below the LCST. However, these interactions were enhanced remarkably above the LCST. In addition, the polymer-modified cationic liposomes did not cause leakage of calcein from the anionic liposomes below the LCST, but promoted the leakage above this temperature as the unmodified cationic liposomes did. Temperature-induced conformational change of the polymer chains from a hydrated coil to a dehydrated globule might affect the affinity of the polymer-modified cationic liposomes to the anionic liposomes. PMID:10561483

  12. Interfacial charge transfer between CdTe quantum dots and Gram negative vs. Gram positive bacteria.

    SciTech Connect

    Dumas, E.; Gao, C.; Suffern, D.; Bradforth, S. E.; Dimitrejevic, N. M.; Nadeau, J. L.; McGill Univ.; Univ. of Southern California

    2010-01-01

    Oxidative toxicity of semiconductor and metal nanomaterials to cells has been well established. However, it may result from many different mechanisms, some requiring direct cell contact and others resulting from the diffusion of reactive species in solution. Published results are contradictory due to differences in particle preparation, bacterial strain, and experimental conditions. It has been recently found that C{sub 60} nanoparticles can cause direct oxidative damage to bacterial proteins and membranes, including causing a loss of cell membrane potential (depolarization). However, this did not correlate with toxicity. In this study we perform a similar analysis using fluorescent CdTe quantum dots, adapting our tools to make use of the particles fluorescence. We find that two Gram positive strains show direct electron transfer to CdTe, resulting in changes in CdTe fluorescence lifetimes. These two strains also show changes in membrane potential upon nanoparticle binding. Two Gram negative strains do not show these effects - nevertheless, they are over 10-fold more sensitive to CdTe than the Gram positives. We find subtoxic levels of Cd{sup 2+} release from the particles upon irradiation of the particles, but significant production of hydroxyl radicals, suggesting that the latter is a major source of toxicity. These results help establish mechanisms of toxicity and also provide caveats for use of certain reporter dyes with fluorescent nanoparticles which will be of use to anyone performing these assays. The findings also suggest future avenues of inquiry into electron transfer processes between nanomaterials and bacteria.

  13. Identification of functionally important negatively charged residues in the carboxy end of mouse hepatitis coronavirus A59 nucleocapsid protein.

    PubMed

    Verma, Sandhya; Bednar, Valerie; Blount, Andrew; Hogue, Brenda G

    2006-05-01

    The coronavirus nucleocapsid (N) protein is a multifunctional viral gene product that encapsidates the RNA genome and also plays some as yet not fully defined role in viral RNA replication and/or transcription. A number of conserved negatively charged amino acids are located within domain III in the carboxy end of all coronavirus N proteins. Previous studies suggested that the negatively charged residues are involved in virus assembly by mediating interaction between the membrane (M) protein carboxy tail and nucleocapsids. To determine the importance of these negatively charged residues, a series of alanine and other charged-residue substitutions were introduced in place of those in the N gene within a mouse hepatitis coronavirus A59 infectious clone. Aspartic acid residues 440 and 441 were identified as functionally important. Viruses could not be isolated when both residues were replaced by positively charged amino acids. When either amino acid was replaced by a positively charged residue or both were changed to alanine, viruses were recovered that contained second-site changes within N, but not in the M or envelope protein. The compensatory role of the new changes was confirmed by the construction of new viruses. A few viruses were recovered that retained the D441-to-arginine change and no compensatory changes. These viruses exhibited a small-plaque phenotype and produced significantly less virus. Overall, results from our analysis of a large panel of plaque-purified recovered viruses indicate that the negatively charged residues at positions 440 and 441 are key residues that appear to be involved in virus assembly. PMID:16611893

  14. Propafenone blocks human cardiac Kir2.x channels by decreasing the negative electrostatic charge in the cytoplasmic pore.

    PubMed

    Amorós, Irene; Dolz-Gaitón, Pablo; Gómez, Ricardo; Matamoros, Marcos; Barana, Adriana; de la Fuente, Marta González; Núñez, Mercedes; Pérez-Hernández, Marta; Moraleda, Ignacio; Gálvez, Enrique; Iriepa, Isabel; Tamargo, Juan; Caballero, Ricardo; Delpón, Eva

    2013-07-15

    Human cardiac inward rectifier current (IK1) is generated by Kir2.x channels. Inhibition of IK1 could offer a useful antiarrhythmic strategy against fibrillatory arrhythmias. Therefore, elucidation of Kir2.x channels pharmacology, which still remains elusive, is mandatory. We characterized the electrophysiological and molecular basis of the inhibition produced by the antiarrhythmic propafenone of the current generated by Kir2.x channels (IKir2.x) and the IK1 recorded in human atrial myocytes. Wild type and mutated human Kir2.x channels were transiently transfected in CHO and HEK-293 cells. Macroscopic and single-channel currents were recorded using the patch-clamp technique. At concentrations >1μM propafenone inhibited IKir2.x the order of potency being Kir2.3∼IK1>Kir2.2>Kir2.1 channels. Blockade was irrespective of the extracellular K(+) concentration whereas markedly increased when the intracellular K(+) concentration was decreased. Propafenone decreased inward rectification since at potentials positive to the K(+) equilibrium potential propafenone-induced block decreased in a voltage-dependent manner. Importantly, propafenone favored the occurrence of subconductance levels in Kir2.x channels and decreased phosphatidylinositol 4,5-bisphosphate (PIP2)-channel affinity. Blind docking and site-directed mutagenesis experiments demonstrated that propafenone bound Kir2.x channels at the cytoplasmic domain, close to, but not in the pore itself, the binding site involving two conserved Arg residues (residues 228 and 260 in Kir2.1). Our results suggested that propafenone incorporated into the cytoplasmic domain of the channel in such a way that it decreased the net negative charge sensed by K(+) ions and polyamines which, in turn, promotes the appearance of subconductance levels and the decrease of PIP2 affinity of the channels. PMID:23648307

  15. Radiation transport codes for potential applications related to radiobiology and radiotherapy using protons, neutrons, and negatively charged pions

    NASA Technical Reports Server (NTRS)

    Armstrong, T. W.

    1972-01-01

    Several Monte Carlo radiation transport computer codes are used to predict quantities of interest in the fields of radiotherapy and radiobiology. The calculational methods are described and comparisions of calculated and experimental results are presented for dose distributions produced by protons, neutrons, and negatively charged pions. Comparisons of calculated and experimental cell survival probabilities are also presented.

  16. Equilibrium distribution of permeants in polyelectrolyte microcapsules filled with negatively charged polyelectrolyte: the influence of ionic strength and solvent polarity.

    PubMed

    Tong, Weijun; Song, Haiqing; Gao, Changyou; Möhwald, Helmuth

    2006-07-01

    The effects of ionic strength and solvent polarity on the equilibrium distribution of fluorescein (FL) and FITC-dextran between the interior of polyelectrolyte multilayer microcapsules filled with negatively charged strong polyelectrolyte and the bulk solution were systematically investigated. A negatively charged strong polyelectrolyte, poly(styrene sulfonate) (PSS), used for CaCO3 core fabrication, was entrapped inside the capsules. Due to the semipermeability of the capsule wall, a Donnan equilibrium between the inner solution within the capsules and the bulk solution was created. The equilibrium distribution of the negatively charged permeants was investigated by means of confocal laser scanning microscopy as a function of ionic strength and solvent polarity. The equilibrium distribution of the negatively charged permeants could be tuned by increasing the bulk ionic strength to decrease the Donnan potential. Decreasing the solvent polarity also could enhance the permeation of FL, which induces a sudden increase of permeation when the ethanol volume fraction was higher than 0.7. This is mainly attributed to the precipitation of PSS. A theoretical model combining the Donnan equilibrium and Manning counterion condensation was employed to discuss the results. PMID:16805590

  17. Improving the Lethal Effect of Cpl-7, a Pneumococcal Phage Lysozyme with Broad Bactericidal Activity, by Inverting the Net Charge of Its Cell Wall-Binding Module

    PubMed Central

    Díez-Martínez, Roberto; de Paz, Héctor; Bustamante, Noemí; García, Ernesto; Menéndez, Margarita

    2013-01-01

    Phage endolysins are murein hydrolases that break the bacterial cell wall to provoke lysis and release of phage progeny. Recently, these enzymes have also been recognized as powerful and specific antibacterial agents when added exogenously. In the pneumococcal system, most cell wall associated murein hydrolases reported so far depend on choline for activity, and Cpl-7 lysozyme constitutes a remarkable exception. Here, we report the improvement of the killing activity of the Cpl-7 endolysin by inversion of the sign of the charge of the cell wall-binding module (from −14.93 to +3.0 at neutral pH). The engineered variant, Cpl-7S, has 15 amino acid substitutions and an improved lytic activity against Streptococcus pneumoniae (including multiresistant strains), Streptococcus pyogenes, and other pathogens. Moreover, we have demonstrated that a single 25-μg dose of Cpl-7S significantly increased the survival rate of zebrafish embryos infected with S. pneumoniae or S. pyogenes, confirming the killing effect of Cpl-7S in vivo. Interestingly, Cpl-7S, in combination with 0.01% carvacrol (an essential oil), was also found to efficiently kill Gram-negative bacteria such as Escherichia coli and Pseudomonas putida, an effect not described previously. Our findings provide a strategy to improve the lytic activity of phage endolysins based on facilitating their pass through the negatively charged bacterial envelope, and thereby their interaction with the cell wall target, by modulating the net charge of the cell wall-binding modules. PMID:23959317

  18. Improving the lethal effect of cpl-7, a pneumococcal phage lysozyme with broad bactericidal activity, by inverting the net charge of its cell wall-binding module.

    PubMed

    Díez-Martínez, Roberto; de Paz, Héctor D; de Paz, Héctor; Bustamante, Noemí; García, Ernesto; Menéndez, Margarita; García, Pedro

    2013-11-01

    Phage endolysins are murein hydrolases that break the bacterial cell wall to provoke lysis and release of phage progeny. Recently, these enzymes have also been recognized as powerful and specific antibacterial agents when added exogenously. In the pneumococcal system, most cell wall associated murein hydrolases reported so far depend on choline for activity, and Cpl-7 lysozyme constitutes a remarkable exception. Here, we report the improvement of the killing activity of the Cpl-7 endolysin by inversion of the sign of the charge of the cell wall-binding module (from -14.93 to +3.0 at neutral pH). The engineered variant, Cpl-7S, has 15 amino acid substitutions and an improved lytic activity against Streptococcus pneumoniae (including multiresistant strains), Streptococcus pyogenes, and other pathogens. Moreover, we have demonstrated that a single 25-μg dose of Cpl-7S significantly increased the survival rate of zebrafish embryos infected with S. pneumoniae or S. pyogenes, confirming the killing effect of Cpl-7S in vivo. Interestingly, Cpl-7S, in combination with 0.01% carvacrol (an essential oil), was also found to efficiently kill Gram-negative bacteria such as Escherichia coli and Pseudomonas putida, an effect not described previously. Our findings provide a strategy to improve the lytic activity of phage endolysins based on facilitating their pass through the negatively charged bacterial envelope, and thereby their interaction with the cell wall target, by modulating the net charge of the cell wall-binding modules. PMID:23959317

  19. Negative differential conductance in InAs wire based double quantum dot induced by a charged AFM tip

    SciTech Connect

    Zhukov, A. A.; Volk, Ch.; Winden, A.; Hardtdegen, H.; Schaepers, Th.

    2012-12-15

    We investigate the conductance of an InAs nanowire in the nonlinear regime in the case of low electron density where the wire is split into quantum dots connected in series. The negative differential conductance in the wire is initiated by means of a charged atomic force microscope tip adjusting the transparency of the tunneling barrier between two adjoining quantum dots. We confirm that the negative differential conductance arises due to the resonant tunneling between these two adjoining quantum dots. The influence of the transparency of the blocking barriers and the relative position of energy states in the adjoining dots on a decrease of the negative differential conductance is investigated in detail.

  20. Tantalum oxide/silicon nitride: A negatively charged surface passivation stack for silicon solar cells

    SciTech Connect

    Wan, Yimao Bullock, James; Cuevas, Andres

    2015-05-18

    This letter reports effective passivation of crystalline silicon (c-Si) surfaces by thermal atomic layer deposited tantalum oxide (Ta{sub 2}O{sub 5}) underneath plasma enhanced chemical vapour deposited silicon nitride (SiN{sub x}). Cross-sectional transmission electron microscopy imaging shows an approximately 2 nm thick interfacial layer between Ta{sub 2}O{sub 5} and c-Si. Surface recombination velocities as low as 5.0 cm/s and 3.2 cm/s are attained on p-type 0.8 Ω·cm and n-type 1.0 Ω·cm c-Si wafers, respectively. Recombination current densities of 25 fA/cm{sup 2} and 68 fA/cm{sup 2} are measured on 150 Ω/sq boron-diffused p{sup +} and 120 Ω/sq phosphorus-diffused n{sup +} c-Si, respectively. Capacitance–voltage measurements reveal a negative fixed insulator charge density of −1.8 × 10{sup 12 }cm{sup −2} for the Ta{sub 2}O{sub 5} film and −1.0 × 10{sup 12 }cm{sup −2} for the Ta{sub 2}O{sub 5}/SiN{sub x} stack. The Ta{sub 2}O{sub 5}/SiN{sub x} stack is demonstrated to be an excellent candidate for surface passivation of high efficiency silicon solar cells.

  1. Molecular Interactions of Alzheimer Amyloid-β Oligomer with Neutral and Negatively Charged Lipid Bilayers

    PubMed Central

    Yu, Xiang; Wang, Qiuming; Pan, Qingfen; Zhou, Feimeng; Zheng, Jie

    2013-01-01

    Interaction of p3 (Aβ17-42) peptides with cell membrane is crucial for the understanding of amyloid toxicity associated with Alzheimer’s disease (AD). Such p3-membrane interactions are considered to induce the disruption of membrane permeability and integrity, but the exact mechanisms of how p3 aggregates, particularly small p3 oligomers, induce receptor-independent membrane disruption are not yet completely understood. Here, we investigate the adsorption, orientation, and surface interaction of the p3 pentamer with lipid bilayers composed of both pure zwitterionic POPC (palmitoyl-oleyl-phosphatidylcholine) and mixed anionic POPC/POPG (palmitoyl-oleyl-phosphatidylglycerol) (3:1) lipids using explicit-solvent molecular dynamics (MD) simulations. MD simulation results show that the p3 pentamer has much stronger interactions with mixed POPC/POPG lipids than pure POPC lipids, consistent with experimental observation that Aβ adsorption and fibrililation are enhanced on anionic lipid bilayers. Although electrostatic interactions are main attractive forces to drive the p3 to adsorb on the bilayer surface, the adsorption of the p3 pentamer on the lipid bilayer with a preferential C-terminal β-strands facing toward the bilayer surface is a net outcome of different competitions between p3 peptides-lipid bilayer and ions-p3-bilayer interactions. More importantly, Ca2+ ions are found to form ionic bridges to associate negatively charged residues of p3 with anionic headgroups of the lipid bilayer, resulting in Aβ–Ca2+–PO4− complexes. Intensive Ca2+ bound to lipid bilayer and Ca2+ ionic bridges may lead to the alternation of Ca2+ hemostasis responsible for neuronal dysfunction and death. This work provides insights into the mutual structure, dynamics, and interactions of both Aβ peptides and lipid bilayer at the atomic level, which expand our understanding of the complex behavior of amyloid-induced membrane disruption. PMID:23493873

  2. New results on catalyzed big bang nucleosynthesis with a long-lived negatively charged massive particle

    SciTech Connect

    Kusakabe, Motohiko; Kajino, Toshitaka; Yoshida, Takashi; Mathews, Grant J.

    2010-04-15

    It has been proposed that the apparent discrepancies between the inferred primordial abundances of {sup 6}Li and {sup 7}Li and the predictions of big bang nucleosynthesis (BBN) can be resolved by the existence of a negatively charged massive unstable supersymmetric particle (X{sup -}) during the BBN epoch. Here, we present new BBN calculations with an X{sup -} particle utilizing an improved nuclear reaction network including captures of nuclei by the particle, nuclear reactions and {beta} decays of normal nuclei and nuclei bound to the X{sup -} particles (X nuclei), and new reaction rates derived from recent rigorous quantum many-body dynamical calculations. We find that this is still a viable model to explain the observed {sup 6}Li and {sup 7}Li abundances. We also show that with the new rates the production of heavier nuclei is suppressed and there is no signature on abundances of nuclei heavier than Be in the X{sup -}-particle catalyzed BBN model as has been previously proposed. We also consider the version of this model whereby the X{sup -} particle decays into the present cold dark matter. We analyze this paradigm in light of the recent constraints on the dark-matter mass deduced from the possible detected events in the CDMS-II experiment. We conclude that based upon the inferred range for the dark-matter mass, only X{sup -} decay via the weak interaction can achieve the desired {sup 7}Li destruction while also reproducing the observed {sup 6}Li abundance.

  3. High-energy negative ion beam obtained from pulsed inductively coupled plasma for charge-free etching process

    NASA Astrophysics Data System (ADS)

    Vozniy, O. V.; Yeom, G. Y.

    2009-06-01

    Negative ions in conventional inductively coupled plasma are often more chemically active than positive ions (for example, in CF4 or SF6 plasmas), but inconveniently they are trapped inside the sheath and cannot be used for high-energy surface etching in sources with a grid-type acceleration system. In this work we describe a method of positive and negative ion extraction that allows the energy and flux of oppositely charged particles to be varied independently. Then by scattering the ions off from a metal surface, it is possible to form a high-energy beam of neutrals from the negative ions by using the low-energy positive component of the beam current for better charge compensation.

  4. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    NASA Astrophysics Data System (ADS)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  5. Preserved serotonin transporter binding in de novo Parkinson's disease: negative correlation with the dopamine transporter.

    PubMed

    Strecker, Karl; Wegner, Florian; Hesse, Swen; Becker, Georg-Alexander; Patt, Marianne; Meyer, Philipp M; Lobsien, Donald; Schwarz, Johannes; Sabri, Osama

    2011-01-01

    Recent imaging and neuropathological studies indicate reduced serotonin transporter (SERT) in advanced Parkinson's disease (PD). However, data on SERT in early PD patients are sparse. Following the hypothesis that the serotonergic system is damaged early in PD, the aim of our study was to investigate SERT availability by means of PET imaging. Since the loss of dopaminergic neurons is the pathologic hallmark of PD and SERT might be associated with psychiatric co-morbidity, we further sought to correlate SERT availability with the availability of dopamine transporter (DAT) and depressive or motor symptoms in early PD. We prospectively recruited nine early PD patients (4 female, 5 male; 42-76 years) and nine age matched healthy volunteers (5 female, 4 male; 42-72 years). Diagnosis of PD was confirmed by the UK brain bank criteria and DAT imaging. SERT availability was measured by means of [11C]DASB PET. For neuropsychiatric assessment done on the day of PET we applied UPDRS parts I, II and III, Beck's Depression Inventory, Hamilton Rating Scale for Depression, Mini-Mental State Examination and Demtect. SERT was not reduced in any of 14 investigated regions of interest in the nine PD patients compared to healthy controls (p>0.13). SERT was negatively associated with DAT in the striatum (r=-0.69; p=0.04) but not within the midbrain. There was no correlation of SERT availability with depressive symptoms. No alteration of SERT binding in our patients suggests that the serotonergic system is remarkably preserved in early PD. Correlation with DAT might point to a compensatory regulation of the serotonergic system in early stages of PD. PMID:20644949

  6. Role of negatively charged ions in plasma on the growth and field emission properties of spherical carbon nanotube tip

    SciTech Connect

    Tewari, Aarti; Walia, Ritu; Sharma, Suresh C.

    2012-01-15

    The role of negatively charged ions in plasma on growth (without catalyst) and field emission properties of spherical carbon nanotube (CNT) tip has been theoretically investigated. A theoretical model of charge neutrality, including the kinetics of electrons, negatively and positively charged ions, neutral atoms, and the energy balance of various species has been developed. Numerical calculations of the spherical CNT tip radius for different relative density of negatively charged ions {epsilon}{sub r}(=n{sub SF{sub 6{sup -}}}/n{sub C{sup +}}, where n{sub SF{sub 6{sup -}}} and n{sub C}{sup +} are the equilibrium densities of sulphur hexafluoride and carbon ions, respectively) have been carried out for the typical glow discharge plasma parameters. It is found that the spherical CNT tip radius decreases with {epsilon}{sub r} and hence the field emission of electrons from the spherical CNT tip increases. Some of our theoretical results are in accordance with the existing experimental observations.

  7. Structure, Stability, and Fragmentation of Sodium bis(2-ethylhexyl)Sulfosuccinate Negatively Charged Aggregates In Vacuo by MD Simulations

    NASA Astrophysics Data System (ADS)

    Longhi, Giovanna; Abbate, Sergio; Ceselli, Alberto; Ceraulo, Leopoldo; Fornili, Sandro L.; Turco Liveri, Vincenzo

    2014-09-01

    Negatively charged supramolecular aggregates formed in vacuo by n bis(2-ethylhexyl)sulfosuccinate (AOT-) anions and n + n c sodium counterions (i.e., [AOT n Na n+nc ] nc ) have been investigated by molecular dynamics (MD) simulations for n = 1 to 20 and n c = -1 to -5. By comparing the maximum excess charge values of negatively and positively charged AOTNa aggregates, it is found that the charge storage capability is higher for the latter systems, the difference decreasing as the aggregation number increases. Statistical analysis of physical properties like gyration radii and moment of inertia tensors of aggregates provides detailed information on their structural properties. Even for n c = -5, all stable aggregates show a reverse micelle-like structure with an internal core, including sodium counterions and surfactant polar heads, surrounded by an external layer consisting of the surfactant alkyl chains. Interestingly, the reverse micelle-like structure is retained also in proximity of fragmentation. Moreover, the aggregate shapes may be approximated by elongated ellipsoids whose longer axis increases with n and | n c |. The fragmentation patterns of a number of these aggregates have also been examined and have been found to markedly depend on the aggregate charge state. The simulated fragmentation patterns of a representative aggregate show good agreement with experimental data obtained using low collision voltages.

  8. Structure, stability, and fragmentation of sodium bis(2-ethylhexyl)sulfosuccinate negatively charged aggregates in vacuo by MD simulations.

    PubMed

    Longhi, Giovanna; Abbate, Sergio; Ceselli, Alberto; Ceraulo, Leopoldo; Fornili, Sandro L; Turco Liveri, Vincenzo

    2014-09-01

    Negatively charged supramolecular aggregates formed in vacuo by n bis(2-ethylhexyl)sulfosuccinate (AOT(-)) anions and n + n(c) sodium counterions (i.e., [AOT(n) Na(n+nc)](nc)) have been investigated by molecular dynamics (MD) simulations for n = 1 to 20 and n(c) = -1 to -5. By comparing the maximum excess charge values of negatively and positively charged AOTNa aggregates, it is found that the charge storage capability is higher for the latter systems, the difference decreasing as the aggregation number increases. Statistical analysis of physical properties like gyration radii and moment of inertia tensors of aggregates provides detailed information on their structural properties. Even for n(c) = -5, all stable aggregates show a reverse micelle-like structure with an internal core, including sodium counterions and surfactant polar heads, surrounded by an external layer consisting of the surfactant alkyl chains. Interestingly, the reverse micelle-like structure is retained also in proximity of fragmentation. Moreover, the aggregate shapes may be approximated by elongated ellipsoids whose longer axis increases with n and |n(c)|. The fragmentation patterns of a number of these aggregates have also been examined and have been found to markedly depend on the aggregate charge state. The simulated fragmentation patterns of a representative aggregate show good agreement with experimental data obtained using low collision voltages. PMID:24969925

  9. Binding of the Cationic Peptide (KL)4K to Lipid Monolayers at the Air-Water Interface: Effect of Lipid Headgroup Charge, Acyl Chain Length, and Acyl Chain Saturation.

    PubMed

    Hädicke, André; Blume, Alfred

    2016-04-28

    The binding of the cationic peptide (KL)4K to monolayers of different anionic lipids was determined by adsorption experiments. The chemical structure of the anionic phospholipids was changed in different ways. First, the hydrophobic region of phosphatidylglycerols was altered by elongation of the acyl chain length. Second, an unsaturated chain was introduced. Third, lipids with negatively charged headgroups of different chemical structure were compared. (KL)4K itself shows no surface activity and does not bind to monolayers of zwitterionic lipids. Analysis of (KL)4K binding to anionic lipid monolayers reveals a competition between two binding processes: (i) incorporation of the peptide into the acyl chain region (surface pressure increase) and (ii) electrostatic interaction screening the negative charges with reduction of charge repulsion (surface pressure decrease due to monolayer condensation). The lipid acyl chain length and the chemical structure of the headgroup have minor effects on the binding properties. However, a strong dependence on the phase state of the monolayer was observed. In the liquid-expanded (LE) phase, the fluid monolayer provides enough space, so that peptide insertion due to hydrophobic interactions dominates. For monolayers in the liquid-condensed (LC) phase, peptide binding followed by monolayer condensation is the main effect. PMID:27049846

  10. Negligible "negative space-charge layer effects" at oxide-electrolyte/electrode interfaces of thin-film batteries.

    PubMed

    Haruta, Masakazu; Shiraki, Susumu; Suzuki, Tohru; Kumatani, Akichika; Ohsawa, Takeo; Takagi, Yoshitaka; Shimizu, Ryota; Hitosugi, Taro

    2015-03-11

    In this paper, we report the surprisingly low electrolyte/electrode interface resistance of 8.6 Ω cm(2) observed in thin-film batteries. This value is an order of magnitude smaller than that presented in previous reports on all-solid-state lithium batteries. The value is also smaller than that found in a liquid electrolyte-based batteries. The low interface resistance indicates that the negative space-charge layer effects at the Li3PO(4-x)N(x)/LiCoO2 interface are negligible and demonstrates that it is possible to fabricate all-solid state batteries with faster charging/discharging properties. PMID:25710500

  11. Interaction of the Tim44 C-terminal domain with negatively charged phospholipids.

    PubMed

    Marom, Milit; Safonov, Roman; Amram, Shay; Avneon, Yoav; Nachliel, Esther; Gutman, Menachem; Zohary, Keren; Azem, Abdussalam; Tsfadia, Yossi

    2009-12-01

    The translocation of proteins from the cytosol into the mitochondrial matrix is mediated by the coordinated action of the TOM complex in the outer membrane, as well as the TIM23 complex and its associated protein import motor in the inner membrane. The focus of this work is the peripheral inner membrane protein Tim44. Tim44 is a vital component of the mitochondrial protein translocation motor that anchors components of the motor to the TIM23 complex. For this purpose, Tim44 associates with the import channel by direct interaction with the Tim23 protein. Additionally, it was shown in vitro that Tim44 associates with acidic model membranes, in particular those containing cardiolipin. The latter interaction was shown to be mediated by the carboxy-terminal domain of Tim44 [Weiss, C., et al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96, 8890-8894]. The aim of this study was to determine the precise recognition site for negative lipids in the C-terminal domain of Tim44. In particular, we wanted to examine the recently suggested hypothesis that acidic phospholipids associate with Tim44 via a hydrophobic cavity that is observed in the high-resolution structure of the C-terminal domain of the protein [Josyula, R., et al. (2006) J. Mol. Biol. 359, 798-804]. Molecular dynamics simulations suggest that (i) the hydrophobic tail of lipids may interact with Tim44 via the latter's hydrophobic cavity and (ii) a region, located in the N-terminal alpha-helix of the C-terminal domain (helices A1 and A2), may serve as a membrane attachment site. To validate this assumption, N-terminal truncations of yeast Tim44 were examined for their ability to bind cardiolipin-containing phospholipid vesicles. The results indicate that removal of the N-terminal alpha-helix (helix A1) abolishes the capacity of Tim44 to associate with cardiolipin-containing liposomes. We suggest that helices A1 and A2, in Tim44, jointly promote the association of the protein with acidic phospholipids. PMID:19863062

  12. Negative-U carbon vacancy in 4H-SiC: Assessment of charge correction schemes and identification of the negative carbon vacancy at the quasicubic site

    NASA Astrophysics Data System (ADS)

    Trinh, X. T.; Szász, K.; Hornos, T.; Kawahara, K.; Suda, J.; Kimoto, T.; Gali, A.; Janzén, E.; Son, N. T.

    2013-12-01

    The carbon vacancy (VC) has been suggested by different studies to be involved in the Z1/Z2 defect-a carrier lifetime killer in SiC. However, the correlation between the Z1/Z2 deep level with VC is not possible since only the negative carbon vacancy (VC-) at the hexagonal site, VC-(h), with unclear negative-U behaviors was identified by electron paramagnetic resonance (EPR). Using freestanding n-type 4H-SiC epilayers irradiated with low energy (250 keV) electrons at room temperature to introduce mainly VC and defects in the C sublattice, we observed the strong EPR signals of VC-(h) and another S = 1/2 center. Electron paramagnetic resonance experiments show a negative-U behavior of the two centers and their similar symmetry lowering from C3v to C1h at low temperatures. Comparing the 29Si and 13C ligand hyperfine constants observed by EPR and first principles calculations, the new center is identified as VC-(k). The negative-U behavior is further confirmed by large scale density functional theory supercell calculations using different charge correction schemes. The results support the identification of the lifetime limiting Z1/Z2 defect to be related to acceptor states of the carbon vacancy.

  13. Positive and negative singly charged ion production of a laser induced plasma using a capillary graphite target.

    PubMed

    Saquilayan, G Q; Wada, M

    2016-02-01

    A new type of laser ion source is being developed aiming at the production of positive and negative singly charged ions using a capillary graphite target structure. The initial results of the laser plasma produced inside of the 10 mm diameter conduit indicated the formation of the secondary charged particle production inside the target. A high speed camera clearly recorded the plasma plume expansion inside the target. The time-of-flight spectrum of the laser produced plasma in vacuum showed that the signal of the positive ions formed two peaks as the laser power density exceeded 10 GW/cm(2). The addition of neutral gas to the system produced a signal corresponding to negative ions after the positive signal. PMID:26931968

  14. Involvement of I2-imidazoline binding sites in positive and negative morphine analgesia modulatory effects.

    PubMed

    Gentili, Francesco; Cardinaletti, Claudia; Carrieri, Antonio; Ghelfi, Francesca; Mattioli, Laura; Perfumi, Marina; Vesprini, Cristian; Pigini, Maria

    2006-12-28

    Some studies, suggesting the involvement of I(2)-imidazoline binding sites (I(2)-IBS) in morphine analgesia modulation, prompted us to examine on mice antinociceptive assays the effect produced by 1 (phenyzoline), that in view of its high I(2)-IBS affinity and high I(2)-IBS selectivity with regard to I(1)-IBS, alpha(2)-adrenoreceptors and mu-opioid receptors might be considered the first interesting I(2)-IBS ligand. The study was also applied to its ortho phenyl derivative 2 (diphenyzoline), designed and prepared in order to produce a possible modification of the biological profile of 1. Diphenyzoline (2) retains a significant I(2)-IBS selectivity with regard to I(1)-IBS, alpha(2)-adrenoreceptors and mu-opioid receptors. Moreover, by the functional assays 1 and 2 proved inactive at all alpha(2)-adrenoreceptors subtypes up to 10(-3) M. As expected, phenyzoline and diphenyzoline, which are structurally related, highlighted an interesting "positive" or "negative", respectively, morphine analgesia modulatory effect. In fact, 1 (s.c. 10 mg/kg) enhanced morphine analgesia (60% and 40% in mouse tail-flick and mouse hot-plate, respectively), while 2 (s.c. 10 mg/kg) decreased it (-41% and -20%, respectively). The ability to decrease morphine analgesia had never been observed before in I(2)-IBS ligands. These effects were not affected by i.p. treatment of animals with yohimbine (a selective alpha(2)-adrenoreceptor antagonist, 0.625 mg/kg) or efaroxan (an I(1)-IBS/alpha(2)-adrenoreceptor antagonist, 1.0 mg/kg). In contrast, they were completely reversed by i.p. treatment of animals with idazoxan (an I(2)-IBS/alpha(2)-adrenoreceptor antagonist, 2 mg/kg). Moreover, compound 2, in mouse tail-flick test, was able to potentiate by 23% the naloxone-induced decrease of morphine analgesia. Therefore, the results of this study indicate the crucial involvement of I(2)-IBS in the morphine analgesia modulatory effects of 1 and 2. PMID:17081513

  15. CHARGE MEASUREMENTS ON INDIVIDUAL PARTICLES EXITING LABORATORY PRECIPITATORS WITH POSITIVE AND NEGATIVE CORONA AT VARIOUS TEMPERATURES

    EPA Science Inventory

    The paper reports measurements of charge values on individual particles exiting three different laboratory electrostatic precipitators (ESPs) in an experimental apparatus containing a Millikan cell. Dioctylphthalate (DOP) droplets and fly ash particles were measured at temperatur...

  16. Spatial distribution of the charged particles and potentials during beam extraction in a negative-ion source

    SciTech Connect

    Tsumori, K.; Nakano, H.; Kisaki, M.; Ikeda, K.; Nagaoka, K.; Osakabe, M.; Takeiri, Y.; Kaneko, O.; Shibuya, M.; Asano, E.; Kondo, T.; Sato, M.; Komada, S.; Sekiguchi, H.; Kameyama, N.; Fukuyama, T.; Wada, S.; Hatayama, A.

    2012-02-15

    We report on the characteristics of the electronegative plasma in a large-scale hydrogen negative ion (H{sup -}) source. The measurement has been made with a time-resolved Langmuir probe installed in the beam extraction region. The H{sup -} density is monitored with a cavity ring-down system to identify the electrons in the negative charges. The electron-saturation current decreases rapidly after starting to seed Cs, and ion-ion plasma is observed in the extraction region. The H{sup -} density steps down during the beam extraction and the electron density jumps up correspondingly. The time integral of the decreasing H{sup -} charge density agrees well with the electron charge collected with the probe. The agreement of the charges is interpreted to indicate that the H{sup -} density decreasing at the beam extraction is compensated by the electrons diffusing from the driver region. In the plasmas with very low electron density, the pre-sheath of the extraction field penetrates deeply inside the plasmas. That is because the shielding length in those plasmas is longer than that in the usual electron-ion plasmas, and furthermore the electrons are suppressed to diffuse to the extraction region due to the strong magnetic field.

  17. Negative superhelicity promotes ATP-dependent binding of yeast RAD3 protein to ultraviolet-damaged DNA.

    PubMed

    Sung, P; Watkins, J F; Prakash, L; Prakash, S

    1994-03-18

    The RAD3 gene of Saccharomyces cerevisiae is required for excision repair of UV-damaged DNA and is essential for cell viability. Remarkable homology exists between RAD3 and the human excision repair gene XPD, whose mutational inactivation underlies the cancer-prone disorder in xeroderma pigmentosum group D patients. Our previous work demonstrated that RAD3-encoded protein contains a DNA helicase activity. Here, we show that RAD3 binds preferentially to UV-damaged DNA over nondamaged DNA. Removal of pyrimidine dimers from damaged DNA by enzymatic photoreactivation does not affect binding, suggesting an affinity of RAD3 for pyrimidine (6-4) pyrimidone photoproducts. Damage-specific binding by RAD3 is strongly dependent on ATP and on the degree of negative superhelicity in DNA. The requirement of superhelicity in damage binding may target RAD3 to regions of DNA undergoing transcription, resulting in the preferential repair of these regions. The rad3 Arg-48 mutant protein, which lacks the DNA helicase activity, also binds UV-damaged DNA preferentially, indicating that DNA helicase and damage binding are two distinct and separable functional entities in RAD3. PMID:8132553

  18. Shotgun Metabolomics Approach for the Analysis of Negatively Charged Water-Soluble Cellular Metabolites from Mouse Heart Tissue

    PubMed Central

    Sun, Gang; Yang, Kui; Zhao, Zhongdan; Guan, Shaoping; Han, Xianlin; Gross, Richard W.

    2010-01-01

    A shotgun metabolomics approach using MALDI-TOF/TOF mass spectrometry was developed for the rapid analysis of negatively charged water-soluble cellular metabolites. Through the use of neutral organic solvents to inactivate endogenous enzyme activities (i.e., methanol/chloroform/H2O extraction), in conjunction with a matrix having minimal background noise (9-amnioacridine), a set of multiplexed conditions was developed that allowed identification of 285 peaks corresponding to negatively charged metabolites from mouse heart extracts. Identification of metabolite peaks was based on mass accuracy and was confirmed by tandem mass spectrometry for 90 of the identified metabolite peaks. Through multiplexing ionization conditions, new suites of metabolites could be ionized and “spectrometric isolation” of closely neighboring peaks for subsequent tandem mass spectrometric interrogation could be achieved. Moreover, assignments of ions from isomeric metabolites and quantitation of their relative abundance was achieved in many cases through tandem mass spectrometry by identification of diagnostic fragmentation ions (e.g., discrimination of ATP from dGTP). The high sensitivity of this approach facilitated the detection of extremely low abundance metabolites including important signaling metabolites such as IP3, cAMP, and cGMP. Collectively, these results identify a multiplexed MALDI-TOF/TOF MS approach for analysis of negatively charged metabolites in mammalian tissues. PMID:17665876

  19. Mass Spectrometry Study of Multiply Negatively Charged, Gas-Phase NaAOT Micelles: How Does Charge State Affect Micellar Structure and Encapsulation?

    NASA Astrophysics Data System (ADS)

    Fang, Yigang; Liu, Fangwei; Liu, Jianbo

    2013-01-01

    We report the formation and characterization of multiply negatively charged sodium bis(2-ethylhexyl) sulfosuccinate (NaAOT) aggregates in the gas phase, by electrospray ionization of methanol/water solution of NaAOT followed by detection using a guided-ion-beam tandem mass spectrometer. Singly and doubly charged aggregates dominate the mass spectra with the compositions of [Nan-zAOTn]z- ( n = 1-18 and z = 1-2). Solvation by water was detected only for small aggregates [Nan-1AOTnH2O]- of n = 3-9. Incorporation of glycine and tryptophan into [Nan-zAOTn]z- aggregates was achieved, aimed at identifying effects of guest molecule hydrophobicity on micellar solubilization. Only one glycine molecule could be incorporated into each [Nan-zAOTn]z- of n ≥ 7, and at most two glycine molecules could be hosted in that of n ≥ 13. In contrast to glycine, up to four tryptophan molecules could be accommodated within single aggregates of n ≥ 6. However, deprotonation of tryptophan significantly decrease its affinity towards aggregates. Collision-induced dissociation (CID) was carried out for mass-selected aggregate ions, including measurements of product ion mass spectra for both empty and amino acid-containing aggregates. CID results provide a probe for aggregate structures, surfactant-solute interactions, and incorporation sites of amino acids. The present data was compared with mass spectrometry results of positively charged [Nan+zAOTn]z+ aggregates. Contrary to their positive analogues, which form reverse micelles, negatively charged aggregates may adopt a direct micelle-like structure with AOT polar heads exposed and amino acids being adsorbed near the micellar outer surface.

  20. Mass spectrometry study of multiply negatively charged, gas-phase NaAOT micelles: how does charge state affect micellar structure and encapsulation?

    PubMed

    Fang, Yigang; Liu, Fangwei; Liu, Jianbo

    2013-01-01

    We report the formation and characterization of multiply negatively charged sodium bis(2-ethylhexyl) sulfosuccinate (NaAOT) aggregates in the gas phase, by electrospray ionization of methanol/water solution of NaAOT followed by detection using a guided-ion-beam tandem mass spectrometer. Singly and doubly charged aggregates dominate the mass spectra with the compositions of [Na(n-z)AOT(n)](z-) (n = 1-18 and z = 1-2). Solvation by water was detected only for small aggregates [Na(n-1)AOT(n)H(2)O](-) of n = 3-9. Incorporation of glycine and tryptophan into [Na(n-z)AOT(n)](z-) aggregates was achieved, aimed at identifying effects of guest molecule hydrophobicity on micellar solubilization. Only one glycine molecule could be incorporated into each [Na(n-z)AOT(n)](z-) of n ≥ 7, and at most two glycine molecules could be hosted in that of n ≥ 13. In contrast to glycine, up to four tryptophan molecules could be accommodated within single aggregates of n ≥ 6. However, deprotonation of tryptophan significantly decrease its affinity towards aggregates. Collision-induced dissociation (CID) was carried out for mass-selected aggregate ions, including measurements of product ion mass spectra for both empty and amino acid-containing aggregates. CID results provide a probe for aggregate structures, surfactant-solute interactions, and incorporation sites of amino acids. The present data was compared with mass spectrometry results of positively charged [Na(n+z)AOT(n)](z+) aggregates. Contrary to their positive analogues, which form reverse micelles, negatively charged aggregates may adopt a direct micelle-like structure with AOT polar heads exposed and amino acids being adsorbed near the micellar outer surface. PMID:23247969

  1. Identification of negative transcriptional factor E4BP4-binding site in the mouse circadian-regulated gene Mdr2.

    PubMed

    Kotaka, Maki; Onishi, Yoshiaki; Ohno, Tomoya; Akaike, Toshihiro; Ishida, Norio

    2008-03-01

    The hepatic transporter Mdr2 is an ATP-binding cassette transporter which excretes phosphatidylcholine into the bile. We showed that the level of Mdr2 mRNA oscillated in circadian fashion in mouse liver whereas such oscillation was dampened in the liver of Clock mutants. To examine transcriptional regulation of the Mdr2 gene we performed luciferase reporter assays using plasmid constructs containing the 5'-flanking region of the Mdr2 gene. Reporter assays using deletion constructs demonstrated that E4BP4 represses the transcriptional activity of the promoter including the D1 and D2 sites within four putative E4BP4-binding sites. Chromatin immunoprecipitation and gel shift assays showed that E4BP4 binds to the D2 site, but not to the D1 site. These data suggested that E4BP4 is a negative transcription factor for circadian Mdr2 mRNA expression. PMID:18242748

  2. REVISED BIG BANG NUCLEOSYNTHESIS WITH LONG-LIVED, NEGATIVELY CHARGED MASSIVE PARTICLES: UPDATED RECOMBINATION RATES, PRIMORDIAL {sup 9}Be NUCLEOSYNTHESIS, AND IMPACT OF NEW {sup 6}Li LIMITS

    SciTech Connect

    Kusakabe, Motohiko; Kim, K. S.; Cheoun, Myung-Ki; Kajino, Toshitaka; Kino, Yasushi; Mathews, Grant J. E-mail: kyungsik@kau.ac.kr E-mail: kajino@nao.ac.jp E-mail: gmathews@nd.edu

    2014-09-01

    We extensively reanalyze the effects of a long-lived, negatively charged massive particle, X {sup –}, on big bang nucleosynthesis (BBN). The BBN model with an X {sup –} particle was originally motivated by the discrepancy between the {sup 6,} {sup 7}Li abundances predicted in the standard BBN model and those inferred from observations of metal-poor stars. In this model, {sup 7}Be is destroyed via the recombination with an X {sup –} particle followed by radiative proton capture. We calculate precise rates for the radiative recombinations of {sup 7}Be, {sup 7}Li, {sup 9}Be, and {sup 4}He with X {sup –}. In nonresonant rates, we take into account respective partial waves of scattering states and respective bound states. The finite sizes of nuclear charge distributions cause deviations in wave functions from those of point-charge nuclei. For a heavy X {sup –} mass, m{sub X} ≳ 100 GeV, the d-wave → 2P transition is most important for {sup 7}Li and {sup 7,} {sup 9}Be, unlike recombination with electrons. Our new nonresonant rate of the {sup 7}Be recombination for m{sub X} = 1000 GeV is more than six times larger than the existing rate. Moreover, we suggest a new important reaction for {sup 9}Be production: the recombination of {sup 7}Li and X {sup –} followed by deuteron capture. We derive binding energies of X nuclei along with reaction rates and Q values. We then calculate BBN and find that the amount of {sup 7}Be destruction depends significantly on the charge distribution of {sup 7}Be. Finally, updated constraints on the initial abundance and the lifetime of the X {sup –} are derived in the context of revised upper limits to the primordial {sup 6}Li abundance. Parameter regions for the solution to the {sup 7}Li problem and the primordial {sup 9}Be abundances are revised.

  3. Revised Big Bang Nucleosynthesis with Long-lived, Negatively Charged Massive Particles: Updated Recombination Rates, Primordial 9Be Nucleosynthesis, and Impact of New 6Li Limits

    NASA Astrophysics Data System (ADS)

    Kusakabe, Motohiko; Kim, K. S.; Cheoun, Myung-Ki; Kajino, Toshitaka; Kino, Yasushi; Mathews, Grant. J.

    2014-09-01

    We extensively reanalyze the effects of a long-lived, negatively charged massive particle, X -, on big bang nucleosynthesis (BBN). The BBN model with an X - particle was originally motivated by the discrepancy between the 6, 7Li abundances predicted in the standard BBN model and those inferred from observations of metal-poor stars. In this model, 7Be is destroyed via the recombination with an X - particle followed by radiative proton capture. We calculate precise rates for the radiative recombinations of 7Be, 7Li, 9Be, and 4He with X -. In nonresonant rates, we take into account respective partial waves of scattering states and respective bound states. The finite sizes of nuclear charge distributions cause deviations in wave functions from those of point-charge nuclei. For a heavy X - mass, mX >~ 100 GeV, the d-wave → 2P transition is most important for 7Li and 7, 9Be, unlike recombination with electrons. Our new nonresonant rate of the 7Be recombination for mX = 1000 GeV is more than six times larger than the existing rate. Moreover, we suggest a new important reaction for 9Be production: the recombination of 7Li and X - followed by deuteron capture. We derive binding energies of X nuclei along with reaction rates and Q values. We then calculate BBN and find that the amount of 7Be destruction depends significantly on the charge distribution of 7Be. Finally, updated constraints on the initial abundance and the lifetime of the X - are derived in the context of revised upper limits to the primordial 6Li abundance. Parameter regions for the solution to the 7Li problem and the primordial 9Be abundances are revised.

  4. Evidence for a Negative Cooperativity between eIF5A and eEF2 on Binding to the Ribosome

    PubMed Central

    Galvão, Fabio C.; Boldrin, Paulo E. G.; Hershey, John W. B.; Zanelli, Cleslei F.; Fraser, Christopher S.; Valentini, Sandro R.

    2016-01-01

    eIF5A is the only protein known to contain the essential and unique amino acid residue hypusine. eIF5A functions in both translation initiation due to its stimulation of methionyl-puromycin synthesis and translation elongation, being highly required for peptide-bound formation of specific ribosome stalling sequences such as poly-proline. The functional interaction between eIF5A, tRNA, and eEF2 on the surface of the ribosome is further clarified herein. Fluorescence anisotropy assays were performed to determine the affinity of eIF5A to different ribosomal complexes and reveal its interaction exclusively and directly with the 60S ribosomal subunit in a hypusine-dependent manner (Ki60S-eIF5A-Hyp = 16 nM, Ki60S-eIF5A-Lys = 385 nM). A 3-fold increase in eIF5A affinity to the 80S is observed upon charged-tRNAiMet binding, indicating positive cooperativity between P-site tRNA binding and eIF5A binding to the ribosome. Previously identified conditional mutants of yeast eIF5A, eIF5AQ22H/L93F and eIF5AK56A, display a significant decrease in ribosome binding affinity. Binding affinity between ribosome and eIF5A-wild type or mutants eIF5AK56A, but not eIF5AQ22H/L93F, is impaired in the presence of eEF2 by 4-fold, consistent with negative cooperativity between eEF2 and eIF5A binding to the ribosome. Interestingly, high-copy eEF2 is toxic only to eIF5AQ22H/L93F and causes translation elongation defects in this mutant. These results suggest that binding of eEF2 to the ribosome alters its conformation, resulting in a weakened affinity of eIF5A and impairment of this interplay compromises cell growth due to translation elongation defects. PMID:27115996

  5. Roles of negatively-charged heavy ions and nonextensivity in cylindrical and spherical dust-ion-acoustic shock waves

    NASA Astrophysics Data System (ADS)

    Ema, S. A.; Ferdousi, M.; Sultana, S.; Mamun, A. A.

    2015-06-01

    A rigorous theoretical investigation has been carried out on the propagation of nonplanar (cylindrical and spherical) dust-ion-acoustic (DIA) waves in an unmagnetized dusty multi-ion plasma system containing nonextensive electrons, inertial negatively-charged heavy ions, positively-charged Maxwellian light ions, and negatively-charged stationary dust. The well-known reductive perturbation technique has been used to derive the modified Burgers-type equation (which describes the shock wave's properties), and its numerical solution is obtained. The basic features (viz. polarity, amplitude, width, etc.) of the cylindrical and the spherical DIA shock waves are investigated. The basic features of the cylindrical and the spherical DIA shock waves are found to have been significantly modified in a way that depends on the intrinsic parameters (viz. electron nonextensivity, heavy-ion's kinematic viscosity, heavy-to-light-ion number density ratio, electron-to-light-ion temperature ratio, etc.) of the considered plasma system. The characteristics of the cylindrical and the spherical DIA shock waves are observed to be qualitatively different from those of planar ones.

  6. A modified QM/MM Hamiltonian with the Self-Consistent-Charge Density-Functional-Tight-Binding Theory for highly charged QM regions

    PubMed Central

    Hou, Guanhua; Zhu, Xiao; Elstner, Marcus; Cui, Qiang

    2012-01-01

    To improve the description of electrostatic interaction between QM and MM atoms when the QM is SCC-DFTB, we adopt a Klopman-Ohno (KO) functional form which considers the finite size of the QM and MM charge distributions. Compared to the original implementation that used a simple Coulombic interaction between QM Mulliken and MM point charges, the KO based QM/MM scheme takes charge penetration effect into consideration and therefore significantly improves the description of QM/MM interaction at short range, especially when the QM region is highly charged. To be consistent with the third-order formulation of SCC-DFTB, the Hubbard parameter in the KO functional is dependent on the QM charge. As a result, the effective size of the QM charge distribution naturally adjusts as the QM region undergoes chemical transformations, making the KO based QM/MM scheme particularly attractive for describing chemical reactions in the condensed phase. Together with the van der Waals parameters for the QM atom, the KO based QM/MM model introduces four parameters for each element type. They are fitted here based on microsolvation models of small solutes, focusing on negatively charged molecular ions, for elements O, C, H and P with a specific version of SCC-DFTB (SCC-DFTBPR). Test calculations confirm that the KO based QM/MM scheme significantly improves the interactions between QM and MM atoms over the original point charge based model and it is transferable due to the small number of parameters. The new form of QM/MM Hamiltonian will greatly improve the applicability of SCC-DFTB based QM/MM methods to problems that involve highly charged QM regions, such as enzyme catalyzed phosphoryl transfers. PMID:23275762

  7. Preparation and chromatographic evaluation of zwitterionic stationary phases with controllable ratio of positively and negatively charged groups.

    PubMed

    Cheng, Xiao-Dong; Hao, Yan-Hong; Peng, Xi-Tian; Yuan, Bi-Feng; Shi, Zhi-Guo; Feng, Yu-Qi

    2015-08-15

    The present study described the preparation and application of zwitterionic stationary phases (ACS) with controllable ratio of positively charged tertiary amine groups and negatively charged carboxyl groups. Various parameters, including water content, pH values and ionic strength of the mobile phase, were investigated to study the chromatographic characteristics of ACS columns. The prepared ACS columns demonstrated a mix-mode retention mechanism composed of surface adsorption, partitioning and electrostatic interactions. The elemental analysis of different batches of the ACS phases demonstrated good reproducibility of the preparation strategy. Additionally, various categories of compounds, including nucleosides, water-soluble vitamins, benzoic acid derivatives and basic compounds were successively employed to evaluate the separation selectivity of the prepared ACS stationary phases. These ACS phases exhibited entirely different selectivity and retention behavior from each other for various polar analytes, demonstrating the excellent application potential in the analysis of polar compounds in HILIC. PMID:25966373

  8. Binding energy of (Lambda)He-7 and test of charge symmetry breaking in the Lambda N interaction potential

    SciTech Connect

    Hashimoto, O; Honda, D; Kaneta, M; Kato, F; Kawama, D; Maruyama, N; Matsumura, A; Nakamura, S N; Nomura, H; Nonaka, K; Ohtani, A; Okayasu, Y; Osaka, M; Oyamada, M; Sumihama, M; Tamura, H; Baker, O K; Cole, L; Christy, M; Gueye, P; Keppel, C; Tang, L; Yuan, L; Acha, A; Baturin, P; Boeglin, W; Kramer, L; Markowitz, P; Pamela, P; Perez, N; Raue, B; Reinhold, J; Rivera, R; Kato, S; Sato, Y; Takahashi, T; Daniel, A; Hungerford, Ed V; Ispiryan, M; Kalantarians, N; Lan, K J; Li, Y; Miyoshi, T; Randeniya, S; Rodriguez, V M; Bosted, P; Carlini, R; Ent, R; Fenker, H; Gaskell, D; Jones, M; Mack, D; Roche, J; Smith, G; Tvaskis, V; Vulcan, W; Wood, S; Yan, C; Asaturyan, A; Asaturyan, R; Egiyan, K; Mkrtchyan, H; Margaryan, A; Navasardyan, T; Tadevosyan, V; Zamkochian, S; Hu, B; Song, Y; Luo, W; Androic, D; Furic, M; Petkovic, T; Seva, T; Ahmidouch, A; Danagoulian, S; Gasparian, A; Halkyard, R; Johnson, K; Simicevic, N; Wells, S; Niculescu, G; Niculescu, M I; Gan, L; Benmokhtar, F; Horn, T; Elassar, M; Gibson, E F

    2011-09-01

    The binding energy of 7LambdaHe has been obtained for the first time with reaction spectroscopy using the (e, e'K+) reaction at Jefferson Lab's Hall C. A comparison among the binding energies of the A = 7 T = l iso-triplet hypernuclei, 7LambdaHe, 7LambdaLi*and 7LambdaBe, is made and possible charge symmetry breaking (CSB) in the LambdaN potential is discussed. For 7LambdaHe and 7LambdaBe, the shifts in binding energies are opposite to those predicted by a recent cluster model calculation, which assumes that the unexplained part of the binding energy difference between 4LambdaH and 4LambdaHe, is due to the CSB of the LambdaN potential. Further examination of CSB in light hypernuclear systems is required both experimentally and theoretically.

  9. Increasing binding density of yeast cells by control of surface charge with allylamine grafting to ion modified polymer surfaces.

    PubMed

    Tran, Clara T H; Kondyurin, Alexey; Chrzanowski, Wojciech; Bilek, Marcela M M; McKenzie, David R

    2014-10-01

    Plasma immersion ion implantation (PIII) treatment of polymers creates a biointerface capable of direct covalent immobilization of biomolecules. The immobilization of protein molecules is achieved by covalent bonds formed between embedded radicals on the treated surface and amino acid side chains and cells can be immobilized through cell-wall proteins. The attachment density of negatively charged entities on a PIII treated surface is inhibited by its negative surface charge at neutral pH. To reduce the negative charge of PIII treated surfaces in phosphate buffer (pH 7.4, 11mM), we develop an effective approach of grafting allylamine monomers onto the treated surface. The results reveal reactions between allylamine and radicals on the PIII treated surface. One of these triggers polymerization, increasing the number of amine groups grafted. As a consequence, the PIII treated polystyrene surface after allylamine exposure becomes more hydrophobic and less negatively charged in phosphate buffer. Using yeast cells as an example, we have shown a significant improvement (6-15 times) of cell density immobilized on the PIII treated surface after exposure to allylamine. PMID:25092587

  10. A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat.

    PubMed Central

    Bramblett, D; Hsu, C L; Lozano, M; Earnest, K; Fabritius, C; Dudley, J

    1995-01-01

    The tissue specificity of mouse mammary tumor virus (MMTV) expression is controlled by regulatory elements in the MMTV long terminal repeat (LTR). These regulatory elements include the hormone response element, located approximately between -200 and -75, as well as binding sites for NF-1, Oct-1 (OTF-1), and mammary gland enhancer factors. Naturally occurring MMTV deletion variants isolated from T-cell and kidney tumors, transgenic-mouse experiments with MMTV LTR deletions, and transient transfection assays with LTR constructs indicate that there are additional transcription regulatory elements, including a negative regulatory element (NRE), located upstream of the hormone response element. To further define this regulatory region, we have constructed a series of BAL 31 deletion mutants in the MMTV LTR for use in transient transfection assays. These assays indicated that deletion of two regions (referred to as promoter-distal and -proximal NREs) between -637 and -201 elevated basal MMTV promoter activity in the absence of glucocorticoids. The region between -637 and -264 was surveyed for the presence of nuclear protein binding sites by gel retardation assays. Only one type of protein complex (referred to as NRE-binding protein or NBP) bound exclusively to sites that mapped to the promoter-distal and -proximal NREs identified by BAL 31 mutations. The promoter-proximal binding site was mapped further by linker substitution mutations and transfection assays. Mutations that mapped to a region containing an inverted repeat beginning at -287 relative to the start of transcription elevated basal expression of a reporter gene driven by the MMTV LTR. A 59-bp DNA fragment from the distal NRE also bound the NBP complex. Gel retardation assays showed that mutations within both inverted repeats of the proximal NRE eliminated NBP binding and mutations within single repeats altered NBP binding. Intriguingly, the NBP complex was detected in extracts from T cells and lung cells but

  11. Relationship between the stereoselective negative inotropic effects of verapamil enantiomers and their binding to putative calcium channels in human heart.

    PubMed Central

    Ferry, D. R.; Glossmann, H.; Kaumann, A. J.

    1985-01-01

    Ventricular preparations from patients with mitral disease and hypertrophic obstructive cardiomyopathy (HOCM) were set up to contract isometrically. Ventricular membrane particles were also prepared and putative calcium channels were labelled with [3H]-nimodipine. Positive staircase was induced by varying the rate of stimulation of isolated strips from 6 min-1 to 120 min-1 in the presence of 6-60 microM (-)-adrenaline or (-)-noradrenaline. (-)-Verapamil 3-5 microM or (+)-verapamil 20-30 microM reversed the force-frequency relationship (i.e. caused negative staircase) in preparations from patients with mitral disease or HOCM. In subendocardial strips of ventricular septum from 5 patients with HOCM paced at 60 min-1, both (-)-verapamil and (+)-verapamil caused cardiodepression. Half-maximal cardiodepression was observed with 0.4 microM (-)-verapamil and with 3 microM (+)-verapamil. [3H]-nimodipine bound to ventricular membrane particles in a saturable, reversible fashion to a high affinity site with an equilibrium dissociation constant of 0.23 nM. The density of these sites was 95 fmol mg-1 of membrane protein. Binding of the tritiated 1,4-dihydropyridine was stereoselectively inhibited by 1,4-dihydropyridine enantiomers and nifedipine. (-)-Verapamil and (+)-verapamil inhibited high affinity [3H]-nimodipine binding in a negative heterotropic allosteric manner with (-)-verapamil being 5 times more potent than (+)-verapamil on an IC50 basis. At a given [3H]-nimodipine concentration, (+)-verapamil inhibited a greater fraction of specific [3H]-nimodipine binding. The allosteric mode of (+)-verapamil inhibition of [3H]-nimodipine binding was confirmed by kinetic studies. (-)-Verapamil shifted (+)-verapamil-binding inhibition curves to the right in an apparently competitive fashion. The inversion of staircase caused by both verapamil enantiomers suggests that they cause a use-dependent channel blockade. The similar potency ratios for binding and for cardiodepression are

  12. Negatively charged excitons in semimagnetic CdSe/ZnSe/ZnMnSe quantum dots

    SciTech Connect

    Brichkin, A. S. Chernenko, A. V.; Chekhovich, E. A.; Dorozhkin, P. S.; Kulakovskii, V. D.; Ivanov, S. V.; Toropov, A. A.

    2007-08-15

    Low-temperature (T = 1.6 K) photoluminescence (PL) of individual CdSe/ZnSe/ZnMnSe quantum dots (QDs) with different magnitudes of the sp-d exchange interaction between the magnetic impurity ions and charge carriers has been studied in a magnetic field up to 12 T applied in the Faraday and Voigt geometry. The magnitude of the interaction was controlled by changing the fraction ({eta}{sub e,h}) of the squared wave function of charge carriers in the semimagnetic barrier by means of variation of the nonmagnetic (ZnSe) layer thickness. It is established that the sp-d exchange interaction leads to a change in the sign of the effective hole g factor even for {eta}{sub e,h} {approx} 5%, while further increase in the interaction magnitude is accompanied by a rapid growth in the magnitude of spin splitting for both electrons and holes. The quantum yield of PL exhibits a significant decrease due to nonradiative Auger recombination with the excitation of Mn ions only for {eta}{sub e,h} {approx} 12%, while the rate of the holes spin relaxation starts growing only for still higher {eta}{sub e,h} values. In a strong magnetic field perpendicular to the sample plane, the alignment of Mn spins leads to suppression of the Auger recombination only in the excited spin state. For a small rate of the hole spin relaxation, this leads to a rather unusual result: the emission from an excited trion state predominates in strong magnetic fields.

  13. Fixed negative charge and the Donnan effect: a description of the driving forces associated with brain tissue swelling and oedema.

    PubMed

    Elkin, Benjamin S; Shaik, Mohammed A; Morrison, Barclay

    2010-02-13

    Cerebral oedema or brain tissue swelling is a significant complication following traumatic brain injury or stroke that can increase the intracranial pressure (ICP) and impair blood flow. Here, we have identified a potential driver of oedema: the negatively charged molecules fixed within cells. This fixed charge density (FCD), once exposed, could increase ICP through the Donnan effect. We have shown that metabolic processes and membrane integrity are required for concealing this FCD as slices of rat cortex swelled immediately (within 30 min) following dissection if treated with 2 deoxyglucose + cyanide (2DG+CN) or Triton X-100. Slices given ample oxygen and glucose, however, did not swell significantly. We also found that dead brain tissue swells and shrinks in response to changes in ionic strength of the bathing medium, which suggests that the Donnan effect is capable of pressurizing and swelling brain tissue. As predicted, a non-ionic osmolyte, 1,2 propanediol, elicited no volume change at 2000 x 10(-3) osmoles l(-1) (Osm). Swelling data were well described by triphasic mixture theory with the calculated reference state FCD similar to that measured with a 1,9 dimethylmethylene blue assay. Taken together, these data suggest that intracellular fixed charges may contribute to the driving forces responsible for brain swelling. PMID:20047940

  14. Charge recombination mechanism to explain the negative capacitance in dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Lie-Feng, Feng; Kun, Zhao; Hai-Tao, Dai; Shu-Guo, Wang; Xiao-Wei, Sun

    2016-03-01

    Negative capacitance (NC) in dye-sensitized solar cells (DSCs) has been confirmed experimentally. In this work, the recombination behavior of carriers in DSC with semiconductor interface as a carrier’s transport layer is explored theoretically in detail. Analytical results indicate that the recombination behavior of carriers could contribute to the NC of DSCs under small signal perturbation. Using this recombination capacitance we propose a novel equivalent circuit to completely explain the negative terminal capacitance. Further analysis based on the recombination complex impedance show that the NC is inversely proportional to frequency. In addition, analytical recombination resistance is composed by the alternating current (AC) recombination resistance (Rrac) and the direct current (DC) recombination resistance (Rrdc), which are caused by small-signal perturbation and the DC bias voltage, respectively. Both of two parts will decrease with increasing bias voltage. Project supported by the National Natural Science Foundation of China (Grant Nos. 11204209 and 60876035) and the Natural Science Foundation of Tianjin City, China (Grant No. 13JCZDJC32800).

  15. β-Lactoglobulin (BLG) binding to highly charged cationic polymer-grafted magnetic nanoparticles: effect of ionic strength.

    PubMed

    Qin, Li; Xu, Yisheng; Han, Haoya; Liu, Miaomiao; Chen, Kaimin; Wang, Siyi; Wang, Jie; Xu, Jun; Li, Li; Guo, Xuhong

    2015-12-15

    Poly(2-(methacryloyloxy)ethyltrimethyl ammonium chloride) (PMATAC) modified magnetic nanoparticles (NPs) with a high zeta potential of ca. 50mV were synthesized by atom transfer radical polymerization (ATRP). The prepared NPs consist of a magnetic core around 13nm and a PMATAC shell around 20nm attached on the surface of magnetic nanoparticles. Thermodynamic binding parameters between β-lactoglobulin and these polycationic NPs were investigated at different ionic strengths by high-resolution turbidimetry, dynamic light scattering (DLS), and isothermal titration calorimetry (ITC). Both turbidity and ITC show that binding affinities for BLG display a non-monotonic ionic strength dependence trend and a maximum appears at ionic strength of 50mM. Such observation should arise from the coeffects of protein charge anisotropy visualized by DelPhi electrostatic modeling and the strong electrostatic repulsion among highly charged NPs at a variety of ionic strengths. PMID:26322494

  16. Negative Ion MALDI Mass Spectrometry of Polyoxometalates (POMs): Mechanism of Singly Charged Anion Formation and Chemical Properties Evaluation

    NASA Astrophysics Data System (ADS)

    Boulicault, Jean E.; Alves, Sandra; Cole, Richard B.

    2016-05-01

    MALDI-MS has been developed for the negative ion mode analysis of polyoxometalates (POMs). Matrix optimization was performed using a variety of matrix compounds. A first group of matrixes offers MALDI mass spectra containing abundant intact singly charged anionic adduct ions, as well as abundant in-source fragmentations at elevated laser powers. A relative ranking of the ability to induce POM fragmentation is found to be: DAN > CHCA > CNA > DIT> HABA > DCTB > IAA. Matrixes of a second group provide poorer quality MALDI mass spectra without observable fragments. Sample preparation, including the testing of salt additives, was performed to optimize signals for a model POM, POMc12, the core structure of which bears four negative charges. The matrix 9-cyanoanthracene (CNA) provided the best signals corresponding to singly charged intact POMc12 anions. Decompositions of these intact anionic species were examined in detail, and it was concluded that hydrogen radical-induced mechanisms were not prevalent, but rather that the observed prompt fragments originate from transferred energy derived from initial electronic excitation of the CNA matrix. Moreover, in obtained MALDI mass spectra, clear evidence of electron transfer to analyte POM species was found: a manifestation of the POMs ability to readily capture electrons. The affinity of polyanionic POMc12 toward a variety of cations was evaluated and the following affinity ranking was established: Fe3+ > Al3+ > Li+ > Ga3+ > Co2+ > Cr3+ > Cu2+ > [Mn2+, Mg2+] > [Na+, K+]. Thus, from the available cationic species, specific adducts are preferentially formed, and evidence is given that these higher affinity POM complexes are formed in the gas phase during the early stages of plume expansion.

  17. Negative Ion MALDI Mass Spectrometry of Polyoxometalates (POMs): Mechanism of Singly Charged Anion Formation and Chemical Properties Evaluation

    NASA Astrophysics Data System (ADS)

    Boulicault, Jean E.; Alves, Sandra; Cole, Richard B.

    2016-08-01

    MALDI-MS has been developed for the negative ion mode analysis of polyoxometalates (POMs). Matrix optimization was performed using a variety of matrix compounds. A first group of matrixes offers MALDI mass spectra containing abundant intact singly charged anionic adduct ions, as well as abundant in-source fragmentations at elevated laser powers. A relative ranking of the ability to induce POM fragmentation is found to be: DAN > CHCA > CNA > DIT> HABA > DCTB > IAA. Matrixes of a second group provide poorer quality MALDI mass spectra without observable fragments. Sample preparation, including the testing of salt additives, was performed to optimize signals for a model POM, POMc12, the core structure of which bears four negative charges. The matrix 9-cyanoanthracene (CNA) provided the best signals corresponding to singly charged intact POMc12 anions. Decompositions of these intact anionic species were examined in detail, and it was concluded that hydrogen radical-induced mechanisms were not prevalent, but rather that the observed prompt fragments originate from transferred energy derived from initial electronic excitation of the CNA matrix. Moreover, in obtained MALDI mass spectra, clear evidence of electron transfer to analyte POM species was found: a manifestation of the POMs ability to readily capture electrons. The affinity of polyanionic POMc12 toward a variety of cations was evaluated and the following affinity ranking was established: Fe3+ > Al3+ > Li+ > Ga3+ > Co2+ > Cr3+ > Cu2+ > [Mn2+, Mg2+] > [Na+, K+]. Thus, from the available cationic species, specific adducts are preferentially formed, and evidence is given that these higher affinity POM complexes are formed in the gas phase during the early stages of plume expansion.

  18. Negative Ion MALDI Mass Spectrometry of Polyoxometalates (POMs): Mechanism of Singly Charged Anion Formation and Chemical Properties Evaluation.

    PubMed

    Boulicault, Jean E; Alves, Sandra; Cole, Richard B

    2016-08-01

    MALDI-MS has been developed for the negative ion mode analysis of polyoxometalates (POMs). Matrix optimization was performed using a variety of matrix compounds. A first group of matrixes offers MALDI mass spectra containing abundant intact singly charged anionic adduct ions, as well as abundant in-source fragmentations at elevated laser powers. A relative ranking of the ability to induce POM fragmentation is found to be: DAN > CHCA > CNA > DIT> HABA > DCTB > IAA. Matrixes of a second group provide poorer quality MALDI mass spectra without observable fragments. Sample preparation, including the testing of salt additives, was performed to optimize signals for a model POM, POMc12, the core structure of which bears four negative charges. The matrix 9-cyanoanthracene (CNA) provided the best signals corresponding to singly charged intact POMc12 anions. Decompositions of these intact anionic species were examined in detail, and it was concluded that hydrogen radical-induced mechanisms were not prevalent, but rather that the observed prompt fragments originate from transferred energy derived from initial electronic excitation of the CNA matrix. Moreover, in obtained MALDI mass spectra, clear evidence of electron transfer to analyte POM species was found: a manifestation of the POMs ability to readily capture electrons. The affinity of polyanionic POMc12 toward a variety of cations was evaluated and the following affinity ranking was established: Fe(3+) > Al(3+) > Li(+) > Ga(3+) > Co(2+) > Cr(3+) > Cu(2+) > [Mn(2+), Mg(2+)] > [Na(+), K(+)]. Thus, from the available cationic species, specific adducts are preferentially formed, and evidence is given that these higher affinity POM complexes are formed in the gas phase during the early stages of plume expansion. Graphical Abstract ᅟ. PMID:27142457

  19. Novel ion specificity of a carboxylate cluster Mg(II) binding site: strong charge selectivity and weak size selectivity.

    PubMed

    Needham, J V; Chen, T Y; Falke, J J

    1993-04-01

    Carboxylate cluster Mg(II) binding sites consist of a cluster of side-chain carboxylates, typically 3-4 in number, partially buried in a shallow cleft on the surface of a Mg(II) binding protein. Such clusters are often found in the active sites of enzymes catalyzing phosphochemistry. An example is the phospho-signaling protein CheY of the Escherichia coli chemotaxis pathway, which binds Mg(II) via a cluster of three carboxylates at its phosphorylation site. The present study quantitates both the ion charge and size specificity of the CheY site by measuring the dissociation constants of metal ions from groups Ia, IIa, IIIa, and the lanthanides; these spherical cations provide a range of substrates with incrementally varying charge and radius. The site binds divalent and trivalent cations, but it effectively excludes monovalent cations, including the physiological ions Na(I) and K(I). This charge specificity is in contrast to the site's remarkable lack of size specificity: divalent and trivalent cations exhibit affinities which are essentially independent of radius. It is revealing to compare the ion specificity of the Mg(II) site with the previously characterized specificity of the EF-hand class of Ca(II) sites commonly found in Ca(II) signaling proteins. The Mg(II) and Ca(II) sites exhibit similar charge selectivity, but the Ca(II) site is highly size-selective, preferring divalent and trivalent ions with radii similar to that of Ca(II).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8461299

  20. Ligand binding site of tear lipocalin: contribution of a trigonal cluster of charged residues probed by 8-anilino-1-naphthalenesulfonic acid.

    PubMed

    Gasymov, Oktay K; Abduragimov, Adil R; Glasgow, Ben J

    2008-02-01

    Human tear lipocalin (TL) exhibits diverse functions, most of which are linked to ligand binding. To map the binding site of TL for some amphiphilic ligands, we capitalized on the hydrophobic and hydrophilic properties of 8-anilino-1-naphthalenesulfonic acid (ANS). In single Trp mutants, resonance energy transfer from Trp to ANS indicates that the naphthalene group of ANS is proximate to Leu105 in the cavity. Binding energies of TL to ANS and its analogues reveal contributions from electrostatic interactions. The sulfonate group of ANS interacts strongly with the nonconserved intracavitary residue Lys114 and less with neighboring residues His84 and Glu34. This trigonal cluster of residues may play a role in the ligand recognition site for some negatively charged ligands. Because many drugs possess sulfonate groups, the trigonal cluster-sulfonate interaction can also be exploited as a lipocalin-based drug delivery mechanism. The binding of lauric acid and its analogues shows that fatty acids assume heterogeneous orientations in the cavity of TL. Predominantly, the hydrocarbon tail is buried in the cavity of TL and the carboxyl group is oriented toward the mouth. However, TL can also interact, albeit relatively weakly, with fatty acids oriented in the opposite direction. As the major lipid binding protein of tears, the ability to accommodate fatty acids in two opposing orientations may have functional implications for TL. At the aqueous-lipid interface, fatty acids whose carboxyl groups are positioned toward the aqueous phase are available for interaction with TL that could augment stability of the tear film. PMID:18179255

  1. Ligand Binding Site of Tear Lipocalin: Contribution of a Trigonal Cluster of Charged Residues Probed by 8-Anilino-1-naphthalenesulfonic Acid†

    PubMed Central

    Gasymov, Oktay K.; Abduragimov, Adil R.; Glasgow, Ben J.

    2010-01-01

    Human tear lipocalin (TL) exhibits diverse functions, most of which are linked to ligand binding. To map the binding site of TL for some amphiphilic ligands, we capitalized on the hydrophobic and hydrophilic properties of 8-anilino-1-naphthalenesulfonic acid (ANS). In single Trp mutants, resonance energy transfer from Trp to ANS indicates that the naphthalene group of ANS is proximate to Leu105 in the cavity. Binding energies of TL to ANS and its analogues reveal contributions from electrostatic interactions. The sulfonate group of ANS interacts strongly with the nonconserved intracavitary residue Lys114 and less with neighboring residues His84 and Glu34. This trigonal cluster of residues may play a role in the ligand recognition site for some negatively charged ligands. Because many drugs possess sulfonate groups, the trigonal cluster–sulfonate interaction can also be exploited as a lipocalin-based drug delivery mechanism. The binding of lauric acid and its analogues shows that fatty acids assume heterogeneous orientations in the cavity of TL. Predominantly, the hydrocarbon tail is buried in the cavity of TL and the carboxyl group is oriented toward the mouth. However, TL can also interact, albeit relatively weakly, with fatty acids oriented in the opposite direction. As the major lipid binding protein of tears, the ability to accommodate fatty acids in two opposing orientations may have functional implications for TL. At the aqueous–lipid interface, fatty acids whose carboxyl groups are positioned toward the aqueous phase are available for interaction with TL that could augment stability of the tear film. PMID:18179255

  2. Monte Carlo charge transport and photoemission from negative electron affinity GaAs photocathodes

    NASA Astrophysics Data System (ADS)

    Karkare, Siddharth; Dimitrov, Dimitre; Schaff, William; Cultrera, Luca; Bartnik, Adam; Liu, Xianghong; Sawyer, Eric; Esposito, Teresa; Bazarov, Ivan

    2013-03-01

    High quantum yield, low transverse energy spread, and prompt response time make GaAs activated to negative electron affinity an ideal candidate for a photocathode in high brightness photoinjectors. Even after decades of investigation, the exact mechanism of electron emission from GaAs is not well understood. Here, photoemission from such photocathodes is modeled using detailed Monte Carlo electron transport simulations. Simulations show a quantitative agreement with the experimental results for quantum efficiency, energy distributions of emitted electrons, and response time without the assumption of any ad hoc parameters. This agreement between simulation and experiment sheds light on the mechanism of electron emission and provides an opportunity to design novel semiconductor photocathodes with optimized performance.

  3. Porcine oviduct sperm binding glycoprotein and its deleterious effect on sperm: a mechanism for negative selection of sperm?

    PubMed

    Teijeiro, Juan M; Dapino, Dora G; Marini, Patricia E

    2011-01-01

    In their journey through the oviduct some subpopulations of sperm are preserved in a reservoir, while others are negatively selected. Sperm binding glycoprotein (SBG) is a pig oviductal epithelial cell glycoprotein that produces, under capacitating conditions, acrosome alteration, p97 tyrosine-phosphorylation and reduction of the motility of sperm. In this paper, we show that SBG is accessible at the extracellular surface of the oviductal epithelial cells, supporting a sperm interaction biological role in situ. We analyze the possible dependence of the tyrosine-phosphorylation of p97 on the PKA mechanism, finding that apparently it is not PKA dependent. Also, after SBG treatment the phosphorylated proteins locate mainly at the detached periacrosomal region and at the tail of sperm; the latter may be related to SBG's motility reduction effect. The study of the time course effect of SBG on sperm as detected by chlortetracycline (CTC) staining and of its binding to sperm by immunodetection in conjunction with CTC, shows results in agreement with the hypothesis that this glycoprotein is involved in the alteration of acrosomes in a specific sperm subpopulation. The results suggest that SBG may be part of a mechanism for negative selection of sperm. PMID:22446595

  4. Phosphatidylserine flipping enhances membrane curvature and negative charge required for vesicular transport

    PubMed Central

    Xu, Peng; Baldridge, Ryan D.; Chi, Richard J.; Burd, Christopher G.

    2013-01-01

    Vesicle-mediated protein transport between organelles of the secretory and endocytic pathways is strongly influenced by the composition and organization of membrane lipids. In budding yeast, protein transport between the trans-Golgi network (TGN) and early endosome (EE) requires Drs2, a phospholipid translocase in the type IV P-type ATPase family. However, downstream effectors of Drs2 and specific phospholipid substrate requirements for protein transport in this pathway are unknown. Here, we show that the Arf GTPase-activating protein (ArfGAP) Gcs1 is a Drs2 effector that requires a variant of the ArfGAP lipid packing sensor (+ALPS) motif for localization to TGN/EE membranes. Drs2 increases membrane curvature and anionic phospholipid composition of the cytosolic leaflet, both of which are sensed by the +ALPS motif. Using mutant forms of Drs2 and the related protein Dnf1, which alter their ability to recognize phosphatidylserine, we show that translocation of this substrate to the cytosolic leaflet is essential for +ALPS binding and vesicular transport between the EE and the TGN. PMID:24019533

  5. CCAAT displacement protein (CDP/cut) binds a negative regulatory element in the human tryptophan hydroxylase gene.

    PubMed

    Teerawatanasuk, N; Skalnik, D G; Carr, L G

    1999-01-01

    Tryptophan hydroxylase (TPH) is the rate-limiting enzyme in the biosynthesis of serotonin, a neurotransmitter that has been implicated in many psychiatric illnesses. The mechanism of transcriptional regulation of the human TPH gene is largely unknown. We have identified a negative regulatory element located between nucleotides -310 and -220 in the human TPH (hTPH) gene. Electromobility shift analyses performed with the -310/-220 hTPH probe and nuclear extract from P815-HTR (a TPH-expressing cell line) revealed two slow migrating protein-DNA complexes, designated I and II. CCAAT displacement protein (CDP/Cut) is involved in complex I formation as shown in electromobility shift analysis, using consensus oligonucleotide competitor and antibody. Mutations in the CDP/Cut binding site not only disrupted the CDP-DNA complex but also disrupted the second complex, suggesting that the core binding sequences of the two proteins are overlapping. The functional importance of these protein-DNA interactions was assessed by transiently transfecting wild-type and mutant pTPH/luciferase reporter constructs into P815-HTR cells. Mutations in the core CDP/Cut site resulted in an approximately fourfold increase in relative luciferase activities. Because CDP/Cut has been shown to repress transcription of many target genes, we speculate that disruption of the CDP/Cut binding was responsible, at least in part, for the activation of hTPH gene. PMID:9886051

  6. Lipopolysaccharide-binding protein of Bombyx mori participates in a hemocyte-mediated defense reaction against gram-negative bacteria.

    PubMed

    Koizumi, N; Imai, Y; Morozumi, A; Imamura, M; Kadotani, T; Yaoi, K; Iwahana, H; Sato, R

    1999-09-01

    BmLBP is a lipopolysaccharide-binding protein in B. mori and participates in bacterial clearance in vivo. Here, we investigated the function of BmLBP more specifically. More than 90% of injected gram-negative rough strains to which BmLBP binds were removed from the plasma within 30 min post-injection, whereas it required 8h for the clearance of smooth strains to which BmLBP does not bind. Observation of the hemocoel after the injection of Escherichia coli rough strain showed that melanized nodules were formed at 30 min post-injection when the clearance of injected E. coli cells had occurred. Fluorescence microscope observation revealed that E. coli cells were actually trapped in the nodules formed in vivo. Furthermore, plasma pre-treated E. coli rough cells (BmLBP bound) added to hemocytes isolated in vitro caused vigorous hemocyte aggregations with the bacteria, while plasma pre-treated smooth cells did not. The formation of aggregates was inhibited by anti-BmLBP serum pre-treatment, suggesting that BmLBP causes the clearance of bacteria by promoting hemocyte nodule formation. PMID:12770298

  7. Negatively Charged Metal Oxide Nanoparticles Interact with the 20S Proteasome and Differentially Modulate Its Biologic Functional Effects

    PubMed Central

    Falaschetti, Christine A.; Paunesku, Tatjana; Kurepa, Jasmina; Nanavati, Dhaval; Chou, Stanley S.; De, Mrinmoy; Song, MinHa; Jang, Jung-tak; Wu, Aiguo; Dravid, Vinayak P.; Cheon, Jinwoo; Smalle, Jan; Woloschak, Gayle E.

    2013-01-01

    The multicatalytic ubiquitin-proteasome system (UPS) carries out proteolysis in a highly orchestrated way and regulates a large number of cellular processes. Deregulation of the UPS in many disorders has been documented. In some cases, e.g. carcinogenesis, elevated proteasome activity has been implicated in disease development, while the etiology of other diseases, e.g. neurodegeneration, includes decreased UPS activity. Therefore, agents that alter proteasome activity could suppress as well as enhance a multitude of diseases. Metal oxide nanoparticles, often developed as diagnostic tools, have not previously been tested as modulators of proteasome activity. Here, several types of metal oxide nanoparticles were found to adsorb to the proteasome and show variable preferential binding for particular proteasome subunits with several peptide binding “hotspots” possible. These interactions depend on the size, charge, and concentration of the nanoparticles and affect proteasome activity in a time-dependent manner. Should metal oxide nanoparticles increase proteasome activity in cells, as they do in vitro, unintended effects related to changes in proteasome function can be expected. PMID:23930940

  8. One-step solvothermal synthesis of highly water-soluble, negatively charged superparamagnetic Fe3O4 colloidal nanocrystal clusters

    NASA Astrophysics Data System (ADS)

    Gao, Jining; Ran, Xinze; Shi, Chunmeng; Cheng, Humin; Cheng, Tianmin; Su, Yongping

    2013-07-01

    Highly charged hydrophilic superparamagnetic Fe3O4 colloidal nanocrystal clusters with an average diameter of 195 nm have been successfully synthesized using a modified one-step solvothermal method. Anionic polyelectrolyte poly(4-styrenesulfonic acid-co-maleic acid) sodium salt containing both sulfonate and carboxylate groups was used as the stabilizer. The clusters synthesized under different experimental conditions were characterized with transmission electron microscopy and dynamic light scattering; it was found that the size distribution and water dispersity were significantly affected by the concentration of the polyelectrolyte stabilizer and iron sources in the reaction mixtures. A possible mechanism involving novel gel-like large molecular networks that confined the nucleation and aggregation process was proposed and discussed. The colloidal nanocrystal clusters remained negatively charged in the experimental pH ranges from 2 to 11, and also showed high colloidal stability in phosphate buffered saline (PBS) and ethanol. These highly colloidal stable superparamagnetic Fe3O4 clusters could find potential applications in bioseparation, targeted drug delivery, and photonics.Highly charged hydrophilic superparamagnetic Fe3O4 colloidal nanocrystal clusters with an average diameter of 195 nm have been successfully synthesized using a modified one-step solvothermal method. Anionic polyelectrolyte poly(4-styrenesulfonic acid-co-maleic acid) sodium salt containing both sulfonate and carboxylate groups was used as the stabilizer. The clusters synthesized under different experimental conditions were characterized with transmission electron microscopy and dynamic light scattering; it was found that the size distribution and water dispersity were significantly affected by the concentration of the polyelectrolyte stabilizer and iron sources in the reaction mixtures. A possible mechanism involving novel gel-like large molecular networks that confined the nucleation and

  9. Negative regulation of RNA-binding protein HuR by tumor-suppressor ECRG2.

    PubMed

    Lucchesi, C; Sheikh, M S; Huang, Y

    2016-05-19

    Esophageal cancer-related gene 2 (ECRG2) is a newer tumor suppressor whose function in the regulation of cell growth and apoptosis remains to be elucidated. Here we show that ECRG2 expression was upregulated in response to DNA damage, and increased ECRG2 expression induced growth suppression in cancer cells but not in non-cancerous epithelial cells. ECRG2-mediated growth suppression was associated with activation of caspases and marked reduction in the levels of apoptosis inhibitor, X chromosome-linked inhibitor of apoptosis protein (XIAP). ECRG2, via RNA-binding protein human antigen R (HuR), regulated XIAP mRNA stability and expression. Furthermore, ECRG2 increased HuR ubiquitination and degradation but was unable to modulate the non-ubiquitinable mutant form of HuR. We also identified missense and frame-shift ECRG2 mutations in various human malignancies and noted that, unlike wild-type ECRG2, one cancer-derived ECRG2 mutant harboring glutamic acid instead of valine at position 30 (V30E) failed to induce cell death and activation of caspases. This naturally occurring V30E mutant also did not suppress XIAP and HuR. Importantly, the V30E mutant overexpressing cancer cells acquired resistance against multiple anticancer drugs, thus suggesting that ECRG2 mutations appear to have an important role in the acquisition of anticancer drug resistance in a subset of human malignancies. PMID:26434587

  10. Impact of Multiple Negative Charges on Blood Clearance and Biodistribution Characteristics of 99mTc-Labeled Dimeric Cyclic RGD Peptides

    PubMed Central

    2015-01-01

    This study sought to evaluate the impact of multiple negative charges on blood clearance kinetics and biodistribution properties of 99mTc-labeled RGD peptide dimers. Bioconjugates HYNIC-P6G-RGD2 and HYNIC-P6D-RGD2 were prepared by reacting P6G-RGD2 and P6D-RGD2, respectively, with excess HYNIC-OSu in the presence of diisopropylethylamine. Their IC50 values were determined to be 31 ± 5 and 41 ± 6 nM, respectively, against 125I-echistatin bound to U87MG glioma cells in a whole-cell displacement assay. Complexes [99mTc(HYNIC-P6G-RGD2)(tricine)(TPPTS)] (99mTc-P6G-RGD2) and [99mTc(HYNIC-P6D-RGD2)(tricine)(TPPTS)] (99mTc-P6D-RGD2) were prepared in high radiochemical purity (RCP > 95%) and specific activity (37–110 GBq/μmol). They were evaluated in athymic nude mice bearing U87MG glioma xenografts for their biodistribution. The most significant difference between 99mTc-P6D-RGD2 and 99mTc-P6G-RGD2 was their blood radioactivity levels and tumor uptake. The initial blood radioactivity level for 99mTc-P6D-RGD2 (4.71 ± 1.00%ID/g) was ∼5× higher than that of 99mTc-P6G-RGD2 (0.88 ± 0.05%ID/g), but this difference disappeared at 60 min p.i. 99mTc-P6D-RGD2 had much lower tumor uptake (2.20–3.11%ID/g) than 99mTc-P6G-RGD2 (7.82–9.27%ID/g) over a 2 h period. Since HYNIC-P6D-RGD2 and HYNIC-P6G-RGD2 shared a similar integrin αvβ3 binding affinity (41 ± 6 nM versus 31 ± 5 nM), the difference in their blood activity and tumor uptake is most likely related to the nine negative charges and high protein binding of 99mTc-P6D-RGD2. Despite its low uptake in U87MG tumors, the tumor uptake of 99mTc-P6D-RGD2 was integrin αvβ3-specific. SPECT/CT studies were performed using 99mTc-P6G-RGD2 in athymic nude mice bearing U87MG glioma and MDA-MB-231 breast cancer xenografts. The SPECT/CT data demonstrated the tumor-targeting capability of 99mTc-P6G-RGD2, and its tumor uptake depends on the integrin αvβ3 expression levels on tumor cells and neovasculature. It was concluded that

  11. Cell Type-Specific Activation of AKT and ERK Signaling Pathways by Small Negatively-Charged Magnetic Nanoparticles

    PubMed Central

    Rauch, Jens; Kolch, Walter; Mahmoudi, Morteza

    2012-01-01

    The interaction of nanoparticles (NPs) with living organisms has become a focus of public and scientific debate due to their potential wide applications in biomedicine, but also because of unwanted side effects. Here, we show that superparamagnetic iron oxide NPs (SPIONs) with different surface coatings can differentially affect signal transduction pathways. Using isogenic pairs of breast and colon derived cell lines we found that the stimulation of ERK and AKT signaling pathways by SPIONs is selectively dependent on the cell type and SPION type. In general, cells with Ras mutations respond better than their non-mutant counterparts. Small negatively charged SPIONs (snSPIONs) activated ERK to a similar extent as epidermal growth factor (EGF), and used the same upstream signaling components including activation of the EGF receptor. Importantly, snSPIONs stimulated the proliferation of Ras transformed breast epithelial cells as efficiently as EGF suggesting that NPs can mimic physiological growth factors. PMID:23162692

  12. Excellent passivation of highly doped p-type Si surfaces by the negative-charge-dielectric Al2O3

    NASA Astrophysics Data System (ADS)

    Hoex, B.; Schmidt, J.; Bock, R.; Altermatt, P. P.; van de Sanden, M. C. M.; Kessels, W. M. M.

    2007-09-01

    From lifetime measurements, including a direct experimental comparison with thermal SiO2, a-Si :H, and as-deposited a-SiNx:H, it is demonstrated that Al2O3 provides an excellent level of surface passivation on highly B-doped c-Si with doping concentrations around 1019cm-3. The Al2O3 films, synthesized by plasma-assisted atomic layer deposition and with a high fixed negative charge density, limit the emitter saturation current density of B-diffused p +-emitters to ˜10 and ˜30fA/cm2 on >100 and 54Ω/sq sheet resistance p+-emitters, respectively. These results demonstrate that highly doped p-type Si surfaces can be passivated as effectively as highly doped n-type surfaces.

  13. Cell Type-Specific Activation of AKT and ERK Signaling Pathways by Small Negatively-Charged Magnetic Nanoparticles

    NASA Astrophysics Data System (ADS)

    Rauch, Jens; Kolch, Walter; Mahmoudi, Morteza

    2012-11-01

    The interaction of nanoparticles (NPs) with living organisms has become a focus of public and scientific debate due to their potential wide applications in biomedicine, but also because of unwanted side effects. Here, we show that superparamagnetic iron oxide NPs (SPIONs) with different surface coatings can differentially affect signal transduction pathways. Using isogenic pairs of breast and colon derived cell lines we found that the stimulation of ERK and AKT signaling pathways by SPIONs is selectively dependent on the cell type and SPION type. In general, cells with Ras mutations respond better than their non-mutant counterparts. Small negatively charged SPIONs (snSPIONs) activated ERK to a similar extent as epidermal growth factor (EGF), and used the same upstream signaling components including activation of the EGF receptor. Importantly, snSPIONs stimulated the proliferation of Ras transformed breast epithelial cells as efficiently as EGF suggesting that NPs can mimic physiological growth factors.

  14. Observation of relaxation time of surface charge limit for InGaN photocathodes with negative electron affinity

    NASA Astrophysics Data System (ADS)

    Sato, Daiki; Nishitani, Tomohiro; Honda, Yoshio; Amano, Hiroshi

    2016-05-01

    A thin p-type InGaN with a negative electron affinity (NEA) surface was used to measure the relaxation time of a surface charge limit (SCL) by irradiating rectangular laser beam pulses at changing time interval. The p-type InGaN film was grown by metal organic vapor phase epitaxy and the NEA activation was performed after the sample was heat cleaned. 13 nC per pulse with 10 ms width was obtained from the InGaN photocathode. The current decreased exponentially from the beginning of the pulse. The initial current value after the laser irradiation decreased with the time interval. As a result, the SCL relaxation time was estimated through the InGaN photocathode measurements at 100 ms.

  15. Negatively-charged residues in the polar carboxy-terminal region in FSP27 are indispensable for expanding lipid droplets.

    PubMed

    Tamori, Yoshikazu; Tateya, Sanshiro; Ijuin, Takeshi; Nishimoto, Yuki; Nakajima, Shinsuke; Ogawa, Wataru

    2016-03-01

    FSP27 has an important role in large lipid droplet (LD) formation because it exchanges lipids at the contact site between LDs. In the present study, we clarify that the amino-terminal domain of FSP27 (amino acids 1-130) is dispensable for LD enlargement, although it accelerates LD growth. LD expansion depends on the carboxy-terminal domain of FSP27 (amino acids 131-239). Especially, the negative charge of the acidic residues (D215, E218, E219 and E220) in the polar carboxy-terminal region (amino acids 202-239) is essential for the enlargement of LD. We propose that the carboxy-terminal domain of FSP27 has a crucial role in LD expansion, whereas the amino-terminal domain only has a supportive role. PMID:26921608

  16. Integrating high electrical conductivity and photocatalytic activity in cotton fabric by cationizing for enriched coating of negatively charged graphene oxide.

    PubMed

    Sahito, Iftikhar Ali; Sun, Kyung Chul; Arbab, Alvira Ayoub; Qadir, Muhammad Bilal; Jeong, Sung Hoon

    2015-10-01

    Electroconductive textiles have attended tremendous focus recently and researchers are making efforts to increase conductivity of e-textiles, in order to increase the use of such flexible and low cost textile materials. In this study, surface conductivity and photo catalytic activity of standard cotton fabric (SCF) was enhanced by modifying its surface charge, from negative to positive, using Bovine Serum Albumin (BSA) as a cationic agent, to convert it into cationised cotton fabric (CCF). Then, both types of fabrics were dip coated with a simple dip and dry technique for the adsorption of negatively charged graphene oxide (GO) sheets onto its surface. This resulted in 67.74% higher loading amount of GO on the CCF making self-assembly. Finally, this coating was chemically converted by vapor reduction using hydrazine hydrate to reduced graphene oxide (rGO) for restoration of a high electrical conductivity at the fabric surface. Our results revealed that with such high loading of GO, the surface resistance of CCF was only 40Ω/sq as compared to 510Ω/sq of the SCF and a 66% higher photo catalytic activity was also achieved through cationization for improved GO coating. Graphene coated SCF and CCF were characterized using FE-SEM, FTIR, Raman, UV-vis, WAXD, EDX and XPS spectroscopy to ascertain successful reduction of GO to rGO. The effect of BSA treatment on adsorption of cotton fabric was studied using drop shape analyzer to measure contact angle and for thermal and mechanical resistance, the fabric was tested for TGA and tensile strength, respectively. rGO coated fabric also showed slightly improved thermal stability yet a minor loss of strength was observed. The high flexibility, photocatalytic activity and excellent conductivity of this fabric suggests that it can be used as an electrode material for various applications. PMID:26076630

  17. Exposure to negatively charged-particle dominant air-conditions on human lymphocytes in vitro activates immunological responses.

    PubMed

    Nishimura, Yasumitsu; Takahashi, Kazuaki; Mase, Akinori; Kotani, Muneo; Ami, Kazuhisa; Maeda, Megumi; Shirahama, Takashi; Lee, Suni; Matsuzaki, Hidenori; Kumagai-Takei, Naoko; Yoshitome, Kei; Otsuki, Takemi

    2015-12-01

    Indoor air-conditions may play an important role in human health. Investigation of house conditions that promote health revealed that negatively charged-particle dominant indoor air-conditions (NAC) induced immune stimulation. NAC was established using fine charcoal powder on walls and ceilings and utilizing forced negatively charged particles (approximate diameter: 20 nm) dominant in indoor air-conditions created by applying an electric voltage (72 V) between the backside of the walls and the ground. We reported previously that these conditions induced a slight and significant increase of interleukin-2 during 2.5 h stay, and an increase of natural killer (NK) cell cytotoxicity, when examining human subjects after a two-week night stay under these conditions. In the present study, we investigated whether exposure to NAC in vitro affects immune conditions. Although the concentrations of particles were different, an incubator for cell culture with NAC was set and cellular compositions and functions of various freshly isolated human lymphocytes derived from healthy donors were assayed in the NAC incubator and compared with those of cultures in a standard (STD) incubator. Results showed that NAC cultivation caused an increase of CD25 and PD-1 expressing cells in the CD4 positive fraction, enhancement of NK cell cytotoxicity, production of interferon-y (IFNγ), and slight enhancement of regulatory T cell function. In addition, the formula designated as the "immune-index" clearly differed between STD and NAC culture conditions. Thus, NAC conditions may promote human health through slight activation of the immune system against cancer cells and virus infection as shown by this in vitro study and our previously reported human studies. PMID:26213096

  18. Quantum effects in electron emission from and accretion on negatively charged spherical particles in a complex plasma

    SciTech Connect

    Mishra, S. K.; Sodha, M. S.; Misra, Shikha

    2012-07-15

    The authors have investigated the electron emissions (thermionic, electric field, photoelectric, and light induced field) from and electron accretion on a charged particle in a complex plasma, on the basis of a three region electrical potential model in and around a charged spherical particle in a complex plasma, characterized by Debye shielding. A continuous variation of the transmission coefficient across the surface of a particle (corresponding to emission and accretion) with the radial electron energy {epsilon}{sub r} has been obtained. It is seen that the numerical values of the emission and accretion transmission coefficients [D({epsilon}{sub r})] are almost the same. This is the necessary and sufficient condition for the validity of Saha's equation for thermal equilibrium of a system of dust and electrons. This is in contrast to the earlier condition, which limited the range of validity of Saha's equation to the range of the applicability of Born approximation. It is seen that D({epsilon}{sub r}) increases with increasing {epsilon}{sub r}, increasing negative electric potential on the surface, decreasing radius, and deceasing Debye length. The electron currents, corresponding to thermionic, electric field, photoelectric and light induced field emission increase with increasing surface potential; this fact may have significant repercussions in complex plasma kinetics. Since numerically D({epsilon}{sub r}) is significantly different from unity in the range of {epsilon}{sub r} of interest, it is necessary to take into account the D({epsilon}{sub r})-{epsilon}{sub r} dependence in complex plasma theory.

  19. Channel-forming activity of syringopeptin 25A in mercury-supported phospholipid monolayers and negatively charged bilayers.

    PubMed

    Becucci, Lucia; Toppi, Arianna; Fiore, Alberto; Scaloni, Andrea; Guidelli, Rolando

    2016-10-01

    Interactions of the cationic lipodepsipeptide syringopeptin 25A (SP25A) with mercury-supported dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylserine (DOPS) and dioeleoylphosphatidic acid (DOPA) self-assembled monolayers (SAMs) were investigated by AC voltammetry in 0.1M KCl at pH3, 5.4 and 6.8. SP25A targets and penetrates the DOPS SAM much more effectively than the other SAMs not only at pH6.8, where the DOPS SAM is negatively charged, but also at pH3, where it is positively charged just as SP25A. Similar investigations at tethered bilayer lipid membranes (tBLMs) consisting of a thiolipid called DPTL anchored to mercury, with a DOPS, DOPA or DOPC distal monolayer on top of it, showed that, at physiological transmembrane potentials, SP25A forms ion channels spanning the tBLM only if DOPS is the distal monolayer. The distinguishing chemical feature of the DOPS SAM is the ionic interaction between the protonated amino group of a DOPS molecule and the carboxylate group of an adjacent phospholipid molecule. Under the reasonable assumption that SP25A preferentially interacts with this ion pair, the selective lipodepsipeptide antimicrobial activity against Gram-positive bacteria may be tentatively explained by its affinity for similar protonated amino-carboxylate pairs, which are expected to be present in the peptide moieties of peptidoglycan strands. PMID:27322780

  20. Comparison of positively and negatively charged achiral co-monomers added to cyclodextrin monolith: improved chiral separations in capillary electrochromatography.

    PubMed

    Lu, Yang; Shamsi, Shahab A

    2014-10-01

    Cyclodextrins (CDs) and their derivatives have been one of the most popular and successful chiral additives used in electrokinetic chromatography because of the presence of multiple chiral centers, which leads to multiple chiral interactions. However, there has been relatively less published work on the use of CDs as monolithic media for capillary electrochromatography (CEC). The goal of this study was to show how the addition of achiral co-monomer to a polymerizable CD such as glycidyl methacrylate β-cyclodextrin (GMA/β-CD) can affect the enantioselective separations in monolithic CEC. To achieve this goal, polymeric monoliths columns were prepared by co-polymerizing GMA/β-CD with cationic or anionic achiral co-monomers [(2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) and vinyl benzyltrimethyl-ammonium (VBTA)] in the presence of conventional crosslinker (ethylene dimethacrylate) and ternary porogen system including butanediol, propanol and water. A total of 34 negatively charged compounds, 30 positively charged compounds and 33 neutral compounds were screened to compare the enantioresolution capability on the GMA/β-CD, GMA/β-CD-VBTA and GMA/β-CD-AMPS monolithic columns. PMID:24108813

  1. Negatively charged silver nanoparticles cause retinal vascular permeability by activating plasma contact system and disrupting adherens junction.

    PubMed

    Long, Yan-Min; Zhao, Xing-Chen; Clermont, Allen C; Zhou, Qun-Fang; Liu, Qian; Feener, Edward P; Yan, Bing; Jiang, Gui-Bin

    2016-01-01

    Silver nanoparticles (AgNPs) have been extensively used as antibacterial component in numerous healthcare, biomedical and consumer products. Therefore, their adverse effects to biological systems have become a major concern. AgNPs have been shown to be absorbed into circulation and redistributed into various organs. It is thus of great importance to understand how these nanoparticles affect vascular permeability and uncover the underlying molecular mechanisms. A negatively charged mecaptoundeonic acid-capped silver nanoparticle (MUA@AgNP) was investigated in this work. Ex vivo experiments in mouse plasma revealed that MUA@AgNPs caused plasma prekallikrein cleavage, while positively charged or neutral AgNPs, as well as Ag ions had no effect. In vitro tests revealed that MUA@AgNPs activated the plasma kallikrein-kinin system (KKS) by triggering Hageman factor autoactivation. By using specific inhibitors aprotinin and HOE 140, we demonstrated that KKS activation caused the release of bradykinin, which activated B2 receptors and induced the shedding of adherens junction protein, VE-cadherin. These biological perturbations eventually resulted in endothelial paracellular permeability in mouse retina after intravitreal injection of MUA@AgNPs. The findings from this work provided key insights for toxicity modulation and biomedical applications of AgNPs. PMID:26399585

  2. Experimental and theoretical characterization of the 3,5-didehydrobenzoate anion: a negatively charged meta-benzyne.

    PubMed

    Price, Jason M; Nizzi, Katrina Emilia; Campbell, J Larry; Kenttämaa, Hilkka I; Seierstad, Mark; Cramer, Christopher J

    2003-01-01

    A negatively charged analogue of meta-benzyne, 3,5-didehydrobenzoate, was synthesized in a Fourier transform ion cyclotron resonance mass spectrometer, and its reactivity was compared to that of the same ion generated previously in a flowing afterglow apparatus and to its positively charged cousin, N-(3,5-didehydrophenyl)-3-fluoropyridinium. 3,5-Didehydrobenzoate was found to react as a nucleophile with electrophilic reagents. In contrast, N-(3,5-didehydrophenyl)-3-fluoropyridinium does not react with the same electrophilic reagents but reacts instead with nucleophilic reagents. Neither ion is able to abstract hydrogen atoms from typical hydrogen atom donors. The absence of any radical reactivity for these meta-benzynes is consistent with predictions that radical reactions of singlet biradicals should be hindered as compared to their monoradical counterparts. High-level calculations predict that the carboxylate moiety does not significantly perturb the singlet-triplet splitting of 3,5-didehydrobenzoate relative to the parent meta-benzyne. PMID:12515514

  3. Estimating collision cross sections of negatively charged N-glycans using traveling wave ion mobility-mass spectrometry.

    PubMed

    Hofmann, Johanna; Struwe, Weston B; Scarff, Charlotte A; Scrivens, James H; Harvey, David J; Pagel, Kevin

    2014-11-01

    Glycosylation is one of the most common post-translational modifications occurring in proteins. A detailed structural characterization of the involved carbohydrates, however, is still one of the greatest challenges in modern glycoproteomics, since multiple regio- and stereoisomers with an identical monosaccharide composition may exist. Recently, ion mobility-mass spectrometry (IM-MS), a technique in which ions are separated according to their mass, charge, and shape, has evolved as a promising technique for the separation and structural analysis of complex carbohydrates. This growing interest is based on the fact that the measured drift times can be converted into collision cross sections (CCSs), which can be compared, implemented into databases, and used as additional search criteria for structural identification. However, most of the currently used commercial IM-MS instruments utilize a nonuniform traveling wave field to propel the ions through the IM cell. As a result, CCS measurements cannot be performed directly and require calibration. Here, we present a calibration data set consisting of over 500 reference CCSs for negatively charged N-glycans and their fragments. Moreover, we show that dextran, already widely used as a calibrant in high performance liquid chromatography, is also a suitable calibrant for CCS estimations. Our data also indicate that a considerably increased error has to be taken into account when reference CCSs acquired in a different drift gas are used for calibration. PMID:25268221

  4. Interplay of electrostatics and lipid packing determines the binding of charged polymer coated nanoparticles to model membranes.

    PubMed

    Biswas, Nupur; Bhattacharya, Rupak; Saha, Arindam; Jana, Nikhil R; Basu, Jaydeep K

    2015-10-01

    Understanding of nanoparticle-membrane interactions is useful for various applications of nanoparticles like drug delivery and imaging. Here we report on the studies of interaction between hydrophilic charged polymer coated semiconductor quantum dot nanoparticles with model lipid membranes. Atomic force microscopy and X-ray reflectivity measurements suggest that cationic nanoparticles bind and penetrate bilayers of zwitterionic lipids. Penetration and binding depend on the extent of lipid packing and result in the disruption of the lipid bilayer accompanied by enhanced lipid diffusion. On the other hand, anionic nanoparticles show minimal membrane binding although, curiously, their interaction leads to reduction in lipid diffusivity. It is suggested that the enhanced binding of cationic QDs at higher lipid packing can be understood in terms of the effective surface potential of the bilayers which is tunable through membrane lipid packing. Our results bring forth the subtle interplay of membrane lipid packing and electrostatics which determine nanoparticle binding and penetration of model membranes with further implications for real cell membranes. PMID:26327393

  5. Characterization of oil-free and oil-loaded liquid-crystalline particles stabilized by negatively charged stabilizer citrem.

    PubMed

    Nilsson, Christa; Edwards, Katarina; Eriksson, Jonny; Larsen, Susan Weng; Østergaard, Jesper; Larsen, Claus; Urtti, Arto; Yaghmur, Anan

    2012-08-14

    The present study was designed to evaluate the effect of the negatively charged food-grade emulsifier citrem on the internal nanostructures of oil-free and oil-loaded aqueous dispersions of phytantriol (PHYT) and glyceryl monooleate (GMO). To our knowledge, this is the first report in the literature on the utilization of this charged stabilizing agent in the formation of aqueous dispersions consisting of well-ordered interiors (either inverted-type hexagonal (H(2)) phases or inverted-type microemulsion systems). Synchrotron small-angle X-ray scattering (SAXS) and cryogenic transmission electron microscopy (cryo-TEM) were used to characterize the dispersed and the corresponding nondispersed phases of inverted-type nonlamellar liquid-crystalline phases and microemulsions. The results suggest a transition between different internal nanostructures of the aqueous dispersions after the addition of the stabilizer. In addition to the main function of citrem as a stabilizer that adheres to the surface of the dispersed particles, it has a significant impact on the internal nanostructures, which is governed by the following factors: (1) its penetration between the hydrophobic tails of the lipid molecules and (2) its degree of incorporation into the lipid-water interfacial area. In the presence of citrem, the formation of aqueous dispersions with functionalized hydrophilic domains by the enlargement of the hydrophilic nanochannels of the internal H(2) phase in hexosomes and the hydrophilic core of the L(2) phase in emulsified microemulsions (EMEs) could be particularly attractive for solubilizing and controlling the release of positively charged drugs. PMID:22831645

  6. CD4-Negative Cells Bind Human Immunodeficiency Virus Type 1 and Efficiently Transfer Virus to T Cells

    PubMed Central

    Olinger, Gene G.; Saifuddin, Mohammed; Spear, Gregory T.

    2000-01-01

    The ability of human immunodeficiency virus strain MN (HIVMN), a T-cell line-adapted strain of HIV, and X4 and R5 primary isolates to bind to various cell types was investigated. In general, HIVMN bound to cells at higher levels than did the primary isolates. Virus bound to both CD4-positive (CD4+) and CD4-negative (CD4−) cells, including neutrophils, Raji cells, tonsil mononuclear cells, erythrocytes, platelets, and peripheral blood mononuclear cells (PBMC), although virus bound at significantly higher levels to PBMC. However, there was no difference in the amount of HIV that bound to CD4-enriched or CD4-depleted PBMC. Virus bound to CD4− cells was up to 17 times more infectious for T cells in cocultures than was the same amount of cell-free virus. Virus bound to nucleated cells was significantly more infectious than virus bound to erythrocytes or platelets. The enhanced infection of T cells by virus bound to CD4− cells was not due to stimulatory signals provided by CD4− cells or infection of CD4− cells. However, anti-CD18 antibody substantially reduced the enhanced virus replication in T cells, suggesting that virus that bound to the surface of CD4− cells is efficiently passed to CD4+ T cells during cell-cell adhesion. These studies show that HIV binds at relatively high levels to CD4− cells and, once bound, is highly infectious for T cells. This suggests that virus binding to the surface of CD4− cells is an important route for infection of T cells in vivo. PMID:10954556

  7. Far upstream element binding protein 2 interacts with enterovirus 71 internal ribosomal entry site and negatively regulates viral translation

    PubMed Central

    Lin, Jing-Yi; Li, Mei-Ling; Shih, Shin-Ru

    2009-01-01

    An internal ribosomal entry site (IRES) that directs the initiation of viral protein translation is a potential drug target for enterovirus 71 (EV71). Regulation of internal initiation requires the interaction of IRES trans-acting factors (ITAFs) with the internal ribosomal entry site. Biotinylated RNA-affinity chromatography and proteomic approaches were employed to identify far upstream element (FUSE) binding protein 2 (FBP2) as an ITAF for EV71. The interactions of FBP2 with EV71 IRES were confirmed by competition assay and by mapping the association sites in both viral IRES and FBP2 protein. During EV71 infection, FBP2 was enriched in cytoplasm where viral replication occurs, whereas FBP2 was localized in the nucleus in mock-infected cells. The synthesis of viral proteins increased in FBP2-knockdown cells that were infected by EV71. IRES activity in FBP2-knockdown cells exceeded that in the negative control (NC) siRNA-treated cells. On the other hand, IRES activity decreased when FBP2 was over-expressed in the cells. Results of this study suggest that FBP2 is a novel ITAF that interacts with EV71 IRES and negatively regulates viral translation. PMID:19010963

  8. Increasing the Net Negative Charge by Replacement of DOTA Chelator with DOTAGA Improves the Biodistribution of Radiolabeled Second-Generation Synthetic Affibody Molecules.

    PubMed

    Westerlund, Kristina; Honarvar, Hadis; Norrström, Emily; Strand, Joanna; Mitran, Bogdan; Orlova, Anna; Eriksson Karlström, Amelie; Tolmachev, Vladimir

    2016-05-01

    A promising strategy to enable patient stratification for targeted therapies is to monitor the target expression in a tumor by radionuclide molecular imaging. Affibody molecules (7 kDa) are nonimmunoglobulin scaffold proteins with a 25-fold smaller size than intact antibodies. They have shown an apparent potential as molecular imaging probes both in preclinical and clinical studies. Earlier, we found that hepatic uptake can be reduced by the incorporation of negatively charged purification tags at the N-terminus of Affibody molecules. We hypothesized that liver uptake might similarly be reduced by positioning the chelator at the N-terminus, where the chelator-radionuclide complex will provide negative charges. To test this hypothesis, a second generation synthetic anti-HER2 ZHER2:2891 Affibody molecule was synthesized and labeled with (111)In and (68)Ga using DOTAGA and DOTA chelators. The chelators were manually coupled to the N-terminus of ZHER2:2891 forming an amide bond. Labeling DOTAGA-ZHER2:2891 and DOTA-ZHER2:2891 with (68)Ga and (111)In resulted in stable radioconjugates. The tumor-targeting and biodistribution properties of the (111)In- and (68)Ga-labeled conjugates were compared in SKOV-3 tumor-bearing nude mice at 2 h postinjection. The HER2-specific binding of the radioconjugates was verified both in vitro and in vivo. Using the DOTAGA chelator gave significantly lower radioactivity in liver and blood for both radionuclides. The (111)In-labeled conjugates showed more rapid blood clearance than the (68)Ga-labeled conjugates. The most pronounced influence of the chelators was found when they were labeled with (68)Ga. The DOTAGA chelator gave significantly higher tumor-to-blood (61 ± 6 vs 23 ± 5, p < 0.05) and tumor-to-liver (10.4 ± 0.6 vs 4.5 ± 0.5, p < 0.05) ratios than the DOTA chelator. This study demonstrated that chelators may be used to alter the uptake of Affibody molecules, and most likely other scaffold-based imaging probes, for improvement

  9. Effects of Surfactants and Polyelectrolytes on the Interaction between a Negatively Charged Surface and a Hydrophobic Polymer Surface.

    PubMed

    Rapp, Michael V; Donaldson, Stephen H; Gebbie, Matthew A; Gizaw, Yonas; Koenig, Peter; Roiter, Yuri; Israelachvili, Jacob N

    2015-07-28

    We have measured and characterized how three classes of surface-active molecules self-assemble at, and modulate the interfacial forces between, a negatively charged mica surface and a hydrophobic end-grafted polydimethylsiloxane (PDMS) polymer surface in solution. We provide a broad overview of how chemical and structural properties of surfactant molecules result in different self-assembled structures at polymer and mineral surfaces, by studying three characteristic surfactants: (1) an anionic aliphatic surfactant, sodium dodecyl sulfate (SDS), (2) a cationic aliphatic surfactant, myristyltrimethylammonium bromide (MTAB), and (3) a silicone polyelectrolyte with a long-chain PDMS midblock and multiple cationic end groups. Through surface forces apparatus measurements, we show that the separate addition of three surfactants can result in interaction energies ranging from fully attractive to fully repulsive. Specifically, SDS adsorbs at the PDMS surface as a monolayer and modifies the monotonic electrostatic repulsion to a mica surface. MTAB adsorbs at both the PDMS (as a monolayer) and the mica surface (as a monolayer or bilayer), resulting in concentration-dependent interactions, including a long-range electrostatic repulsion, a short-range steric hydration repulsion, and a short-range hydrophobic attraction. The cationic polyelectrolyte adsorbs as a monolayer on the PDMS and causes a long-range electrostatic attraction to mica, which can be modulated to a monotonic repulsion upon further addition of SDS. Therefore, through judicious selection of surfactants, we show how to modify the magnitude and sign of the interaction energy at different separation distances between hydrophobic and hydrophilic surfaces, which govern the static and kinetic stability of colloidal dispersions. Additionally, we demonstrate how the charge density of silicone polyelectrolytes modifies both their self-assembly at polymer interfaces and the robust adhesion of thin PDMS films to target

  10. SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations

    PubMed Central

    Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

    2016-01-01

    Predicting the effect of amino acid substitutions on protein–protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/. PMID:27077847

  11. SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations.

    PubMed

    Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

    2016-01-01

    Predicting the effect of amino acid substitutions on protein-protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/. PMID:27077847

  12. Detection of molecular binding via charge-induced mechanical response of optical fibers†

    PubMed Central

    Guan, Yan; Shan, Xiaonan; Wang, Shaopeng; Zhang, Peiming; Tao, Nongjian

    2014-01-01

    We report a charge sensitive optical detection technique for label-free study of molecular interactions. Traditional label-free optical detection techniques largely rely on the detection of the mass of a molecule, which are insensitive to small molecules. In contrast, the present technique detects the charge of a molecule, where the signal does not diminish with the size of the molecule, thus capable for studying small molecules. In addition, the technique is compatible with the standard microplate platform, making it suitable for high-throughput screening of drug candidates. Using the technique, we have detected 0.2 nM anti-BSA and 15 μM anti-cancer drug (imatinib) with an enzyme modified surface. The achieved effective charge detection limit is ~0.25 electron charge/μm2, corresponding to ~0.3 fg/mm2 for imatinib, which is orders of magnitude better than traditional label-free optical detection methods. PMID:25408862

  13. Negatively Charged Carbon Nanohorn Supported Cationic Liposome Nanoparticles: A Novel Delivery Vehicle for Anti-Nicotine Vaccine.

    PubMed

    Zheng, Hong; Hu, Yun; Huang, Wei; de Villiers, Sabina; Pentel, Paul; Zhang, Jianfei; Dorn, Harry; Ehrich, Marion; Zhang, Chenming

    2015-12-01

    Tobacco addiction is the second-leading cause of death in the world. Due to the nature of nicotine (a small molecule), finding ways to combat nicotine's deleterious effects has been a constant challenge to the society and the medical field. In the present work, a novel anti-nicotine vaccine based on nanohorn supported liposome nanoparticles (NsL NPs) was developed. The nano-vaccine was constructed by using negatively charged carbon nanohorns as a scaffold for the assembly of cationic liposomes, which allow the conjugation of hapten conjugated carrier proteins. The assembled bio-nanoparticles are stable. Mice were immunized subcutaneously with the nano-vaccine, which induced high titer and high affinity of nicotine specific antibodies in mice. Furthermore, no evidence of clinical signs or systemic toxicity followed multiple administrations of NsL-based anti-nicotine vaccine. These results suggest that NsL-based anti-nicotine vaccine is a promising candidate in treating nicotine dependence and could have potential to significantly contribute to smoking cessation. PMID:26510313

  14. Effect of negatively charged cellulose nanofibers on the dispersion of hydroxyapatite nanoparticles for scaffolds in bone tissue engineering.

    PubMed

    Park, Minsung; Lee, Dajung; Shin, Sungchul; Hyun, Jinho

    2015-06-01

    Nanofibrous 2,2,6,6-tetramethylpiperidine-1-oxyl(TEMPO)-oxidized bacterial cellulose (TOBC) was used as a dispersant of hydroxyapatite (HA) nanoparticles in aqueous solution. The surfaces of TOBC nanofibers were negatively charged after the reaction with the TEMPO/NaBr/NaClO system at pH 10 and room temperature. HA nanoparticles were simply adsorbed on the TOBC nanofibers (HA-TOBC) and dispersed well in DI water. The well-dispersed HA-TOBC colloidal solution formed a hydrogel after the addition of gelatin, followed by crosslinking with glutaraldehyde (HA-TOBC-Gel). The chemical modification of the fiber surfaces and the colloidal stability of the dispersion solution confirmed TOBC as a promising HA dispersant. Both the Young's modulus and maximum tensile stress increased as the amount of gelatin increased due to the increased crosslinking of gelatin. In addition, the well-dispersed HA produced a denser scaffold structure resulting in the increase of the Young's modulus and maximum tensile stress. The well-developed porous structures of the HA-TOBC-Gel composites were incubated with Calvarial osteoblasts. The HA-TOBC-Gel significantly improved cell proliferation as well as cell differentiation confirming the material as a potential candidate for use in bone tissue engineering scaffolds. PMID:25910635

  15. Manufacturing and characterization of bent silicon crystals for studies of coherent interactions with negatively charged particles beams

    NASA Astrophysics Data System (ADS)

    Germogli, G.; Mazzolari, A.; Bandiera, L.; Bagli, E.; Guidi, V.

    2015-07-01

    Efficient steering of GeV-energy negatively charged particle beams was demonstrated to be possible with a new generation of thin bent silicon crystals. Suitable crystals were produced at the Sensor Semiconductor Laboratory of Ferrara starting from Silicon On Insulator wafers, adopting proper revisitation of silicon micromachining techniques such as Low Pressure Chemical Vapor Deposition, photolithography and anisotropic chemical etching. Mechanical holders, which allow to properly bend the crystal and to reduce unwanted torsions, were employed. Crystallographic directions and crystal holder design were optimized in order to excite quasi-mosaic effect along (1 1 1) planes. Prior to exposing the crystal to particle beams, a full set of characterizations were performed. Infrared interferometry was used to measure crystal thickness with high accuracy. White-light interferometry was employed to characterize surface deformational state and its torsion. High-resolution X-rays diffraction was used to precisely measure crystal bending angle along the beam. Manufactured crystals were installed and tested at the MAMI MAinz MIcrotron to steer sub-GeV electrons, and at SLAC to deflect an electron beam in the 1 to 10 GeV energy range.

  16. Assessing carbon-based anodes for lithium-ion batteries: a universal description of charge-transfer binding.

    PubMed

    Liu, Yuanyue; Wang, Y Morris; Yakobson, Boris I; Wood, Brandon C

    2014-07-11

    Many key performance characteristics of carbon-based lithium-ion battery anodes are largely determined by the strength of binding between lithium (Li) and sp(2) carbon (C), which can vary significantly with subtle changes in substrate structure, chemistry, and morphology. Here, we use density functional theory calculations to investigate the interactions of Li with a wide variety of sp(2) C substrates, including pristine, defective, and strained graphene, planar C clusters, nanotubes, C edges, and multilayer stacks. In almost all cases, we find a universal linear relation between the Li-C binding energy and the work required to fill previously unoccupied electronic states within the substrate. This suggests that Li capacity is predominantly determined by two key factors-namely, intrinsic quantum capacitance limitations and the absolute placement of the Fermi level. This simple descriptor allows for straightforward prediction of the Li-C binding energy and related battery characteristics in candidate C materials based solely on the substrate electronic structure. It further suggests specific guidelines for designing more effective C-based anodes. The method should be broadly applicable to charge-transfer adsorption on planar substrates, and provides a phenomenological connection to established principles in supercapacitor and catalyst design. PMID:25062244

  17. A zebrafish intelectin ortholog agglutinates both Gram-negative and Gram-positive bacteria with binding capacity to bacterial polysaccharide.

    PubMed

    Chen, Lei; Yan, Jie; Sun, Weiping; Zhang, Yan; Sui, Chao; Qi, Jing; Du, Yijun; Feng, Lijun

    2016-08-01

    Intelectins are glycan-binding lectins found in various species including cephalochordates, urochordates, fish, amphibians and mammals. But their detailed functions are not well studied in zebrafish which is a good model to study native immunity. In this study, we cloned a zebrafish intelectin ortholog, zebrafish intelectin 2 (zITLN2), which contains a conserved fibrinogen-related domain (FReD) in the N-terminus and the unique intelectin domain in the C-terminus. We examined the tissue distribution of zITLN2 in adult zebrafish and found that zITLN2 was expressed in various organs with the highest level in intestine. Like amphioxus intelectins, zITLN2 expression was upregulated in adult zebrafish infected with Staphylococcus aureus with the highest expression level at 12 h after challenge. Recombinant zITLN2 protein expressed in E. coli was able to agglutinate both Gram-negative and Gram-positive bacteria to similar degrees in a calcium-dependent manner. Furthermore, recombinant zITLN2 bound lipopolysaccharide (LPS) and peptidoglycan (PGN) comparably. Our work on zITLN2 provided further information to understand functions of this new family of lectins and the innate immunity in vertebrates. PMID:27329687

  18. Protein kinase D negatively regulates hepatitis C virus secretion through phosphorylation of oxysterol-binding protein and ceramide transfer protein.

    PubMed

    Amako, Yutaka; Syed, Gulam H; Siddiqui, Aleem

    2011-04-01

    Hepatitis C virus (HCV) RNA replicates its genome on specialized endoplasmic reticulum modified membranes termed membranous web and utilizes lipid droplets for initiating the viral nucleocapsid assembly. HCV maturation and/or the egress pathway requires host sphingolipid synthesis, which occur in the Golgi. Ceramide transfer protein (CERT) and oxysterol-binding protein (OSBP) play a crucial role in sphingolipid biosynthesis. Protein kinase D (PKD), a serine/threonine kinase, is recruited to the trans-Golgi network where it influences vesicular trafficking to the plasma membrane by regulation of several important mediators via phosphorylation. PKD attenuates the function of both CERT and OSBP by phosphorylation at their respective Ser(132) and Ser(240) residues (phosphorylation inhibition). Here, we investigated the functional role of PKD in HCV secretion. Our studies show that HCV gene expression down-regulated PKD activation. PKD depletion by shRNA or inhibition by pharmacological inhibitor Gö6976 enhanced HCV secretion. Overexpression of a constitutively active form of PKD suppressed HCV secretion. The suppression by PKD was subverted by the ectopic expression of nonphosphorylatable serine mutant CERT S132A or OSBP S240A. These observations imply that PKD negatively regulates HCV secretion/release by attenuating OSBP and CERT functions by phosphorylation inhibition. This study identifies the key role of the Golgi components in the HCV maturation process. PMID:21285358

  19. Exploration of Porphyrin-based Semiconductors for Negative Charge Transport Applications Using Synthetic, Spectroscopic, Potentiometric, Magnetic Resonance, and Computational Methods

    NASA Astrophysics Data System (ADS)

    Rawson, Jeffrey Scott

    Organic pi-conjugated materials are emerging as commercially relevant components in electronic applications that include transistors, light-emitting diodes, and solar cells. One requirement common to all of these functions is an aptitude for accepting and transmitting charges. It is generally agreed that the development of organic semiconductors that favor electrons as the majority carriers (n-type) lags behind the advances in hole transporting (p-type) materials. This shortcoming suggests that the design space for n-type materials is not yet well explored, presenting researchers with the opportunity to develop unconventional architectures. In this regard, it is worth noting that discrete molecular materials are demonstrating the potential to usurp the preeminent positions that pi-conjugated polymers have held in these areas of organic electronics research. This dissertation describes how an extraordinary class of molecules, meso-to-meso ethyne-bridged porphyrin arrays, has been bent to these new uses. Chapter one describes vis-NIR spectroscopic and magnetic resonance measurements revealing that these porphyrin arrays possess a remarkable aptitude for the delocalization of negative charge. In fact, the miniscule electron-lattice interactions exhibited in these rigid molecules allow them to host the most vast electron-polarons ever observed in a pi-conjugated material. Chapter two describes the development of an ethyne-bridged porphyrin-isoindigo hybrid chromophore that can take the place of fullerene derivatives in the conventional thin film solar cell architecture. Particularly noteworthy is the key role played by the 5,15-bis(heptafluoropropyl)porphyrin building block in the engineering of a chromophore that, gram for gram, is twice as absorptive as poly(3-hexyl)thiophene, exhibits a lower energy absorption onset than this polymer, and yet possesses a photoexcited singlet state sufficiently energetic to transfer a hole to this polymer. Chapter three describes

  20. A 90-day study of subchronic oral toxicity of 20 nm, negatively charged zinc oxide nanoparticles in Sprague Dawley rats

    PubMed Central

    Park, Hark-Soo; Shin, Sung-Sup; Meang, Eun Ho; Hong, Jeong-sup; Park, Jong-Il; Kim, Su-Hyon; Koh, Sang-Bum; Lee, Seung-Young; Jang, Dong-Hyouk; Lee, Jong-Yun; Sun, Yle-Shik; Kang, Jin Seok; Kim, Yu-Ri; Kim, Meyoung-Kon; Jeong, Jayoung; Lee, Jong-Kwon; Son, Woo-Chan; Park, Jae-Hak

    2014-01-01

    Purpose The widespread use of nanoparticles (NPs) in industrial and biomedical applications has prompted growing concern regarding their potential toxicity and impact on human health. This study therefore investigated the subchronic, systemic oral toxicity and no-observed-adverse-effect level (NOAEL) of 20 nm, negatively charged zinc oxide (ZnOSM20(−)) NPs in Sprague Dawley rats for 90 days. Methods The high-dose NP level was set at 500 mg/kg of bodyweight, and the mid- and low-dose levels were set at 250 and 125 mg/kg, respectively. The rats were observed during a 14-day recovery period after the last NP administration for the persistence or reduction of any adverse effects. Toxicokinetic and distribution studies were also conducted to determine the systemic distribution of the NPs. Results No rats died during the test period. However, ZnOSM20(−) NPs (500 mg/kg) induced changes in the levels of anemia-related factors, prompted acinar cell apoptosis and ductular hyperplasia, stimulated periductular lymphoid cell infiltration and excessive salivation, and increased the numbers of regenerative acinar cells in the pancreas. In addition, stomach lesions were seen at 125, 250, and 500 mg/kg, and retinal atrophy was observed at 250 and 500 mg/kg. The Zn concentration was dose-dependently increased in the liver, kidney, intestines, and plasma, but not in other organs investigated. Conclusion A ZnOSM20(−) NP NOAEL could not be established from the current results, but the lowest-observed-adverse-effect level was 125 mg/kg. Furthermore, the NPs were associated with a number of undesirable systemic actions. Thus, their use in humans must be approached with caution. PMID:25565828

  1. Absence of a guiding effect and charge transfer in the interaction of keV-energy negative ions with Al{sub 2}O{sub 3} nanocapillaries

    SciTech Connect

    Chen Lin; Guo Yanling; Jia Juanjuan; Zhang Hongqiang; Cui Ying; Shao Jianxiong; Yin Yongzhi; Qiu Xiyu; Lv Xueyang; Sun Guangzhi; Wang Jun; Chen Yifeng; Xi Fayuan; Chen Ximeng

    2011-09-15

    In this work, the efficient electron loss process was observed for the transmission of 10- to 18-keV Cu{sup -} and Cl{sup -} ions through Al{sub 2}O{sub 3} nanocapillaries. The fractions of the scattered particles were simultaneously measured using a position-sensitive microchannel plate detector. The neutrals were guided through the capillary via multiple grazing scattering. In particular, the scattered Cl{sup -} ions were observed in the transmission, whereas no Cu{sup -} ion was formed. In contrast to highly charged ions, these results support strongly the fact that the scattering events dominate the transport of negative ions through the nanocapillaries and that there is no direct evidence for the formation of negative charge patches inside the capillaries which are able to repulse and guide negative ions efficiently.

  2. Basal electric and magnetic fields of celestial bodies come from positive-negative charge separation caused by gravitation of quasi-Casimir pressure in weak interaction

    NASA Astrophysics Data System (ADS)

    Chen, Shao-Guang

    According to f =d(mv)/dt=m(dv/dt)+ v(dm/dt), a same gravitational formula had been de-duced from the variance in physical mass of QFT and from the variance in mass of inductive energy-transfer of GR respectively: f QF T = f GR = -G (mM/r2 )((r/r)+(v/c)) when their interaction-constants are all taken the experimental values (H05-0029-08, E15-0039-08). f QF T is the quasi-Casimir pressure. f GR is equivalent to Einstein's equation, then more easy to solve it. The hypothesis of the equivalent principle is not used in f QF T , but required by f GR . The predictions of f QF T and f GR are identical except that f QF T has quantum effects but f GR has not and f GR has Lense-Thirring effect but f QF T has not. The quantum effects of gravitation had been verified by Nesvizhevsky et al with the ultracold neutrons falling in the earth's gravitational field in 2002. Yet Lense-Thirring effect had not been measured by GP-B. It shows that f QF T is essential but f GR is phenomenological. The macro-f QF T is the statistic average pressure collided by net virtual neutrinos ν 0 flux (after self-offset in opposite directions) and in direct proportion to the mass. But micro-f QF T is in direct proportion to the scattering section. The electric mass (in inverse proportion to de Broglie wavelength λ) far less than nucleonic mass and the electric scattering section (in direct proportion to λ2 ) far large than that of nucleon, then the net ν 0 flux pressure exerted to electron far large than that to nucleon and the electric displacement far large than that of nucleon, it causes the gravitational polarization of positive-negative charge center separation. Because the gravity far less than the electromagnetic binding force, in atoms the gravitational polarization only produces a little separation. But the net ν 0 flux can press a part freedom electrons in plasma of ionosphere into the earth's surface, the static electric force of redundant positive ions prevents electrons from further

  3. Basal electric and magnetic fields of celestial bodies come from positive-negative charge separation caused by gravitation of quasi-Casimir pressure in weak interaction

    NASA Astrophysics Data System (ADS)

    Chen, Shao-Guang

    According to f =d(mv)/dt=m(dv/dt)+ v(dm/dt), a same gravitational formula had been de-duced from the variance in physical mass of QFT and from the variance in mass of inductive energy-transfer of GR respectively: f QF T = f GR = -G (mM/r2 )((r/r)+(v/c)) when their interaction-constants are all taken the experimental values (H05-0029-08, E15-0039-08). f QF T is the quasi-Casimir pressure. f GR is equivalent to Einstein's equation, then more easy to solve it. The hypothesis of the equivalent principle is not used in f QF T , but required by f GR . The predictions of f QF T and f GR are identical except that f QF T has quantum effects but f GR has not and f GR has Lense-Thirring effect but f QF T has not. The quantum effects of gravitation had been verified by Nesvizhevsky et al with the ultracold neutrons falling in the earth's gravitational field in 2002. Yet Lense-Thirring effect had not been measured by GP-B. It shows that f QF T is essential but f GR is phenomenological. The macro-f QF T is the statistic average pressure collided by net virtual neutrinos ν 0 flux (after self-offset in opposite directions) and in direct proportion to the mass. But micro-f QF T is in direct proportion to the scattering section. The electric mass (in inverse proportion to de Broglie wavelength λ) far less than nucleonic mass and the electric scattering section (in direct proportion to λ2 ) far large than that of nucleon, then the net ν 0 flux pressure exerted to electron far large than that to nucleon and the electric displacement far large than that of nucleon, it causes the gravitational polarization of positive-negative charge center separation. Because the gravity far less than the electromagnetic binding force, in atoms the gravitational polarization only produces a little separation. But the net ν 0 flux can press a part freedom electrons in plasma of ionosphere into the earth's surface, the static electric force of redundant positive ions prevents electrons from further

  4. Genetic Variability in Probe Binding Regions Explains False Negative Results of a Molecular Assay for the Detection of Dengue Virus.

    PubMed

    Koo, Carmen; Kaur, Simrandeep; Teh, Zhi-Yong; Xu, Helen; Nasir, Amna; Lai, Yee-Ling; Khan, Erum; Ng, Lee-Ching; Hapuarachchi, Hapuarachchige C

    2016-07-01

    Dengue fever is currently the most prevalent disease caused by mosquito-borne flaviviruses. Despite being potentially fatal, there are no specific antiviral therapies for Dengue virus (DENV) infections. Therefore, early, accurate, and rapid diagnosis plays an important role in proper patient management. In this study, we evaluated the performance of a probe-based real-time RT-PCR (rRT-PCR) assay against that of a conventional RT-PCR assay in three sample cohorts from Pakistan (n = 94) and Singapore (first cohort; n = 559, second cohort; n = 123). The Pakistan cohort also included a comparison with virus isolation. The rRT-PCR assay showed relatively lower overall sensitivity (20.2%) in the Pakistan cohort than that in first (90.8%) and second (80.5%) Singapore cohorts. Surprisingly, the overall sensitivity of rRT-PCR assay was lower compared with the virus isolation (26.6%) among Pakistan samples, indicating a high percentage (79.8%) of false negatives due to rRT-PCR assay. The analysis of sequences of failed and successful DENV isolates indicated mismatches in probe binding regions as the likely cause of rRT-PCR assay failure. Our observations testify the importance of utilizing a combination of methods for dengue diagnostics and surveillance. We emphasize that a thorough understanding of the genetic composition of local DENV populations as well as regular monitoring of the performance and reviewing of probe/primer sequences are essential to maintain a consistently high diagnostic accuracy of PCR-based assays. PMID:27172387

  5. Mast cell degranulation is negatively regulated by the Munc13-4-binding small-guanosine triphosphatase Rab37

    PubMed Central

    Higashio, Hironori; Satoh, Yoh-ichi; Saino, Tomoyuki

    2016-01-01

    Mast cell degranulation is regulated by the small guanosine triphosphatases (GTPases) Rab27a and Rab27b, which have distinct and opposing roles: Rab27b acts as a positive regulator through its effector protein Munc13-4, a non-neuronal isoform of the vesicle-priming Munc13 family of proteins, whereas Rab27a acts as a negative regulator through its effector protein melanophilin, by maintaining integrity of cortical filamentous actin (F-actin), a barrier to degranulation. Here we investigated the role of Rab37, one of the Rab GTPases assumed to be implicated in regulated secretion during mast cell degranulation. Using the RBL-2H3 mast cell line, we detected Rab37 on the secretory granules and found that antigen-induced degranulation was extensively increased by either knockdown of Rab37 or overexpression of a dominant-active Rab37 mutant. This hypersecretion phenotype in the Rab37-knockdown cells was suppressed by simultaneous knockdown of Rab27a and Rab27b or of Munc13-4, but not by disruption of cortical F-actin. We further found that Rab37 interacted with Munc13-4 in a GTP-independent manner and formed a Rab27-Munc13-4-Rab37 complex. These results suggest that Rab37 is a Munc13-4-binding protein that inhibits mast cell degranulation through its effector protein, by counteracting the vesicle-priming activity of the Rab27-Munc13-4 system. PMID:26931073

  6. Lysozyme Net Charge and Ion Binding in Concentrated Aqueous Electrolyte Solutions

    SciTech Connect

    Kuehner, Daniel E.; Engmann, Jan; Fergg, Florian; Wernick, Meredith; Blanch, Harvey W.; Prausnitz, John M.

    1999-02-01

    Hydrogen-ion titrations were conducted for hen-egg-white lysozyme in solutions of potassium chloride, over the range of pH 2.5 - 11.5 and for ionic strengths to 2. 0 M. The dependence of lysozyme's net proton charge, zP' on pH and ionic-strength in potassium-chloride solution is measured. From the ionic-strength dependence of zP' interactions of lysozynie with potassium and chloride ions are calculated using the molecular-thennodynamic theory of Fraaije and Lyklema 1. Lysozyme interacts preferentially with up to 12 chloride ions at pH 2.5. The observed dependence of ion-protein interactions on pH and ionic strength is explained in terms of electricdouble-layer theory. New experimental pKa data are reported for eleven ammo acids in potassium-chloride solutions of ionic strength to 3.0 M.

  7. Lysozyme net charge and ion binding in concentrated aqueous electrolyte solutions

    SciTech Connect

    Kuehner, Daniel E.; Engmann, Jan; Fergg, Florian; Wernick, Meredith; Blanch, Harvey W.; Prausnitz, John M.

    1999-02-01

    Hydrogen-ion titrations were conducted for hen-egg-white lysozyme in solutions of potassium chloride over the range pH 2.5--11.5 and for ionic strengths to 2.0 M. The dependence of lysozyme`s net proton charge, z{sub p}, on pH and ionic strength in potassium chloride solution is measured. From the ionic-strength dependence of z{sub p}, interactions of lysozyme with potassium and chloride ions are calculated using the molecular-thermodynamic theory of Fraaije and Lyklema. Lysozyme interacts preferentially with up to 12 chloride ions at pH 2.5. The observed dependence of ion-protein interactions on pH and ionic strength is explained in terms of electric-double-layer theory. New experimental pK{sub a} data are reported for 11 amino acids in potassium chloride solutions of ionic strength to 3.0 M.

  8. Femtosecond Hydrogen Bond Dynamics of Bulk-like and Bound Water at Positively and Negatively Charged Lipid Interfaces Revealed by 2D HD-VSFG Spectroscopy.

    PubMed

    Singh, Prashant Chandra; Inoue, Ken-Ichi; Nihonyanagi, Satoshi; Yamaguchi, Shoichi; Tahara, Tahei

    2016-08-26

    Interfacial water in the vicinity of lipids plays an important role in many biological processes, such as drug delivery, ion transportation, and lipid fusion. Hence, molecular-level elucidation of the properties of water at lipid interfaces is of the utmost importance. We report the two-dimensional heterodyne-detected vibrational sum frequency generation (2D HD-VSFG) study of the OH stretch of HOD at charged lipid interfaces, which shows that the hydrogen bond dynamics of interfacial water differ drastically, depending on the lipids. The data indicate that the spectral diffusion of the OH stretch at a positively charged lipid interface is dominated by the ultrafast (<∼100 fs) component, followed by the minor sub-picosecond slow dynamics, while the dynamics at a negatively charged lipid interface exhibit sub-picosecond dynamics almost exclusively, implying that fast hydrogen bond fluctuation is prohibited. These results reveal that the ultrafast hydrogen bond dynamics at the positively charged lipid-water interface are attributable to the bulk-like property of interfacial water, whereas the slow dynamics at the negatively charged lipid interface are due to bound water, which is hydrogen-bonded to the hydrophilic head group. PMID:27482947

  9. First study of the negative binomial distribution applied to higher moments of net-charge and net-proton multiplicity distributions

    NASA Astrophysics Data System (ADS)

    Tarnowsky, Terence J.; Westfall, Gary D.

    2013-07-01

    A study of the first four moments (mean, variance, skewness, and kurtosis) and their products (κσ2 and Sσ) of the net-charge and net-proton distributions in Au + Au collisions at √{sNN} = 7.7- 200 GeV from HIJING simulations has been carried out. The skewness and kurtosis and the collision volume independent products κσ2 and Sσ have been proposed as sensitive probes for identifying the presence of a QCD critical point. A discrete probability distribution that effectively describes the separate positively and negatively charged particle (or proton and anti-proton) multiplicity distributions is the negative binomial (or binomial) distribution (NBD/BD). The NBD/BD has been used to characterize particle production in high-energy particle and nuclear physics. Their application to the higher moments of the net-charge and net-proton distributions is examined. Differences between κσ2 and a statistical Poisson assumption of a factor of four (for net-charge) and 40% (for net-protons) can be accounted for by the NBD/BD. This is the first application of the properties of the NBD/BD to describe the behavior of the higher moments of net-charge and net-proton distributions in nucleus-nucleus collisions.

  10. Relationship between immune system and gram negative bacteria. I. Spontaneous binding of smooth and rough Salmonella to human peripheral blood lymphocytes.

    PubMed Central

    Jirillo, E; Antonaci, S; Michalek, S M; Colwell, D E; McGhee, J R; Bonomo, L

    1984-01-01

    Over the past years many reports have emphasized that either Gram positive or Gram negative bacteria possess the ability to bind spontaneously to human peripheral blood lymphocytes (PBL). Here, bacterial binding to human PBL has been studied by using a smooth (S) Salmonella typhimurium LT-2 and two rough (R) mutants of Salmonella minnesota R 345 (Rb) and R 595 (Re), which possess specific deletions in their lipopolysaccharide (LPS) molecule. Our results provide evidence that all three bacterial strains spontaneously bind to PBL, even though Re and mostly Rb cells display the highest degree of adherence. The three major regions of LPS (O-polysaccharide chain, R core and lipid A) seem to be involved in the binding since adherence is specifically inhibited by pretreating PBL with S- or R-LPS extracted from homologous bacteria. Furthermore, using a panel of monoclonal antibodies to lymphocyte surface antigens, S- and R-Salmonella bacteria bind to T lymphocytes (preferentially T8+ cells), while few B cells are coated by bacteria. Additionally, bacterial binding is significantly reduced by trypsin pretreatment of PBL, this suggesting that proteins (or glycoproteins) of the PBL membrane are involved in the binding. PMID:6383666

  11. The effect of charge reversal mutations in the alpha-helical region of liver fatty acid binding protein on the binding of fatty-acyl CoAs, lysophospholipids and bile acids.

    PubMed

    Hagan, Robert M; Davies, Joanna K; Wilton, David C

    2002-10-01

    Liver fatty acid binding protein (LFABP) is unique among the various types of FABPs in that it can bind a variety of ligands in addition to fatty acids. LFABP is able to bind long chain fatty acids with a 2:1 stoichiometry and the crystal structure has identified two fatty acid binding sites in the binding cavity. The presumed primary site (site 1) involves the fatty acid binding with the carboxylate group buried in the cavity whereas the fatty acid at site 2 has the carboxylate group solvent-exposed within the ligand portal region and in the vicinity of alpha-helix II. The alpha-helical region contains three cationic residues, K20, K31, K33 and modelling studies suggest that K31 on alpha-helix II could make an electrostatic contribution to anionic ligands binding to site 2. The preparation of three charge reversal mutants of LFABP, K20E, K31E and K33E has allowed an investigation of the role of site 2 in ligand binding, particularly those ligands with a bulky anionic head group. The binding of oleoyl CoA, lysophosphatidic acid, lysophosphatidylcholine, lithocholic acid and taurolithocholate 3-sulphate to LFABP has been studied using the alpha-helical mutants. The results support the concept that such ligands bind at site 2 of LFABP where solvent exposure allows the accommodation of their bulky anionic group. PMID:12479568

  12. Charge steering of laser plasma accelerated fast ions in a liquid spray — creation of MeV negative ion and neutral atom beams

    SciTech Connect

    Schnürer, M.; Abicht, F.; Priebe, G.; Braenzel, J.; Prasad, R.; Borghesi, M.; Andreev, A.; Nickles, P. V.; Jequier, S.; Tikhonchuk, V.; Ter-Avetisyan, S.

    2013-11-15

    The scenario of “electron capture and loss” has been recently proposed for the formation of negative ion and neutral atom beams with up to MeV kinetic energy [S. Ter-Avetisyan, et al., Appl. Phys. Lett. 99, 051501 (2011)]. Validation of these processes and of their generic nature is here provided in experiments where the ion source and the interaction medium have been spatially separated. Fast positive ions accelerated from a laser plasma source are sent through a cold spray where their charge is changed. Such formed neutral atom or negative ion has nearly the same momentum as the original positive ion. Experiments are released for protons, carbon, and oxygen ions and corresponding beams of negative ions and neutral atoms have been obtained. The electron capture and loss phenomenon is confirmed to be the origin of the negative ion and neutral atom beams. The equilibrium ratios of different charge components and cross sections have been measured. Our method is general and allows the creation of beams of neutral atoms and negative ions for different species which inherit the characteristics of the positive ion source.

  13. Incorporation of negatively charged iron oxide nanoparticles in the shell of anionic surfactant-stabilized microbubbles: The effect of NaCl concentration.

    PubMed

    Kovalenko, Artem; Jouhannaud, Julien; Polavarapu, Prasad; Krafft, Marie Pierre; Waton, Gilles; Pourroy, Geneviève

    2016-06-15

    We report on the key effect of NaCl for the stabilization of nanoparticle-decorated microbubbles coated by an anionic perfluoroalkylated phosphate C10F21(CH2)2OP(O)(OH)2 surfactant and negatively charged iron oxide nanoparticles. We show that hollow microspheres with shells of 100-200 nm in thickness can be stabilized even at high pH when a strong ionic force is required to screen the negative charges. Due to the more drastic conditions required to stabilize the hollow microspheres, they appear to be stable enough to be deposited on a surface and dried. That can be a simple way to fabricate porous ceramics. PMID:27038281

  14. Distributed feature binding in the auditory modality: experimental evidence toward reconciliation of opposing views on the basis of mismatch negativity and behavioral measures.

    PubMed

    Chernyshev, Boris V; Bryzgalov, Dmitri V; Lazarev, Ivan E; Chernysheva, Elena G

    2016-08-01

    Current understanding of feature binding remains controversial. Studies involving mismatch negativity (MMN) measurement show a low level of binding, whereas behavioral experiments suggest a higher level. We examined the possibility that the two levels of feature binding coexist and may be shown within one experiment. The electroencephalogram was recorded while participants were engaged in an auditory two-alternative choice task, which was a combination of the oddball and the condensation tasks. Two types of deviant target stimuli were used - complex stimuli, which required feature conjunction to be identified, and simple stimuli, which differed from standard stimuli in a single feature. Two behavioral outcomes - correct responses and errors - were analyzed separately. Responses to complex stimuli were slower and less accurate than responses to simple stimuli. MMN was prominent and its amplitude was similar for both simple and complex stimuli, whereas the respective stimuli differed from standards in a single feature or two features respectively. Errors in response only to complex stimuli were associated with decreased MMN amplitude. P300 amplitude was greater for complex stimuli than for simple stimuli. Our data are compatible with the explanation that feature binding in auditory modality depends on two concurrent levels of processing. We speculate that the earlier level related to MMN generation is an essential and critical stage. Yet, a later analysis is also carried out, affecting P300 amplitude and response time. The current findings provide resolution to conflicting views on the nature of feature binding and show that feature binding is a distributed multilevel process. PMID:27306594

  15. The highly charged region of plant beta-type phosphatidylinositol 4-kinase is involved in membrane targeting and phospholipid binding.

    PubMed

    Lou, Ying; Ma, Hui; Lin, Wen-Hui; Chu, Zhao-Qing; Mueller-Roeber, Bernd; Xu, Zhi-Hong; Xue, Hong-Wei

    2006-03-01

    In Arabidopsis thaliana and Oryza sativa, two types of PI 4-kinase (PI4Ks) have been isolated and functionally characterized. The alpha-type PI4Ks (approximately 220 kDa) contain a PH domain, which is lacking in beta-type PI4Ks (approximately 120 kDa). Beta-type PI4Ks, exemplified by Arabidopsis AtPI4Kbeta and rice OsPI4K2, contain a highly charged repetitive segment designated PPC (Plant PI4K Charged) region, which is an unique domain only found in plant beta-type PI4Ks at present. The PPC region has a length of approximately 300 amino acids and harboring 11 (AtPI4Kbeta) and 14 (OsPI4K2) repeats, respectively, of a 20-aa motif. Studies employing a modified yeast-based "Sequence of Membrane-Targeting Detection" system demonstrate that the PPC(OsPI4K2) region, as well as the former 8 and latter 6 repetitive motifs within the PPC region, are able to target fusion proteins to the plasma membrane. Further detection on the transiently expressed GFP fusion proteins in onion epidermal cells showed that the PPC(OsPI4K2) region alone, as well as the region containing repetitive motifs 1-8, was able to direct GFP to the plasma membrane, while the regions containing less repetitive motifs, i.e. 6, 4, 2 or single motif(s) led to predominantly intracellular localization. Agrobacterium-mediated transient expression of PPC-GFP fusion protein further confirms the membrane-targeting capacities of PPC region. In addition, the predominant plasma membrane localization of AtPI4Kbeta was mediated by the PPC region. Recombinant PPC peptide, expressed in E. coli, strongly binds phosphatidic acid, PI and PI4P, but not phosphatidylcholine, PI5P, or PI(4,5)P2 in vitro, providing insights into potential mechanisms for regulating sub-cellular localization and lipid binding for the plant beta-type PI4Ks. PMID:16649109

  16. Insulin-Like Growth Factor 1 Mediates Negative Feedback to Somatotroph GH Expression via POU1F1/CREB Binding Protein Interactions

    PubMed Central

    Pine-Twaddell, Elyse; Sima, Daniela I.; Miller, Ryan S.; He, Ling; Wondisford, Fredric; Radovick, Sally

    2012-01-01

    Circulating insulin-like growth factor 1 (IGF-1) has been shown to act as a negative feedback regulator of growth hormone (GH) gene expression; however, the mechanism of this negative feedback is poorly understood. Activation and regulation of GH gene expression require the binding of the transcription factor POU1F1 to the GH promoter along with cyclic AMP (cAMP) response element binding protein (CREB) binding protein (CBP). We investigate the role of CBP as a target of IGF-1 somatotroph regulation using the MtT/S somatotroph cell line. IGF-1 significantly inhibits basal GH mRNA levels but not POU1F1 levels. Chromatin immunoprecipitation assays demonstrate inhibition of CBP binding to the GH promoter after IGF-1 treatment. We hypothesized that IGF-1 receptor (IGF-1R) signaling disrupts the POU1F1/CBP complex to inhibit gene expression. In support, the use of a mutant CBP (S436A) construct, which lacks a critical phosphorylation site, leads to the loss of IGF-1 inhibition. The studies of CBP (S436A) knock-in mice show elevated serum GH levels, a greater response to GH releasing hormone (GHRH) stimulation along with lower weight gain, and decreased body fat. Our data confirm the inhibitory effects of IGF-1 on GH expression at the level of the promoter and provide evidence of CBP's role as a target of IGF-1R signaling. PMID:22890843

  17. Molecular dynamic study of MlaC protein in Gram-negative bacteria: conformational flexibility, solvent effect and protein-phospholipid binding.

    PubMed

    Huang, Yu-Ming M; Miao, Yinglong; Munguia, Jason; Lin, Leo; Nizet, Victor; McCammon, J Andrew

    2016-08-01

    The composition of the outer membrane in Gram-negative bacteria is asymmetric, with the lipopolysaccharides found in the outer leaflet and phospholipids in the inner leaflet. The MlaC protein transfers phospholipids from the outer to inner membrane to maintain such lipid asymmetry in the Mla pathway. In this work, we have performed molecular dynamics simulations on apo and phospholipid-bound systems to study the dynamical properties of MlaC. Our simulations show that the phospholipid forms hydrophobic interactions with the protein. Residues surrounding the entrance of the binding site exhibit correlated motions to control the site opening and closing. Lipid binding leads to increase of the binding pocket volume and precludes entry of the water molecules. However, in the absence of the phospholipid, water molecules can freely move in and out of the binding site when the pocket is open. Dehydration occurs when the pocket closes. This study provides dynamic information of the MlaC protein and may facilitate the design of antibiotics against the Mla pathway of Gram-negative bacteria. PMID:27111825

  18. Possibility of controlling the earth's negative charge and the unitary variation of its electric field by cosmic rays

    NASA Technical Reports Server (NTRS)

    Bragin, Y. A.; Vorontsov, S. S.; Kocheyev, A. A.

    1975-01-01

    The dependence of the atmospheric conductivity upon the cosmic ray intensity, the possibility of charge generation in thunderstorms by cosmic rays, the dependence of the troposphere electricity on the stratosphere, the relationship between the unitary variation of the earth's electric field intensity and that of cosmic ray intensity (daily, yearly and 11-year latitudinal dependence of both values), deny first, the exceptional role of the tropospheric processes in maintaining the terrestrial charge and unitary variation, and, second, compel one to consider the cause mentioned above to be the result of the influence of cosmic rays.

  19. Symmetry-related mutants in the quinone binding sites of the reaction center -- The effects of changes in charge distribution

    SciTech Connect

    Hanson, D.K.; Schiffer, M.

    1997-09-01

    To probe the structural elements that contribute to the functional asymmetries of the two ubiquinone{sub 10}binding pockets in the reaction center of Rhodobacter capsulatus, the authors targeted the L212Glu-L213Asp (near Q{sub B}) and the M246Ala-M247Ala (near Q{sub A}) pairs of symmetry-related residues for site-specific mutagenesis. They have constructed site-specific mutants that eliminate the sequence differences at these positions (L212Glu-L213Asp{yields}Ala-Ala or M246Ala-M247Ala{yields}Glu-Asp), and have reversed that asymmetry by constructing a quadruple-mutant strain, RQ (L212Glu-L213Asp-M246Ala-M247Ala{yields}Ala-Ala-Glu-Asp). The mutations were designed to change the charge distribution in the quinone-binding region of the reaction center; none of the strains is capable of photosynthetic growth. In photocomponent phenotypic revertants of the RQ strain, second-site mutations which affect Q{sub B} function are coupled to mutations in the Q{sub A} site which restore an Ala or substitute a Tyr at the M247 site; one strain carries an additional Met{yields}Glu substitution at M260 near Q{sub A}. All of the RQ revertants retain the engineered M246Ala{yields}Glu mutation in the Q{sub A} site as well as the L212Ala-L213Ala mutations in the Q{sub B} site. Kinetic characterization of the RQ revertants will give them an idea of what structural and functional elements are important for restoring efficiency to electron and proton transfer pathways in the RQRC, which is far from native. To date, these preliminary results underscore the importance of an asymmetric distribution of polar amino acids in the quinone binding pockets and its influence on the functional properties of the reaction center.

  20. Floating gate memory with charge storage dots array formed by Dps protein modified with site-specific binding peptides

    NASA Astrophysics Data System (ADS)

    Kamitake, Hiroki; Uenuma, Mutsunori; Okamoto, Naofumi; Horita, Masahiro; Ishikawa, Yasuaki; Yamashita, Ichro; Uraoka, Yukiharu

    2015-05-01

    We report a nanodot (ND) floating gate memory (NFGM) with a high-density ND array formed by a biological nano process. We utilized two kinds of cage-shaped proteins displaying SiO2 binding peptide (minTBP-1) on their outer surfaces: ferritin and Dps, which accommodate cobalt oxide NDs in their cavities. The diameters of the cobalt NDs were regulated by the cavity sizes of the proteins. Because minTBP-1 is strongly adsorbed on the SiO2 surface, high-density cobalt oxide ND arrays were obtained by a simple spin coating process. The densities of cobalt oxide ND arrays based on ferritin and Dps were 6.8 × 1011 dots cm-2 and 1.2 × 1012 dots cm-2, respectively. After selective protein elimination and embedding in a metal-oxide-semiconductor (MOS) capacitor, the charge capacities of both ND arrays were evaluated by measuring their C-V characteristics. The MOS capacitor embedded with the Dps ND array showed a wider memory window than the device embedded with the ferritin ND array. Finally, we fabricated an NFGM with a high-density ND array based on Dps, and confirmed its competent writing/erasing characteristics and long retention time.

  1. The N-terminal Domain of Drosophila Gram-negative Binding Protein 3 (GNBP3) Defines a Novel Family of Fungal Pattern Recognition Receptors*

    PubMed Central

    Mishima, Yumiko; Quintin, Jessica; Aimanianda, Vishukumar; Kellenberger, Christine; Coste, Franck; Clavaud, Cecile; Hetru, Charles; Hoffmann, Jules A.; Latgé, Jean-Paul; Ferrandon, Dominique; Roussel, Alain

    2009-01-01

    Gram-negative binding protein 3 (GNBP3), a pattern recognition receptor that circulates in the hemolymph of Drosophila, is responsible for sensing fungal infection and triggering Toll pathway activation. Here, we report that GNBP3 N-terminal domain binds to fungi upon identifying long chains of β-1,3-glucans in the fungal cell wall as a major ligand. Interestingly, this domain fails to interact strongly with short oligosaccharides. The crystal structure of GNBP3-Nter reveals an immunoglobulin-like fold in which the glucan binding site is masked by a loop that is highly conserved among glucan-binding proteins identified in several insect orders. Structure-based mutagenesis experiments reveal an essential role for this occluding loop in discriminating between short and long polysaccharides. The displacement of the occluding loop is necessary for binding and could explain the specificity of the interaction with long chain structured polysaccharides. This represents a novel mechanism for β-glucan recognition. PMID:19692333

  2. Negative Factor from SIV Binds to the Catalytic Subunit of the V-ATPase to Internalize CD4 and to Increase Viral Infectivity

    PubMed Central

    Mandic, Robert; Fackler, Oliver T.; Geyer, Matthias; Linnemann, Thomas; Zheng, Yong-Hui; Peterlin, B. Matija

    2001-01-01

    The accessory protein negative factor (Nef) from human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) is required for optimal viral infectivity and the progression to acquired immunodeficiency syndrome (AIDS). Nef interacts with the endocytic machinery, resulting in the down-regulation of cluster of differentiation antigen 4 (CD4) and major histocompatibility complex class I (MHCI) molecules on the surface of infected cells. Mutations in the C-terminal flexible loop of Nef result in a lower rate of internalization by this viral protein. However, no loop-dependent binding of Nef to adaptor protein-2 (AP-2), which is the adaptor protein complex that is required for the internalization of proteins from the plasma membrane, could be demonstrated. In this study we investigated the relevance of different motifs in Nef from SIVmac239 for its internalization, CD4 down-regulation, binding to components of the trafficking machinery, and viral infectivity. Our data suggest that the binding of Nef to the catalytic subunit H of the vacuolar membrane ATPase (V-ATPase) facilitates its internalization. This binding depends on the integrity of the whole flexible loop. Subsequent studies on Nef mutant viruses revealed that the flexible loop is essential for optimal viral infectivity. Therefore, our data demonstrate how Nef contacts the endocytic machinery in the absence of its direct binding to AP-2 and suggest an important role for subunit H of the V-ATPase in viral infectivity. PMID:11179428

  3. Positively and Negatively Charged Ionic Modifications to Cellulose Assessed as Cotton-Based Protease-Lowering and Haemostatic Wound Agents

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent developments in cellulose wound dressings targeted to different stages of wound healing have been based on structural and charge modifications that function to modulate events in the complex inflammatory and hemostatic phases of wound healing. Hemostasis and inflammation comprise two overlapp...

  4. Negatively charged residues of the segment linking the enzyme and cytolysin moieties restrict the membrane-permeabilizing capacity of adenylate cyclase toxin.

    PubMed

    Masin, Jiri; Osickova, Adriana; Sukova, Anna; Fiser, Radovan; Halada, Petr; Bumba, Ladislav; Linhartova, Irena; Osicka, Radim; Sebo, Peter

    2016-01-01

    The whooping cough agent, Bordetella pertussis, secretes an adenylate cyclase toxin-hemolysin (CyaA) that plays a crucial role in host respiratory tract colonization. CyaA targets CR3-expressing cells and disrupts their bactericidal functions by delivering into their cytosol an adenylate cyclase enzyme that converts intracellular ATP to cAMP. In parallel, the hydrophobic domain of CyaA forms cation-selective pores that permeabilize cell membrane. The invasive AC and pore-forming domains of CyaA are linked by a segment that is unique in the RTX cytolysin family. We used mass spectrometry and circular dichroism to show that the linker segment forms α-helical structures that penetrate into lipid bilayer. Replacement of the positively charged arginine residues, proposed to be involved in target membrane destabilization by the linker segment, reduced the capacity of the toxin to translocate the AC domain across cell membrane. Substitutions of negatively charged residues then revealed that two clusters of negative charges within the linker segment control the size and the propensity of CyaA pore formation, thereby restricting the cell-permeabilizing capacity of CyaA. The 'AC to Hly-linking segment' thus appears to account for the smaller size and modest cell-permeabilizing capacity of CyaA pores, as compared to typical RTX hemolysins. PMID:27581058

  5. Design of an electrolyte composition for stable and rapid charging-discharging of a graphite negative electrode in a bis(fluorosulfonyl)imide-based ionic liquid

    NASA Astrophysics Data System (ADS)

    Matsui, Yukiko; Yamagata, Masaki; Murakami, Satoshi; Saito, Yasuteru; Higashizaki, Tetsuya; Ishiko, Eriko; Kono, Michiyuki; Ishikawa, Masashi

    2015-04-01

    We evaluate the effects of lithium salt on the charge-discharge performance of a graphite negative electrode in 1-ethyl-3-methylimidazolium bis(fluorosulfonyl)imide (EMImFSI) ionic liquid-based electrolytes. Although the graphite negative electrode exhibits good cyclability and rate capability in both 0.43 mol dm-3 LiFSI/EMImFSI and LiTFSI/EMImFSI (TFSI- = bis(trifluoromethylsulfonyl)imide) at room temperature, only the LiFSI/EMImFSI system enables the graphite electrode to be operated with sufficient discharge capacity at the low temperature of 0 °C, even though there is no noticeable difference in ionic conductivity, compared with LiTFSI/EMImFSI. Furthermore, a clear difference in the low-temperature behaviors of the two cells composed of EMImFSI with a high-concentration of lithium salts is observed. Additionally, charge-discharge operation of the graphite electrode at C-rate of over 5.0 can be achieved using of the high-concentration LiFSI/EMImFSI electrolyte. Considering the low-temperature characteristics in both high-concentration electrolytes, the stable and rapid charge-discharge operation in the high-concentration LiFSI/EMImFSI is presumably attributed to a suitable electrode/electrolyte interface with low resistivity. These results suggest that optimization of the electrolyte composition can realize safe and high-performance lithium-ion batteries that utilize ionic liquid-based electrolytes.

  6. Negatively charged residues of the segment linking the enzyme and cytolysin moieties restrict the membrane-permeabilizing capacity of adenylate cyclase toxin

    PubMed Central

    Masin, Jiri; Osickova, Adriana; Sukova, Anna; Fiser, Radovan; Halada, Petr; Bumba, Ladislav; Linhartova, Irena; Osicka, Radim; Sebo, Peter

    2016-01-01

    The whooping cough agent, Bordetella pertussis, secretes an adenylate cyclase toxin-hemolysin (CyaA) that plays a crucial role in host respiratory tract colonization. CyaA targets CR3-expressing cells and disrupts their bactericidal functions by delivering into their cytosol an adenylate cyclase enzyme that converts intracellular ATP to cAMP. In parallel, the hydrophobic domain of CyaA forms cation-selective pores that permeabilize cell membrane. The invasive AC and pore-forming domains of CyaA are linked by a segment that is unique in the RTX cytolysin family. We used mass spectrometry and circular dichroism to show that the linker segment forms α-helical structures that penetrate into lipid bilayer. Replacement of the positively charged arginine residues, proposed to be involved in target membrane destabilization by the linker segment, reduced the capacity of the toxin to translocate the AC domain across cell membrane. Substitutions of negatively charged residues then revealed that two clusters of negative charges within the linker segment control the size and the propensity of CyaA pore formation, thereby restricting the cell-permeabilizing capacity of CyaA. The ‘AC to Hly-linking segment’ thus appears to account for the smaller size and modest cell-permeabilizing capacity of CyaA pores, as compared to typical RTX hemolysins. PMID:27581058

  7. Folding without charges

    PubMed Central

    Kurnik, Martin; Hedberg, Linda; Danielsson, Jens; Oliveberg, Mikael

    2012-01-01

    Surface charges of proteins have in several cases been found to function as “structural gatekeepers,” which avoid unwanted interactions by negative design, for example, in the control of protein aggregation and binding. The question is then if side-chain charges, due to their desolvation penalties, play a corresponding role in protein folding by avoiding competing, misfolded traps? To find out, we removed all 32 side-chain charges from the 101-residue protein S6 from Thermus thermophilus. The results show that the charge-depleted S6 variant not only retains its native structure and cooperative folding transition, but folds also faster than the wild-type protein. In addition, charge removal unleashes pronounced aggregation on longer timescales. S6 provides thus an example where the bias toward native contacts of a naturally evolved protein sequence is independent of charges, and point at a fundamental difference in the codes for folding and intermolecular interaction: specificity in folding is governed primarily by hydrophobic packing and hydrogen bonding, whereas solubility and binding relies critically on the interplay of side-chain charges. PMID:22454493

  8. A β-integrin from sea cucumber Apostichopus japonicus exhibits LPS binding activity and negatively regulates coelomocyte apoptosis.

    PubMed

    Wang, Zhenhui; Shao, Yina; Li, Chenghua; Lv, Zhimeng; Wang, Haihong; Zhang, Weiwei; Zhao, Xuelin

    2016-05-01

    Integrins are a family of membrane glycoproteins, which are the major receptors for extracellular matrix and cell-cell adhesion molecules. In this study, a 1038 bp sequence representing the full-length cDNA of a novel β-integrin subunit (designated as AjITGB) was cloned from Apostichopus japonicusby using combined transcriptome sequencing and RACE approaches. The deduced amino acid sequence of AjITGB shared a conserved tripeptide Arg-Gly-Asp (RGD) binding domain with an S-diglyceridecysteine or N-Palm cysteine residue (C(31)), a transmembrane domain, and a β-integrin cytoplasmic domain. Spatial distribution analysis showed that AjITGB was constitutively expressed in all tested tissues with dominant expression in the muscles and weak expression in the respiratory tree. The pathogen Vibrio splendidus challenge and LPS stimulation could both significantly down-regulate the mRNA expression of AjITGB. Functional investigation revealed that recombinant AjITGB displayed higher LPS binding activity but lower binding activity to PGN and MAN. More importantly, knockdown of AjITGB by specific siRNA resulted in the significant promotion of coelomocyte apoptosis in vitro. Results indicated that AjITGB may serve as an apoptosis inhibitor with LPS binding activity during host-pathogen interaction in sea cucumber. PMID:26994670

  9. Covalent and non-covalent binding in the ion/ion charge inversion of peptide cations with benzene-disulfonic acid anions.

    PubMed

    Stutzman, John R; Luongo, Carl A; McLuckey, Scott A

    2012-06-01

    Protonated angiotensin II and protonated leucine enkephalin-based peptides, which included YGGFL, YGGFLF, YGGFLH, YGGFLK and YGGFLR, were subjected to ion/ion reactions with the doubly deprotonated reagents 4-formyl-1,3-benzenedisulfonic acid (FBDSA) and 1,3-benzenedisulfonic acid (BDSA). The major product of the ion/ion reaction is a negatively charged complex of the peptide and reagent. Following dehydration of [M + FBDSA-H](-) via collisional-induced dissociation (CID), angiotensin II (DRVYIHPF) showed evidence for two product populations, one in which a covalent modification has taken place and one in which an electrostatic modification has occurred (i.e. no covalent bond formation). A series of studies with model systems confirmed that strong non-covalent binding of the FBDSA reagent can occur with subsequent ion trap CID resulting in dehydration unrelated to the adduct. Ion trap CID of the dehydration product can result in cleavage of amide bonds in competition with loss of the FBDSA adduct. This scenario is most likely for electrostatically bound complexes in which the peptide contains both an arginine residue and one or more carboxyl groups. Otherwise, loss of the reagent species from the complex, either as an anion or as a neutral species, is the dominant process for electrostatically bound complexes. The results reported here shed new light on the nature of non-covalent interactions in gas phase complexes of peptide ions that can be used in the rationale design of reagent ions for specific ion/ion reaction applications. PMID:22707160

  10. Negative electrospray ionization on porous supporting tips for mass spectrometric analysis: electrostatic charging effect on detection sensitivity and its application to explosive detection.

    PubMed

    Wong, Melody Yee-Man; Man, Sin-Heng; Che, Chi-Ming; Lau, Kai-Chung; Ng, Kwan-Ming

    2014-03-21

    The simplicity and easy manipulation of a porous substrate-based ESI-MS technique have been widely applied to the direct analysis of different types of samples in positive ion mode. However, the study and application of this technique in negative ion mode are sparse. A key challenge could be due to the ease of electrical discharge on supporting tips upon the application of negative voltage. The aim of this study is to investigate the effect of supporting materials, including polyester, polyethylene and wood, on the detection sensitivity of a porous substrate-based negative ESI-MS technique. By using nitrobenzene derivatives and nitrophenol derivatives as the target analytes, it was found that the hydrophobic materials (i.e., polyethylene and polyester) with a higher tendency to accumulate negative charge could enhance the detection sensitivity towards nitrobenzene derivatives via electron-capture ionization; whereas, compounds with electron affinities lower than the cut-off value (1.13 eV) were not detected. Nitrophenol derivatives with pKa smaller than 9.0 could be detected in the form of deprotonated ions; whereas polar materials (i.e., wood), which might undergo competitive deprotonation with the analytes, could suppress the detection sensitivity. With the investigation of the material effects on the detection sensitivity, the porous substrate-based negative ESI-MS method was developed and applied to the direct detection of two commonly encountered explosives in complex samples. PMID:24492411

  11. Energy spectra of single neutrons and charged particles emitted following the absorption of stopped negative pions in 4He

    NASA Astrophysics Data System (ADS)

    Cernigoi, C.; Gabrielli, I.; Grion, N.; Pauli, G.; Saitta, B.; Ricci, R. A.; Boccaccio, P.; Viesti, G.

    1981-02-01

    Energy spectra have been measured of single neutrons, protons and deuterons emitted following the capture at rest of negative pions in 4He. The neutron energy spectrum has been measured with an energy resolution of 4% at 90 MeV. The absolute number of stopped pions has been measured.

  12. Impact of negative affectively charged stimuli and response style on cognitive-control-related neural activation: An ERP study

    PubMed Central

    Lamm, C.; Pine, D. S.; Fox, N. A.

    2013-01-01

    The canonical AX-CPT task measures two forms of cognitive control: sustained goal-oriented control (“proactive” control) and transient changes in cognitive control following unexpected events (“reactive” control). We modified this task by adding negative and neutral International Affective Picture System (IAPS) pictures to assess the effects of negative emotion on these two forms of cognitive control. Proactive and reactive control styles were assessed based on measures of behavior and electrophysiology, including the N2 event-related potential component and source space activation (Low Resolution Tomography [LORETA]). We found slower reaction-times and greater DLPFC activation for negative relative to neutral stimuli. Additionally, we found that a proactive style of responding was related to less prefrontal activation (interpreted to reflect increased efficiency of processing) during actively maintained previously cued information and that a reactive style of responding was related to less prefrontal activation (interpreted to reflect increased efficiency of processing) during just-in-time environmentally triggered information. This pattern of results was evident in relatively neutral contexts, but in the face of negative emotion, these associations were not found, suggesting potential response style-by-emotion interaction effects on prefrontal neural activation PMID:24021156

  13. Double mutagenesis of a positive charge cluster in the ligand-binding site of the ferric enterobactin receptor, FepA.

    PubMed

    Newton, S M; Allen, J S; Cao, Z; Qi, Z; Jiang, X; Sprencel, C; Igo, J D; Foster, S B; Payne, M A; Klebba, P E

    1997-04-29

    Siderophores and colicins enter bacterial cells through TonB-dependent outer membrane proteins. Using site-directed substitution mutagenesis, we studied ligand recognition by a prototypic Escherichia coli siderophore receptor, FepA, that binds the iron chelate ferric enterobactin and colicins B and D. These genetic experiments identified a common binding site for two of the three ligands, containing multiple positive charges, within cell surface residues of FepA. Elimination of single residues in this region did not impair the adsorption or transport of ferric enterobactin, but double mutagenesis in the charge cluster identified amino acids (Arg-286 and Arg-316) that participate in siderophore binding and function in FepA-mediated killing by colicins B and D. Ferric enterobactin binding, furthermore, prevented covalent modification of FepA within this domain by either a fluorescent probe or an arginine-specific reagent, corroborating the involvement of this site in ligand recognition. These results identify, for the first time, residues in a TonB-dependent outer membrane protein that participate in ligand binding. They also explain the competition between ferric enterobactin and the colicins on the bacterial cell surface: all three ligands interact with the same arginine residues within FepA during their penetration through the outer membrane. PMID:9114029

  14. Positively-Charged Semi-Tunnel Is a Structural and Surface Characteristic of Polyphosphate-Binding Proteins: An In-Silico Study

    PubMed Central

    Wei, Zheng Zachory; Vatcher, Greg; Tin, Alvin Hok Yan; Teng, Jun Lin; Wang, Juan; Cui, Qing Hua; Chen, Jian Guo; Yu, Albert Cheung Hoi

    2015-01-01

    Phosphate is essential for all major life processes, especially energy metabolism and signal transduction. A linear phosphate polymer, polyphosphate (polyP), linked by high-energy phosphoanhydride bonds, can interact with various proteins, playing important roles as an energy source and regulatory factor. However, polyP-binding structures are largely unknown. Here we proposed a putative polyP binding site, a positively-charged semi-tunnel (PCST), identified by surface electrostatics analyses in polyP kinases (PPKs) and many other polyP-related proteins. We found that the PCSTs in varied proteins were folded in different secondary structure compositions. Molecular docking calculations revealed a significant value for binding affinity to polyP in PCST-containing proteins. Utilizing the PCST identified in the β subunit of PPK3, we predicted the potential polyP-binding domain of PPK3. The discovery of this feature facilitates future searches for polyP-binding proteins and discovery of the mechanisms for polyP-binding activities. This should greatly enhance the understanding of the many physiological functions of protein-bound polyP and the involvement of polyP and polyP-binding proteins in various human diseases. PMID:25879219

  15. A model for the abrogation of the SOS response by an SOS protein: a negatively charged helix in DinI mimics DNA in its interaction with RecA

    PubMed Central

    Voloshin, Oleg N.; Ramirez, Benjamin E.; Bax, Ad; Camerini-Otero, R. Daniel

    2001-01-01

    DinI is a recently described negative regulator of the SOS response in Escherichia coli. Here we show that it physically interacts with RecA and prevents the binding of single-stranded DNA to RecA, which is required for the activation of the latter. DinI also displaces ssDNA from a stable RecA–DNA cofilament, thus eliminating the SOS signal. In addition, DinI inhibits RecA-mediated homologous DNA pairing, but has no effect on actively proceeding strand exchange. Biochemical data, together with the molecular structure, define the C-terminal α-helix in DinI as the active site of the protein. In an unusual example of molecular mimicry, a negatively charged surface on this α-helix, by imitating single-stranded DNA, interacts with the loop L2 homologous pairing region of RecA and interferes with the activation of RecA. PMID:11230150

  16. Enhancement of NK Cell Cytotoxicity Induced by Long-Term Living in Negatively Charged-Particle Dominant Indoor Air-Conditions

    PubMed Central

    Nishimura, Yasumitsu; Takahashi, Kazuaki; Mase, Akinori; Kotani, Muneo; Ami, Kazuhisa; Maeda, Megumi; Shirahama, Takashi; Lee, Suni; Matsuzaki, Hidenori; Kumagai-Takei, Naoko; Yoshitome, Kei; Otsuki, Takemi

    2015-01-01

    Investigation of house conditions that promote health revealed that negatively charged-particle dominant indoor air-conditions (NCPDIAC) induced immune stimulation. Negatively charged air-conditions were established using a fine charcoal powder on walls and ceilings and utilizing forced negatively charged particles (approximate diameter: 20 nm) dominant in indoor air-conditions created by applying an electric voltage (72 V) between the backside of the walls and the ground. We reported previously that these conditions induced a slight and significant increase of interleukin-2 during a 2.5-h stay and an increase of NK cell cytotoxicity when examining human subjects after a two-week night stay under these conditions. In the present study, seven healthy volunteers had a device installed to create NCPDIAC in the living or sleeping rooms of their own homes. Every three months the volunteers then turned the NCPDIAC device on or off. A total of 16 ON and 13 OFF trials were conducted and their biological effects were analyzed. NK activity increased during ON trials and decreased during OFF trials, although no other adverse effects were found. In addition, there were slight increases of epidermal growth factor (EGF) during ON trials. Furthermore, a comparison of the cytokine status between ON and OFF trials showed that basic immune status was stimulated slightly during ON trials under NCPIADC. Our overall findings indicate that the NCPDIAC device caused activation of NK activity and stimulated immune status, particularly only on NK activity, and therefore could be set in the home or office buildings. PMID:26173062

  17. Influence of expander components on the processes at the negative plates of lead-acid cells on high-rate partial-state-of-charge cycling. Part I: Effect of lignosulfonates and BaSO 4 on the processes of charge and discharge of negative plates

    NASA Astrophysics Data System (ADS)

    Pavlov, D.; Nikolov, P.; Rogachev, T.

    This study investigates the influence of the organic expander component (Vanisperse A) and of BaSO 4 on the performance of negative lead-acid battery plates on high-rate partial-state-of-charge (HRPSoC) cycling. Batteries operating in the HRPSoC mode should be classified as a separate type of lead-acid batteries. Hence, the additives to the negative plates should differ from the conventional expander composition. It has been established that lignosulfonates are adsorbed onto the lead surface and thus impede the charge processes, which results in impaired reversibility of the charge-discharge processes and hence shorter cycle life on HRPSoC operation, limited by sulfation of the negative plates. BaSO 4 exerts the opposite effect: it improves the reversibility of the processes in the HRPSoC mode and hence prolongs the cycle life of the cells. The most pronounced effect of BaSO 4 has been registered when it is added in concentration of 1.0 wt.% versus the leady oxide (LO) used for paste preparation. It has also been established that BaSO 4 lowers the overpotential of PbSO 4 nucleation. The results of the present investigation indicate that BaSO 4 affects also the crystallization process of Pb during cell charging. Thus, BaSO 4 eventually improves the performance characteristics of lead-acid cells on HRPSoC cycling.

  18. Negative regulation of the rat stromelysin gene promoter by retinoic acid is mediated by an AP1 binding site.

    PubMed Central

    Nicholson, R C; Mader, S; Nagpal, S; Leid, M; Rochette-Egly, C; Chambon, P

    1990-01-01

    Stromelysin is a member of the metalloproteinase family which plays an important role in extracellular matrix remodelling during many normal and disease processes. We show here that in polyomavirus-transformed rat embryo fibroblast cells (PyT21), the transcription from the stromelysin gene is repressed by the vitamin A derivative retinoic acid (RA). Furthermore, expression vectors encoding the human RA receptors hRAR-alpha, hRAR-beta and hRAR-gamma repress chloramphenicol acetyltransferase (CAT) expression from stromelysin promoter-CAT gene expression vectors in RA-treated PyT21 and human HeLa cells, as determined by transient transfection assays. Through mutation and deletion analysis, we show that the RA dependent repression is mediated by a 25 bp region from nucleotide positions -72 to -48 of the rat stromelysin 5'-flanking DNA sequence. Further mutation analysis of this region indicates that the DNA sequence required for RA dependent repression colocalizes with an AP1 binding site which is essential for promoter activity. We show also that RA represses the transcriptional activity of a reporter gene containing a TPA responding AP1 binding site driving the HSV tk promoter. Thus the RAR-RA complex appears to repress transcription of the stromelysin gene by blocking activation by positive regulatory factors. However, we found no evidence supporting the possibility that the RA dependent repression could be due to RAR binding to the AP1 binding site or to the AP1 components c-fos and c-jun. Images Fig. 1. Fig. 2. Fig. 4. Fig. 6. Fig. 7. Fig. 8. PMID:2176152

  19. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9.

    PubMed

    Zhang, Ruoxi; Fang, Liurong; Wang, Dang; Cai, Kaimei; Zhang, Huan; Xie, Lilan; Li, Yi; Chen, Huanchun; Xiao, Shaobo

    2015-11-01

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9). Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. PMID:26342467

  20. Oxidation of p53 through DNA charge transport involves a network of disulfides within the DNA-binding domain.

    PubMed

    Schaefer, Kathryn N; Geil, Wendy M; Sweredoski, Michael J; Moradian, Annie; Hess, Sonja; Barton, Jacqueline K

    2015-01-27

    Transcription factor p53 plays a critical role in the cellular response to stress stimuli. We have seen that p53 dissociates selectively from various promoter sites as a result of oxidation at long-range through DNA-mediated charge transport (CT). Here, we examine this chemical oxidation and determine the residues in p53 that are essential for oxidative dissociation, focusing on the network of cysteine residues adjacent to the DNA-binding site. Of the eight mutants studied, only the C275S mutation shows decreased affinity for the Gadd45 promoter site. However, both mutations C275S and C277S result in substantial attenuation of oxidative dissociation, with C275S causing the most severe attenuation. Differential thiol labeling was used to determine the oxidation states of cysteine residues within p53 after DNA-mediated oxidation. Reduced cysteines were iodoacetamide-labeled, whereas oxidized cysteines participating in disulfide bonds were (13)C2D2-iodoacetamide-labeled. Intensities of respective iodoacetamide-modified peptide fragments were analyzed by mass spectrometry. A distinct shift in peptide labeling toward (13)C2D2-iodoacetamide-labeled cysteines is observed in oxidized samples, confirming that chemical oxidation of p53 occurs at long range. All observable cysteine residues trend toward the heavy label under conditions of DNA CT, indicating the formation of multiple disulfide bonds among the cysteine network. On the basis of these data, it is proposed that disulfide formation involving C275 is critical for inducing oxidative dissociation of p53 from DNA. PMID:25584637

  1. Charge effect on the photoinactivation of Gram-negative and Gram-positive bacteria by cationic meso-substituted porphyrins

    PubMed Central

    2009-01-01

    Background In recent times photodynamic antimicrobial therapy has been used to efficiently destroy Gram (+) and Gram (-) bacteria using cationic porphyrins as photosensitizers. There is an increasing interest in this approach, namely in the search of photosensitizers with adequate structural features for an efficient photoinactivation process. In this study we propose to compare the efficiency of seven cationic porphyrins differing in meso-substituent groups, charge number and charge distribution, on the photodynamic inactivation of a Gram (+) bacterium (Enterococcus faecalis) and of a Gram (-) bacterium (Escherichia coli). The present study complements our previous work on the search for photosensitizers that might be considered good candidates for the photoinactivation of a large spectrum of environmental microorganisms. Results Bacterial suspension (107 CFU mL-1) treated with different photosensitizers concentrations (0.5, 1.0 and 5.0 μM) were exposed to white light (40 W m-2) for a total light dose of 64.8 J cm-2. The most effective photosensitizers against both bacterial strains were the Tri-Py+-Me-PF and Tri-Py+-Me-CO2Me at 5.0 μM with a light fluence of 64.8 J cm-2, leading to > 7.0 log (> 99,999%) of photoinactivation. The tetracationic porphyrin also proved to be a good photosensitizer against both bacterial strains. Both di-cationic and the monocationic porphyrins were the least effective ones. Conclusion The number of positive charges, the charge distribution in the porphyrins' structure and the meso-substituent groups seem to have different effects on the photoinactivation of both bacteria. As the Tri-Py+-Me-PF porphyrin provides the highest log reduction using lower light doses, this photosensitizer can efficiently photoinactivate a large spectrum of environmental bacteria. The complete inactivation of both bacterial strains with low light fluence (40 W m-2) means that the photodynamic approach can be applied to wastewater treatment under natural

  2. Balancing charge in the complementarity-determining regions of humanized mAbs without affecting pI reduces non-specific binding and improves the pharmacokinetics

    PubMed Central

    Datta-Mannan, Amita; Thangaraju, Arunkumar; Leung, Donmienne; Tang, Ying; Witcher, Derrick R; Lu, Jirong; Wroblewski, Victor J

    2015-01-01

    Lowering the isoelectric point (pI) through engineering the variable region or framework of an IgG can improve its exposure and half-life via a reduction in clearance mediated through non-specific interactions. As such, net charge is a potentially important property to consider in developing therapeutic IgG molecules having favorable pharmaceutical characteristics. Frequently, it may not be possible to shift the pI of monoclonal antibodies (mAbs) dramatically without the introduction of other liabilities such as increased off-target interactions or reduced on-target binding properties. In this report, we explored the influence of more subtle modifications of molecular charge on the in vivo properties of an IgG1 and IgG4 monoclonal antibody. Molecular surface modeling was used to direct residue substitutions in the complementarity-determining regions (CDRs) to disrupt positive charge patch regions, resulting in a reduction in net positive charge without affecting the overall pI of the mAbs. The effect of balancing the net positive charge on non-specific binding was more significant for the IgG4 versus the IgG1 molecule that we examined. This differential effect was connected to the degree of influence on cellular degradation in vitro and in vivo clearance, distribution and metabolism in mice. In the more extreme case of the IgG4, balancing the charge yielded an ∼7-fold improvement in peripheral exposure, as well as significantly reduced tissue catabolism and subsequent excretion of proteolyzed products in urine. Balancing charge on the IgG1 molecule had a more subtle influence on non-specific binding and yielded only a modest alteration in clearance, distribution and elimination. These results suggest that balancing CDR charge without affecting the pI can lead to improved mAb pharmacokinetics, the magnitude of which is likely dependent on the relative influence of charge imbalance and other factors affecting the molecule's disposition. PMID:25695748

  3. Ubiquitous and neuronal DNA-binding proteins interact with a negative regulatory element of the human hypoxanthine phosphoribosyltransferase gene.

    PubMed Central

    Rincón-Limas, D E; Amaya-Manzanares, F; Niño-Rosales, M L; Yu, Y; Yang, T P; Patel, P I

    1995-01-01

    The hypoxanthine phosphoribosyltransferase (HPRT) gene is constitutively expressed at low levels in all tissues but at higher levels in the brain; the significance and mechanism of this differential expression are unknown. We previously identified a 182-bp element (hHPRT-NE) within the 5'-flanking region of the human HPRT (hHPRT) gene, which is involved not only in conferring neuronal specificity but also in repressing gene expression in nonneuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation. We also mapped the binding sites for both complexes to a 60-bp region (Ff; positions -510 to -451) which, when analyzed in transfection assays, functioned as a repressor element analogous to the full-length hHPRT-NE sequence. Methylation interference footprintings revealed a minimal unique DNA motif, 5'-GGAAGCC-3', as the binding site for nuclear proteins from both neuronal and nonneuronal sources. However, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the associations of these two complexes. Moreover, UV cross-linking experiments showed that both complexes are formed by the association of several different proteins. Taken together, these data suggest that differential interaction of DNA-binding factors with this regulatory element plays a crucial role in the brain-preferential expression of the gene, and they should lead to the isolation of transcriptional regulators important in neuronal expression of the HPRT gene. PMID:8524221

  4. The negative effects of exogenous DNA binding on porcine spermatozoa are caused by removal of seminal fluid.

    PubMed

    Kang, J H; Hakimov, H; Ruiz, A; Friendship, R M; Buhr, M; Golovan, S P

    2008-11-01

    Sperm-mediated gene transfer (SMGT) might become the most efficient and cost effective technique to generate transgenic animals, which will significantly increase their application in biomedical research and in commercial production. Despite some successes, the technique has remained controversial for almost 20 years and despite number of studies the reasons for poor reproducibility of this promising technology has not been understood. We suggest that the reason for poor reproducibility is the presence of natural defences against exogenous DNA invasion acting in spermatozoa or in embryo. Based on previous reports we have investigated the effect of foreign DNA binding on spermatozoa by monitoring motility, viability and genomic DNA damage. Evaluation of DNA binding in sperm collected from 16 boars demonstrated that 28-45% of the added pEGFP plasmid was bound to spermatozoa with 9-32% being internalized in sperm nucleus. In agreement with previous reports, our results demonstrated that the pEGFP-treated sperm show an average a 2-fold decrease in motility (p<0.05), 5-fold decrease in progressive motility (p<0.05), and 1.4-fold increase in number of sperm with highly damaged DNA (p<0.05) as detected by Comet assay. In contrast with previous reports, we demonstrate that all such changes were associated with the removal of seminal plasma during the washing step and not with foreign DNA binding per se. We suggest that poor reproducibility of SMGT most likely result from selection against DNA-loaded sperm at later stages of fertilization. PMID:18653226

  5. The FasX Small Regulatory RNA Negatively Regulates the Expression of Two Fibronectin-Binding Proteins in Group A Streptococcus

    PubMed Central

    Danger, Jessica L.; Makthal, Nishanth; Kumaraswami, Muthiah

    2015-01-01

    ABSTRACT The group A Streptococcus (GAS; Streptococcus pyogenes) causes more than 700 million human infections each year. The success of this pathogen can be traced in part to the extensive arsenal of virulence factors that are available for expression in temporally and spatially specific manners. To modify the expression of these virulence factors, GAS use both protein- and RNA-based regulators, with the best-characterized RNA-based regulator being the small regulatory RNA (sRNA) FasX. FasX is a 205-nucleotide sRNA that contributes to GAS virulence by enhancing the expression of the thrombolytic secreted virulence factor streptokinase and by repressing the expression of the collagen-binding cell surface pili. Here, we have expanded the FasX regulon, showing that this sRNA also negatively regulates the expression of the adhesion- and internalization-promoting, fibronectin-binding proteins PrtF1 and PrtF2. FasX posttranscriptionally regulates the expression of PrtF1/2 through a mechanism that involves base pairing to the prtF1 and prtF2 mRNAs within their 5′ untranslated regions, overlapping the mRNA ribosome-binding sites. Thus, duplex formation between FasX and the prtF1 and prtF2 mRNAs blocks ribosome access, leading to an inhibition of mRNA translation. Given that FasX positively regulates the expression of the spreading factor streptokinase and negatively regulates the expression of the collagen-binding pili and of the fibronectin-binding PrtF1/2, our data are consistent with FasX functioning as a molecular switch that governs the transition of GAS between the colonization and dissemination stages of infection. IMPORTANCE More than half a million deaths each year are a consequence of infections caused by GAS. Insights into how this pathogen regulates the production of proteins during infection may facilitate the development of novel therapeutic or preventative regimens aimed at inhibiting this activity. Here, we have expanded insight into the regulatory

  6. A cluster of negative charges at the amino terminal tail of CFTR regulates ATP-dependent channel gating

    PubMed Central

    Fu, Jian; Ji, Hong-Long; Naren, Anjaparavanda P; Kirk, Kevin L

    2001-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is activated by protein kinase A (PKA) phosphorylation of its R domain and by ATP binding at its nucleotide-binding domains (NBDs). Here we investigated the functional role of a cluster of acidic residues in the amino terminal tail (N-tail) that also modulate CFTR channel gating by an unknown mechanism.A disease-associated mutant that lacks one of these acidic residues (D58N CFTR) exhibited lower macroscopic currents in Xenopus oocytes and faster deactivation following washout of a cAMP -activating cocktail than wild-type CFTR.In excised membrane patches D58N CFTR exhibited a two-fold reduction in single channel open probability due primarily to shortened open channel bursts.Replacing this and two nearby acidic residues with alanines (D47A, E54A, D58A) also reduced channel activity, but had negligible effects on bulk PKA phosphorylation or on the ATP dependence of channel activation.Conversely, the N-tail triple mutant exhibited a markedly inhibited response to AMP-PNP, a poorly hydrolysable ATP analogue that can nearly lock open the wild-type channel. The N-tail mutant had both a slower response to AMP-PNP (activation half-time of 140 ± 20 s vs. 21 ± 4 s for wild type) and a lower steady-state open probability following AMP-PNP addition (0.68 ± 0.08 vs. 0.92 ± 0.03 for wild type).Introducing the N-tail mutations into K1250A CFTR, an NBD2 hydrolysis mutant that normally exhibits very long open channel bursts, destabilized the activity of this mutant as evidenced by decreased macroscopic currents and shortened open channel bursts.We propose that this cluster of acidic residues modulates the stability of CFTR channel openings at a step that is downstream of ATP binding and upstream of ATP hydrolysis, probably at NBD2. PMID:11600681

  7. Annexin A2 binds to endosomes and negatively regulates TLR4-triggered inflammatory responses via the TRAM-TRIF pathway

    PubMed Central

    Zhang, Shuang; Yu, Min; Guo, Qiang; Li, Rongpeng; Li, Guobo; Tan, Shirui; Li, Xuefeng; Wei, Yuquan; Wu, Min

    2015-01-01

    Lipopolysaccharide (LPS) derived from Gram-negative bacteria activates plasma membrane signaling via Toll-like receptor 4 (TLR4) on host cells and triggers innate inflammatory responses, but the underlying mechanisms remain to be fully elucidated. Here we reveal a role for annexin A2 (AnxA2) in host defense against infection as anxa2−/− mice were highly susceptible to Gram-negative bacteria-induced sepsis with enhanced inflammatory responses. Computing analysis and biochemical experiments identified that constitutive AnxA2 expression facilitated TLR4 internalization and its subsequent translocation into early endosomal membranes. It activated the TRAM-dependent endosomal signaling, leading to the release of anti-inflammatory cytokines. Importantly, AnxA2 deficiency prolonged TLR4-mediated signaling from the plasma membrane, which was attributable to pro-inflammatory cytokine production (IL-6, TNFα and IL-1β). Thus, AnxA2 directly exerted negative regulation of inflammatory responses through TLR4-initiated TRAM-TRIF pathway occurring on endosomes. This study reveals AnxA2 as a critical regulator in infection-initiated inflammation, which protects the host from excessive inflammatory damage. PMID:26527544

  8. Quantitative Estimation of Aluminum-Induced Negative Charge Region Top Area of SiO2 Based on Frequency-Dependent AC Surface Photovoltage

    NASA Astrophysics Data System (ADS)

    Shimizu, Hirofumi; Wakashima, Hiroya; Ishikawa, Takuma; Ikeda, Masanori

    2007-11-01

    Most aluminum (Al) in Al-contaminated and thermally oxidized n-type silicon (Si) dioxide (SiO2) is clarified to be segregated at the very top area of SiO2, causing a negative charge, as has been suggested by the formation of an (AlOSi)- network and/or AlO2- based on AC surface photovoltage (SPV). For a strongly inverted state at an oxidation temperature of 800 °C for 1 h, the thickness of the Al-induced negative charge region is quantitatively determined to be 2.4 nm on the basis of AC SPV after successive step etching and chemical analysis. As oxidation duration increased at 800 °C for 3 h, the strongly inverted state changed into a weakly inverted state, where the thickness of the Al-rich region is reduced (0.8 nm), proving that more than half of the (AlOSi)- network collapse and/or Al diffuses inside SiO2 during a longer oxidation duration.

  9. Lactosylated PLGA nanoparticles containing ϵ-polylysine for the sustained release and liver-targeted delivery of the negatively charged proteins.

    PubMed

    Zhou, Ping; An, Tong; Zhao, Chuan; Li, Yuan; Li, Rongshan; Yang, Rui; Wang, Yinsong; Gao, Xiujun

    2015-01-30

    The acidic internal pH environment, initial burst release and lack of targeting property are main limitations of poly(lactide-co-glycolide) (PLGA) nanoparticles for carrying proteins. In this study, ϵ-polylysine (ϵ-PL) was used as an anti-acidic agent and a protein protectant to prepare PLGA nanoparticles for the protein delivery. To obtain the liver-targeting capability, lactosylated PLGA (Lac-PLGA) was synthesized by conjugation of lactose acid to PLGA at both ends, and then used to prepare nanoparticles containing ϵ-PL by the nanoprecipitation method. Bovine serumal bumin (BSA), a negatively charged protein, was efficiently loaded into Lac-PLGA/ϵ-PL nanoparticles and exhibited significant decreased burst release in vitro, sustained release in the blood and increased liver distribution in mice after intravenous injections. The enhanced stability of BSA was due to its electrical interaction with ϵ-PL and the neutralized internal environment of nanoparticles. In conclusion, Lac-PLGA/ϵ-PL nanoparticle system can be used as a promising carrier for the negatively charged proteins. PMID:25510599

  10. Neutral Sites for Calcium Ion Binding to Elastin and Collagen: A Charge Neutralization Theory for Calcification and Its Relationship to Atherosclerosis

    PubMed Central

    Urry, D. W.

    1971-01-01

    Neutral, uncharged binding sites for calcium ions are proposed for elastin and collagen. The sites utilize, particularly from a conformational viewpoint, the most striking feature of the amino acid composition, that is, the high glycine content. Glycines favor the formation of β-turns and associated conformations that are known, from studies on ion-transporting antibiotics, to interact with cations. By analogy with certain antibiotics, which are uncharged polypeptides and depsipeptides that bind cations by coordination with neutral acyl oxygens, it is proposed that calcium-ion binding also utilizes uncharged coordinating groups, i.e., neutral sites, in the protein matrix. The protein matrix, which becomes positively charged by virtue of the bound calcium ions, attracts neutralizing phosphate and carbonate ions, which then allow further calcium ion binding. The driving force is, therefore, the affinity of calcium ions for the neutral nucleation sites. The charge neutralization theory of calcification suggests a fundamental role of organic anions, for example sulfated mucopolysaccharides, in regulating bone formation and in retardation of atherosclerosis. The proposed mechanism contains elements that tend to unify several theories on the pathogenesis of atherosclerosis. PMID:4251554

  11. Quantitative Estimation of the Metal-Induced Negative Oxide Charge Density in n-Type Silicon Wafers from Measurements of Frequency-Dependent AC Surface Photovoltage

    NASA Astrophysics Data System (ADS)

    Shimizu, Hirofumi; Shin, Ryuhei; Ikeda, Masanori

    2006-03-01

    A quantitative estimation of metal-induced oxide charge (Qmi) density is performed on the surface of n-type silicon (Si) wafers rinsed with trivalent aluminum (Al)- and iron (Fe)-contaminated RCA alkaline solution by analyzing the frequency-dependent AC surface photovoltage (SPV). Qmi arises from (AlOSi)- or (FeOSi)- networks in native oxide which are responsible for inducing negative oxide charge. On the basis of Munakata and Nishimatsu’s half-sided junction model [C. Munakata and S. Nishimatsu: Jpn. J. Appl. Phys. 25 (1986) 807], the network densities are estimated in depletion and/or weak inversion in which the cutoff frequencies of the frequency-dependent AC SPV curves are defined. It is found that the charge density Qmi increases with the time of exposure to air and it is calculated that about 4% of Al atoms in the native oxide are activated in the form of an (AlOSi)- network for 1 h of exposure. The (FeOSi)- network density is calculated as a function of Fe concentration. As a result, the frequency-dependent AC SPV measurements carried out here enable a successful evaluation of impurity level in a nondestructive and noncontact manner.

  12. Fixed negative charge and the Donnan effect: a description of the driving forces associated with brain tissue swelling and oedema

    PubMed Central

    Elkin, Benjamin S.; Shaik, Mohammed A.; Morrison, Barclay

    2010-01-01

    Cerebral oedema or brain tissue swelling is a significant complication following traumatic brain injury or stroke that can increase the intracranial pressure (ICP) and impair blood flow. Here, we have identified a potential driver of oedema: the negatively charged molecules fixed within cells. This fixed charge density (FCD), once exposed, could increase ICP through the Donnan effect. We have shown that metabolic processes and membrane integrity are required for concealing this FCD as slices of rat cortex swelled immediately (within 30 min) following dissection if treated with 2 deoxyglucose + cyanide (2DG+CN) or Triton X-100. Slices given ample oxygen and glucose, however, did not swell significantly. We also found that dead brain tissue swells and shrinks in response to changes in ionic strength of the bathing medium, which suggests that the Donnan effect is capable of pressurizing and swelling brain tissue. As predicted, a non-ionic osmolyte, 1,2 propanediol, elicited no volume change at 2000×10−3 osmoles l−1 (Osm). Swelling data were well described by triphasic mixture theory with the calculated reference state FCD similar to that measured with a 1,9 dimethylmethylene blue assay. Taken together, these data suggest that intracellular fixed charges may contribute to the driving forces responsible for brain swelling. PMID:20047940

  13. Differential DNA and RNA sequence discrimination by PNA having charged side chains.

    PubMed

    De Costa, N Tilani S; Heemstra, Jennifer M

    2014-05-15

    PNA sequences modified with charged side chains were evaluated for base-pairing sequence selectivity under physiological conditions. PNA having negatively charged aspartic acid side chains shows higher selectivity with RNA, while PNA having positively charged lysine side chains shows higher selectivity with DNA. These observations provide insight into the binding selectivity of modified PNA in antisense and antigene applications. PMID:24731279

  14. Kinetic instability of the dust acoustic mode in inhomogeneous, partially magnetized plasma with both positively and negatively charged grains

    SciTech Connect

    Vranjes, J.; Poedts, S.

    2010-08-15

    A purely kinetic instability of the dust acoustic mode in inhomogeneous plasmas is discussed. In the presence of a magnetic field, electrons and ions may be magnetized while at the same time dust grains may remain unmagnetized. Although the dynamics of the light species is strongly affected by the magnetic field, the dust acoustic mode may still propagate in practically any direction. The inhomogeneity implies a source of free energy for an instability that develops through the diamagnetic drift effects of the magnetized species. It is shown that this may be a powerful mechanism for the excitation of dust acoustic waves. The analysis presented in the work is also directly applicable to plasmas containing both positive and negative ions and electrons, provided that at least one of the two ion species is unmagnetized.

  15. The protein kinase CK2 phosphorylates SNAP190 to negatively regulate SNAPC DNA binding and human U6 transcription by RNA polymerase III.

    PubMed

    Gu, Liping; Husain-Ponnampalam, Rhonda; Hoffmann-Benning, Susanne; Henry, R William

    2007-09-21

    Human U6 small nuclear RNA gene transcription by RNA polymerase III requires the general transcription factor SNAP(C), which binds to human small nuclear RNA core promoter elements and nucleates pre-initiation complex assembly with the Brf2-TFIIIB complex. Multiple components in this pathway are phosphorylated by the protein kinase CK2, including the Bdp1 subunit of the Brf2-TFIIIB complex, and RNA polymerase III, with negative and positive outcomes for U6 transcription, respectively. However, a role for CK2 phosphorylation of SNAP(C) in U6 transcription has not been defined. In this report, we investigated the role of CK2 in modulating the transcriptional properties of SNAP(C) and demonstrate that within SNAP(C), CK2 phosphorylates the N-terminal half of the SNAP190 subunit at two regions (amino acids 20-63 and 514-545) that each contain multiple CK2 consensus sites. SNAP190 phosphorylation by CK2 inhibits both SNAP(C) DNA binding and U6 transcription activity. Mutational analyses of SNAP190 support a model wherein CK2 phosphorylation triggers an allosteric inhibition of the SNAP190 Myb DNA binding domain. PMID:17670747

  16. A photoelectron spectroscopy and ab initio study of B21-: Negatively charged boron clusters continue to be planar at 21

    SciTech Connect

    Piazza, Zachary A.; Li, Wei-Li; Romanescu, Constantin; Sergeeva, Alina P.; Wang, Lai-Sheng; Boldyrev, Alexander I.

    2012-01-01

    The structures and chemical bonding of the B21- cluster have been investigated by a combined photoelectron spectroscopy and ab initio study. The photoelectron spectrum at 193 nm revealed a very high adiabatic electron binding energy of 4.38 eV for B21- and a congested spectral pattern. Extensive global minimum searches were conducted using two different methods, followed by high-level calculations of the low-lying isomers. The global minimum of B21- was found to be a quasiplanar structure with the next low-lying planar isomer only 1.9 kcal/mol higher in energy at the CCSD(T)/6-311-G* level of theory. The calculated vertical detachment energies for the two isomers were found to be in good agreement with the experimental spectrum, suggesting that they were both present experimentally and contributed to the observed spectrum. Chemical bonding analyses showed that both isomers consist of a 14-atom periphery, which is bonded by classical two-center two-electron bonds, and seven interior atoms in the planar structures. A localized two-center two-electron bond is found in the interior of the two planar isomers, in addition to delocalized multi-center σ and π bonds. The structures and the delocalized bonding of the two lowest lying isomers of B21- were found to be similar to those in the two lowest energy isomers in B19-.

  17. Development of additives in negative active-material to suppress sulfation during high-rate partial-state-of-charge operation of lead-acid batteries

    NASA Astrophysics Data System (ADS)

    Sawai, Ken; Funato, Takayuki; Watanabe, Masashi; Wada, Hidetoshi; Nakamura, Kenji; Shiomi, Masaaki; Osumi, Shigeharu

    Additives in the negative active-material of lead-acid batteries were examined to determine whether they could prevent progressive accumulation of lead sulfate (PbSO 4) in negative plates during high-rate partial-state-of-charge (HRPSoC) operation. This phenomenon is caused by progressive growth of PbSO 4 particles and a lack of conductive paths near these PbSO 4 particles. Barium sulfate (BaSO 4) particles in various sizes and synthetic lignin were added to the negative active-material to control PbSO 4 particle size during HRPSoC cycle-life. Some types of carbon fibres were also added to form conductive paths around the PbSO 4 particles. Synthetic lignin was found to be the most effective additive for improving battery life in HRPSoC cycle-life tests, whereas the other factors such as BaSO 4 size or carbon fibre extended less influence. The growth rate of PbSO 4 particles per cycle was much lower in a cell with synthetic lignin than in a cell with natural lignin.

  18. Brain angiogenesis inhibitor 1 (BAI1) is a pattern recognition receptor that mediates macrophage binding and engulfment of Gram-negative bacteria.

    PubMed

    Das, Soumita; Owen, Katherine A; Ly, Kim T; Park, Daeho; Black, Steven G; Wilson, Jeffrey M; Sifri, Costi D; Ravichandran, Kodi S; Ernst, Peter B; Casanova, James E

    2011-02-01

    Bacterial recognition by host cells is essential for initiation of infection and the host response. Bacteria interact with host cells via multiple pattern recognition receptors that recognize microbial products or pathogen-associated molecular patterns. In response to this interaction, host cell signaling cascades are activated that lead to inflammatory responses and/or phagocytic clearance of attached bacteria. Brain angiogenesis inhibitor 1 (BAI1) is a receptor that recognizes apoptotic cells through its conserved type I thrombospondin repeats and triggers their engulfment through an ELMO1/Dock/Rac1 signaling module. Because thrombospondin repeats in other proteins have been shown to bind bacterial surface components, we hypothesized that BAI1 may also mediate the recognition and clearance of pathogenic bacteria. We found that preincubation of bacteria with recombinant soluble BAI1 ectodomain or knockdown of endogenous BAI1 in primary macrophages significantly reduced binding and internalization of the Gram-negative pathogen Salmonella typhimurium. Conversely, overexpression of BAI1 enhanced attachment and engulfment of Salmonella in macrophages and in heterologous nonphagocytic cells. Bacterial uptake is triggered by the BAI1-mediated activation of Rac through an ELMO/Dock-dependent mechanism, and inhibition of the BAI1/ELMO1 interaction prevents both Rac activation and bacterial uptake. Moreover, inhibition of ELMO1 or Rac function significantly impairs the proinflammatory response to infection. Finally, we show that BAI1 interacts with a variety of Gram-negative, but not Gram-positive, bacteria through recognition of their surface lipopolysaccharide. Together these findings identify BAI1 as a pattern recognition receptor that mediates nonopsonic phagocytosis of Gram-negative bacteria by macrophages and directly affects the host response to infection. PMID:21245295

  19. Novel negatively charged hybrids. 3. Removal of Pb2+ from aqueous solution using zwitterionic hybrid polymers as adsorbent.

    PubMed

    Liu, Junsheng; Ma, Yue; Zhang, Yaping; Shao, Guoquan

    2010-01-15

    Using zwitterionic hybrid polymers as adsorbent, the adsorption kinetics and isotherm, thermodynamic parameters of Delta G, Delta H and DeltaS for the removal of Pb(2+) from aqueous solution were investigated. It is indicated that the adsorption of Pb(2+) ions on these zwitterionic hybrid polymers followed the Lagergren second-order kinetic model and Freundlich isotherm model, demonstrating that the adsorption process might be Langmuir monolayer adsorption. The negative values of Delta G and the positive values of Delta H evidence that Pb(2+) adsorption on these zwitterionic hybrid polymers is spontaneous and endothermic process in nature. Moreover, the zwitterionic hybrid polymers produced reveal relatively higher desorption efficiency in 2 mol dm(-3) aqueous HNO(3) solution, indicating that they can be recycled in industrial processes. These findings suggest that these zwitterionic hybrid polymers are the promising adsorbents for Pb(2+) removal and can be potentially applied in the separation and recovery of Pb(2+) ions from the waste chemicals and contaminated water of lead-acid rechargeable battery. PMID:19744785

  20. PEG-b-PCL copolymer micelles with the ability of pH-controlled negative-to-positive charge reversal for intracellular delivery of doxorubicin.

    PubMed

    Deng, Hongzhang; Liu, Jinjian; Zhao, Xuefei; Zhang, Yuming; Liu, Jianfeng; Xu, Shuxin; Deng, Liandong; Dong, Anjie; Zhang, Jianhua

    2014-11-10

    The application of PEG-b-PCL micelles was dampened by their inherent low drug-loading capability and relatively poor cell uptake efficiency. In this study, a series of novel PEG-b-PCL copolymers methoxy poly(ethylene glycol)-b-poly(ε-caprolactone-co-γ-dimethyl maleamidic acid -ε-caprolactone) (mPEG-b-P(CL-co-DCL)) bearing different amounts of acid-labile β-carboxylic amides on the polyester moiety were synthesized. The chain structure and chemical composition of copolymers were characterized by (1)H NMR, Fourier transform infrared spectroscopy (FT-IR), and gel permeation chromatography (GPC). mPEG-b-P(CL-co-DCL) with critical micellar concentrations (CMCs) of 3.2-6.3 μg/mL could self-assemble into stable micelles in water with diameters of 100 to 150 nm. Doxorubicin (DOX), a cationic hydrophobic drug, was successfully encapsulated into the polymer micelles, achieving a very high loading content due to electrostatic interaction. Then the stability, charge-conversional behavior, loading and release profiles, cellular uptake and in vitro cytotoxicity of free drug and drug-loaded micelles were evaluated. The β-carboxylic amides functionalized polymer micelles are negatively charged and stable in neutral solution but quickly become positively charged at pH 6.0, due to the hydrolysis of β-carboxylic amides in acidic conditions. The pH-triggered negative-to-positive charge reversal not only resulted in a very fast drug release in acidic conditions, but also effectively enhanced the cellular uptake by electrostatic absorptive endocytosis. The MTT assay demonstrated that mPEG-b-P(CL-co-DCL) micelles were biocompatible to HepG2 cells while DOX-loaded micelles showed significant cytotoxicity. In sum, the introduction of acid-labile β-carboxylic amides on the polyester block in mPEG-b-P(CL-co-DCL) exhibited great potentials for the modifications in the stability in blood circulation, drug solubilization, and release properties, as well as cell internalization and

  1. Dominant role of local dipolar interactions in phosphate binding to a receptor cleft with an electronegative charge surface: equilibrium, kinetic, and crystallographic studies.

    PubMed Central

    Ledvina, P. S.; Tsai, A. L.; Wang, Z.; Koehl, E.; Quiocho, F. A.

    1998-01-01

    Stringent specificity and complementarity between the receptor, a periplasmic phosphate-binding protein (PBP) with a two-domain structure, and the completely buried and dehydrated phosphate are achieved by hydrogen bonding or dipolar interactions. We recently found that the surface charge potential of the cleft between the two domains that contains the anion binding site is intensely electronegative. This novel finding prompted the study reported here of the effect of ionic strength on the equilibrium and rapid kinetics of phosphate binding. To facilitate this study, Ala197, located on the edge of the cleft, was replaced by a Trp residue (A197W PBP) to generate a fluorescence reporter group. The A197W PBP-phosphate complex retains wild-type Kd and X-ray structure beyond the replacement residue. The Kd (0.18 microM) at no salt is increased by 20-fold at greater than 0.30 M NaCl. Stopped-flow fluorescence kinetic studies indicate a two-step binding process: (1) The phosphate (L) binds, at near diffusion-controlled rate, to the open cleft form (Po) of PBP to produce an intermediate, PoL. This rate decreases with increasing ionic strength. (2) The intermediate isomerizes to the closed-conformation form, PcL. The results indicate that the high specificity, affinity, and rate of phosphate binding are not influenced by the noncomplementary electronegative surface potential of the cleft. That binding depends almost entirely on local dipolar interactions with the receptor has important ramification in electrostatic interactions in protein structures and in ligand recognition. PMID:9865949

  2. Polymorphism rs11085226 in the Gene Encoding Polypyrimidine Tract-Binding Protein 1 Negatively Affects Glucose-Stimulated Insulin Secretion

    PubMed Central

    Heni, Martin; Ketterer, Caroline; Wagner, Robert; Linder, Katarzyna; Böhm, Anja; Herzberg-Schäfer, Silke A.; Machicao, Fausto; Knoch, Klaus-Peter; Fritsche, Andreas; Staiger, Harald; Häring, Hans-Ulrich; Solimena, Michele

    2012-01-01

    Objective Polypyrimidine tract-binding protein 1 (PTBP1) promotes stability and translation of mRNAs coding for insulin secretion granule proteins and thereby plays a role in β-cells function. We studied whether common genetic variations within the PTBP1 locus influence insulin secretion, and/or proinsulin conversion. Methods We genotyped 1,502 healthy German subjects for four tagging single nucleotide polymorphisms (SNPs) within the PTBP1 locus (rs351974, rs11085226, rs736926, and rs123698) covering 100% of genetic variation with an r2≥0.8. The subjects were metabolically characterized by an oral glucose tolerance test with insulin, proinsulin, and C-peptide measurements. A subgroup of 320 subjects also underwent an IVGTT. Results PTBP1 SNP rs11085226 was nominally associated with lower insulinogenic index and lower cleared insulin response in the OGTT (p≤0.04). The other tested SNPs did not show any association with the analyzed OGTT-derived secretion parameters. In the IVGTT subgroup, SNP rs11085226 was accordingly associated with lower insulin levels within the first ten minutes following glucose injection (p = 0.0103). Furthermore, SNP rs351974 was associated with insulin levels in the IVGTT (p = 0.0108). Upon interrogation of MAGIC HOMA-B data, our rs11085226 result was replicated (MAGIC p = 0.018), but the rs351974 was not. Conclusions We conclude that common genetic variation in PTBP1 influences glucose-stimulated insulin secretion. This underlines the importance of PTBP1 for beta cell function in vivo. PMID:23077502

  3. Huwe1, a novel cellular interactor of Gag-Pol through integrase binding, negatively influences HIV-1 infectivity.

    PubMed

    Yamamoto, Seiji P; Okawa, Katsuya; Nakano, Takashi; Sano, Kouichi; Ogawa, Kanako; Masuda, Takao; Morikawa, Yuko; Koyanagi, Yoshio; Suzuki, Youichi

    2011-04-01

    Integration, an indispensable step for retrovirus replication, is executed by integrase (IN), which is expressed as a part of a Gag-Pol precursor. Although mechanistic detail of the IN-catalyzed integration reaction is well defined, numerous evidence have demonstrated that IN is involved in multiple steps of retrovirus replication other than integration. In this study, Huwe1, a HECT-type E3 ubiquitin ligase, was identified as a new cellular interactor of human immunodeficiency virus type 1 (HIV-1) IN. The interaction was mediated through the catalytic core domain of IN and a wide-range region of Huwe1. Interestingly, although depletion of Huwe1 in target cells did not affect the early phase of HIV-1 infection in a human T cell line, we found that infectivity of HIV-1 released from the Huwe1 knockdown cells was significantly augmented more than that of virus produced from control cells. The increase in infectivity occurred in proviral DNA synthesis. Further analysis revealed that Huwe1 interacted with HIV-1 Gag-Pol precursor protein through an IN domain. Our results suggest that Huwe1 in HIV-1 producer cells has a negative impact on early post-entry events during the next round of virus infection via association with an IN region of Gag-Pol. PMID:21167302

  4. Optical study of a doubly negatively charged exciton in a CdTe/ZnTe quantum dot containing a single Mn+2 ion

    NASA Astrophysics Data System (ADS)

    Smoleński, T.; Koperski, M.; Goryca, M.; Wojnar, P.; Kossacki, P.; Kazimierczuk, T.

    2015-08-01

    We present a magnetospectroscopic study of a doubly negatively charged exciton X2 - in a CdTe quantum dot doped with a single Mn+2 ion. The X2 - emission leading to the singlet final state of an excited electron pair is demonstrated to consist of six distinct lines corresponding to different projections of the Mn+2 spin, similarly as for the neutral exciton X . We show that the fine structure of X2 - energy levels, as well as the effects of the longitudinal magnetic field, are well reproduced by a simple spin Hamiltonian model featuring both carrier-ion and intershell electron-hole exchange interactions. We also point out two important effects distinguishing the X2 - from the X , which result from different symmetries of the electron wave function: the field-induced decrease of the anisotropic part of intershell electron-hole exchange, and the negligible value of the Mn+2 exchange integral with the p -shell electron.

  5. Negative charge trapping effects in Al2O3 films grown by atomic layer deposition onto thermally oxidized 4H-SiC

    NASA Astrophysics Data System (ADS)

    Schilirò, Emanuela; Lo Nigro, Raffaella; Fiorenza, Patrick; Roccaforte, Fabrizio

    2016-07-01

    This letter reports on the negative charge trapping in Al2O3 thin films grown by atomic layer deposition onto oxidized silicon carbide (4H-SiC). The films exhibited a permittivity of 8.4, a breakdown field of 9.2 MV/cm and small hysteresis under moderate bias cycles. However, severe electron trapping inside the Al2O3 film (1 × 1012 cm-2) occurs upon high positive bias stress (>10V). Capacitance-voltage measurements at different temperatures and stress conditions have been used to determine an activation energy of 0.1eV. The results provide indications on the possible nature of the trapping defects and, hence, on the strategies to improve this technology for 4H-SiC devices.

  6. DNA-PK/Ku complex binds to latency-associated nuclear antigen and negatively regulates Kaposi's sarcoma-associated herpesvirus latent replication

    SciTech Connect

    Cha, Seho; Lim, Chunghun; Lee, Jae Young; Song, Yoon-Jae; Park, Junsoo; Choe, Joonho; Seo, Taegun

    2010-04-16

    During latent infection, latency-associated nuclear antigen (LANA) of Kaposi's sarcoma-associated herpesvirus (KSHV) plays important roles in episomal persistence and replication. Several host factors are associated with KSHV latent replication. Here, we show that the catalytic subunit of DNA protein kinase (DNA-PKcs), Ku70, and Ku86 bind the N-terminal region of LANA. LANA was phosphorylated by DNA-PK and overexpression of Ku70, but not Ku86, impaired transient replication. The efficiency of transient replication was significantly increased in the HCT116 (Ku86 +/-) cell line, compared to the HCT116 (Ku86 +/+) cell line, suggesting that the DNA-PK/Ku complex negatively regulates KSHV latent replication.

  7. Beneficial effects of activated carbon additives on the performance of negative lead-acid battery electrode for high-rate partial-state-of-charge operation

    NASA Astrophysics Data System (ADS)

    Xiang, Jiayuan; Ding, Ping; Zhang, Hao; Wu, Xianzhang; Chen, Jian; Yang, Yusheng

    2013-11-01

    Experiments are made with negative electrode of 2 V cell and 12 V lead-acid battery doped with typical activated carbon additives. It turns out that the negative electrode containing tens-of-micron-sized carbon particles in NAM exhibits markedly increased HRPSoC cycle life than the one containing carbon particles with much smaller size of several microns or the one containing no activated carbon. The improved performance is mainly attributed to the optimized NAM microstructure and the enhanced electrode reaction kinetics by introducing appropriate activated carbon. The beneficial effects can be briefly summarized from three aspects. First, activated carbon acts as new porous-skeleton builder to increase the porosity and active surface of NAM, and thus facilitates the electrolyte diffusion from surface to inner and provides more sites for crystallization/dissolution of lead sulfate; second, activated carbon plays the role of electrolyte supplier to provide sufficient H2SO4 in the inner of plate when the diffusion of H2SO4 from plate surface cannot keep pace of the electrode reaction; Third, activated carbon acts as capacitive buffer to absorb excess charge current which would otherwise lead to insufficient NAM conversion and hydrogen evolution.

  8. Negative Feedback Regulation of the Yeast Cth1 and Cth2 mRNA Binding Proteins Is Required for Adaptation to Iron Deficiency and Iron Supplementation

    PubMed Central

    Martínez-Pastor, Mar; Vergara, Sandra V.

    2013-01-01

    Iron (Fe) is an essential element for all eukaryotic organisms because it functions as a cofactor in a wide range of biochemical processes. Cells have developed sophisticated mechanisms to tightly control Fe utilization in response to alterations in cellular demands and bioavailability. In response to Fe deficiency, the yeast Saccharomyces cerevisiae activates transcription of the CTH1 and CTH2 genes, which encode proteins that bind to AU-rich elements (AREs) within the 3′ untranslated regions (3′UTRs) of many mRNAs, leading to metabolic reprogramming of Fe-dependent pathways and decreased Fe storage. The precise mechanisms underlying Cth1 and Cth2 function and regulation are incompletely understood. We report here that the Cth1 and Cth2 proteins specifically bind in vivo to AREs located at the 3′UTRs of their own transcripts in an auto- and cross-regulated mechanism that limits their expression. By mutagenesis of the AREs within the CTH2 transcript, we demonstrate that a Cth2 negative-feedback loop is required for the efficient decline in Cth2 protein levels observed upon a rapid rise in Fe availability. Importantly, Cth2 autoregulation is critical for the appropriate recovery of Fe-dependent processes and resumption of growth in response to a change from Fe deficiency to Fe supplementation. PMID:23530061

  9. Particularity and universality of a putative Gram-negative bacteria-binding protein (GNBP) gene from amphioxus (Branchiostoma belcheri): insights into the function and evolution of GNBP.

    PubMed

    Jin, Ping; Zhou, Lu; Song, Xiaojun; Qian, Jinjun; Chen, Liming; Ma, Fei

    2012-10-01

    Gram-negative bacteria-binding proteins (GNBPs) are important pattern recognition proteins (PRPs), which can initiate host defense in response to pathogen surface molecules. The roles of GNBP in innate immunity of arthropods and molluscs have recently been reported. However, the GNBP gene has not been characterized in the species of higher evolutionary status yet. In this study, we identified and characterized an amphioxus GNBP gene (designated as AmphiGNBP). First, we identified and cloned the AmphiGNBP and found that the AmphiGNBP encodes a putative protein with 558 amino acids, which contains a conserved β-1, 3-glucan recognizing and binding domain. Second, we found that the AmphiGNBP encodes two extra WSC (cell Wall integrity and Stress response Component) domains, which are unique in AmphiGNBP protein. The two WSC domains of AmphiGNBP protein coupled with the expansion of amphioxus immunity repertoire might undergo intensive domain shuffling during the age of the Cambrian explosion. Finally, we found that the AmphiGNBP was mainly expressed in immune tissues, such as hepatic cecum and intestine, and the expression of AmphiGNBP was affected after LPS stimulation. In conclusion, our findings disclose the particularity and universality of AmphiGNBP and provide profound insights into the function and evolution of GNBP. PMID:22986589

  10. Identification of the Zinc Finger Protein ZRANB2 as a Novel Maternal Lipopolysaccharide-binding Protein That Protects Embryos of Zebrafish against Gram-negative Bacterial Infections.

    PubMed

    Wang, Xia; Du, Xiaoyuan; Li, Hongyan; Zhang, Shicui

    2016-02-19

    Zinc finger ZRANB2 proteins are widespread in animals, but their functions and mechanisms remain poorly defined. Here we clearly demonstrate that ZRANB2 is a newly identified LPS-binding protein present abundantly in the eggs/embryos of zebrafish. We also show that recombinant ZRANB2 (rZRANB2) acts as a pattern recognition receptor capable of identifying the bacterial signature molecule LPS as well as binding the Gram-negative bacteria Escherichia coli, Vibrio anguilarum, and Aeromonas hydrophila and functions as an antibacterial effector molecule capable of directly killing the bacteria. Furthermore, we reveal that N-terminal residues 11-37 consisting of the first ZnF_RBZ domain are indispensable for ZRANB2 antimicrobial activity. Importantly, microinjection of rZRANB2 into early embryos significantly enhanced the resistance of the embryos against pathogenic A. hydrophila challenge, and this enhanced bacterial resistance was markedly reduced by co-injection of anti-ZRANB2 antibody. Moreover, precipitation of ZRANB2 in the embryo extracts by preincubation with anti-ZRANB2 antibody caused a marked decrease in the antibacterial activity of the extracts against the bacteria tested. In addition, the N-terminal peptide Z1/37 or Z11/37 with in vitro antibacterial activity also promoted the resistance of embryos against A. hydrophila, but the peptide Z38/198 without in vitro antibacterial activity did not. Collectively, these results indicate that ZRANB2 is a maternal LPS-binding protein that can protect the early embryos of zebrafish against pathogenic attacks, a novel role ever assigned to ZRANB2 proteins. This work also provides new insights into the immunological function of the zinc finger proteins that are widely distributed in various animals. PMID:26740623

  11. Charge transfer, lattice distortion, and quantum confinement effects in Pd, Cu, and Pd-Cu nanoparticles; size and alloying induced modifications in binding energy

    SciTech Connect

    Sengar, Saurabh K.; Mehta, B. R.; Gupta, Govind

    2011-05-09

    In this letter, effect of size and alloying on the core and valence band shifts of Pd, Cu, and Pd-Cu alloy nanoparticles has been studied. It has been shown that the sign and magnitude of the binding energy shifts is determined by the contributions of different effects; with quantum confinement and lattice distortion effects overlapping for size induced shifts in case of core levels and lattice distortion and charge transfer effects overlapping for alloying induced shifts at smaller sizes. These results are important for understanding gas molecule-solid surface interaction in metal and alloy nanoparticles in terms of valance band positions.

  12. The electrostatic co-assembly in non-stoichiometric aqueous mixtures of copolymers composed of one neutral water-soluble and one polyelectrolyte (either positively or negatively charged) block: a dissipative particle dynamics study.

    PubMed

    Šindelka, Karel; Limpouchová, Zuzana; Lísal, Martin; Procházka, Karel

    2016-06-28

    The electrostatic co-assembly in non-stoichiometric aqueous mixtures of diblock copolymers composed of a neutral water-soluble block and an either positively or negatively charged polyelectrolyte (PE) block has been studied by dissipative particle dynamics (DPD) simulations. The employed DPD variant includes explicit electrostatics and enables the investigation of the role of small ions in the co-assembly. The properties of core-shell associates containing insoluble interpolyelectrolyte complex cores and protective neutral shells were investigated as functions of the ratio of positive-to-negative charges in the system. This ratio was varied by increasing the number of positively charged PE chains of the same length as those of negatively charged chains, and by changing the PE length and charge density. The simulation results show that the associates formed in non-stoichiometric mixtures differ from those formed in stoichiometric mixtures: their association numbers are lower, their cores are charged and a fraction of excess chains remain free in the non-associated state. The study demonstrates the important role of the compatibility of the counterions with the polymer blocks. It simultaneously emphasizes the necessity of including the electrostatic interaction of all the charged species in the DPD computational scheme. PMID:27253089

  13. The Effect of Lipopolysaccharide Core Oligosaccharide Size on the Electrostatic Binding of Antimicrobial Proteins to Models of the Gram Negative Bacterial Outer Membrane.

    PubMed

    Clifton, Luke A; Ciesielski, Filip; Skoda, Maximilian W A; Paracini, Nicolò; Holt, Stephen A; Lakey, Jeremy H

    2016-04-12

    Understanding the electrostatic interactions between bacterial membranes and exogenous proteins is crucial to designing effective antimicrobial agents against Gram-negative bacteria. Here we study, using neutron reflecometry under multiple isotopic contrast conditions, the role of the uncharged sugar groups in the outer core region of lipopolysaccharide (LPS) in protecting the phosphate-rich inner core region from electrostatic interactions with antimicrobial proteins. Models of the asymmetric Gram negative outer membrane on silicon were prepared with phopshatidylcholine (PC) in the inner leaflet (closest to the silicon), whereas rough LPS was used to form the outer leaflet (facing the bulk solution). We show how salt concentration can be used to reversibly alter the binding affinity of a protein antibiotic colicin N (ColN) to the anionic LPS confirming that the interaction is electrostatic in nature. By examining the interaction of ColN with two rough LPS types with different-sized core oligosaccharide regions we demonstrate the role of uncharged sugars in blocking short-range electrostatic interactions between the cationic antibiotics and the vulnerable anionic phosphate groups. PMID:27003358

  14. The Effect of Lipopolysaccharide Core Oligosaccharide Size on the Electrostatic Binding of Antimicrobial Proteins to Models of the Gram Negative Bacterial Outer Membrane

    PubMed Central

    2016-01-01

    Understanding the electrostatic interactions between bacterial membranes and exogenous proteins is crucial to designing effective antimicrobial agents against Gram-negative bacteria. Here we study, using neutron reflecometry under multiple isotopic contrast conditions, the role of the uncharged sugar groups in the outer core region of lipopolysaccharide (LPS) in protecting the phosphate-rich inner core region from electrostatic interactions with antimicrobial proteins. Models of the asymmetric Gram negative outer membrane on silicon were prepared with phopshatidylcholine (PC) in the inner leaflet (closest to the silicon), whereas rough LPS was used to form the outer leaflet (facing the bulk solution). We show how salt concentration can be used to reversibly alter the binding affinity of a protein antibiotic colicin N (ColN) to the anionic LPS confirming that the interaction is electrostatic in nature. By examining the interaction of ColN with two rough LPS types with different-sized core oligosaccharide regions we demonstrate the role of uncharged sugars in blocking short-range electrostatic interactions between the cationic antibiotics and the vulnerable anionic phosphate groups. PMID:27003358

  15. A novel phagocytic receptor (CgNimC) from Pacific oyster Crassostrea gigas with lipopolysaccharide and gram-negative bacteria binding activity.

    PubMed

    Wang, Weilin; Liu, Rui; Zhang, Tao; Zhang, Ran; Song, Xuan; Wang, Lingling; Song, Linsheng

    2015-03-01

    Phagocytosis is an evolutionarily conserved process to ingest the invading microbes and apoptotic or necrotic corpses, playing vital roles in defensing invaders and maintenance of normal physiological conditions. In the present study, a new Nimrod family phagocytic receptor with three EGF-like domains was identified in Pacific oyster Crassostrea gigas (designated CgNimC). CgNimC shared homology with other identified multiple EGF-like domain containing proteins. The mRNA transcripts of CgNimC were mainly distributed in mantle and hemocytes. Its relative expression level in hemocytes was significantly (P < 0.01) up-regulated after the injection of bacteria Vibrio anguillarum. Different to the NimC in Drosophila and Anopheles gambiae, the recombinant protein of CgNimC (rCgNimC) could bind directly to two gram-negative bacteria V. anguillarum and Vibrio splendidus, but not to gram-positive bacteria Staphylococci aureus, Micrococcus luteus or fungi Yarrowia lipolytica and Pichia pastoris. The affinity of rCgNimC toward M. luteus and Y. lipolytica was enhanced when the microorganisms were pre-incubated with the cell free hemolymph. rCgNimC exhibited higher affinity to lipopolysaccharide (LPS) and relatively lower affinity to peptidoglycan (PGN), while no affinity to glucan (GLU). After the CgNimC receptor was blocked by anti-rCgNimC antibody in vitro, the phagocytic rate of hemocytes toward two gram-negative bacteria V. anguillarum and V. splendidus was reduced significantly (P < 0.05), but no significant change of phagocytic rate was observed toward M. luteus and Y. lipolytica. All these results implied that CgNimC, with significant binding capability to LPS and gram-negative bacteria, was a novel phagocytic receptor involved in immune response of Pacific oyster. Further, it was speculated that receptors of Nimrod family might function as a phagocytic receptor to recognize PAMPs on the invaders and its recognition could be promoted by opsonization of molecules in

  16. Binding of alpha-bungarotoxin to proteolytic fragments of the alpha subunit of Torpedo acetylcholine receptor analyzed by protein transfer on positively charged membrane filters.

    PubMed Central

    Wilson, P T; Gershoni, J M; Hawrot, E; Lentz, T L

    1984-01-01

    Proteolytic fragments of the alpha subunit of the acetylcholine receptor retain the ability to bind alpha-bungarotoxin following resolution by polyacrylamide gel electrophoresis and immobilization on protein transfers. The alpha subunit of the acetylcholine receptor of Torpedo electric organ was digested with four proteases: Staphylococcus aureus V-8 protease, papain, bromelain, and proteinase K. The proteolytic fragments resolved on 15% polyacrylamide gels were electrophoretically transferred onto positively charged nylon membrane filters. When incubated with 0.3 nM 125I-labeled alpha-bungarotoxin and autoradiographed, the transfers yielded patterns of labeled bands characteristic for each protease. The molecular masses of the fragments binding toxin ranged from 7 to 34 kDa, with major groupings in the 8-, 18-, and 28-kDa ranges. The apparent affinity of the fragments for alpha-bungarotoxin as determined from the IC50 value was 6.7 X 10(-8) M. The labeling of fragments with alpha-bungarotoxin could be inhibited by prior affinity alkylation of receptor-containing membranes with 4-(N-maleimido)-alpha-benzyltrimethylammonium iodide. These findings demonstrate that immobilized proteolytic fragments as small as 1/5 the size of the alpha subunit retain the structural characteristics necessary for binding alpha-bungarotoxin, although the toxin is bound to the fragments with lower affinity than to the native receptor. The effect of affinity ligand alkylation demonstrates that the alpha-bungarotoxin binding site detected on the proteolytic fragments is the same as the affinity-labeled acetylcholine binding site on the intact acetylcholine receptor. Images PMID:6371817

  17. A cluster of charged and aromatic residues in the C-terminal portion of maltoporin participates in sugar binding and uptake.

    PubMed

    Charbit, A; Wang, J; Michel, V; Hofnung, M

    1998-11-01

    The maltoporin LamB of Escherichia coli K12 is a trimeric protein which facilitates the diffusion of maltose and maltodextrins through the bacterial outer membrane, and also acts as a non-specific porin for small hydrophilic molecules as well as a receptor for phages. Loop L9 (residues 375 to 405) is the most distal and largest surface-exposed loop of LamB. It comprises a central portion, which varies in size and sequence in the maltoporins of known sequence, flanked by two conserved regions containing charged and aromatic residues. In order to identify the residues within the proximal region that are specifically involved in sugar utilization, we used site-directed mutagenesis to change, individually, each of the charged (five) and aromatic (three) residues in the region 371 to 379 into alanine. None of the eight single amino acid substitutions affected the phage receptor activity of LamB. In contrast, they all affected, to variable extents, maltoporin functions. For all the mutants, very good correlations were observed between the effects on sugar binding and on in vivo uptake. In no case were maltoporin functions completely abolished. Mutants E374 A and W376 A were the most impaired (with over 60% reduction in dextrin binding and in vivo uptake of maltose and maltopentaose). These two mutations also led to an increased bacterial sensitivity to bacitracin and vancomycin. The functional and structural implications are discussed. PMID:9862470

  18. Conserved Negative Charges in the N-terminal Tetramerization Domain Mediate Efficient Assembly of Kv2.1 and Kv2.1/Kv6.4 Channels*

    PubMed Central

    Bocksteins, Elke; Labro, Alain J.; Mayeur, Evy; Bruyns, Tine; Timmermans, Jean-Pierre; Adriaensen, Dirk; Snyders, Dirk J.

    2009-01-01

    Voltage-gated potassium (Kv) channels are transmembrane tetramers of individual α-subunits. Eight different Shaker-related Kv subfamilies have been identified in which the tetramerization domain T1, located on the intracellular N terminus, facilitates and controls the assembly of both homo- and heterotetrameric channels. Only the Kv2 α-subunits are able to form heterotetramers with members of the silent Kv subfamilies (Kv5, Kv6, Kv8, and Kv9). The T1 domain contains two subdomains, A and B box, which presumably determine subfamily specificity by preventing incompatible subunits to assemble. In contrast, little is known about the involvement of the A/B linker sequence. Both Kv2 and silent Kv subfamilies contain a fully conserved and negatively charged sequence (CDD) in this linker that is lacking in the other subfamilies. Neutralizing these aspartates in Kv2.1 by mutating them to alanines did not affect the gating properties, but reduced the current density moderately. However, charge reversal arginine substitutions strongly reduced the current density of these homotetrameric mutant Kv2.1 channels and immunocytochemistry confirmed the reduced expression at the plasma membrane. Förster resonance energy transfer measurements using confocal microscopy showed that the latter was not due to impaired trafficking, but to a failure to assemble the tetramer. This was further confirmed with co-immunoprecipitation experiments. The corresponding arginine substitution in Kv6.4 prevented its heterotetrameric interaction with Kv2.1. These results indicate that these aspartates (especially the first one) in the A/B box linker of the T1 domain are required for efficient assembly of both homotetrameric Kv2.1 and heterotetrameric Kv2.1/silent Kv6.4 channels. PMID:19717558

  19. Negatively charged Ir(iii) cyclometalated complexes containing a chelating bis-tetrazolato ligand: synthesis, photophysics and the study of reactivity with electrophiles.

    PubMed

    Fiorini, Valentina; Zacchini, Stefano; Raiteri, Paolo; Mazzoni, Rita; Zanotti, Valerio; Massi, Massimiliano; Stagni, Stefano

    2016-08-01

    The bis-tetrazolate dianion [1,2 BTB](2-), which is the deprotonated form of 1,2 bis-(1H-tetrazol-5-yl)benzene [1,2-H2BTB], is for the first time exploited as an ancillary N^N ligand for negatively charged [Ir(C^N)2(N^N)](-)-type complexes, where C^N is represented by cyclometalated 2-phenylpyridine (ppy) or 2-(2,4-difluorophenyl)pyridine (F2ppy). The new Ir(iii) complexes [Ir(ppy)2(1,2 BTB)]- and [Ir(F2ppy)2(1,2 BTB)]- have been fully characterised and the analysis of the X-ray structure of [Ir(ppy)2(1,2 BTB)]- confirmed the coordination of the [1,2 BTB](2-) dianion in a bis chelated fashion through the N-atoms adjacent to each of the tetrazolic carbons. Both of the new anionic Ir(iii) complexes displayed phosphorescence in the visible region, with intense sky-blue (λmax = 460-490 nm) or aqua (λmax = 490-520 nm) emissions originating from [Ir(F2ppy)2(1,2 BTB)]- and [Ir(ppy)2(1,2 BTB)]-, respectively. In comparison with our very recent examples of anionic Ir(iii)tetrazolate cyclometalates, the new Ir(iii) tris chelate complexes [Ir(F2ppy)2(1,2 BTB)]- and [Ir(ppy)2(1,2 BTB)]-, display an improved robustness, allowing the study of their reactivity toward the addition of electrophiles such as H(+) and CH3(+). In all cases, the electrophilic attacks occurred at the coordinated tetrazolate rings, involving the reversible - by a protonation deprotonation mechanism - or permanent - upon addition of a methyl moiety - switching of their global net charge from negative to positive and, in particular, the concomitant variation of their photoluminescence output. The combination of the anionic complexes [Ir(F2ppy)2(1,2 BTB)]- or [Ir(ppy)2(1,2 BTB)]- with a deep red emitting (λmax = 686 nm) cationic Ir(iii) tetrazole complex such as [IrTPYZ-Me]+, where TPYZ-Me is 2-(2-methyl-2H-tetrazol-5-yl)pyrazine, gave rise to two fully Ir(iii)-based soft salts capable of displaying additive and O2-sensitive emission colours, with an almost pure white light obtained by the appropriate

  20. Interactions and diffusion in fine-stranded β-lactoglobulin gels determined via FRAP and binding.

    PubMed

    Schuster, Erich; Hermansson, Anne-Marie; Ohgren, Camilla; Rudemo, Mats; Lorén, Niklas

    2014-01-01

    The effects of electrostatic interactions and obstruction by the microstructure on probe diffusion were determined in positively charged hydrogels. Probe diffusion in fine-stranded gels and solutions of β-lactoglobulin at pH 3.5 was determined using fluorescence recovery after photobleaching (FRAP) and binding, which is widely used in biophysics. The microstructures of the β-lactoglobulin gels were characterized using transmission electron microscopy. The effects of probe size and charge (negatively charged Na2-fluorescein (376Da) and weakly anionic 70kDa FITC-dextran), probe concentration (50 to 200 ppm), and β-lactoglobulin concentration (9% to 12% w/w) on the diffusion properties and the electrostatic interaction between the negatively charged probes and the positively charged gels or solutions were evaluated. The results show that the diffusion of negatively charged Na2-fluorescein is strongly influenced by electrostatic interactions in the positively charged β-lactoglobulin systems. A linear relationship between the pseudo-on binding rate constant and the β-lactoglobulin concentration for three different probe concentrations was found. This validates an important assumption of existing biophysical FRAP and binding models, namely that the pseudo-on binding rate constant equals the product of the molecular binding rate constant and the concentration of the free binding sites. Indicators were established to clarify whether FRAP data should be analyzed using a binding-diffusion model or an obstruction-diffusion model. PMID:24411257

  1. Interactions and Diffusion in Fine-Stranded β-lactoglobulin Gels Determined via FRAP and Binding

    PubMed Central

    Schuster, Erich; Hermansson, Anne-Marie; Öhgren, Camilla; Rudemo, Mats; Lorén, Niklas

    2014-01-01

    The effects of electrostatic interactions and obstruction by the microstructure on probe diffusion were determined in positively charged hydrogels. Probe diffusion in fine-stranded gels and solutions of β-lactoglobulin at pH 3.5 was determined using fluorescence recovery after photobleaching (FRAP) and binding, which is widely used in biophysics. The microstructures of the β-lactoglobulin gels were characterized using transmission electron microscopy. The effects of probe size and charge (negatively charged Na2-fluorescein (376Da) and weakly anionic 70kDa FITC-dextran), probe concentration (50 to 200 ppm), and β-lactoglobulin concentration (9% to 12% w/w) on the diffusion properties and the electrostatic interaction between the negatively charged probes and the positively charged gels or solutions were evaluated. The results show that the diffusion of negatively charged Na2-fluorescein is strongly influenced by electrostatic interactions in the positively charged β-lactoglobulin systems. A linear relationship between the pseudo-on binding rate constant and the β-lactoglobulin concentration for three different probe concentrations was found. This validates an important assumption of existing biophysical FRAP and binding models, namely that the pseudo-on binding rate constant equals the product of the molecular binding rate constant and the concentration of the free binding sites. Indicators were established to clarify whether FRAP data should be analyzed using a binding-diffusion model or an obstruction-diffusion model. PMID:24411257

  2. A single charge in the actin binding domain of fascin can independently tune the linear and non-linear response of an actin bundle network.

    PubMed

    Maier, M; Müller, K W; Heussinger, C; Köhler, S; Wall, W A; Bausch, A R; Lieleg, O

    2015-05-01

    Actin binding proteins (ABPs) not only set the structure of actin filament assemblies but also mediate the frequency-dependent viscoelastic moduli of cross-linked and bundled actin networks. Point mutations in the actin binding domain of those ABPs can tune the association and dissociation dynamics of the actin/ABP bond and thus modulate the network mechanics both in the linear and non-linear response regime. We here demonstrate how the exchange of a single charged amino acid in the actin binding domain of the ABP fascin triggers such a modulation of the network rheology. Whereas the overall structure of the bundle networks is conserved, the transition point from strain-hardening to strain-weakening sensitively depends on the cross-linker off-rate and the applied shear rate. Our experimental results are consistent both with numerical simulations of a cross-linked bundle network and a theoretical description of the bundle network mechanics which is based on non-affine bending deformations and force-dependent cross-link dynamics. PMID:26004635

  3. Molecular recognition of NO/NO+ via multicenter (charge-transfer) binding to bridged diarene donors. Effect of structure on the optical transitions and complexation thermodynamics.

    PubMed

    Rosokha, S V; Lindeman, S V; Rathore, R; Kochi, J K

    2003-05-16

    Bridged diarenes form very strong [1:1] complexes with nitrosonium/nitric oxide in which the NO moiety is optimally sandwiched in the cleft between a pair of cofacial aromatic rings which act as a molecular "Venus flytrap". The spectral features of these associates are generally similar to those for [1:1] and [2:1] nitrosonium complexes with mononuclear alkyl-substituted benzenes, and they are appropriately described within the LCAO molecular-orbital methodology and the Mulliken (charge-transfer) formulation of donor/acceptor electronic transitions. The thermodynamics study indicates that the efficient binding is determined by (i) the close matching of the donor/acceptor redox potentials and (ii) the ability of bridged diarenes for multicentered interactions with a single NO moiety. The best fit of the electronic and structural parameters is provided by a calixarene host that allows the interacting centers to be arranged in a manner similar to those extant in [2:1] nitrosonium complexes with analogous (nonbridged) aromatic donors; this results in its very strong noncovalent binding with nitrosonium/nitric oxide with the formation constant of K(B) approximately 10(8) M(-)(1) and free-energy change of -DeltaG degrees = 45 kJ mol(-)(1). Such strong, selective, and reversible bindings of nitrosonium/nitric oxide by (cofacial) aromatic centers thus provide the basis for the development of efficient NO sensors/absorbents and also suggest their potential relevance to biochemical systems. PMID:12737577

  4. Weakly Charged Cationic Nanoparticles Induce DNA Bending and Strand Separation

    SciTech Connect

    Railsback, Justin; Singh, Abhishek; Pearce, Ryan; McKnight, Timothy E; Collazo, Ramon; Sitar, Zlatko; Yingling, Yaroslava; Melechko, Anatoli Vasilievich

    2012-01-01

    The understanding of interactions between double stranded (ds) DNA and charged nanoparticles will have a broad bearing on many important applications from drug delivery [ 1 4 ] to DNAtemplated metallization. [ 5 , 6 ] Cationic nanoparticles (NPs) can bind to DNA, a negatively charged molecule, through a combination of electrostatic attraction, groove binding, and intercalation. Such binding events induce changes in the conformation of a DNA strand. In nature, DNA wraps around a cylindrical protein assembly (diameter and height of 6 nm) [ 7 ] with an 220 positive charge, [ 8 ] creating the complex known as chromatin. Wrapping and bending of DNA has also been achieved in the laboratory through the binding of highly charged species such as molecular assemblies, [ 9 , 10 ] cationic dendrimers, [ 11 , 12 ] and nanoparticles. [ 13 15 ] The charge of a nanoparticle plays a crucial role in its ability to induce DNA structural changes. If a nanoparticle has a highly positive surface charge density, the DNA is likely to wrap and bend upon binding to the nanoparticle [ 13 ] (as in the case of chromatin). On the other hand, if a nanoparticle is weakly charged it will not induce dsDNA compaction. [ 9 , 10 , 15 ] Consequently, there is a transition zone from extended to compact DNA conformations which depends on the chemical nature of the nanoparticle and occurs for polycations with charges between 5 and 10. [ 9 ] While the interactions between highly charged NPs and DNA have been extensively studied, the processes that occur within the transition zone are less explored.

  5. External and Internal Guest Binding of a Highly Charged Supramolecular Host in Water: Deconvoluting the Very Different Thermodynamics

    SciTech Connect

    Sgarlata, Carmelo; Mugridge, Jeffrey; Pluth, Michael; Tiedemann,, Bryan; Zito, Valeria; Arena, Giuseppe; Raymond, Kenneth N.

    2009-07-22

    NMR, UV-vis and isothermal titration calorimetry (ITC) measurements probe different aspects of competing host-guest equilibria as simple alkylammonium guest molecules interact with both the exterior (ion-association) and interior (encapsulation) of the [Ga{sub 4}L{sub 6}]{sup 12-} supramolecular assembly in water. Data obtained by each independent technique measure different components of the host-guest equilibria and only when analyzed together does a complete picture of the solution thermodynamics emerge. Striking differences between the internal and external guest binding are found. External binding is enthalpy driven and mainly due to attractive interactions between the guests and the exterior surface of the assembly while encapsulation is entropy driven as a result of desolvation and release of solvent molecules from the host cavity.

  6. Murine Gammaherpesvirus 68 Encoding Open Reading Frame 11 Targets TANK Binding Kinase 1 To Negatively Regulate the Host Type I Interferon Response

    PubMed Central

    Kang, Hye-Ri; Cheong, Woo-Chang; Park, Ji-Eun; Ryu, Seungbo; Cho, Hye-Jeong; Youn, Hyunyee; Ahn, Jin-Hyun

    2014-01-01

    ABSTRACT Upon viral infection, type I interferons, such as alpha and beta interferon (IFN-α and IFN-β, respectively), are rapidly induced and activate multiple antiviral genes, thereby serving as the first line of host defense. Many DNA and RNA viruses counteract the host interferon system by modulating the production of IFNs. In this study, we report that murine gammaherpesvirus 68 (MHV-68), a double-stranded DNA virus, encodes open reading frame 11 (ORF11), a novel immune modulator, to block IFN-β production. ORF11-deficient recombinant viruses induced more IFN-β production in fibroblast and macrophage cells than the MHV-68 wild type or a marker rescue virus. MHV-68 ORF11 decreased IFN-β promoter activation by various factors, the signaling of which converges on TBK1-IRF3 activation. MHV-68 ORF11 directly interacted with both overexpressed and endogenous TBK1 but not with IRF3. Physical interactions between ORF11 and endogenous TBK1 were further confirmed during virus replication in fibroblasts using a recombinant virus expressing FLAG-ORF11. ORF11 efficiently reduced interaction between TBK1 and IRF3 and subsequently inhibited activation of IRF3, thereby negatively regulating IFN-β production. Our domain-mapping study showed that the central domain of ORF11 was responsible for both TBK1 binding and inhibition of IFN-β induction, while the kinase domain of TBK1 was sufficient for ORF11 binding. Taken together, these results suggest a mechanism underlying inhibition of IFN-β production by a gammaherpesvirus and highlight the importance of TBK1 in DNA virus replication. IMPORTANCE Gammaherpesviruses are important human pathogens, as they are associated with various kinds of tumors. Upon virus infection, the type I interferon pathway is activated by a series of signaling molecules and stimulates antiviral gene expression. To subvert such interferon antiviral responses, viruses are equipped with multiple factors that can inhibit its critical steps. In this

  7. Disinfection of Escherichia coli Gram negative bacteria using surface modified TiO2: optimization of Ag metallization and depiction of charge transfer mechanism.

    PubMed

    Gomathi Devi, LakshmipathiNaik; Nagaraj, Basavalingaiah

    2014-01-01

    The antibacterial activity of silver deposited TiO2 (Ag-TiO2 ) against Gram negative Escherichia coli bacteria was investigated by varying the Ag metal content from 0.10 to 0.50% on the surface of TiO2 . Ag depositions by the photoreduction method were found to be stable. Surface silver metallization was confirmed by EDAX and XPS studies. Photoluminescence studies show that the charge carrier recombination is less for 0.1% Ag-TiO2 and this catalyst shows superior bactericidal activity under solar light irradiation compared to Sol gel TiO2 (SG-TiO2 ) due to the surface plasmon effect. The energy levels of deposited Ag are dependent on the Ag content and it varies from -4.64 eV to -1.30 eV with respect to the vacuum energy level based on atomic silver to bulk silver deposits. The ability of electron transfer from Ag deposit to O2 depends on the position of the energy levels. The 0.25% and 0.50% Ag depositions showed detrimental effect on bactericidal activity due to the mismatch of energy levels. The effect of the EROS (External generation of the Reactive Oxygen Species by 0.1% Ag-TiO2 ) and IROS (Interior generation of Reactive Oxygen Species within the bacteria) on the bactericidal inactivation is discussed in detail. PMID:24995499

  8. Kinetic distinction between cytochromes a and a3 in cytochrome c oxidase. Rapid scanning stopped flow study of anaerobic reduction by a neutral and a negatively charged donor.

    PubMed

    Halaka, F G; Babcock, G T; Dye, J L

    1981-02-10

    Anaerobic reduction of cytochrome c oxidase by 5,10-dihydro-5-methylphenazine (reduced PMS) and by sodium dithionite were studied by rapid scanning stopped flow spectrophotometry. In both cases the decay of the Soret band of the oxidized oxidase is not uniform. With reduced PMS, the reduction involves two molecules of reductant (4 electrons)/oxidase molecule. The first stage of the reduction exhibits an isosbestic point in the Soret region at 437 nm. This shifts to 428 nm in later stages of the reaction. The reduction of the oxidase by sodium dithionite is also complete and apparently involves SO2 radical. In this case the spectra show an isosbestic point at approximately 420 nm which shifts to 432 nm as the reaction proceeds. For each of the reductants the reaction is best described by three phases: the first is a second order reaction between the oxidase and the reductant, followed by two first order processes which appear to describe the intramolecular electron redistribution within the oxidase molecule. The results agree with the assignment of the Soret band of the oxidase molecule to cytochrome a3 with an absorption maximum near 410 nm and to cytochrome a which has its maximum absorption hear 430 nm. If these assignments are correct, the present data show that reduced PMS, an uncharged molecule, reacts more rapidly with cytochrome a than it does with cytochrome a3, while the negatively charged radical anion, SO2, appears to have more direct access to cytochrome a3. PMID:6256379

  9. Recovery rate of multiple enteric viruses artificially seeded in water and concentrated by adsorption-elution with negatively charged membranes: interaction and interference between different virus species.

    PubMed

    Vecchia, Andréia Dalla; Rigotto, Caroline; Soliman, Mayra Cristina; Souza, Fernanda Gil de; Giehl, Isabel Cristina; Spilki, Fernando Rosado

    2015-01-01

    Viral concentration method by adsorption-elution with negative membranes has been widely employed for concentrating viruses from environmental samples. In order to provide an adequate assessment of its recovery efficiency, this study was conducted to assess viral recovery rates for viral species commonly found in water (HAdV-5, EV, RV, BAdV and CAV-2), quantifying viral genomes at the end of the five different steps of the process. Recovery rates were analyzed for several viruses combined in a single water sample and for each virus assayed separately. Ultrapure water samples were artificially contaminated and analyzed by real-time quantitative polymerase chain reaction (qPCR). High recovery rates were found after the final stage when assessed individually (89 to 125%) and combined in the same sample (23 to > 164%). HAdV-5 exhibited >100% recovery when assayed with human viruses and other AdVs, whereas BAdV and CAV-2 were not detected. These data suggest that recovery efficiency could be related to viral structural characteristics, their electric charges and other interactions, so that they are retained with greater or lesser efficiency when coupled. This protocol could be applied to environmental samples, since high recovery rates were observed and infectious viruses were detected at the end of the concentration process. PMID:26676018

  10. Extracellularly secreted APE1/Ref-1 triggers apoptosis in triple-negative breast cancer cells via RAGE binding, which is mediated through acetylation

    PubMed Central

    Lee, Yu Ran; Kim, Ki Mo; Jeon, Byeong Hwa; Choi, Sunga

    2015-01-01

    The present study evaluated the mechanism of apoptosis caused by post-translational modification, hyperacetylation in triple-negative breast cancer (TNBC) cells. We previously showed that trichostatin A (TSA) induced secretion of acetylated apurinic apyrimidinic endonuclease 1/redox factor-1 (Ac-APE1/Ref-1). This is the first report showing that Ac-APE1/Ref-1 initiates apoptosis in TNBC cells by binding to the receptor for advanced glycation end products (RAGE). The functional significance of secreted Ac-APE1/Ref-1 was studied by induction of intracellular hyperacetylation through co-treatment with acetylsalicylic acid and TSA in MDA-MB-231 cells. In response to hyperacetylation, secretion of Ac-APE1/Ref-1 in vesicles was observed, resulting in significantly decreased cell viability and induction of apoptosis with increased expression of RAGE. The hyperacetylation-induced apoptosis was similar in two other TNBC cell lines: BT-459 and MDA-MB-468. Therefore, hyperacetylation may be a therapeutic target for treatment of TNBCs. This study introduces a novel paradigm whereby post-translational modification induces apoptotic cell death in breast cancer cells resistant to standard chemotherapeutic agents through secretion of auto- or paracrine molecules such as Ac-APE1/Ref-1. PMID:26125438

  11. Mutations within the LINC-HELLP non-coding RNA differentially bind ribosomal and RNA splicing complexes and negatively affect trophoblast differentiation.

    PubMed

    van Dijk, Marie; Visser, Allerdien; Buabeng, Kwadwo M L; Poutsma, Ankie; van der Schors, Roel C; Oudejans, Cees B M

    2015-10-01

    LINC-HELLP, showing chromosomal linkage with the pregnancy-specific HELLP syndrome in Dutch families, reduces differentiation from a proliferative to an invasive phenotype of first-trimester extravillous trophoblasts. Here we show that mutations in LINC-HELLP identified in HELLP families negatively affect this trophoblast differentiation either by inducing proliferation rate or by causing cell cycle exit as shown by a decrease in both proliferation and invasion. As LincRNAs predominantly function through interactions with proteins, we identified the directly interacting proteins using chromatin isolation by RNA purification followed by protein mass spectrometry. We found 22 proteins predominantly clustering in two functional networks, i.e. RNA splicing and the ribosome. YBX1, PCBP1, PCBP2, RPS6 and RPL7 were validated, and binding to these proteins was influenced by the HELLP mutations carried. Finally, we show that the LINC-HELLP transcript levels are significantly upregulated in plasma of women in their first trimester of pregnancy compared with non-pregnant women, whereas this upregulation seems absent in a pilot set of patients later developing pregnancy complications, indicative of its functional significance in vivo. PMID:26173455

  12. AcEBP1, an ErbB3-Binding Protein (EBP1) from halophyte Atriplex canescens, negatively regulates cell growth and stress responses in Arabidopsis.

    PubMed

    Li, Jingtao; Yu, Gang; Sun, Xinhua; Zhang, Xianghui; Liu, Jinliang; Pan, Hongyu

    2016-07-01

    An ErbB-3-binding protein gene AcEBP1, also known as proliferation-associated 2G4 gene (PA2G4s) belonging to the M24 superfamily, was obtained from the saltbush Atriplex canescens. Subcellular localization imaging showed the fusion protein AcEBP1-eGFP was located in the nucleus of epidermal cells in Nicotiana benthamiana. The AcEBP1 gene expression levels were up-regulated under salt, osmotic stress, and hormones treatment as revealed by qRT-PCR. Overexpression of AcEBP1 in Arabidopsis demonstrated that AcEBP1 was involved in root cell growth and stress responses (NaCl, osmotic stress, ABA, low temperature, and drought). These phenotypic data were correlated with the expression patterns of stress responsive genes and PR genes. The AcEBP1 transgenic Arabidopsis plants also displayed increased sensitivity under low temperature and evaluated resistance to drought stress. Together, these results demonstrate that AcEBP1 negatively affects cell growth and is a regulator under stress conditions. PMID:27181948

  13. Identification and characterization of anion binding sites in RNA

    SciTech Connect

    Kieft, Jeffrey S.; Chase, Elaine; Costantino, David A.; Golden, Barbara L.

    2010-05-24

    Although RNA molecules are highly negatively charged, anions have been observed bound to RNA in crystal structures. It has been proposed that anion binding sites found within isolated RNAs represent regions of the molecule that could be involved in intermolecular interactions, indicating potential contact points for negatively charged amino acids from proteins or phosphate groups from an RNA. Several types of anion binding sites have been cataloged based on available structures. However, currently there is no method for unambiguously assigning anions to crystallographic electron density, and this has precluded more detailed analysis of RNA-anion interaction motifs and their significance. We therefore soaked selenate into two different types of RNA crystals and used the anomalous signal from these anions to identify binding sites in these RNA molecules unambiguously. Examination of these sites and comparison with other suspected anion binding sites reveals features of anion binding motifs, and shows that selenate may be a useful tool for studying RNA-anion interactions.

  14. Charge transport in HoxLu1 -xB12 : Separating positive and negative magnetoresistance in metals with magnetic ions

    NASA Astrophysics Data System (ADS)

    Sluchanko, N. E.; Khoroshilov, A. L.; Anisimov, M. A.; Azarevich, A. N.; Bogach, A. V.; Glushkov, V. V.; Demishev, S. V.; Krasnorussky, V. N.; Samarin, N. A.; Shitsevalova, N. Yu.; Filippov, V. B.; Levchenko, A. V.; Pristas, G.; Gabani, S.; Flachbart, K.

    2015-06-01

    The magnetoresistance (MR) Δ ρ /ρ of the cage-glass compound HoxLu1 -xB12 with various concentrations of magnetic holmium ions (x ≤0.5 ) has been studied in detail concurrently with magnetization M (T ) and Hall effect investigations on high-quality single crystals at temperatures 1.9-120 K and in magnetic field up to 80 kOe. The undertaken analysis of Δ ρ /ρ allows us to conclude that the large negative magnetoresistance (nMR) observed in the vicinity of the Néel temperature is caused by scattering of charge carriers on magnetic clusters of Ho3 + ions, and that these nanosize regions with antiferromagnetic (AF) exchange inside may be considered as short-range-order AF domains. It was shown that the Yosida relation -Δ ρ /ρ ˜M2 provides an adequate description of the nMR effect for the case of Langevin-type behavior of magnetization. Moreover, a reduction of Ho-ion effective magnetic moments in the range 3-9 μB was found to develop both with temperature lowering and under the increase of holmium content. A phenomenological description of the large positive quadratic contribution Δ ρ /ρ ˜μD2H2 which dominates in HoxLu1 -xB12 in the intermediate temperature range 20-120 K allows us to estimate the drift mobility exponential changes μD˜T-α with α =1.3 -1.6 depending on Ho concentration. An even more comprehensive behavior of magnetoresistance has been found in the AF state of HoxLu1 -xB12 where an additional linear positive component was observed and attributed to charge-carrier scattering on the spin density wave (SDW). High-precision measurements of Δ ρ /ρ =f (H ,T ) have allowed us also to reconstruct the magnetic H-T phase diagram of Ho0.5Lu0.5B12 and to resolve its magnetic structure as a superposition of 4 f (based on localized moments) and 5 d (based on SDW) components.

  15. Macroporous hydrogels based on 2-hydroxyethyl methacrylate. Part 4: growth of rat bone marrow stromal cells in three-dimensional hydrogels with positive and negative surface charges and in polyelectrolyte complexes.

    PubMed

    Lesný, P; Prádný, M; Jendelová, P; Michálek, J; Vacík, J; Syková, E

    2006-09-01

    The growth of bone marrow stromal cells was assessed in vitro in macroporous hydrogels based on 2-hydro- xyethyl methacrylate (HEMA) copolymers with different electric charges. Copolymers of HEMA with sodium methacrylate (MA(-)) carried a negative electric charge, copolymers of HEMA with [2-(methacryloyloxy)ethyl] trimethylammonium chloride (MOETA(-)) carried a positive electric charge and terpolymers of HEMA, MA(-) and MOETA(+) carried both, positive and negative electric charges. The charges in the polyelectrolyte complexes were shielded by counter-ions. The hydrogels had similar porosities, based on a comparison of their diffusion parameters for small cations as measured by the real-time tetramethylammonium iontophoretic method of diffusion analysis. The cell growth was studied in the peripheral and central regions of the hydrogels at 2 hours and 2, 7, 14 and 28 days after cell seeding. Image analysis revealed the highest cellular density in the HEMA-MOETA(+) copolymers; most of the cells were present in the peripheral region of the hydrogels. A lower density of cells but no difference between the peripheral and central regions was observed in the HEMA-MA(-) copolymers and in polyelectrolyte complexes. This study showed that positively charged functional groups promote the adhesion of cells. PMID:16932865

  16. Conserved charged residues in the leucine-rich repeat domain of the Ran GTPase activating protein are required for Ran binding and GTPase activation.

    PubMed Central

    Haberland, J; Gerke, V

    1999-01-01

    GTPase activating proteins (GAPs) for Ran, a Ras-related GTPase participating in nucleocytoplasmic transport, have been identified in different species ranging from yeast to man. All RanGAPs are characterized by a conserved domain consisting of eight leucine-rich repeats (LRRs) interrupted at two positions by so-called separating regions, the latter being unique for RanGAPs within the family of LRR proteins. The cytosolic RanGAP activity is essential for the Ran GTPase cycle which in turn provides directionality in nucleocytoplasmic transport, but the structural basis for the interaction between Ran and its GAP has not been elucidated. In order to gain a better understanding of this interaction we generated a number of mutant RanGAPs carrying amino acid substitutions in the LRR domain and analysed their complex formation with Ran as well as their ability to stimulate the intrinsic GTPase activity of the G protein. We show that conserved charged residues present in the separating regions of the LRR domain are indispensable for efficient Ran binding and GAP activity. These separating regions contain three conserved arginines which could possibly serve as catalytic residues similar to the arginine fingers identified in GAPs for other small GTPases. However, mutations in two of these arginines do not affect the GAP activity and replacement of the third conserved arginine (Arg91 in human RanGAP) severely interferes not only with GAP activity but also with Ran binding. This indicates that RanGAP-stimulated GTP hydrolysis on Ran does not involve a catalytic arginine residue but requires certain charged residues of the LRR domain of the GAP for mediating the protein-protein interaction. PMID:10527945

  17. Study of electrochemically active carbon, Ga2O3 and Bi2O3 as negative additives for valve-regulated lead-acid batteries working under high-rate, partial-state-of-charge conditions

    NASA Astrophysics Data System (ADS)

    Zhao, Li; Chen, Baishuang; Wu, Jinzhu; Wang, Dianlong

    2014-02-01

    Electrochemically active carbon (EAC), Gallium (III) oxide (Ga2O3) and Bismuth (III) oxide (Bi2O3) are used as the negative additives of valve-regulated lead-acid (VRLA) batteries to prolong the cycle life of VRLA batteries under high-rate partial-state-of-charge (HRPSoC) conditions, and their effects on the cycle life of VRLA batteries are investigated. It is found that the addition of EAC in negative active material can restrain the sulfation of the negative plates and prolong the cycle performance of VRLA batteries under HRPSoC conditions. It is also observed that the addition of Ga2O3 or Bi2O3 in EAC can effectively increase the overpotential of hydrogen evolution on EAC electrodes, and decrease the evolution rate of hydrogen. An appropriate addition amount of Ga2O3 or Bi2O3 in the negative plates of VRLA batteries can decrease the cut-off charging voltage, increase the cut-off discharging voltage, and prolong the cycle life of VRLA batteries under HRPSoC conditions. The battery added with 0.5% EAC and 0.01% Ga2O3 in negative active material shows a lowest cut-off charging voltage and a highest cut-off discharging voltage under HRPSoC conditions, and its' cycle life reaches about 8100 cycles which is at least three times longer than that without Ga2O3.

  18. The role of charge and multiple faces of the CD8 alpha/alpha homodimer in binding to major histocompatibility complex class I molecules: support for a bivalent model.

    PubMed Central

    Giblin, P A; Leahy, D J; Mennone, J; Kavathas, P B

    1994-01-01

    The CD8 dimer interacts with the alpha 3 domain of major histocompatibility complex class I molecules through two immunoglobulin variable-like domains. In this study a crystal structure-informed mutational analysis has been performed to identify amino acids in the CD8 alpha/alpha homodimer that are likely to be involved in binding to class I. Several key residues are situated on the top face of the dimer within loops analogous to the complementarity-determining regions (CDRs) of immunoglobulin. In addition, other important amino acids are located in the A and B beta-strands on the sides of the dimer. The potential involvement of amino acids on both the top and the side faces of the molecule is consistent with a bivalent model for the interaction between a single CD8 alpha/alpha homodimer and two class I molecules and may have important implications for signal transduction in class I-expressing cells. This study also demonstrates a role for the positive surface potential of CD8 in class I binding and complements previous work demonstrating the importance of a negatively charged loop on the alpha 3 domain of class I for CD8 alpha/alpha-class I interaction. We propose a model whereby residues located on the CDR-like loops of the CD8 homodimer interact with the alpha 3 domain of MHC class I while amino acids on the side of the molecule containing the A and B beta-strands contact the alpha 2 domain of class I. Images PMID:8127870

  19. Characterization of immune genes from the schistosome host snail Biomphalaria glabrata that encode peptidoglycan recognition proteins and gram-negative bacteria binding protein

    PubMed Central

    Zeng, Yong; Loker, Eric S.

    2013-01-01

    Peptidoglycan (PGN) recognition proteins (PGRPs) and gram-negative bacteria binding proteins (GNBPs) play an essential role in Toll/Imd signaling pathways in arthropods. The existence of homologous pathways involving PGRPs and GNBPs in other major invertebrate phyla such as the Mollusca remains unclear. In this paper, we report four full-length PGRP cDNAs and one full-length GNBP cDNA cloned from the snail Biomphalaria glabrata, the intermediate host of the human blood fluke Schistosoma mansoni, designated as BgPGRPs and BgGNBP, respectively. Three transcripts are generated from a long form PGRP gene (BgPGRP-LA) by alternative splicing and one from a short form PGRP gene (BgPGRP-SA). BgGNBP encodes a putative secreted protein. Northern blots demonstrated that expression of BgPGRP-SA and BgGNBP was down-regulated in B. glabrata at 6 h after exposure to three types of microbes. No significant changes in expression were observed in snails at 2 days post-exposure (dpe) to the trematodes Echinostoma paraensei or S. mansoni. However, up-regulation of BgPGRP-SA in M line snails at later time points of infection with E. paraensei (i.e., 12 and 17 dpe) was observed. Our study revealed that exposure to either microbes or trematodes did not alter the expression levels of BgPGRP-LAs, which were consistently low. This study provides new insights into the potential pathogen recognition capabilities of molluscs, indicates that further studies of the Toll/Imd pathways in this phylum are in order, and provides additional ways to judge the importance of this pathway in the evolution of internal defense across the animal phyla. PMID:17805526

  20. Organic dust augments nucleotide-binding oligomerization domain expression via an NF-κB pathway to negatively regulate inflammatory responses

    PubMed Central

    Kielian, Tammy; Wyatt, Todd A.; Gleason, Angela M.; Stone, Jeremy; Palm, Kelsey; West, William W.; Romberger, Debra J.

    2011-01-01

    Nucleotide-binding oligomerization domain 2 (NOD2) is involved in innate immune responses to peptidoglycan degradation products. Peptidoglycans are important mediators of organic dust-induced airway diseases in exposed agriculture workers; however, the role of NOD2 in response to complex organic dust is unknown. Monocytes/macrophages were exposed to swine facility organic dust extract (ODE), whereupon NOD2 expression was evaluated by real-time PCR and Western blot. ODE induced significant NOD2 mRNA and protein expression at 24 and 48 h, respectively, which was mediated via a NF-κB signaling pathway as opposed to a TNF-α autocrine/paracrine mechanism. Specifically, NF-κB translocation increased rapidly following ODE stimulation as demonstrated by EMSA, and inhibition of the NF-κB pathway significantly reduced ODE-induced NOD2 expression. However, there was no significant reduction in ODE-induced NOD2 gene expression when TNF-α was inhibited or absent. Next, it was determined whether NOD2 regulated ODE-induced inflammatory cytokine production. Knockdown of NOD2 expression by small interfering RNA resulted in increased CXCL8 and IL-6, but not TNF-α production in response to ODE. Similarly, primary lung macrophages from NOD2 knockout mice demonstrated increased IL-6, CXCL1, and CXCL1, but not TNF-α, expression. Lastly, a higher degree of airway inflammation occurred in the absence of NOD2 following acute (single) and repetitive (3 wk) ODE exposure in an established in vivo murine model. In summary, ODE-induced NOD2 expression is directly dependent on NF-κB signaling, and NOD2 is a negative regulator of complex, organic dust-induced inflammatory cytokine/chemokine production in mononuclear phagocytes. PMID:21665963

  1. Phospholipid and Hydrocarbon Interactions with a Charged Electrode Interface.

    PubMed

    Levine, Zachary A; DeNardis, Nadica Ivošević; Vernier, P Thomas

    2016-03-22

    Using a combination of molecular dynamics simulations and experiments we examined the interactions of alkanes and phospholipids at charged interfaces in order to understand how interfacial charge densities affect the association of these two representative molecules with electrodes. Consistent with theory and experiment, these model systems reveal interfacial associations mediated through a combination of Coulombic and van der Waals forces. van der Waals forces, in particular, mediate rapid binding of decane to neutral electrodes. No decane binding was observed at high surface charge densities because of interfacial water polarization, which screens hydrophobic attractions. The positively charged choline moiety of the phospholipid palmitoyloleoylphosphatidylcholine (POPC) is primarily responsible for POPC attraction by a moderately negatively charged electrode. The hydrocarbon tails of POPC interact with the hydrophobic electrode interface similarly to decane. Previously reported electrochemical results confirm these findings by demonstrating bipolar displacement currents from PC vesicles adhering to moderately negatively charged interfaces, originating from the choline interactions observed in simulations. At more negatively charged interfaces, choline-to-surface binding was stronger. In both simulations and experiments the maximal interaction of anionic PS occurs with a positively charged interface, provided that the electrostatic forces outweigh local Lennard-Jones interactions. Direct comparisons between the binding affinities measured in experiments and those obtained in simulations reveal previously unobserved atomic interactions that facilitate lipid vesicle adhesion to charged interfaces. Moreover, the implementation of a charged interface in molecular dynamics simulations provides an alternative method for the generation of large electric fields across phospholipid bilayers, especially for systems with periodic boundary conditions, and may be useful for

  2. Sentential Negation in English

    ERIC Educational Resources Information Center

    Mowarin, Macaulay

    2009-01-01

    This paper undertakes a detailed analysis of sentential negation in the English language with Chomsky's Government-Binding theory of Transformational Grammar as theoretical model. It distinguishes between constituent and sentential negation in English. The essay identifies the exact position of Negation phrase in an English clause structure. It…

  3. RNA Binding-independent Dimerization of Adenosine Deaminases Acting on RNA and Dominant Negative Effects of Nonfunctional Subunits on Dimer Functions*

    PubMed Central

    Valente, Louis; Nishikura, Kazuko

    2010-01-01

    RNA editing that converts adenosine to inosine in double-stranded RNA (dsRNA) is mediated by adenosine deaminases acting on RNA (ADAR). ADAR1 and ADAR2 form respective homodimers, and this association is essential for their enzymatic activities. In this investigation, we set out experiments aiming to determine whether formation of the homodimer complex is mediated by an amino acid interface made through protein-protein interactions of two monomers or via binding of the two subunits to a dsRNA substrate. Point mutations were created in the dsRNA binding domains (dsRBDs) that abolished all RNA binding, as tested for two classes of ADAR ligands, long and short dsRNA. The mutant ADAR dimer complexes were intact, as demonstrated by their ability to co-purify in a sequential affinity-tagged purification and also by their elution at the dimeric fraction position on a size fractionation column. Our results demonstrated ADAR dimerization independent of their binding to dsRNA, establishing the importance of protein-protein interactions for dimer formation. As expected, these mutant ADARs could no longer perform their catalytic function due to the loss in substrate binding. Surprisingly, a chimeric dimer consisting of one RNA binding mutant monomer and a wild type partner still abolished its ability to bind and edit its substrate, indicating that ADAR dimers require two subunits with functional dsRBDs for binding to a dsRNA substrate and then for editing activity to occur. PMID:17428802

  4. DNA Binding to the Silica Surface.

    PubMed

    Shi, Bobo; Shin, Yun Kyung; Hassanali, Ali A; Singer, Sherwin J

    2015-08-27

    We investigate the DNA-silica binding mechanism using molecular dynamics simulations. This system is of technological importance, and also of interest to explore how negatively charged DNA can bind to a silica surface, which is also negatively charged at pH values above its isoelectric point near pH 3. We find that the two major binding mechanisms are attractive interactions between DNA phosphate and surface silanol groups and hydrophobic bonding between DNA base and silica hydrophobic region. Umbrella sampling and the weighted histogram analysis method (WHAM) are used to calculate the free energy surface for detachment of DNA from a binding configuration to a location far from the silica surface. Several factors explain why single-stranded DNA (ssDNA) has been observed to be more strongly attracted to silica than double-stranded (dsDNA): (1) ssDNA is more flexible and therefore able to maximize the number of binding interactions. (2) ssDNA has free unpaired bases to form hydrophobic attachment to silica while dsDNA has to break hydrogen bonds with base partners to get free bases. (3) The linear charge density of dsDNA is twice that of ssDNA. We devise a procedure to approximate the atomic forces between biomolecules and amorphous silica to enable large-scale biomolecule-silica simulations as reported here. PMID:25966319

  5. Proposal for high-speed and high-fidelity electron-spin initialization in a negatively charged quantum dot coupled to a microcavity in a weak external magnetic field

    SciTech Connect

    Majumdar, Arka; Lin Ziliang; Faraon, Andrei; Vuckovic, Jelena

    2010-08-15

    We describe a proposal for fast electron-spin initialization in a negatively charged quantum dot coupled to a microcavity without the need for a strong magnetic field. We employ two-photon excitation to access trion states that are spin forbidden by one-photon excitation. Our simulation shows a maximum initialization speed of 1.3 GHz and maximum fidelity of 99.7% with realistic system parameters.

  6. Analytical modeling and simulation of electrochemical charge/discharge behavior of Si thin film negative electrodes in Li-ion cells

    NASA Astrophysics Data System (ADS)

    Jagannathan, M.; Chandran, K. S. Ravi

    2014-02-01

    Physically-based analytical models that provide insights into the diffusion and/or interface charge transfer effects in bulk (lithiating/delithiating) electrodes are needed to truly assess the performance/limitations of electrode materials for Li-ion batteries. In this context, an analytical modeling framework is constructed here to predict the electrochemical charge-discharge characteristics during lithiation and delithiation of solid amorphous Si (a-Si) thin film electrodes. The framework includes analytical expressions that satisfy Fick's second law for Li transport and the requisite flux boundary conditions of lithiation and delithiation steps. The expressions are derived here by the method of separation of variables. They enable the determination of transient Li concentration profiles in the thin film electrode as a function of state of charge/discharge. The time-dependent electrode surface concentrations (at the electrode-electrolyte interface) obtained from these profiles were used to determine the activation overpotentials and thus, the non-equilibrium cell potentials, as a function of state of charge/discharge using Butler-Volmer kinetics. The simulated charge/discharge characteristics agreed well with the experimental data of a-Si thin film electrodes obtained at different C-rates. The model offers insights into how the charge-discharge behavior is controlled by diffusion limitation within electrode and/or the activation overpotentials at the interface. The analytical framework is also shown to predict successfully the hysteretic behavior of lithiation/delithiation voltage curves.

  7. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  8. Spectroscopic and molecular docking studies on the charge transfer complex of bovine serum albumin with quinone in aqueous medium and its influence on the ligand binding property of the protein

    NASA Astrophysics Data System (ADS)

    Satheshkumar, Angupillai; Elango, Kuppanagounder P.

    2014-09-01

    The spectral techniques such as UV-Vis, 1H NMR and fluorescence and electrochemical experiments have been employed to investigate the interaction between 2-methoxy-3,5,6-trichloro-1,4-benzoquinone (MQ; a water soluble quinone) and bovine serum albumin (BSA) in aqueous medium. The fluorescence of BSA was quenched by MQ via formation of a 1:1 BSA-MQ charge transfer adduct with a formation constant of 3.3 × 108 L mol-1. Based on the Forster’s theory the binding distance between them is calculated as 2.65 nm indicating high probability of binding. For the first time, influence of quinone on the binding property of various types of ligands such as aspirin, ascorbic acid, nicotinimide and sodium stearate has also been investigated. The results indicated that the strong and spontaneous binding existing between BSA and MQ, decreased the intensity of binding of these ligands with BSA. Since Tryptophan (Trp) is the basic residue present in BSA, a comparison between binding property of Trp-MQ adduct with that of BSA-MQ with these ligands has also been attempted. 1H NMR titration study indicated that the Trp forms a charge transfer complex with MQ, which reduces the interaction of Trp with the ligands. Molecular docking study supported the fact that the quinone interacts with the Trp212 unit of the BSA and the free energy change of binding (ΔG) for the BSA-MQ complex was found to be -46 kJ mol-1, which is comparable to our experimental free energy of binding (-49 kJ mol-1) obtained from fluorescence study.

  9. DNA binding and recognition by binuclear transition metal complexes

    NASA Astrophysics Data System (ADS)

    Liu, Changlin; Yan, Rui; Xu, Yan; Yu, Siwang; Liao, Zhanru; Li, Dongfeng; Xu, Hui-Bie F.

    2001-09-01

    The development of small molecules that can bind and recognize DNA with sequence- or stereo-specificity under physiological conditions has been attracting a great interest in chemistry and biochemistry. Here, spectroscopic characterization and gel electrophoresis methods have been utilized to investigate the DNA binding and recognition by a variety of binuclear transition metal complexes. The result indicate that the structures and charges of binuclear transition metal complexes, compositions of coordination spheres, central metal ions and their coordination unsaturation, and separations between two central metal atoms can exert significant effects on the DNA binding and recognition. If there are not intercalative ligands into DNA base pairs or kinetically substitutable ligands by DNA phosphate groups within coordination sphere, the coordination saturation and compact binuclear transition metal complexes weaker bind to DNA than the coordination unsaturation and extended ones to DNA. Since the different transtiometal ions exhibit different affinities to DNA phosphate oxygen atoms, the binding interactions between their binuclear complexes and DNA are controlled by the affinity. He binuclear complexes with one or more negative charges lead to a consequence that they can not efficient associate with DNA, because DNA phosphodiester backbone is negatively charged. Whenthe separations between two central transition metal atoms is more than the distance between two DNA base pairs, the binuclear complexes could bind and recognize the DNA sequence with two or more base pairs. The protonated and positively charged ligands can strengthen the DNA binding and recognition by these binuclear metal complexes. Based on such DNA binding and recognition principles, the binuclear zinc complex designed in the study preferentially bind and recognize the following DNA sequence on pBR322 DNA with binding constant K.

  10. Synthesis, spectroscopic characterization and structural investigations of a new charge transfer complex of 2,6-diaminopyridine with 3,5-dinitrobenzoic acid: DNA binding and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Khan, Ishaat M.; Ahmad, Afaq; Kumar, Sarvendra

    2013-03-01

    A new charge transfer (CT) complex [(DAPH)+(DNB)-] consisting of 2,6-diaminopyridine (DAP) as donor and 3,5-dinitrobenzoic acid (DNB-H) as acceptor, was synthesized and characterized by FTIR, 1H and 13C NMR, ESI mass spectroscopic and X-ray crystallographic techniques. The hydrogen bonding (N+-H⋯O-) plays an important role to consolidate the cation and anion together. CT complex shows a considerable interaction with Calf thymus DNA. The CT complex was also tested for its antibacterial activity against two Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa strains by using Tetracycline as standard, and antifungal property against Aspergillus niger, Candida albicans, and Penicillium sp. by using Nystatin as standard. The results were compared with standard drugs and significant conclusions were obtained. A polymeric net work through H-bonding interactions between neighboring moieties was observed. This has been attributed to the formation of 1:1 type CT complex.

  11. Costimulation by B7-1 and LFA-3 targets distinct nuclear factors that bind to the interleukin-2 promoter: B7-1 negatively regulates LFA-3-induced NF-AT DNA binding.

    PubMed Central

    Parra, E; Varga, M; Hedlund, G; Kalland, T; Dohlsten, M

    1997-01-01

    We have characterized the regulation of nuclear factors involved in transcriptional control of the interleukin-2 (IL-2) promoter-enhancer activity in Jurkat T cells stimulated with superantigen presented on HLA-DR transfectants combined with the ligands LFA-3 (CD58) and B7-1 (CD80). Gel shift analyses showed that NF-AT was strongly induced in LFA-3-costimulated Jurkat T cells, suggesting that NF-AT is a key target nuclear factor for the CD2-LFA-3 pathway. Studies using HLA-DR-B7-1-LFA-3 triple transfectants showed that the LFA-3-induced NF-AT DNA binding activity was negatively regulated by B7-1 costimulation. In contrast, induction of a CD28 response complex containing only c-Rel proteins was seen after B7-1 costimulation. Both LFA-3 costimulation and B7-1 costimulation induced the AP-1 and NF-kappaB nuclear factors. Distinct compositions of the NF-AT complexes were seen in B7-1- and LFA-3-costimulated cells. LFA-3 induced primarily Jun-D, Fra-1, and Fra-2, while B7-1 induced June-D-Fos complexes. In contrast, AP-1 and NF-kappaB complexes induced in B7-1- and LFA-3-costimulated T cells showed similar contents. Transient transfection of Jurkat T cells with a construct encoding the IL-2 enhancer-promoter region (position -500 to +60) linked to a luciferase reporter gene revealed that B7-1 costimulation was required to induce strong transcriptional activity. Combined B7-1-LFA-3 costimulation resulted in a synergistic increase in IL-2 transcriptional activity. Multimers of the AP-1, NF-AT, NF-kappaB, and CD28 response elements showed distinct kinetics and activity after LFA-3 and B7-1 costimulation and revealed that B7-1 and LFA-3 converge to superinduce transcriptional activity of the AP-1, NF-AT, and CD28 response elements. Transcriptional studies with an IL-2 enhancer-promoter carrying a mutation in the CD28 response element site revealed that the activity was reduced by 80% after B7-1 and B7-1-LFA-3 costimulation whereas the transcriptional activity induced by LFA

  12. The self-consistent charge density functional tight binding method applied to liquid water and the hydrated excess proton: benchmark simulations.

    PubMed

    Maupin, C Mark; Aradi, Bálint; Voth, Gregory A

    2010-05-27

    The self-consistent charge density functional tight binding (SCC-DFTB) method is a relatively new approximate electronic structure method that is increasingly used to study biologically relevant systems in aqueous environments. There have been several gas phase cluster calculations that indicate, in some instances, an ability to predict geometries, energies, and vibrational frequencies in reasonable agreement with high level ab initio calculations. However, to date, there has been little validation of the method for bulk water properties, and no validation for the properties of the hydrated excess proton in water. Presented here is a detailed SCC-DFTB analysis of the latter two systems. This work focuses on the ability of the original SCC-DFTB method, and a modified version that includes a hydrogen bonding damping function (HBD-SCC-DFTB), to describe the structural, energetic, and dynamical nature of these aqueous systems. The SCC-DFTB and HBD-SCC-DFTB results are compared to experimental data and Car-Parrinello molecular dynamics (CPMD) simulations using the HCTH/120 gradient-corrected exchange-correlation energy functional. All simulations for these systems contained 128 water molecules, plus one additional proton in the case of the excess proton system, and were carried out in a periodic simulation box with Ewald long-range electrostatics. The liquid water structure for the original SCC-DFTB is shown to poorly reproduce bulk water properties, while the HBD-SCC-DFTB somewhat more closely represents bulk water due to an improved ability to describe hydrogen bonding energies. Both SCC-DFTB methods are found to underestimate the water dimer interaction energy, resulting in a low heat of vaporization and a significantly elevated water oxygen diffusion coefficient as compared to experiment. The addition of an excess hydrated proton to the bulk water resulted in the Zundel cation (H(5)O(2)(+)) stabilized species being the stable form of the charge defect, which

  13. The receptor binding domain of botulinum neurotoxin serotype C binds phosphoinositides.

    PubMed

    Zhang, Yanfeng; Varnum, Susan M

    2012-03-01

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD(50) of ∼1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a "dual receptor" mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro domain. BoNT/C-HCR was found to bind negatively charged phospholipids, preferentially phosphoinositides in both assays. Interactions with phosphoinositides may facilitate tighter binding between neuronal membranes and BoNT/C. PMID:22120109

  14. Insulin-like growth factor binding protein-5 (IGFBP-5) interacts with thrombospondin-1 to induce negative regulatory effects on IGF-I actions.

    PubMed

    Moralez, Anna M; Maile, Laura A; Clarke, Jane; Busby, Walker H; Clemmons, David R

    2005-05-01

    Insulin-like growth factor binding protein-5 (IGFBP-5) and thrombospondin-1 (TS-1) are both present in extracellular matrix (ECM). Both proteins have been shown to bind to one another with high affinity. The purpose of these studies was to determine how the interaction between IGFBP-5 and TS-1 modulates IGF-I actions in porcine aortic smooth muscle cells (pSMC) in culture. The addition of increasing concentrations of TS-1 to pSMC cultures enhanced the protein synthesis and cell migration responses to IGF-I; whereas the addition of IGFBP-5 alone resulted in minimal changes. In contrast, the addition of IGFBP-5 to cultures that were also exposed to IGF-I and TS-1 resulted in inhibition of protein synthesis. When the cell migration response was assessed, the response to IGF-I plus TS-1 was also significantly inhibited by the addition of IGFBP-5, whereas 1.0 microg/ml of IGFBP-5 alone had no effect on the response to IGF-I. To determine the molecular mechanism by which this inhibition occurred, a mutant form of IGFBP-5 that does not bind to IGF-I was tested. This mutant was equipotent compared to native IGFBP-5 in its ability to inhibit both protein synthesis and cell migration responses to IGF-I plus TS-1 thus excluding the possibility that IGFBP-5 was inhibiting the response to TS-1 and IGF-I by inhibiting IGF-I binding to the IGF-I receptor. To determine if an interaction between TS-1 and IGFBP-5 was the primary determinant of the inhibitory effect of IGFBP-5, an IGFBP-5 mutant that bound poorly to TS-1 was utilized. The addition of 1.0 microg/ml of this mutant did not inhibit the protein synthesis or cell migration responses to IGF-I plus TS-1. To determine the mechanism by which IGFBP-5 binding to TS-1 inhibited cellular responses to TS-1 plus IGF-I, TS-1 binding to integrin associated protein (IAP) was assessed. The addition of IGFBP-5 (1.0 microg/ml) inhibited TS-1-IAP association. In contrast, a mutant form of IGFBP-5 that bound poorly to TS-1 had a minimal

  15. Excitons and charged excitons in semiconductor quantum wells

    SciTech Connect

    Riva, C.; Peeters, F. M.; Varga, K.

    2000-05-15

    A variational calculation of the ground-state energy of neutral excitons and of positively and negatively charged excitons (trions) confined in a single-quantum well is presented. We study the dependence of the correlation energy and of the binding energy on the well width and on the hole mass. The conditional probability distribution for positively and negatively charged excitons is obtained, providing information on the correlation and the charge distribution in the system. A comparison is made with available experimental data on trion binding energies in GaAs-, ZnSe-, and CdTe-based quantum well structures, which indicates that trions become localized with decreasing quantum well width. (c) 2000 The American Physical Society.

  16. Crucial roles of charged saccharide moieties in survival of gram negative bacteria against protamine revealed by combination of grazing incidence x-ray structural characterizations and Monte Carlo simulations

    NASA Astrophysics Data System (ADS)

    Oliveira, Rafael G.; Schneck, Emanuel; Quinn, Bonnie E.; Konovalov, Oleg V.; Brandenburg, Klaus; Gutsmann, Thomas; Gill, Tom; Hanna, Charles B.; Pink, David A.; Tanaka, Motomu

    2010-04-01

    Grazing incidence x-ray scattering techniques and Monte Carlo (MC) simulations are combined to reveal the influence of molecular structure (genetic mutation) and divalent cations on the survival of gram negative bacteria against cationic peptides such as protamine. The former yields detailed structures of bacterial lipopolysaccharide (LPS) membranes with minimized radiation damages, while the minimal computer model based on the linearized Poisson-Boltzmann theory allows for the simulation of conformational changes of macromolecules (LPSs and peptides) that occur in the time scale of ms. The complementary combination of the structural characterizations and MC simulation demonstrates that the condensations of divalent ions ( Ca2+ or Mg2+ ) in the negatively charged core saccharides are crucial for bacterial survival.

  17. Lack of Negatively Charged Residues at the External Mouth of Kir2.2 Channels Enable the Voltage-Dependent Block by External Mg2+

    PubMed Central

    Li, Junwei; Xie, Xiaoxiao; Liu, Jun; Yu, Hui; Zhang, Suhua; Zhan, Yong; Zhang, Hailin; Logothetis, Diomedes E.; An, Hailong

    2014-01-01

    Kir channels display voltage-dependent block by cytosolic cations such as Mg2+ and polyamines that causes inward rectification. In fact, cations can regulate K channel activity from both the extracellular and intracellular sides. Previous studies have provided insight into the up-regulation of Kir channel activity by extracellular K+ concentration. In contrast, extracellular Mg2+ has been found to reduce the amplitude of the single-channel current at milimolar concentrations. However, little is known about the molecular mechanism of Kir channel blockade by external Mg2+ and the relationship between the Mg2+ blockade and activity potentiation by permeant K+ ions. In this study, we applied an interactive approach between theory and experiment. Electrophysiological recordings on Kir2.2 and its mutants were performed by heterologous expression in Xenopus laevis oocytes. Our results confirmed that extracellular Mg2+ could reduce heterologously expressed WT Kir2.2 currents in a voltage dependent manner. The kinetics of inhibition and recovery of Mg2+ exhibit a 3∼4s time constant. Molecular dynamics simulation results revealed a Mg2+ binding site located at the extracellular mouth of Kir2.2 that showed voltage-dependent Mg2+ binding. The mutants, G119D, Q126E and H128D, increased the number of permeant K+ ions and reduced the voltage-dependent blockade of Kir2.2 by extracellular Mg2+. PMID:25350118

  18. Water clusters in an argon matrix: infrared spectra from molecular dynamics simulations with a self-consistent charge density functional-based tight binding/force-field potential.

    PubMed

    Simon, Aude; Iftner, Christophe; Mascetti, Joëlle; Spiegelman, Fernand

    2015-03-19

    The present theoretical study aims at investigating the effects of an argon matrix on the structures, energetics, dynamics, and infrared (IR) spectra of small water clusters (H2O)n (n = 1-6). The potential energy surface is obtained from a hybrid self-consistent charge density functional-based tight binding/force-field approach (SCC-DFTB/FF) in which the water clusters are treated at the SCC-DFTB level and the matrix is modeled at the FF level by a cluster consisting of ∼340 Ar atoms with a face centered cubic (fcc) structure, namely (H2O)n/Ar. With respect to a pure FF scheme, this allows a quantum description of the molecular system embedded in the matrix, along with all-atom geometry optimization and molecular dynamics (MD) simulations of the (H2O)n/Ar system. Finite-temperature IR spectra are derived from the MD simulations. The SCC-DFTB/FF scheme is first benchmarked on (H2O)Arn clusters against correlated wave function results and DFT calculations performed in the present work, and against FF data available in the literature. Regarding (H2O)n/Ar systems, the geometries of the water clusters are found to adapt to the fcc environment, possibly leading to intermolecular distortion and matrix perturbation. Several energetical quantities are estimated to characterize the water clusters in the matrix. In the particular case of the water hexamer, substitution and insertion energies for the prism, bag, and cage are found to be lower than that for the 6-member ring isomer. Finite-temperature MD simulations show that the water monomer has a quasifree rotation motion at 13 K, in agreement with experimental data. In the case of the water dimer, the only large-amplitude motion is a distortion-rotation intermolecular motion, whereas only vibration motions around the nuclei equilibrium positions are observed for clusters with larger sizes. Regarding the IR spectra, we find that the matrix environment leads to redshifts of the stretching modes and almost no shift of the

  19. Description of phosphate hydrolysis reactions with the Self-Consistent-Charge Density-Functional-Tight-Binding (SCC-DFTB) theory. 1. Parameterization

    PubMed Central

    Yang, Yang; Yu, Haibo; York, Darrin; Elstner, Marcus

    2009-01-01

    Phosphate chemistry is involved in many key biological processes yet the underlying mechanism often remains unclear. For theoretical analysis to effectively complement experimental mechanistic analysis, it is essential to develop computational methods that can capture the complexity of the underlying potential energy surface and allow for sufficient sampling of the configurational space. To this end, we report the parameterization of an approximate density functional theory, Self-Consistent-Charge Density-Functional Tight-Binding (SCC-DFTB) method for systems containing phosphorus. Compared to high-level density functional theory and ab initio (MP2 and G3B3) results, the standard second-order parameterization is shown to give reliable structures for a diverse set of phosphate compounds but inaccurate energetics. With the on-site third-order terms included, referred to as SCC-DFTBPA, calculated proton affinities of phosphate compounds are substantially improved, although it remains difficult to obtain reliable proton affinity for both phosphates and compounds that do not contain phosphorus, indicating that further improvement in the formulation of SCC-DFTB is still a challenge to meet. To make SCC-DFTB applicable to phosphate reactions in the current (on-site-third-order-only) formulation, a “reaction-specific” parameterization, referred to as SCC-DFTBPR, is developed based on hydrolysis reactions of model phosphate species. Benchmark calculations in both the gas-phase and solution-phase indicate that SCC-DFTBPR gives reliable structural properties and semi-quantitative energetics for phosphate hydrolysis reactions. Since the number of reaction-specific parameters is small, it is likely that SCC-DFTBPR is applicable to a broad set of phosphate species. Indeed, for 56 reaction exothermicities and 47 energy barriers related to RNA catalysis model reactions collected from the QCRNA database, which involve molecules rather different from those used to parameterize

  20. Rapid Detection of Methicillin Resistance in Coagulase-Negative Staphylococci by a Penicillin-Binding Protein 2a-Specific Latex Agglutination Test

    PubMed Central

    Horstkotte, Matthias A.; Knobloch, Johannes K.-M.; Rohde, Holger; Mack, Dietrich

    2001-01-01

    The detection of PBP 2a by the MRSA-Screen latex agglutination test with 201 clinical coagulase-negative staphylococci had an initial sensitivity of 98% and a high degree of specificity for Staphylococcus epidermidis strains compared to PCR for mecA. Determination of oxacillin MICs evaluated according to the new breakpoint (0.5 μg/ml) of the National Committee for Clinical Laboratory Standards exhibited an extremely low specificity for this population. PMID:11574595

  1. Suppression of telomere-binding protein TPP1 resulted in telomere dysfunction and enhanced radiation sensitivity in telomerase-negative osteosarcoma cell line

    SciTech Connect

    Qiang, Weiguang; Wu, Qinqin; Zhou, Fuxiang; Xie, Conghua; Wu, Changping; Zhou, Yunfeng

    2014-03-07

    Highlights: • Down-regulation of TPP1 shortened telomere length in telomerase-negative cells. • Down-regulation of TPP1 induced cell apoptosis in telomerase-negative cells. • Down-regulation of TPP1 increased radiosensitivity in telomerase-negative cells. - Abstract: Mammalian telomeres are protected by the shelterin complex that contains the six core proteins POT1, TPP1, TIN2, TRF1, TRF2 and RAP1. TPP1, formerly known as TINT1, PTOP, and PIP1, is a key factor that regulates telomerase recruitment and activity. In addition to this, TPP1 is required to mediate the shelterin assembly and stabilize telomere. Previous work has found that TPP1 expression was elevated in radioresistant cells and that overexpression of TPP1 led to radioresistance and telomere lengthening in telomerase-positive cells. However, the exact effects and mechanism of TPP1 on radiosensitivity are yet to be precisely defined in the ALT cells. Here we report on the phenotypes of the conditional deletion of TPP1 from the human osteosarcoma U2OS cells using ALT pathway to extend the telomeres.TPP1 deletion resulted in telomere shortening, increased apoptosis and radiation sensitivity enhancement. Together, our findings show that TPP1 plays a vital role in telomere maintenance and protection and establish an intimate relationship between TPP1, telomere and cellular response to ionizing radiation, but likely has the specific mechanism yet to be defined.

  2. Effect of Polyelectrolyte Stiffness and Solution pH on the Nanostructure of Complexes Formed by Cationic Amphiphiles and Negatively Charged Polyelectrolytes.

    PubMed

    Ram-On, Maor; Cohen, Yachin; Talmon, Yeshayahu

    2016-07-01

    The interaction between amphiphiles and polyelectrolytes has been widely investigated in recent years due to their potential application in industry and medicine, with special focus on gene therapy. The cationic lipid dioleoyl trimethylammonium propane, DOTAP, and the oppositely charged polyelectrolytes, sodium poly(acrylic acid) and sodium poly(styrenesulfonate), form multilamellar complexes in water. Because of the different molecular stiffness of the two polyelectrolytes, they form different nanostructured complexes. Also, because of the different ionization behavior of the two polyelectrolytes, pH differently affects the complexation of the polyelectrolytes with didodecyldimethylammonium bromide (DDAB), another cationic surfactant. We used cryogenic temperature transmission electron microscopy (cryo-TEM) and small-angle X-ray scattering (SAXS) to compare the nanostructures formed. Our results show that although the basic nanostructures of the complexes are always lamellar (multilamellar or unilamellar) the morphology of the complexes is affected by the polyelectrolyte rigidity and the solution pH. PMID:27049758

  3. The empirical dependence of radiation-induced charge neutralization on negative bias in dosimeters based on the metal-oxide-semiconductor field-effect transistor

    SciTech Connect

    Benson, Chris; Albadri, Abdulrahman; Joyce, Malcolm J.; Price, Robert A.

    2006-08-15

    The dependence of radiation-induced charge neutralization (RICN) has been studied in metal-oxide-semiconductor field-effect transistor (MOSFET) dosimeters. These devices were first exposed to x rays under positive bias and then to further dose increments at a selection of reverse bias levels. A nonlinear empirical trend has been established that is consistent with that identified in the data obtained in this work. Estimates for the reverse bias level corresponding to the maximum rate of RICN have been extracted from the data. These optimum bias levels appear to be independent of the level of initial absorbed dose under positive bias. The established models for threshold voltage change have been considered and indicate a related nonlinear trend for neutralization cross section {sigma}{sub N} as a function of oxide field. These data are discussed in the context of dose measurement with MOSFETs and within the framework of statistical mechanics associated with neutral traps and their field dependence.

  4. Changes in mitochondrial surface charge mediate recruitment of signaling molecules during apoptosis.

    PubMed

    Heit, Bryan; Yeung, Tony; Grinstein, Sergio

    2011-01-01

    Electrostatic interactions with negative lipids contribute to the subcellular localization of polycationic proteins. In situ measurements using cytosolic probes of surface charge indicate that normal mitochondria are not noticeably electronegative. However, during apoptosis mitochondria accrue negative charge and acquire the ability to attract cationic proteins, including K-Ras. The marked increase in the surface charge of mitochondria occurs early in apoptosis, preceding depolarization of their inner membrane, cytochrome c release, and flipping of phosphatidylserine across the plasmalemma. Using novel biosensors, we determined that the increased electronegativity of the mitochondria coincided with and was likely attributable to increased exposure of cardiolipin, which is dianionic. Ectopic (over)expression of cardiolipin-binding proteins precluded the increase in surface charge and inhibited apoptosis, implying that mitochondrial exposure of negatively charged lipids is required for progression of programmed cell death. PMID:20926778

  5. Melittin binding to mixed phosphatidylglycerol/phosphatidylcholine membranes

    SciTech Connect

    Beschiaschvili, G.; Seelig, J. )

    1990-01-09

    The binding of bee venom melittin to negatively charged unilamellar vesicles and planar lipid bilayers composed of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) was studied with circular dichroism and deuterium NMR spectroscopy. The melittin binding isotherm was measured for small unilamellar vesicles containing 10 or 20 mol % POPG. Due to electrostatic attraction, binding of the positively charged melittin was much enhanced as compared to the binding to neutral lipid vesicles. However, after correction for electrostatic effects by means of the Gouy-Chapman theory, all melittin binding isotherms could be described by a partition Kp = (4.5 +/- 0.6) x 10(4) M-1. It was estimated that about 50% of the total melittin surface was embedded in a hydrophobic environment. The melittin partition constant for small unilamellar vesicles was by a factor of 20 larger than that of planar bilayers and attests to the tighter lipid packing in the nonsonicated bilayers. Deuterium NMR studies were performed with coarse lipid dispersions. Binding of melittin to POPC/POPG (80/20 mol/mol) membranes caused systematic changes in the conformation of the phosphocholine and phosphoglycerol head groups which were ascribed to the influence of electrostatic charge on the choline dipole. While the negative charge of phosphatidylglycerol moved the N+ end of the choline -P-N+ dipole toward the bilayer interior, the binding of melittin reversed this effect and rotated the N+ end toward the aqueous phase. No specific melittin-POPG complexes could be detected. The phosphoglycerol head group was less affected by melittin binding than its choline counterpart.

  6. Negative compressibility observed in graphene containing resonant impurities

    SciTech Connect

    Chen, X. L.; Wang, L.; Li, W.; Wang, Y.; He, Y. H.; Wu, Z. F.; Han, Y.; Zhang, M. W.; Xiong, W.; Wang, N.

    2013-05-20

    We observed negative compressibility in monolayer graphene containing resonant impurities under different magnetic fields. Hydrogenous impurities were introduced into graphene by electron beam (e-beam) irradiation. Resonant states located in the energy region of {+-}0.04 eV around the charge neutrality point were probed in e-beam-irradiated graphene capacitors. Theoretical results based on tight-binding and Lifshitz models agreed well with experimental observations of graphene containing a low concentration of resonant impurities. The interaction between resonant states and Landau levels was detected by varying the applied magnetic field. The interaction mechanisms and enhancement of the negative compressibility in disordered graphene are discussed.

  7. Negative compressibility observed in graphene containing resonant impurities

    NASA Astrophysics Data System (ADS)

    Chen, X. L.; Wang, L.; Li, W.; Wang, Y.; He, Y. H.; Wu, Z. F.; Han, Y.; Zhang, M. W.; Xiong, W.; Wang, N.

    2013-05-01

    We observed negative compressibility in monolayer graphene containing resonant impurities under different magnetic fields. Hydrogenous impurities were introduced into graphene by electron beam (e-beam) irradiation. Resonant states located in the energy region of ±0.04 eV around the charge neutrality point were probed in e-beam-irradiated graphene capacitors. Theoretical results based on tight-binding and Lifshitz models agreed well with experimental observations of graphene containing a low concentration of resonant impurities. The interaction between resonant states and Landau levels was detected by varying the applied magnetic field. The interaction mechanisms and enhancement of the negative compressibility in disordered graphene are discussed.

  8. Optimization studies of carbon additives to negative active material for the purpose of extending the life of VRLA batteries in high-rate partial-state-of-charge operation

    NASA Astrophysics Data System (ADS)

    Boden, D. P.; Loosemore, D. V.; Spence, M. A.; Wojcinski, T. D.

    The negative plates of lead-acid batteries subjected to partial-state-of-charge (PSOC) operation fail because of the development of an electrically inert film of lead sulfate on their surfaces. It has been found that carbon additives to the negative active material can significantly increase their cycle life in this type of operation. In this paper we show that various types of carbon, including graphite, carbon black eliminate the surface development of lead sulfate and that, in their presence, the lead sulfate becomes homogeneously distributed throughout the active material. Examination of active material by energy dispersive spectroscopy after extensive cycling shows that lead formed during charge of lead sulfate preferentially deposits on the carbon particles that have been embedded in the active material. Electrochemical studies have been carried out on a number of types of carbon additives having a wide range of properties. These included flake, expanded and synthetic graphite, isotropically graphitized carbon, carbon black and activated carbon. We have investigated their effect on the resistivity and surface areas of the negative active material and also on such electrochemical properties as active material utilization and cycle life. Most of the carbon additives increase the utilization of the active material and impressive increases in cycle life have been obtained with over 6000 capacity turnovers having been achieved. However, at this time, we have not been able to correlate either the type or the properties of the carbon with capacity or cycle life. Further work is needed in this area. The increases that have been achieved in cycle life provide evidence that the lead-acid battery is a viable low cost option for hybrid-electric vehicle use.

  9. Charge and aggregation pattern govern the interaction of plasticins with LPS monolayers mimicking the external leaflet of the outer membrane of Gram-negative bacteria.

    PubMed

    Michel, J P; Wang, Y X; Dé, E; Fontaine, P; Goldmann, M; Rosilio, V

    2015-11-01

    Bacterial resistance to antibiotics has become today a major public health issue. In the development of new anti-infectious therapies, antimicrobial peptides appear as promising candidates. However, their mechanisms of action against bacterial membranes are still poorly understood. We describe for the first time the interaction and penetration of plasticins into lipid monolayers and bilayers modeling the two leaflets of the asymmetrical outer membrane of Gram-negative bacteria. The lipid composition of these monolayers mimics that of each leaflet: mixtures of LPS Re 595 mutant and wild type S-form from Salmonella enterica for the external leaflet, and SOPE/SOPG/cardiolipin (80/15/5) for the inner one. The analysis of the interfacial behavior of native (PTCDA1) and modified (PTCDA1-KF) antimicrobial plasticins showed that PTCDA1-KF exhibited better surface properties than its unmodified counterpart. Both peptides could penetrate into the model monolayers at concentrations higher than 0.1 μM. The penetration was particularly enhanced for PTCDA1-KF into the mixed LPS monolayer, due to attractive electrostatic interactions. Grazing X-ray diffraction and atomic force microscopy studies revealed the changes in LPS monolayers organization upon peptide insertion. The interaction of plasticins with liposomes was also monitored by light scattering and circular dichroism techniques. Only the cationic plasticin achieved full disaggregation and structuration in α helices, whereas the native one remained aggregated and unstructured. The main steps of the penetration mechanism of the two plasticins into lipid models of the external leaflet of the outer membrane of Gram-negative bacteria have been established. PMID:26343162

  10. Sequence similarity between the erythrocyte binding domain of the Plasmodium vivax Duffy binding protein and the V3 loop of HIV-1 strain MN reveals a functional heparin binding motif involved in binding to the Duffy antigen receptor for chemokines

    PubMed Central

    2011-01-01

    Background The HIV surface glycoprotein gp120 (SU, gp120) and the Plasmodium vivax Duffy binding protein (PvDBP) bind to chemokine receptors during infection and have a site of amino acid sequence similarity in their binding domains that often includes a heparin binding motif (HBM). Infection by either pathogen has been found to be inhibited by polyanions. Results Specific polyanions that inhibit HIV infection and bind to the V3 loop of X4 strains also inhibited DBP-mediated infection of erythrocytes and DBP binding to the Duffy Antigen Receptor for Chemokines (DARC). A peptide including the HBM of PvDBP had similar affinity for heparin as RANTES and V3 loop peptides, and could be specifically inhibited from heparin binding by the same polyanions that inhibit DBP binding to DARC. However, some V3 peptides can competitively inhibit RANTES binding to heparin, but not the PvDBP HBM peptide. Three other members of the DBP family have an HBM sequence that is necessary for erythrocyte binding, however only the protein which binds to DARC, the P. knowlesi alpha protein, is inhibited by heparin from binding to erythrocytes. Heparitinase digestion does not affect the binding of DBP to erythrocytes. Conclusion The HBMs of DBPs that bind to DARC have similar heparin binding affinities as some V3 loop peptides and chemokines, are responsible for specific sulfated polysaccharide inhibition of parasite binding and invasion of red blood cells, and are more likely to bind to negative charges on the receptor than cell surface glycosaminoglycans. PMID:22122911

  11. Negative cooperativity across β1-adrenoceptor homodimers provides insights into the nature of the secondary low-affinity CGP 12177 β1-adrenoceptor binding conformation.

    PubMed

    Gherbi, Karolina; May, Lauren T; Baker, Jillian G; Briddon, Stephen J; Hill, Stephen J

    2015-07-01

    At the β1-adrenoceptor, CGP 12177 potently antagonizes agonist responses at the primary high-affinity catecholamine conformation while also exerting agonist effects of its own through a secondary low-affinity conformation. A recent mutagenesis study identified transmembrane region (TM)4 of the β1-adrenoceptor as key for this low-affinity conformation. Others suggested that TM4 has a role in β1-adrenoceptor oligomerization. Here, assessment of the dissociation rate of a fluorescent analog of CGP 12177 [bordifluoropyrromethane-tetramethylrhodamine-(±)CGP 12177 (BODIPY-TMR-CGP)] at the human β1-adrenoceptor expressed in Chinese hamster ovary cells revealed negative cooperative interactions between 2 distinct β1-adrenoceptor conformations. The dissociation rate of 3 nM BODIPY-TMR-CGP was 0.09 ± 0.01 min(-1) in the absence of competitor ligands, and this was enhanced 2.2- and 2.1-fold in the presence of 1 µM CGP 12177 and 1 µM propranolol, respectively. These effects on the BODIPY-TMR-CGP dissociation rate were markedly enhanced in β1-adrenoceptor homodimers constrained by bimolecular fluorescence complementation (9.8- and 9.9-fold for 1 µM CGP 12177 and 1 µM propranolol, respectively) and abolished in β1-adrenoceptors containing TM4 mutations vital for the second conformation pharmacology. This study suggests that negative cooperativity across a β1-adrenoceptor homodimer may be responsible for generating the low-affinity pharmacology of the secondary β1-adrenoceptor conformation. PMID:25837585

  12. Expression of poly(C)-binding protein 1 (PCBP1) in NSCLC as a negative regulator of EMT and its clinical value

    PubMed Central

    Liu, Yifei; Gai, Ling; Liu, Jian; Cui, Yuan; Zhang, Yan; Feng, Jia

    2015-01-01

    Poly (C)-binding Protein 1 (PCBP1) is a 35 kDa protein involved in a number of biological processes. Recently, the research found that PCBP1 might be involved in epithelial-mesenchymal transition (EMT). However, the role of PCBP1 in non-small-cell lung cancer (NSCLC) metastasis needs further elucidation. The purpose of this study was to determine whether PCBP1 could serve as a biomarker for stratification and prediction of prognosis in NSCLC as a regulator of EMT formation. In this study, PCBP1 expression was evaluated by Western blot in 8 fresh lung cancer tissues and immunohistochemistry (IHC) on 145 paraffin-embedded slices. PCBP1 was highly expressed in non-metastatic NSCLC specimens and significantly correlated with lymph node status (P < 0.001), clinical stage (P = 0.001), vimentin expression (P = 0.033) and E-cadherin expression (P = 0.042). Our study showed that the low expression of PCBP1 was correlated with decreased expression of E-cadherin and elevated expression of vimentin, which were the markers of EMT. Besides, high expression of PCBP1 was correlated with better prognosis. These findings suggested that PCBP1 might play an important role in preventing the process of EMT in NSCLC, thus be a promising therapeutic target to inhibit NSCLC metastasis. PMID:26261610

  13. Radiation quality of beams of negative pions

    SciTech Connect

    Dicello, J.F.; Brenner, D.J.

    1981-01-01

    As a negative pion stops in tissue, it attaches itself to an adjacent atom to form a mesonic atom. Subsequently, the wave function of the pion interacts with that of the nucleus and the pion is absorbed. Because the energy associated with the rest mass of the pion is greater than the separation energy of the nuclear particles, the nucleus disintegrates (pion star). In tissue, approximately 40 MeV goes into overcoming the binding energies; 20 MeV goes into kinetic energy of charged particles; 80 MeV goes into kinetic energy of neutrons. In cases where biological studies are performed with beams of negative pions, as much as 20% of the total absorbed dose in the treatment volume and about 50% of the high-LET dose (> 100 keV/..mu..m) can result from neutrons. The degree of biological response and the variation of that response throughout the treatment volume can be altered by the neutron dose.

  14. Calculating the binding free energies of charged species based on explicit-solvent simulations employing lattice-sum methods: An accurate correction scheme for electrostatic finite-size effects

    PubMed Central

    Rocklin, Gabriel J.; Mobley, David L.; Dill, Ken A.; Hünenberger, Philippe H.

    2013-01-01

    The calculation of a protein-ligand binding free energy based on molecular dynamics (MD) simulations generally relies on a thermodynamic cycle in which the ligand is alchemically inserted into the system, both in the solvated protein and free in solution. The corresponding ligand-insertion free energies are typically calculated in nanoscale computational boxes simulated under periodic boundary conditions and considering electrostatic interactions defined by a periodic lattice-sum. This is distinct from the ideal bulk situation of a system of macroscopic size simulated under non-periodic boundary conditions with Coulombic electrostatic interactions. This discrepancy results in finite-size effects, which affect primarily the charging component of the insertion free energy, are dependent on the box size, and can be large when the ligand bears a net charge, especially if the protein is charged as well. This article investigates finite-size effects on calculated charging free energies using as a test case the binding of the ligand 2-amino-5-methylthiazole (net charge +1 e) to a mutant form of yeast cytochrome c peroxidase in water. Considering different charge isoforms of the protein (net charges −5, 0, +3, or +9 e), either in the absence or the presence of neutralizing counter-ions, and sizes of the cubic computational box (edges ranging from 7.42 to 11.02 nm), the potentially large magnitude of finite-size effects on the raw charging free energies (up to 17.1 kJ mol−1) is demonstrated. Two correction schemes are then proposed to eliminate these effects, a numerical and an analytical one. Both schemes are based on a continuum-electrostatics analysis and require performing Poisson-Boltzmann (PB) calculations on the protein-ligand system. While the numerical scheme requires PB calculations under both non-periodic and periodic boundary conditions, the latter at the box size considered in the MD simulations, the analytical scheme only requires three non-periodic PB

  15. Calculating the binding free energies of charged species based on explicit-solvent simulations employing lattice-sum methods: An accurate correction scheme for electrostatic finite-size effects

    SciTech Connect

    Rocklin, Gabriel J.; Mobley, David L.; Dill, Ken A.; Hünenberger, Philippe H.

    2013-11-14

    The calculation of a protein-ligand binding free energy based on molecular dynamics (MD) simulations generally relies on a thermodynamic cycle in which the ligand is alchemically inserted into the system, both in the solvated protein and free in solution. The corresponding ligand-insertion free energies are typically calculated in nanoscale computational boxes simulated under periodic boundary conditions and considering electrostatic interactions defined by a periodic lattice-sum. This is distinct from the ideal bulk situation of a system of macroscopic size simulated under non-periodic boundary conditions with Coulombic electrostatic interactions. This discrepancy results in finite-size effects, which affect primarily the charging component of the insertion free energy, are dependent on the box size, and can be large when the ligand bears a net charge, especially if the protein is charged as well. This article investigates finite-size effects on calculated charging free energies using as a test case the binding of the ligand 2-amino-5-methylthiazole (net charge +1 e) to a mutant form of yeast cytochrome c peroxidase in water. Considering different charge isoforms of the protein (net charges −5, 0, +3, or +9 e), either in the absence or the presence of neutralizing counter-ions, and sizes of the cubic computational box (edges ranging from 7.42 to 11.02 nm), the potentially large magnitude of finite-size effects on the raw charging free energies (up to 17.1 kJ mol{sup −1}) is demonstrated. Two correction schemes are then proposed to eliminate these effects, a numerical and an analytical one. Both schemes are based on a continuum-electrostatics analysis and require performing Poisson-Boltzmann (PB) calculations on the protein-ligand system. While the numerical scheme requires PB calculations under both non-periodic and periodic boundary conditions, the latter at the box size considered in the MD simulations, the analytical scheme only requires three non

  16. Inducible nuclear expression of newly synthesized I kappa B alpha negatively regulates DNA-binding and transcriptional activities of NF-kappa B.

    PubMed Central

    Arenzana-Seisdedos, F; Thompson, J; Rodriguez, M S; Bachelerie, F; Thomas, D; Hay, R T

    1995-01-01

    The transcription factor NF-kappa B is exploited by many viruses, including the human immunodeficiency virus, for expression of viral genes, but its primary role appears to be in the rapid induction of cellular genes during immune and inflammatory responses. The inhibitor protein I kappa B alpha maintains NF-kappa B in an inactive form in the cytoplasms of unstimulated cells, but upon cell activation, I kappa B alpha is rapidly degraded, leading to nuclear translocation of free NF-kappa B. However, NF-kappa B-dependent transcription of the I kappa B alpha gene leads to rapid resynthesis of the I kappa B alpha protein and inhibition of NF-kappa B-dependent transcription. Here we demonstrate a new regulatory function of I kappa B alpha exerted on NF-kappa B in the nuclear compartment. Although normally found in the cytoplasm, I kappa B alpha, newly synthesized in response to tumor necrosis factor or interleukin I, is transported to the nucleus. In the nucleus I kappa B alpha associates with the p50 and p65 subunits of NF-kappa B, inhibiting DNA binding of the transcription factor. Furthermore, nuclear expression of I kappa B alpha correlates with transcription termination of transfected NF-kappa B-dependent luciferase genes. Following the appearance of I kappa B alpha in the nuclei of activated cells, a dramatic reduction in the amount of nuclear p50 occurs, suggesting that NF-kappa B-I kappa B alpha complexes are cleared from the nucleus. PMID:7739549

  17. Charged fullerenes as high-capacity hydrogen storage media.

    PubMed

    Yoon, Mina; Yang, Shenyuan; Wang, Enge; Zhang, Zhenyu

    2007-09-01

    Using first-principles calculations within density functional theory, we explore systematically the capacity of charged carbon fullerenes Cn (20 binding strength of molecular hydrogen on either positively or negatively charged fullerenes can be dramatically enhanced to 0.18-0.32 eV, a desirable range for potential room-temperature, near ambient applications. The enhanced binding is delocalized in nature, surrounding the whole surface of a charged fullerene, and is attributed to the polarization of the hydrogen molecules by the high electric field generated near the surface of the charged fullerene. At full hydrogen coverage, these charged fullerenes can gain storage capacities of up to approximately 8.0 wt %. We also find that, contrary to intuitive expectation, fullerenes containing encapsulated metal atoms only exhibit negligible enhancement in the hydrogen binding strength, because the charge donated by the metal atoms is primarily confined inside the fullerene cages. These predictions may prove to be instrumental in searching for a new class of high-capacity hydrogen storage media. PMID:17718530

  18. Charged Fullerenes as High Capacity Hydrogen Storage Media

    SciTech Connect

    Yoon, Mina; Yang, Shenyuan; Wang, Enge; Zhang, Zhenyu

    2007-01-01

    Using first-principles calculations within density functional theory, we explore systematically the capacity of charged carbon fullerenes Cn (20≤n≤84) as hydrogen storage media. We find that the binding strength of molecular hydrogen on either positively or negatively charged fullerenes can be dramatically enhanced to 0.18-0.32 eV, a desirable range for potential room-temperature, near ambient applications. The enhanced binding is delocalized in nature, surrounding the whole surface of a charged fullerene, and is attributed to the polarization of the hydrogen molecules by the high electric field generated near the surface of the charged fullerene. At full hydrogen coverage, these charged fullerenes can gain storage capacities of up to ~8.0wt%. We also find that, contrary to intuitive expectation, fullerenes containing intercalated metal atoms only exhibit negligible enhancement in the hydrogen binding strength, because the charge donated by the metal atoms is primarily confined inside the fullerene cages. These predictions may prove to be instrumental in searching for a new class of high capacity hydrogen storage media.

  19. Observation of negative and positive trions in the electrochemically carrier-doped single-walled carbon nanotubes.

    PubMed

    Park, Jin Sung; Hirana, Yasuhiko; Mouri, Shinichiro; Miyauchi, Yuhei; Nakashima, Naotoshi; Matsuda, Kazunari

    2012-09-01

    Understanding of electronic and optical features of single-walled carbon nanotubes (SWNTs) has been a central issue in science and nanotechnology of carbon nanotubes. We describe the detection of both the positive trion (positively charged exciton) and negative trion (negatively charged exciton) as a three-particle bound state in the SWNTs at room temperature by an in situ photoluminescence spectroelectrochemistry method for an isolated SWNT film cast on an ITO electrode. The electrochemical hole and electron dopings enable us to detect such trions on the SWNTs. The large energy difference between the singlet bright exciton and the negative and positive trions showing a tube diameter dependence is determined by both the exchange splitting energy and the trion binding energy. In contrast to conventional compound semiconductors, on the SWNTs, the negative trion has almost the same binding energy to the positive trion, which is attributed to nearly identical effective masses of the holes and electrons. PMID:22870955

  20. Single-stranded DNA-binding proteins PURalpha and PURbeta bind to a purine-rich negative regulatory element of the alpha-myosin heavy chain gene and control transcriptional and translational regulation of the gene expression. Implications in the repression of alpha-myosin heavy chain during heart failure.

    PubMed

    Gupta, Madhu; Sueblinvong, Viranuj; Raman, Jai; Jeevanandam, Valluvan; Gupta, Mahesh P

    2003-11-01

    The alpha-myosin heavy chain is a principal molecule of the thick filament of the sarcomere, expressed primarily in cardiac myocytes. The mechanism for its cardiac-restricted expression is not yet fully understood. We previously identified a purine-rich negative regulatory (PNR) element in the first intron of the gene, which is essential for its cardiac-specific expression (Gupta, M., Zak, R., Libermann, T. A., and Gupta, M. P. (1998) Mol. Cell. Biol. 18, 7243-7258). In this study we cloned and characterized muscle and non-muscle factors that bind to this element. We show that two single-stranded DNA-binding proteins of the PUR family, PURalpha and PURbeta, which are derived from cardiac myocytes, bind to the plus strand of the PNR element. In functional assays, PURalpha and PURbeta repressed alpha-myosin heavy chain (alpha-MHC) gene expression in the presence of upstream regulatory sequences of the gene. However, from HeLa cells an Ets family of protein, Ets-related protein (ERP), binds to double-stranded PNR element. The ERP.PNR complex inhibited the activity of the basal transcription complex from homologous as well as heterologous promoters in a PNR position-independent manner, suggesting that ERP acts as a silencer of alpha-MHC gene expression in non-muscle cells. We also show that PUR proteins are capable of binding to alpha-MHC mRNA and attenuate its translational efficiency. Furthermore, we show robust expression of PUR proteins in failing hearts where alpha-MHC mRNA levels are suppressed. Together, these results reveal that (i) PUR proteins participate in transcriptional as well as translational regulation of alpha-MHC expression in cardiac myocytes and (ii) ERP may be involved in cardiac-restricted expression of the alpha-MHC gene by preventing its expression in non-muscle cells. PMID:12933792

  1. How Do Structure and Charge Affect Metal-Complex Binding to DNA? An Upper-Division Integrated Laboratory Project Using Cyclic Voltammetry

    ERIC Educational Resources Information Center

    Kulczynska, Agnieszka; Johnson, Reed; Frost, Tony; Margerum, Lawrence D.

    2011-01-01

    An advanced undergraduate laboratory project is described that integrates inorganic, analytical, physical, and biochemical techniques to reveal differences in binding between cationic metal complexes and anionic DNA (herring testes). Students were guided to formulate testable hypotheses based on the title question and a list of different metal…

  2. Synthesis, spectroscopic characterization and structural investigation of a new charge transfer complex of 2,6-diaminopyridine with 4-nitrophenylacetic acid: Antimicrobial, DNA binding/cleavage and antioxidant studies

    NASA Astrophysics Data System (ADS)

    Murugesan, Venkatesan; Saravanabhavan, Munusamy; Sekar, Marimuthu

    2015-08-01

    A new hydrogen-bonded charge-transfer complex (CT) formed by the reaction between donor, 2,6-diaminopyridine and acceptor, 4-nitrophenylacetic acid in methanol at room temperature. The crystal was characterized by elemental analysis, IR, NMR spectroscopic studies and thermal studies. The elemental analysis of CT complex, obtained data revealed that the formation of 1:1 ratio CT complex was proposed. Infrared and NMR studies confirm the chemical constituents and molecular structure of the synthesized complex crystal. The high thermal stability is due to the molecular frame work through H-bonding interactions. Structural investigation indicates that cation and anion are linked through strong N+-H⋯O- type of hydrogen bond. The hydrogen bonded charge transfer crystal was screened for its pharmacology, such as antimicrobial, DNA binding/cleavage and antioxidant studies. The CT complex was screened for its antibacterial and antifungal activity against various bacterial and fungal species, which shows good antimicrobial activity. The DNA binding results indicated that the compound could interact with DNA through intercalation. It should have weak to moderate capacity of scavenging with DPPH.

  3. The structurally novel Ca sup 2+ channel blocker Ro 40-5967, which binds to the ( sup 3 H) desmethoxyverapamil receptor, is devoid of the negative inotropic effects of verapamil in normal and failing rat hearts

    SciTech Connect

    Clozel, J.P.; Veniant, M.; Osterrieder, W. )

    1990-06-01

    Ro 40-5967 is a structurally novel Ca{sup 2+} channel blocker that binds to the verapamil-type receptor of cardiac membranes but that has been shown in isolated guinea-pig hearts to be about ten times less potent a negative inotropic agent than verapamil. The goals of the present study were to confirm these findings in vitro in isolated perfused rat hearts as well as in vivo in conscious rats and to compare Ro 40-5967 to verapamil. The effects of Ro 40-5967 and verapamil were tested not only in normal rats, but also in rats with heart failure induced by chronic myocardial infarction. In isolated Langendorff hearts (without heart failure), no decrease of contractility was observed with Ro 40-5967 up to complete AV block. In contrast, verapamil decreased contractility with an IC50 of 100 nM. In isolated, electrically stimulated rat papillary muscles, the IC50 values for the decrease of contractile force were 15,000 and 440 nM for Ro 40-5967 and verapamil, respectively. In vivo, Ro 40-5967 did not decrease left ventricular contractility (as assessed by changes of dP/dt max +) in rats without and with heart failure. In contrast, verapamil was markedly negative inotropic in both conditions.

  4. sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis-dependent release of eDNA.

    PubMed

    Christner, Martin; Heinze, Constanze; Busch, Michael; Franke, Gefion; Hentschke, Moritz; Bayard Dühring, Sara; Büttner, Henning; Kotasinska, Marta; Wischnewski, Victoria; Kroll, Gesche; Buck, Friedrich; Molin, Soeren; Otto, Michael; Rohde, Holger

    2012-10-01

    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant-associated infections. Nonetheless, large proportions of invasive Staphylococcus epidermidis isolates fail to form a biofilm in vitro. We here tested the hypothesis that this apparent paradox is related to the existence of superimposed regulatory systems suppressing a multicellular biofilm life style in vitro. Transposon mutagenesis of clinical significant but biofilm-negative S. epidermidis 1585 was used to isolate a biofilm positive mutant carrying a Tn917 insertion in sarA, chief regulator of staphylococcal virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via overexpression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed to biofilm formation in mutant 1585ΔsarA. Increased eDNA amounts indirectly resulted from upregulation of metalloprotease SepA, leading to boosted processing of autolysin AtlE, in turn inducing augmented autolysis and release of eDNA. Hence, this study identifies sarA as a negative regulator of Embp- and eDNA-dependent biofilm formation. Given the importance of SarA as a positive regulator of polysaccharide mediated cell aggregation, the regulator enables S. epidermidis to switch between mechanisms of biofilm formation, ensuring S. epidermidis adaptation to hostile environments. PMID:22957858

  5. Negative mass

    NASA Astrophysics Data System (ADS)

    Hammond, Richard T.

    2015-03-01

    Some physical aspects of negative mass are examined. Several unusual properties, such as the ability of negative mass to penetrate any armor, are analysed. Other surprising effects include the bizarre system of negative mass chasing positive mass, naked singularities and the violation of cosmic censorship, wormholes, and quantum mechanical results as well. In addition, a brief look into the implications for strings is given.

  6. Spatial proximity statistics suggest a regulatory role of protein phosphorylation on compound binding.

    PubMed

    Korkuć, Paula; Walther, Dirk

    2016-05-01

    Phosphorylation is an important post-translational modification that regulates protein function by the attachment of negatively charged phosphate groups to phosphorylatable amino acid residues. As a mode of action, an influence of phosphorylation on the binding of compounds to proteins has been discussed and described for a number of proteins in the literature. However, a systematic statistical survey probing for enriched phosphorylation sites close to compound binding sites in support of this notion and with properly chosen random reference distributions has not been presented yet. Using high-resolution protein structures from the Protein Data Bank including their co-crystallized non-covalently bound compounds and experimentally determined phosphorylation sites, we analyzed the pairwise distance distributions of phosphorylation and compound binding sites on protein surfaces. We found that phosphorylation sites are indeed located at significantly closer distances to compounds than expected by chance holding true specifically also for the subset of compound binding sites serving as catalytic sites of metabolic reactions. This tendency was particularly evident when treating phosphorylation sites as collective sets supporting the relevance of phosphorylation hotspots. Interestingly, phosphorylation sites were found to be closer to negatively charged than to positively charged compounds suggesting a stronger modulation of the binding of negatively charged compounds in dependence on phosphorylation status than on positively charged compounds. The enrichment of phosphorylation sites near compound binding sites confirms a regulatory role of phosphorylation in compound binding and provides a solid statistical basis for the literature-reported selected events. Proteins 2016; 84:565-579. © 2016 Wiley Periodicals, Inc. PMID:26817627

  7. Nanoparticle coagulation in fractionally charged and charge fluctuating dusty plasmas

    SciTech Connect

    Nunomura, Shota; Kondo, Michio; Shiratani, Masaharu; Koga, Kazunori; Watanabe, Yukio

    2008-08-15

    The kinetics of nanoparticle coagulation has been studied in fractionally charged and charge fluctuating dusty plasmas. The coagulation occurs when the mutual collision frequency among nanoparticles exceeds their charging and decharging/neutralization frequency. Interestingly, the coagulation is suppressed while a fraction (several percent) of nanoparticles are negatively charged in a plasma, in which stochastic charging plays an important role. A model is developed to predict a phase diagram of the coagulation and its suppression.

  8. Direct measurement of the exciton binding energy and effective masses for charge carriers in organic-inorganic tri-halide perovskites

    NASA Astrophysics Data System (ADS)

    Miyata, Atsuhiko; Mitioglu, Anatolie; Plochocka, Paulina; Portugall, Oliver; Wang, Jacob Tse-Wei; Stranks, Samuel D.; Snaith, Henry J.; Nicholas, Robin J.

    2015-07-01

    Solar cells based on the organic-inorganic tri-halide perovskite family of materials have shown significant progress recently, offering the prospect of low-cost solar energy from devices that are very simple to process. Fundamental to understanding the operation of these devices is the exciton binding energy, which has proved both difficult to measure directly and controversial. We demonstrate that by using very high magnetic fields it is possible to make an accurate and direct spectroscopic measurement of the exciton binding energy, which we find to be only 16 meV at low temperatures, over three times smaller than has been previously assumed. In the room-temperature phase we show that the binding energy falls to even smaller values of only a few millielectronvolts, which explains their excellent device performance as being due to spontaneous free-carrier generation following light absorption. Additionally, we determine the excitonic reduced effective mass to be 0.104me (where me is the electron mass), significantly smaller than previously estimated experimentally but in good agreement with recent calculations. Our work provides crucial information about the photophysics of these materials, which will in turn allow improved optoelectronic device operation and better understanding of their electronic properties.

  9. Binding interaction of differently charged fluorescent probes with egg yolk phosphatidylcholine and the effect of β-cyclodextrin on the lipid-probe complexes: A fluorometric investigation

    NASA Astrophysics Data System (ADS)

    Kundu, Pronab; Ghosh, Saptarshi; Jana, Barnali; Chattopadhyay, Nitin

    2015-05-01

    Interaction of cationic phenosafranin (PSF), anionic 8-anilino-1-naphthalene sulfonate (ANS) and non-ionic nile red (NR) have been studied with the zwitterionic phospholipid, egg yolk L-α-phosphatidylcholine (EYPC). The study reveals discernible binding interactions of the three fluorescent probes with the EYPC lipid vesicle. Once the binding of the probes with the lipid is established, the effect of cyclic oligosaccharide, β-cyclodextrin (β-CD), on these lipid bound probes has been investigated. Different fluorometric techniques suggest that addition of β-CD to the probe-lipid complexes leads to the release of the probes from the lipid medium through the formation of probe-β-CD inclusion complexes. A competitive binding of the probes between β-cyclodextrin and the lipid is ascribed to be responsible for the effect. This provides an easy avenue for the removal of the probe molecules from the lipid environment. Extension of this work with drug molecules in cell membranes is expected to give rise to a strategy for the removal of adsorbed drugs from the cell membranes by the use of non-toxic β-cyclodextrin.

  10. Effect of charges on the interaction of water with hematite

    NASA Astrophysics Data System (ADS)

    Negreiros Ribeiro, Fabio; Pedroza, Luana; Dalpian, Gustavo

    Hematite is one of the many types of iron oxide that is easily found in nature. It is most commonly used in catalysis and it is rarely present in its pristine form. The influence of charged defects in its properties is very important for the correct geometrical/electronic characterization in more realistic operative conditions, but very few studies focus explicitly on these defects in this system. In this work we perform first principles DFT+U calculations to determine the properties of a hematite slab when both dopant and electrons/holes are added. We focus on the differences between the geometrical/electronic properties between the neutral/charged surfaces and also study their interaction with water (molecule and liquid) by performing molecular dynamics simulations at room temperature. Our results indicate that electric charges strongly influence the properties of these surfaces, changing the binding energies and the molecular arrangement of the water molecules adsorbed on hematite. Negative charges induce a larger binding and favor the partial water dissociation, whereas positive charges weaken the binding energy. We will provide comparative results for different configurations of this system. FAPESP.

  11. The role of surface charge on the uptake and biocompatibility of hydroxyapatite nanoparticles with osteoblast cells

    PubMed Central

    Chen, Liang; Mccrate, Joseph M.; Lee, James C-M.; Li, Hao

    2011-01-01

    The objective of this study is to evaluate the effect of hydroxyapatite (HAP) nanoparticles with different surface charges on the cellular uptake behavior and in vitro cell viability and proliferation of MC3T3-E1 cell lines (osteoblast). The nanoparticles surface charge was varied by the surface modification with two carboxylic acids: 12-aminododecanoic acid (positive) and dodecanedioic acid (negative). The untreated HAP nanoparticles and dodecanoic acid modified HAP nanoparticles (neutral) were used as the control. X-ray diffraction (XRD) revealed that surface modifications by the three carboxylic acids did not change the crystal structure of HAP nanoparticles; Fourier transform infrared spectroscopy (FTIR) confirmed the adsorption and binding of the carboxylic acids on HAP nanoparticle surface; and zeta potential measurement confirmed that the chemicals successfully modified the surface charge of HAP nanoparticles in water based solution. Transmission electron microscopy (TEM) images showed that positively charged, negatively charged and untreated HAP nanoparticles, with similar size and shape, all penetrated into the cells and cells had more uptake of HAP nanoparticles with positive charge compared to those with negative charge, which might be attributed to the attractive or repulsive interaction between the negatively charged cell membrane and positively/negatively charged HAP nanoparticles. The neutral HAP nanoparticles could not penetrate cell membrane due to the larger size. MTT assay and LDH assay results indicated that as compared with the polystyrene control, greater cell viability and cell proliferation were measured on MC3T3-E1 cells treated with the three kinds of the HAP nanoparticles (neutral, positive, and untreated), among which positively charged HAP nanoparticles shows strongest improvement for cell viability and cell proliferation. In summary, the surface charge of HAP nanoparticles can be modified to influence the cellular uptake of HAP

  12. Identification and characterization of anion binding sites in RNA.

    PubMed

    Kieft, Jeffrey S; Chase, Elaine; Costantino, David A; Golden, Barbara L

    2010-06-01

    Although RNA molecules are highly negatively charged, anions have been observed bound to RNA in crystal structures. It has been proposed that anion binding sites found within isolated RNAs represent regions of the molecule that could be involved in intermolecular interactions, indicating potential contact points for negatively charged amino acids from proteins or phosphate groups from an RNA. Several types of anion binding sites have been cataloged based on available structures. However, currently there is no method for unambiguously assigning anions to crystallographic electron density, and this has precluded more detailed analysis of RNA-anion interaction motifs and their significance. We therefore soaked selenate into two different types of RNA crystals and used the anomalous signal from these anions to identify binding sites in these RNA molecules unambiguously. Examination of these sites and comparison with other suspected anion binding sites reveals features of anion binding motifs, and shows that selenate may be a useful tool for studying RNA-anion interactions. PMID:20410239

  13. Negative-ion source applications.

    PubMed

    Ishikawa, J

    2008-02-01

    In this paper heavy negative-ion sources which we developed and their applications for materials science are reviewed. Heavy negative ions can be effectively produced by the ejection of a sputtered atom through the optimally cesiated surface of target with a low work function. Then, enough continuous negative-ion currents for materials-science applications can be obtained. We developed several kinds of sputter-type heavy negative-ion sources such as neutral- and ionized-alkaline metal bombardment-type heavy negative-ion source and rf-plasma sputter type. In the case where a negative ion is irradiated on a material surface, surface charging seldom takes place because incoming negative charge of the negative ion is well balanced with outgoing negative charge of the released secondary electron. In the negative-ion implantation into an insulator or insulated conductive material, high precision implantation processing with charge-up free properties can be achieved. Negative-ion implantation technique, therefore, can be applied to the following novel material processing systems: the surface modification of micrometer-sized powders, the nanoparticle formation in an insulator for the quantum devices, and the nerve cell growth manipulation by precise control of the biocompatibility of polymer surface. When a negative ion with low kinetic energy approaches the solid surface, the kinetic energy causes the interatomic bonding (kinetic bonding), and formation of a metastable material is promoted. Carbon films with high constituent of sp(3) bonding, therefore, can be formed by carbon negative-ion beam deposition. PMID:18315249

  14. A comparative study on the effect of Curcumin and Chlorin-p6 on the diffusion of two organic cations across a negatively charged lipid bilayer probed by second harmonic spectroscopy

    NASA Astrophysics Data System (ADS)

    Saini, R. K.; Varshney, G. K.; Dube, A.; Gupta, P. K.; Das, K.

    2014-09-01

    The influence of Curcumin and Chlorin-p6 (Cp6) on the real time diffusion kinetics of two organic cations, LDS (LDS-698) and Malachite Green (MG) across a negatively charged phospholipid bilayer is investigated by Second Harmonic (SH) spectroscopy. The diffusion time constant of LDS at neutral pH in liposomes containing either Curcumin or Cp6 is significantly reduced, the effect being more pronounced with Curcumin. At acidic pH, the quantum of reduction in the diffusion time constant of MG by both the drugs was observed to be similar. The relative changes in the average diffusion time constants of the cations with increasing drug concentration at pH 5.0 and 7.4 shows a substantial pH effect for Curcumin induced membrane permeability, while a modest pH effect was observed for Cp6 induced membrane permeability. Based on available evidence this can be attributed to the increased interaction between the drug and the polar head groups of the lipid at pH 7.4 where the drug resides closer to the lipid-water interface.

  15. Phosphatidylserine-binding protein lactadherin inhibits protein translocation across the ER membrane.

    PubMed

    Yamamoto, Hitoshi; Kida, Yuichiro; Sakaguchi, Masao

    2013-05-10

    Secretory and membrane proteins are translocated across and inserted into the endoplasmic reticulum membrane via translocon channels. To investigate the effect of the negatively-charged phospholipid phosphatidylserine on the translocation of nascent polypeptide chains through the translocon, we used the phosphatidylserine-binding protein lactadherin C2-domain. Lactadherin inhibited targeting of nascent chain to the translocon by signal sequence and the initiation of translocation. Moreover, lactadherin inhibited the movement of the translocating polypeptide chain regardless of the presence or absence of positively-charged residues. Phosphatidylserine might be critically involved in translocon function, but it is not a major determinant for translocation arrest of positively-charged residues. PMID:23583395

  16. Charge inversion in DNA-amphiphile complexes: Possible application to gene therapy

    NASA Astrophysics Data System (ADS)

    Kuhn, Paulo S.; Levin, Yan; Barbosa, Marcia C.

    1999-12-01

    We study complex formation between the DNA and cationic amphiphilic molecules. As the amphiphile is added to the solution containing DNA, a cooperative binding of surfactants to the DNA molecules is found. This binding transition occurs at a specific density of amphiphile, which is strongly dependent on the concentration of the salt and on the hydrophobicity of the surfactant molecules. We find that for amphiphiles which are sufficiently hydrophobic, a charge neutralization, or even charge inversion of the complex is possible. This is of particular importance in applications to gene therapy, for which the functional delivery of specific base sequence into living cells remains an outstanding problem. The charge inversion could, in principle, allow the DNA-surfactant complexes to approach the negatively charged cell membranes permitting the transfection to take place.

  17. Charge inversion in DNA--amphiphile complexes: Applications for gene therapy

    NASA Astrophysics Data System (ADS)

    Barbosa, Marcia C.; Kuhn, Paulo; Levin, Yan

    2000-03-01

    We study a complex formation between the DNA and cationic amphiphilic molecules. As the amphiphile is added to the solution containing DNA, a cooperative binding of surfactants to the DNA molecules is found. This binding transition occurs at specific density of amphiphile, which is strongly dependent on the concentration of the salt and on the hydrophobicity of the surfactant molecules. We find that for amphiphiles which are sufficiently hydrophobic, a charge neutralization, or even charge inversion of the complex is possible. This is of particular importance in applications to gene therapy, for which the functional delivery of specific base sequence into living cells remains an outstanding problem. The charge inversion could, in principle, allow the DNA-surfactant complexes to approach negatively charged cell membranes permitting the transfection to take place.

  18. Soluble expression of proteins correlates with a lack of positively-charged surface

    NASA Astrophysics Data System (ADS)

    Chan, Pedro; Curtis, Robin A.; Warwicker, Jim

    2013-11-01

    Prediction of protein solubility is gaining importance with the growing use of protein molecules as therapeutics, and ongoing requirements for high level expression. We have investigated protein surface features that correlate with insolubility. Non-polar surface patches associate to some degree with insolubility, but this is far exceeded by the association with positively-charged patches. Negatively-charged patches do not separate insoluble/soluble subsets. The separation of soluble and insoluble subsets by positive charge clustering (area under the curve for a ROC plot is 0.85) has a striking parallel with the separation that delineates nucleic acid-binding proteins, although most of the insoluble dataset are not known to bind nucleic acid. Additionally, these basic patches are enriched for arginine, relative to lysine. The results are discussed in the context of expression systems and downstream processing, contributing to a view of protein solubility in which the molecular interactions of charged groups are far from equivalent.

  19. Evidence of a local negative role for cocaine and amphetamine regulated transcript (CART), inhibins and low molecular weight insulin like growth factor binding proteins in regulation of granulosa cell estradiol production during follicular waves in cattle

    PubMed Central

    Kobayashi, Yasuhiro; Jimenez-Krassel, Fermin; Ireland, James J; Smith, George W

    2006-01-01

    The ability of ovarian follicles to produce large amounts of estradiol is a hallmark of follicle health status. Estradiol producing capacity is lost in ovarian follicles before morphological signs of atresia. A prominent wave like pattern of growth of antral follicles is characteristic of monotocous species such as cattle, horses and humans. While our knowledge of the role of pituitary gonadotropins in support of antral follicle growth and development is well established, the intrinsic factors that suppress estradiol production and may help promote atresia during follicular waves are not well understood. Numerous growth factors and cytokines have been reported to suppress granulosa cell estradiol production in vitro, but the association of expression of many such factors in vivo with follicle health status and their physiological significance are not clear. The purpose of this review is to discuss the in vivo and in vitro evidence supporting a local physiological role for cocaine and amphetamine regulated transcript, inhibins and low molecular weight insulin like growth factor binding proteins in negative regulation of granulosa cell estradiol production, with emphasis on evidence from the bovine model system. PMID:16611367

  20. Mucin Binding Reduces Colistin Antimicrobial Activity

    PubMed Central

    Huang, Johnny X.; Blaskovich, Mark A. T.; Pelingon, Ruby; Ramu, Soumya; Kavanagh, Angela; Elliott, Alysha G.; Butler, Mark S.

    2015-01-01

    Colistin has found increasing use in treating drug-resistant bacterial lung infections, but potential interactions with pulmonary biomolecules have not been investigated. We postulated that colistin, like aminoglycoside antibiotics, may bind to secretory mucin in sputum or epithelial mucin that lines airways, reducing free drug levels. To test this hypothesis, we measured binding of colistin and other antibiotics to porcine mucin, a family of densely glycosylated proteins used as a surrogate for human sputum and airway mucin. Antibiotics were incubated in dialysis tubing with or without mucin, and concentrations of unbound antibiotics able to penetrate the dialysis tubing were measured over time using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The percentage of antibiotic measured in the dialysate after 4 h in the presence of mucin, relative to the amount without mucin, was 15% for colistin, 16% for polymyxin B, 19% for tobramycin, 52% for ciprofloxacin, and 78% for daptomycin. Antibiotics with the strongest mucin binding had an overall polybasic positive charge, whereas those with comparatively little binding were less basic. When comparing MICs measured with or without added mucin, colistin and polymyxin B showed >100-fold increases in MICs for multiple Gram-negative bacteria. Preclinical evaluation of mucin binding should become a standard procedure when considering the potential pulmonary use of new or existing antibiotics, particularly those with a polybasic overall charge. In the airways, mucin binding may reduce the antibacterial efficacy of inhaled or intravenously administered colistin, and the presence of sub-MIC effective antibiotic concentrations could result in the development of antibiotic resistance. PMID:26169405

  1. Protein charge ladders reveal that the net charge of ALS-linked superoxide dismutase can be different in sign and magnitude from predicted values

    PubMed Central

    Shi, Yunhua; Abdolvahabi, Alireza; Shaw, Bryan F

    2014-01-01

    This article utilized “protein charge ladders”—chemical derivatives of proteins with similar structure, but systematically altered net charge—to quantify how missense mutations that cause amyotrophic lateral sclerosis (ALS) affect the net negative charge (Z) of superoxide dismutase-1 (SOD1) as a function of subcellular pH and Zn2+ stoichiometry. Capillary electrophoresis revealed that the net charge of ALS-variant SOD1 can be different in sign and in magnitude—by up to 7.4 units per dimer at lysosomal pH—than values predicted from standard pKa values of amino acids and formal oxidation states of metal ions. At pH 7.4, the G85R, D90A, and G93R substitutions diminished the net negative charge of dimeric SOD1 by up to +2.29 units more than predicted; E100K lowered net charge by less than predicted. The binding of a single Zn2+ to mutant SOD1 lowered its net charge by an additional +2.33 ± 0.01 to +3.18 ± 0.02 units, however, each protein regulated net charge when binding a second, third, or fourth Zn2+ (ΔZ < 0.44 ± 0.07 per additional Zn2+). Both metalated and apo-SOD1 regulated net charge across subcellular pH, without inverting from negative to positive at the theoretical pI. Differential scanning calorimetry, hydrogen-deuterium exchange, and inductively coupled plasma mass spectrometry confirmed that the structure, stability, and metal content of mutant proteins were not significantly affected by lysine acetylation. Measured values of net charge should be used when correlating the biophysical properties of a specific ALS-variant SOD1 protein with its observed aggregation propensity or clinical phenotype. PMID:25052939

  2. The Positively Charged COOH-terminal Glycosaminoglycan-binding CXCL9(74-103) Peptide Inhibits CXCL8-induced Neutrophil Extravasation and Monosodium Urate Crystal-induced Gout in Mice.

    PubMed

    Vanheule, Vincent; Janssens, Rik; Boff, Daiane; Kitic, Nikola; Berghmans, Nele; Ronsse, Isabelle; Kungl, Andreas J; Amaral, Flavio Almeida; Teixeira, Mauro Martins; Van Damme, Jo; Proost, Paul; Mortier, Anneleen

    2015-08-28

    The ELR(-)CXC chemokine CXCL9 is characterized by a long, highly positively charged COOH-terminal region, absent in most other chemokines. Several natural leukocyte- and fibroblast-derived COOH-terminally truncated CXCL9 forms missing up to 30 amino acids were identified. To investigate the role of the COOH-terminal region of CXCL9, several COOH-terminal peptides were chemically synthesized. These peptides display high affinity for glycosaminoglycans (GAGs) and compete with functional intact chemokines for GAG binding, the longest peptide (CXCL9(74-103)) being the most potent. The COOH-terminal peptide CXCL9(74-103) does not signal through or act as an antagonist for CXCR3, the G protein-coupled CXCL9 receptor, and does not influence neutrophil chemotactic activity of CXCL8 in vitro. Based on the GAG binding data, an anti-inflammatory role for CXCL9(74-103) was further evidenced in vivo. Simultaneous intravenous injection of CXCL9(74-103) with CXCL8 injection in the joint diminished CXCL8-induced neutrophil extravasation. Analogously, monosodium urate crystal-induced neutrophil migration to the tibiofemural articulation, a murine model of gout, is highly reduced by intravenous injection of CXCL9(74-103). These data show that chemokine-derived peptides with high affinity for GAGs may be used as anti-inflammatory peptides; by competing with active chemokines for binding and immobilization on GAGs, these peptides may lower chemokine presentation on the endothelium and disrupt the generation of a chemokine gradient, thereby preventing a chemokine from properly performing its chemotactic function. The CXCL9 peptide may serve as a lead molecule for further development of inhibitors of inflammation based on interference with chemokine-GAG interactions. PMID:26183778

  3. Structures of the spectrin-ankyrin interaction binding domains

    SciTech Connect

    Ipsaro, Jonathan J.; Huang, Lei; Mondragón, Alfonso

    2010-01-07

    As key components of the erythrocyte membrane skeleton, spectrin and ankyrin specifically interact to tether the spectrin cytoskeleton to the cell membrane. The structure of the spectrin binding domain of ankyrin and the ankyrin binding domain of spectrin have been solved to elucidate the structural basis for ankyrin-spectrin recognition. The structure of repeats 14 and 15 of spectrin shows that these repeats are similar to all other spectrin repeats. One feature that could account for the preference of ankyrin for these repeats is the presence of a conserved, negatively charged patch on one side of repeat 14. The structure of the ankyrin ZU5 domain shows a novel structure containing a {beta} core. The structure reveals that the canonical ZU5 consensus sequence is likely to be missing an important region that codes for a {beta} strand that forms part of the core of the domain. In addition, a positively charged region is suggestive of a binding surface for the negatively charged spectrin repeat 14. Previously reported mutants of ankyrin that map to this region lie mostly on the surface of the protein, although at least one is likely to be part of the core.

  4. Isolation and characterizations of oxalate-binding proteins in the kidney.

    PubMed

    Roop-ngam, Piyachat; Chaiyarit, Sakdithep; Pongsakul, Nutkridta; Thongboonkerd, Visith

    2012-08-01

    Oxalate-binding proteins are thought to serve as potential modulators of kidney stone formation. However, only few oxalate-binding proteins have been identified from previous studies. Our present study, therefore, aimed for large-scale identification of oxalate-binding proteins in porcine kidney using an oxalate-affinity column containing oxalate-conjugated EAH Sepharose 4B beads for purification followed by two-dimensional gel electrophoresis (2-DE) to resolve the recovered proteins. Comparing with those obtained from the controlled column containing uncoupled EAH-Sepharose 4B (to subtract the background of non-specific bindings), a total of 38 protein spots were defined as oxalate-binding proteins. These protein spots were successfully identified by quadrupole time-of-flight mass spectrometry (MS) and/or tandem MS (MS/MS) as 26 unique proteins, including several nuclear proteins, mitochondrial proteins, oxidative stress regulatory proteins, metabolic enzymes and others. Identification of oxalate-binding domain using the PRATT tool revealed "L-x(3,5)-R-x(2)-[AGILPV]" as a functional domain responsible for oxalate-binding in 25 of 26 (96%) unique identified proteins. We report herein, for the first time, large-scale identification and characterizations of oxalate-binding proteins in the kidney. The presence of positively charged arginine residue in the middle of this functional domain suggested its significance for binding to the negatively charged oxalate. These data will enhance future stone research, particularly on stone modulators. PMID:22796524

  5. Nepsilon-(3-[*I]Iodobenzoyl)-Lys5-Nalpha-maleimido-Gly1-GEEEK ([*I]IB-Mal-D-GEEEK): a radioiodinated prosthetic group containing negatively charged D-glutamates for labeling internalizing monoclonal antibodies.

    PubMed

    Vaidyanathan, Ganesan; Alston, Kevin L; Bigner, Darrel D; Zalutsky, Michael R

    2006-01-01

    Novel methods are needed for the radiohalogenation of cell-internalizing proteins and peptides because rapid loss of label occurs after lysosomal processing when these molecules are labeled using conventional radioiodination methodologies. We have developed a radiolabeled prosthetic group that contains multiple negatively charged D-amino acids to facilitate trapping of the radioactivity in the cell after proteolysis of the labeled protein. N(epsilon)-(3-[(125)I]iodobenzoyl)-Lys(5)-N(alpha)-maleimido-Gly(1)-GEEEK ([(125)I]IB-Mal-D-GEEEK) was synthesized via iododestannylation in 90.3 +/- 3.9% radiochemical yields. This radioiodinated agent was conjugated to iminothiolane-treated L8A4, an anti-epidermal growth factor receptor variant III (EGFRvIII) specific monoclonal antibody (mAb) in 54.3 +/- 17.7% conjugation yields. In vitro assays with the EGFRvIII-expressing U87MGDeltaEGFR glioma cell line demonstrated that the internalized radioactivity for the [(125)I]IB-Mal-D-GEEEK-L8A4 conjugate increased from 14.1% at 1 h to 44.7% at 24 h and was about 15-fold higher than that of directly radioiodinated L8A4 at 24 h. A commensurately increased tumor uptake in vivo in athymic mice bearing subcutaneous U87MGDeltaEGFR xenografts (52.6 +/- 14.3% injected dose per gram versus 17.4 +/- 3.5% ID/g at 72 h) also was observed. These results suggest that [(125)I]IB-Mal-d-GEEEK is a promising reagent for the radioiodination of internalizing mAbs. PMID:16848419

  6. A single-nucleotide polymorphism in the 3′-UTR region of the adipocyte fatty acid binding protein 4 gene is associated with prognosis of triple-negative breast cancer

    PubMed Central

    Wang, Wenmiao; Yuan, Peng; Yu, Dianke; Du, Feng; Zhu, Anjie; Li, Qing; Zhang, Pin; Lin, Dongxin; Xu, Binghe

    2016-01-01

    Triple-negative breast cancer (TNBC) is a subtype of breast cancer with poor prognosis and high heterogeneity. The aim of this study was to screen patients for single-nucleotide polymorphisms (SNPs) associated with the prognosis of TNBC. Database-derived SNPs (NextBio, Ensembl, NCBI and MirSNP) located in the 3′-untranslated regions (3′-UTRs) of genes that are differentially expressed in breast cancer were selected. The possible associations between 111 SNPs and progression risk among 323 TNBC patients were investigated using a two-step case-control study with a discovery cohort (n=162) and a validation cohort (n=161). We identified the rs1054135 SNP in the adipocyte fatty acid binding protein 4 (FABP4) gene as a predictor of TNBC recurrence. The G allele of rs1054135 was associated with a reduced risk of disease progression as well as a prolonged disease-free survival time (DFS), with a hazard ratio (HR) for recurrence in the combined sample of 0.269 [95%CI: 0.098−0.735;P=0.001]. Notably, for individuals having the rs1054135 SNP with the AA/AG genotype, the magnitude of increased tumour recurrence risk for overweight patients (BMI≥25kg/m2) was significantly elevated (HR2.53; 95%CI: 1.06–6.03). Immunohistochemical staining of adipocytes adjacent to TNBC tissues showed that the expression level of FABP4 was statistically significantly lower in patients with the rs1054135-GG genotype and those in the disease-free group (P=0.0004 and P=0.0091, respectively). These results suggested that the expression of a lipid metabolism-related gene and an important SNP in the 3′-UTR of FABP4 are associated with TNBC prognosis, which may aid in the screening of high-risk patients with TNBC recurrence and the development of novel chemotherapeutic agents. PMID:26959740

  7. Synthesis and properties of differently charged chemiluminescent acridinium ester labels.

    PubMed

    Natrajan, Anand; Sharpe, David

    2013-02-14

    Chemiluminescent acridinium dimethylphenyl esters containing N-sulfopropyl groups in the acridinium ring are highly sensitive, hydrophilic labels that are used in automated immunoassays for clinical diagnostics. Light emission from these labels is triggered with alkaline peroxide in the presence of a cationic surfactant. At physiological pH, N-sulfopropyl acridinium esters exist as water adducts that are commonly referred to as pseudobases. Pseudobase formation, which results from addition of water to the zwitterionic N-sulfopropyl acridinium ring, neutralizes the positive charge on the acridinium nitrogen and imparts a net negative charge to the label due to the sulfonate moiety. As a consequence, N-sulfopropyl acridinium ester conjugates of small molecule haptens as well as large molecules such as proteins gain negative charges at neutral pH. In the current study, we describe the synthesis and properties of two new hydrophilic acridinium dimethylphenyl ester labels where the net charge in the labels was altered. In one label, the structure of the hydrophilic N-alkyl group attached to the acridinium ring was changed so that the pseudobase of the label contains no net charge. In the second acridinium ester, two additional negative charges in the form of sulfopropyl groups were added to the acridinium ring to make this label's pseudobase strongly anionic. Chemiluminescence measurements of these labels, as well as their conjugates of an antibody with a neutral pI, indicate that acridinium ester charge while having a modest effect on emission kinetics has little influence on light output. However, our results demonstrate that acridinium ester charge can affect protein pI, apparent chemiluminescence stability and non-specific binding of protein conjugates to microparticles. These results emphasize the need for careful consideration of acridinium ester charge in order to optimize reagent stability and performance in immunoassays. In the current study, we observed that

  8. Negative ions of polyatomic molecules.

    PubMed Central

    Christophorou, L G

    1980-01-01

    In this paper general concepts relating to, and recent advances in, the study of negative ions of polyatomic molecules area discussed with emphasis on halocarbons. The topics dealt with in the paper are as follows: basic electron attachment processes, modes of electron capture by molecules, short-lived transient negative ions, dissociative electron attachment to ground-state molecules and to "hot" molecules (effects of temperature on electron attachment), parent negative ions, effect of density, nature, and state of the medium on electron attachment, electron attachment to electronically excited molecules, the binding of attached electrons to molecules ("electron affinity"), and the basic and the applied significance of negative-ion studies. PMID:7428744

  9. Configuration effects on satellite charging response

    NASA Technical Reports Server (NTRS)

    Purvis, C. K.

    1980-01-01

    The response of various spacecraft configurations to a charging environment in sunlight was studied using the NASA Charging Analyzer Program code. The configuration features geometry, type of stabilization, and overall size. Results indicate that sunlight charging response is dominated by differential charging effects. Shaded insulation charges negatively result in the formation of potential barriers which suppress photoelectron emission from sunlit surfaces. Sunlight charging occurs relatively slowly: with 30 minutes of charging simulations, in none of the configurations modeled did the most negative surface cell reach half its equilibrium potential in eclipse.

  10. Lipid binding specificity of bovine α-lactalbumin: a multidimensional approach.

    PubMed

    Chaudhuri, Arunima; Chattopadhyay, Amitabha

    2014-08-01

    Many soluble proteins are known to interact with membranes in partially disordered states, and the mechanism and relevance of such interactions in cellular processes are beginning to be understood. Bovine α-lactalbumin (BLA) represents an excellent prototype for monitoring membrane interaction due to its conformational plasticity. In this work, we comprehensively monitored the interaction of apo-BLA with zwitterionic and negatively charged membranes utilizing a variety of approaches. We show that BLA preferentially binds to negatively charged membranes at acidic pH with higher binding affinity. This is supported by spectral changes observed with a potential-sensitive membrane probe and fluorescence anisotropy measurements of a hydrophobic probe. Our results show that BLA exhibits a molten globule conformation when bound to negatively charged membranes. We further show, using the parallax approach, that BLA penetrates the interior of negatively charged membranes, and tryptophan residues are localized at the membrane interface. Red edge excitation shift (REES) measurements reveal that the immediate environment of tryptophans in membrane-bound BLA is restricted, and the restriction is dependent on membrane lipid composition. We envision that understanding the mechanism of BLA-membrane interaction would help in bioengineering of α-lactalbumin, and to address the mechanism of tumoricidal and antimicrobial activities of BLA-oleic acid complex. PMID:24802274

  11. The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

    SciTech Connect

    Zhang, Yanfeng; Varnum, Susan M.

    2012-03-01

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was found to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.

  12. Surface charge modulated aptasensor in a single glass conical nanopore.

    PubMed

    Cai, Sheng-Lin; Cao, Shuo-Hui; Zheng, Yu-Bin; Zhao, Shuang; Yang, Jin-Lei; Li, Yao-Qun

    2015-09-15

    In this work, we have proposed a label-free nanopore-based biosensing strategy for protein detection by performing the DNA-protein interaction inside a single glass conical nanopore. A lysozyme binding aptamer (LBA) was used to functionalize the walls of glass nanopore via siloxane chemistry and negatively charged recognition sites were thus generated. The covalent modification procedures and their recognition towards lysozyme of the single conical nanopore were characterized via ionic current passing through the nanopore membrane, which was measured by recording the current-voltage (I-V) curves in 1mM KCl electrolyte at pH=7.4. With the occurring of recognition event, the negatively charged wall was partially neutralized by the positively charged lysozyme molecules, leading to a sensitive change of the surface charge-dependent current-voltage (I-V) characteristics. Our results not only demonstrate excellent selectivity and sensitivity towards the target protein, but also suggest a route to extend this nanopore-based sensing strategy to the biosensing platform designs of a wide range of proteins based on a charge modulation. PMID:25884732

  13. Synthesis, spectral investigations, antimicrobial activity and DNA-binding studies of novel charge transfer complex of 1,10-phenanthroline as an electron donor with π-acceptor p-Nitrophenol

    NASA Astrophysics Data System (ADS)

    Khan, Ishaat M.; Ahmad, Afaq

    2010-08-01

    Proton or charge transfer (CT) complex of donor, 1,10-phenanthroline (Phen) with π-acceptor, p-Nitrophenol (PNP) has been studied spectrophotometrically in methanol at room temperature. The binding of the CT complex with calf thymus (ct) DNA has been investigated by fluorescence spectrum, to establish the ability of the CT complex of its interaction with DNA. Stern-Volmer quenching constant ( Ksv) has also been calculated. The formation constant ( KCT), molar extinction coefficient ( ɛCT), free energy (Δ Go) and stoichiometric ratio of the CT complex have been determined by Benesi-Hildebrand equation. The stoichiometry was found to be 1:1. The CT complex was screened for its pharmacology as antibacterial and antifungal activity against various bacterial and fungal strains, showing excellent antibacterial and antifungal activity. The newly synthesized CT complex has been characterized by FTIR spectra, elemental analysis, 1H NMR, electronic absorption spectra. TGA-DTA studies were also carried out to check the stability of CT complex.

  14. Negative refraction and superconductivity

    NASA Astrophysics Data System (ADS)

    Amariti, Antonio; Forcella, Davide; Mariotti, Alberto; Siani, Massimo

    2011-10-01

    We discuss exotic properties of charged hydrodynamical systems, in the broken superconducting phase, probed by electromagnetic waves. Motivated by general arguments from hydrodynamics, we observe that negative refraction, namely the propagation in opposite directions of the phase velocities and of the energy flux, is expected for low enough frequencies. We corroborate this general idea by analyzing a holographic superconductor in the AdS/CFT correspondence, where the response functions can be explicitly computed. We study the dual gravitational theory both in the probe and in the backreacted case. We find that, while in the first case the refractive index is positive at every frequency, in the second case there is negative refraction at low enough frequencies. This is in agreement with hydrodynamic considerations.

  15. Engineering Cel7A carbohydrate binding module and linker for reduced lignin inhibition.

    PubMed

    Strobel, Kathryn L; Pfeiffer, Katherine A; Blanch, Harvey W; Clark, Douglas S

    2016-06-01

    Non-productive binding of cellulases to lignin inhibits enzymatic hydrolysis of biomass, increasing enzyme requirements and the cost of biofuels. This study used site-directed mutagenesis of the Trichoderma Cel7A carbohydrate binding module (CBM) and linker to investigate the mechanisms of adsorption to lignin and engineer a cellulase with increased binding specificity for cellulose. CBM mutations that added hydrophobic or positively charged residues decreased the specificity for cellulose, while mutations that added negatively charged residues increased the specificity. Linker mutations that altered predicted glycosylation patterns selectively impacted lignin affinity. Beneficial mutations were combined to generate a mutant with 2.5-fold less lignin affinity while fully retaining cellulose affinity. This mutant was uninhibited by added lignin during hydrolysis of Avicel and generated 40% more glucose than the wild-type enzyme from dilute acid-pretreated Miscanthus. Biotechnol. Bioeng. 2016;113: 1369-1374. © 2015 Wiley Periodicals, Inc. PMID:26616493

  16. Charge Shielding of PIP2 by Cations Regulates Enzyme Activity of Phospholipase C.

    PubMed

    Seo, Jong Bae; Jung, Seung-Ryoung; Huang, Weigang; Zhang, Qisheng; Koh, Duk-Su

    2015-01-01

    Hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) of the plasma membrane by phospholipase C (PLC) generates two critical second messengers, inositol-1,4,5-trisphosphate and diacylglycerol. For the enzymatic reaction, PIP2 binds to positively charged amino acids in the pleckstrin homology domain of PLC. Here we tested the hypothesis that positively charged divalent and multivalent cations accumulate around the negatively charged PIP2, a process called electrostatic charge shielding, and therefore inhibit electrostatic PIP2-PLC interaction. This charge shielding of PIP2 was measured quantitatively with an in vitro enzyme assay using WH-15, a PIP2 analog, and various recombinant PLC proteins (β1, γ1, and δ1). Reduction of PLC activity by divalent cations, polyamines, and neomycin was well described by a theoretical model considering accumulation of cations around PIP2 via their electrostatic interaction and chemical binding. Finally, the charge shielding of PIP2 was also observed in live cells. Perfusion of the cations into cells via patch clamp pipette reduced PIP2 hydrolysis by PLC as triggered by M1 muscarinic receptors with a potency order of Mg2+ < spermine4+ < neomycin6+. Accumulation of divalent cations into cells through divalent-permeable TRPM7 channel had the same effect. Altogether our results suggest that Mg2+ and polyamines modulate the activity of PLCs by controlling the amount of free PIP2 available for the enzymes and that highly charged biomolecules can be inactivated by counterions electrostatically. PMID:26658739

  17. Charge Shielding of PIP2 by Cations Regulates Enzyme Activity of Phospholipase C

    PubMed Central

    Seo, Jong Bae; Jung, Seung-Ryoung; Huang, Weigang; Zhang, Qisheng; Koh, Duk-Su

    2015-01-01

    Hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) of the plasma membrane by phospholipase C (PLC) generates two critical second messengers, inositol-1,4,5-trisphosphate and diacylglycerol. For the enzymatic reaction, PIP2 binds to positively charged amino acids in the pleckstrin homology domain of PLC. Here we tested the hypothesis that positively charged divalent and multivalent cations accumulate around the negatively charged PIP2, a process called electrostatic charge shielding, and therefore inhibit electrostatic PIP2-PLC interaction. This charge shielding of PIP2 was measured quantitatively with an in vitro enzyme assay using WH-15, a PIP2 analog, and various recombinant PLC proteins (β1, γ1, and δ1). Reduction of PLC activity by divalent cations, polyamines, and neomycin was well described by a theoretical model considering accumulation of cations around PIP2 via their electrostatic interaction and chemical binding. Finally, the charge shielding of PIP2 was also observed in live cells. Perfusion of the cations into cells via patch clamp pipette reduced PIP2 hydrolysis by PLC as triggered by M1 muscarinic receptors with a potency order of Mg2+ < spermine4+ < neomycin6+. Accumulation of divalent cations into cells through divalent-permeable TRPM7 channel had the same effect. Altogether our results suggest that Mg2+ and polyamines modulate the activity of PLCs by controlling the amount of free PIP2 available for the enzymes and that highly charged biomolecules can be inactivated by counterions electrostatically. PMID:26658739

  18. Charge and Hydrophobicity Effects of NIR Fluorophores on Bone-Specific Imaging

    PubMed Central

    Bao, Kai; Nasr, Khaled A.; Hyun, Hoon; Lee, Jeong Heon; Gravier, Julien; Gibbs, Summer L.; Choi, Hak Soo

    2015-01-01

    Recent advances in near-infrared (NIR) fluorescence imaging enabled real-time intraoperative detection of bone metastases, bone growth, and tissue microcalcification. Pamidronate (PAM) has been widely used for this purpose because of its high binding affinity toward bone and remarkable therapeutic effects. Herein we describe the development of a series of PAM-conjugated NIR fluorophores that varied in net charges and hydrophobicity, and compared their bone targeting efficiency, biodistribution, and blood clearance. Since the targeting moiety, PAM, is highly negatively charged but small, the overall in vivo bone targeting and biodistribution were mediated by the physicochemical properties of conjugated fluorophores. PMID:25825600

  19. Charge density-dependent strength of hydration and biological structure.

    PubMed Central

    Collins, K D

    1997-01-01

    Small ions of high charge density (kosmotropes) bind water molecules strongly, whereas large monovalent ions of low charge density (chaotropes) bind water molecules weakly relative to the strength of water-water interactions in bulk solution. The standard heat of solution of a crystalline alkali halide is shown here to be negative (exothermic) only when one ion is a kosmotrope and the ion of opposite charge is a chaotrope; this standard heat of solution is known to become proportionally more positive as the difference between the absolute heats of hydration of the corresponding gaseous anion and cation decreases. This suggests that inner sphere ion pairs are preferentially formed between oppositely charged ions with matching absolute enthalpies of hydration, and that biological organization arises from the noncovalent association of moieties with matching absolute free energies of solution, except where free energy is expended to keep them apart. The major intracellular anions (phosphates and carboxylates) are kosmotropes, whereas the major intracellular monovalent cations (K+; arg, his, and lys side chains) are chaotropes; together they form highly soluble, solvent-separated ion pairs that keep the contents of the cell in solution. PMID:8994593

  20. Triboelectric and plasma charging of microparticles

    NASA Astrophysics Data System (ADS)

    Heijmans, L. C. J.; Nijdam, S.

    2016-06-01

    The charge on two sets of 100 μm polystyrene particles has been measured using their acceleration in an externally applied electric field. This allows for the measurement of the individual charge on multiple particles at the same time. It is found that particles will charge each other both positively and negatively due to the triboelectric effect. This leads to a broad particle-charge distribution with positive, negative and neutral particles. The particle charge can be largely removed by applying a plasma over the particle containing surface. After plasma charge removal, the particles are triboelectrically recharged when they come into contact with other materials.

  1. Electrogenic Steps Associated with Substrate Binding to the Neuronal Glutamate Transporter EAAC1.

    PubMed

    Tanui, Rose; Tao, Zhen; Silverstein, Nechama; Kanner, Baruch; Grewer, Christof

    2016-05-27

    Glutamate transporters actively take up glutamate into the cell, driven by the co-transport of sodium ions down their transmembrane concentration gradient. It was proposed that glutamate binds to its binding site and is subsequently transported across the membrane in the negatively charged form. With the glutamate binding site being located partially within the membrane domain, the possibility has to be considered that glutamate binding is dependent on the transmembrane potential and, thus, is electrogenic. Experiments presented in this report test this possibility. Rapid application of glutamate to the wild-type glutamate transporter subtype EAAC1 (excitatory amino acid carrier 1) through photo-release from caged glutamate generated a transient inward current, as expected for the electrogenic inward movement of co-transported Na(+) In contrast, glutamate application to a transporter with the mutation A334E induced transient outward current, consistent with movement of negatively charged glutamate into its binding site within the dielectric of the membrane. These results are in agreement with electrostatic calculations, predicting a valence for glutamate binding of -0.27. Control experiments further validate and rule out other possible explanations for the transient outward current. Electrogenic glutamate binding can be isolated in the mutant glutamate transporter because reactions, such as glutamate translocation and/or Na(+) binding to the glutamate-bound state, are inhibited by the A334E substitution. Electrogenic glutamate binding has to be considered together with other voltage-dependent partial reactions to cooperatively determine the voltage dependence of steady-state glutamate uptake and glutamate buffering at the synapse. PMID:27044739

  2. Predicting Nonspecific Ion Binding Using DelPhi

    PubMed Central

    Petukh, Marharyta; Zhenirovskyy, Maxim; Li, Chuan; Li, Lin; Wang, Lin; Alexov, Emil

    2012-01-01

    Ions are an important component of the cell and affect the corresponding biological macromolecules either via direct binding or as a screening ion cloud. Although some ion binding is highly specific and frequently associated with the function of the macromolecule, other ions bind to the protein surface nonspecifically, presumably because the electrostatic attraction is strong enough to immobilize them. Here, we test such a scenario and demonstrate that experimentally identified surface-bound ions are located at a potential that facilitates binding, which indicates that the major driving force is the electrostatics. Without taking into consideration geometrical factors and structural fluctuations, we show that ions tend to be bound onto the protein surface at positions with strong potential but with polarity opposite to that of the ion. This observation is used to develop a method that uses a DelPhi-calculated potential map in conjunction with an in-house-developed clustering algorithm to predict nonspecific ion-binding sites. Although this approach distinguishes only the polarity of the ions, and not their chemical nature, it can predict nonspecific binding of positively or negatively charged ions with acceptable accuracy. One can use the predictions in the Poisson-Boltzmann approach by placing explicit ions in the predicted positions, which in turn will reduce the magnitude of the local potential and extend the limits of the Poisson-Boltzmann equation. In addition, one can use this approach to place the desired number of ions before conducting molecular-dynamics simulations to neutralize the net charge of the protein, because it was shown to perform better than standard screened Coulomb canned routines, or to predict ion-binding sites in proteins. This latter is especially true for proteins that are involved in ion transport, because such ions are loosely bound and very difficult to detect experimentally. PMID:22735539

  3. Photoelectric Charging of Dust Particles

    NASA Technical Reports Server (NTRS)

    Sickafoose, A.; Colwell, J.; Horanyi, M.; Robertson, S.; Walch, B.

    1999-01-01

    Laboratory experiments have been performed on the photoelectric charging of dust particles which are either isolated or adjacent to a surface that is also a photoemitter. We find that zinc dust charges to a positive potential of a few volts when isolated in vacuum and that it charges to a negative potential of a few volts when passed by a photoemitting surface. The illumination is an arc lamp emitting wavelengths longer than 200 nm and the emitting surface is a zirconium foil.

  4. Charge Distribution in Mesospheric Clouds

    SciTech Connect

    Misra, Shikha; Mishra, S. K.; Sodha, M. S.

    2011-11-29

    This work presents an analytical model for the physical understanding of the charge distribution on pure (with high work function) and dirty (with low work function) ice dust particles in polar mesospheric clouds PMCs (NLCs and PMSEs). The analysis is based on number and energy balance of constituents and allows the charge to be only an integral multiple (positive or negative) of the electronic charge.

  5. Isolation and characterizations of oxalate-binding proteins in the kidney

    SciTech Connect

    Roop-ngam, Piyachat; Chaiyarit, Sakdithep; Pongsakul, Nutkridta; Thongboonkerd, Visith

    2012-08-03

    Highlights: Black-Right-Pointing-Pointer The first large-scale characterizations of oxalate-binding kidney proteins. Black-Right-Pointing-Pointer The recently developed oxalate-conjugated EAH Sepharose 4B beads were applied. Black-Right-Pointing-Pointer 38 forms of 26 unique oxalate-binding kidney proteins were identified. Black-Right-Pointing-Pointer 25/26 (96%) of identified proteins had 'L-x(3,5)-R-x(2)-[AGILPV]' domain. -- Abstract: Oxalate-binding proteins are thought to serve as potential modulators of kidney stone formation. However, only few oxalate-binding proteins have been identified from previous studies. Our present study, therefore, aimed for large-scale identification of oxalate-binding proteins in porcine kidney using an oxalate-affinity column containing oxalate-conjugated EAH Sepharose 4B beads for purification followed by two-dimensional gel electrophoresis (2-DE) to resolve the recovered proteins. Comparing with those obtained from the controlled column containing uncoupled EAH-Sepharose 4B (to subtract the background of non-specific bindings), a total of 38 protein spots were defined as oxalate-binding proteins. These protein spots were successfully identified by quadrupole time-of-flight mass spectrometry (MS) and/or tandem MS (MS/MS) as 26 unique proteins, including several nuclear proteins, mitochondrial proteins, oxidative stress regulatory proteins, metabolic enzymes and others. Identification of oxalate-binding domain using the PRATT tool revealed 'L-x(3,5)-R-x(2)-[AGILPV]' as a functional domain responsible for oxalate-binding in 25 of 26 (96%) unique identified proteins. We report herein, for the first time, large-scale identification and characterizations of oxalate-binding proteins in the kidney. The presence of positively charged arginine residue in the middle of this functional domain suggested its significance for binding to the negatively charged oxalate. These data will enhance future stone research, particularly on stone

  6. Positron binding to molecules

    NASA Astrophysics Data System (ADS)

    Danielson, J. R.

    2011-05-01

    While there is theoretical evidence that positrons can bind to atoms, calculations for molecules are much less precise. Unfortunately, there have been no measurements of positron-atom binding, due primarily to the difficulty in forming positron-atom bound states in two-body collisions. In contrast, positrons attach to molecules via Feshbach resonances (VFR) in which a vibrational mode absorbs the excess energy. Using a high-resolution positron beam, this VFR process has been studied to measure binding energies for more than 40 molecules. New measurements will be described in two areas: positron binding to relatively simple molecules, for which theoretical calculations appear to be possible; and positron binding to molecules with large permanent dipole moments, which can be compared to analogous, weakly bound electron-molecule (negative-ion) states. Binding energies range from 75 meV for CS2 (no dipole moment) to 180 meV for acetonitrile (CH3CN). Other species studied include aldehydes and ketones, which have permanent dipole moments in the range 2.5 - 3.0 debye. The measured binding energies are surprisingly large (by a factor of 10 to 100) compared to those for the analogous negative ions, and these differences will be discussed. New theoretical calculations for positron-molecule binding are in progress, and a recent result for acetonitrile will be discussed. This ability to compare theory and experiment represents a significant step in attempts to understand positron binding to matter. In collaboration with A. C. L. Jones, J. J. Gosselin, and C. M. Surko, and supported by NSF grant PHY 07-55809.

  7. Critical interpretation of CH– and OH– stretching regions for infrared spectra of methanol clusters (CH{sub 3}OH){sub n} (n = 2–5) using self-consistent-charge density functional tight-binding molecular dynamics simulations

    SciTech Connect

    Nishimura, Yoshifumi; Lee, Yuan-Pern; Irle, Stephan; Witek, Henryk A.

    2014-09-07

    Vibrational infrared (IR) spectra of gas-phase O–H⋅⋅⋅O methanol clusters up to pentamer are simulated using self-consistent-charge density functional tight-binding method using two distinct methodologies: standard normal mode analysis and Fourier transform of the dipole time-correlation function. The twofold simulations aim at the direct critical assignment of the C–H stretching region of the recently recorded experimental spectra [H.-L. Han, C. Camacho, H. A. Witek, and Y.-P. Lee, J. Chem. Phys. 134, 144309 (2011)]. Both approaches confirm the previous assignment (ibid.) of the C–H stretching bands based on the B3LYP/ANO1 harmonic frequencies, showing that ν{sub 3}, ν{sub 9}, and ν{sub 2} C–H stretching modes of the proton-accepting (PA) and proton-donating (PD) methanol monomers experience only small splittings upon the cluster formation. This finding is in sharp discord with the assignment based on anharmonic B3LYP/VPT2/ANO1 vibrational frequencies (ibid.), suggesting that some procedural faults, likely related to the breakdown of the perturbational vibrational treatment, led the anharmonic calculations astray. The IR spectra based on the Fourier transform of the dipole time-correlation function include new, previously unaccounted for physical factors such as non-zero temperature of the system and large amplitude motions of the clusters. The elevation of temperature results in a considerable non-homogeneous broadening of the observed IR signals, while the presence of large-amplitude motions (methyl group rotations and PA-PD flipping), somewhat surprisingly, does not introduce any new features in the spectrum.

  8. The specificity of protection against cationic antimicrobial peptides by lactoferrin binding protein B.

    PubMed

    Morgenthau, Ari; Partha, Sarathy K; Adamiak, Paul; Schryvers, Anthony B

    2014-10-01

    A variety of Gram-negative pathogens possess host-specific lactoferrin (Lf) receptors that mediate the acquisition of iron from host Lf. The integral membrane protein component of the receptor, lactoferrin binding protein A specifically binds host Lf and is required for acquisition of iron from Lf. In contrast, the role of the bi-lobed surface lipoprotein, lactoferrin binding protein B (LbpB), in Lf binding and iron acquisition is uncertain. A common feature of LbpBs from most species is the presence of clusters of negatively charged amino acids in the protein's C-terminal lobe. Recently it has been shown that the negatively charged regions from the Neisseria meningitidis LbpB are responsible for protecting against an 11 amino acid cationic antimicrobial peptide (CAP), lactoferricin (Lfcin), derived from human Lf. In this study we investigated whether the LbpB confers resistance to other CAPs since N. meningitidis is likely to encounter other CAPs from the host. LbpB provided protection against the cathelicidin derived peptide, cathelicidin related antimicrobial peptide (mCRAMP), but did not confer protection against Tritrp 1 or LL37 under our experimental conditions. When tested against a range of rationally designed synthetic peptides, LbpB was shown to protect against IDR-1002 and IDR-0018 but not against HH-2 or HHC10. PMID:25038734

  9. Refinement of the conformation of a critical region of charge-charge interaction between cholecystokinin and its receptor.

    PubMed

    Ding, Xi-Qin; Pinon, Delia I; Furse, Kristina E; Lybrand, Terry P; Miller, Laurence J

    2002-05-01

    Insight into the molecular basis of cholecystokinin (CCK) binding to its receptor has come from receptor mutagenesis and photoaffinity labeling studies, with both contributing to the current hypothesis that the acidic Tyr-sulfate-27 residue within the peptide is situated adjacent to basic Arg(197) in the second loop of the receptor. Here, we refine our understanding of this region of interaction by examining a structure-activity series of these positions within both ligand and receptor and by performing three-dimensional molecular modeling of key pairs of modified ligand and receptor constructs. The important roles of Arg(197) and Tyr-sulfate-27 were supported by the marked negative impact on binding and biological response with their natural partner molecule when the receptor residue was replaced by acidic Asp or Glu and when the peptide residue was replaced by basic Arg, Lys, p-amino-Phe, p-guanidino-Phe, or p-methylamino-Phe. Complementary ligand-receptor charge-exchange experiments were unable to regain the lost function. This was supported by the molecular modeling, which demonstrated that the charge-reversed double mutants could not form a good interaction without extensive rearrangement of receptor conformation. The models further predicted that R197D and R197E mutations would lead to conformational changes in the extracellular domain, and this was experimentally supported by data showing that these mutations decreased peptide agonist and antagonist binding and increased nonpeptidyl antagonist binding. These receptor constructs also had increased susceptibility to trypsin degradation relative to the wild-type receptor. In contrast, the relatively conservative R197K mutation had modest negative impact on peptide agonist binding, again consistent with the modeling demonstration of loss of a series of stabilizing inter- and intramolecular bonds. The strong correlation between predicted and experimental results support the reported refinement in the three

  10. Analysis of the kinetics of P+ HA- recombination in membrane-embedded wild-type and mutant Rhodobacter sphaeroides reaction centers between 298 and 77 K indicates that the adjacent negatively charged QA ubiquinone modulates the free energy of P+ HA- and may influence the rate of the protein dielectric response.

    PubMed

    Gibasiewicz, Krzysztof; Pajzderska, Maria; Dobek, Andrzej; Brettel, Klaus; Jones, Michael R

    2013-09-26

    Time-resolved spectroscopic studies of recombination of the P(+)HA(-) radical pair in photosynthetic reaction centers (RCs) from Rhodobacter sphaeroides give an opportunity to study protein dynamics triggered by light and occurring over the lifetime of P(+)HA(-). The state P(+)HA(-) is formed after the ultrafast light-induced electron transfer from the primary donor pair of bacteriochlorophylls (P) to the acceptor bacteriopheophytin (HA). In order to increase the lifetime of this state, and thus increase the temporal window for the examination of protein dynamics, it is possible to block forward electron transfer from HA(-) to the secondary electron acceptor QA. In this contribution, the dynamics of P(+)HA(-) recombination were compared at a range of temperatures from 77 K to room temperature, electron transfer from HA(-) to QA being blocked either by prereduction of QA or by genetic removal of QA. The observed P(+)HA(-) charge recombination was significantly slower in the QA-deficient RCs, and in both types of complexes, lowering the temperature from RT to 77 K led to a slowing of charge recombination. The effects are explained in the frame of a model in which charge recombination occurs via competing pathways, one of which is thermally activated and includes transient formation of a higher-energy state, P(+)BA(-). An internal electrostatic field supplied by the negative charge on QA increases the free energy levels of the state P(+)HA(-), thus decreasing its energetic distance to the state P(+)BA(-). In addition, the dielectric response of the protein environment to the appearance of the state P(+)HA(-) is accelerated from ∼50-100 ns in the QA-deficient mutant RCs to ∼1-16 ns in WT RCs with a negatively charged QA(-). In both cases, the temperature dependence of the protein dynamics is weak. PMID:23477295

  11. Evaluation of Generalized Born Model Accuracy for Absolute Binding Free Energy Calculations.

    PubMed

    Zeller, Fabian; Zacharias, Martin

    2014-06-27

    Generalized Born (GB) implicit solvent models are widely used in molecular dynamics simulations to evaluate the interactions of biomolecular complexes. The continuum treatment of the solvent results in significant computational savings in comparison to an explicit solvent representation. It is, however, not clear how accurately the GB approach reproduces the absolute free energies of biomolecular binding. On the basis of induced dissociation by means of umbrella sampling simulations, the absolute binding free energies of small proline-rich peptide ligands and a protein receptor were calculated. Comparative simulations according to the same protocol were performed by employing an explicit solvent model and various GB-type implicit solvent models in combination with a nonpolar surface tension term. The peptide ligands differed in a key residue at the peptide-protein interface, including either a nonpolar, a neutral polar, a positively charged, or a negatively charged group. For the peptides with a neutral polar or nonpolar interface residue, very good agreement between the explicit solvent and GB implicit solvent results was found. Deviations in the main separation free energy contributions are smaller than 1 kcal/mol. In contrast, for peptides with a charged interface residue, significant deviations of 2-4 kcal/mol were observed. The results indicate that recent GB models can compete with explicit solvent representations in total binding free energy calculations as long as no charged residues are present at the binding interface. PMID:24941018

  12. CHARGE IMBALANCE

    SciTech Connect

    Clarke, John

    1980-09-01

    The purpose of this article is to review the theory of charge imbalance, and to discuss its relevance to a number of experimental situations. We introduce the concepts of quasiparticle charge and charge imbalance, and discuss the generation and detection of charge imbalance by tunneling. We describe the relaxation of the injected charge imbalance by inelastic scattering processes, and show how the Boltzmann equation can be solved to obtain the steady state quasiparticle distribution and the charge relaxation rate. Details are given of experiments to measure charge imbalance and the charge relaxation rate when inelastic scattering is the predominant relaxation mechanism. Experiments on and theories of other charge relaxation mechanisms are discussed, namely relaxation via elastic scattering in the presence of energy gap anisotropy, or in the presence of a pair breaking mechanism such as magnetic impurities or an applied supercurrent or magnetic field. We describe three other situations in which charge imbalance occurs, namely the resistance of the NS interface, phase slip centers, and the flow of a supercurrent in the presence of a temperature gradient.

  13. Modeling the Interaction between Integrin-Binding Peptide (RGD) and Rutile Surface: The Effect of Na+ on Peptide Adsorption

    SciTech Connect

    Wu, Chunya; Skelton, Adam; Chen, Mingjun; Vlcek, Lukas; Cummings, Peter T

    2011-01-01

    The dynamics of a single tripeptide Arg-Gly-Asp (RGD) adsorbing onto negatively charged hydroxylated rutile (110) surface in aqueous solution was studied using molecular dynamics (MD) simulations. The results indicate that the adsorbed Na{sup +} ions play an important role in determining the binding geometry of RGD. With an initial 'horseshoe' configuration, the charged side groups (COO{sup -} and NH{sub 2}) of the peptide are able to interact with the surface through direct hydrogen bonds (H bonds) in the very early stage of adsorption. The Na{sup +} ions approach the positively charged Arg side chain, competing with the Arg side chain for adsorption to the negatively charged hydroxyl oxygen. In coordination with the structural adjustment of the peptide, the Arg residue is driven to detach from the rutile surface. In contrast, the Na+ ions in close proximity to the negatively charged Asp side chain contribute to the binding of the COO{sup -} group on the surface, helping the carboxyl oxygen not involved in COO{sup -}-surface H bonds to orientate toward the hydroxyl hydrogens. Once both carboxyl oxygens form enough H bonds with the hydroxyl hydrogens, the redundant ions move toward a more favorable adsorption site.

  14. Joint interaction of ethidium bromide and methylene blue with DNA. The effect of ionic strength on binding thermodynamic parameters.

    PubMed

    Vardevanyan, Poghos O; Antonyan, Ara P; Parsadanyan, Marine A; Torosyan, Margarita A; Karapetian, Armen T

    2016-07-01

    Large amount of data of experimental and theoretical studies have shown that ethidium bromide (EtBr) and methylene blue (MB) may bind to nucleic acids via three modes: intercalation between two adjacent base pairs, insertion into the plane between neighboring bases in the same strand (semi-intercalation), and outside binding with negatively charged backbone phosphate groups. The aim of the given research is to examine the behavior of these two ligands at both separate and joint DNA binding. The obtained experimental data show that the effect of simultaneous binding of EtBr and MB on double-stranded DNA has a non-additive effect of separate binding. The analyses of the melting thermodynamic parameters of DNA complexes with two bound ligands suggest competitive mechanism of interaction. PMID:26239502

  15. Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding dEF1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an estrogen receptor-enhanced cell line when treated with estrogen. This promoter-enhancer also binds unidentified proteins that recognize a consens...

  16. Solid-to-Liquid Charge Transfer for Generating Droplets with Tunable Charge.

    PubMed

    Sun, Yajuan; Huang, Xu; Soh, Siowling

    2016-08-16

    Charged liquid droplets are typically generated by a high-voltage power supply. Herein, a previously unreported method is used for charging liquid droplets: by transferring charge from an insulating solid surface charged by contact electrification to the droplets. Charging the solid surface by contact electrification involves bringing it into contact with another solid surface for generating static charge. Subsequently, water droplets that flow across the surface are found to be charged-thus, the charge is readily transferred from solid to liquid. The charge of the droplets can be tuned continuously from positive to negative by varying the way the solid surface is charged. The amount of charge generated is sufficient for manipulating, coalescing, and sorting the water droplets by solid surfaces charged by contact electrification. This method of generating charged droplets is general, simple, inexpensive, and does not need any additional equipment or power supply. PMID:27417888

  17. Gentamicin Binds to the Megalin Receptor as a Competitive Inhibitor Using the Common Ligand Binding Motif of Complement Type Repeats

    PubMed Central

    Dagil, Robert; O'Shea, Charlotte; Nykjær, Anders; Bonvin, Alexandre M. J. J.; Kragelund, Birthe B.

    2013-01-01

    Gentamicin is an aminoglycoside widely used in treatments of, in particular, enterococcal, mycobacterial, and severe Gram-negative bacterial infections. Large doses of gentamicin cause nephrotoxicity and ototoxicity, entering the cell via the receptor megalin. Until now, no structural information has been available to describe the interaction with gentamicin in atomic detail, and neither have any three-dimensional structures of domains from the human megalin receptor been solved. To address this gap in our knowledge, we have solved the NMR structure of the 10th complement type repeat of human megalin and investigated its interaction with gentamicin. Using NMR titration data in HADDOCK, we have generated a three-dimensional model describing the complex between megalin and gentamicin. Gentamicin binds to megalin with low affinity and exploits the common ligand binding motif previously described (Jensen, G. A., Andersen, O. M., Bonvin, A. M., Bjerrum-Bohr, I., Etzerodt, M., Thogersen, H. C., O'Shea, C., Poulsen, F. M., and Kragelund, B. B. (2006) J. Mol. Biol. 362, 700–716) utilizing the indole side chain of Trp-1126 and the negatively charged residues Asp-1129, Asp-1131, and Asp-1133. Binding to megalin is highly similar to gentamicin binding to calreticulin. We discuss the impact of this novel insight for the future structure-based design of gentamicin antagonists. PMID:23275343

  18. Internal Charging

    NASA Technical Reports Server (NTRS)

    Minow, Joseph I.

    2014-01-01

    (1) High energy (>100keV) electrons penetrate spacecraft walls and accumulate in dielectrics or isolated conductors; (2) Threat environment is energetic electrons with sufficient flux to charge circuit boards, cable insulation, and ungrounded metal faster than charge can dissipate; (3) Accumulating charge density generates electric fields in excess of material breakdown strenght resulting in electrostatic discharge; and (4) System impact is material damage, discharge currents inside of spacecraft Faraday cage on or near critical circuitry, and RF noise.

  19. Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

    SciTech Connect

    Newberry, K.J.; Huffman, J.L.; Miller, M.C.; Vazquez-Laslop, N.; Neyfakh, A.A.; Brennan, R.G.

    2009-05-22

    BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets, that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.

  20. Binding of small basic peptides to membranes containing acidic lipids: theoretical models and experimental results.

    PubMed Central

    Ben-Tal, N; Honig, B; Peitzsch, R M; Denisov, G; McLaughlin, S

    1996-01-01

    We measured directly the binding of Lys3, Lys5, and Lys7 to vesicles containing acidic phospholipids. When the vesicles contain 33% acidic lipids and the aqueous solution contains 100 mM monovalent salt, the standard Gibbs free energy for the binding of these peptides is 3, 5, and 7 kcal/mol, respectively. The binding energies decrease as the mol% of acidic lipids in the membrane decreases and/or as the salt concentration increases. Several lines of evidence suggest that these hydrophilic peptides do not penetrate the polar headgroup region of the membrane and that the binding is mainly due to electrostatic interactions. To calculate the binding energies from classical electrostatics, we applied the nonlinear Poisson-Boltzmann equation to atomic models of the phospholipid bilayers and the basic peptides in aqueous solution. The electrostatic free energy of interaction, which arises from both a long-range coulombic attraction between the positively charged peptide and the negatively charged lipid bilayer, and a short-range Born or image charge repulsion, is a minimum when approximately 2.5 A (i.e., one layer of water) exists between the van der Waals surfaces of the peptide and the lipid bilayer. The calculated molar association constants, K, agree well with the measured values: K is typically about 10-fold smaller than the experimental value (i.e., a difference of about 1.5 kcal/mol in the free energy of binding). The predicted dependence of K (or the binding free energies) on the ionic strength of the solution, the mol% of acidic lipids in the membrane, and the number of basic residues in the peptide agree very well with the experimental measurements. These calculations are relevant to the membrane binding of a number of important proteins that contain clusters of basic residues. Images FIGURE 2 FIGURE 3 PMID:8842196

  1. MARCKS is a natively unfolded protein with an inaccessible actin-binding site: evidence for long-range intramolecular interactions.

    PubMed

    Tapp, Hazel; Al-Naggar, Iman M; Yarmola, Elena G; Harrison, Alexis; Shaw, Gerry; Edison, Arthur S; Bubb, Michael R

    2005-03-18

    Myristoylated alanine-rich C kinase substrate (MARCKS) is an unfolded protein that contains well characterized actin-binding sites within the phosphorylation site domain (PSD), yet paradoxically, we now find that intact MARCKS does not bind to actin. Intact MARCKS also does not bind as well to calmodulin as does the PSD alone. Myristoylation at the N terminus alters how calmodulin binds to MARCKS, implying that, despite its unfolded state, the distant N terminus influences binding events at the PSD. We show that the free PSD binds with site specificity to MARCKS, suggesting that long-range intramolecular interactions within MARCKS are also possible. Because of the unusual primary sequence of MARCKS with an overall isoelectric point of 4.2 yet a very basic PSD (overall charge of +13), we speculated that ionic interactions between oppositely charged domains of MARCKS were responsible for long-range interactions within MARCKS that sterically influence binding events at the PSD and that explain the observed differences between properties of the PSD and MARCKS. Consistent with this hypothesis, chemical modifications of MARCKS that neutralize negatively charged residues outside of the PSD allow the PSD to bind to actin and increase the affinity of MARCKS for calmodulin. Similarly, both myristoylation of MARCKS and cleavage of MARCKS by calpain are shown to increase the availability of the PSD so as to activate its actin-binding activity. Because abundant evidence supports the conclusion that MARCKS is an important protein in regulating actin dynamics, our data imply that post-translational modifications of MARCKS are necessary and sufficient to regulate actin-binding activity. PMID:15640140

  2. Deconstructing the DGAT1 Enzyme: Membrane Interactions at Substrate Binding Sites

    PubMed Central

    Lopes, Jose L. S.; Beltramini, Leila M.; Wallace, Bonnie A.; Araujo, Ana P. U.

    2015-01-01

    Diacylglycerol acyltransferase 1 (DGAT1) is a key enzyme in the triacylglyceride synthesis pathway. Bovine DGAT1 is an endoplasmic reticulum membrane-bound protein associated with the regulation of fat content in milk and meat. The aim of this study was to evaluate the interaction of DGAT1 peptides corresponding to putative substrate binding sites with different types of model membranes. Whilst these peptides are predicted to be located in an extramembranous loop of the membrane-bound protein, their hydrophobic substrates are membrane-bound molecules. In this study, peptides corresponding to the binding sites of the two substrates involved in the reaction were examined in the presence of model membranes in order to probe potential interactions between them that might influence the subsequent binding of the substrates. Whilst the conformation of one of the peptides changed upon binding several types of micelles regardless of their surface charge, suggesting binding to hydrophobic domains, the other peptide bound strongly to negatively-charged model membranes. This binding was accompanied by a change in conformation, and produced leakage of the liposome-entrapped dye calcein. The different hydrophobic and electrostatic interactions observed suggest the peptides may be involved in the interactions of the enzyme with membrane surfaces, facilitating access of the catalytic histidine to the triacylglycerol substrates. PMID:25719207

  3. How to Optimize Binding of Coated Nanoparticles: Coupling of Physical Interactions, Molecular Organization and Chemical State.

    PubMed

    Nap, R J; Szleifer, I

    2013-08-01

    One of the key challenges in the development of nano carriers for drug delivery and imaging is the design of a system that selectively binds to target cells. A common strategy is to coat the delivery device with specific ligands that bind strongly to overexpressed receptors. However such devices are usually unable to discriminate between receptors found on benign and malignant cells. We demonstrate, theoretically, how one can achieve enhanced binding to target cells by using multiple physical and chemical interactions. We study the effective interactions between a polymer decorated nano micelle or nanoparticle with three types of model lipid membranes that differ in the composition of their outer leaflet. They are: i) lipid membranes with overexpressed receptors, ii) membranes with a given fraction of negatively charged lipids and iii) membranes with both overexpressed receptors and negatively charged lipids. The coating contains a mixtures of two short polymers, one neutral for protection and the other a polybase with a functional end-group to optimize specific binding with the overexpressed receptors and electrostatic interactions with charged lipid head-groups. The strength of the binding for the combined system is much larger than the sum of the independent electrostatic or specific interactions binding. We find a range of distances where the addition of two effective repulsive interactions become an attraction in the combined case. The changes in the strength and shape of the effective interaction are due to the coupling that exists between molecular organization, physical interactions and chemical state, e.g., protonation. The predictions provide guidelines for the design of carrier devices for targeted drug and nanoparticle delivery and give insight in the competing and highly non-additive nature of the different effective interactions in nanoscale systems in constrained environments that are ubiquitous in synthetic and biological systems. PMID:23930222

  4. Direct correlation between a negative autoregulatory response element at the cap site of the herpes simplex virus type 1 IE175 (alpha 4) promoter and a specific binding site for the IE175 (ICP4) protein.

    PubMed Central

    Roberts, M S; Boundy, A; O'Hare, P; Pizzorno, M C; Ciufo, D M; Hayward, G S

    1988-01-01

    In transient-expression assays, the IE175 (alpha 4) promoter region of herpes simple virus is down-regulated after cotransfection with DNA encoding its own protein product (IE175 or ICP4). The inhibition by IE175 proved to be highly specific for its own promoter region and did not act on either the herpes simplex virus type 1 IE110 (alpha 0) or human cytomegalovirus major immediate-early promoters. Furthermore, the inhibition was still exhibited by IE175 effector plasmids driven by strong heterologous promoters and therefore must be a direct autoregulatory response that cannot be explained by promoter competition effects. In gel mobility retardation assays with infected-cell nuclear extracts, a prominent and specific DNA-protein complex was formed with DNA fragments containing sequences from -108 to +30 in the IE175 promoter region. This activity was not present in mock-infected samples. Even stronger binding occurred with a fragment containing sequences from -128 to +120 in the IE110 promoter, but this second locus was not associated with any detectable response phenotype in cotransfection assays. Supershift experiments with an anti-IE175 monoclonal antibody confirmed the presence of the IE175 protein in both DNA-protein complexes. In the IE175 promoter, specific binding correlated closely with the presence of an intact autoregulatory signal near the cap site as judged by the loss of both activities in a 3'-deleted promoter fragment lacking sequences from -7 to +30. Insertion of a cloned 30-mer synthetic oligonucleotide sequence from positions -8 to +18 in IE175 restored both IE175 binding activity and the down-regulation phenotype. Direct shift-up assays with a similar 30-base-pair (bp) oligonucleotide containing 21 bp from positions -75 to -55 of IE110 (which encompasses a consensus ATCGTC motif) also produced a specific DNA-protein complex containing the IE175 protein. This ATCGTC motif proved to be a necessary component of both the IE110 and IE175 binding

  5. Estimation of the binding ability of main transport proteins of blood plasma with liver cirrhosis by the fluorescent probe method

    NASA Astrophysics Data System (ADS)

    Korolenko, E. A.; Korolik, E. V.; Korolik, A. K.; Kirkovskii, V. V.

    2007-07-01

    We present results from an investigation of the binding ability of the main transport proteins (albumin, lipoproteins, and α-1-acid glycoprotein) of blood plasma from patients at different stages of liver cirrhosis by the fluorescent probe method. We used the hydrophobic fluorescent probes anionic 8-anilinonaphthalene-1-sulfonate, which interacts in blood plasma mainly with albumin; cationic Quinaldine red, which interacts with α-1-acid glycoprotein; and neutral Nile red, which redistributes between lipoproteins and albumin in whole blood plasma. We show that the binding ability of albumin and α-1-acid glycoprotein to negatively charged and positively charged hydrophobic metabolites, respectively, increases in the compensation stage of liver cirrhosis. As the pathology process deepens and transitions into the decompensation stage, the transport abilities of albumin and α-1-acid glycoprotein decrease whereas the binding ability of lipoproteins remains high.

  6. Charging machine

    DOEpatents

    Medlin, John B.

    1976-05-25

    A charging machine for loading fuel slugs into the process tubes of a nuclear reactor includes a tubular housing connected to the process tube, a charging trough connected to the other end of the tubular housing, a device for loading the charging trough with a group of fuel slugs, means for equalizing the coolant pressure in the charging trough with the pressure in the process tubes, means for pushing the group of fuel slugs into the process tube and a latch and a seal engaging the last object in the group of fuel slugs to prevent the fuel slugs from being ejected from the process tube when the pusher is removed and to prevent pressure liquid from entering the charging machine.

  7. Comparison of S. cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site

    PubMed Central

    Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.

    2015-01-01

    SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000

  8. 'Bootstrap' charging of surfaces composed of multiple materials

    NASA Technical Reports Server (NTRS)

    Stannard, P. R.; Katz, I.; Parks, D. E.

    1981-01-01

    The paper examines the charging of a checkerboard array of two materials, only one of which tends to acquire a negative potential alone, using the NASA Charging Analyzer Program (NASCAP). The influence of the charging material's field causes the otherwise 'non-charging' material to acquire a negative potential due to the suppression of its secondary emission ('bootstrap' charging). The NASCAP predictions for the equilibrium potential difference between the two materials are compared to results based on an analytical model.

  9. Binding Procurement

    NASA Technical Reports Server (NTRS)

    Rao, Gopalakrishna M.; Vaidyanathan, Hari

    2007-01-01

    This viewgraph presentation reviews the use of the binding procurement process in purchasing Aerospace Flight Battery Systems. NASA Engineering and Safety Center (NESC) requested NASA Aerospace Flight Battery Systems Working Group to develop a set of guideline requirements document for Binding Procurement Contracts.

  10. Surface Charge and Ion Sorption Properties of Titanium Dioxide

    NASA Astrophysics Data System (ADS)

    Ridley, M. K.; Machesky, M. L.; Wesolowski, D. J.; Finnegan, M. P.; Palmer, D. A.

    2001-12-01

    The interaction of submicron metal oxide particles with natural aqueous solutions results in the hydroxylation of surface sites, which impart a pH-dependent surface charge. The charged submicron particles influence processes such as nanoparticle assembly and alteration, crystal growth rates and morphologies, colloid flocculation, and contaminant transport. The surface charge and ion sorption properties of metal-oxide particles may be studied by potentiometric titrations, using hydrogen-electrode concentration-cells or traditional glass electrodes and an autotitrator. These techniques have been used to quantify the adsorption of various ions (Na+, Rb+, Ca2+, Sr2+, Cl-) on rutile, at ionic strengths up to 1.0 molality and temperatures to 250° C. The crystalline rutile used in these studies is less than 400 nm in diameter, has a BET surface area of 17 m2/g, and the 110 and 100 faces predominate. The negative surface charge of the rutile was enhanced by increasing temperature, increasing ionic strength, and decreasing the ionic radii of the electrolyte cation. Moreover, the addition of a divalent cation significantly enhances the negative charge of the rutile surface. These data have been rationalized with the MUSIC model of Hiemestra and van Riemsdijk, and a Basic Stern layer description of the electric double layer (EDL). Model fitting of the experimental data provides binding constants for the adsorbed counterions and divalent cations, and capacitance values as well as corresponding electrical potential values of the binding planes. Recently, new studies have been initiated to determine particle size affects on the proton induced surface charge and ion sorption properties of titanium dioxide. In these studies, anatase with a BET surface area of 40 and 100 m2/g (primary particle sizes of 40 and 10 nm, respectively) is being investigated. The complexity of both the experimental and modeling procedures increases with decreasing particle size. For example, the fine

  11. Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

    PubMed

    Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

    2008-12-01

    Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1. PMID:19008385

  12. Characterization of the binding of 2-mercaptobenzimidazole to bovine serum albumin.

    PubMed

    Teng, Yue; Zou, Luyi; Huang, Ming; Zong, Wansong

    2015-04-01

    2-Mercaptobenzimidazole (MBI) is widely utilized as a corrosion inhibitor, copper-plating brightener and rubber accelerator. The residue of MBI in the environment is potentially harmful to human health. In this article, the interaction of MBI with bovine serum albumin (BSA) was explored using spectroscopic and molecular docking methods under physiological conditions. The positively charged MBI can spontaneously bind with the negatively charged BSA through electrostatic forces with one binding site. The site marker competition experiments and the molecular docking study revealed that MBI bou