Relativistic Brueckner-Hartree-Fock theory for neutron drops
NASA Astrophysics Data System (ADS)
Shen, Shihang; Liang, Haozhao; Meng, Jie; Ring, Peter; Zhang, Shuangquan
2018-05-01
Neutron drops confined in an external field are studied in the framework of relativistic Brueckner-Hartree-Fock theory using the bare nucleon-nucleon interaction. The ground-state energies and radii of neutron drops with even numbers from N =4 to N =50 are calculated and compared with results obtained from other nonrelativistic ab initio calculations and from relativistic density functional theory. Special attention has been paid to the magic numbers and to the subshell closures. The single-particle energies are investigated and the monopole effect of the tensor force on the evolutions of the spin-orbit and the pseudospin-orbit splittings is discussed. The results provide interesting insights into neutron-rich systems and can form an important guide for future density functionals.
Brueckner-AMD Study of Light Nuclei
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kato, Kiyoshi; Yamamoto, Yuhei; Togashi, Tomoaki
2011-06-28
We applied the Brueckner theory to the Antisymmetrized Molecular Dynamics (AMD) and examined the reliability of the AMD calculations based on realistic nuclear interactions. In this method, the Bethe-Goldstone equation in the Brueckner theory is solved for every nucleon pair described by wave packets of AMD, and the G-matrix is calculated with single-particle orbits in AMD self-consistently. We apply this framework to not only {alpha}-nuclei but also N{ne}Z nuclei with A{approx}10. It is confirmed that these results present the description of reasonable cluster structures and energy-level schemes comparable with the experimental ones in light nuclei.
Hu, Jinniu; Toki, Hiroshi; Shen, Hong
2016-01-01
We study the properties of nuclear matter with lattice nucleon-nucleon (NN) potential in the relativistic Brueckner-Hartree-Fock (RBHF) theory. To use this potential in such a microscopic many-body theory, we firstly have to construct a one-boson-exchange potential (OBEP) based on the latest lattice NN potential. Three mesons, pion, σ meson, and ω meson, are considered. Their coupling constants and cut-off momenta are determined by fitting the on-shell behaviors and phase shifts of the lattice force, respectively. Therefore, we obtain two parameter sets of the OBEP potential (named as LOBEP1 and LOBEP2) with these two fitting ways. We calculate the properties of symmetric and pure neutron matter with LOBEP1 and LOBEP2. In non-relativistic Brueckner-Hartree-Fock case, the binding energies of symmetric nuclear matter are around −3 and −5 MeV at saturation density, while it becomes −8 and −12 MeV in relativistic framework with 1S0, 3S1, and 3D1 channels using our two parameter sets. For the pure neutron matter, the equations of state in non-relativistic and relativistic cases are very similar due to only consideration 1S0 channel with isospin T = 1 case. PMID:27752124
Hu, Jinniu; Toki, Hiroshi; Shen, Hong
2016-10-18
We study the properties of nuclear matter with lattice nucleon-nucleon (NN) potential in the relativistic Brueckner-Hartree-Fock (RBHF) theory. To use this potential in such a microscopic many-body theory, we firstly have to construct a one-boson-exchange potential (OBEP) based on the latest lattice NN potential. Three mesons, pion, σ meson, and ω meson, are considered. Their coupling constants and cut-off momenta are determined by fitting the on-shell behaviors and phase shifts of the lattice force, respectively. Therefore, we obtain two parameter sets of the OBEP potential (named as LOBEP1 and LOBEP2) with these two fitting ways. We calculate the properties of symmetric and pure neutron matter with LOBEP1 and LOBEP2. In non-relativistic Brueckner-Hartree-Fock case, the binding energies of symmetric nuclear matter are around -3 and -5 MeV at saturation density, while it becomes -8 and -12 MeV in relativistic framework with 1 S 0 , 3 S 1 , and 3 D 1 channels using our two parameter sets. For the pure neutron matter, the equations of state in non-relativistic and relativistic cases are very similar due to only consideration 1 S 0 channel with isospin T = 1 case.
[From humanism to nihilism: dialectics on Jean Watson's caring theory].
Krol, Pawel J; Lavoie, Mireille
2015-09-01
nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.
Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.
Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika
2017-07-01
The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.
From theory to practice: caring science according to Watson and Brewer.
Clarke, Pamela N; Watson, Jean; Brewer, Barbara B
2009-10-01
Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.
Weighted Watson-Crick automata
NASA Astrophysics Data System (ADS)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
2014-07-01
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Closure properties of Watson-Crick grammars
NASA Astrophysics Data System (ADS)
Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh
2015-12-01
In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.
Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories
Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein
2017-01-01
Background: In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. Materials and Methods: In this study, we use concept analyses of Walker–Avants and compare research methods. Material used is all Islamic documents. Results: According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans taking care of themselves, (3) Other humans taking care of humans, and (4) The universe taking care of humans and vice versa. God caring for humans affects the three other types of caring. All three definitions of caring have humanistic and holistic view. According to Watson's and Parse's definition, the development of the caring theory is based on the person's experiences that result from human interactions with, and experiences of, their environment. In Islamic definition, although the caring process is affected by environmental experiences and interactions, human not developed only base the effect of environment; rather, it is developed on the basis of human nature and divine commands. God taking care of humans is specific to Islamic perspective and is not found in other definitions. Islamic perspective maintains that God is the creator of humanity and is in charge of guiding humans. A superior form of human can always be discovered. Conclusions: Thus, nursing implementation in Muslims must be done based on Islamic commands, and Islamic commands are superior to human experiences. However, Islamic commands interpreted with human wisdom and thought can be striving toward excellence. PMID:28584543
ERIC Educational Resources Information Center
Sternod, Latisha; French, Brian
2016-01-01
The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…
Data Discovery with IBM Watson
NASA Astrophysics Data System (ADS)
Fessler, J.
2016-12-01
BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies
Charpa, Ulrich
2008-01-01
This article opens with general and historical remarks on philosophy of science's problems with the concept of discovery. Then, drawing upon simple examples of Watson's and Crick's non-philosophical usage, I characterize phrases of the type "x discovers y" semantically. It will subsequently be shown how widespread philosophical discussion on discovery violates the semantic constraints of phrases of the type "x discovers y." Then I provide a philosophical reconstruction of "x discovers y" that is in keeping with the "folk" notion of discovery. The philosophical ingredients of this approach are taken from a certain aspect of action theory and from epistemological reliabilism. The approach draws upon the concept of superior action and connects this concept to progressive research. In contrast to normal actions, superior actions are primarily explained by competencies. This perspective includes reminders of what some nineteenth-century philosopher-scientists had advocated as a competence-oriented view on scientific research. Finally, this approach is applied to the case of Watson's and Crick's discovery.
Elevation, west portal. Sign on portal reads Watson Mill Bridge, ...
Elevation, west portal. Sign on portal reads Watson Mill Bridge, est. 1885. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA
Making IBM's Computer, Watson, Human
ERIC Educational Resources Information Center
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
Brueckner G -matrix approach for neutron-proton pairing correlations in the deformed BCS approach
NASA Astrophysics Data System (ADS)
Ha, Eunja; Cheoun, Myung-Ki; Šimkovic, F.
2015-10-01
Ground states of even-even Ge isotopes with mass number A =64 -76 have been studied in the deformed Bardeen-Cooper-Schrieffer (BCS) theory by taking neutron-proton (n p ) pairing correlations as well as neutron-neutron (n n ) and proton-proton (p p ) pairing correlations. The n p pairing has two different modes J =0 ,T =1 (isotriplet) and J =1 ,T =0 (isosinglet). In this work, the Brueckner G matrix, based on the CD-Bonn potential, has been exploited to reduce the ambiguity regarding nucleon-nucleon interactions inside nuclei compared to the results by a simple schematic phenomenological force. We found that the G matrix plays important roles to obtain reasonable descriptions of even-even nuclei compared to the schematic force. The n p pairing strength has been shown to have a clear correlation with quadrupole deformation parameter β2 for the isotopes, and affects the smearing of the Fermi surfaces of not only N =Z nuclei but also N ≠Z nuclei. In particular, the coexistence of the like particle (n n and p p ) and the n p pairing modes was found to become more salient by the G -matrix approach than by the schematic force approach.
John B. Watson's Legacy: Learning and Environment.
ERIC Educational Resources Information Center
Horowitz, Frances Degen
1992-01-01
Evaluates John B. Watson's contributions to developmental psychology. Watson's insistence on objective methodology in psychology retains its influence, but his extreme environmentalism has been rejected. His concern with the principles of learning is reflected in the work of Hull and Skinner. (BC)
The multiple personalities of Watson and Crick strands.
Cartwright, Reed A; Graur, Dan
2011-02-08
In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.
The multiple personalities of Watson and Crick strands
2011-01-01
Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin. PMID:21303550
Range-Separated Brueckner Coupled Cluster Doubles Theory
NASA Astrophysics Data System (ADS)
Shepherd, James J.; Henderson, Thomas M.; Scuseria, Gustavo E.
2014-04-01
We introduce a range-separation approximation to coupled cluster doubles (CCD) theory that successfully overcomes limitations of regular CCD when applied to the uniform electron gas. We combine the short-range ladder channel with the long-range ring channel in the presence of a Bruckner renormalized one-body interaction and obtain ground-state energies with an accuracy of 0.001 a.u./electron across a wide range of density regimes. Our scheme is particularly useful in the low-density and strongly correlated regimes, where regular CCD has serious drawbacks. Moreover, we cure the infamous overcorrelation of approaches based on ring diagrams (i.e., the particle-hole random phase approximation). Our energies are further shown to have appropriate basis set and thermodynamic limit convergence, and overall this scheme promises energetic properties for realistic periodic and extended systems which existing methods do not possess.
Durgun Ozan, Yeter; Okumuş, Hülya
2017-06-01
Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.
"I May Be Crackin', But Um Fackin": Racial Humor in "The Watsons Go To Birmingham--1963"
ERIC Educational Resources Information Center
McNair, Jonda C.
2008-01-01
This article examines the utilization of racial humor in Christopher Paul Curtis' novel, "The Watsons Go To Birmingham--1963." The theoretical perspectives that inform the analysis include critical race theory and humor theory. The results of the analysis reveal that the use of humor in this book is influenced to a significant degree by race and…
Making IBM's Computer, Watson, Human
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial “self,” are all incidental to its humanity. PMID:22942530
Making IBM's Computer, Watson, Human.
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial "self," are all incidental to its humanity.
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.
Cubero, Elena; Luque, F Javier; Orozco, Modesto
2006-02-01
A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2006-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814
Replication infidelity via a mismatch with Watson-Crick geometry.
Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A
2011-02-01
In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.
ERIC Educational Resources Information Center
Detterman, Douglas K.
2011-01-01
Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…
ERIC Educational Resources Information Center
Barker, Jani L.
2010-01-01
Multiethnic children's literature addresses multiple audiences, providing different reading experiences and benefits for each. Using critical race theory as an interpretive tool, this article examines how two African American historical fiction novels, Mildred Taylor's "Roll of Thunder, Hear My Cry" and Christopher Paul Curtis's "The Watsons Go to…
James Craig Watson (1838-1880)
NASA Astrophysics Data System (ADS)
Broughton, Peter
1996-04-01
Canadians feel a bittersweet pride when young people leave to make their fame and fortune in the United States. The life of the eminent nineteenth century astronomer, J. C. Watson, is another example from history that our brightest and best emigrate when educational and career opportunities are lacking at home.
Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.
Digdon, Nancy; Powell, Russell A; Harris, Ben
2014-11-01
In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.
NASA Astrophysics Data System (ADS)
Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker
2001-04-01
Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.
Morari, Cristian; Bogdan, Diana; Muntean, Cristina M
2012-11-01
The binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. The calculations were carried out on Watson-Crick and Hoogsteen configurations of the base pairs. We have found, that in Watson-Crick configuration, the metal is coordinated to N7 atom of guanine while, in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen structures. Our results show that the vibrational amplitudes of metallic atoms are strong for wavenumbers lower than 600 cm⁻¹. Also, we predict that the distinction between Watson-Crick and Hoogsteen configurations can be seen around 85, 170 and 310 cm⁻¹.
Oncologists partner with Watson on genomics.
2015-08-01
A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.
John B. Watson's Alleged Sex Research: An Appraisal of the Evidence
ERIC Educational Resources Information Center
Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.
2007-01-01
In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…
Some Lady! A Conversation with Dorothy Watson, Outstanding Educator in the Language Arts.
ERIC Educational Resources Information Center
Bishop, Rudine Sims
2002-01-01
Presents a conversation with Dorothy Watson, the 2002 Outstanding Educator in the Language Arts recipient. Hopes that this profile will provide insight into Dorothy Watson and her intellectual foundations, her humaneness, and her passion for teaching and learning. (SG)
Discovering Watson's Crick in High School Chemistry.
ERIC Educational Resources Information Center
Whitman, Mark
1984-01-01
High school chemistry students begin the school year by reading and studying "The Double Helix" by James B. Watson. Rationale, objectives, and instructional strategies for this assignment are discussed. Sample discussion questions based on the book are included. (JN)
Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D
2004-09-28
Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.
78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-20
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-25
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-11-13
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-06-04
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
Watson, Swellengrebel and species sanitation: environmental and ecological aspects.
Bradley, D J
1994-08-01
Following the discovery of mosquito transmission of malaria, the theory and practice of malaria control by general and selective removal of specific vector populations resulted particularly from Malcolm Watson's empirical work in peninsular Malaysia, first in the urban and peri-urban areas of Klang and Port Swettenham and subsequently in the rural rubber plantations, and from the work of N.H. Swellengrebel in nearby Indonesia on the taxonomy, ecology and control of anophelines. They developed the concept of species sanitation: the selective modification of the environment to render a particular anopheline of no importance as a vector in a particular situation. The lack of progress along these lines in India at that time is contrasted with that in south-east Asia. The extension of species sanitation and related concepts to other geographical areas and to other vector-borne disease situations is outlined.
James E. Watson, Jr.: Named to the Health Physics Society
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strom, Daniel J.; Stansbury, Paul S.
At its 2010 Annual Meeting, the Health Physics Society named James E. Watson, Jr. to its Honor Roll of distinguished members. This citation summarizes Professor Jim Watson's life and professional career at the University of North Carolina at Chapel Hill, where he led the Radiological Hygiene program in the School of Public Health for nearly 3 decades. He was President of the Health Physics Society during the 1985-1986 term. He did pioneering work in radiation dose reconstruction for epidemiology as part of the U.S. Department of Energy Health and Mortality Studies.
Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.
Doyle-Lindrud, Susan
2015-02-01
IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.
Validating the Watson Glaser Critical Thinking Appraisal
ERIC Educational Resources Information Center
Hassan, Karma El; Madhum, Ghida
2007-01-01
This study validated the Watson Glaser Critical Thinking Appraisal (WGCTA) on a sample of 273 private university students in Lebanon. For that purpose, evidence for construct validation was investigated through identifying the test's factor structure and subscale total correlations, in addition to differences in scores by gender, different levels,…
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
NASA Astrophysics Data System (ADS)
Xu, Ruirui; Ma, Zhongyu; Muether, Herbert; van Dalen, E. N. E.; Liu, Tinjin; Zhang, Yue; Zhang, Zhi; Tian, Yuan
2017-09-01
A relativistic microscopic optical model potential, named CTOM, for nucleon-nucleus scattering is investigated in the framework of Dirac-Brueckner-Hartree-Fock approach. The microscopic feature of CTOM is guaranteed through rigorously adopting the isospin dependent DBHF calculation within the subtracted T matrix scheme. In order to verify its prediction power, a global study n, p+ A scattering are carried out. The predicted scattering observables coincide with experimental data within a good accuracy over a broad range of targets and a large region of energies only with two free items, namely the free-range factor t in the applied improved local density approximation and minor adjustments of the scalar and vector potentials in the low-density region. In addition, to estimate the uncertainty of the theoretical results, the deterministic simple least square approach is preliminarily employed to derive the covariance of predicted angular distributions, which is also briefly contained in this paper.
Watson for Genomics: Moving Personalized Medicine Forward.
Rhrissorrakrai, Kahn; Koyama, Takahiko; Parida, Laxmi
2016-08-01
The confluence of genomic technologies and cognitive computing has brought us to the doorstep of widespread usage of personalized medicine. Cognitive systems, such as Watson for Genomics (WG), integrate massive amounts of new omic data with the current body of knowledge to assist physicians in analyzing and acting on patient's genomic profiles. Copyright © 2016 Elsevier Inc. All rights reserved.
Charlton, Bruce G
2008-01-01
In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and
20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. ...
20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. Gary Stich, operator. - Juniata Shops, Erecting Shop & Machine Shop, East of Fourth Avenue, between Fourth & Fifth Streets, Altoona, Blair County, PA
Creating Healing Environments Through the Theory of Caring.
Norman, Vivian; Rossillo, Kim; Skelton, Katie
2016-11-01
We describe the journey of personnel at one hospital to create a healing environment for patients and staff members at all levels through the implementation of Watson's Theory of Human Caring and her Caritas Processes (ie, loving kindness, authentic presence, spirituality, being the environment, believing in miracles). We used experiential teaching and learning to explore the nursing theory with staff members. Positive outcomes include using Caritas Processes care plans in our electronic medical record, greater ease in the understanding and application of Watson's theory, integrating a blessing for nurses during National Nurses Week, inclusion of ministry formation courses to extend the mission of the hospital's founding religious order to current and future employees, and positive patient feedback. As a result of theory application, our nurses are more open to discussing caring, authentic presence and, when appropriate, prayer in their clinical narratives and how it is affecting patients and themselves. Copyright © 2016 AORN, Inc. Published by Elsevier Inc. All rights reserved.
Falk-Rafael, Adeline
2005-01-01
Critical caring is proposed as a hybrid, midrange theory that builds on nursing science and critical feminist theories. As such, it has the potential to root public health nursing practice in an expanded nursing caring science that reincorporates the social justice agenda characteristic of early public health nursing practice but not featured prominently in contemporary nursing theories. Critical caring transforms the carative processes of Watson's theory into 7 carative health-promoting processes that form the "core" of public health nursing practice and reflect the legacy and reality of public health nursing practice.
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.
Chen, Ying; Elenee Argentinis, J D; Weber, Griff
2016-04-01
Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Annual Quality Assurance Conference Files by Nicola Watson and Rui Li
26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li
A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.
Sawada, Tomohisa; Fujita, Makoto
2010-05-26
Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.
Watson: A new link in the IIE iron chain
NASA Technical Reports Server (NTRS)
Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence
1994-01-01
Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Yusupov, Marat; Yusupova, Gulnara
2014-01-01
The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524
NASA Astrophysics Data System (ADS)
Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.
2017-12-01
Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as
Portrait of a discovery. Watson, Crick, and the double helix.
de Chadarevian, Soraya
2003-03-01
This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Corral, Álvaro; Garcia-Millan, Rosalba; Font-Clos, Francesc
2016-01-01
The theory of finite-size scaling explains how the singular behavior of thermodynamic quantities in the critical point of a phase transition emerges when the size of the system becomes infinite. Usually, this theory is presented in a phenomenological way. Here, we exactly demonstrate the existence of a finite-size scaling law for the Galton-Watson branching processes when the number of offsprings of each individual follows either a geometric distribution or a generalized geometric distribution. We also derive the corrections to scaling and the limits of validity of the finite-size scaling law away the critical point. A mapping between branching processes and random walks allows us to establish that these results also hold for the latter case, for which the order parameter turns out to be the probability of hitting a distant boundary. PMID:27584596
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
NASA Astrophysics Data System (ADS)
Jang, Sa-Han
Galton-Watson branching processes of relevance to human population dynamics are the subject of this thesis. We begin with an historical survey of the invention of the invention of this model in the middle of the 19th century, for the purpose of modelling the extinction of unusual surnames in France and Britain. We then review the principal developments and refinements of this model, and their applications to a wide variety of problems in biology and physics. Next, we discuss in detail the case where the probability generating function for a Galton-Watson branching process is a geometric series, which can be summed in closed form to yield a fractional linear generating function that can be iterated indefinitely in closed form. We then describe the matrix method of Keyfitz and Tyree, and use it to determine how large a matrix must be chosen to model accurately a Galton-Watson branching process for a very large number of generations, of the order of hundreds or even thousands. Finally, we show that any attempt to explain the recent evidence for the existence thousands of generations ago of a 'mitochondrial Eve' and a 'Y-chromosomal Adam' in terms of a the standard Galton-Watson branching process, or indeed any statistical model that assumes equality of probabilities of passing one's genes to one's descendents in later generations, is unlikely to be successful. We explain that such models take no account of the advantages that the descendents of the most successful individuals in earlier generations enjoy over their contemporaries, which must play a key role in human evolution.
Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.
Müller, Andreas; Frey, Jann A; Leutwyler, Samuel
2005-06-16
The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 <-- S0 vibronic spectra of 2PY.U, 2PY.3MU, 2PY.1MU, and 2PY.T were measured using UV laser resonant two-photon ionization (R2PI). The spectra of the Watson-Crick and wobble isomers of 2PY.1MU were separated using UV-UV spectral hole-burning. We identify the different isomers by combining three different diagnostic tools: (1) Selective methylation of the uracil N3-H group, which allows formation of the sugar-edge isomer only, and methylation of the N1-H group, which leads to formation of the Watson-Crick and wobble isomers. (2) The experimental S1 <-- S0 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-06-21
Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)<-->A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics
2016-01-01
Background We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. Objective To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. Methods The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Results Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.
Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita
2016-10-11
We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix
Watson-Glaser Critical Thinking Appraisal, Form-S for Education Majors
ERIC Educational Resources Information Center
Gadzella, Bernadette M.; Stacks, James; Stephens, Rebecca C.; Masten, William G.
2005-01-01
The purpose of this study was to investigate whether the Watson-Glaser Critical Thinking Appraisal-Form S was a reliable and valid instrument to measure critical thinking for students pursuing a teacher career. The participants were 137 students enrolled in Educational Psychology. The data showed that the alpha for the total WGTA-FS was 0.76 and…
Some theoretical aspects of boundary layer stability theory
NASA Technical Reports Server (NTRS)
Hall, Philip
1990-01-01
Increased understanding in recent years of boundary layer transition has been made possible by the development of strongly nonlinear stability theories. After some twenty or so years when nonlinear stability theory was restricted to the application of the Stuart-Watson method (or less formal amplitude expansion procedures), there now exist strongly nonlinear theories which can describe processes which have an 0(1) effect on the basic state. These strongly nonlinear theories and their possible role in pushing theoretical understanding of transition ever further into the nonlinear regime are discussed.
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B
2018-01-01
Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P < .001). Despite the high correlation, the Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
Applications of the Galton Watson process to human DNA evolution and demography
NASA Astrophysics Data System (ADS)
Neves, Armando G. M.; Moreira, Carlos H. C.
2006-08-01
We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton-Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman Nbar is constrained to a small range depending on the probability p that a child is a female. Assuming that the value p≈0.488 valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable probability is 2.0492
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
ERIC Educational Resources Information Center
Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.
2010-01-01
The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…
Charlton, Bruce G
2008-01-01
Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.
Finding Little Albert: A Journey to John B. Watson's Infant Laboratory
ERIC Educational Resources Information Center
Beck, Hall P.; Levinson, Sharman; Irons, Gary
2009-01-01
In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…
Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert
2018-02-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.
Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius
2018-07-01
A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that
Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York
IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti
Caplan, R M
1982-06-01
The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.
ERIC Educational Resources Information Center
Hicks, R. E.; Southey, G. N.
1990-01-01
The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)
Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering
NASA Astrophysics Data System (ADS)
Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.
2017-06-01
The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson
Flood Plain Information, Mill, Watson, and Lahaska Creeks, Bucks County, Pennsylvania.
1975-05-01
AD-AIOI 592 ARENGINEER DISTRICT PHI LADELPHIA P A F/6 8/8 T7LOOD PLAIN INFORMATION, MIL , WATSON, AND LAI4ASKA CREEKS, SUCK-’ETCIU) UNCLASSIFIED...will be iu LblckW V’ A PREPARED FOR THE BUCKS COUNTY PLANNING COMMISSION p BY CORPS OF ENGINEERS, U.S. ARMY PHILADELPHIA DISTRICT MAY 975 8 1 7 20 055...No. 4655 at Langhorne , Pennsylvania) ..... ................. 8 3 Peak Flows for the Intermediate Regional and Standard Project Floods
James Watson's most inconvenient truth: race realism and the moralistic fallacy.
Rushton, J Philippe; Jensen, Arthur R
2008-11-01
Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.
Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru
2010-06-15
The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.
Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre
2012-01-01
The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274
NASA Astrophysics Data System (ADS)
Sheehan, William
1996-05-01
The first director of the Washburn Observatory, Watson began his career at the University of Michigan, where he discovered more than a score of asteroids and planned (but did not live to carry out) the first search for a trans-Neptunian planet. He became a strong supporter of Le Verrier's hypothesis that a planet closer to the Sun than Mercury (Vulcan) was causing the anomalous advance of 38" of arc per century of Mercury's perihelion, and mounted a special search for Vulcan at the July 29, 1878 total eclipse, at Separation, Wyoming, recording two strange reddish stars near the Sun which he assumed were intra-Mercurial bodies. With the exception of Lewis Swift at Denver, Colorado, no one else confirmed his observations, and they were sharply criticized by Clinton College (New York) astronomer C. H. F. Peters. Nevertheless, Watson remained absolutely convinced of what he had seen, and his move from Ann Arbor to Madison in 1879 was partly motivated by the prospects of obtaining better instruments with which to further his search for Vulcan, which became the obsession of his later years. He was in the process of constructing an underground solar observatory from which he hoped to see stars near the Sun in broad daylight when he died, unexpectedly, in 1880. Though it is now known that Vulcan does not exist, Watson's observations at the July 1878 eclipse remain problematic; it is probable that he observed at least one and possibly two pygmy comets in the neighborhood of the Sun.
The ϱ-ππ coupling constant in lattice gauge theory
NASA Astrophysics Data System (ADS)
Gottlieb, Steven; MacKenzie, Paul B.; Thacker, H. B.; Weingarten, Don
1984-01-01
We present a method for studying hadronic transitions in lattice gauge theory which requires computer time comparable to that required by recent hadron spectrum calculations. This method is applied to a calculation of the decay ϱ-->ππ. On leave from the Department of Physics, Indiana University, Bloomington, IN 47405, USA. Address after September 1, 1983: IBM, T.J. Watson Research Center, Yorktown Heights, NY 10598, USA.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Pipe, Teresa Britt
2008-01-01
Sustained, high-performance nursing leadership can be effectively guided by caring theory. While much of leadership performance is manifested by external behaviors, highly effective leaders are also grounded by internal work of self-reflection and growth. This article focuses primarily on the inward journey of leadership as guided by Jean Watson's Theory of Human Caring. Key elements of the theory are interpreted within the context of the emerging, urgent, high-stakes challenges of the current healthcare environment. The links between self-nurturance and caring-healing leadership of others are explored.
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan
2015-09-01
Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.
Kottemann, Molly C; Smogorzewska, Agata
2013-01-17
The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.
NASA Astrophysics Data System (ADS)
Tait, Alastair W.; Tomkins, Andrew G.; Godel, Bélinda M.; Wilson, Siobhan A.; Hasalova, Pavlina
2014-06-01
Despite the fact that the number of officially classified meteorites is now over 45,000, we lack a clearly defined sequence of samples from a single parent body that records the entire range in metamorphic temperatures from pristine primitive meteorites up to the temperatures required for extensive silicate partial melting. Here, we conduct a detailed analysis of Watson 012, an H7 ordinary chondrite, to generate some clarity on the textural and chemical changes associated with equilibrium-based silicate partial melting in chondritic meteorites. To do this we compare the textures in the meteorite with those preserved in metamorphic contact aureoles on Earth. The most distinctive texture generated by the partial melting that affected Watson 012 is an extensively interconnected plagioclase network, which is clearly observable with a petrographic microscope. Enlarged metal-troilite grains are encapsulated at widenings in this plagioclase network, and this is clearly visible in reflected light. Together with these features, we define a series of other characteristics that can be used to more clearly classify chondritic meteorites as being of petrologic Type 7. To provide comprehensive evidence of silicate partial melting and strengthen the case for using simple petrographic observations to classify similar meteorites, we use high-resolution X-ray computed tomography to demonstrate that the plagioclase network has a high degree of interconnectedness and crystallised as large (cm-scale) skeletal crystals within an olivine-orthopyroxene-clinopyroxene framework, essentially pseudomorphing a melt network. Back-scattered electron imaging and element mapping are used to show that some of the clino- and orthopyroxene in Watson 012 also crystallised from silicate melt, and the order of crystallisation was orthopyroxene → clinopyroxene → plagioclase. X-ray diffraction data, supported by bulk geochemistry, are used to show that plagioclase and ortho- and clinopyroxene were
Is Watson's ``CHARGE-MODIFIED'' Reduced Mass always best for Diatomic Ions ?
NASA Astrophysics Data System (ADS)
Le Roy, Robert J.; Dattani, Nikesh S.
2016-06-01
Watson's landmark reformulation of the Born-Oppenheimer separation problem has been the basis of most combined-isotopologue analyses of diatomic spectroscopic data since 1980. One noteworthy feature of this work was his proposal that description of the dynamical behaviour of a diatomic ion with (±) charge Q, formed from atoms with isotopic masses of M_1 and M_2, should use a ``charge-modified'' reduced mass: μWat≡ M_1 M_2 /(M_1 + M_2 - Q m_e) , in which m_e is the electron mass, and this proposal seems to have been benignly accepted and adopted. The first quantitative test of this proposal was in the pioneering combined-isotopologue direct-potential-fit (CI-DPF) study of HeH^+ by Coxon and Hajigeorgiou in 1999, where they compared the quality of fit for analyses that used different choices for the definition of the reduced masses of the various isotopologues, and found that the best choice seemed to be to use conventional two-body reduced masses for (M_1 - 1/2 m_e) and (M_2 - 1/2 m_e ). This question was re-examined recently in the context of a CI-DPF study of CH^+, and a rather different conclusion was reached. The present paper combines new CI-DPF studies of HeH^+ and BeH^+ with our recent CH^+ work, and attempts to draw some general conclusions on this matter. J.K.G. Watson, J. Mol. Spectrosc. 80, 411 (1980) J.A. Coxon and P. Hajigeorgiou, J. Mol. Spectrosc. 193, 306 (1999). Y.-S. Cho and R.J. Le Roy, J. Chem. Phys. 144, 024311 (2016)
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Jović, Ozren
2016-12-15
A novel method for quantitative prediction and variable-selection on spectroscopic data, called Durbin-Watson partial least-squares regression (dwPLS), is proposed in this paper. The idea is to inspect serial correlation in infrared data that is known to consist of highly correlated neighbouring variables. The method selects only those variables whose intervals have a lower Durbin-Watson statistic (dw) than a certain optimal cutoff. For each interval, dw is calculated on a vector of regression coefficients. Adulteration of cold-pressed linseed oil (L), a well-known nutrient beneficial to health, is studied in this work by its being mixed with cheaper oils: rapeseed oil (R), sesame oil (Se) and sunflower oil (Su). The samples for each botanical origin of oil vary with respect to producer, content and geographic origin. The results obtained indicate that MIR-ATR, combined with dwPLS could be implemented to quantitative determination of edible-oil adulteration. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geltman, S.
Recent measurements on CO{sub 2}-laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for {ital E}{sub 0}/2{omega}{sup 2}{lt}1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations inmore » perturbation theory shows that use of the {open_quote}{open_quote}outgoing{close_quote}{close_quote} wave final state gives much better agreement with experiment than does the {open_quote}{open_quote}ingoing{close_quote}{close_quote} wave final state, which is different from the choice made in early bremsstrahlung theory. {copyright} {ital 1996 The American Physical Society.}« less
Hagemann, Rudolf
2007-01-01
At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
ERIC Educational Resources Information Center
Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.
2014-01-01
The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…
Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian
2011-12-01
We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.
Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A
2011-03-07
Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
ERIC Educational Resources Information Center
Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian
2014-01-01
In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.
Many-body-theory study of lithium photoionization
NASA Technical Reports Server (NTRS)
Chang, T. N.; Poe, R. T.
1975-01-01
A detailed theoretical calculation is carried out for the photoionization of lithium at low energies within the framework of Brueckner-Goldstone perturbational approach. In this calculation extensive use is made of the recently developed multiple-basis-set technique. Through this technique all second-order perturbation terms, plus a number of important classes of terms to infinite order, have been taken into account. Analysis of the results enables one to resolve the discrepancies between two previous works on this subject. The detailed calculation also serves as a test on the convergence of the many-body perturbation-expansion approach.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
The Towers Watson Approach to Improving Corporate Wellness.
Wootton, Adam
2012-06-01
Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.
Covariant density functional theory: predictive power and first attempts of a microscopic derivation
NASA Astrophysics Data System (ADS)
Ring, Peter
2018-05-01
We discuss systematic global investigations with modern covariant density functionals. The number of their phenomenological parameters can be reduced considerable by using microscopic input from ab-initio calculations in nuclear matter. The size of the tensor force is still an open problem. Therefore we use the first full relativistic Brueckner-Hartree-Fock calculations in finite nuclear systems in order to study properties of such functionals, which cannot be obtained from nuclear matter calculations.
Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration
NASA Technical Reports Server (NTRS)
Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell
2018-01-01
Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.
Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho
2018-04-01
Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was
Development of a New Critical Thinking Test Using Item Response Theory
ERIC Educational Resources Information Center
Wagner, Teresa A.; Harvey, Robert J.
2006-01-01
The authors describe the initial development of the Wagner Assessment Test (WAT), an instrument designed to assess critical thinking, using the 5-faceted view popularized by the Watson-Glaser Critical Thinking Appraisal (WGCTA; G. B. Watson & E. M. Glaser, 1980). The WAT was designed to reduce the degree of successful guessing relative to the…
The development of ensemble theory. A new glimpse at the history of statistical mechanics
NASA Astrophysics Data System (ADS)
Inaba, Hajime
2015-12-01
This paper investigates the history of statistical mechanics from the viewpoint of the development of the ensemble theory from 1871 to 1902. In 1871, Ludwig Boltzmann introduced a prototype model of an ensemble that represents a polyatomic gas. In 1879, James Clerk Maxwell defined an ensemble as copies of systems of the same energy. Inspired by H.W. Watson, he called his approach "statistical". Boltzmann and Maxwell regarded the ensemble theory as a much more general approach than the kinetic theory. In the 1880s, influenced by Hermann von Helmholtz, Boltzmann made use of ensembles to establish thermodynamic relations. In Elementary Principles in Statistical Mechanics of 1902, Josiah Willard Gibbs tried to get his ensemble theory to mirror thermodynamics, including thermodynamic operations in its scope. Thermodynamics played the role of a "blind guide". His theory of ensembles can be characterized as more mathematically oriented than Einstein's theory proposed in the same year. Mechanical, empirical, and statistical approaches to foundations of statistical mechanics are presented. Although it was formulated in classical terms, the ensemble theory provided an infrastructure still valuable in quantum statistics because of its generality.
Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane
2013-11-01
William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.
Low-density homogeneous symmetric nuclear matter: Disclosing dinucleons in coexisting phases
NASA Astrophysics Data System (ADS)
Arellano, Hugo F.; Delaroche, Jean-Paul
2015-01-01
The effect of in-medium dinucleon bound states on self-consistent single-particle fields in Brueckner, Bethe and Goldstone theory is investigated in symmetric nuclear matter at zero temperature. To this end, dinucleon bound state occurences in the 1 S 0 and 3 SD 1 channels are explicitly accounted for --within the continuous choice for the auxiliary fields-- while imposing self-consistency in Brueckner-Hartree-Fock approximation calculations. Searches are carried out at Fermi momenta in the range fm-1, using the Argonne bare nucleon-nucleon potential without resorting to the effective-mass approximation. As a result, two distinct solutions meeting the self-consistency requirement are found with overlapping domains in the interval 0.130 fm-1 0.285 fm-1, corresponding to mass densities between and g cm-3. Effective masses as high as three times the nucleon mass are found in the coexistence domain. The emergence of superfluidity in relationship with BCS pairing gap solutions is discussed.
Srivastava, Ruby
2018-03-01
We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.
USDA-ARS?s Scientific Manuscript database
Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...
Algebraic Methods to Design Signals
2015-08-27
sequence pairs with optimal correlation values. 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially balanced incomplete block designs with two...IEEE Transactions Information Theory, Volume: 58, Issue: 11, Nov 2012, Page(s): 6968 – 6978 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-01-01
The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied
Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.
Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A
2017-11-16
Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.
Momentum-resolved spectroscopy of a Fermi liquid
Doggen, Elmer V. H.; Kinnunen, Jami J.
2015-01-01
We consider a recent momentum-resolved radio-frequency spectroscopy experiment, in which Fermi liquid properties of a strongly interacting atomic Fermi gas were studied. Here we show that by extending the Brueckner-Goldstone model, we can formulate a theory that goes beyond basic mean-field theories and that can be used for studying spectroscopies of dilute atomic gases in the strongly interacting regime. The model hosts well-defined quasiparticles and works across a wide range of temperatures and interaction strengths. The theory provides excellent qualitative agreement with the experiment. Comparing the predictions of the present theory with the mean-field Bardeen-Cooper-Schrieffer theory yields insights into the role of pair correlations, Tan's contact, and the Hartree mean-field energy shift. PMID:25941948
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.
STRUCTURES OF THE VELA PULSAR AND THE GLITCH CRISIS FROM THE BRUECKNER THEORY
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, A.; Dong, J. M.; Wang, J. B.
Detailed structures of the Vela pulsar (PSR B0833-45, with a period of 89.33 ms) are predicted by adopting a recently constructed unified treatment of all parts of neutron stars: the outer crust, the inner crust, and the core based on modern microscopic Brueckner–Hartree–Fock calculations. Taking a pulsar mass in the range from 1.0 to 2.0 M{sub ⊙}, we calculate the central density, the core/crust radii, the core/crustal mass, the core/crustal thickness, the moment of inertia, and the crustal moment of inertia. Among them, the crustal moment of inertia could be effectively constrained from the accumulated glitch observations, which has been a great debate recently, knownmore » as the “glitch crisis.” Namely, superfluid neutrons contained in the inner crust, which are regarded as the origin of the glitch in the standard two-component model, could be largely entrained in the nuclei lattices, and then there may not be enough superfluid neutrons (∼4/5 less than the previous value) to trigger the large glitches (Δν/ν{sub 0} ∼ 10{sup −6}) in the Vela pulsar. By confronting the glitch observations with the theoretical calculations for the crustal moment of inertia, we find that despite some recent opposition to the crisis argument, the glitch crisis is still present, which means that besides the crustal superfluid neutrons, core neutrons might be necessary for explaining the large glitches of the Vela pulsar.« less
Principle-based concept analysis: intentionality in holistic nursing theories.
Aghebati, Nahid; Mohammadi, Eesa; Ahmadi, Fazlollah; Noaparast, Khosrow Bagheri
2015-03-01
This is a report of a principle-based concept analysis of intentionality in holistic nursing theories. A principle-based concept analysis method was used to analyze seven holistic theories. The data included eight books and 31 articles (1998-2011), which were retrieved through MEDLINE and CINAHL. Erickson, Kriger, Parse, Watson, and Zahourek define intentionality as a capacity, a focused consciousness, and a pattern of human being. Rogers and Newman do not explicitly mention intentionality; however, they do explain pattern and consciousness (epistemology). Intentionality has been operationalized as a core concept of nurse-client relationships (pragmatic). The theories are consistent on intentionality as a noun and as an attribute of the person-intentionality is different from intent and intention (linguistic). There is ambiguity concerning the boundaries between intentionality and consciousness (logic). Theoretically, intentionality is an evolutionary capacity to integrate human awareness and experience. Because intentionality is an individualized concept, we introduced it as "a matrix of continuous known changes" that emerges in two forms: as a capacity of human being and as a capacity of transpersonal caring. This study has produced a theoretical definition of intentionality and provides a foundation for future research to further investigate intentionality to better delineate its boundaries. © The Author(s) 2014.
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
Rumor Processes in Random Environment on and on Galton-Watson Trees
NASA Astrophysics Data System (ADS)
Bertacchi, Daniela; Zucca, Fabio
2013-11-01
The aim of this paper is to study rumor processes in random environment. In a rumor process a signal starts from the stations of a fixed vertex (the root) and travels on a graph from vertex to vertex. We consider two rumor processes. In the firework process each station, when reached by the signal, transmits it up to a random distance. In the reverse firework process, on the other hand, stations do not send any signal but they “listen” for it up to a random distance. The first random environment that we consider is the deterministic 1-dimensional tree with a random number of stations on each vertex; in this case the root is the origin of . We give conditions for the survival/extinction on almost every realization of the sequence of stations. Later on, we study the processes on Galton-Watson trees with random number of stations on each vertex. We show that if the probability of survival is positive, then there is survival on almost every realization of the infinite tree such that there is at least one station at the root. We characterize the survival of the process in some cases and we give sufficient conditions for survival/extinction.
Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
NASA Astrophysics Data System (ADS)
Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq
2018-04-01
This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.
Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M
2017-12-20
This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.
Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.
Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J
2013-04-18
Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Single-Stranded γPNAs for In Vivo Site-Specific Genome Editing via Watson-Crick Recognition
Bahal, Raman; Quijano, Elias; McNeer, Nicole Ali; Liu, Yanfeng; Bhunia, Dinesh C.; López-Giráldez, Francesco; Fields, Rachel J.; Saltzman, W. Mark; Ly, Danith H.; Glazer, Peter M.
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction. PMID:25174576
Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.
Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki
2015-12-02
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Neutron Diffraction Investigations of Magnetism in BiFeO3 Epitaxial Films
2011-01-01
magnetism;epitaxial thin film;BiFeO3 Daisuke Kan, Wangchun Chen, Shannon Watson, Songxue Chi, Ross Erwin, Garry J. McIntyre, Sylvia C. Capelli, William ...Weinheim 1567wileyonlinelibrary.comAdv. Funct. Mater. 2011, 21, 1567–1574 William Ratcliff II , * Daisuke Kan , * Wangchun Chen , Shannon Watson...15 ] S. W. Lovesey , Theory of Neutron Scattering from Condensed Matter vol. 2 Oxford , New York , 1984 . [ 16 ] W. Gavin Williams
Graduate nurse internship program: a formalized orientation program.
Phillips, Tracy; Hall, Mellisa
2014-01-01
The graduate nurse internship program was developed on the basis of Watson's Human Caring Theory. In this article, the author discusses how an orientation program was formalized into an internship program and how the theory was applied.
Thomas, Michael L
2012-03-01
There is growing evidence that psychiatric disorders maintain hierarchical associations where general and domain-specific factors play prominent roles (see D. Watson, 2005). Standard, unidimensional measurement models can fail to capture the meaningful nuances of such complex latent variable structures. The present study examined the ability of the multidimensional item response theory bifactor model (see R. D. Gibbons & D. R. Hedeker, 1992) to improve construct validity by serving as a bridge between measurement and clinical theories. Archival data consisting of 688 outpatients' psychiatric diagnoses and item-level responses to the Brief Symptom Inventory (BSI; L. R. Derogatis, 1993) were extracted from files at a university mental health clinic. The bifactor model demonstrated superior fit for the internal structure of the BSI and improved overall diagnostic accuracy in the sample (73%) compared with unidimensional (61%) and oblique simple structure (65%) models. Consistent with clinical theory, multiple sources of item variance were drawn from individual test items. Test developers and clinical researchers are encouraged to consider model-based measurement in the assessment of psychiatric distress.
NASA Astrophysics Data System (ADS)
Hey, J. D.
2014-08-01
As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean-Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon-Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n‧ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound-bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521, Ali
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So
NASA Astrophysics Data System (ADS)
Bombaci, Ignazio; Logoteta, Domenico
2018-02-01
Aims: We report a new microscopic equation of state (EOS) of dense symmetric nuclear matter, pure neutron matter, and asymmetric and β-stable nuclear matter at zero temperature using recent realistic two-body and three-body nuclear interactions derived in the framework of chiral perturbation theory (ChPT) and including the Δ(1232) isobar intermediate state. This EOS is provided in tabular form and in parametrized form ready for use in numerical general relativity simulations of binary neutron star merging. Here we use our new EOS for β-stable nuclear matter to compute various structural properties of non-rotating neutron stars. Methods: The EOS is derived using the Brueckner-Bethe-Goldstone quantum many-body theory in the Brueckner-Hartree-Fock approximation. Neutron star properties are next computed solving numerically the Tolman-Oppenheimer-Volkov structure equations. Results: Our EOS models are able to reproduce the empirical saturation point of symmetric nuclear matter, the symmetry energy Esym, and its slope parameter L at the empirical saturation density n0. In addition, our EOS models are compatible with experimental data from collisions between heavy nuclei at energies ranging from a few tens of MeV up to several hundreds of MeV per nucleon. These experiments provide a selective test for constraining the nuclear EOS up to 4n0. Our EOS models are consistent with present measured neutron star masses and particularly with the mass M = 2.01 ± 0.04 M⊙ of the neutron stars in PSR J0348+0432.
Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.
Zenk, John; Tuntivate, Chanon; Schulman, Rebecca
2016-03-16
We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).
Problematic p-benzyne: Orbital instabilities, biradical character, and broken symmetry
NASA Astrophysics Data System (ADS)
Crawford, T. Daniel; Kraka, Elfi; Stanton, John F.; Cremer, Dieter
2001-06-01
The equilibrium geometry, harmonic vibrational frequencies, and infrared transition intensities of p-benzyne were calculated at the MBPT(2), SDQ-MBPT(4), CCSD, and CCSD(T) levels of theory using different reference wave functions obtained from restricted and unrestricted Hartree-Fock (RHF and UHF), restricted Brueckner (RB) orbital, and Generalized Valence Bond (GVB) theory. RHF erroneously describes p-benzyne as a closed-shell singlet rather than a singlet biradical, which leads to orbital near-instabilities in connection with the mixing of orbital pairs b1u-ag (HOMO-LUMO), b2g-ag (HOMO-1-LUMO), and b1g-ag (HOMO-2-LUMO). Vibrational modes of the corresponding symmetries cause method-dependent anomalous increases (unreasonable force constants and infrared intensities) or decreases in the energy (breaking of the D2h symmetry of the molecular framework of p-benzyne). This basic failure of the RHF starting function is reduced by adding dynamic electron correlation. However RHF-MBPT(2), RHF-SDQ-MBPT(4), RHF-CCSD, RB-CCD, and RHF-CCSD(T) descriptions of p-benzyne are still unreliable as best documented by the properties of the b1u-, b2g-, and b1g-symmetrical vibrational modes. The first reliable spin-restricted description is provided when using Brueckner orbitals at the RB-CCD(T) level. GVB leads to exaggerated biradical character that is reduced at the GVB-MP2 level of theory. The best results are obtained with a UHF reference wave function, provided a sufficient account of dynamic electron correlation is included. At the UHF-CCSD level, the triplet contaminant is completely annihilated. UHF-CCSD(T) gives a reliable account of the infrared spectrum apart from a CCH bending vibrational mode, which is still in disagreement with experiment.
Role modeling excellence in clinical nursing practice.
Perry, R N Beth
2009-01-01
Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.
Statement on nursing: a personal perspective.
McCutcheon, Tonna
2004-01-01
Contemporary nursing is based on a conglomerate of theoretical nursing models. These models each incorporate four central concepts: person, health, environment, and nursing. By defining these concepts, nurses develop an individual framework from which they base their nursing practice. As an aspiring nurse practitioner in the gastroenterology field, I have retrospectively assessed my personal definitions of person, health, environment, and nursing. From these definitions, I am able to incorporate specific theoretical frameworks into my personal belief system, thus formulating a basis for my nursing practice. This foundation is comprised of the influence of nursing theorists Jean Watson, Sister Callista Roy, Kolcaba, Florence Nightingale, and Ida J. Orlando; the Perioperative Patient-Focused Model; Watson's Theory of Human Caring; theories regarding transpersonal human caring and healing; and feminist theories. Therefore, this article describes self-examination of nursing care by defining central nursing concepts, acknowledging the influence of nursing theorists and theories, and developing a personal framework from which I base my nursing practice.
Krasnoshchekov, Sergey V; Isayeva, Elena V; Stepanov, Nikolay F
2012-04-12
Anharmonic vibrational states of semirigid polyatomic molecules are often studied using the second-order vibrational perturbation theory (VPT2). For efficient higher-order analysis, an approach based on the canonical Van Vleck perturbation theory (CVPT), the Watson Hamiltonian and operators of creation and annihilation of vibrational quanta is employed. This method allows analysis of the convergence of perturbation theory and solves a number of theoretical problems of VPT2, e.g., yields anharmonic constants y(ijk), z(ijkl), and allows the reliable evaluation of vibrational IR and Raman anharmonic intensities in the presence of resonances. Darling-Dennison and higher-order resonance coupling coefficients can be reliably evaluated as well. The method is illustrated on classic molecules: water and formaldehyde. A number of theoretical conclusions results, including the necessity of using sextic force field in the fourth order (CVPT4) and the nearly vanishing CVPT4 contributions for bending and wagging modes. The coefficients of perturbative Dunham-type Hamiltonians in high-orders of CVPT are found to conform to the rules of equality at different orders as earlier proven analytically for diatomic molecules. The method can serve as a good substitution of the more traditional VPT2.
Smith, Troy A; Kimball, Daniel R
2012-01-01
Leading theories of false memory predict that veridical and false recall of lists of semantically associated words can be dissociated by varying the presentation speed during study. Specifically, as presentation rate increases from milliseconds to seconds, veridical recall is predicted to increase monotonically while false recall is predicted to show a rapid rise and then a slow decrease--a pattern shown by McDermott and Watson (2001) in a study using immediate recall tests. In three experiments we tested the generality of the effects of rapid presentation rates on veridical and false memory. In Experiments 1 and 2 participants exhibited high levels of false recall on a delayed recall test, even for very fast stimulus onset asynchronies (SOA)--contrary to predictions from leading theories of false memory. When we switched to an immediate recall test in Experiment 3 we replicated the pattern predicted by the theories and observed by McDermott and Watson. Follow-up analyses further showed that the relative output position of false recalls is not affected by presentation rate, contrary to predictions from fuzzy trace theory. Implications for theories of false memory, including activation monitoring theory and fuzzy trace theory, are discussed.
From the crust to the core of neutron stars on a microscopic basis
NASA Astrophysics Data System (ADS)
Baldo, M.; Burgio, G. F.; Centelles, M.; Sharma, B. K.; Viñas, X.
2014-09-01
Within a microscopic approach the structure of Neutron Stars is usually studied by modelling the homogeneous nuclear matter of the core by a suitable Equation of State, based on a many-body theory, and the crust by a functional based on a more phenomenological approach. We present the first calculation of Neutron Star overall structure by adopting for the core an Equation of State derived from the Brueckner-Hartree-Fock theory and for the crust, including the pasta phase, an Energy Density Functional based on the same Equation of State, and which is able to describe accurately the binding energy of nuclei throughout the mass table. Comparison with other approaches is discussed. The relevance of the crust Equation of State for the Neutron Star radius is particularly emphasised.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Spin symmetry in the Dirac sea derived from the bare nucleon-nucleon interaction
NASA Astrophysics Data System (ADS)
Shen, Shihang; Liang, Haozhao; Meng, Jie; Ring, Peter; Zhang, Shuangquan
2018-06-01
The spin symmetry in the Dirac sea has been investigated with relativistic Brueckner-Hartree-Fock theory using the bare nucleon-nucleon interaction. Taking the nucleus 16O as an example and comparing the theoretical results with the data, the definition of the single-particle potential in the Dirac sea is studied in detail. It is found that if the single-particle states in the Dirac sea are treated as occupied states, the ground state properties are in better agreement with experimental data. Moreover, in this case, the spin symmetry in the Dirac sea is better conserved and it is more consistent with the findings using phenomenological relativistic density functionals.
[Considering body ethics in the healthcare profession].
Wang, Shin-Yun
2014-10-01
This article uses the theory of body phenomenology and Watson's caring theory to develop and apply body ethics to the clinical healthcare profession. This attempt is meant to facilitate deep, humanistic experiences for healthcare personnel. The analysis of body phenomenology reveals that the soul is banished from her familiar and comfortable "at-home" status when illness and pain invade the body. In such situations, the body becomes an external object that is self-alienated. This experience induces experiences such as solitude and violence. However, it also holds the potential to expose the original morality of the body. Additionally, this article discusses popular tools used in clinical ethics such as principalism and virtual-based ethics, which are based on moral reasoning and moral feeling. In contrast to these, body ethics seek a more profound and humble level of sensibility that is able to implant authenticity into the ethics. Finally, we offer some suggestions related to Watson's caring theory.
Bandyopadhyay, D; Bhattacharyya, D
2006-10-15
It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tassabehji, M.; Strachan, T.; Colley, A.
Type 1 neurofibromatosis (NF1), Watson syndrome (WS), and Noonan syndrome (NS) show some overlap in clinical manifestations. In addition, WS has been shown to be linked to markers flanking the NF1 locus and a deletion at the NF1 locus demonstrated in a WS patient. This suggests either that WS and NF1 are allelic or the phenotypes arise from mutations in very closely linked genes. Here the authors provide evidence for the former by demonstrating a mutation in the NF1 gene in a family with features of both WS and NS. The mutation is an almost perfect in-frame tandem duplication ofmore » 42 bases in exon 28 of the NF1 gene. Unlike the mutations previously described in classical NF1, which show a preponderance of null alleles, the mutation in this family would be expected to result in a mutant neurofibromin product. 31 refs., 2 figs.« less
Contribution of transpersonal care to cardiac patients in the postoperative period of heart surgery.
Rabelo, Ana Cleide Silva; Souza, Fabíola Vládia Feire Silva; Silva, Lúcia de Fátima da
2018-06-07
To know the contribution of Watson's theory to nursing care for cardiac patients in the postoperative period of cardiac surgery. This is a qualitative study based on the research-care method conducted with ten patients who underwent cardiac surgery in a specialised hospital from June to August 2013, in the city of Fortaleza, Ceará, Brazil. Data were submitted to content analysis based on the Clinical Caritas Process. The results led to four thematic categories: Awareness of being cared for by another being, System of beliefs and subjectivity, Relation of support and trust, and Expression of feelings. Surgery transformed the lives of the patients related to the process of being cared for by other people. The application of Watson's theory to care for cardiac patients after heart surgery shed valuable light on the importance of transpersonal care for the expansion of nursing care.
Short-range correlations in carbon-12, oxygen-16, and neon-20: Intrinsic properties
NASA Technical Reports Server (NTRS)
Braley, R. C.; Ford, W. F.; Becker, R. L.; Patterson, M. R.
1972-01-01
The Brueckner-Hartree-Fock (BHF) method has been applied to nuclei whose intrinsic structure is nonspherical. Reaction matrix elements were calculated as functions of starting energy for the Hamada-Johnston interaction using the Pauli operator appropriate to O-16 and a shifted oscillator spectrum for virtual excited states. Binding energies, single particle energies, radii, and shape deformations of the intrinsic state, in ordinary as well as renormalized BHF, are discussed and compared with previous HF studies and with experiment when possible. Results are presented for C-12, 0-16 and Ne-20. It is found that the binding energies and radii are too small, but that separation energies are well reproduced when the renormalized theory is used.
Effect of liquid surface tension on circular and linear hydraulic jumps; theory and experiments
NASA Astrophysics Data System (ADS)
Bhagat, Rajesh Kumar; Jha, Narsing Kumar; Linden, Paul F.; Wilson, David Ian
2017-11-01
The hydraulic jump has attracted considerable attention since Rayleigh published his account in 1914. Watson (1964) proposed the first satisfactory explanation of the circular hydraulic jump by balancing the momentum and hydrostatic pressure across the jump, but this solution did not explain what actually causes the jump to form. Bohr et al. (1992) showed that the hydraulic jump happens close to the point where the local Froude number equals to one, suggesting a balance between inertial and hydrostatic contributions. Bush & Aristoff (2003) subsequently incorporated the effect of surface tension and showed that this is important when the jump radius is small. In this study, we propose a new account to explain the formation and evolution of hydraulic jumps under conditions where the jump radius is strongly influenced by the liquid surface tension. The theory is compared with experiments employing liquids of different surface tension and different viscosity, in circular and linear configurations. The model predictions and the experimental results show excellent agreement. Commonwealth Scholarship Commission, St. John's college, University of Cambridge.
Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B
2001-11-09
Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They
Macromolecules Vis-a-Vis the Traditions of Chemistry
ERIC Educational Resources Information Center
Flory, Paul J.
1973-01-01
Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…
Toward an effective field theory approach to reheating
NASA Astrophysics Data System (ADS)
Özsoy, Ogan; Giblin, John T.; Nesbit, Eva; Şengör, Gizem; Watson, Scott
2017-12-01
We investigate whether effective field theory (EFT) approaches, which have been useful in examining inflation and dark energy, can also be used to establish a systematic approach to inflationary reheating. We consider two methods. First, we extend Weinberg's background EFT to the end of inflation and reheating. We establish when parametric resonance and decay of the inflaton occurs, but also find intrinsic theoretical limitations, which make it difficult to capture some reheating models. This motivates us to next consider Cheung et al.'s EFT approach, which instead focuses on perturbations and the symmetry breaking induced by the cosmological background. Adapting the latter approach to reheating implies some new and important differences compared to the EFT of inflation. In particular, there are new hierarchical scales, and we must account for inflaton oscillations during reheating, which lead to discrete symmetry breaking. Guided by the fundamental symmetries, we construct the EFT of reheating, and as an example of its usefulness we establish a new class of reheating models and the corresponding predictions for gravity wave observations. In this paper we primarily focus on the first stages of preheating. We conclude by discussing challenges for the approach and future directions. This paper builds on ideas first proposed in the paper [O. Ozsoy, G. Sengor, K. Sinha, and S. Watson, arXiv:1507.06651.].
ERIC Educational Resources Information Center
Applin, Elizabeth Anne Gates
This study explored the relationship between assignment-based teaching methods and achievement in an introductory programming course. Subjects in the study were 42 community college students in south Mississippi. All participants completed the Watson-Glaser Critical Thinking Appraisal and the Productive Environment Preferences Survey. These…
ERIC Educational Resources Information Center
Zeeman, Roger D.
2006-01-01
This article presents and compares the similar views of William Glasser, M.D., founder and president of the William Glasser Institute in Los Angeles, and author of scores of best selling books; and William Watson Purkey, Ed.D, co-founder of the International Association for Invitational Education (IAIE), Professor Emeritus at the University of…
Alternative Watson-Crick Synthetic Genetic Systems.
Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia
2016-11-01
In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.
Computational Methods for Inviscid and Viscous Two-and-Three-Dimensional Flow Fields.
1975-01-01
Difference Equations Over a Network, Watson Sei. Comput. Lab. Report, 19U9. 173- Isaacson, E. and Keller, H. B., Analaysis of Numerical Methods...element method has given a new impulse to the old mathematical theory of multivariate interpolation. We first study the one-dimensional case, which
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Test of time: what if little Albert had escaped?
Field, Andy P; Nightingale, Zoë C
2009-04-01
Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him.
ERIC Educational Resources Information Center
Mori, Miki
2014-01-01
This study looks at how language ideologies affect and are revealed in language socialization practices in a majority-L1 adult ESL classroom, particularly looking at language use and policy. It draws on recent theories and critiques of language socialization (Bayley & Langman, 2011; Bronson & Watson-Gegeo, 2008; Garrett &…
Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M
2011-08-01
The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.
2015-09-30
represent water-mass ( spice ) anomalies on isopycnals so serve as passive tracers. These spectra were compared with existing theories and models. 2 2...isopycnal variability of spice in the North Pacific. J. Geophys. Res. doi: 10.1002/2013JC009421. Ledwell, J.R., A.J. Watson and C.S. Law, 1998
The Relationship between Student Engagement in Online Courses and Credit Hour Value
ERIC Educational Resources Information Center
York, Robyn M. B.
2012-01-01
There is a scarcity of information identifying whether course credit value is a reasonable assessment of university student engagement in online courses. Defining the student hour in an online environment is particularly challenging and can impact student and faculty workloads. Watson's behavioralistic theory grounded the assessments in this…
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Writing Assessment's "Debilitating Inheritance": Behaviorism's Dismissal of Experience
ERIC Educational Resources Information Center
Wilson, Maja Joiwind
2013-01-01
In this project, I examine the legacy of behaviorism's dismissal of experience on contemporary writing assessment theory and practice within the field of composition studies. I use an archival study of John B. Watson's letters to Robert Mearns Yerkes to establish behaviorism's systematic denial of experience and its related constructs: mind,…
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2012-01-01
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427
ERIC Educational Resources Information Center
Yazdi, Amir Amin; German, Tim P.; Defeyter, Margaret Anne; Siegal, Michael
2006-01-01
There is a change in false belief task performance across the 3-5 year age range, as confirmed in a recent meta-analysis [Wellman, H. M., Cross, D., & Watson, J. (2001). Meta-analysis of theory mind development: The truth about false-belief. "Child Development," 72, 655-684]. This meta-analysis identified several performance factors influencing…
Evaluation of Genomic Instability as an Early Event in the Progression of Breast Cancer
2007-04-01
theory of marginotomy. J. Theor. Biol. 41:181-90. 8. Watson, J. D. 1972. The origin of concatemeric T7 DNA. Nat. New Biol. 239:197-201. 9. Karlseder...concentrations were measured 6 using the Picogreen® dsDNA quantitation assay (Molecular Probes, Eugene, OR) using a λ phage DNA as the standard as
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ray, L.; Hoffmann, G.W.; Thaler, R.M.
The treatment of the Coulomb interaction in the multiple scattering theories of Kerman-McManus-Thaler and Watson is examined in detail. By neglecting virtual Coulomb excitations, the lowest order Coulomb term in the Watson optical potential is shown to be a convolution of the point Coulomb interaction with the distributed nuclear charge, while the equivalent Kerman-McManus-Thaler Coulomb potential is obtained from an averaged, single-particle Coulombic T matrix. The Kerman-McManus-Thaler Coulomb potential is expressed as the Watson Coulomb term plus additional Coulomb-nuclear and Coulomb-Coulomb cross terms, and the omission of the extra terms in usual Kerman-McManus-Thaler applications leads to negative infinite total reactionmore » cross section predictions and incorrect pure Coulomb scattering limits. Approximations are presented which eliminate these anomalies. Using the two-potential formula, the full projectile-nucleus T matrix is separated into two terms, one resulting from the distributed nuclear charge and the other being a Coulomb distorted nuclear T matrix. It is shown that the error resulting from the omission of the Kerman-McManus-Thaler Coulomb terms is effectively removed when the pure Coulomb T matrix in Kerman-McManus-Thaler is replaced by the analogous quantity in the Watson approach. Using the various approximations, theoretical angular distributions are obtained for 800 MeV p+/sup 208/Pb elastic scattering and compared with experimental data.« less
Genetics Home Reference: Holt-Oram syndrome
... PubMed OMIM: HOLT-ORAM SYNDROME Hatcher CJ, McDermott DA. Using the TBX5 transcription factor to grow and ... 2002;67:115-20. Citation on PubMed McDermott DA, Bressan MC, He J, Lee JS, Aftimos S, Brueckner ...
Resilient Communication: A New Crisis Communication Strategy for Homeland Security
2012-03-01
communication theory. Author, Timothy Coombs , in Ongoing Crisis Communication , discusses the need for a crisis management 10 plan to prepare for potential... COMMUNICATION : A NEW CRISIS COMMUNICATION STRATEGY FOR HOMELAND SECURITY by Sharon L. Watson March 2012 Thesis Advisor: Christopher Bellavita...REPORT TYPE AND DATES COVERED Master’s Thesis 4. TITLE AND SUBTITLE Resilient Communication : A New Crisis Communication
Somashekhar, S P; Sepúlveda, M-J; Puglielli, S; Norden, A D; Shortliffe, E H; Rohit Kumar, C; Rauthan, A; Arun Kumar, N; Patil, P; Rhee, K; Ramya, Y
2018-02-01
Breast cancer oncologists are challenged to personalize care with rapidly changing scientific evidence, drug approvals, and treatment guidelines. Artificial intelligence (AI) clinical decision-support systems (CDSSs) have the potential to help address this challenge. We report here the results of examining the level of agreement (concordance) between treatment recommendations made by the AI CDSS Watson for Oncology (WFO) and a multidisciplinary tumor board for breast cancer. Treatment recommendations were provided for 638 breast cancers between 2014 and 2016 at the Manipal Comprehensive Cancer Center, Bengaluru, India. WFO provided treatment recommendations for the identical cases in 2016. A blinded second review was carried out by the center's tumor board in 2016 for all cases in which there was not agreement, to account for treatments and guidelines not available before 2016. Treatment recommendations were considered concordant if the tumor board recommendations were designated 'recommended' or 'for consideration' by WFO. Treatment concordance between WFO and the multidisciplinary tumor board occurred in 93% of breast cancer cases. Subgroup analysis found that patients with stage I or IV disease were less likely to be concordant than patients with stage II or III disease. Increasing age was found to have a major impact on concordance. Concordance declined significantly (P ≤ 0.02; P < 0.001) in all age groups compared with patients <45 years of age, except for the age group 55-64 years. Receptor status was not found to affect concordance. Treatment recommendations made by WFO and the tumor board were highly concordant for breast cancer cases examined. Breast cancer stage and patient age had significant influence on concordance, while receptor status alone did not. This study demonstrates that the AI clinical decision-support system WFO may be a helpful tool for breast cancer treatment decision making, especially at centers where expert breast cancer
NASA Astrophysics Data System (ADS)
Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.
2018-01-01
The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.
ERIC Educational Resources Information Center
Rosner, Mary, Ed.; Boehm, Beth, Ed.; Journet, Debra, Ed.
This collection of essays, culled from presentations at the first Thomas R. Watson Conference in Rhetoric and Composition, examines the development of composition as a profession, focusing on the period between 1963 and 1983 when composition changed in a number of crucial ways. Essays in the collection are: (1) "Composition History and…
NASA Astrophysics Data System (ADS)
Carzoli, J.; Dunn, M.; Watson, D. K.
1998-05-01
Large order dimensional perturbation theory (DPT) has been used to study the ground and a number of excited states of two-electron atoms for the case L=0. Here we present the first application of recent work generalizing DPT to higher angular momentum.(M. Dunn, D.K. Watson, Ann. Phys. 251 (1996) 266)^,(M. Dunn, D.K. Watson, The Large Dimension Limit of Higher Angular Momentum States. Phys. Rev. A. (accepted for publication)) In this work we begin the investigation of P^o states, presenting results for the energies of some of the lowest lying states and discuss the analytic structure of these energies as functions of 1/D. We also obtain energies of corresponding D^o states with almost no additional effort by making use of interdimensional degeneracies with the P^o states.
Gilligan's different voice: a perspective for nursing.
Cooper, M C
1989-01-01
This article proposes that Carol Gilligan's ethic of care provides for nursing a paradigm for moral deliberation that demonstrates compatibility with nursing's historical and philosophical traditions of relational caring and furnishes empirical support for the value of caring as a moral activity. The appropriateness of Gilligan's theory for nursing is further illustrated by an elucidation of the similarities between Gilligan's theory and nurse theorist Jean Watson's claims that caring constitutes both a necessary and a fundamental component of nursing. It is argued that Gilligan's theory of moral deliberation more faithfully reflects the nursing experience than Kohlberg's contractual, Kantian theory, which currently dominates the nursing literature.
Three-Dimensional Evolution of Erupted Flux Ropes from the Sun (2-20 Solar Radii) to 1 AU
2012-12-01
public release; distribution unlimited 13. SUPPLEMENTARY NOTES Preprint, Solar Phys., 2013 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY ...NASA GSFC (USA), RAL and University of Birmingham (UK), MPS(Germany), CSL (Belgium), IOTA and IAS (France). References Brueckner, G.E., Howard, R.A
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E
2012-12-04
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.
NASA Astrophysics Data System (ADS)
Luna Acosta, German Aurelio
The masses of observed hadrons are fitted according to the kinematic predictions of Conformal Relativity. The hypothesis gives a remarkably good fit. The isospin SU(2) gauge invariant Lagrangian L(,(pi)NN)(x,(lamda)) is used in the calculation of d(sigma)/d(OMEGA) to 2nd-order Feynman graphs for simplified models of (pi)N(--->)(pi)N. The resulting infinite mass sums over the nucleon (Conformal) families are done via the Generalized-Sommerfeld-Watson Transform Theorem. Even though the models are too simple to be realistic, they indicate that if (DELTA)-internal lines were to be included, 2nd-order Feynman graphs may reproduce the experimental data qualitatively. The energy -dependence of the propagator and couplings in Conformal QFT is different from that of ordinary QFT. Suggestions for further work are made in the areas of ultra-violet divergences and OPEC calculations.
Sit, Janet W H; Chan, Amy W H; So, Winnie K W; Chan, Carmen W H; Chan, Aileen W K; Chan, Helen Y L; Fung, Olivia W M; Wong, Eliza M L
To examine the potential value of a creative art-based activity as a caring modality for promoting holistic well-being among chronic stroke patients, and to explore the feelings and meanings that stroke patients derived from their experience in leisure art-based creative engagement (LACE). Qualitative design. Participants were recruited through purposive and snowball sampling. Individual semi-structured interviews were conducted. Qualitative content analysis was performed. The design and implementation of LACE was guided by Watson's theory of caring. Twenty-four participants completed the study. Four themes emerged from participants' account of experiences with the LACE: (1) appreciation of opportunities, (2) appreciation of self, (3) appreciation of others, and (4) appreciation of life. From the perspective of the participants, engaging in LACE enhances their sense of enjoyment and self-expression. Furthermore, they perceived LACE as an affirmation of life and an empowering process strengthening their connection and appreciation with the self and others. This study adds evidence to existing literature on Watson's theory-guided design and implementation of caring initiatives for community rehabilitation and has laid the groundwork for developing further evidencebased research in leisure art-based caring occasions for promoting holistic well-being in stroke rehabilitation.
1989-10-01
Aires, and Philips Laboratory at Briarcliff, NY. B. Cernuschi-Frias is with Facultad de Ingenieria , Universidad de Buenos Aires, Buenos Aires... Ingenieria , Universidad de Buenos Aires, and from IBM (Thomas J. Watson Research Center). David B. Cooper (S’53-M’64) received the B.Sc. and Sc.M
NASA Astrophysics Data System (ADS)
Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima
2017-10-01
In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.
Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M
2017-05-19
In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
76 FR 55425 - Post Office Closing
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-07
... the closing of the Watson, Alabama post office has been filed. It identifies preliminary steps and... Postal Service's determination to close the Watson post office in Watson, Alabama. The petition was filed...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes andmore » fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.« less
Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R
1998-09-23
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.
Wright, Ian; Bevin, William
2017-11-25
An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.
NASA Astrophysics Data System (ADS)
Bozkaya, Uǧur
2011-12-01
In this research, orbital-optimized third-order Møller-Plesset perturbation theory (OMP3) and its spin-component and spin-opposite scaled variants (SCS-OMP3 and SOS-OMP3) are introduced. Using a Lagrangian-based approach, an efficient, quadratically convergent algorithm for variational optimization of the molecular orbitals (MOs) for third-order Møller-Plesset perturbation theory (MP3) is presented. Explicit equations for response density matrices, the MO gradient, and Hessian are reported in spin-orbital form. The OMP3, SCS-OMP3, and SOS-OMP3 approaches are compared with the second-order Møller-Plesset perturbation theory (MP2), MP3, coupled-cluster doubles (CCD), optimized-doubles (OD), and coupled-cluster singles and doubles (CCSD) methods. All these methods are applied to the O4 +, O3, and seven diatomic molecules. Results demonstrate that the OMP3 and its variants provide significantly better vibrational frequencies than MP3, CCSD, and OD for the molecules where the symmetry-breaking problems are observed. For O4 +, the OMP3 prediction, 1343 cm-1, for ω6 (b3u) mode, where symmetry-breaking appears, is even better than presumably more reliable methods such as Brueckner doubles (BD), 1194 cm-1, and OD, 1193 cm-1, methods (the experimental value is 1320 cm-1). For O3, the predictions of SCS-OMP3 (1143 cm-1) and SOS-OMP3 (1165 cm-1) are remarkably better than the more robust OD method (1282 cm-1); the experimental value is 1089 cm-1. For the seven diatomics, again the SCS-OMP3 and SOS-OMP3 methods provide the lowest average errors, |Δωe| = 44 and |Δωe| = 35 cm-1, respectively, while for OD, |Δωe| = 161 cm-1and CCSD |Δωe| = 106 cm-1. Hence, the OMP3 and especially its spin-scaled variants perform much better than the MP3, CCSD, and more robust OD approaches for considered test cases. Therefore, considering both the computational cost and the reliability, SCS-OMP3 and SOS-OMP3 appear to be the best methods for the symmetry-breaking cases, based on
Bozkaya, Uğur
2011-12-14
In this research, orbital-optimized third-order Møller-Plesset perturbation theory (OMP3) and its spin-component and spin-opposite scaled variants (SCS-OMP3 and SOS-OMP3) are introduced. Using a Lagrangian-based approach, an efficient, quadratically convergent algorithm for variational optimization of the molecular orbitals (MOs) for third-order Møller-Plesset perturbation theory (MP3) is presented. Explicit equations for response density matrices, the MO gradient, and Hessian are reported in spin-orbital form. The OMP3, SCS-OMP3, and SOS-OMP3 approaches are compared with the second-order Møller-Plesset perturbation theory (MP2), MP3, coupled-cluster doubles (CCD), optimized-doubles (OD), and coupled-cluster singles and doubles (CCSD) methods. All these methods are applied to the O(4)(+), O(3), and seven diatomic molecules. Results demonstrate that the OMP3 and its variants provide significantly better vibrational frequencies than MP3, CCSD, and OD for the molecules where the symmetry-breaking problems are observed. For O(4)(+), the OMP3 prediction, 1343 cm(-1), for ω(6) (b(3u)) mode, where symmetry-breaking appears, is even better than presumably more reliable methods such as Brueckner doubles (BD), 1194 cm(-1), and OD, 1193 cm(-1), methods (the experimental value is 1320 cm(-1)). For O(3), the predictions of SCS-OMP3 (1143 cm(-1)) and SOS-OMP3 (1165 cm(-1)) are remarkably better than the more robust OD method (1282 cm(-1)); the experimental value is 1089 cm(-1). For the seven diatomics, again the SCS-OMP3 and SOS-OMP3 methods provide the lowest average errors, ∣Δω(e)∣ = 44 and ∣Δω(e)∣ = 35 cm(-1), respectively, while for OD, ∣Δω(e)∣ = 161 cm(-1)and CCSD ∣Δω(e)∣ = 106 cm(-1). Hence, the OMP3 and especially its spin-scaled variants perform much better than the MP3, CCSD, and more robust OD approaches for considered test cases. Therefore, considering both the computational cost and the reliability, SCS-OMP3 and SOS-OMP3 appear to be the
Watson, Jean
2003-01-01
This manuscript offers a new view of old and timeless values: the essential ethic of love, informed by contemporary European philosophies, and caring theory, as well as ancient poetry and wisdom traditions. It integrates some of the philosophical views of Levinas and Logstrup with Watson's Transpersonal Caring Theory. The metaphysics, metaphors, and meanings associated with "ethics of face," the "infinity of the human soul," and "holding another's life in our hands" are tied to a deeply ethical foundation for the timeless practice of love and caring, as a means to sustain, not only our shared humanity, but the profession of nursing itself.
Oblique perspective of portal, due north. Bridge has gable roof ...
Oblique perspective of portal, due north. Bridge has gable roof clad with wood shingles and has board and batten siding. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA
Oblique perspective, due east by 70 degrees. Note concrete pier, ...
Oblique perspective, due east by 70 degrees. Note concrete pier, added CA. 1930's. Other piers and abutments are heavily mortared rubble stone. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA
NASA Astrophysics Data System (ADS)
Zirkel, Jack
Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”
Strategies for innovative energy-based nursing practice: the Healing Touch program.
Kelley, Mari
2002-01-01
The purpose of this article is to share professional knowledge, practice, and educational opportunities related to energy-based nursing in order to broaden and improve the delivery of health care services. The holistic, theory-based approach places a patient's perceived needs first, and cares for the human body as well as the spirit. Energy medicine is an intricate part of the patient's expectation for health care. Watson's transpersonal-caring-healing model is explored (Watson, 1999). This model expands the view of the person to one that embodies energy that is comprised of spirit, a universal mind, and consciousness. The North American Nurses Diagnosis Association (NANDA) recognizes energy therapy as an intervention representing a specific theory: human energy field theory (HEFT). This therapy is related to the approved nursing diagnosis of energy field disturbance 1.8 (NANDA, 1995/1996). Healing touch (HT) is an energy-based therapeutic approach to healing that emphasizes caring for the whole person based on the HEFT. It is used in the nursing profession to influence changes in the human energy system; HT affects physical, emotional, mental, and spiritual health. The nursing process is evident throughout the curriculum. Nurse researchers report positive patients outcomes. The holistic nursing concept of energetic healing returns nurse professionals to the essence of nursing. Spinal cord injury (SCI) nurses will benefit by increasing their knowledge and awareness of energy therapy to increase patient satisfaction and improve outcomes for persons with SCI.
ERIC Educational Resources Information Center
MACCIA, ELIZABETH S.; AND OTHERS
AN ANNOTATED BIBLIOGRAPHY OF 20 ITEMS AND A DISCUSSION OF ITS SIGNIFICANCE WAS PRESENTED TO DESCRIBE CURRENT UTILIZATION OF SUBJECT THEORIES IN THE CONSTRUCTION OF AN EDUCATIONAL THEORY. ALSO, A THEORY MODEL WAS USED TO DEMONSTRATE CONSTRUCTION OF A SCIENTIFIC EDUCATIONAL THEORY. THE THEORY MODEL INCORPORATED SET THEORY (S), INFORMATION THEORY…
77 FR 1471 - The Historically Black College and University Capital Financing Advisory Board
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-10
... INFORMATION CONTACT: Donald E. Watson, Executive Director, Historically Black College and University Capital...; telephone: (202) 219-7037; fax: (202) 502-7852; email: donald.watson@ed.gov . Individuals who use a..., assistance listening devices, or materials in alternative format) should notify Donald Watson at (202) 219...
2006-03-01
factors that “maximize the benefit of location to the firm” ( Heizer & Render , 2004:302-307). In the book, Facility Location: Applications and Theory...Fylstra, D., Lasdon, L., Watson, J. and Waren, A. “Design and Use of the Microsoft Excel Solver,” Interfaces, 28(5):29-55, 1998. Heizer , Jay...and Render , Barry. Principles of Operations Management (5th ed.). New Jersey: Pearson Education Inc., 2004. Hofstra University. (n.d.). Von
Equation of state for neutron stars. Some recent developments
NASA Astrophysics Data System (ADS)
Haensel, P.; Fortin, M.
2017-12-01
Calculations using the chiral effective field theory (ChEFT) indicate that the four-body force contribution to the equation of state (EOS) of pure neutron matter (PNM) at the nuclear density n 0 is negligibly small. However, the overall uncertainty in the EOS of PNM at n 0 remains ∼ 20%. Relativistic mean field (RMF) calculations with in-medium scaling, and including hyperons and Δ resonances, can be made consistent with recent nuclear and astrophysical constraints. Dirac-Brueckner-Hartree-Fock calculations with some medium dependence of the nuclear interaction yield neutron star (NS) models with hyperonic cores consistent with 2 M⊙ stars and agreeing with the saturation parameters of nuclear matter. Many unified EOS for the NS crust and core were calculated, and are reviewed here. The effect of the finite size of baryons on the EOS, its treatment via the excluded-volume approximation, and its relevance for the hypothetical hybrid-star twins at ∼ 2 M⊙ are dicussed.
NASA Astrophysics Data System (ADS)
Burgio, G. F.
2018-03-01
We discuss the structure of Neutron Stars by modelling the homogeneous nuclear matter of the core by a suitable microscopic Equation of State, based on the Brueckner-Hartree-Fock many-body theory, and the crust, including the pasta phase, by the BCPM energy density functional which is based on the same Equation of State. This allows for a uni ed description of the Neutron Star matter over a wide density range. A comparison with other uni ed approaches is discussed. With the same Equation of State, which features strong direct Urca processes and using consistent nuclear pairing gaps as well as effective masses, we model neutron star cooling, in particular the current rapid cooldown of the neutron star Cas A. We nd that several scenarios are possible to explain the features of Cas A, but only large and extended proton 1 S 0 gaps and small neutron 3 PF 2 gaps can accommodate also the major part of the complete current cooling data.
Fortmann, Carsten; Wierling, August; Röpke, Gerd
2010-02-01
The dynamic structure factor, which determines the Thomson scattering spectrum, is calculated via an extended Mermin approach. It incorporates the dynamical collision frequency as well as the local-field correction factor. This allows to study systematically the impact of electron-ion collisions as well as electron-electron correlations due to degeneracy and short-range interaction on the characteristics of the Thomson scattering signal. As such, the plasmon dispersion and damping width is calculated for a two-component plasma, where the electron subsystem is completely degenerate. Strong deviations of the plasmon resonance position due to the electron-electron correlations are observed at increasing Brueckner parameters r(s). These results are of paramount importance for the interpretation of collective Thomson scattering spectra, as the determination of the free electron density from the plasmon resonance position requires a precise theory of the plasmon dispersion. Implications due to different approximations for the electron-electron correlation, i.e., different forms of the one-component local-field correction, are discussed.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-06
... Affairs Officer) 90 Hennepin Avenue, Minneapolis, Minnesota 55480-0291: 1. Thomas Watson, Grand Forks, North Dakota, as an individual and as trustee, and Thomas Watson and Toby Kommer, Fargo, North Dakota... indirectly acquire control of Bank Forward, Hannaford, North Dakota. In addition, Mr. Watson and Mr. Kommer...
78 FR 52230 - Government/Industry Aeronautical Charting Forum Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-22
...: [email protected] . For information relating to the Charting Group, contact Valerie S. Watson...) 427-5155; Email: valerie.s.watson@faa.gov . SUPPLEMENTARY INFORMATION: Pursuant to Sec. 10(a)(2) of... if time permits. Issued in Washington, DC, on August 15, 2013. Valerie S. Watson, Co-Chair...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-17
... 20590, phone (202) 366-4325, email [email protected] . For the listening sessions: Ms. Shannon Watson..., 1200 New Jersey Avenue SE., Washington, DC 20590, phone (202) 385-2395, email shannon.watson@dot.gov . If you need sign language assistance to participate in a listening session, please contact Ms. Watson...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-06
..., phone (202) 366-4325, email [email protected] . For the listening sessions: Ms. Shannon Watson, Senior... Jersey Avenue SE., Washington, DC 20590, phone (202) 385-2395, email shannon.watson@dot.gov . If you need sign language assistance to participate in a listening session, please contact Shannon Watson at (202...
75 FR 42081 - The Historically Black College and University Capital Financing Advisory Board
Federal Register 2010, 2011, 2012, 2013, 2014
2010-07-20
..., DC. 20001. FOR FURTHER INFORMATION CONTACT: Donald E. Watson, Executive Director, Historically Black... 6071, Washington, DC 20006; telephone: (202) 219-7037; fax: (202) 502-7852; e-mail: donald.watson@ed...) should notify Donald Watson at 202 219-7037, no later than July 16, 2010. We will attempt to meet...
Propagation of Species at Risk Atlantic Pigtoe on Military Installations
2010-04-30
adult mussels are constantly being adapted to meet the needs of each species. 6.0. PROCEDURES 6.1. Potential Host Fish Collection In order to...Watson) o VA freshwater mussel web atlas (Watson) o Freshwater gastropod of VA web atlas, Atlantic slope (Watson) 5) Other Issues of Interest
76 FR 5424 - Motor Carrier Safety Advisory Committee; Request for Nominations
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-31
... FURTHER INFORMATION CONTACT: Ms. Shannon L. Watson, MCSAC Liaison, FMCSA, at 202-385-2395 or via e-mail at Shannon.Watson@dot.gov . SUPPLEMENTARY INFORMATION: I. Background Section 4144 of the Safe, Accountable...://mcsac.fmcsa.dot.gov/ , completed on-line, and e-mailed to Shannon L. Watson, MCSAC liaison, at Shannon...
Historical Review of Emergency Tourniquet Use to Stop Bleeding
2012-02-01
comment to, “More lives have been lost than were ever saved by the use of the tourniquet.”49 Watson- Jones concluded that the emergency tourniquet was a dan...in major limb trauma. J Trauma 2008;64: S38–50. 21. Kragh JF Jr, Littrel ML, Jones JA, et al. Battle casualty survival with emergency tourniquet use...Watson- Jones . J Bone Joint Surg 1972;54B:569–75. 48. Watson- Jones R. Fractures and Joint Injuries. London: Livingstone; 1955:121–2. 49. Watson- Jones R
Superconducting Qubit with Integrated Single Flux Quantum Controller Part I: Theory and Fabrication
NASA Astrophysics Data System (ADS)
Beck, Matthew; Leonard, Edward, Jr.; Thorbeck, Ted; Zhu, Shaojiang; Howington, Caleb; Nelson, Jj; Plourde, Britton; McDermott, Robert
As the size of quantum processors grow, so do the classical control requirements. The single flux quantum (SFQ) Josephson digital logic family offers an attractive route to proximal classical control of multi-qubit processors. Here we describe coherent control of qubits via trains of SFQ pulses. We discuss the fabrication of an SFQ-based pulse generator and a superconducting transmon qubit on a single chip. Sources of excess microwave loss stemming from the complex multilayer fabrication of the SFQ circuit are discussed. We show how to mitigate this loss through judicious choice of process workflow and appropriate use of sacrificial protection layers. Present address: IBM T.J. Watson Research Center.
Panczyk, Tomasz; Wolski, Pawel
2018-06-01
This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually
energy solutions for emission mitigation, international climate change strategies, and renewable energy technical decision making. Andrea's expertise lies in strategic planning, change strategies, and decision
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
NASA Astrophysics Data System (ADS)
Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.
2013-12-01
Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW
Bullying in a caring profession: reasons, results, and recommendations.
Broome, Barbara S; Williams-Evans, Shiphrah
2011-10-01
The theories of Florence Nightingale and Jean Watson provide a framework for the caring work of nurses. Ironically, this caring profession struggles with bullying. Bullying has both physiological and psychological ramifications for the person being bullied and a negative impact on the organization and patient care. Strategies to address bullying include education, developing codes of acceptable conduct for the workplace, and a zero-tolerance policy. Mental health nurses have a vital role in helping nurses return to roles of caring. Copyright 2011, SLACK Incorporated.
77 FR 13683 - Government/Industry Aeronautical Charting Forum Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-07
.... Watson, FAA, National Aeronautical Navigation Products (AeroNav Products), Quality Assurance & Regulatory..., on February 28, 2012. Valerie S. Watson, Co-Chair, Aeronautical Charting Forum. [FR Doc. 2012-5293...
Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer
2001-10-01
Genetic Markers of the Invasive Phenotype in Human Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Peter Watson CONTRACTING ORGANIZATION: University of...Markers of the Invasive Phenotype DAMD17-97-1-7320 in Human Breast Cancer 6. AUTHOR(S) Dr. Peter Watson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES...markers of the invasive phenotype in human breast cancer" Dr Peter H. Watson INTRODUCTION. The acquisition of the ability to invade is the single most
78 FR 12415 - Government/Industry Aeronautical Charting Forum Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-22
... Valerie S. Watson, FAA, National Aeronautical Navigation Products (AeroNav Products), Quality Assurance.... Issued in Washington, DC, on February 19, 2013. Valerie S. Watson, Co-Chair, Aeronautical Charting Forum...
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-15
.... Products LLC. 74,606 Watson Laboratories, Inc., Carmel, NY September 3, 2009. Watson Pharmaceuticals...--Enterprise Services), Virtual Workers Across the United States. 74,343 JohnsonDiversey Santa Cruz, CA...
Acquiring Procedural Skills from Lesson Sequences.
1985-08-13
Teachers of Mathematics . Washington, D)C: NCTM . Brueckner, I..J. (1930) Diagnostic aund remedial teaching in arithmetic. Philadelphia. PA: Winston. Burton...arithmetic and algebra, fr-m multi-lesson curricula. The central hypothesis is that students and teachers obey cc: :-.entions that cause the goal hierarchy...students and • . teachers obey conventions that cause the goal hierarchy of the acquired procedure to be a particular structural function of the sequential
21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 049185 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division... Olney Ave., Cherry Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880...
21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 50704 017139 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division... Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000842 Texas...
[Transpersonal caring in nursing: an analysis grounded in a conceptual model].
Favero, Luciane; Pagliuca, Lorita Marlena Freitag; Lacerda, Maria Ribeiro
2013-04-01
This theoretical study aimed to analyze the attributes, antecedents, and consequences of the transpersonal caring concept through using the Concepts Analysis Model. For this purpose, books published based on Jean Watson's theory in Portuguese and English from 1979 to 2012 were listed. Fulfilled inclusion criteria, only six literary works remained. The time of care and intention to be in relationship were the most cited antecedents. The most present attributes were intersubjectivity and relationships among those ones involved in the process. With regard to consequences, the most present element was the fact that the transpersonal caring provides restoration/reconstitution (healing). The study allowed noting tiny changes in the concept definition over the years and publications of theory. Thus, analyzing the attributes, antecedents, and consequences of concept provided its better understanding and comprehension of its importance in the Human Caring Theory proposed by American theorist.
Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding
2008-07-11
Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-05
..., Dallas, Texas 75201-2272: 1. Rebecca Watson Vizard, St. Joseph Louisiana; Michael Rene Vizard, St. Joseph... William Wade Watson, St. Joseph, Louisiana, (collectively known as the ``Vizard Family Group'') to retain...
Teaching Theory X and Theory Y in Organizational Communication
ERIC Educational Resources Information Center
Noland, Carey
2014-01-01
The purpose of the activity described here is to integrate McGregor's Theory X and Theory Y into a group application: design a syllabus that embodies either Theory X or Theory Y tenets. Students should be able to differentiate between Theory X and Theory Y, create a syllabus based on Theory X or Theory Y tenets, evaluate the different syllabi…
Effective theories of universal theories
Wells, James D.; Zhang, Zhengkang
2016-01-20
It is well-known but sometimes overlooked that constraints on the oblique parameters (most notably S and T parameters) are generally speaking only applicable to a special class of new physics scenarios known as universal theories. The oblique parameters should not be associated with Wilson coefficients in a particular operator basis in the effective field theory (EFT) framework, unless restrictions have been imposed on the EFT so that it describes universal theories. Here, we work out these restrictions, and present a detailed EFT analysis of universal theories. We find that at the dimension-6 level, universal theories are completely characterized by 16more » parameters. They are conveniently chosen to be: 5 oblique parameters that agree with the commonly-adopted ones, 4 anomalous triple-gauge couplings, 3 rescaling factors for the h 3, hff, hV V vertices, 3 parameters for hV V vertices absent in the Standard Model, and 1 four-fermion coupling of order yf 2. Furthermore, all these parameters are defined in an unambiguous and basis-independent way, allowing for consistent constraints on the universal theories parameter space from precision electroweak and Higgs data.« less
Effective theories of universal theories
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wells, James D.; Zhang, Zhengkang
It is well-known but sometimes overlooked that constraints on the oblique parameters (most notably S and T parameters) are generally speaking only applicable to a special class of new physics scenarios known as universal theories. The oblique parameters should not be associated with Wilson coefficients in a particular operator basis in the effective field theory (EFT) framework, unless restrictions have been imposed on the EFT so that it describes universal theories. Here, we work out these restrictions, and present a detailed EFT analysis of universal theories. We find that at the dimension-6 level, universal theories are completely characterized by 16more » parameters. They are conveniently chosen to be: 5 oblique parameters that agree with the commonly-adopted ones, 4 anomalous triple-gauge couplings, 3 rescaling factors for the h 3, hff, hV V vertices, 3 parameters for hV V vertices absent in the Standard Model, and 1 four-fermion coupling of order yf 2. Furthermore, all these parameters are defined in an unambiguous and basis-independent way, allowing for consistent constraints on the universal theories parameter space from precision electroweak and Higgs data.« less
Theories of Career Development. A Comparison of the Theories.
ERIC Educational Resources Information Center
Osipow, Samuel H.
These seven theories of career development are examined in previous chapters: (1) Roe's personality theory, (2) Holland's career typology theory, (3) the Ginzberg, Ginsburg, Axelrod, and Herma Theory, (4) psychoanalytic conceptions, (5) Super's developmental self-concept theory, (6) other personality theories, and (7) social systems theories.…
77 FR 40947 - Motor Carrier Safety Advisory Committee (MCSAC): Membership Solicitation
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-11
.... Shannon L. Watson, Senior Advisor to the Associate Administrator for Policy, Federal Motor Carrier Safety....fmcsa.dot.gov/ , completed on-line and emailed to Shannon L. Watson, Senior Advisor to the Associate...
A Future of Communication Theory: Systems Theory.
ERIC Educational Resources Information Center
Lindsey, Georg N.
Concepts of general systems theory, cybernetics and the like may provide the methodology for communication theory to move from a level of technology to a level of pure science. It was the purpose of this paper to (1) demonstrate the necessity of applying systems theory to the construction of communication theory, (2) review relevant systems…
Foundations for a theory of gravitation theories
NASA Technical Reports Server (NTRS)
Thorne, K. S.; Lee, D. L.; Lightman, A. P.
1972-01-01
A foundation is laid for future analyses of gravitation theories. This foundation is applicable to any theory formulated in terms of geometric objects defined on a 4-dimensional spacetime manifold. The foundation consists of (1) a glossary of fundamental concepts; (2) a theorem that delineates the overlap between Lagrangian-based theories and metric theories; (3) a conjecture (due to Schiff) that the Weak Equivalence Principle implies the Einstein Equivalence Principle; and (4) a plausibility argument supporting this conjecture for the special case of relativistic, Lagrangian-based theories.
Situation-specific theories from the middle-range transitions theory.
Im, Eun-Ok
2014-01-01
The purpose of this article was to analyze the theory development process of the situation-specific theories that were derived from the middle-range transitions theory. This analysis aims to provide directions for future development of situation-specific theories. First, transitions theory is concisely described with its history, goal, and major concepts. Then, the approach that was used to retrieve the situation-specific theories derived from transitions theory is described. Next, an analysis of 6 situation-specific theories is presented. Finally, 4 themes reflecting commonalities and variances in the theory development process are discussed with implications for future theoretical development.
The power of loving humane care in nursing.
Rivero, Digna Escobar; Erdmann, Alacoque Lorenzini
2007-01-01
This study aimed to develop an approach about the power of humane care within the concept of nursing through the building of a theoretical structure. Spiegelberg's methodology was used to seek the meaning of the power of humane care for new nurses and for patients. The resulting theoretical structure is based on Parker's theory of power, Patterson and Zderad's humane care, Watson's theories and Larrañaga's concept of love. The elements of this structure are: the nurse, the ill or healthy person, the environment and nursing, all bound by an affectionate humane care. The final reflection was that all of them are included within the technical-scientific paradigm of modernity and that the patients hope to be care for by humane nurses.
76 FR 58817 - National Boating Safety Advisory Council; Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-22
... and RADM James Watson, USCG Director of Prevention Policy; (2) Receipt and discussion of the following... October 3, 2011. Dated: September 16, 2011. James A. Watson, Rear Admiral, U.S. Coast Guard, Director of...
Genetics Home Reference: Alagille syndrome
... my area? Other Names for This Condition Alagille-Watson Syndrome Alagille's syndrome arteriohepatic dysplasia (AHD) cardiovertebral syndrome ... hypoplasia hepatofacioneurocardiovertebral syndrome paucity of interlobular bile ducts Watson-Miller syndrome Related Information How are genetic conditions ...
76 FR 53924 - Merchant Mariner Medical Advisory Committee
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-30
... and swearing in of the new members; (3) Remarks from Coast Guard Leadership, Rear Admiral J. A. Watson.../presentations; and (3) Closing remarks/plans for next meeting. Dated: August 24, 2011. J. A. Watson, Rear...
How Many Cancers Are Linked with HPV Each Year?
... 24:1548–1556. 3 Viens LJ, Henley SJ, Watson M, Markowitz LE, Thomas CC, Thompson TD, Razzaghi ... Lynch CF, Hernandez BY, Lyu CW, Steinau M, Watson M, Wilkinson EJ, Hopenhayn C, Copeland G, Cozen ...
Code of Federal Regulations, 2010 CFR
2010-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
Code of Federal Regulations, 2013 CFR
2013-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
Code of Federal Regulations, 2011 CFR
2011-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
Code of Federal Regulations, 2014 CFR
2014-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
Code of Federal Regulations, 2012 CFR
2012-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
ERIC Educational Resources Information Center
Golledge, Reginald G.
1996-01-01
Discusses the origin of theories in geography and particularly the development of location theories. Considers the influence of economic theory on agricultural land use, industrial location, and geographic location theories. Explores a set of interrelated activities that show how the marketing process illustrates process theory. (MJP)
The Analyst's "Use" of Theory or Theories: The Play of Theory.
Cooper, Steven H
2017-10-01
Two clinical vignettes demonstrate a methodological approach that guides the analyst's attention to metaphors and surfaces that are the focus of different theories. Clinically, the use of different theories expands the metaphorical language with which the analyst tries to make contact with the patient's unconscious life. Metaphorical expressions may be said to relate to each other as the syntax of unconscious fantasy (Arlow 1979). The unconscious fantasy itself represents a metaphorical construction of childhood experience that has persisted, dynamically expressive and emergent into adult life. This persistence is evident in how, in some instances, long periods of an analysis focus on translating one or a few metaphors, chiefly because the manifest metaphorical expressions of a central theme regularly lead to better understanding of an unconscious fantasy. At times employing another model or theory assists in a level of self-reflection about clinical understanding and clinical decisions. The analyst's choice of theory or theories is unique to the analyst and is not prescriptive, except as illustrating a way to think about these issues. The use of multiple models in no way suggests or implies that theories may be integrated.
Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching
2008-01-01
C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the
Decidability of formal theories and hyperincursivity theory
NASA Astrophysics Data System (ADS)
Grappone, Arturo G.
2000-05-01
This paper shows the limits of the Proof Standard Theory (briefly, PST) and gives some ideas of how to build a proof anticipatory theory (briefly, PAT) that has no such limits. Also, this paper considers that Gödel's proof of the undecidability of Principia Mathematica formal theory is not valid for axiomatic theories that use a PAT to build their proofs because the (hyper)incursive functions are self-representable.
Theory of Multiple Intelligences: Is It a Scientific Theory?
ERIC Educational Resources Information Center
Chen, Jie-Qi
2004-01-01
This essay discusses the status of multiple intelligences (MI) theory as a scientific theory by addressing three issues: the empirical evidence Gardner used to establish MI theory, the methodology he employed to validate MI theory, and the purpose or function of MI theory.
Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene
2016-06-01
Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.
Spatial Autocorrelation Approaches to Testing Residuals from Least Squares Regression.
Chen, Yanguang
2016-01-01
In geo-statistics, the Durbin-Watson test is frequently employed to detect the presence of residual serial correlation from least squares regression analyses. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the test will be ineffectual because the value of Durbin-Watson's statistic depends on the sequence of data points. This paper develops two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran's index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then by analogy with the Durbin-Watson statistic, two types of new serial correlation indices are constructed. As a case study, the two newly presented statistics are applied to a spatial sample of 29 China's regions. These results show that the new spatial autocorrelation models can be used to test the serial correlation of residuals from regression analysis. In practice, the new statistics can make up for the deficiencies of the Durbin-Watson test.
Theory X and Theory Y in the Organizational Structure.
ERIC Educational Resources Information Center
Barry, Thomas J.
This document defines contrasting assumptions about the labor force--theory X and theory Y--and shows how they apply to the pyramid organizational structure, examines the assumptions of the two theories, and finally, based on a survey and individual interviews, proposes a merger of theories X and Y to produce theory Z. Organizational structures…
When is a theory a theory? A case example.
Alkin, Marvin C
2017-08-01
This discussion comments on the approximately 20years history of writings on the prescriptive theory called Empowerment Evaluation. To do so, involves examining how "Empowerment Evaluation Theory" has been defined at various points of time (particularly 1996 and now in 2015). Defining a theory is different from judging the success of a theory. This latter topic has been addressed elsewhere by Michael Scriven, Michael Patton, and Brad Cousins. I am initially guided by the work of Robin Miller (2010) who has written on the issue of how to judge the success of a theory. In doing so, she provided potential standards for judging the adequacy of theories. My task is not judging the adequacy or success of the Empowerment Evaluation prescriptive theory in practice, but determining how well the theory is delineated. That is, to what extent do the writings qualify as a prescriptive theory. Copyright © 2016 Elsevier Ltd. All rights reserved.
Abelian gauge symmetries in F-theory and dual theories
NASA Astrophysics Data System (ADS)
Song, Peng
In this dissertation, we focus on important physical and mathematical aspects, especially abelian gauge symmetries, of F-theory compactifications and its dual formulations within type IIB and heterotic string theory. F-theory is a non-perturbative formulation of type IIB string theory which enjoys important dualities with other string theories such as M-theory and E8 x E8 heterotic string theory. One of the main strengths of F-theory is its geometrization of many physical problems in the dual string theories. In particular, its study requires a lot of mathematical tools such as advanced techniques in algebraic geometry. Thus, it has also received a lot of interests among mathematicians, and is a vivid area of research within both the physics and the mathematics community. Although F-theory has been a long-standing theory, abelian gauge symmetry in Ftheory has been rarely studied, until recently. Within the mathematics community, in 2009, Grassi and Perduca first discovered the possibility of constructing elliptically fibered varieties with non-trivial toric Mordell-Weil group. In the physics community, in 2012, Morrison and Park first made a major advancement by constructing general F-theory compactifications with U(1) abelian gauge symmetry. They found that in such cases, the elliptically-fibered Calabi-Yau manifold that F-theory needs to be compactified on has its fiber being a generic elliptic curve in the blow-up of the weighted projective space P(1;1;2) at one point. Subsequent developments have been made by Cvetic, Klevers and Piragua extended the works of Morrison and Park and constructed general F-theory compactifications with U(1) x U(1) abelian gauge symmetry. They found that in the U(1) x U(1) abelian gauge symmetry case, the elliptically-fibered Calabi-Yau manifold that F-theory needs to be compactified on has its fiber being a generic elliptic curve in the del Pezzo surface dP2. In chapter 2 of this dissertation, I bring this a step further by
Identity theory and personality theory: mutual relevance.
Stryker, Sheldon
2007-12-01
Some personality psychologists have found a structural symbolic interactionist frame and identity theory relevant to their work. This frame and theory, developed in sociology, are first reviewed. Emphasized in the review are a multiple identity conception of self, identities as internalized expectations derived from roles embedded in organized networks of social interaction, and a view of social structures as facilitators in bringing people into networks or constraints in keeping them out, subsequently, attention turns to a discussion of the mutual relevance of structural symbolic interactionism/identity theory and personality theory, looking to extensions of the current literature on these topics.
[From the cell theory to the neuron theory].
Tixier-Vidal, Andrée
2010-01-01
The relationship between the cell theory formulated by Schwann (1839) and by Virchow (1855) on the one hand, and, on the other hand, the neuron theory, as formulated by Waldeyer (1891) and by Cajal (1906), are discussed from a historical point of view. Both of them are the result of technical and conceptuel progress. Both of them had to fight against the dominant dogma before being accepted. The cell theory opposed the school of Bichat, the vitalist philosophy and the positivist philosophy of Auguste Comte. The neuron theory, which is clearly based on the cell theory, was mostly concerned with the mode of interneuronal communication; it opposed the concept of contiguity to Golgi's concept of continuity. At present, the cell theory remains central in every field of Biology. By contrast, the neuron theory, which until the middle of the XXth century opened the study of the nervous system to a necessary reductionnist approach, is no longer central to recent developments of neurosciences. © Société de Biologie, 2011.
Noncommutative Field Theories and (super)string Field Theories
NASA Astrophysics Data System (ADS)
Aref'eva, I. Ya.; Belov, D. M.; Giryavets, A. A.; Koshelev, A. S.; Medvedev, P. B.
2002-11-01
In this lecture notes we explain and discuss some ideas concerning noncommutative geometry in general, as well as noncommutative field theories and string field theories. We consider noncommutative quantum field theories emphasizing an issue of their renormalizability and the UV/IR mixing. Sen's conjectures on open string tachyon condensation and their application to the D-brane physics have led to wide investigations of the covariant string field theory proposed by Witten about 15 years ago. We review main ingredients of cubic (super)string field theories using various formulations: functional, operator, conformal and the half string formalisms. The main technical tools that are used to study conjectured D-brane decay into closed string vacuum through the tachyon condensation are presented. We describe also methods which are used to study the cubic open string field theory around the tachyon vacuum: construction of the sliver state, "comma" and matrix representations of vertices.
'Theory of Mind' I: a theory of knowledge?
Plastow, Michael
2012-06-01
'Theory of mind' is a cognitive notion introduced by Simon Baron-Cohen and colleagues to explain certain deficits in autistic disorders. It has, however, been extended beyond this, and applied more broadly. It proposes a means of knowing the mind of others, and suggests that this means fails in autism. The epistemological basis of 'theory of mind' will be examined critically, not just in terms of its endeavour as a theory of knowledge, but also in regard to the principles that underlie it. The proponents of 'theory of mind' eschew the rich field of psychological and phenomenological research, privileging only the biological sciences into which they endeavour to place their theorizations. In doing this, they fail to recognize the epistemological problems involved. This leads to the theory remaining hamstrung by the very Cartesian ontological problems that it seeks to avoid. For some, 'theory of mind' is but an artefact of the cognitive approach that it employs. It is argued that these difficulties are compounded by the failure of 'theory of mind' to take account of the place of language in the interpersonal encounters it attempts to describe.
A succession of theories: purging redundancy from disturbance theory.
Pulsford, Stephanie A; Lindenmayer, David B; Driscoll, Don A
2016-02-01
The topics of succession and post-disturbance ecosystem recovery have a long and convoluted history. There is extensive redundancy within this body of theory, which has resulted in confusion, and the links among theories have not been adequately drawn. This review aims to distil the unique ideas from the array of theory related to ecosystem change in response to disturbance. This will help to reduce redundancy, and improve communication and understanding between researchers. We first outline the broad range of concepts that have developed over the past century to describe community change in response to disturbance. The body of work spans overlapping succession concepts presented by Clements in 1916, Egler in 1954, and Connell and Slatyer in 1977. Other theories describing community change include state and transition models, biological legacy theory, and the application of functional traits to predict responses to disturbance. Second, we identify areas of overlap of these theories, in addition to highlighting the conceptual and taxonomic limitations of each. In aligning each of these theories with one another, the limited scope and relative inflexibility of some theories becomes apparent, and redundancy becomes explicit. We identify a set of unique concepts to describe the range of mechanisms driving ecosystem responses to disturbance. We present a schematic model of our proposed synthesis which brings together the range of unique mechanisms that were identified in our review. The model describes five main mechanisms of transition away from a post-disturbance community: (i) pulse events with rapid state shifts; (ii) stochastic community drift; (iii) facilitation; (iv) competition; and (v) the influence of the initial composition of a post-disturbance community. In addition, stabilising processes such as biological legacies, inhibition or continuing disturbance may prevent a transition between community types. Integrating these six mechanisms with the functional
Riemann tensor of motion vision revisited.
Brill, M
2001-07-02
This note shows that the Riemann-space interpretation of motion vision developed by Barth and Watson is neither necessary for their results, nor sufficient to handle an intrinsic coordinate problem. Recasting the Barth-Watson framework as a classical velocity-solver (as in computer vision) solves these problems.
NASA Astrophysics Data System (ADS)
Kadyshevich, E. A.; Dzyabchenko, A. V.; Ostrovskii, V. E.
2014-04-01
Size compatibility of the CH4-hydrate structure II and multi-component DNA fragments is confirmed by three-dimensional simulation; it is validation of the Life Origination Hydrate Theory (LOH-Theory).
Harris, Tina
2015-04-29
Grounded theory is a popular research approach in health care and the social sciences. This article provides a description of grounded theory methodology and its key components, using examples from published studies to demonstrate practical application. It aims to demystify grounded theory for novice nurse researchers, by explaining what it is, when to use it, why they would want to use it and how to use it. It should enable nurse researchers to decide if grounded theory is an appropriate approach for their research, and to determine the quality of any grounded theory research they read.
Commentary on Malone: Who Founded Behaviorism?
Reese, Hayne W
2015-05-01
Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.
Comparison of Attachment theory and Cognitive-Motivational Structure theory.
Malerstein, A J
2005-01-01
Attachment theory and Cognitive-Motivational Structure (CMS) are similar in most respects. They differ primarily in their proposal of when, during development, one's sense of the self and of the outside world are formed. I propose that the theories supplement each other after about age seven years--when Attachment theory's predictions of social function become unreliable, CMS theory comes into play.
NASA Astrophysics Data System (ADS)
Garza, Alejandro J.; Bulik, Ireneusz W.; Alencar, Ana G. Sousa; Sun, Jianwei; Perdew, John P.; Scuseria, Gustavo E.
2016-04-01
Contrary to standard coupled cluster doubles (CCD) and Brueckner doubles (BD), singlet-paired analogues of CCD and BD (denoted here as CCD0 and BD0) do not break down when static correlation is present, but neglect substantial amounts of dynamic correlation. In fact, CCD0 and BD0 do not account for any contributions from multielectron excitations involving only same-spin electrons at all. We exploit this feature to add - without introducing double counting, self-interaction, or increase in cost - the missing correlation to these methods via meta-GGA (generalised gradient approximation) density functionals (Tao-Perdew-Staroverov-Scuseria and strongly constrained and appropriately normed). Furthermore, we improve upon these CCD0+DFT blends by invoking range separation: the short- and long-range correlations absent in CCD0/BD0 are evaluated with density functional theory and the direct random phase approximation, respectively. This corrects the description of long-range van der Waals forces. Comprehensive benchmarking shows that the combinations presented here are very accurate for weakly correlated systems, while also providing a reasonable description of strongly correlated problems without resorting to symmetry breaking.
Generalized isobaric multiplet mass equation and its application to the Nolen-Schiffer anomaly
NASA Astrophysics Data System (ADS)
Dong, J. M.; Zhang, Y. H.; Zuo, W.; Gu, J. Z.; Wang, L. J.; Sun, Y.
2018-02-01
The Wigner isobaric multiplet mass equation (IMME) is the most fundamental prediction in nuclear physics with the concept of isospin. However, it was deduced based on the Wigner-Eckart theorem with the assumption that all charge-violating interactions can be written as tensors of rank two. In the present work, the charge-symmetry breaking (CSB) and charge-independent breaking (CIB) components of the nucleon-nucleon force, which contribute to the effective interaction in nuclear medium, are established in the framework of Brueckner theory with AV18 and AV14 bare interactions. Because such charge-violating components can no longer be expressed as an irreducible tensor due to density dependence, its matrix element cannot be analytically reduced by the Wigner-Eckart theorem. With an alternative approach, we derive a generalized IMME (GIMME) that modifies the coefficients of the original IMME. As the first application of GIMME, we study the long-standing question of the origin of the Nolen-Schiffer anomaly (NSA) found in the Coulomb displacement energy of mirror nuclei. We find that the naturally emerged CSB term in GIMME is largely responsible for explaining the NSA.
NASA Astrophysics Data System (ADS)
1995-04-01
The following topics were dealt with: string theory, gauge theory, quantum gravity, quantum geometry, black hole physics and information loss, second quantisation of the Wilson loop, 2D Yang-Mills theory, topological field theories, equivariant cohomology, superstring theory and fermion masses, supergravity, topological gravity, waves in string cosmology, superstring theories, 4D space-time.
Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space
ERIC Educational Resources Information Center
Fukawa-Connelly, Timothy Patrick; Newton, Charlene
2014-01-01
Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…
NASA Astrophysics Data System (ADS)
Gilio, Mattia; Clos, Frediano; Van Roermund, Herman L. M.
2013-04-01
The Scandinavian Caledonides (SC) are a deeply eroded Alpine-type orogenic belt formed by closure of the Iapetus ocean and collision between Baltica and Laurentia (500-380 Ma). The SC consists of a stack of Nappe Complexes (from bottom to top called Lower, Middle, Upper and Uppermost Allochthons) thrusted to the east over the Baltic Shield (Brueckner and Van Roermund, 2004; Gee et al., 2008). Fossil lithospheric mantle fragments, called orogenic peridotites, have been found within the (upper part of) middle, upper and uppermost Allochthons, as well as in the reworked basement gneisses (a.o Western Gneiss Complex (WGC)) along the Norwegian west coast. They occur as isolated lenses that contain diverse mineral parageneses and/or bulk rock compositions. Crustal incorporation of orogenic peridotite is classically interpreted to be the result of plate collisional processes related to orogeny (Brueckner and Medaris, 2000). The WGC and parts of the upper part of the Middle Allochthon (a.o. Seve Nappe Complex (SNC) in N Jämtland/S Västerbotten, central Sweden), are well known for the occurrence of high (HP) and ultrahigh pressure (UHP) metamorphic terranes (of Caledonian age). The (U)HPM evidence clearly demonstrates the deep metamorphic origin of these rocks interpreted to be caused by continental subduction and/or collision. Other metamorphic rocks (of Caledonian age) exposed in allochthonous nappes are solely characterised by greenschist-, amphibolite- and/or MP granulite "facies" mineral assemblages that can be interpreted, in the absence of retrogression, to have formed in less deeply subducted (and/or metamorphic) environments. This duality in metamorphic "facies" allows for a discrimination (at least theoretically) between "deep" versus "shallow" rooted nappes (in central parts of the Scandinavian Caledonides). Conform this reasoning, this duality should also be present within the Caledonian mineral assemblages (= metamorphic overprint) of orogenic peridotites (in
How to Map Theory: Reliable Methods Are Fruitless Without Rigorous Theory.
Gray, Kurt
2017-09-01
Good science requires both reliable methods and rigorous theory. Theory allows us to build a unified structure of knowledge, to connect the dots of individual studies and reveal the bigger picture. Some have criticized the proliferation of pet "Theories," but generic "theory" is essential to healthy science, because questions of theory are ultimately those of validity. Although reliable methods and rigorous theory are synergistic, Action Identification suggests psychological tension between them: The more we focus on methodological details, the less we notice the broader connections. Therefore, psychology needs to supplement training in methods (how to design studies and analyze data) with training in theory (how to connect studies and synthesize ideas). This article provides a technique for visually outlining theory: theory mapping. Theory mapping contains five elements, which are illustrated with moral judgment and with cars. Also included are 15 additional theory maps provided by experts in emotion, culture, priming, power, stress, ideology, morality, marketing, decision-making, and more (see all at theorymaps.org ). Theory mapping provides both precision and synthesis, which helps to resolve arguments, prevent redundancies, assess the theoretical contribution of papers, and evaluate the likelihood of surprising effects.
Changing theories of change: strategic shifting in implicit theory endorsement.
Leith, Scott A; Ward, Cindy L P; Giacomin, Miranda; Landau, Enoch S; Ehrlinger, Joyce; Wilson, Anne E
2014-10-01
People differ in their implicit theories about the malleability of characteristics such as intelligence and personality. These relatively chronic theories can be experimentally altered, and can be affected by parent or teacher feedback. Little is known about whether people might selectively shift their implicit beliefs in response to salient situational goals. We predicted that, when motivated to reach a desired conclusion, people might subtly shift their implicit theories of change and stability to garner supporting evidence for their desired position. Any motivated context in which a particular lay theory would help people to reach a preferred directional conclusion could elicit shifts in theory endorsement. We examine a variety of motivated situational contexts across 7 studies, finding that people's theories of change shifted in line with goals to protect self and liked others and to cast aspersions on disliked others. Studies 1-3 demonstrate how people regulate their implicit theories to manage self-view by more strongly endorsing an incremental theory after threatening performance feedback or memories of failure. Studies 4-6 revealed that people regulate the implicit theories they hold about favored and reviled political candidates, endorsing an incremental theory to forgive preferred candidates for past gaffes but leaning toward an entity theory to ensure past failings "stick" to opponents. Finally, in Study 7, people who were most threatened by a previously convicted child sex offender (i.e., parents reading about the offender moving to their neighborhood) gravitated most to the entity view that others do not change. Although chronic implicit theories are undoubtedly meaningful, this research reveals a previously unexplored source of fluidity by highlighting the active role people play in managing their implicit theories in response to goals. 2014 APA, all rights reserved
Toda theories as contractions of affine Toda theories
NASA Astrophysics Data System (ADS)
Aghamohammadi, A.; Khorrami, M.; Shariati, A.
1996-02-01
Using a contraction procedure, we obtain Toda theories and their structures, from affine Toda theories and their corresponding structures. By structures, we mean the equation of motion, the classical Lax pair, the boundary term for half line theories, and the quantum transfer matrix. The Lax pair and the transfer matrix so obtained, depend nontrivially on the spectral parameter.
Generalizability Theory and Classical Test Theory
ERIC Educational Resources Information Center
Brennan, Robert L.
2011-01-01
Broadly conceived, reliability involves quantifying the consistencies and inconsistencies in observed scores. Generalizability theory, or G theory, is particularly well suited to addressing such matters in that it enables an investigator to quantify and distinguish the sources of inconsistencies in observed scores that arise, or could arise, over…
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
Critical Thinking in Adulthood.
ERIC Educational Resources Information Center
Fulton, Rodney D.
Critical thinking is often defined as that which a particular instrument measures. The most prominent tests are the Watson-Glaser Critical Thinking Appraisal, the Ennis-Weir Critical Thinking Essay Test, and the Cornell Critical Thinking Tests. Watson and Glaser's (1980) view of critical thinking is "a composite of attitudes, knowledge, and…
G-theory: The generator of M-theory and supersymmetry
NASA Astrophysics Data System (ADS)
Sepehri, Alireza; Pincak, Richard
2018-04-01
In string theory with ten dimensions, all Dp-branes are constructed from D0-branes whose action has two-dimensional brackets of Lie 2-algebra. Also, in M-theory, with 11 dimensions, all Mp-branes are built from M0-branes whose action contains three-dimensional brackets of Lie 3-algebra. In these theories, the reason for difference between bosons and fermions is unclear and especially in M-theory there is not any stable object like stable M3-branes on which our universe would be formed on it and for this reason it cannot help us to explain cosmological events. For this reason, we construct G-theory with M dimensions whose branes are formed from G0-branes with N-dimensional brackets. In this theory, we assume that at the beginning there is nothing. Then, two energies, which differ in their signs only, emerge and produce 2M degrees of freedom. Each two degrees of freedom create a new dimension and then M dimensions emerge. M-N of these degrees of freedom are removed by symmetrically compacting half of M-N dimensions to produce Lie-N-algebra. In fact, each dimension produces a degree of freedom. Consequently, by compacting M-N dimensions from M dimensions, N dimensions and N degrees of freedom is emerged. These N degrees of freedoms produce Lie-N-algebra. During this compactification, some dimensions take extra i and are different from other dimensions, which are known as time coordinates. By this compactification, two types of branes, Gp and anti-Gp-branes, are produced and rank of tensor fields which live on them changes from zero to dimension of brane. The number of time coordinates, which are produced by negative energy in anti-Gp-branes, is more sensible to number of times in Gp-branes. These branes are compactified anti-symmetrically and then fermionic superpartners of bosonic fields emerge and supersymmetry is born. Some of gauge fields play the role of graviton and gravitino and produce the supergravity. The question may arise that what is the physical reason
Dufwenberg, Martin
2011-03-01
Game theory is a toolkit for examining situations where decision makers influence each other. I discuss the nature of game-theoretic analysis, the history of game theory, why game theory is useful for understanding human psychology, and why game theory has played a key role in the recent explosion of interest in the field of behavioral economics. WIREs Cogni Sci 2011 2 167-173 DOI: 10.1002/wcs.119 For further resources related to this article, please visit the WIREs website. Copyright © 2010 John Wiley & Sons, Ltd.
Educational Technologists: Leading Change for a New Paradigm of Education
ERIC Educational Resources Information Center
Aslan, Sinem; Reigeluth, Charles M.
2013-01-01
The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…
ERIC Educational Resources Information Center
Watson, David
2014-01-01
In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…
Systemic Thinking in Career Development Theory: Contributions of the Systems Theory Framework
ERIC Educational Resources Information Center
McMahon, Mary; Patton, Wendy
2018-01-01
This article considers systemic thinking in relation to the Systems Theory Framework (STF) and to career theory. An overview of systems theory and its applications is followed by a discussion of career theory to provide a context for the subsequent description of STF. The contributions of STF to career theory and to theory integration are…
Reasoning about beliefs: a human specialization?
Povinelli, D J; Giambrone, S
2001-01-01
A recent meta-analysis performed by Wellman, Cross, and Watson clears the air surrounding young children's performance on tests of false belief by showing that it is highly likely that there is some type of conceptual development between 3 and 5 years of age that supports improved task performance. The data concerning the evolutionary origin of these abilities, however, is considerably less clear. Nonetheless, there is some reason to suspect that theory of mind is unique to our species, and that its original function was to provide a more abstract level of describing ancient behavioral patterns (such as deception, reconciliation, and gaze following)-behaviors that humans share in common with many other species. Thus, the initial selective advantage of theory of mind may have been because it increased the flexibility of already-existing behaviors, not because it generated scores of radically new ones.
"Fathers" and "sons" of theories in cell physiology: the membrane theory.
Matveev, V V; Wheatley, D N
2005-12-16
The last 50 years in the history of life sciences are remarkable for a new important feature that looks as a great threat for their future. A profound specialization dominating in quickly developing fields of science causes a crisis of the scientific method. The essence of the method is a unity of two elements, the experimental data and the theory that explains them. To us, "fathers" of science, classically, were the creators of new ideas and theories. They were the true experts of their own theories. It is only they who have the right to say: "I am the theory". In other words, they were carriers of theories, of the theoretical knowledge. The fathers provided the necessary logical integrity to their theories, since theories in biology have still to be based on strict mathematical proofs. It is not true for sons. As a result of massive specialization, modern experts operate in very confined close spaces. They formulate particular rules far from the level of theory. The main theories of science are known to them only at the textbook level. Nowadays, nobody can say: "I am the theory". With whom, then is it possible to discuss today on a broader theoretical level? How can a classical theory--for example, the membrane one--be changed or even disproved under these conditions? How can the "sons" with their narrow education catch sight of membrane theory defects? As a result, "global" theories have few critics and control. Due to specialization, we have lost the ability to work at the experimental level of biology within the correct or appropriate theoretical context. The scientific method in its classic form is now being rapidly eroded. A good case can be made for "Membrane Theory", to which we will largely refer throughout this article.
Critical Theory: Implications for School Leadership Theory and Practice.
ERIC Educational Resources Information Center
Peca, Kathy
The school leader's behaviors are inspired by theories, and theories are intrinsic to practice. This paper provides an overview of an emerging perspective in educational administration, critical theory. The paper first highlights the philosophies of Immanuel Kant, Fichte, Hegel, Marx, and the Frankfurt School. It then discusses critical theory…
NORMATIVE ACCOUNTING THEORY AND THE THEORY OF DECISION,
The paper discusses an approach to the construction of normative accounting theory with respect to both methodology and substance. The method of...postulation and deduction is outlined, with particular emphasis on its role in the social sciences in general and in accounting in particular. It is...suggested that a formal link must be established between the (normative) theory of decision and accounting , and that rigorous (economic) theories of the
Administrative Attribution Theory.
ERIC Educational Resources Information Center
Frasher, James M.; Frasher, Ramona S.
1981-01-01
Hypothesizes that the growing body of empirical data concerning attribution theory offers insight into the administrative process. To stimulate research to test this hypothesis, presents previous relevant research and a theory entitled Administrative Attribution Theory. Research questions applying the theory to educational administration are…
Contrasting Ohlsson's Resubsumption Theory with Chi's Categorical Shift Theory
ERIC Educational Resources Information Center
Chi, Michelene T. H.; Brem, Sarah K.
2009-01-01
Ohlsson's proposal of resubsumption as the dominant process in conceptual, or nonmonotonic, change presents a worthy challenge to more established theories, such as Chi's theory of ontological shift. The two approaches differ primarily in that Ohlsson's theory emphasizes a process of learning in which narrower, more specific concepts are subsumed…
Informal Theory: The Ignored Link in Theory-to-Practice
ERIC Educational Resources Information Center
Love, Patrick
2012-01-01
Applying theory to practice in student affairs is dominated by the assumption that formal theory is directly applied to practice. Among the problems with this assumption is that many practitioners believe they must choose between their lived experiences and formal theory, and that graduate students are taught that their experience "does not…
ERIC Educational Resources Information Center
Moore, J.
2011-01-01
Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…
Music Technology and Musical Creativity: Making Connections
ERIC Educational Resources Information Center
Thompson, Douglas Earl
2012-01-01
This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…
Bringing Precision Medicine to Community Oncologists.
2017-01-01
Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.
Extreme Scale Computing Studies
2010-12-01
PUBLICATION IN ACCORDANCE WITH ASSIGNED DISTRIBUTION STATEMENT. *//Signature// //Signature// KERRY HILL, Program Manager BRADLEY J ...Research Institute William Carlson Institute for Defense Analyses William Dally Stanford University Monty Denneau IBM T. J . Watson Research...for Defense Analyses William Dally, Stanford University Monty Denneau, IBM T. J . Watson Research Laboratories Paul Franzon, North Carolina State
Drawing Out Theory: Art and the Teaching of Political Theory.
ERIC Educational Resources Information Center
Miller, Char R.
2000-01-01
Discusses how to use art in introductory political theory courses. Provides examples of incorporating art to teach political theory, such as examining Machiavelli's "The Prince" and Michelangelo's "David" to understand Florentine (Florence, Italy) political theory. (CMK)
Contributions of treatment theory and enablement theory to rehabilitation research and practice.
Whyte, John
2014-01-01
Scientific theory is crucial to the advancement of clinical research. The breadth of rehabilitation treatment requires that many different theoretical perspectives be incorporated into the design and testing of treatment interventions. In this article, the 2 broad classes of theory relevant to rehabilitation research and practice are defined, and their distinct but complementary contributions to research and clinical practice are explored. These theory classes are referred to as treatment theories (theories about how to effect change in clinical targets) and enablement theories (theories about how changes in a proximal clinical target will influence distal clinical aims). Treatment theories provide the tools for inducing clinical change but do not specify how far reaching the ultimate impact of the change will be. Enablement theories model the impact of changes on other areas of function but provide no insight as to how treatment can create functional change. Treatment theories are more critical in the early stages of treatment development, whereas enablement theories become increasingly relevant in specifying the clinical significance and practical effectiveness of more mature treatments. Understanding the differences in the questions these theory classes address and how to combine their insights is crucial for effective research development and clinical practice. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
ERIC Educational Resources Information Center
Apsche, Jack A.
2005-01-01
In his work on the Theory of Modes, Beck (1996) suggested that there were flaws with his cognitive theory. He suggested that though there are shortcomings to his cognitive theory, there were not similar shortcomings to the practice of Cognitive Therapy. The author suggests that if there are shortcomings to cognitive theory the same shortcomings…
Learning Theories, Career Development Theories, and Their Applications at Two-Year Colleges.
ERIC Educational Resources Information Center
Haag-Mutter, Priscilla
Trait-factor theory, developmental/self-concept theory, personality theory, and behavioral theory are some of the major theories of career development. The first three (trait-factor, developmental/self-concept, and personality) have ties to the gestalt school because of the emphasis on the individual's relationship to the environment. Anne Roe's…
[Consanguinity between meridian theory and Bianque's pulse theory].
Huang, Longxiang
2015-05-01
The integral meridian theory is composed of five parts, including meridian course, syndrome, diagnostic method, treating principle and treatment, and the core of it is meridian syndrome. It has been proved by multiple evidences that the meridian syndrome induced by the pathological change in meridian and the death syndrome of pulse penetrating or attaching to the syndrome are all originated from Bianque' s facial color and pulse diagnosis. And regarding the pulse syndrome,there are many different interpretations based on the theory of yin-yang in four seasons before the Han Dynasty. The emerging of Biaoben diagnostic method in Bianque's pulse method and its extensive clinical application promote a new theoretic interpretation the connection of meridians interpreting pulse syndrome directly. Besides, along with the new development of blood-pulse theory of Bianque's medicine, the revolution on meridian theory is aroused as well its theoretical paradigm turning from "tree" type to "ring" type. In other words, Bianque's medicine not only gives birth to meridian theory, but also decides its final development.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sanfilippo, Antonio P.
2005-12-27
Graph theory is a branch of discrete combinatorial mathematics that studies the properties of graphs. The theory was pioneered by the Swiss mathematician Leonhard Euler in the 18th century, commenced its formal development during the second half of the 19th century, and has witnessed substantial growth during the last seventy years, with applications in areas as diverse as engineering, computer science, physics, sociology, chemistry and biology. Graph theory has also had a strong impact in computational linguistics by providing the foundations for the theory of features structures that has emerged as one of the most widely used frameworks for themore » representation of grammar formalisms.« less
[The anthropic principle in biology and radiobiology].
Akif'ev, A P; Degtiarev, S V
1999-01-01
In accordance with the anthropic principle of the Universe the physical constants of fundamental particles of matter and the laws of their counteraction are those that an appearance of man and mind becomes possible and necessary. It is suggested to add some biological constants to the set of fundamental constants. With reparation of DNA as an example it was shown how a cell ran some parameters of Watson-Crick double helix. It was pointed that the concept of the anthropic principle of the Universe in its full body including biological constants is a key to developing of a unified theory of evolution of the Universe within the limits of scientific creationism.
A History and Overview of the Behavioral Neuroscience of Learning and Memory.
Clark, Robert E
2018-01-01
Here, I provide a basic history of important milestones in the development of theories for how the brain accomplishes the phenomenon of learning and memory. Included are the ideas of Plato, René Descartes, Théodule Ribot, William James, Ivan Pavlov, John Watson, Karl Lashley, and others. The modern era of learning and memory research begins with the description of H.M. by Brenda Milner and the gradual discovery that the brain contains multiple learning and memory systems that are supported by anatomically discrete brain structures. Finally, a brief overview is provided for the chapters that are included in current topics in Behavioral Neuroscience-Learning and Memory.
A History and Overview of the Behavioral Neuroscience of Learning and Memory.
Clark, Robert E
2018-01-05
Here, I provide a basic history of important milestones in the development of theories for how the brain accomplishes the phenomenon of learning and memory. Included are the ideas of Plato, René Descartes, Théodule Ribot, William James, Ivan Pavlov, John Watson, Karl Lashley, and others. The modern era of learning and memory research begins with the description of H.M. by Brenda Milner and the gradual discovery that the brain contains multiple learning and memory systems that are supported by anatomically discrete brain structures. Finally, a brief overview is provided for the chapters that are included in current topics in Behavioral Neuroscience-Learning and Memory.
Use of Edible Laminate Layers in Intermediate Moisture Food Rations to Inhibit Moisture Migration
2016-04-29
methylcellulose, propylene glycol, citric acid, modified starch , white beeswax Water resistant coating on one side Watson, Inc. Dual-sided HPMC moisture...barrier film Hydroxypropyl methylcellulose, propylene glycol, citric acid, modified starch , white beeswax Water resistant coating on both sides...Moisture Barrier (BWMB) film #1 Pullulan*, beeswax, glycerin, propylene glycol, starch , polysorbate 80 Water soluble Watson, Inc. Pullulan BWMB film
ERIC Educational Resources Information Center
Watson, Derrick G.; Kunar, Melina A.
2010-01-01
Visual search efficiency improves by presenting (previewing) one set of distractors before the target and remaining distractor items (D. G. Watson & G. W. Humphreys, 1997). Previous work has shown that this preview benefit is abolished if the old items change their shape when the new items are added (e.g., D. G. Watson & G. W. Humphreys,…
Code of Federal Regulations, 2010 CFR
2010-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Code of Federal Regulations, 2011 CFR
2011-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Code of Federal Regulations, 2014 CFR
2014-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Code of Federal Regulations, 2012 CFR
2012-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Code of Federal Regulations, 2013 CFR
2013-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
ERIC Educational Resources Information Center
Willis, Derek W.
2010-01-01
This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…
NASA Astrophysics Data System (ADS)
Pries-Heje, Jan; Baskerville, Richard L.
This paper elaborates a design science approach for management planning anchored to the concept of a management design theory. Unlike the notions of design theories arising from information systems, management design theories can appear as a system of technological rules, much as a system of hypotheses or propositions can embody scientific theories. The paper illus trates this form of management design theories with three grounded cases. These grounded cases include a software process improvement study, a user involvement study, and an organizational change study. Collectively these studies demonstrate how design theories founded on technological rules can not only improve the design of information systems, but that these concepts have great practical value for improving the framing of strategic organi zational design decisions about such systems. Each case is either grounded in an empirical sense, that is to say, actual practice, or it is grounded to practices described extensively in the practical literature. Such design theories will help managers more easily approach complex, strategic decisions.
Constructor theory of probability
2016-01-01
Unitary quantum theory, having no Born Rule, is non-probabilistic. Hence the notorious problem of reconciling it with the unpredictability and appearance of stochasticity in quantum measurements. Generalizing and improving upon the so-called ‘decision-theoretic approach’, I shall recast that problem in the recently proposed constructor theory of information—where quantum theory is represented as one of a class of superinformation theories, which are local, non-probabilistic theories conforming to certain constructor-theoretic conditions. I prove that the unpredictability of measurement outcomes (to which constructor theory gives an exact meaning) necessarily arises in superinformation theories. Then I explain how the appearance of stochasticity in (finitely many) repeated measurements can arise under superinformation theories. And I establish sufficient conditions for a superinformation theory to inform decisions (made under it) as if it were probabilistic, via a Deutsch–Wallace-type argument—thus defining a class of decision-supporting superinformation theories. This broadens the domain of applicability of that argument to cover constructor-theory compliant theories. In addition, in this version some of the argument's assumptions, previously construed as merely decision-theoretic, follow from physical properties expressed by constructor-theoretic principles. PMID:27616914
Generalized probability theories: what determines the structure of quantum theory?
NASA Astrophysics Data System (ADS)
Janotta, Peter; Hinrichsen, Haye
2014-08-01
The framework of generalized probabilistic theories is a powerful tool for studying the foundations of quantum physics. It provides the basis for a variety of recent findings that significantly improve our understanding of the rich physical structure of quantum theory. This review paper tries to present the framework and recent results to a broader readership in an accessible manner. To achieve this, we follow a constructive approach. Starting from a few basic physically motivated assumptions we show how a given set of observations can be manifested in an operational theory. Furthermore, we characterize consistency conditions limiting the range of possible extensions. In this framework classical and quantum theory appear as special cases, and the aim is to understand what distinguishes quantum mechanics as the fundamental theory realized in nature. It turns out that non-classical features of single systems can equivalently result from higher-dimensional classical theories that have been restricted. Entanglement and non-locality, however, are shown to be genuine non-classical features.
Religion, evolution, and mental health: attachment theory and ETAS theory.
Flannelly, Kevin J; Galek, Kathleen
2010-09-01
This article reviews the historical origins of Attachment Theory and Evolutionary Threat Assessment Systems Theory (ETAS Theory), their evolutionary basis and their application in research on religion and mental health. Attachment Theory has been most commonly applied to religion and mental health in research on God as an attachment figure, which has shown that secure attachment to God is positively associated with psychological well-being. Its broader application to religion and mental health is comprehensively discussed by Kirkpatrick (2005). ETAS Theory explains why certain religious beliefs--including beliefs about God and life-after-death--should have an adverse association, an advantageous association, or no association at all with mental health. Moreover, it makes specific predictions to this effect, which have been confirmed, in part. The authors advocate the application of ETAS Theory in research on religion and mental health because it explains how religious and other beliefs related to the dangerousness of the world can directly affect psychiatric symptoms through their affects on specific brain structures.
Levy, Florence
2007-11-01
The purpose of the present paper was to review psychological theories of autism, and to integrate these theories with neurobiological findings. Cognitive, theory of mind, language and coherence theories were identified, and briefly reviewed. Psychological theories were found not to account for the rigid/repetitive behaviours universally described in autistic subjects, and underlying neurobiological systems were identified. When the developing brain encounters constrained connectivity, it evolves an abnormal organization, the features of which may be best explained by a developmental failure of neural connectivity, where high local connectivity develops in tandem with low long-range connectivity, resulting in constricted repetitive behaviours.
2010-10-05
Cargill et al. 2006; Linton and Longcope 2006; Onofri, Isliker, & Vlahos , L. 2006, Vršnak et al. 2009). A second difficulty comes from the very nature of...Brueckner G. E., Howard, R. A., Koomen, M. J., et al., 1995, SoPh, 162, 357 Cargill P. J., Vlahos L., Turkmani R., Galsgaard K., Isliker H., 2006, SSRv, 124...ApJ, 642, 1177 Litvinenko, Y. E. 1996, ApJ, 462, 997 McKenzie D. E., Hudson H. S., 1999, ApJ, 519, L93 Onofri, M., Isliker, H., & Vlahos , L. 2006
Toward Understanding the Early Stags of an Impulsively Accelerated Coronal Mass Ejection
2010-08-09
B. E., & Howard, R. A . 2009, ApJ, 702, 901 Wood, B. E., Karovska , M., Chen, J., Brueckner, G. E., Cook, J. W., & Howard, R. A . 1999, ApJ, 512, 484...ar X iv :1 00 8. 11 71 v1 [ as tr o- ph .S R ] 6 A ug 2 01 0 Astronomy & Astrophysics manuscript no. bubble c© ESO 2010 August 9, 2010 Toward...understanding the early stages of an impulsively accelerated coronal mass ejection SECCHI observations S. Patsourakos1, A . Vourlidas2, and B. Kliem3,4
On the way to a microscopic derivation of covariant density functionals in nuclei
NASA Astrophysics Data System (ADS)
Ring, Peter
2018-02-01
Several methods are discussed to derive covariant density functionals from the microscopic input of bare nuclear forces. In a first step there are semi-microscopic functionals, which are fitted to ab-initio calculations of nuclear matter and depend in addition on very few phenomenological parameters. They are able to describe nuclear properties with the same precision as fully phenomenological functionals. In a second step we present first relativistic Brueckner-Hartree-Fock calculations in finite nuclei in order to study properties of such functionals, which cannot be obtained from nuclear matter calculations.
1990-02-21
LIDS-P-1953 Multiscale System Theory Albert Benveniste IRISA-INRIA, Campus de Beaulieu 35042 RENNES CEDEX, FRANCE Ramine Nikoukhah INRIA...TITLE AND SUBTITLE Multiscale System Theory 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e...the development of a corresponding system theory and a theory of stochastic processes and their estimation. The research presented in this and several
Conformal field theories from deformations of theories with Wn symmetry
NASA Astrophysics Data System (ADS)
Babaro, Juan Pablo; Giribet, Gaston; Ranjbar, Arash
2016-10-01
We construct a set of nonrational conformal field theories that consist of deformations of Toda field theory for s l (n ). In addition to preserving conformal invariance, the theories may still exhibit a remnant infinite-dimensional affine symmetry. The case n =3 is used to illustrate this phenomenon, together with further deformations that yield enhanced Kac-Moody symmetry algebras. For generic n we compute N -point correlation functions on the Riemann sphere and show that these can be expressed in terms of s l (n ) Toda field theory ((N -2 )n +2 ) -point correlation functions.
Naylor, Ron
2007-03-01
The aim of Galileo's tidal theory was to show that the tides were produced entirely by the earth's motion and thereby to demonstrate the physical truth of Copernicanism. However, in the Dialogue Concerning the Two Chief World Systems Galileo did not explain some of the most significant aspects of the theory completely. As a consequence, the way the theory works has long been disputed. Though there exist a number of interpretations in the literature, the most widely accepted are based on ideas that are not explicitly articulated by Galileo in the Dialogue. This essay attempts to understand the way the theory functions in terms of Galilean physics. It is an interpretation of the theory based solely on Galileo's arguments--and one that reveals it to have had some unrecognized consequences. This interpretation indicates that Galileo's theory would not have worked in the manner he described in the Dialogue.
NASA Technical Reports Server (NTRS)
Owre, Sam; Shankar, Natarajan; Butler, Ricky W. (Technical Monitor)
2001-01-01
The purpose of this task was to provide a mechanism for theory interpretations in a prototype verification system (PVS) so that it is possible to demonstrate the consistency of a theory by exhibiting an interpretation that validates the axioms. The mechanization makes it possible to show that one collection of theories is correctly interpreted by another collection of theories under a user-specified interpretation for the uninterpreted types and constants. A theory instance is generated and imported, while the axiom instances are generated as proof obligations to ensure that the interpretation is valid. Interpretations can be used to show that an implementation is a correct refinement of a specification, that an axiomatically defined specification is consistent, or that a axiomatically defined specification captures its intended models. In addition, the theory parameter mechanism has been extended with a notion of theory as parameter so that a theory instance can be given as an actual parameter to an imported theory. Theory interpretations can thus be used to refine an abstract specification or to demonstrate the consistency of an axiomatic theory. In this report we describe the mechanism in detail. This extension is a part of PVS version 3.0, which will be publicly released in mid-2001.
Connecting Relational Theory and the Systems Theory Framework: Individuals and Their Systems
ERIC Educational Resources Information Center
Patton, Wendy
2007-01-01
The Systems Theory Framework (STF) facilitates the inclusion of relevant aspects of multiple existing theories within an integrated framework, wherein relevance and meaning is decided upon by each individual. Patton and McMahon emphasise that the application of the Systems Theory Framework in integrating theory and practice is located within the…
Cooney, Adeline
2011-01-01
This paper explores ways to enhance and demonstrate rigour in a grounded theory study. Grounded theory is sometimes criticised for a lack of rigour. Beck (1993) identified credibility, auditability and fittingness as the main standards of rigour for qualitative research methods. These criteria were evaluated for applicability to a Straussian grounded theory study and expanded or refocused where necessary. The author uses a Straussian grounded theory study (Cooney, In press) to examine how the revised criteria can be applied when conducting a grounded theory study. Strauss and Corbin (1998b) criteria for judging the adequacy of a grounded theory were examined in the context of the wider literature examining rigour in qualitative research studies in general and grounded theory studies in particular. A literature search for 'rigour' and 'grounded theory' was carried out to support this analysis. Criteria are suggested for enhancing and demonstrating the rigour of a Straussian grounded theory study. These include: cross-checking emerging concepts against participants' meanings, asking experts if the theory 'fit' their experiences, and recording detailed memos outlining all analytical and sampling decisions. IMPLICATIONS FOR RESEARCH PRACTICE: The criteria identified have been expressed as questions to enable novice researchers to audit the extent to which they are demonstrating rigour when writing up their studies. However, it should not be forgotten that rigour is built into the grounded theory method through the inductive-deductive cycle of theory generation. Care in applying the grounded theory methodology correctly is the single most important factor in ensuring rigour.
AdS/CFT in string theory and M-theory
NASA Astrophysics Data System (ADS)
Gulotta, Daniel R.
The AdS/CFT correspondence is a powerful tool that can help shed light on the relationship between geometry and field theory. The first part of this thesis will focus on the construction of theories dual to Type IIB string theory on AdS5 × Y5, where Y5 is a toric Sasaki-Einstein manifold. This thesis will introduce a consistency condition called ``proper ordering'' and demonstrate that it is equivalent to several other previously known consistency conditions. It will then give an efficient algorithm that produces a consistent field theory for any toric Sasaki-Einstein Y5. The second part of this thesis will examine the large-N limit of the Kapustin-Willett-Yaakov matrix model. This model computes the S3 partition function for a CFT dual to M-theory on AdS4 × Y7. One of the main results will be a formula that relates the distribution of eigenvalues in the matrix model to the distribution of holomorphic operators on the cone over Y7. A variety of examples are given to support this formula.
Developing a Domain Theory Defining and Exemplifying a Learning Theory of Progressive Attainments
ERIC Educational Resources Information Center
Bunderson, C. Victor
2011-01-01
This article defines the concept of Domain Theory, or, when educational measurement is the goal, one might call it a "Learning Theory of Progressive Attainments in X Domain". The concept of Domain Theory is first shown to be rooted in validity theory, then the concept of domain theory is expanded to amplify its necessary but long neglected…
Petrenko, Y M
2015-01-01
Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.
Spatial Autocorrelation Approaches to Testing Residuals from Least Squares Regression
Chen, Yanguang
2016-01-01
In geo-statistics, the Durbin-Watson test is frequently employed to detect the presence of residual serial correlation from least squares regression analyses. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the test will be ineffectual because the value of Durbin-Watson’s statistic depends on the sequence of data points. This paper develops two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran’s index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then by analogy with the Durbin-Watson statistic, two types of new serial correlation indices are constructed. As a case study, the two newly presented statistics are applied to a spatial sample of 29 China’s regions. These results show that the new spatial autocorrelation models can be used to test the serial correlation of residuals from regression analysis. In practice, the new statistics can make up for the deficiencies of the Durbin-Watson test. PMID:26800271
Shkalim, Eleanor; Almagor, Moshe; Ben-Porath, Yossef S
2017-01-01
Watson ( 2005 ) proposed a hierarchical reorganization of the underlying structure of emotional disorders. This study cross-culturally evaluated Watson's (2005) structure of mood and anxiety disorders, using mainly dichotomous criteria, and explored the placement of obsessive-compulsive disorder (OCD) in this model. It also tested Sellbom, Ben-Porath, and Bagby's (2008) proposed elaboration of the 2-factor model (positive and negative activation) that incorporates a higher order dimension of demoralization. One hundred men and 133 women from psychiatric settings in Israel completed the Minnesota Multiphasic Personality Inventory-2 (Butcher et al., 2001 ) and the Maudsley Obsessional-Compulsive Inventory (Hodgson & Rachman, 1977 ). They were interviewed using the Mini International Neuropsychiatric Interview (Sheehan et al., 1998 ). Confirmatory factor analyses replicated Watson's structure for women but not for men. Mixed results were obtained regarding OCD's location in the model. Findings among women support the applicability of Watson's (2005) model across a variety of assessment modalities, as well as in a different language and for diversified cultural backgrounds. This conclusion, however, should be tempered in consideration of the results among men. Findings also provide evidence of the importance of demoralization in mood and anxiety disorders.
Generalized Causal Quantum Theories
NASA Astrophysics Data System (ADS)
Parmeggiani, Claudio
2007-12-01
We shall show that is always possible to construct causal Quantum Theories fully equivalent (as predictive tools) to acausal, standard Quantum Theory, relativistic or not relativistic; we re-obtain, as a particular case, the usual Quantum Bohmian Theory. Then we consider the measurement process, in causal theories, and we conclude that the state of affairs is not really improved, with respect to standard theories.
From practice to midrange theory and back again: Beck's theory of postpartum depression.
Lasiuk, Gerri C; Ferguson, Linda M
2005-01-01
This article presents a brief overview of theory as background for a more detailed discussion of midrange theory-its origins, the critical role for midrange theory in the development of nursing practice knowledge, and the criteria for evaluating midrange theory. We then chronicle Cheryl Tatano Beck's program of research on postpartum depression (PPD) and advance the thesis that her theory of PPD, titled Teetering on the Edge, is an exemplar of a substantive midrange nursing theory. We demonstrate Beck's progression from identification of a clinical problem to exploratory-descriptive research, to concept analysis and midrange theory development, and finally to the application and testing of the theory in the clinical setting. Through ongoing refinement and testing of her theory, Beck has increased its generalizability across various practice settings and continually identifies new issues for investigation. Beck's program of research on PPD exemplifies using nursing outcomes to build and test nursing practice knowledge.
Acquisition by Processing Theory: A Theory of Everything?
ERIC Educational Resources Information Center
Carroll, Susanne E.
2004-01-01
Truscott and Sharwood Smith (henceforth T&SS) propose a novel theory of language acquisition, "Acquisition by Processing Theory" (APT), designed to account for both first and second language acquisition, monolingual and bilingual speech perception and parsing, and speech production. This is a tall order. Like any theoretically ambitious…
Three-dimensional gauge theories and gravitational instantons from string theory
NASA Astrophysics Data System (ADS)
Cherkis, Sergey Alexander
Various realizations of gauge theories in string theory allow an identification of their spaces of vacua with gravitational instantons. Also, they provide a correspondence of vacua of gauge theories with nonabelian monopole configurations and solutions of a system of integrable equations called Nahm equations. These identifications make it possible to apply powerful techniques of differential and algebraic geometry to solve the gauge theories in question. In other words, it becomes possible to find the exact metrics on their moduli spaces of vacua with all quantum corrections included. As another outcome we obtain for the first time the description of a series of all Dk-type gravitational instantons.
33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.
Code of Federal Regulations, 2011 CFR
2011-07-01
...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...
33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.
Code of Federal Regulations, 2013 CFR
2013-07-01
...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...
33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.
Code of Federal Regulations, 2014 CFR
2014-07-01
...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...
33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.
Code of Federal Regulations, 2012 CFR
2012-07-01
...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...
NASA Technical Reports Server (NTRS)
Baird, J. K.
1986-01-01
The Ostwald-ripening theory is deduced and discussed starting from the fundamental principles such as Ising model concept, Mayer cluster expansion, Langer condensation point theory, Ginzburg-Landau free energy, Stillinger cutoff-pair potential, LSW-theory and MLSW-theory. Mathematical intricacies are reduced to an understanding version. Comparison of selected works, from 1949 to 1984, on solution of diffusion equation with and without sink/sources term(s) is presented. Kahlweit's 1980 work and Marqusee-Ross' 1954 work are more emphasized. Odijk and Lekkerkerker's 1985 work on rodlike macromolecules is introduced in order to simulate interested investigators.
Integrating Practice-to-Theory and Theory-to-Practice
ERIC Educational Resources Information Center
Johnson, R. Burke; Stefurak, Tres
2012-01-01
In "Towards a systemic theory of gifted education", Ziegler and Phillipson offer a useful critique of current research and the current paradigm in gifted education. They provide an interesting and useful merging of systems theory with their actiotope model, and using this paradigm they suggest many fruitful areas for future research. However, the…
Automated problem list generation and physicians perspective from a pilot study.
Devarakonda, Murthy V; Mehta, Neil; Tsou, Ching-Huei; Liang, Jennifer J; Nowacki, Amy S; Jelovsek, John Eric
2017-09-01
An accurate, comprehensive and up-to-date problem list can help clinicians provide patient-centered care. Unfortunately, problem lists created and maintained in electronic health records by providers tend to be inaccurate, duplicative and out of date. With advances in machine learning and natural language processing, it is possible to automatically generate a problem list from the data in the EHR and keep it current. In this paper, we describe an automated problem list generation method and report on insights from a pilot study of physicians' assessment of the generated problem lists compared to existing providers-curated problem lists in an institution's EHR system. The natural language processing and machine learning-based Watson 1 method models clinical thinking in identifying a patient's problem list using clinical notes and structured data. This pilot study assessed the Watson method and included 15 randomly selected, de-identified patient records from a large healthcare system that were each planned to be reviewed by at least two internal medicine physicians. The physicians created their own problem lists, and then evaluated the overall usefulness of their own problem lists (P), Watson generated problem lists (W), and the existing EHR problem lists (E) on a 10-point scale. The primary outcome was pairwise comparisons of P, W, and E. Six out of the 10 invited physicians completed 27 assessments of P, W, and E, and in process evaluated 732 Watson generated problems and 444 problems in the EHR system. As expected, physicians rated their own lists, P, highest. However, W was rated higher than E. Among 89% of assessments, Watson identified at least one important problem that physicians missed. Cognitive computing systems like this Watson system hold the potential for accurate, problem-list-centered summarization of patient records, potentially leading to increased efficiency, better clinical decision support, and improved quality of patient care. Copyright © 2017
Employing Theories Far beyond Their Limits - Linear Dichroism Theory.
Mayerhöfer, Thomas G
2018-05-15
Using linear polarized light, it is possible in case of ordered structures, such as stretched polymers or single crystals, to determine the orientation of the transition moments of electronic and vibrational transitions. This not only helps to resolve overlapping bands, but also assigning the symmetry species of the transitions and to elucidate the structure. To perform spectral evaluation quantitatively, a sometimes "Linear Dichroism Theory" called approach is very often used. This approach links the relative orientation of the transition moment and polarization direction to the quantity absorbance. This linkage is highly questionable for several reasons. First of all, absorbance is a quantity that is by its definition not compatible with Maxwell's equations. Furthermore, absorbance seems not to be the quantity which is generally compatible with linear dichroism theory. In addition, linear dichroism theory disregards that it is not only the angle between transition moment and polarization direction, but also the angle between sample surface and transition moment, that influences band shape and intensity. Accordingly, the often invoked "magic angle" has never existed and the orientation distribution influences spectra to a much higher degree than if linear dichroism theory would hold strictly. A last point that is completely ignored by linear dichroism theory is the fact that partially oriented or randomly-oriented samples usually consist of ordered domains. It is their size relative to the wavelength of light that can also greatly influence a spectrum. All these findings can help to elucidate orientation to a much higher degree by optical methods than currently thought possible by the users of linear dichroism theory. Hence, it is the goal of this contribution to point out these shortcomings of linear dichroism theory to its users to stimulate efforts to overcome the long-lasting stagnation of this important field. © 2018 Wiley-VCH Verlag GmbH & Co. KGa
Ventegodt, Soren; Merrick, Joav; Andersen, Niels Jorgen
2003-01-01
Quality of life (QOL) means a good life and we believe that a good life is the same as living a life with a high quality. This paper presents the theoretical and philosophical framework of the Danish Quality of Life Survey, and of the SEQOL, QOL5, and QOL1 questionnaires.The notion of a good life can be observed from subjective to the objective, where this spectrum incorporates a number of existing quality of life theories. We call this spectrum the integrative quality-of-life (IQOL) theory and discuss the following aspects in this paper: well being, satisfaction with life, happiness, meaning in life, the biological information system (“balance”), realizing life potential, fulfillment of needs, and objective factors.The philosophy of life outlined in this paper tries to measure the global quality of life with questions derived from the integrative theory of the quality of life. The IQOL theory is an overall theory or meta-theory encompassing eight more factual theories in a subjective-existential-objective spectrum. Other philosophies of life can stress other aspects of life, but by this notion of introducing such an existential depth into the health and social sciences, we believe to have taken a necessary step towards a new humility and respect for the richness and complexity of life. PMID:14570993
Transition operators in electromagnetic-wave diffraction theory - General theory
NASA Technical Reports Server (NTRS)
Hahne, G. E.
1992-01-01
A formal theory is developed for the scattering of time-harmonic electromagnetic waves from impenetrable immobile obstacles with given linear, homogeneous, and generally nonlocal boundary conditions of Leontovich (impedance) type for the wave of the obstacle's surface. The theory is modeled on the complete Green's function and the transition (T) operator in time-independent formal scattering theory of nonrelativistic quantum mechanics. An expression for the differential scattering cross section for plane electromagnetic waves is derived in terms of certain matrix elements of the T operator for the obstacle.
Thermal Theory of Combustion and Explosion. 3; Theory of Normal Flame Propagation
NASA Technical Reports Server (NTRS)
Semenov, N. N.
1942-01-01
The technical memorandum covers experimental data on flame propagation, the velocity of flame propagation, analysis of the old theoretical views of flame propagation, confirmation of the theory for simple reactions (theory of combustion of explosive substances and in particular nitroglycol), and check of the theory by example of a chain oxidizing reaction (theory of flame propagation in carbon monoxide, air and carbon monoxide - oxygen mixtures).
Kline, A David
2006-04-01
The received account of whistleblowing, developed over the last quarter century, is identified with the work of Norman Bowie and Richard DeGeorge. Michael Davis has detailed three anomalies for the received view: the paradoxes of burden, missing harm and failure. In addition, he has proposed an alternative account of whistleblowing, viz., the Complicity Theory. This paper examines the Complicity Theory. The supposed anomalies rest on misunderstandings of the received view or misreadings of model cases of whistleblowing, for example, the Challenger disaster and the Ford Pinto. Nevertheless, the Complicity Theory is important for as in science the contrast with alternative competing accounts often helps us better understand the received view. Several aspects of the received view are reviewed and strengthened through comparison with Complicity Theory, including why whistleblowing needs moral justification. Complicity Theory is also critiqued. The fundamental failure of Complicity Theory is its failure to explain why government and the public encourage and protect whistleblowers despite the possibility of considerable harm to the relevant company in reputation, lost jobs, and lost shareholder value.
Correlations in polymer blends: Simulations, perturbation theory, and coarse-grained theory
NASA Astrophysics Data System (ADS)
Chung, Jun Kyung
A thermodynamic perturbation theory of symmetric polymer blends is developed that properly accounts for the correlation in the spatial arrangement of monomers. By expanding the free energy of mixing in powers of a small parameter alpha which controls the incompatibility of two monomer species, we show that the perturbation theory has the form of the original Flory-Huggins theory, to first order in alpha. However, the lattice coordination number in the original theory is replaced by an effective coordination number. A random walk model for the effective coordination number is found to describe Monte Carlo simulation data very well. We also propose a way to estimate Flory-Huggins chi parameter by extrapolating the perturbation theory to the limit of a hypothetical system of infinitely long chains. The first order perturbation theory yields an accurate estimation of chi to first order in alpha. Going to second order, however, turns out to be more involved and an unambiguous determination of the coefficient of alpha2 term is not possible at the moment. Lastly, we test the predictions of a renormalized one-loop theory of fluctuations using two coarse-grained models of symmetric polymer blends at the critical composition. It is found that the theory accurately describes the correlation effect for relatively small values of chiN. In addition, the universality assumption of coarse-grained models is examined and we find results that are supportive of it.
ERIC Educational Resources Information Center
Cook, Desmond L.
This document, one of a series of reports examining the possible contribution of other disciplines to evaluation methodology, describes the major elements of general systems theory (GST), cybernetics theory (CT) and management control theory (MCT). The author suggests that MCT encapsulates major concerns of evaluation since it reveals that…
Massive neutron star with strangeness in a relativistic mean-field model with a high-density cutoff
NASA Astrophysics Data System (ADS)
Zhang, Ying; Hu, Jinniu; Liu, Peng
2018-01-01
The properties of neutron stars with the strangeness degree of freedom are studied in the relativistic mean-field (RMF) model via including a logarithmic interaction as a function of the scalar meson field. This interaction, named the σ -cut potential, can largely reduce the attractive contributions of the scalar meson field at high density without any influence on the properties of nuclear structure around the normal saturation density. In this work, the TM1 parameter set is chosen as the RMF interaction, while the strengths of σ -cut potential are constrained by the properties of finite nuclei so that we can obtain a reasonable effective nucleon-nucleon interaction. The hyperons Λ ,Σ , and Ξ are considered in neutron stars within this framework, whose coupling constants with mesons are determined by the latest hyperon-nucleon and Λ -Λ potentials extracted from the available experimental data of hypernuclei. The maximum mass of neutron star can be larger than 2 M⊙ with these hyperons in the present framework. Furthermore, the nucleon mass at high density will be saturated due to this additional σ -cut potential, which is consistent with the conclusions obtained by other calculations such as Brueckner-Hartree-Fock theory and quark mean-field model.
NASA Astrophysics Data System (ADS)
Saito, Toru; Nishihara, Satomichi; Yamanaka, Shusuke; Kitagawa, Yasutaka; Kawakami, Takashi; Okumura, Mitsutaka; Yamaguchi, Kizashi
2010-10-01
Mukherjee's type of multireference coupled-cluster (MkMRCC), approximate spin-projected spin-unrestricted CC (APUCC), and AP spin-unrestricted Brueckner's (APUBD) methods were applied to didehydronated ethylene, allyl cation, cis-butadiene, and naphthalene. The focus is on descriptions of magnetic properties for these diradical species such as S-T gaps and diradical characters. Several types of orbital sets were examined as reference orbitals for MkMRCC calculations, and it was found that the change of orbital sets do not give significant impacts on computational results for these species. Comparison of MkMRCC results with APUCC and APUBD results show that these two types of methods yield similar results. These results show that the quantum spin corrected UCC and UBD methods can effectively account for both nondynamical and dynamical correlation effects that are covered by the MkMRCC methods. It was also shown that appropriately parameterized hybrid density functional theory (DFT) with AP corrections (APUDFT) calculations yielded very accurate data that qualitatively agree with those of MRCC and APUBD methods. This hierarchy of methods, MRCC, APUCC, and APUDFT, is expected to constitute a series of standard ab initio approaches towards radical systems, among which we could choose one of them, depending on the size of the systems and the required accuracy.
Hamilton-Jacobi theory in multisymplectic classical field theories
NASA Astrophysics Data System (ADS)
de León, Manuel; Prieto-Martínez, Pedro Daniel; Román-Roy, Narciso; Vilariño, Silvia
2017-09-01
The geometric framework for the Hamilton-Jacobi theory developed in the studies of Cariñena et al. [Int. J. Geom. Methods Mod. Phys. 3(7), 1417-1458 (2006)], Cariñena et al. [Int. J. Geom. Methods Mod. Phys. 13(2), 1650017 (2015)], and de León et al. [Variations, Geometry and Physics (Nova Science Publishers, New York, 2009)] is extended for multisymplectic first-order classical field theories. The Hamilton-Jacobi problem is stated for the Lagrangian and the Hamiltonian formalisms of these theories as a particular case of a more general problem, and the classical Hamilton-Jacobi equation for field theories is recovered from this geometrical setting. Particular and complete solutions to these problems are defined and characterized in several equivalent ways in both formalisms, and the equivalence between them is proved. The use of distributions in jet bundles that represent the solutions to the field equations is the fundamental tool in this formulation. Some examples are analyzed and, in particular, the Hamilton-Jacobi equation for non-autonomous mechanical systems is obtained as a special case of our results.
Quantum Electrodynamics: Theory
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lincoln, Don
The Standard Model of particle physics is composed of several theories that are added together. The most precise component theory is the theory of quantum electrodynamics or QED. In this video, Fermilab’s Dr. Don Lincoln explains how theoretical QED calculations can be done. This video links to other videos, giving the viewer a deep understanding of the process.
Free field theory as a string theory?
NASA Astrophysics Data System (ADS)
Gopakumar, Rajesh
2004-11-01
An approach to systematically implement open-closed string duality for free large N gauge theories is summarised. We show how the relevant closed string moduli space emerges from a reorganisation of the Feynman diagrams contributing to free field correlators. We also indicate why the resulting integrand on moduli space has the right features to be that of a string theory on AdS. To cite this article: R. Gopakumar, C. R. Physique 5 (2004).
General Open Systems Theory and the Substrata-Factor Theory of Reading.
ERIC Educational Resources Information Center
Kling, Martin
This study was designed to extend the generality of the Substrata-Factor Theory by two methods of investigation: (1) theoretically, to establish the validity of the hypothesis that an isomorphic relationship exists between the Substrata-Factor Theory and the General Open Systems Theory, and (2) experimentally, to discover through a series of…
General Open Systems Theory and the Substrata-Factor Theory of Reading.
ERIC Educational Resources Information Center
Kling, Martin
This study was designed to extend the generality of the Substrata-Factor Theory by two methods of investigation: (1) theoretically, to est"blish the validity of the hypothesis that an isomorphic relationship exists between the Substrata-Factor Theory and the General Open Systems Theory, and (2) experimentally, to disc"ver through a…
Theory-Based Stakeholder Evaluation
ERIC Educational Resources Information Center
Hansen, Morten Balle; Vedung, Evert
2010-01-01
This article introduces a new approach to program theory evaluation called theory-based stakeholder evaluation or the TSE model for short. Most theory-based approaches are program theory driven and some are stakeholder oriented as well. Practically, all of the latter fuse the program perceptions of the various stakeholder groups into one unitary…
[Introduction to grounded theory].
Wang, Shou-Yu; Windsor, Carol; Yates, Patsy
2012-02-01
Grounded theory, first developed by Glaser and Strauss in the 1960s, was introduced into nursing education as a distinct research methodology in the 1970s. The theory is grounded in a critique of the dominant contemporary approach to social inquiry, which imposed "enduring" theoretical propositions onto study data. Rather than starting from a set theoretical framework, grounded theory relies on researchers distinguishing meaningful constructs from generated data and then identifying an appropriate theory. Grounded theory is thus particularly useful in investigating complex issues and behaviours not previously addressed and concepts and relationships in particular populations or places that are still undeveloped or weakly connected. Grounded theory data analysis processes include open, axial and selective coding levels. The purpose of this article was to explore the grounded theory research process and provide an initial understanding of this methodology.
Activity Theory and Situated Learning Theory: Contrasting Views of Educational Practice
ERIC Educational Resources Information Center
Arnseth, Hans Christian
2008-01-01
The purpose of this article is to offer a critical discussion of the practice turn in contemporary educational research. In order to make the discussion specific, I use two influential theories, namely activity theory and situated learning theory. They both turn to the notion of practice in order to overcome the limitations of mentalist and…
ERIC Educational Resources Information Center
Rank, Mark R.; LeCroy, Craig W.
1983-01-01
Examines the complementarity of three often-used theories in family research: social exchange theory, symbolic interactionism, and conflict theory. Provides a case example in which a multiple perspective is applied to a problem of marital discord. Discusses implications for the clinician. (Author/WAS)
Asakura, Nobuhiko; Inui, Toshio
2016-01-01
Two apparently contrasting theories have been proposed to account for the development of children's theory of mind (ToM): theory-theory and simulation theory. We present a Bayesian framework that rationally integrates both theories for false belief reasoning. This framework exploits two internal models for predicting the belief states of others: one of self and one of others. These internal models are responsible for simulation-based and theory-based reasoning, respectively. The framework further takes into account empirical studies of a developmental ToM scale (e.g., Wellman and Liu, 2004): developmental progressions of various mental state understandings leading up to false belief understanding. By representing the internal models and their interactions as a causal Bayesian network, we formalize the model of children's false belief reasoning as probabilistic computations on the Bayesian network. This model probabilistically weighs and combines the two internal models and predicts children's false belief ability as a multiplicative effect of their early-developed abilities to understand the mental concepts of diverse beliefs and knowledge access. Specifically, the model predicts that children's proportion of correct responses on a false belief task can be closely approximated as the product of their proportions correct on the diverse belief and knowledge access tasks. To validate this prediction, we illustrate that our model provides good fits to a variety of ToM scale data for preschool children. We discuss the implications and extensions of our model for a deeper understanding of developmental progressions of children's ToM abilities.
Variational Transition State Theory
DOE Office of Scientific and Technical Information (OSTI.GOV)
Truhlar, Donald G.
2016-09-29
This is the final report on a project involving the development and applications of variational transition state theory. This project involved the development of variational transition state theory for gas-phase reactions, including optimized multidimensional tunneling contributions and the application of this theory to gas-phase reactions with a special emphasis on developing reaction rate theory in directions that are important for applications to combustion. The development of variational transition state theory with optimized multidimensional tunneling as a useful computational tool for combustion kinetics involved eight objectives.
Quantum Electrodynamics: Theory
Lincoln, Don
2018-01-16
The Standard Model of particle physics is composed of several theories that are added together. The most precise component theory is the theory of quantum electrodynamics or QED. In this video, Fermilabâs Dr. Don Lincoln explains how theoretical QED calculations can be done. This video links to other videos, giving the viewer a deep understanding of the process.
ERIC Educational Resources Information Center
MacLure, Maggie
2010-01-01
Theory frequently offends. The paper argues that this is its strength: the value of theory lies in its power to get in the way. Theory is needed to block the reproduction of banality, and thereby, hopefully, open new possibilities for thinking and doing. However, I also note that theory has become somewhat disengaged from its objects, diminishing…
Resource Theory of Superposition
NASA Astrophysics Data System (ADS)
Theurer, T.; Killoran, N.; Egloff, D.; Plenio, M. B.
2017-12-01
The superposition principle lies at the heart of many nonclassical properties of quantum mechanics. Motivated by this, we introduce a rigorous resource theory framework for the quantification of superposition of a finite number of linear independent states. This theory is a generalization of resource theories of coherence. We determine the general structure of operations which do not create superposition, find a fundamental connection to unambiguous state discrimination, and propose several quantitative superposition measures. Using this theory, we show that trace decreasing operations can be completed for free which, when specialized to the theory of coherence, resolves an outstanding open question and is used to address the free probabilistic transformation between pure states. Finally, we prove that linearly independent superposition is a necessary and sufficient condition for the faithful creation of entanglement in discrete settings, establishing a strong structural connection between our theory of superposition and entanglement theory.
Adapting Structuration Theory as a Comprehensive Theory for Distance Education: The ASTIDE Model
ERIC Educational Resources Information Center
Aktaruzzaman, Md; Plunkett, Margaret
2016-01-01
Distance Education (DE) theorists have argued about the requirement for a theory to be comprehensive in a way that can explicate many of the activities associated with DE. Currently, Transactional Distance Theory (TDT) (Moore, 1993) and the Theory of Instructional Dialogue (IDT) (Caspi & Gorsky, 2006) are the most prominent theories, yet they…
ERIC Educational Resources Information Center
Costley, Kevin C.
2006-01-01
University professors teaching pre-service teachers base much of their philosophies on theories. Students often ask "Why do we have theories?" "What is the purpose of theories?" "If we like a theory, do we have to use all of the theory?" The most frequent controversial issue is how to use a particular theory in a practical way. In the quest for…
Combined linear theory/impact theory method for analysis and design of high speed configurations
NASA Technical Reports Server (NTRS)
Brooke, D.; Vondrasek, D. V.
1980-01-01
Pressure distributions on a wing body at Mach 4.63 are calculated. The combined theory is shown to give improved predictions over either linear theory or impact theory alone. The combined theory is also applied in the inverse design mode to calculate optimum camber slopes at Mach 4.63. Comparisons with optimum camber slopes obtained from unmodified linear theory show large differences. Analysis of the results indicate that the combined theory correctly predicts the effect of thickness on the loading distributions at high Mach numbers, and that finite thickness wings optimized at high Mach numbers using unmodified linear theory will not achieve the minimum drag characteristics for which they are designed.
Trautmann, Stefan T; van de Kuilen, Gijs
2012-01-01
Attitudes toward risks are central to organizational decisions. These attitudes are commonly modeled by prospect theory. Construal level theory has been proposed as an alternative theory of risky choice, accounting for psychological distance deriving from temporal, spatial and social aspects of risk that are typical of agency situations. Unnoticed in the literature, the two theories make contradicting predictions. The current study investigates which theory provides a better description of risky decisions in the presence of temporal, spatial, and social factors. We find that the psychophysical effects modeled by prospect theory dominate the psychological distance effects of construal level theory. Copyright © 2011 Elsevier B.V. All rights reserved.
The Joint Chiefs of Staff and National Policy Volume III 1950-1951, The Korean War: Part One,
1998-01-01
National Policy Volume III 1950-1951 The Korean War Part One James F . Schnabel Robert J. Watson Office of Joint History Office of the Chairman...transferred to other du- ties, Mr. James F . Schnabel assumed responsibility for the volume and planned, Foreword researched, and wrote the...into publishable form. JAMES F . SCHNABEL ROBERT J.WATSON vm Contents 1. Korea in US Policy, 1945-1950 1 The Partition of Korea 1 Establishment
Superimposed Code Theoretic Analysis of DNA Codes and DNA Computing
2008-01-01
complements of one another and the DNA duplex formed is a Watson - Crick (WC) duplex. However, there are many instances when the formation of non-WC...that the user’s requirements for probe selection are met based on the Watson - Crick probe locality within a target. The second type, called...AFRL-RI-RS-TR-2007-288 Final Technical Report January 2008 SUPERIMPOSED CODE THEORETIC ANALYSIS OF DNA CODES AND DNA COMPUTING
2014-04-17
Marshall Center Director Patrick Scheuermann and Dr. Lisa Watson-Morgan talk to news media at the April 17 Marshall 2014 Update. Watson-Morgan, the first woman to be named the center's chief engineer, answered questions about progress on the Space Launch System and other projects, and spoke about the importance of attracting young people to science, technology, engineering and mathematics education to maintain a "pipeline" of future engineers.
Optimal Repair And Replacement Policy For A System With Multiple Components
2016-06-17
Numerical Demonstration To implement the linear program, we use the Python Programming Language (PSF 2016) with the Pyomo optimization modeling language...opre.1040.0133. Hart, W.E., C. Laird, J. Watson, D.L. Woodruff. 2012. Pyomo–optimization modeling in python , vol. 67. Springer Science & Business...Media. Hart, W.E., J. Watson, D.L. Woodruff. 2011. Pyomo: modeling and solving mathematical programs in python . Mathematical Programming Computation 3(3
Perception of Long-Period Complex Sounds
1989-11-27
Richard M. Warren AFOSR Grant No. 88-0320 M CES Guttman, N. & Julesz, B. (1963). Lower limits of auditory periodicity analysis. Journal of the Aostical...order within auditory sequences. Peretion & PsvchobhVsics, 12, 86-90. Watson, C.S., (1987). Uncertainty, informational masking, and the capacity of...immediate memory. In W.A. Yost and C.S. Watson (eds.), Auditory Processing of Camlex Sounds. New Jersey: lawrence Erlbaum Associates, pp. 267-277
Index of Air Weather Service Technical Publications. Headquarters AWS and Subordinate Units.
1982-07-01
Area," by Capt L. F. Haker , 33p. "Forecasting in the Watson Lake Area," by Capt F. F. Hooper, 28p. 105-48 "Study of Blowing Dust in the 19th Weather...Area," by Capt L. F. Haker , 33p. "Forecasting in the Watson Lake Area," by Capt F. F. Hooper, 28p. "On the Origin and Climatology of Noctilucent
A resuscitation "dilemma" theory-practice-ethics. Is there a theory-practice-ethics gap?
Mortell, Manfred
2009-07-01
The theory-practice-ethics gap - a new paradigm to contemplate. Practices based on tradition, rituals and outdated information are placed into a nonscientific paradigm called the theory-practice gap. Within this paradigm there is often a gap between theoretical knowledge and its application in practice. This theory-practice gap has always existed [Allmark, P., 1995. A classical view of the theory-practice gap in nursing. J. Adv. Nurs. 22 (1), 18-23; Hewison, A. et al., 1996. The theory-practice gap in nursing: a new dimension. J. Adv. Nurs. 24 (4), 754-761]. Its creation is often sited as a culmination of theory being idealistic and impractical, even if practical and beneficial, are often ignored. Most of the evidence relating to the non integration of theory and practice makes the assumption that environmental factors are responsible and will affect learning and practice outcomes, hence the "gap". In fact, it is the author's belief, that to "bridge the gap" between theory and practice an additional component is required, called ethics. A moral duty and obligation ensuring theory and practice integrate. In order to effectively implement new practices, one must deem these practices are worthy and relevant to their role as healthcare providers. Otherwise, we fall victims to providing nothing more than a lip service. This introduces a new concept which the author refers to as the theory-practice-ethics gap. This theory-practice-ethics gap must be considered when reviewing some of the unacceptable outcomes in health care practice. The author believes that there is a crisis of ethics where theory and practice integrate, and as a consequence, malfeasance. We are failing to fulfill our duty as healthcare providers and as patient advocates. One practice of major concern, which the author will endeavor to unfold relates to adult and pediatric resuscitation.
Nonlinear response from transport theory and quantum field theory at finite temperature
NASA Astrophysics Data System (ADS)
Carrington, M. E.; Defu, Hou; Kobes, R.
2001-07-01
We study the nonlinear response in weakly coupled hot φ4 theory. We obtain an expression for a quadratic shear viscous response coefficient using two different formalisms: transport theory and response theory. The transport theory calculation is done by assuming a local equilibrium form for the distribution function and expanding in the gradient of the local four dimensional velocity field. By performing a Chapman-Enskog expansion on the Boltzmann equation we obtain a hierarchy of equations for the coefficients of the expanded distribution function. To do the response theory calculation we use Zubarev's techniques in nonequilibrium statistical mechanics to derive a generalized Kubo formula. Using this formula allows us to obtain the quadratic shear viscous response from the three-point retarded Green function of the viscous shear stress tensor. We use the closed time path formalism of real time finite temperature field theory to show that this three-point function can be calculated by writing it as an integral equation involving a four-point vertex. This four-point vertex can in turn be obtained from an integral equation which represents the resummation of an infinite series of ladder and extended-ladder diagrams. The connection between transport theory and response theory is made when we show that the integral equation for this four-point vertex has exactly the same form as the equation obtained from the Boltzmann equation for the coefficient of the quadratic term of the gradient expansion of the distribution function. We conclude that calculating the quadratic shear viscous response using transport theory and keeping terms that are quadratic in the gradient of the velocity field in the Chapman-Enskog expansion of the Boltzmann equation is equivalent to calculating the quadratic shear viscous response from response theory using the next-to-linear response Kubo formula, with a vertex given by an infinite resummation of ladder and extended-ladder diagrams.
NASA Astrophysics Data System (ADS)
Svozil, K.
1995-11-01
Inasmuch as physical theories are formalizable, set theory provides a framework for theoretical physics. Four speculations about the relevance of set theoretical modeling for physics are presented: the role of transcendental set theory (i) in chaos theory, (ii) for paradoxical decompositions of solid three-dimensional objects, (iii) in the theory of effective computability (Church-Turing thesis) related to the possible “solution of supertasks,” and (iv) for weak solutions. Several approaches to set theory and their advantages and disadvatages for physical applications are discussed: Canlorian “naive” (i.e., nonaxiomatic) set theory, contructivism, and operationalism. In the author's opinion, an attitude of “suspended attention” (a term borrowed from psychoanalysis) seems most promising for progress. Physical and set theoretical entities must be operationalized wherever possible. At the same time, physicists should be open to “bizarre” or “mindboggling” new formalisms, which need not be operationalizable or testable at the lime of their creation, but which may successfully lead to novel fields of phenomenology and technology.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-08-14
The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.
NASA Astrophysics Data System (ADS)
Sǎraru, Silviu-Constantin
Topological field theories originate in the papers of Schwarz and Witten. Initially, Schwarz shown that one of the topological invariants, namely the Ray-Singer torsion, can be represented as the partition function of a certain quantum field theory. Subsequently, Witten constructed a framework for understanding Morse theory in terms of supersymmetric quantum mechanics. These two constructions represent the prototypes of all topological field theories. The model used by Witten has been applied to classical index theorems and, moreover, suggested some generalizations that led to new mathematical results on holomorphic Morse inequalities. Starting with these results, further developments in the domain of topological field theories have been achieved. The Becchi-Rouet-Stora-Tyutin (BRST) symmetry allowed for a new definition of topological ...eld theories as theories whose BRST-invariant Hamiltonian is also BRST-exact. An important class of topological theories of Schwarz type is the class of BF models. This type of models describes three-dimensional quantum gravity and is useful at the study of four-dimensional quantum gravity in Ashtekar-Rovelli-Smolin formulation. Two-dimensional BF models are correlated to Poisson sigma models from various two-dimensional gravities. The analysis of Poisson sigma models, including their relationship to two-dimensional gravity and the study of classical solutions, has been intensively studied in the literature. In this thesis we approach the problem of construction of some classes of interacting BF models in the context of the BRST formalism. In view of this, we use the method of the deformation of the BRST charge and BRST-invariant Hamiltonian. Both methods rely on specific techniques of local BRST cohomology. The main hypotheses in which we construct the above mentioned interactions are: space-time locality, Poincare invariance, smoothness of deformations in the coupling constant and the preservation of the number of derivatives on
Asakura, Nobuhiko; Inui, Toshio
2016-01-01
Two apparently contrasting theories have been proposed to account for the development of children's theory of mind (ToM): theory-theory and simulation theory. We present a Bayesian framework that rationally integrates both theories for false belief reasoning. This framework exploits two internal models for predicting the belief states of others: one of self and one of others. These internal models are responsible for simulation-based and theory-based reasoning, respectively. The framework further takes into account empirical studies of a developmental ToM scale (e.g., Wellman and Liu, 2004): developmental progressions of various mental state understandings leading up to false belief understanding. By representing the internal models and their interactions as a causal Bayesian network, we formalize the model of children's false belief reasoning as probabilistic computations on the Bayesian network. This model probabilistically weighs and combines the two internal models and predicts children's false belief ability as a multiplicative effect of their early-developed abilities to understand the mental concepts of diverse beliefs and knowledge access. Specifically, the model predicts that children's proportion of correct responses on a false belief task can be closely approximated as the product of their proportions correct on the diverse belief and knowledge access tasks. To validate this prediction, we illustrate that our model provides good fits to a variety of ToM scale data for preschool children. We discuss the implications and extensions of our model for a deeper understanding of developmental progressions of children's ToM abilities. PMID:28082941
ERIC Educational Resources Information Center
Colbry, Stephanie; Hurwitz, Marc; Adair, Rodger
2014-01-01
Theories of collaboration exist at the interfirm and intergroup level, but not the intragroup or team level. Team interactions are often framed in terms of leadership and followership, a categorization which may, or may not, accurately reflect the dynamics of intragroup interactions. To create a grounded theory of collaboration, the Farmer's…
Children's theories of motivation.
Gurland, Suzanne T; Glowacky, Victoria C
2011-09-01
To investigate children's theories of motivation, we asked 166 children (8-12 years of age) to rate the effect of various motivational strategies on task interest, over the short and long terms, in activities described as appealing or unappealing. Children viewed the rewards strategy as resulting in greatest interest except when implemented over the long term for appealing activities. Individual difference analyses revealed that some children held operant theories of motivation, in which rewards were central, and others held hybrid theories, in which rewards were key, but some allowance was made for interest to be self-sustaining in the absence of inducements. Children's theories predicted their academic self-regulation. Their theories are discussed relative to an expert theory of motivation. Copyright © 2011 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Friedberg, R.; Hohenberg, P. C.
2014-09-01
Formulations of quantum mechanics (QM) can be characterized as realistic, operationalist, or a combination of the two. In this paper a realistic theory is defined as describing a closed system entirely by means of entities and concepts pertaining to the system. An operationalist theory, on the other hand, requires in addition entities external to the system. A realistic formulation comprises an ontology, the set of (mathematical) entities that describe the system, and assertions, the set of correct statements (predictions) the theory makes about the objects in the ontology. Classical mechanics is the prime example of a realistic physical theory. A straightforward generalization of classical mechanics to QM is hampered by the inconsistency of quantum properties with classical logic, a circumstance that was noted many years ago by Birkhoff and von Neumann. The present realistic formulation of the histories approach originally introduced by Griffiths, which we call ‘compatible quantum theory (CQT)’, consists of a ‘microscopic’ part (MIQM), which applies to a closed quantum system of any size, and a ‘macroscopic’ part (MAQM), which requires the participation of a large (ideally, an infinite) system. The first (MIQM) can be fully formulated based solely on the assumption of a Hilbert space ontology and the noncontextuality of probability values, relying in an essential way on Gleason's theorem and on an application to dynamics due in large part to Nistico. Thus, the present formulation, in contrast to earlier ones, derives the Born probability formulas and the consistency (decoherence) conditions for frameworks. The microscopic theory does not, however, possess a unique corpus of assertions, but rather a multiplicity of contextual truths (‘c-truths’), each one associated with a different framework. This circumstance leads us to consider the microscopic theory to be physically indeterminate and therefore incomplete, though logically coherent. The
CONSTRUCTION OF EDUCATIONAL THEORY MODELS.
ERIC Educational Resources Information Center
MACCIA, ELIZABETH S.; AND OTHERS
THIS STUDY DELINEATED MODELS WHICH HAVE POTENTIAL USE IN GENERATING EDUCATIONAL THEORY. A THEORY MODELS METHOD WAS FORMULATED. BY SELECTING AND ORDERING CONCEPTS FROM OTHER DISCIPLINES, THE INVESTIGATORS FORMULATED SEVEN THEORY MODELS. THE FINAL STEP OF DEVISING EDUCATIONAL THEORY FROM THE THEORY MODELS WAS PERFORMED ONLY TO THE EXTENT REQUIRED TO…
Base pairing and base mis-pairing in nucleic acids
NASA Technical Reports Server (NTRS)
Wang, A. H. J.; Rich, A.
1986-01-01
In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.
Relevance Theory, Action Theory and Second Language Communication Strategies
ERIC Educational Resources Information Center
Foster-Cohen, Susan H.
2004-01-01
The discussion in this article offers a comparison between Relevance Theory as an account of human communication and Herbert Clark's (1996) sociocognitive Action Theory approach. It is argued that the differences are fundamental and impact analysis of all kinds of naturally occurring communicative data, including that produced by non-native…
A general theory of linear cosmological perturbations: scalar-tensor and vector-tensor theories
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lagos, Macarena; Baker, Tessa; Ferreira, Pedro G.
We present a method for parametrizing linear cosmological perturbations of theories of gravity, around homogeneous and isotropic backgrounds. The method is sufficiently general and systematic that it can be applied to theories with any degrees of freedom (DoFs) and arbitrary gauge symmetries. In this paper, we focus on scalar-tensor and vector-tensor theories, invariant under linear coordinate transformations. In the case of scalar-tensor theories, we use our framework to recover the simple parametrizations of linearized Horndeski and ''Beyond Horndeski'' theories, and also find higher-derivative corrections. In the case of vector-tensor theories, we first construct the most general quadratic action for perturbationsmore » that leads to second-order equations of motion, which propagates two scalar DoFs. Then we specialize to the case in which the vector field is time-like (à la Einstein-Aether gravity), where the theory only propagates one scalar DoF. As a result, we identify the complete forms of the quadratic actions for perturbations, and the number of free parameters that need to be defined, to cosmologically characterize these two broad classes of theories.« less
ERIC Educational Resources Information Center
Jonsson, Anna-Carin; Beach, Dennis; Korp, Helena; Erlandson, Peter
2012-01-01
A sample of 226 Swedish high school teachers from various knowledge domains completed self-report measures of intelligence regarding implicit theories and scientific theories of intelligence. A mixed ANOVA showed that teachers from language, social science and practical disciplines had a significant preference for an incremental theory of…
The complete Brans–Dicke theories
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kofinas, Georgios, E-mail: gkofinas@aegean.gr
Given that the simple wave equation of Brans–Dicke theory for the scalar field is preserved, we have investigated, through exhaustively analyzing the Bianchi identities, the consistent theories which violate the exact energy conservation equation. It is found that only three theories exist which are unambiguously determined from consistency, without imposing arbitrary functions by hand. Each of these theories possesses a specific interaction term which controls the energy exchange between the scalar field and ordinary matter. The theories contain new parameters (integration constants from the integration procedure) and when these are switched-off, Brans–Dicke theory emerges. As usually, the vacuum theories canmore » be defined from the complete Brans–Dicke theories when the matter energy–momentum tensor vanishes.« less
Leaper, Campbell
2011-01-01
Many contemporary theories of social development are similar and/or share complementary constructs. Yet, there have been relatively few efforts toward theoretical integration. The present chapter represents a call for increased theory bridging. The problem of theoretical fragmentation in psychology is reviewed. Seven highlighted reasons for this predicament include differences between behavioral sciences and other sciences, theoretical paradigms as social identities, the uniqueness assumption, information overload, field fixation, linguistic fragmentation, and few incentives for theoretical integration. Afterward, the feasibility of theoretical synthesis is considered. Finally, some possible directions are proposed for theoretical integration among five contemporary theories of social and gender development: social cognitive theory, expectancy-value theory, cognitive-developmental theory, gender schema theory, and self-categorization theory.
Medium-heavy nuclei from nucleon-nucleon interactions in lattice QCD
NASA Astrophysics Data System (ADS)
Inoue, Takashi; Aoki, Sinya; Charron, Bruno; Doi, Takumi; Hatsuda, Tetsuo; Ikeda, Yoichi; Ishii, Noriyoshi; Murano, Keiko; Nemura, Hidekatsu; Sasaki, Kenji; HAL QCD Collaboration
2015-01-01
On the basis of the Brueckner-Hartree-Fock method with the nucleon-nucleon forces obtained from lattice QCD simulations, the properties of the medium-heavy doubly magic nuclei such as 16O and 40Ca are investigated. We found that those nuclei are bound for the pseudoscalar meson mass MPS≃470 MeV. The mass number dependence of the binding energies, single-particle spectra, and density distributions are qualitatively consistent with those expected from empirical data at the physical point, although these hypothetical nuclei at heavy quark mass have smaller binding energies than the real nuclei.
Nonstandard Methods in Lie Theory
ERIC Educational Resources Information Center
Goldbring, Isaac Martin
2009-01-01
In this thesis, we apply model theory to Lie theory and geometric group theory. These applications of model theory come via nonstandard analysis. In Lie theory, we use nonstandard methods to prove two results. First, we give a positive solution to the local form of Hilbert's Fifth Problem, which asks whether every locally euclidean local…
General Theory of Absorption in Porous Materials: Restricted Multilayer Theory.
Aduenko, Alexander A; Murray, Andy; Mendoza-Cortes, Jose L
2018-04-18
In this article, we present an approach for the generalization of adsorption of light gases in porous materials. This new theory goes beyond Langmuir and Brunauer-Emmett-Teller theories, which are the standard approaches that have a limited application to crystalline porous materials by their unphysical assumptions on the amount of possible adsorption layers. The derivation of a more general equation for any crystalline porous framework is presented, restricted multilayer theory. Our approach allows the determination of gas uptake considering only geometrical constraints of the porous framework and the interaction energy of the guest molecule with the framework. On the basis of this theory, we calculated optimal values for the adsorption enthalpy at different temperatures and pressures. We also present the use of this theory to determine the optimal linker length for a topologically equivalent framework series. We validate this theoretical approach by applying it to metal-organic frameworks (MOFs) and show that it reproduces the experimental results for seven different reported materials. We obtained the universal equation for the optimal linker length, given the topology of a porous framework. This work applied the general equation to MOFs and H 2 to create energy-storage materials; however, this theory can be applied to other crystalline porous materials and light gases, which opens the possibility of designing the next generations of energy-storage materials by first considering only the geometrical constraints of the porous materials.
NASA Astrophysics Data System (ADS)
Sati, Hisham
2011-06-01
M-theory can be defined on closed manifolds as well as on manifolds with boundary. As an extension, we show that manifolds with corners appear naturally in M-theory. We illustrate this with four situations: the lift to bounding 12 dimensions of M-theory on anti-de Sitter spaces, ten-dimensional heterotic string theory in relation to 12 dimensions, and the two M-branes within M-theory in the presence of a boundary. The M2-brane is taken with (or as) a boundary and the worldvolume of the M5-brane is viewed as a tubular neighborhood. We then concentrate on the (variant) of the heterotic theory as a corner and explore analytical and geometric consequences. In particular, we formulate and study the phase of the partition function in this setting and identify the corrections due to the corner(s). The analysis involves considering M-theory on disconnected manifolds and makes use of the extension of the Atiyah-Patodi-Singer index theorem to manifolds with corners and the b-calculus of Melrose.
ERIC Educational Resources Information Center
Chen, Huey T.; Turner, Nannette C.
2012-01-01
Health promotion and social betterment program interventions are based on either formal theory from academia or stakeholder theory from stakeholders' observations and experiences in working with clients. Over time, formal theory-based interventions have acquired high prestige, while stakeholder theory-based interventions have been held in low…
The Impact of Lamarck's Theory of Evolution Before Darwin's Theory.
Galera, Andrés
2017-02-01
This paper analyzes the impact that Lamarckian evolutionary theory had in the scientific community during the period between the advent of Zoological Philosophy and the publication Origin of Species. During these 50 years Lamarck's model was a well known theory and it was discussed by the scientific community as a hypothesis to explain the changing nature of the fossil record throughout the history of Earth. Lamarck's transmutation theory established the foundation of an evolutionary model introducing a new way to research in nature. Darwin's selectionist theory was proposed in 1859 to explain the origin of species within this epistemological process. In this context, Charles Lyell's Principles of Geology and Auguste Comte's Cours de Philosophie Positive appear as two major works for the dissemination of Lamarck's evolutionary ideology after the death of the French naturalist in 1829.
Human Purposive Movement Theory
2012-03-01
theory and provides examples of developmental and operational technologies that could use this theory in common settings. 15. SUBJECT TERMS human ... activity , prediction of behavior, human algorithms purposive movement theory 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT UU 18
Ma, Zimi; Jia, Chunhua; Guo, Jin; Gu, Haorong; Miao, Yanhuan
2014-02-01
To study the Chinese ancient five-element theory, one of the philosophical foundations of Traditional Chinese Medicine (TCM) theory construction, from the perspective of comtemporary cognitive science, and to reveal the important functions of five-element theory in the construction of TCM theory. The basic effects of five-element theory in the construction of TCM theory are intensively expounded and proved from the following aspects: embodiment of five-element theory in cognizing the world, quasi axiom of five-element theory in essence, classification thery of family resemblance and deductive inference pattern of five-element theory, and the openness and expansibility of five-element theory. If five-element theory is considered a cognitive pattern or cognitive system related to culture, then there should be features of cognitive embodiment in the cognitive system. If five-element theory is regarded as a symbolic system, however, then there should be a quasi-axiom for the system, and inferential deduction. If, however, five-element theory is taken as a theoretical constructive metaphor, then there should be features of opening and expansibility for the metaphor. Based on five-element theory, this study provides a cognitive frame for the construction of TCM (a medicine that originated in China, and is characterized by holism and treatment based on pattern identification differentiation) theory with the function of constructing a concept base, thereby implying further research strategies. Useful information may be produced from the creative inferences obtained from the incorporation of five-element theory.
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes
2007-10-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)
2007-01-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Balancing Value and Risk in Information Sharing Through Obfuscation
2012-09-20
California, Los Angeles Chatschik Bisdikian IBM T.J. Watson Research Center Lance M. Kaplan US Army Research Laboratory Abstract—Fast-paced data-to...AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) IBM T.J. Watson Research...giving us annotations for both the white listed activity detection as well as the black listed activity recognition . We implemented five features
Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer
2000-10-01
Mandinova A, Atar D, Schafer BW, Spiess M, Aebi U, Heizmann CW: J, Schnitt S, Livingston DM: Location of BRCA1 in human breast and Distinct...Genetic Markers of the Invasive Phenotype in Human Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Peter H. Watson CONTRACTING ORGANIZATION: University of...Markers of the Invasive Phenotype DAMD17-97-1-7320 in Human Breast Cancer 6. AUTHOR(S) Dr. Peter H. Watson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS
NASA Astrophysics Data System (ADS)
Reichman, David R.; Charbonneau, Patrick
2005-05-01
In this set of lecture notes we review the mode-coupling theory of the glass transition from several perspectives. First, we derive mode-coupling equations for the description of density fluctuations from microscopic considerations with the use the Mori Zwanzig projection operator technique. We also derive schematic mode-coupling equations of a similar form from a field-theoretic perspective. We review the successes and failures of mode-coupling theory, and discuss recent advances in the applications of the theory.
Using grounded theory to create a substantive theory of promoting schoolchildren's mental health.
Puolakka, Kristiina; Haapasalo-Pesu, Kirsi-Maria; Kiikkala, Irma; Astedt-Kurki, Päivi; Paavilainen, Eija
2013-01-01
To discuss the creation of a substantive theory using grounded theory. This article provides an example of generating theory from a study of mental health promotion at a high school in Finland. Grounded theory is a method for creating explanatory theory. It is a valuable tool for health professionals when studying phenomena that affect patients' health, offering a deeper understanding of nursing methods and knowledge. Interviews with school employees, students and parents, and verbal responses to the 'school wellbeing profile survey', as well as working group memos related to the development activities. Participating children were aged between 12 and 15. The analysis was conducted by applying the grounded theory method and involved open coding of the material, constant comparison, axial coding and selective coding after identifying the core category. The analysis produced concepts about mental health promotion in school and assumptions about relationships. Grounded theory proved to be an effective means of eliciting people's viewpoints on mental health promotion. The personal views of different parties make it easier to identify an action applicable to practice.
General Contingency Theory of Organizations: An Alternative to Open Systems Theory.
1982-08-01
genetic and mechanical open systems. We have recently proposed a general contingency theory (GCT) of management (Luthans and Stewart, 1977) which promises...developed in response to the need for an integrative theory of management that incorporates the environment (in the open systems sense. and begins to... management and desired performance out- comes. We will show that the GCT matrix can lead to organizational effec- tiveness. The Theory as a Basis for More
Extended vector-tensor theories
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kimura, Rampei; Naruko, Atsushi; Yoshida, Daisuke, E-mail: rampei@th.phys.titech.ac.jp, E-mail: naruko@th.phys.titech.ac.jp, E-mail: yoshida@th.phys.titech.ac.jp
Recently, several extensions of massive vector theory in curved space-time have been proposed in many literatures. In this paper, we consider the most general vector-tensor theories that contain up to two derivatives with respect to metric and vector field. By imposing a degeneracy condition of the Lagrangian in the context of ADM decomposition of space-time to eliminate an unwanted mode, we construct a new class of massive vector theories where five degrees of freedom can propagate, corresponding to three for massive vector modes and two for massless tensor modes. We find that the generalized Proca and the beyond generalized Procamore » theories up to the quartic Lagrangian, which should be included in this formulation, are degenerate theories even in curved space-time. Finally, introducing new metric and vector field transformations, we investigate the properties of thus obtained theories under such transformations.« less
Infusing Theory into Practice, Practice into Theory: Small Wins and Big Gains for Evaluation
ERIC Educational Resources Information Center
Rog, Debra J.
2015-01-01
This article illustrates the synergistic role between practice and theory in evaluation. Using reflective practice, the author reviews her own work as well as the work of other evaluators to illustrate how theory can influence practice and, in turn, how evaluation practice can inform and grow theory, especially evaluation theory. The following…
ERIC Educational Resources Information Center
Crossouard, Barbara; Pryor, John
2012-01-01
The positioning of theory in relation to educational practice has provoked much recent debate, with some arguing that educational theory constrains thinking in education, while others dismiss "theory" out of hand as belonging to the world of the "academic," abstracted from the "realities" of the classroom. This paper views theory as necessarily…
Laubichler, Manfred D; Prohaska, Sonja J; Stadler, Peter F
2018-01-01
Reconciling different underlying ontologies and explanatory contexts has been one of the main challenges and impediments for theory integration in biology. Here, we analyze the challenge of developing an inclusive and integrative theory of phenotypic evolution as an example for the broader challenge of developing a theory of theory integration within the life sciences and suggest a number of necessary formal steps toward the resolution of often incompatible (hidden) assumptions. Theory integration in biology requires a better formal understanding of the structure of biological theories The strategy for integrating theories crucially depends on the relationships of the underlying ontologies. © 2018 Wiley Periodicals, Inc.
Hamiltonian Anomalies from Extended Field Theories
NASA Astrophysics Data System (ADS)
Monnier, Samuel
2015-09-01
We develop a proposal by Freed to see anomalous field theories as relative field theories, namely field theories taking value in a field theory in one dimension higher, the anomaly field theory. We show that when the anomaly field theory is extended down to codimension 2, familiar facts about Hamiltonian anomalies can be naturally recovered, such as the fact that the anomalous symmetry group admits only a projective representation on the Hilbert space, or that the latter is really an abelian bundle gerbe over the moduli space. We include in the discussion the case of non-invertible anomaly field theories, which is relevant to six-dimensional (2, 0) superconformal theories. In this case, we show that the Hamiltonian anomaly is characterized by a degree 2 non-abelian group cohomology class, associated to the non-abelian gerbe playing the role of the state space of the anomalous theory. We construct Dai-Freed theories, governing the anomalies of chiral fermionic theories, and Wess-Zumino theories, governing the anomalies of Wess-Zumino terms and self-dual field theories, as extended field theories down to codimension 2.
Active-Passive-Intuitive Learning Theory: A Unified Theory of Learning and Development
ERIC Educational Resources Information Center
Sigette, Tyson
2009-01-01
This paper addresses many theories of learning and human development which are very similar with regards as to how they suggest learning occurs. The differences in most of the theories exist in how they treat the development of the learner compared to methods of teaching. Most of the major learning theories taught to educators today are based on…
Protection motivation theory: is this a worthwhile theory for physical activity promotion?
Plotnikoff, Ronald C; Trinh, Linda
2010-04-01
This article reviews the published studies in the physical activity domain, which include novel hypothesis from our laboratory, that have tested Rogers' Protection Motivation Theory. Across the various population groups, the theory's coping appraisal is generally supported; however, there is limited support for the theory's threat components. Implications of these findings are discussed from both theoretical and practical perspectives.
Purposeful Program Theory: Effective Use of Theories of Change and Logic Models
ERIC Educational Resources Information Center
Funnell, Sue C.; Rogers, Patricia J.
2011-01-01
Between good intentions and great results lies a program theory--not just a list of tasks but a vision of what needs to happen, and how. Now widely used in government and not-for-profit organizations, program theory provides a coherent picture of how change occurs and how to improve performance. "Purposeful Program Theory" shows how to develop,…
Theories of Motivation--Borrowing the Best.
ERIC Educational Resources Information Center
Terpstra, David E.
1979-01-01
Five theories of motivation are discussed: Maslow's Need Hierarchy, Herzberg's dual-factor or motivation-hygiene theory, goal setting or task motivation, expectancy/valence-theory (also known as instrumentality theory, valence-instrumentality-expectancy theory, or expectancy theory), and reinforcement. (JH)
The Theory of Multiple Intelligences.
ERIC Educational Resources Information Center
Gardner, Howard
1987-01-01
The multiple intelligence theory is based on cultural contexts, biological analysis, developmental theories, and a vertical theory of faculties. Seven intelligences are identified: linguistic, logical mathematical, musical, spatial, bodily kinesthetic, interpersonal, and intrapersonal. The theory's educational implications are described,…
Information Theory - The Bridge Connecting Bounded Rational Game Theory and Statistical Physics
NASA Technical Reports Server (NTRS)
Wolpert, David H.
2005-01-01
A long-running difficulty with conventional game theory has been how to modify it to accommodate the bounded rationality of all red-world players. A recurring issue in statistical physics is how best to approximate joint probability distributions with decoupled (and therefore far more tractable) distributions. This paper shows that the same information theoretic mathematical structure, known as Product Distribution (PD) theory, addresses both issues. In this, PD theory not only provides a principle formulation of bounded rationality and a set of new types of mean field theory in statistical physics; it also shows that those topics are fundamentally one and the same.
[Towards an unified theory of the universe basic forces ("the everything theory")].
Aguilar Peris, José
2004-01-01
Numerous efforts have been made in order to unify all the basic forces in nature. In 1967 the fusion of electromagnetic and weak forces was obtained and in 1973 a theoretical bridge between the electroweak and the strong forces have been constructed. This theory is waiting for experimental proofs in the CERN large hadron collider. The last stage would be "the everything theory", which includes the gravitational force. Only the so called superstring theory is a good candidate to overcome the incompatibility of the quantum mechanics and the general relativity, but this theory is not already achieved.
1978-11-01
R 2. GOVT A $ SION NO. 3 RIEqLPýIVT’S.;TALOG NUMBER r/ 4. TITLE (and wbiFflT, -L M4 1 , FEEDBACK SYSTEM THEORY ~r Inter in- 6. PERFORMING ORG. REPORT...ANNUAL REPORT FEEDBACK SYSTEM THEORY AFOSR GRANT NO. 76-2946B Air Force Office of Scientific Research for year ending October 31, 1978 79 02 08 L|I...re less stringent than in other synthesis techniques which cannot handle significant parameter uncertainty. _I FEEDBACK SYSTEM THEORY 1. Introduction
N=2 gauge theories and degenerate fields of Toda theory
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanno, Shoichi; Matsuo, Yutaka; Shiba, Shotaro
We discuss the correspondence between degenerate fields of the W{sub N} algebra and punctures of Gaiotto's description of the Seiberg-Witten curve of N=2 superconformal gauge theories. Namely, we find that the type of degenerate fields of the W{sub N} algebra, with null states at level one, is classified by Young diagrams with N boxes, and that the singular behavior of the Seiberg-Witten curve near the puncture agrees with that of W{sub N} generators. We also find how to translate mass parameters of the gauge theory to the momenta of the Toda theory.
Relevance theory: pragmatics and cognition.
Wearing, Catherine J
2015-01-01
Relevance Theory is a cognitively oriented theory of pragmatics, i.e., a theory of language use. It builds on the seminal work of H.P. Grice(1) to develop a pragmatic theory which is at once philosophically sensitive and empirically plausible (in both psychological and evolutionary terms). This entry reviews the central commitments and chief contributions of Relevance Theory, including its Gricean commitment to the centrality of intention-reading and inference in communication; the cognitively grounded notion of relevance which provides the mechanism for explaining pragmatic interpretation as an intention-driven, inferential process; and several key applications of the theory (lexical pragmatics, metaphor and irony, procedural meaning). Relevance Theory is an important contribution to our understanding of the pragmatics of communication. © 2014 John Wiley & Sons, Ltd.
[Shedding light on chaos theory].
Chou, Shieu-Ming
2004-06-01
Gleick (1987) said that only three twentieth century scientific theories would be important enough to continue be of use in the twenty-first century: The Theory of Relativity, Quantum Theory, and Chaos Theory. Chaos Theory has become a craze which is being used to forge a new scientific system. It has also been extensively applied in a variety of professions. The purpose of this article is to introduce chaos theory and its nursing applications. Chaos is a sign of regular order. This is to say that chaos theory emphasizes the intrinsic potential for regular order within disordered phenomena. It is to be hoped that this article will inspire more nursing scientists to apply this concept to clinical, research, or administrative fields in our profession.
ERIC Educational Resources Information Center
Thomas, Gary
1997-01-01
Argues against the use of theory in educational inquiry, contending that the meaning of theory is unclear; both personal theory and grand theory inhibit creativity and methodology; and less structured problem solving and ad hoc approaches are more likely to result in pluralistic ideas. (SK)
Health values and prospect theory.
Treadwell, J R; Lenert, L A
1999-01-01
Health values are important components of medical decisions. Experimental data suggest that people value health in complex and dynamic ways. Prospect theory is a descriptive theory of choice that may accurately characterize how people assign values to health states. The authors first provide background on prospect theory and how it can be applied to health values. Next, they review the relevant health research and find mixed support for prospect theory. Last, they discuss implications of prospect theory for cost-effectiveness analysis. The application of prospect theory to health deserves further research because it may help clarify the link between health and values.
ERIC Educational Resources Information Center
Rajendran, Gnanathusharan; Mitchell, Peter
2007-01-01
This article considers three theories of autism: The Theory of Mind Deficit, Executive Dysfunction and the Weak Central Coherence accounts. It outlines each along with studies relevant to their emergence, their expansion, their limitations and their possible integration. Furthermore, consideration is given to any implication from the theories in…
An Integrated Higgs Force Theory
NASA Astrophysics Data System (ADS)
Colella, Antonio
2016-03-01
An Integrated Higgs force theory (IHFT) was based on 2 key requirement amplifications: a matter particle/Higgs force was one and inseparable; a matter particle/Higgs force bidirectionally condensed/evaporated from/to super force. These were basis of 5 theories: particle creation, baryogenesis, superpartner/quark decays, spontaneous symmetry breaking, and stellar black holes. Our universe's 129 matter/force particles contained 64 supersymmetric Higgs particles; 9 transient matter particles/Higgs forces decayed to 8 permanent matter particles/Higgs forces; mass was given to a matter particle by its Higgs force and gravitons; and sum of 8 Higgs force energies of 8 permanent matter particles was dark energy. An IHFT's essence is the intimate physical relationships between 8 theories. These theories are independent because physicists in one theory worked independently of physicists in the other seven. An IHFT's premise is without sacrificing their integrities, 8 independent existing theories are replaced by 8 interrelated amplified theories. Requirement amplifications provide interfaces between the 8 theories. Intimate relationships between 8 theories including the above 5 and string, Higgs forces, and Super Universe are described. The sorting category selected was F. PARTICLES AND FIELDS (e.g., F1 Higgs Physics, F10 Alternative Beyond the Standard Model Physics, F11 Dark Sector Theories and Searches, and F12 Particle Cosmology).
Analyzing Test-Taking Behavior: Decision Theory Meets Psychometric Theory.
Budescu, David V; Bo, Yuanchao
2015-12-01
We investigate the implications of penalizing incorrect answers to multiple-choice tests, from the perspective of both test-takers and test-makers. To do so, we use a model that combines a well-known item response theory model with prospect theory (Kahneman and Tversky, Prospect theory: An analysis of decision under risk, Econometrica 47:263-91, 1979). Our results reveal that when test-takers are fully informed of the scoring rule, the use of any penalty has detrimental effects for both test-takers (they are always penalized in excess, particularly those who are risk averse and loss averse) and test-makers (the bias of the estimated scores, as well as the variance and skewness of their distribution, increase as a function of the severity of the penalty).
Is ``the Theory of Everything'' Merely the Ultimate Ensemble Theory?
NASA Astrophysics Data System (ADS)
Tegmark, Max
1998-11-01
We discuss some physical consequences of what might be called "the ultimate ensemble theory,", where not only worlds corresponding to say different sets of initial data or different physical constants are considered equally real, but also worlds ruled by altogether different equations. The only postulate in this theory is that all structures that exist mathematically exist also physically, by which we mean that in those complex enough to contain self-aware substructures (SASs), these SASs will subjectively perceive themselves as existing in a physically "real" world. We find that it is far from clear that this simple theory, which has no free parameters whatsoever, is observationally ruled out. The predictions of the theory take the form of probability distributions for the outcome of experiments, which makes it testable. In addition, it may be possible to rule it out by comparing its a priori predictions for the observable attributes of nature (the particle masses, the dimensionality of spacetime, etc.) with what is observed.
Evaluation Theory Tree Re-Examined
ERIC Educational Resources Information Center
Christie, Christina A.; Alkin, Marvin C.
2008-01-01
When examining various evaluation prescriptive theories comparatively, we find it helpful to have a framework showing how they are related that highlights features that distinguish theoretical perspectives, thus a "theory" about theories. The evaluation theory tree that we presented in Alkin's recent book, "Evaluation Roots"…
Strongly contracted canonical transformation theory
NASA Astrophysics Data System (ADS)
Neuscamman, Eric; Yanai, Takeshi; Chan, Garnet Kin-Lic
2010-01-01
Canonical transformation (CT) theory describes dynamic correlation in multireference systems with large active spaces. Here we discuss CT theory's intruder state problem and why our previous approach of overlap matrix truncation becomes infeasible for sufficiently large active spaces. We propose the use of strongly and weakly contracted excitation operators as alternatives for dealing with intruder states in CT theory. The performance of these operators is evaluated for the H2O, N2, and NiO molecules, with comparisons made to complete active space second order perturbation theory and Davidson-corrected multireference configuration interaction theory. Finally, using a combination of strongly contracted CT theory and orbital-optimized density matrix renormalization group theory, we evaluate the singlet-triplet gap of free base porphin using an active space containing all 24 out-of-plane 2p orbitals. Modeling dynamic correlation with an active space of this size is currently only possible using CT theory.
The Rod Contraction-Clock Retardation Ether Theory and the Special Theory of Relativity
ERIC Educational Resources Information Center
Erlichson, Herman
1973-01-01
Discusses the historical rod contraction-block retardation (RC-CR) ether theory to illustrate its relationship to the special theory of relativity and the possibility of experimental differences between them. Indicates that the RC-CR theory is worthy of the attention of both physicists and science philosophers. (CC)
Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.
2018-01-01
A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE
Maples, Jessica L; Carter, Nathan T; Few, Lauren R; Crego, Cristina; Gore, Whitney L; Samuel, Douglas B; Williamson, Rachel L; Lynam, Donald R; Widiger, Thomas A; Markon, Kristian E; Krueger, Robert F; Miller, Joshua D
2015-12-01
The fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) includes an alternative model of personality disorders (PDs) in Section III, consisting in part of a pathological personality trait model. To date, the 220-item Personality Inventory for DSM-5 (PID-5; Krueger, Derringer, Markon, Watson, & Skodol, 2012) is the only extant self-report instrument explicitly developed to measure this pathological trait model. The present study used item response theory-based analyses in a large sample (n = 1,417) to investigate whether a reduced set of 100 items could be identified from the PID-5 that could measure the 25 traits and 5 domains. This reduced set of PID-5 items was then tested in a community sample of adults currently receiving psychological treatment (n = 109). Across a wide range of criterion variables including NEO PI-R domains and facets, DSM-5 Section II PD scores, and externalizing and internalizing outcomes, the correlational profiles of the original and reduced versions of the PID-5 were nearly identical (rICC = .995). These results provide strong support for the hypothesis that an abbreviated set of PID-5 items can be used to reliably, validly, and efficiently assess these personality disorder traits. The ability to assess the DSM-5 Section III traits using only 100 items has important implications in that it suggests these traits could still be measured in settings in which assessment-related resources (e.g., time, compensation) are limited. (c) 2015 APA, all rights reserved).
MaxEnt-Based Ecological Theory: A Template for Integrated Catchment Theory
NASA Astrophysics Data System (ADS)
Harte, J.
2017-12-01
The maximum information entropy procedure (MaxEnt) is both a powerful tool for inferring least-biased probability distributions from limited data and a framework for the construction of complex systems theory. The maximum entropy theory of ecology (METE) describes remarkably well widely observed patterns in the distribution, abundance and energetics of individuals and taxa in relatively static ecosystems. An extension to ecosystems undergoing change in response to disturbance or natural succession (DynaMETE) is in progress. I describe the structure of both the static and the dynamic theory and show a range of comparisons with census data. I then propose a generalization of the MaxEnt approach that could provide a framework for a predictive theory of both static and dynamic, fully-coupled, eco-socio-hydrological catchment systems.
Higher-derivative operators and effective field theory for general scalar-tensor theories
NASA Astrophysics Data System (ADS)
Solomon, Adam R.; Trodden, Mark
2018-02-01
We discuss the extent to which it is necessary to include higher-derivative operators in the effective field theory of general scalar-tensor theories. We explore the circumstances under which it is correct to restrict to second-order operators only, and demonstrate this using several different techniques, such as reduction of order and explicit field redefinitions. These methods are applied, in particular, to the much-studied Horndeski theories. The goal is to clarify the application of effective field theory techniques in the context of popular cosmological models, and to explicitly demonstrate how and when higher-derivative operators can be cast into lower-derivative forms suitable for numerical solution techniques.
Current trends in nursing theories.
Im, Eun-Ok; Chang, Sun Ju
2012-06-01
To explore current trends in nursing theories through an integrated literature review. The literature related to nursing theories during the past 10 years was searched through multiple databases and reviewed to determine themes reflecting current trends in nursing theories. The trends can be categorized into six themes: (a) foci on specifics; (b) coexistence of various types of theories; (c) close links to research; (d) international collaborative works; (e) integration to practice; and (f) selective evolution. We need to make our continuous efforts to link research and practice to theories, to identify specifics of our theories, to develop diverse types of theories, and to conduct international collaborative works. Our paper gives implications for future theoretical development in diverse clinical areas of nursing research and practice. © 2012 Sigma Theta Tau International.
Self Psychology as Feminist Theory.
ERIC Educational Resources Information Center
Gardiner, Judith Kegan
1987-01-01
Although the "self psychology" theories of Heinz Kohut tend to neglect gender, they hold promise for feminist theory because they avoid some problems and limitations of the object-relations theory, especially its conflation of femininity with heterosexuality and apparent closure to historical change. Feminist self-psychology theory, in…
Lincoln, Don
2018-01-16
The Big Bang is the name of the most respected theory of the creation of the universe. Basically, the theory says that the universe was once smaller and denser and has been expending for eons. One common misconception is that the Big Bang theory says something about the instant that set the expansion into motion, however this isnât true. In this video, Fermilabâs Dr. Don Lincoln tells about the Big Bang theory and sketches some speculative ideas about what caused the universe to come into existence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lincoln, Don
The Big Bang is the name of the most respected theory of the creation of the universe. Basically, the theory says that the universe was once smaller and denser and has been expending for eons. One common misconception is that the Big Bang theory says something about the instant that set the expansion into motion, however this isn’t true. In this video, Fermilab’s Dr. Don Lincoln tells about the Big Bang theory and sketches some speculative ideas about what caused the universe to come into existence.
Democratic superstring field theory: gauge fixing
NASA Astrophysics Data System (ADS)
Kroyter, Michael
2011-03-01
We show that a partial gauge fixing of the NS sector of the democratic-picture superstring field theory leads to the non-polynomial theory. Moreover, by partially gauge fixing the Ramond sector we obtain a non-polynomial fully RNS theory at pictures 0 and 1/2 . Within the democratic theory and in the partially gauge fixed theory the equations of motion of both sectors are derived from an action. We also discuss a representation of the non-polynomial theory analogous to a manifestly two-dimensional representation of WZW theory and the action of bosonic pure-gauge solutions. We further demonstrate that one can consistently gauge fix the NS sector of the democratic theory at picture number -1. The resulting theory is new. It is a {mathbb{Z}_2} dual of the modified cubic theory. We construct analytical solutions of this theory and show that they possess the desired properties.
1997-01-09
Riordan Gerald F. Watson Steven E. Koch Chairman of Advisory Committee Dedication I would like to dedicate, first and foremost, this thesis to the Lord...Officer. Tony was promoted to the rick of Cap(alnin June 1995. While atOffut AFB, he was selected by AFIT to attend North Carolina State University to...advisory committee, Dr. Steven E. Koch (Chairman), Dr. Allen J. Riordan , and Dr. Gerald F. Watson. Their guidance and personal interest in this work
1980-11-01
materials work and sample preparation of D.W. Dong; the technical assistance of F.L. Pesavento and J.A. Calise; the assistance in device fabrication...FILMS D.J. DiMaria R. Ghez D.W. Dong I.B.M. Thomas J. Watson Research Center Yorktown Heights, New York 10598 Technical Assistance of F.L. Pesavento and... Pesavento and J.A. Calise; the assistance with gate metallizations by the Silicon Facility and Central Scientific Services at the T.J. Watson
ERIC Educational Resources Information Center
Missinne, Leo E.; Wilcox, Victoria
This paper discusses the life, theories, and therapeutic techniques of psychotherapist, Viktor E. Frankl. A brief biography of Frankl is included discussing the relationship of his early experiences as a physician to his theory of personality. Frankl's theory focusing on man's need for meaning and emphasizing the spiritual dimension in each human…
ERIC Educational Resources Information Center
Davis, Philip W.
This volume explores objectively the essential characteristic of nine twentieth-century linguistic theories with the theoretical variant for discussion based on one closely representative of work within a given approach or usually associated with the name of the theory. First, the theory of Ferdinand de Saussure is discussed based on his book,…
ERIC Educational Resources Information Center
Peim, Nick
2009-01-01
This paper seeks to re-examine Yrio Engestrom's activity theory as a technology of knowledge designed to enable positive transformations of specific practices. The paper focuses on a key paper where Engestrom defines the nature and present state of activity theory. Beginning with a brief account of the relations between activity theory and…
ERIC Educational Resources Information Center
Upton, Matthew G.; Egan, Toby Marshall
2007-01-01
The established limitations of career development (CD) theory and human resource development (HRD) theory building are addressed by expanding the framing of these issues to multilevel contexts. Multilevel theory building is an approach most effectively aligned with HRD literature and CD and HRD practice realities. An innovative approach multilevel…
ERIC Educational Resources Information Center
Bassett, Jonathan F.
2007-01-01
The author attempts to integrate Terror Management Theory (TMT) and R. W. Firestone's Separation Theory (1984, 1994). Both theories emphasize defense against death anxiety as a key human motive. Whereas TMT focuses extensively on self-esteem and cultural worldview, Firestone posited additional defenses such as gene survival, self-nourishing…
Udod, Sonia A; Racine, Louise
2017-12-01
To draw on the findings of a grounded theory study aimed at exploring how power is exercised in nurse-manager relationships in the hospital setting, this paper examines the empirical and pragmatic adequacy of grounded theory as a methodology to advance the concept of empowerment in the area of nursing leadership and management. The evidence on staff nurse empowerment has highlighted the magnitude of individual and organisational outcomes, but has not fully explicated the micro-level processes underlying how power is exercised, shared or created within the nurse-manager relationship. Although grounded theory is a widely adopted nursing research methodology, it remains less used in nursing leadership because of the dominance of quantitative approaches to research. Grounded theory methodology provides the empirical and pragmatic relevance to inform nursing practice and policy. Grounded theory is a relevant qualitative approach to use in leadership research as it provides a fine and detailed analysis of the process underlying complexity and bureaucracy. Discursive paper. A critical examination of the empirical and pragmatic relevance of grounded theory by (Corbin & Strauss, , ) as a method for analysing and solving problems in nurses' practice is provided. This paper provides evidence to support the empirical and pragmatic adequacy of grounded theory methodology. Although the application of the ontological, epistemological and methodological assumptions of grounded theory is challenging, this methodology is useful to address real-life problems in nursing practice by developing theoretical explanations of nurse empowerment, or lack thereof, in the workplace. Grounded theory represents a relevant methodology to inform nursing leadership research. Grounded theory is anchored in the reality of practice. The strength of grounded theory is to provide results that can be readily applied to clinical practice and policy as they arise from problems that affect practice and that
Daugirdas, John T; Greene, Tom; Depner, Thomas A; Chumlea, Cameron; Rocco, Michael J; Chertow, Glenn M
2003-09-01
The modeled volume of urea distribution (Vm) in intermittently hemodialyzed patients is often compared with total body water (TBW) volume predicted from population studies of patient anthropometrics (Vant). Using data from the HEMO Study, we compared Vm determined by both blood-side and dialysate-side urea kinetic models with Vant as calculated by the Watson, Hume-Weyers, and Chertow anthropometric equations. Median levels of dialysate-based Vm and blood-based Vm agreed (43% and 44% of body weight, respectively). These volumes were lower than anthropometric estimates of TBW, which had median values of 52% to 55% of body weight for the three formulas evaluated. The difference between the Watson equation for TBW and modeled urea volume was greater in Caucasians (19%) than in African Americans (13%). Correlations between Vm and Vant determined by each of the three anthropometric estimation equations were similar; but Vant derived from the Watson formula had a slightly higher correlation with Vm. The difference between Vm and the anthropometric formulas was greatest with the Chertow equation, less with the Hume-Weyers formula, and least with the Watson estimate. The age term in the Watson equation for men that adjusts Vant downward with increasing age reduced an age effect on the difference between Vant and Vm in men. The findings show that kinetically derived values for V from blood-side and dialysate-side modeling are similar, and that these modeled urea volumes are lower by a substantial amount than anthropometric estimates of TBW. The higher values for anthropometry-derived TBW in hemodialyzed patients could be due to measurement errors. However, the possibility exists that TBW space is contracted in patients with end-stage renal disease (ESRD) or that the TBW space and the urea distribution space are not identical.
Concept analysis and the building blocks of theory: misconceptions regarding theory development.
Bergdahl, Elisabeth; Berterö, Carina M
2016-10-01
The purpose of this article is to discuss the attempts to justify concepts analysis as a way to construct theory - a notion often advocated in nursing. The notion that concepts are the building blocks or threads from which theory is constructed is often repeated. It can be found in many articles and well-known textbooks. However, this notion is seldom explained or defended. The notion of concepts as building blocks has also been questioned by several authors. However, most of these authors seem to agree to some degree that concepts are essential components from which theory is built. Discussion paper. Literature was reviewed to synthesize and debate current knowledge. Our point is that theory is not built by concepts analysis or clarification and we will show that this notion has its basis in some serious misunderstandings. We argue that concept analysis is not a part of sound scientific method and should be abandoned. The current methods of concept analysis in nursing have no foundation in philosophy of science or in language philosophy. The type of concept analysis performed in nursing is not a way to 'construct' theory. Rather, theories are formed by creative endeavour to propose a solution to a scientific and/or practical problem. The bottom line is that the current style and form of concept analysis in nursing should be abandoned in favour of methods in line with modern theory of science. © 2016 John Wiley & Sons Ltd.
ERIC Educational Resources Information Center
Harris, Kevin
1984-01-01
The author compares the liberal idealist theory of education with a Marxist theory. He suggests that in the developing nations, changes in schooling will parallel stages in development, and specific norms, values, and habits will be fostered by the schools. (CT)
Management Theories and Broadcasting: A Handbook.
ERIC Educational Resources Information Center
Craig, J. Robert; Hindmarsh, Wayne A.
Today's contemporary management and motivation theories, as applied to the business of broadcasting, are the focus of the first section of this paper. It deals with the kinds and reactions of employees in broadcasting stations in relation to 11 motivational theories: (1) Theories X and Y, (2) Immaturity-Maturity Theory, (3) V Theory, (4) Z Theory,…
Further Development of HS Field Theory
NASA Astrophysics Data System (ADS)
Abdurrahman, Abdulmajeed; Faridani, Jacqueline; Gassem, Mahmoud
2006-04-01
We present a systematic treatment of the HS Field theory of the open bosonic string and discuss its relationship to other full string field theories of the open bosonic string such as Witten's theory and the CVS theory. In the development of the HS field theory we encounter infinite dimensional matrices arising from the change of representation between the two theories, i.e., the HS field theory and the full string field theory. We give a general procedure of how to invert these gigantic matrices. The inversion of these matrices involves the computation of many infinite sums. We give the values of these sums and state their generalizations arising from considering higher order vertices (i.e., more than three strings) in string field theory. Moreover, we give a general procedure, on how to evaluate the generalized sums, that can be extended to many generic sums of similar properties. We also discuss the conformal operator connecting the HS field theory to that of the CVS string field theory.
Play: The Reversal Theory Perspective.
ERIC Educational Resources Information Center
Kerr, J. H.
The intention of this theoretical paper is to present a reversal theory interpretation of play phenomena. Reversal theory, a developing theory in psychology, concerns the complex relationship between experience and motivation. One of the central charactieristics of the theory is that it attempts to understand why so much of human behavior is…
Reconstructing constructivism: causal models, Bayesian learning mechanisms, and the theory theory.
Gopnik, Alison; Wellman, Henry M
2012-11-01
We propose a new version of the "theory theory" grounded in the computational framework of probabilistic causal models and Bayesian learning. Probabilistic models allow a constructivist but rigorous and detailed approach to cognitive development. They also explain the learning of both more specific causal hypotheses and more abstract framework theories. We outline the new theoretical ideas, explain the computational framework in an intuitive and nontechnical way, and review an extensive but relatively recent body of empirical results that supports these ideas. These include new studies of the mechanisms of learning. Children infer causal structure from statistical information, through their own actions on the world and through observations of the actions of others. Studies demonstrate these learning mechanisms in children from 16 months to 4 years old and include research on causal statistical learning, informal experimentation through play, and imitation and informal pedagogy. They also include studies of the variability and progressive character of intuitive theory change, particularly theory of mind. These studies investigate both the physical and the psychological and social domains. We conclude with suggestions for further collaborative projects between developmental and computational cognitive scientists.
Magnetic expansion of Nekrasov theory: The SU(2) pure gauge theory
DOE Office of Scientific and Technical Information (OSTI.GOV)
He Wei; Miao Yangang
It is recently claimed by Nekrasov and Shatashvili that the N=2 gauge theories in the {Omega} background with {epsilon}{sub 1}=({h_bar}/2{pi}), {epsilon}{sub 2}=0 are related to the quantization of certain algebraic integrable systems. We study the special case of SU(2) pure gauge theory; the corresponding integrable model is the A{sub 1} Toda model, which reduces to the sine-Gordon quantum mechanics problem. The quantum effects can be expressed as the WKB series written analytically in terms of hypergeometric functions. We obtain the magnetic and dyonic expansions of the Nekrasov theory by studying the property of hypergeometric functions in the magnetic and dyonicmore » regions on the moduli space. We also discuss the relation between the electric-magnetic duality of gauge theory and the action-action duality of the integrable system.« less
Theory, the Final Frontier? A Corpus-Based Analysis of the Role of Theory in Psychological Articles.
Beller, Sieghard; Bender, Andrea
2017-01-01
Contemporary psychology regards itself as an empirical science, at least in most of its subfields. Theory building and development are often considered critical to the sciences, but the extent to which psychology can be cast in this way is under debate. According to those advocating a strong role of theory, studies should be designed to test hypotheses derived from theories (theory-driven) and ideally should yield findings that stimulate hypothesis formation and theory building (theory-generating). The alternative position values empirical findings over theories as the lasting legacy of science. To investigate which role theory actually plays in current research practice, we analyse references to theory in the complete set of 2,046 articles accepted for publication in Frontiers of Psychology in 2015. This sample of articles, while not representative in the strictest sense, covers a broad range of sub-disciplines, both basic and applied, and a broad range of article types, including research articles, reviews, hypothesis & theory, and commentaries. For the titles, keyword lists, and abstracts in this sample, we conducted a text search for terms related to empiricism and theory, assessed the frequency and scope of usage for six theory-related terms, and analyzed their distribution over different article types and subsections of the journal. The results indicate substantially lower frequencies of theoretical than empirical terms, with references to a specific (named) theory in less than 10% of the sample and references to any of even the most frequently mentioned theories in less than 0.5% of the sample. In conclusion, we discuss possible limitations of our study and the prospect of theoretical advancement.
Theory, the Final Frontier? A Corpus-Based Analysis of the Role of Theory in Psychological Articles
Beller, Sieghard; Bender, Andrea
2017-01-01
Contemporary psychology regards itself as an empirical science, at least in most of its subfields. Theory building and development are often considered critical to the sciences, but the extent to which psychology can be cast in this way is under debate. According to those advocating a strong role of theory, studies should be designed to test hypotheses derived from theories (theory-driven) and ideally should yield findings that stimulate hypothesis formation and theory building (theory-generating). The alternative position values empirical findings over theories as the lasting legacy of science. To investigate which role theory actually plays in current research practice, we analyse references to theory in the complete set of 2,046 articles accepted for publication in Frontiers of Psychology in 2015. This sample of articles, while not representative in the strictest sense, covers a broad range of sub-disciplines, both basic and applied, and a broad range of article types, including research articles, reviews, hypothesis & theory, and commentaries. For the titles, keyword lists, and abstracts in this sample, we conducted a text search for terms related to empiricism and theory, assessed the frequency and scope of usage for six theory-related terms, and analyzed their distribution over different article types and subsections of the journal. The results indicate substantially lower frequencies of theoretical than empirical terms, with references to a specific (named) theory in less than 10% of the sample and references to any of even the most frequently mentioned theories in less than 0.5% of the sample. In conclusion, we discuss possible limitations of our study and the prospect of theoretical advancement. PMID:28642728
NASA Technical Reports Server (NTRS)
Ni, W.
1972-01-01
A new relativistic theory of gravity is presented. This theory agrees with all experiments to date. It is a metric theory, it is Lagrangian-based, and it possesses a preferred frame with conformally-flat space slices. With an appropriate choice of certain adjustable functions and parameters, this theory possesses precisely the same post-Newtonian limit as general relativity.
Causality violations in Lovelock theories
NASA Astrophysics Data System (ADS)
Brustein, Ram; Sherf, Yotam
2018-04-01
Higher-derivative gravity theories, such as Lovelock theories, generalize Einstein's general relativity (GR). Modifications to GR are expected when curvatures are near Planckian and appear in string theory or supergravity. But can such theories describe gravity on length scales much larger than the Planck cutoff length scale? Here we find causality constraints on Lovelock theories that arise from the requirement that the equations of motion (EOM) of perturbations be hyperbolic. We find a general expression for the "effective metric" in field space when Lovelock theories are perturbed around some symmetric background solution. In particular, we calculate explicitly the effective metric for a general Lovelock theory perturbed around cosmological Friedman-Robertson-Walker backgrounds and for some specific cases when perturbed around Schwarzschild-like solutions. For the EOM to be hyperbolic, the effective metric needs to be Lorentzian. We find that, unlike for GR, the effective metric is generically not Lorentzian when the Lovelock modifications are significant. So, we conclude that Lovelock theories can only be considered as perturbative extensions of GR and not as truly modified theories of gravity. We compare our results to those in the literature and find that they agree with and reproduce the results of previous studies.
Commonly Used Theories in CTE Research: Toward a Core Theory Base for CTE
ERIC Educational Resources Information Center
Schmidtke, Carsten
2017-01-01
Presently, there is no widespread agreement on foundational theories for Career and Technical Education (CTE) as a discipline, nor is there much discussion and debate in the literature on what a theory foundation might look like. The case has been made that theory helps scholars and practitioners look at data from different angles, offer different…
[Aromatherapy and nursing: historical and theoretical conception].
Gnatta, Juliana Rizzo; Kurebayashi, Leonice Fumiko Sato; Turrini, Ruth Natalia Teresa; Silva, Maria Júlia Paes da
2016-02-01
Aromatherapy is a Practical or Complementary Health Therapy that uses volatile concentrates extracted from plants called essential oils, in order to improve physical, mental and emotional well-being. Aromatherapy has been practiced historically and worldwide by nurses and, as in Brazil is supported by the Federal Nursing Council, it is relevant to discuss this practice in the context of Nursing through Theories of Nursing. This study of theoretical reflection, exploratory and descriptive, aims to discuss the pharmacognosy of essential oils, the historical trajectory of Aromatherapy in Nursing and the conceptions to support Aromatherapy in light of eight Nursing Theorists (Florence Nightingale, Myra Levine, Hildegard Peplau, Martha Rogers, Callista Roy, Wanda Horta, Jean Watson and Katharine Kolcaba), contributing to its inclusion as a nursing care practice.
Galilean field theories and conformal structure
NASA Astrophysics Data System (ADS)
Bagchi, Arjun; Chakrabortty, Joydeep; Mehra, Aditya
2018-04-01
We perform a detailed analysis of Galilean field theories, starting with free theories and then interacting theories. We consider non-relativistic versions of massless scalar and Dirac field theories before we go on to review our previous construction of Galilean Electrodynamics and Galilean Yang-Mills theory. We show that in all these cases, the field theories exhibit non-relativistic conformal structure (in appropriate dimensions). The surprising aspect of the analysis is that the non-relativistic conformal structure exhibited by these theories, unlike relativistic conformal invariance, becomes infinite dimensional even in spacetime dimensions greater than two. We then couple matter with Galilean gauge theories and show that there is a myriad of different sectors that arise in the non-relativistic limit from the parent relativistic theories. In every case, if the parent relativistic theory exhibited conformal invariance, we find an infinitely enhanced Galilean conformal invariance in the non-relativistic case. This leads us to suggest that infinite enhancement of symmetries in the non-relativistic limit is a generic feature of conformal field theories in any dimension.