Sample records for c-coriolis interacting dyad

  1. Comparison of Mother-Infant Interactions between Japanese Dyads and American Dyads.

    ERIC Educational Resources Information Center

    Hirose, Taiko; Shinoki, Eri; Hamada, Yuko

    Mother-infant interaction creates a context for socioemotional, behavioral, and cognitive development. This study used the Nursing Child Assessment Feeding Scale (NCAFS) and the Nursing Child Assessment Teaching Scale (NCATS) to examine mother-infant interaction in Japanese dyads. Subjects were residing in Hikkaido, Japan, and assessments were…

  2. Excited-state interactions in diastereomeric flurbiprofen-thymine dyads.

    PubMed

    Bonancía, Paula; Vayá, Ignacio; Climent, M José; Gustavsson, Thomas; Markovitsi, Dimitra; Jiménez, M Consuelo; Miranda, Miguel A

    2012-09-01

    Excited-state interactions between (S)- or (R)-flurbiprofen ((S)- or (R)-FBP) and thymidine (dThd) covalently linked in dyads 1 or 2 have been investigated. In both dyads, the only emitting species is (1)FBP*, but with a lower fluorescence quantum yield (?(F)) and a shorter fluorescence lifetime (?(F)) than when free in solution. These results indicate that dynamic quenching occurs either by electron transfer or via exciplex formation, with FBP as the charge-donating species. In acetonitrile, both mechanisms are favored, while in dioxane exciplex formation is predominating. Isomer 1 displays lower values of ?(F) and ?(F) than its analogue 2, indicating that the relative spatial arrangement of the chromophores plays a significant role. The triplet quantum yields (?(T)) of 1 and 2 are significantly higher than the expectations based solely on (1)FBP*-dThd intersystem crossing quantum yields (?(ISC)), with ?(T) (1) > ?(T) (2). This can be explained in terms of intramolecular charge recombination at the radical ion pairs and/or the exciplexes, which would be again dependent on geometrical factors. The triplet lifetimes (?(T)) of (3)FBP*-dThd and free (3)FBP* are similar, indicating the lack of excited-state interactions at this stage. The FBP-dThd dyads could, in principle, constitute appropriate model systems for the elucidation of the excited-state interactions in noncovalent DNA-ligand complexes. PMID:22873567

  3. Effects of Social Insertion Mode on Performance and Interaction in Asymmetric Dyads.

    ERIC Educational Resources Information Center

    Fraysse, Jean-Claude

    1991-01-01

    Describes a study of effects of socio-cognitive mediation among children. Reports manipulation of two factors: ego-boosting representation of the subject's ability to perform a task, and representation the children had of others. Concludes that performance was superior when children worked in dyads, dyad composition affects interaction modes, and…

  4. Attachment predicting nonverbal behaviour, interaction quality and perception accuracy in romantic and stranger dyads 

    E-print Network

    Witts, Nathan

    2006-01-01

    This study examined the nonverbal, interaction quality and perceptual accuracy correlates of attachment style within two interactions groups; strangers and romantic couples. Twenty eight stranger dyads and twenty eight ...

  5. When Training with a Partner Is Inferior to Training Alone: The Importance of Dyad Type and Interaction Quality

    ERIC Educational Resources Information Center

    Crook, Amy E.; Beier, Margaret E.

    2010-01-01

    Dyad training, where trainees learn in pairs but ultimately perform individually, has been shown to be an effective method for training some skills. The effectiveness of this approach, however, may be tied to the type of task to be trained and the quality of the interaction in the dyad. We report two studies on the effectiveness of dyad training…

  6. Modalities of Infant-Mother Interaction in Japanese, Japanese American Immigrant, and European American Dyads

    PubMed Central

    Bornstein, Marc H.; Cote, Linda R.; Haynes, O. Maurice; Suwalsky, Joan T. D.; Bakeman, Roger

    2011-01-01

    Cultural variation in relations and moment-to-moment contingencies of infant-mother person-oriented and object-oriented interactions were examined and compared in 118 Japanese, Japanese American immigrant, and European American dyads with 5.5-month-olds. Infant and mother person-oriented behaviors were positively related in all cultural groups, but infant and mother object-oriented behaviors were positively related only among European Americans. In all groups, infant and mother behaviors within each modality were mutually contingent. Culture moderated lead-lag relations: Japanese infants were more likely than their mothers to respond in object-oriented interactions, European American mothers were more likely than their infants to respond in person-oriented interactions. Japanese American dyads behaved more like European American dyads. Interaction, infant effects, and parent socialization findings are set in cultural and accultural models of transactions between young infants and their mothers. PMID:22860874

  7. Parent-Child Interaction Therapy: Application to maltreating parent-child dyads

    Microsoft Academic Search

    Susan G. Timmer; Anthony J. Urquiza; Nancy M. Zebell; Jean M. McGrath

    2005-01-01

    Objective:Parent-Child Interaction Training (PCIT), which uses a social learning framework, is a dyadic intervention that is designed to alter specific patterns of interaction found in parent-child relationships. Previous research suggests that maladaptive and high-risk characteristics found in maltreating parent-child dyads may be responsive to PCIT. The primary focus of this study is to examine the effectiveness of PCIT with maltreating

  8. Face-to-Face Interactions in Unacquainted Female-Male Adolescent DyadsHow Do Girls and Boys Behave?

    Microsoft Academic Search

    Giselle C. Kolaric; Nancy L. Galambos

    1995-01-01

    Verbal and nonverbal behaviors of adolescents interacting in female-male dyads were examined for gender and context (i.e., topic of discussion) differences. Thirty dyads, comprised of unacquainted 15-year-olds, discussed a masculine, feminine, and gender-neutral task for 3 minutes each. The videotaped interactions were coded for verbal (questions, uncertainty, speaking time) and nonverbal (gestures, head\\/facial touches, smiling, gazing) behaviors. Codes also were

  9. MOTHER-INFANT INTERACTION IMPROVES WITH A DEVELOPMENTAL INTERVENTION FOR MOTHER-PRETERM INFANT DYADS

    PubMed Central

    White-Traut, Rosemary; Norr, Kathleen F.; Fabiyi, Camille; Rankin, Kristin M.; Li, Zhyouing; Liu, Li

    2013-01-01

    While premature infants have a high need for positive interactions, both infants and their mothers are challenged by the infant‘s biological immaturity. This randomized clinical trial of 198 premature infants born at 29–34 weeks gestation and their mothers examined the impact of the H-HOPE (Hospital to Home: Optimizing the Infant’s Environment) intervention on mother-premature infant interaction patterns at 6-weeks corrected age (CA). Mothers had at least 2 social environmental risk factors such as minority status or less than high school education. Mother-infant dyads were randomly assigned to the H-HOPE intervention group or an attention Control group. H-HOPE is an integrated intervention that included (1) twice-daily infant stimulation using the ATVV (auditory, tactile, visual, and vestibular-rocking stimulation) and (2) four maternal participatory guidance sessions plus two telephone calls by a nurse-community advocate team. Mother-infant interaction was assessed at 6-weeks CA using the Nursing Child Assessment Satellite Training–Feeding Scale (NCAST, 76 items) and the Dyadic Mutuality Code (DMC, 6-item contingency scale during a 5-minute play session). NCAST and DMC scores for the Control and H-HOPE groups were compared using t-tests, chi-square tests and multivariable analysis. Compared with the Control group (n = 76), the H-HOPE group (n = 66) had higher overall NCAST scores and higher maternal Social-Emotional Growth Fostering Subscale scores. The H-HOPE group also had significantly higher scores for the overall infant subscale and the Infant Clarity of Cues Subscale (p < 0.05). H-HOPE dyads were also more likely to have high responsiveness during play as measured by the DMC (67.6% versus 58.1% of controls). After adjustment for significant maternal and infant characteristics, H-HOPE dyads had marginally higher scores during feeding on overall mother-infant interaction (? = 2.03, p = .06) and significantly higher scores on the infant subscale (? = 0.75, p = .05) when compared to controls. In the adjusted analysis, H-HOPE dyads had increased odds of high versus low mutual responsiveness during play (OR = 2.37, 95% CI = 0.97, 5.80). Intervening with both mother and infant is a promising approach to help premature infants achieve the social interaction patterns essential for optimal development. PMID:23962543

  10. Mother-infant interaction improves with a developmental intervention for mother-preterm infant dyads.

    PubMed

    White-Traut, Rosemary; Norr, Kathleen F; Fabiyi, Camille; Rankin, Kristin M; Li, Zhyouing; Liu, Li

    2013-12-01

    While premature infants have a high need for positive interactions, both infants and their mothers are challenged by the infant's biological immaturity. This randomized clinical trial of 198 premature infants born at 29-34 weeks gestation and their mothers examined the impact of the H-HOPE (Hospital to Home: Optimizing the Infant's Environment) intervention on mother-premature infant interaction patterns at 6-weeks corrected age (CA). Mothers had at least 2 social environmental risk factors such as minority status or less than high school education. Mother-infant dyads were randomly assigned to the H-HOPE intervention group or an attention control group. H-HOPE is an integrated intervention that included (1) twice-daily infant stimulation using the ATVV (auditory, tactile, visual, and vestibular-rocking stimulation) and (2) four maternal participatory guidance sessions plus two telephone calls by a nurse-community advocate team. Mother-infant interaction was assessed at 6-weeks CA using the Nursing Child Assessment Satellite Training-Feeding Scale (NCAST, 76 items) and the Dyadic Mutuality Code (DMC, 6-item contingency scale during a 5-min play session). NCAST and DMC scores for the Control and H-HOPE groups were compared using t-tests, chi-square tests and multivariable analysis. Compared with the Control group (n = 76), the H-HOPE group (n = 66) had higher overall NCAST scores and higher maternal Social-Emotional Growth Fostering Subscale scores. The H-HOPE group also had significantly higher scores for the overall infant subscale and the Infant Clarity of Cues Subscale (p < 0.05). H-HOPE dyads were also more likely to have high responsiveness during play as measured by the DMC (67.6% versus 58.1% of controls). After adjustment for significant maternal and infant characteristics, H-HOPE dyads had marginally higher scores during feeding on overall mother-infant interaction (? = 2.03, p = 0.06) and significantly higher scores on the infant subscale (? = 0.75, p = 0.05) when compared to controls. In the adjusted analysis, H-HOPE dyads had increased odds of high versus low mutual responsiveness during play (OR = 2.37, 95% CI = 0.97, 5.80). Intervening with both mother and infant is a promising approach to help premature infants achieve the social interaction patterns essential for optimal development. PMID:23962543

  11. Drug-protein interactions assessed by fluorescence measurements in the real complexes and in model dyads

    NASA Astrophysics Data System (ADS)

    Vayá, Ignacio; Pérez-Ruiz, Raúl; Lhiaubet-Vallet, Virginie; Jiménez, M. Consuelo; Miranda, Miguel A.

    2010-02-01

    In the present work, a systematic fluorescence study on supramolecular systems using two serum albumins (HSA or BSA) as hosts and the nonsteroidal antiinflammatory drugs carprofen (CPF) or naproxen (NPX) as guests has been undertaken. In parallel, model dyads containing Tyr or Trp covalently linked to CPF or NPX have also been investigated. In HSA/(S)-CPF and BSA/(S)-CPF ( ?exc = 266 nm), at 1:1 M ratio, an important degree (more than 40%) of singlet-singlet energy transfer (SSET) was observed to take place. The distance ( r) calculated for energy transfer from the SAs to (S)-CPF through a FRET mechanism was found to be ca. 21 Å. In the case of HSA/(S)-NPX and BSA/(S)-NPX, energy transfer occurred to a lower extent (ca. 7%), and r was determined as ca. 24 Å. In order to investigate the possible excited state interactions between bound ligands and the relevant amino acids present in the protein binding sites, four pairs of model dyads were designed and synthesised, namely ( S, S)-TyrCPF, ( S, R)-TyrCPF, ( S, S)-TrpCPF, ( S, R)-TrpCPF, ( S, S)-TyrNPX, ( S, R)-TyrNPX, ( S, S)-TrpNPX and ( S, R)-TrpNPX. A complete SSET was observed from Tyr or Trp to CPF, since no contribution from the amino acids was present in the emission of the dyads. Likewise, a very efficient Tyr or Trp to NPX energy transfer was observed. Remarkably, in ( S, S)-TrpNPX and ( S, R)-TrpNPX a configuration-dependent reduction in the emission intensity was observed, revealing a strong and stereoselective intramolecular quenching. This effect can be attributed to exciplex formation and is dynamic in nature, as the fluorescence lifetimes were much shorter in ( S, R)- and ( S, S)-TrpNPX (1.5 and 3.1 ns, respectively) than in (S)-NPX (11 ns).

  12. Two-Photon Study on the Electronic Interactions between the First Excited Singlet States in Carotenoid?Tetrapyrrole Dyads

    SciTech Connect

    Liao, Pen-Nan; Pillai, Smitha; Gust, Devens; Moore, Thomas A.; Moore, Ana L.; Walla, Peter J.

    2011-01-01

    Electronic interactions between the first excited states (S{sub 1}) of carotenoids (Car) of different conjugation lengths (8?11 double bonds) and phthalocyanines (Pc) in different Car?Pc dyad molecules were investigated by two-photon spectroscopy and compared with Car S{sub 1}?chlorophyll (Chl) interactions in photosynthetic light harvesting complexes (LHCs). The observation of Chl/Pc fluorescence after selective two-photon excitation of the Car S{sub 1} state allowed sensitive monitoring of the flow of energy between Car S{sub 1} and Pc or Chl. It is found that two-photon excitation excites to about 80% to 100% exclusively the carotenoid state Car S{sub 1} and that only a small fraction of direct tetrapyrrole two-photon excitation occurs. Amide-linked Car?Pc dyads in tetrahydrofuran demonstrate a molecular gear shift mechanism in that effective Car S{sub 1} ? Pc energy transfer is observed in a dyad with 9 double bonds in the carotenoid, whereas in similar dyads with 11 double bonds in the carotenoid, the Pc fluorescence is strongly quenched by Pc ? Car S{sub 1} energy transfer. In phenylamino-linked Car?Pc dyads in toluene extremely large electronic interactions between the Car S{sub 1} state and Pc were observed, particularly in the case of a dyad in which the carotenoid contained 10 double bonds. This observation together with previous findings in the same system provides strong evidence for excitonic Car S{sub 1}?Pc Q{sub y} interactions. Very similar results were observed with photosynthetic LHC II complexes in the past, supporting an important role of such interactions in photosynthetic down-regulation.

  13. Challenges to Bonnet Monkey (Macaca radiata) Social Groups: Mother–Infant Dyad and Infant Social Interactions

    PubMed Central

    Laudenslager, Mark L.; Natvig, C.; Mikulich-Gilbertson, S.M.; Blevins, M.; Corcoran, C.; Pierre, P.J.; Bennett, A.J.

    2015-01-01

    The mother-infant dyad is crucial to early development in a variety of species. The complexity of social groupings in nonhuman primates makes this relationship resilient as well as susceptible to early challenges associated with environmental chaos. Quantitative behavior observations of bonnet monkey mother-infant interactions were collected from 28 mother-infant dyads between one and twelve months of age. Social groups were subjected to several prenatal and/or postnatal housing relocations within a single year resulting in two study groups. One group experienced relocations (ATYPICAL, n = 14) and the second group (TYPICAL, n = 14) was conceived and reared in the same location. Behaviors in the ethogram included mother-infant interactions and infant social interactions with other members of the group. Observations between ages of two to four months were analyzed by a mixed model analysis of variance including fixed effects of per and postnatal history (TYPICAL, ATYPICAL), age, and history by age interaction and random effects of mother and infant nested within mother. A significant effect of relocation history was noted on a number of infant behaviors. ATYPICAL infants were out of direct contact with their mother at an earlier age but remained in her proximity. Control of proximity shifted to offsrping in the ATYPICAL group compared to the TYPICAL group. Furthermore, greater social interactions between two and four months of age with other members of the social group as well as the ir mother were observed in the ATYPICAL group. It is suggested that continuous challenge associated with relocation may affect the infant at later developmental ages due to these early differences in ways that are yet unclear. PMID:20583143

  14. Face-to-Face Interactions in Unacquainted Female-Male Dyads: How Do Girls and Boys Behave?

    ERIC Educational Resources Information Center

    Kolaric, Giselle C.; Galambos, Nancy L.

    1995-01-01

    Examined adolescents' verbal and nonverbal behavior in 30 female-male dyads. All behaviors were coded. Analysis of videotaped interactions revealed more similarities between girls and boys than differences, although gender distinctions were evident in speaking time and in smiling. Results focus on developmental and contextual accounts of…

  15. van der Waals interactions are critical in Car-Parrinello molecular dynamics simulations of porphyrin-fullerene dyads.

    PubMed

    Karilainen, Topi; Cramariuc, Oana; Kuisma, Mikael; Tappura, Kirsi; Hukka, Terttu I

    2015-04-15

    The interplay between electrostatic and van der Waals (vdW) interactions in porphyrin-C60 dyads is still under debate despite its importance in influencing the structural characteristics of such complexes considered for various applications in molecular photovoltaics. In this article, we sample the conformational space of a porphyrin-C60 dyad using Car-Parrinello molecular dynamics simulations with and without empirical vdW corrections. Long-range vdW interactions, which are poorly described by the commonly used density functional theory functionals, prove to be essential for a proper dynamics of the dyad moieties. Inclusion of vdW corrections brings porphyrin and C60 close together in an orientation that is in agreement with experimental observations. The structural differences arising from the vdW corrections are shown to be significant for several properties and potentially less important for others. Additionally, our Mulliken population analysis reveals that contrary to the common belief, porphyrin is not the primary electron donating moiety for C60 . In the considered dyad, fullerene's affinity for electrons is primarily satisfied by charge transfer from the amide group of the linker. However, we show that in the absence of another suitable bound donor, C60 can withdraw electrons from porphyrin if it is sufficiently close. © 2015 Wiley Periodicals, Inc. PMID:25639631

  16. Analyte interactions with a new ditopic dansylamide-nitrobenzoxadiazole dyad: a combined photophysical, NMR, and theoretical (DFT) study.

    PubMed

    Bhoi, Abhas Kumar; Das, Sudhir Kumar; Majhi, Debashis; Sahu, Prabhat Kumar; Nijamudheen, A; N, Anoop; Rahaman, Abdur; Sarkar, Moloy

    2014-08-21

    We report herein the synthesis and photophysical studies on a new multicomponent chemosensor dyad comprising two fluorescing units, dansylamide (DANS) and nitrobenzoxadiazole (NBD). The system has been developed to investigate receptor-analyte binding interactions in the presence of both cations and anions in a single molecular system. A dimethyl amino (in the DANS unit) group is used as a receptor for cations, and acidic hydrogens of sulfonamide and the NBD group are used as receptors for anions. The system is characterized by conventional analytical techniques. The photophysical properties of this supramolecular system in the absence and presence of various metal ions and nonmetal ions as additives are investigated in an acetonitrile medium. Utility of this system in an aqueous medium has also been demonstrated. The absorption and fluorescence spectrum of the molecular system consists of a broad band typical of an intramolecular charge-transfer (ICT) transition. A low quantum yield and lifetime of the NBD moiety in the present dyad indicates photoinduced electron transfer (PET) between DANS and the NBD moiety. The fluorescence intensity of the system is found to decrease in the presence of fluoride and acetate anions; however, the quenching is found to be much higher for fluoride. This quenching behavior is attributed to the enhanced PET from the anion receptor to the fluorophore moiety. The mechanistic aspect of the fluoride ion signaling behavior has also been studied by infrared (IR) and (1)H NMR experiments. The hydrogen bonding interaction between the acidic NH protons of the DPN moiety and F(-) is found to be primarily responsible for the fluoride selective signaling behavior. While investigating the cation signaling behavior, contrary to anions, significant fluorescence enhancement has been observed only in the presence of transition-metal ions. This behavior is rationalized by considering the disruption of PET communication between DANS and the NBD moiety due to transition-metal ion binding. Theoretical (density functional theory) studies are also performed for the better understanding of the receptor-analyte interaction. Interestingly, negative cooperativity in binding is observed when the interaction of this system is studied in the presence of both Zn(2+) and F(-). Fluorescence microscopy studies also revealed that the newly developed fluorescent sensor system can be employed as an imaging probe in live cells. PMID:25116958

  17. Patterns of mother-infant interaction from 3 to 12 months among dyads with substance abuse and psychiatric problems.

    PubMed

    Siqveland, Torill S; Haabrekke, Kristin; Wentzel-Larsen, Tore; Moe, Vibeke

    2014-11-01

    The aim of this study was to investigate the development of mother-infant interaction patterns from 3 to 12 months among three groups of mother-baby pairs recruited during pregnancy: one group from residential substance abuse treatment (n=28), a second group from psychiatric outpatient treatment (n=22), and a third group from well-baby clinics (n=30). The mother-infant interaction at 3 and 12 months was assessed by the Parent-Child Early Relational Assessment (PCERA), which consists of maternal, child and dyadic subscales (Clark, 2006). Linear mixed effects models were used to analyze group differences and the changes in mother-infant interaction from 3 to 12 months. At 3 months, pairwise comparisons showed that the group with psychiatric problems had significantly more difficulties in the mother-infant interaction than the two other groups. The group with substance abuse problems was not significantly different from the two other groups. At 12 months, the mother-infant pairs in the substance abuse group showed significantly more relational disturbances than the non-clinical pairs, as well as a poorer affective quality of interaction than the dyads in the group with psychiatric problems. Analysis of change from 3 to 12 months showed that difficulties in the interaction increased among the mother-baby pairs in the substance abuse group, while improvements were displayed in the two other groups. These results underline that mother-infant pairs at double risk due to maternal substance abuse and other non-optimal factors, are in need for long-term follow up in order to prevent the development of negative interactional patterns. PMID:25459795

  18. Excited state interactions between flurbiprofen and tryptophan in drug-protein complexes and in model dyads. Fluorescence studies from the femtosecond to the nanosecond time domains.

    PubMed

    Vayá, Ignacio; Bonancía, Paula; Jiménez, M Consuelo; Markovitsi, Dimitra; Gustavsson, Thomas; Miranda, Miguel A

    2013-04-01

    We report here on the interaction dynamics between flurbiprofen (FBP) and tryptophan (Trp) covalently linked in model dyads and in a complex of FBP with human serum albumin (HSA) probed by time-resolved fluorescence spectroscopy from the femto- to the nano-second timescales. In the dyads, a rapid (k > 10(10) s(-1)) dynamic quenching of the (1)FBP* fluorescence is followed by a slower (k > 10(9) s(-1)) quenching of the remaining (1)Trp* fluorescence. Both processes display a clear stereoselectivity; the rates are 2-3 times higher for the (R,S)-dyad. In addition, a red-shifted exciplex emission is observed, rising in the range of 100-200 ps. A similar two-step dynamic fluorescence quenching is also observed in the FBP-HSA complex, although the kinetics of the involved processes are slower. The characteristic reorientational times determined for the two enantiomeric forms of FBP in the protein show that the interaction is stronger for the (R)-form. This is, to our knowledge, the first observation of stereo-selective flurbiprofen-tryptophan interaction dynamics with femtosecond time resolution. PMID:23426282

  19. Mothers and Fathers Interacting in Dyads and Triads With Normal and Hyperactive Sons

    Microsoft Academic Search

    Duane Buhrmester; Lorinda Camparo; Andrew Christensen; Lauren Shapiro Gonzalez; Stephen P. Hinshaw

    1992-01-01

    Mother–son and father–son interactions of families with hyperactive and normal 6- to 12-year-old sons were observed in dyadic and triadic settings. There was more frequent coercion in families with hyperactive boys, especially when mothers and sons interacted in the dyadic setting. This mother–son acrimony carried over to the triadic context, wherein fathers exhibited a rescue–coercion pattern of behavior. Fathers increased,

  20. Interplay of hole transfer and host-guest interaction in a molecular dyad and triad: ensemble and single-molecule spectroscopy and sensing applications.

    PubMed

    Wu, Xiangyang; Liu, Fang; Wells, Kym L; Tan, Serena L J; Webster, Richard D; Tan, Howe-Siang; Zhang, Dawei; Xing, Bengang; Yeow, Edwin K L

    2015-02-16

    A new molecular dyad consisting of a Cy5 chromophore and ferrocene (Fc) and a triad consisting of Cy5, Fc, and ?-cyclodextrin (CD) are synthesized and their photophysical properties investigated at both the ensemble and single-molecule levels. Hole transfer efficiency from Cy5 to Fc in the dyad is reduced upon addition of CD. This is due to an increase in the Cy5-Fc separation (r) when the Fc is encapsulated in the macrocyclic host. On the other hand, the triad adopts either a Fc-CD inclusion complex conformation in which hole transfer quenching of the Cy5 by Fc is minimal or a quasi-static conformation with short r and rapid charge transfer. Single-molecule fluorescence measurements reveal that r is lengthened when the triad molecules are deposited on a glass substrate. By combining intramolecular charge transfer and competitive supramolecular interaction, the triad acts as an efficient chemical sensor to detect different bioactive analytes such as amantadine hydrochloride and sodium lithocholate in aqueous solution and synthetic urine. PMID:25538048

  1. Intramolecular charge-transfer interaction in a new dyad based on C(60) and bis(4'-tert-butylbiphenyl-4-yl)aniline (BBA) donor.

    PubMed

    Ohno, T; Moriwaki, K; Miyata, T

    2001-05-18

    A novel dyad 2 based on C(60) and bis(4'-tert-butylbiphenyl-4-yl)aniline (BBA) donor has been synthesized and characterized. Cyclic voltammetry (CV) and UV-vis spectra of 2, 61-phenyl-1, 2-methanofullerene[60] 4, 1,2-methanofullerene[60] 5, and BBA were measured and analyzed. CV measurements showed that a reversible oxidation wave of 2 was positively shifted by 40 mV compared to that of BBA. More remarkably, comparing UV-vis spectra of 2 and 5 shows the big hyperchromic effect of 2 on a broad band at 500 nm despite lacking of more than 400 nm of absorbance for BBA. These results indicate obvious evidence of intramolecular charge-transfer interactions between C(60)-moiety and BBA. PMID:11348122

  2. Longitudinal associations between maternal disrupted representations, maternal interactive behavior and infant attachment: a comparison between full-term and preterm dyads.

    PubMed

    Hall, R A S; Hoffenkamp, H N; Tooten, A; Braeken, J; Vingerhoets, A J J M; van Bakel, H J A

    2015-04-01

    This prospective study examined whether or not a mother's representations of her infant were more often disrupted after premature childbirth. Furthermore, the study examined if different components of maternal interactive behavior mediated the relation between maternal disrupted representations and infant attachment. The participants were mothers of full-term (n = 75), moderately preterm (n = 68) and very preterm infants (n = 67). Maternal representations were assessed by the Working Model of the Child Interview at 6 months post-partum. Maternal interactive behavior was evaluated at 6 and 24 months post-partum, using the National Institute of Child Health and Human Development Early Care Research Network mother-infant observation scales. Infant attachment was observed at 24 months post-partum and was coded by the Attachment Q-Set. The results reveal that a premature childbirth does not necessarily generate disrupted maternal representations of the infant. Furthermore, maternal interactive behavior appears to be an important mechanism through which maternal representations influence the development of infant attachment in full-term and preterm infants. Early assessment of maternal representations can identify mother-infant dyads at risk, in full-term and preterm samples. PMID:24875043

  3. Scaffolding interaction in parent-child dyads: Multimodal analysis of parental scaffolding with task and non-task oriented children

    Microsoft Academic Search

    Pekka Salonen; Janne Lepola; Marja Vauras

    2007-01-01

    In this exploratory study we conceptualized and explored socio-cognitive, emotional and motivational regulatory processes\\u000a displayed in scaffolding interaction between parents and their non-task and taskoriented children. Based on the dynamic systems\\u000a view and findings from developmental research, we assumed that parents with non-task oriented and task-oriented children have\\u000a formed differential multimodal interaction patterns which have been stabilized during repeated parent-child

  4. Scaffolding Interaction in Parent-Child Dyads: Multimodal Analysis of Parental Scaffolding with Task and Non-Task Oriented Children

    ERIC Educational Resources Information Center

    Salonen, Pekka; Lepola, Janne; Vauras, Marja

    2007-01-01

    In this exploratory study we conceptualized and explored socio-cognitive, emotional and motivational regulatory processes displayed in scaffolding interaction between parents and their non-task and task-oriented children. Based on the dynamic systems view and findings from developmental research, we assumed that parents with non-task oriented and…

  5. Gender Role Self-Concept and Gender-Typed Communication Behavior in Mixed-Sex and Same-Sex Dyads

    Microsoft Academic Search

    Ursula Athenstaedt; Elisabeth Haas; Stephanie Schwab

    2004-01-01

    The focus of this study was the relation between both gender role self-concept and gender role attitudes with gender-related behavior of interacting partners. We observed gender-typed communication behaviors of mixed-sex and same-sex dyads and measured gender role self-concept and gender role attitudes. Thirty mixed-sex dyads, 19 women dyads, and 15 men dyads participated in a behavior observation study. The results

  6. Time-Dependent Solid State Polymorphism of a Series of Donor-Acceptor Dyads.

    PubMed

    Peebles, Cameron; Alvey, Paul M; Lynch, Vincent; Iverson, Brent L

    2014-01-01

    In order to exploit the use of favorable electrostatic interactions between aromatic units in directing the assembly of donor-acceptor (D-A) dyads, the present work examines the ability of conjugated aromatic D-A dyads with symmetric side chains to exhibit solid-state polymorphism as a function of time during the solid formation process. Four such dyads were synthesized and their packing in the solid-state from either slower (10-20 days) or faster (1-2 days) evaporation from solvent was investigated using single crystal X-ray analysis and powder X-ray diffraction. Two of the dyads exhibited tail-to-tail (A-A) packing upon slower evaporation from solvent and head-to-tail (D-A) packing upon faster evaporation from solvent. A combination of single crystal analysis and XRD patterns were used to create models wherein a packing model for the other two dyads is proposed. Our findings suggest that while side chain interactions in asymmetric aromatic dyads can play an important role in enforcing segregated D-A dyad assembly, slowly evaporating symmetrically substituted aromatic dyads allows for favorable electrostatic interactions between the aromatic moieties to facilitate the organization of the dyads in the solid-state. PMID:24678269

  7. Time-Dependent Solid State Polymorphism of a Series of Donor-Acceptor Dyads

    PubMed Central

    Peebles, Cameron; Alvey, Paul M.; Lynch, Vincent; Iverson, Brent L.

    2014-01-01

    In order to exploit the use of favorable electrostatic interactions between aromatic units in directing the assembly of donor-acceptor (D-A) dyads, the present work examines the ability of conjugated aromatic D-A dyads with symmetric side chains to exhibit solid-state polymorphism as a function of time during the solid formation process. Four such dyads were synthesized and their packing in the solid-state from either slower (10-20 days) or faster (1-2 days) evaporation from solvent was investigated using single crystal X-ray analysis and powder X-ray diffraction. Two of the dyads exhibited tail-to-tail (A-A) packing upon slower evaporation from solvent and head-to-tail (D-A) packing upon faster evaporation from solvent. A combination of single crystal analysis and XRD patterns were used to create models wherein a packing model for the other two dyads is proposed. Our findings suggest that while side chain interactions in asymmetric aromatic dyads can play an important role in enforcing segregated D-A dyad assembly, slowly evaporating symmetrically substituted aromatic dyads allows for favorable electrostatic interactions between the aromatic moieties to facilitate the organization of the dyads in the solid-state. PMID:24678269

  8. Fine-tuning dual emission and aggregation-induced emission switching in NPI-BODIPY dyads.

    PubMed

    Mukherjee, Sanjoy; Thilagar, Pakkirisamy

    2014-07-14

    Three new NPI-BODIPY dyads 1-3 (NPI = 1,8-naphthalimide, BODIPY = boron-dipyrromethene) were synthesized, characterized, and studied. The NPI and BODIPY moieties in these dyads are electronically separated by oxoaryl bridges, and the compounds only differ structurally with respect to methyl substituents on the BODIPY fluorophore. The NPI and BODIPY moieties retain their optical features in molecular dyads 1-3. Dyads 1-3 show dual emission in solution originating from the two separate fluorescent units. The variations of the dual emission in these compounds are controlled by the structural flexibilities of the systems. Dyads 1-3, depending on their molecular flexibilities, show considerably different spectral shapes and dissimilar intensity ratios of the two emission bands. The dyads also show significant aggregation-induced emission switching (AIES) on formation of nano-aggregates in THF/H2O with changes in emission color from green to red. Whereas the flexible and aggregation-prone compound 1 shows AIES, rigid systems with less favorable intermolecular interactions (i.e., 2 and 3) show aggregation-induced quenching of emission. Correlations of the emission intensity and structural flexibility were found to be reversed in solution and aggregated states. Photophysical and structural investigations suggested that intermolecular interactions (e.g., ?-? stacking) play a major role in controlling the emission of these compounds in the aggregated state. PMID:24895089

  9. Compatibility in the Coach-Athlete Dyad

    ERIC Educational Resources Information Center

    Carron, Albert V.; Bennett, Bonnie B.

    1977-01-01

    An examination of inclusion, control, and affection behaviors in the interrelationships of coaches and athletes revealed that inclusion was the predominant factor contributing to incompatibility in the dyads. (MJB)

  10. Maternal Teaching in the Zone of Proximal Development: A Comparison of Low- and High-Risk Dyads.

    ERIC Educational Resources Information Center

    Diaz, Rafael M.; And Others

    1991-01-01

    Examines differences between maternal verbal teaching interactions that facilitate adult transfer of task responsibility as demonstrated by children's improved task performance after a teaching session among low- and high-risk mother-child dyads. (Author/BB)

  11. Dynamics of Dyads in Social Networks: Assortative,

    E-print Network

    Kuzmanovic, Aleksandar

    Dynamics of Dyads in Social Networks: Assortative, Relational, and Proximity Mechanisms Mark T relationships and network positions, and proximity mechanisms that focus on the social organization as determinants of ac- tors' behavior and outcomes, understanding the antecedents of social networks has become

  12. Photoinduced electron transfer within a zinc porphyrin-cyclobis(paraquat-p-phenylene) donor-acceptor dyad.

    PubMed

    Fathalla, Maher; Barnes, Jonathan C; Young, Ryan M; Hartlieb, Karel J; Dyar, Scott M; Eaton, Samuel W; Sarjeant, Amy A; Co, Dick T; Wasielewski, Michael R; Stoddart, J Fraser

    2014-11-01

    Understanding the mechanism of efficient photoinduced electron-transfer processes is essential for developing molecular systems for artificial photosynthesis. Towards this goal, we describe the synthesis of a donor-acceptor dyad comprising a zinc porphyrin donor and a tetracationic cyclobis(paraquat-p-phenylene) (CBPQT(4+) ) acceptor. The X-ray crystal structure of the dyad reveals the formation of a dimeric motif through the intermolecular coordination between the triazole nitrogen and the central Zn metal of two adjacent units of the dyad. Photoinduced electron transfer within the dyad in MeCN was investigated by femtosecond and nanosecond transient absorption spectroscopy, as well as by transient EPR spectroscopy. Photoexcitation of the dyad produced a weakly coupled ZnP(+.) -CBPQT(3+.) spin-correlated radical-ion pair having a ?=146?ns lifetime and a spin-spin exchange interaction of only 0.23?mT. The long radical-ion-pair lifetime results from weak donor-acceptor electronic coupling as a consequence of having nine bonds between the donor and the acceptor, and the reduction in reorganization energy for electron transfer caused by charge dispersal over both paraquat units within CBPQT(3+.) . PMID:25258209

  13. The Macrophage Migration Inhibitory Factor-Glucocorticoid Dyad: Regulation of Inflammation and Immunity

    Microsoft Academic Search

    Harry Flaster; Jurgen Bernhagen; Thierry Calandra; Richard Bucala

    2007-01-01

    The cytokine macrophage migration inhibitory factor (MIF) occupies a unique position in phys- iology by its ability to directly regulate the immu- nosuppressive actions of glucocorticoids. We re- view herein the interactions between MIF and glucocorticoids within the immune system and discuss the relevance of the MIF-glucocorticoid regulatory dyad in physiology and immunopa- thology. Therapeutic antagonism of MIF may be

  14. Synthesis of fullerene-acene dyads

    NASA Astrophysics Data System (ADS)

    Cho, Claire Eunhye

    Organic photovoltaic (OPV) cells present potential for industrial use because of their possible low cost production. However, their relatively low efficiencies render them impractical for implementation. A comprehensive understanding of the photophysical process is necessary for eventual development of high efficiency OPV cells. Studying photophysical processes of well-defined structures such as dyad or triad molecules may give insight into their photophysical processes. In this study, we selected pentacene derivatives as electron donors and fullerenes as electron acceptors for dyad and triad molecules with well-defined structures. Several new types of organothiosubstituted 6,13-dihydropentacenes with terminal functionality including carboxylic acid, alcohol and amine groups were synthesized. A sterically hindered pentacene derivative was also prepared in order to prevent cycloaddition between C60 and pentacene. Functionalized fullerenes were synthesized for use as electron acceptors. Numerous reaction methods were attempted toward the synthesis of a donor/acceptor dyad with pentacene and fullerene derivatives. However, hydroamination of pristine C 60 using a diamino dihydropentacene derivative was the only successful method demonstrated to link C60 and dihydropentacene derivatives.

  15. The photoinduced electron transference of porphyrin-anthraquinone dyads bridged with different lengths of links

    NASA Astrophysics Data System (ADS)

    Zhao, Ping; Huang, Jin-Wang; Xu, Lian-Cai; Ma, Li; Ji, Liang-Nian

    2011-01-01

    The photoinduced electron transference (PET) interaction in porphyrin containing donor-acceptor (D-A) molecules is of great importance in nature and a significant part of the PET research has been devoted to the study of its mechanism ("through-space" or "through-bond") in these decades. Herein we synthesized a series of covalently linked porphyrin-anthraquinone dyads (Por-C n-AQ) bridged with flexible alkoxy chains at different lengths ( n = 1, 4, 10) and investigated their intramolecular PET using a combination of electronic absorption, steady-state fluorescence and decayed luminescence spectra. The experimental results show that the PET efficiency depends on the length of the flexible linkage between the porphyrin and anthraquinone moieties. Meanwhile, theoretical calculation applying the density functional theory (DFT) was also carried out to give the frontier orbital distribution and the optimized structures of these dyads. It is found that the orientation of the dyad with high PET efficiency is disadvantageous to ?-? interaction. Thus, the PET of these dyads seemingly is best compatible with a "through-bond" (superexchange) mechanism.

  16. The photoinduced electron transference of porphyrin-anthraquinone dyads bridged with different lengths of links.

    PubMed

    Zhao, Ping; Huang, Jin-Wang; Xu, Lian-Cai; Ma, Li; Ji, Liang-Nian

    2011-01-01

    The photoinduced electron transference (PET) interaction in porphyrin containing donor-acceptor (D-A) molecules is of great importance in nature and a significant part of the PET research has been devoted to the study of its mechanism ("through-space" or "through-bond") in these decades. Herein we synthesized a series of covalently linked porphyrin-anthraquinone dyads (Por-C(n)-AQ) bridged with flexible alkoxy chains at different lengths (n=1, 4, 10) and investigated their intramolecular PET using a combination of electronic absorption, steady-state fluorescence and decayed luminescence spectra. The experimental results show that the PET efficiency depends on the length of the flexible linkage between the porphyrin and anthraquinone moieties. Meanwhile, theoretical calculation applying the density functional theory (DFT) was also carried out to give the frontier orbital distribution and the optimized structures of these dyads. It is found that the orientation of the dyad with high PET efficiency is disadvantageous to ?-? interaction. Thus, the PET of these dyads seemingly is best compatible with a "through-bond" (superexchange) mechanism. PMID:21146453

  17. Excitons bound to Te isoelectronic dyads in ZnSe

    NASA Astrophysics Data System (ADS)

    Marcet, S.; André, R.; Francoeur, S.

    2010-12-01

    We report on the excitonic photoluminescence from individual Te dyads in ZnSe. Based on the emission characteristics of these pairs of pseudodonor impurities, we identify dyads of C2v symmetry and determine their orientation with respect to the host lattice. The diamagnetic shift of the exciton indicates that the hole bound to the dyad is extremely localized. Measurements of large number of individual dyads reveal that (1) light-hole transitions located at higher energy are strongly suppressed, (2) the line shape of the observed phonon replica allows probing the phonon density of states, (3) dyads of various interatomic separations are observed, (4) the emission energy is extremely sensitive to the local environment of the dyad, and (5) dynamic variations in this local environment results in the intensity fluctuations and spectral diffusion.

  18. Ultrafast spectroscopic investigation of a fullerene poly(3-hexylthiophene) dyad

    NASA Astrophysics Data System (ADS)

    Banerji, Natalie; Seifter, Jason; Wang, Mingfeng; Vauthey, Eric; Wudl, Fred; Heeger, Alan J.

    2011-08-01

    We present the femtosecond spectroscopic investigation of a covalently linked dyad, PCB-P3HT, formed by a segment of the conjugated polymer P3HT (regioregular poly(3-hexylthiophene)) that is end capped with the fullerene derivative PCB ([6,6]-phenyl-C61-butyric acid ester), adapted from PCBM. The fluorescence of the P3HT segment in tetrahydrofuran (THF) solution is reduced by 64% in the dyad compared to a control compound without attached fullerene (P3HT-OH). Fluorescence upconversion measurements reveal that the partial fluorescence quenching of PCB-P3HT in THF is multiphasic and occurs on an average time scale of 100 ps, in parallel to excited-state relaxation processes. Judging from ultrafast transient absorption experiments, the origin of the quenching is excitation energy transfer from the P3HT donor to the PCB acceptor. Due to the much higher solubility of P3HT compared to PCB in THF, the PCB-P3HT dyad molecules self-assemble into micelles. When pure C60 is added to the solution, it is incorporated into the fullerene-rich center of the micelles. This dramatically increases the solubility of C60 but does not lead to significant additional quenching of the P3HT fluorescence by the C60 contained in the micelles. In PCB-P3HT thin films drop-cast from THF, the micelle structure is conserved. In contrast to solution, quantitative and ultrafast (<150 fs) charge separation occurs in the solid-state films and leads to the formation of long-lived mobile charge carriers with characteristic transient absorption signatures similar to those that have been observed in P3HT:PCBM bulk heterojunction blends. While ?-stacking interactions between neighboring P3HT chains are weak in the micelles, they are strong in thin films drop-cast from ortho-dichlorobenzene. Here, PCB-P3HT self-assembles into a network of long fibers, clearly seen in atomic force microscopy images. Ultrafast charge separation occurs also for the fibrous morphology, but the transient absorption experiments show fast loss of part of the charge carriers due to intensity-induced recombination and annihilation processes and monomolecular interfacial trap-mediated or geminate recombination. The yield of the long-lived charge carriers in the highly organized fibers is however comparable to that obtained with annealed P3HT:PCBM blends. PCB-P3HT can therefore be considered as an active material in organic photovoltaic devices.

  19. Dyad Composition Effects on Cognitive Elaboration and Student Achievement

    ERIC Educational Resources Information Center

    Denessen, Eddie; Veenman, Simon; Dobbelsteen, Janine; van Schilt, Josie

    2008-01-01

    The authors addressed the following research question: Does composition of dyads in terms of gender and ability affect student participation, the level of cognitive elaborations during a collaborative activity, and individual student achievement? The study involved 24 6th-grade dyads paired as follows: a low-ability student with a medium-ability…

  20. Mutual gaze duration as a function of length of conversation in male-female dyads.

    PubMed

    Cordell, Dena M; McGahan, Joseph R

    2004-02-01

    To assess the effects of familiarity on the duration of mutual gaze, and other measures of visual interaction, e.g., duration of unilateral gaze and discrepancy in duration between partners, 14 male-female dyads discussed unconditional positive regard for 8 min., after individually studying the topic for 10 min. Mutual gaze duration was significantly longer during the last 2 min. of the discussion than during the first 2 min. This suggests that, after some exposure at least, participants maintain longer durations of mutual gaze. Further, if the duration of mutual gaze is interpreted as a measure of intimacy, even a relatively short social interaction appears to increase the intimacy between two individuals of opposite sex. However, it is not clear whether these findings could be generalized to male-male and female-female dyads. PMID:15077754

  1. Multivariate Models of Parent-Late Adolescent Gender Dyads: The Importance of Parenting Processes in Predicting Adjustment

    ERIC Educational Resources Information Center

    McKinney, Cliff; Renk, Kimberly

    2008-01-01

    Although parent-adolescent interactions have been examined, relevant variables have not been integrated into a multivariate model. As a result, this study examined a multivariate model of parent-late adolescent gender dyads in an attempt to capture important predictors in late adolescents' important and unique transition to adulthood. The sample…

  2. Romantic Dyads, Friendships, and the Social Skill Ratings of Preschool Children.

    ERIC Educational Resources Information Center

    Smith, Susan E.; And Others

    1993-01-01

    Examined the incidence of "romantic" dyads, same-sex friendship dyads, and cross-sex friendship dyads in preschools and day-care centers. Behavior patterns that characterize these dyads are described. It is maintained that results suggest that there are romances between preschoolers. (BG)

  3. Ultrafast spectroscopic investigation of a fullerene poly(3-hexylthiophene) dyad

    Microsoft Academic Search

    Natalie Banerji; Jason Seifter; Mingfeng Wang; Eric Vauthey; Fred Wudl; Alan J. Heeger

    2011-01-01

    We present the femtosecond spectroscopic investigation of a covalently linked dyad, PCB-P3HT, formed by a segment of the conjugated polymer P3HT (regioregular poly(3-hexylthiophene)) that is end capped with the fullerene derivative PCB ([6,6]-phenyl-C61-butyric acid ester), adapted from PCBM. The fluorescence of the P3HT segment in tetrahydrofuran (THF) solution is reduced by 64% in the dyad compared to a control compound

  4. Subcortical representation of musical dyads: Individual differences and neural generators.

    PubMed

    Bones, Oliver; Plack, Christopher J

    2015-05-01

    When two notes are played simultaneously they form a musical dyad. The sensation of pleasantness, or "consonance", of a dyad is likely driven by the harmonic relation of the frequency components of the combined spectrum of the two notes. Previous work has demonstrated a relation between individual preference for consonant over dissonant dyads, and the strength of neural temporal coding of the harmonicity of consonant relative to dissonant dyads as measured using the electrophysiological "frequency-following response" (FFR). However, this work also demonstrated that both these variables correlate strongly with musical experience. The current study was designed to determine whether the relation between consonance preference and neural temporal coding is maintained when controlling for musical experience. The results demonstrate that strength of neural coding of harmonicity is predictive of individual preference for consonance even for non-musicians. An additional purpose of the current study was to assess the cochlear generation site of the FFR to low-frequency dyads. By comparing the reduction in FFR strength when high-pass masking noise was added to the output of a model of the auditory periphery, the results provide evidence for the FFR to low-frequency dyads resulting in part from basal cochlear generators. PMID:25636498

  5. Evidence for Unintentional Emotional Contagion Beyond Dyads

    PubMed Central

    Dezecache, Guillaume; Conty, Laurence; Chadwick, Michele; Philip, Leonor; Soussignan, Robert

    2013-01-01

    Little is known about the spread of emotions beyond dyads. Yet, it is of importance for explaining the emergence of crowd behaviors. Here, we experimentally addressed whether emotional homogeneity within a crowd might result from a cascade of local emotional transmissions where the perception of another’s emotional expression produces, in the observer's face and body, sufficient information to allow for the transmission of the emotion to a third party. We reproduced a minimal element of a crowd situation and recorded the facial electromyographic activity and the skin conductance response of an individual C observing the face of an individual B watching an individual A displaying either joy or fear full body expressions. Critically, individual B did not know that she was being watched. We show that emotions of joy and fear displayed by A were spontaneously transmitted to C through B, even when the emotional information available in B’s faces could not be explicitly recognized. These findings demonstrate that one is tuned to react to others’ emotional signals and to unintentionally produce subtle but sufficient emotional cues to induce emotional states in others. This phenomenon could be the mark of a spontaneous cooperative behavior whose function is to communicate survival-value information to conspecifics. PMID:23840683

  6. Altercentric Intrusions from Multiple Perspectives: Beyond Dyads

    PubMed Central

    Capozzi, Francesca; Cavallo, Andrea; Furlanetto, Tiziano; Becchio, Cristina

    2014-01-01

    Recent findings suggest that in dyadic contexts observers rapidly and involuntarily process the visual perspective of others and cannot easily resist interference from their viewpoint. To investigate whether spontaneous perspective taking extends beyond dyads, we employed a novel visual perspective task that required participants to select between multiple competing perspectives. Participants were asked to judge their own perspective or the visual perspective of one or two avatars who either looked at the same objects or looked at different objects. Results indicate that when a single avatar was present in the room, participants processed the irrelevant perspective even when it interfered with participants’ explicit judgments about the relevant perspective. A similar interference effect was observed when two avatars looked at the same discs, but not when they looked at different discs. Indeed, when the two avatars looked at different discs, the interference from the irrelevant perspective was significantly reduced. This is the first evidence that the number and orientation of agents modulate spontaneous perspective taking in non-dyadic contexts: observers may efficiently compute another’s perspective, but in presence of more individuals holding discrepant perspectives, they may not spontaneously track multiple viewpoints. These findings are discussed in relation to the hypothesis that perspective calculation occurs in an effortless and automatic manner. PMID:25436911

  7. Langmuir-Blodgett films of self-assembled (alkylether-derivatized Zn phthalocyanine)-(C?? imidazole adduct) dyad with controlled intermolecular distance for photoelectrochemical studies.

    PubMed

    Obraztsov, Ievgen; Noworyta, Krzysztof; Hart, Aaron; Gobeze, Habtom B; Kc, Chandra B; Kutner, Wlodzimierz; D'Souza, Francis

    2014-06-11

    A multilayer Langmuir-Blodgett (LB) film of the self-assembled electron donor-acceptor dyad of Zn phthalocyanine, appended with four long-chain aliphatic ether peripheral substituents, and an imidazole adduct of C60 was prepared and applied as a photoactive material in a photoelectrochemical cell. Changes in the simultaneously recorded surface pressure and surface potential vs area per molecule compression isotherms for Langmuir films of the dyad and, separately, of its components helped to identify phase transitions and mutual interactions of molecules in films. The Brewster angle microscopy (BAM) imaging of the Langmuir films showed circular condensed phase domains of the dyad molecules. The determined area per molecule was lower than that estimated for the dyad and its components, separately. The multilayer LB films of the dyad were transferred onto hydrophobized fluorine-doped tin oxide-coated (FTO) glass slides under different conditions. The presence of both components in the dyad LB films was confirmed with the UV-vis spectroscopy measurements. For the LB films transferred at different surface pressures, the PM-IRRAS measurements revealed that the phthalocyanine macrocycle planes and ether moieties in films were tilted with respect to the FTO surface. The AFM imaging of the LB films indicated formation of relatively uniform dyad LB films. Then, the femtosecond transient absorption spectral studies evidenced photoinduced electron transfer in the LB film. The obtained transient signals corresponding to both Zn(TPPE)(•+) and C60im(•-) confirmed the occurrence of intramolecular electron transfer. The determined rate constants of charge separation, kcs = 2.6 × 10(11) s(-1), and charge recombination, kcr = 9.7 × 10(9) s(-1), indicated quite efficient electron transfer within the film. In the photoelectrochemical studies, either photoanodic or photocathodic current was generated depending on the applied bias potential when the dyad LB film-coated FTO was used as the working electrode and ascorbic acid or methylviologen, respectively, as the charge mediator in an aqueous solution. PMID:24785360

  8. Exciplex-exciplex energy transfer and annihilation in solid films of porphyrin-fullerene dyads.

    PubMed

    Lehtivuori, Heli; Lemmetyinen, Helge; Tkachenko, Nikolai V

    2006-12-20

    Exciplex-exciplex annihilation was observed for the first time in porphyrin-fullerene molecular films. The films were prepared using Langmuir-Blodgett and drop casting methods. The exciplex-exciplex interactions were studied using femtosecond pump-probe method. The exciplex-exciplex annihilation can be seen as a fast (within few picoseconds) decay of the transient absorption at excitation densities higher than 0.4 mJ/cm2. Analysis of the excitation density dependences indicates that in average four dyads are involved in the exciplex-exciplex interaction, suggesting that an exciplex-exciplex energy transfer may precede the annihilation. PMID:17165747

  9. Gender and Career Development Projects in Early Adolescence: Similarities and Differences between Mother-Daughter and Mother-Son Dyads

    Microsoft Academic Search

    José F. Domene; Rübab G. Arim; Richard A. Young

    2007-01-01

    The way that mother-son and mother-daughter dyads engage in career projects was explored using the action-project differentiation procedure, a variant of the action-project method. The goal-directed actions, joint projects, and interactions of ten early adolescent boys and their mothers were examined in relation to the actions, projects, and interactions of ten early adolescent girls and their mothers. Many more similarities

  10. Cooperation beyond the dyad: on simple models and a complex society

    PubMed Central

    Connor, Richard C.

    2010-01-01

    Players in Axelrod and Hamilton's model of cooperation were not only in a Prisoner's Dilemma, but by definition, they were also trapped in a dyad. But animals are rarely so restricted and even the option to interact with third parties allows individuals to escape from the Prisoner's Dilemma into a much more interesting and varied world of cooperation, from the apparently rare ‘parcelling’ to the widespread phenomenon of market effects. Our understanding of by-product mutualism, pseudo-reciprocity and the snowdrift game is also enriched by thinking ‘beyond the dyad’. The concepts of by-product mutualism and pseudo-reciprocity force us to think again about our basic definitions of cooperative behaviour (behaviour by a single individual) and cooperation (the outcome of an interaction between two or more individuals). Reciprocity is surprisingly rare outside of humans, even among large-brained ‘intelligent’ birds and mammals. Are humans unique in having extensive cooperative interactions among non-kin and an integrated cognitive system for mediating reciprocity? Perhaps, but our best chance for finding a similar phenomenon may be in delphinids, which also live in large societies with extensive cooperative interactions among non-relatives. A system of nested male alliances in bottlenose dolphins illustrates the potential and difficulties of finding a complex system of cooperation close to our own. PMID:20679112

  11. The Circle of Security project: attachment-based intervention with caregiver-pre-school child dyads.

    PubMed

    Marvin, Robert; Cooper, Glen; Hoffman, Kent; Powell, Bert

    2002-04-01

    The Circle of Security intervention protocol is a 20-week, group-based, parent education and psychotherapy intervention designed to shift patterns of attachment-caregiving interactions in high-risk caregiver-child dyads to a more appropriate developmental pathway. All phases of the protocol, including the pre- and post-intervention assessments, and the intervention itself, are based on attachment theory and procedures, current research on early relationships, and object relations theory. Using edited videotapes of their interactions with their children, caregivers are encouraged: 1. to increase their sensitivity and appropriate responsiveness to the child's signals relevant to its moving away from to explore, and its moving back for comfort and soothing; 2. to increase their ability to reflect on their own and the child's behavior, thoughts and feelings regarding their attachment-caregiving interactions; and 3. to reflect on experiences in their own histories that affect their current caregiving patterns. In this paper we describe the conceptual background of the protocol, and the protocol itself. We then present a case study from our current data set of 75 dyads who have completed the protocol. PMID:12065033

  12. Emotional References in Mother-Daughter and Mother-Son Dyads' Conversations about School.

    ERIC Educational Resources Information Center

    Flannagan, Dorothy; Perese, San

    1998-01-01

    Examined the emotional content of conversations of 100 mother-child dyads about the children's school experiences. Mother-daughter dyads made more emotional references than mother-son dyads, especially when discussing interpersonal relationships or emotions experienced by the daughters. Ethnic and socioeconomic differences are also discussed. (SLD)

  13. Parent-Caregiver Relationship Dyad in Greek Day Care Centres

    ERIC Educational Resources Information Center

    Rentzou, Konstantina

    2011-01-01

    High quality early childhood education and care programmes encourage frequent, positive communication with and positive, effective relationships between parents and early childhood educators. The present study aimed to examine the adult relationship aspects of childcare and, more precisely, the parent/caregiver relationship dyad. The way in which…

  14. Photodynamics of pyrene-flavin and phenothiazine-flavin dyads

    NASA Astrophysics Data System (ADS)

    Shirdel, J.; Penzkofer, A.; Procházka, R.; Shen, Z.; Daub, J.

    2007-06-01

    A pyrene-flavin (isoalloxazine) dyad (PFD) and a phenothiazine-phenylene-isoalloxazine dyad (PPF), dissolved in dichloromethane are characterized by absorption and emission spectroscopy. These dyads are model compounds for flavin based blue-light photoreceptors. Absorption cross-section spectra, fluorescence quantum distributions, fluorescence quantum yields, and fluorescence decay times are determined. The absorption spectra of the dyads resemble the superposition of the absorption spectra of the constituents (1-methylpyrene, isoalloxazine, and phenylphenothiazine). Photo-excitation of the flavin moiety causes fluorescence quenching by reductive electron transfer in thermodynamic equilibrium with the exited flavin subunit. The charge-separated states recover by charge recombination. Photo-excitation of the pyrene or phenylphenothiazine moiety causes oxidative electron transfer with successive recombination, and additionally Förster-type energy transfer and Dexter-type energy transfer. For PFD in dichloromethane the rates of reductive electron transfer and oxidative electron transfer were determined to be (5 ps) -1 and (77 ps) -1, respectively, and a charge recombination time of about 16 ps was found. For PPF in dichloromethane the rates of reductive electron transfer and oxidative electron transfer were determined to be (700 fs) -1 and (100 ps) -1, respectively. The HOMO level position of the pyrene radical cation subunit relative to the HOMO level of the excited isoalloxazine subunit is determined from the delayed fluorescence emission of the PFD sample.

  15. Peer Network Overlap in Twin, Sibling, and Friend Dyads

    ERIC Educational Resources Information Center

    McGuire, Shirley; Segal, Nancy L.

    2013-01-01

    Research suggests that sibling–peer connections are important for understanding adolescent problem behaviors. Using a novel behavioral genetic design, the current study investigated peer network overlap in 300 child–child pairs (aged 7-13 years) in 5 dyad types: monozygotic (MZ), dizygotic twins, full siblings (FSs), friend pairs, and virtual…

  16. Acetylation of histone H3 at the nucleosome dyad alters DNA-histone binding.

    PubMed

    Manohar, Mridula; Mooney, Alex M; North, Justin A; Nakkula, Robin J; Picking, Jonathan W; Edon, Annick; Fishel, Richard; Poirier, Michael G; Ottesen, Jennifer J

    2009-08-28

    Histone post-translational modifications are essential for regulating and facilitating biological processes such as RNA transcription and DNA repair. Fifteen modifications are located in the DNA-histone dyad interface and include the acetylation of H3-K115 (H3-K115Ac) and H3-K122 (H3-K122Ac), but the functional consequences of these modifications are unknown. We have prepared semisynthetic histone H3 acetylated at Lys-115 and/or Lys-122 by expressed protein ligation and incorporated them into single nucleosomes. Competitive reconstitution analysis demonstrated that the acetylation of H3-K115 and H3-K122 reduces the free energy of histone octamer binding. Restriction enzyme kinetic analysis suggests that these histone modifications do not alter DNA accessibility near the sites of modification. However, acetylation of H3-K122 increases the rate of thermal repositioning. Remarkably, Lys --> Gln substitution mutations, which are used to mimic Lys acetylation, do not fully duplicate the effects of the H3-K115Ac or H3-K122Ac modifications. Our results are consistent with the conclusion that acetylation in the dyad interface reduces DNA-histone interaction(s), which may facilitate nucleosome repositioning and/or assembly/disassembly. PMID:19520870

  17. Friendship: Communication and interactional patterns in same-sex dyads

    Microsoft Academic Search

    Lynne R. Davidson; Lucile Duberman

    1982-01-01

    Based on the classic work of Georg Simmel on dyadic intimacy and dependency and more recent work on self-disclosure, this study uses subjective accounts to compare same-sex dyadic friendships. Past research has neglected the important dimension of content. Thus, a major purpose was to specify three content levels of communication — topical, relational, and personal — and to determine sex

  18. Informal Helping in Partner and Stranger Dyads.

    ERIC Educational Resources Information Center

    Barker, Chris; Lemle, Russell

    1987-01-01

    Compared helping interactions of partners in close relationships and of strangers. Participants (N=92) from 46 couples completed semistructured helping tasks with their partner and with an opposite-sex stranger. Partners were less empathic and used fewer acknowledgements and more behavioral advisements, interpretations, and self-disclosures than…

  19. Impact of the CD40-CD40L Dyad in Alzheimer’s Disease

    PubMed Central

    Giunta, Brian; Rezai-Zadeh, Kavon; Tan, Jun

    2010-01-01

    As the number of elderly individuals rises, Alzheimer’s disease (AD), marked by amyloid-? deposition, neurofibrillary tangle formation, and low-level neuroinflammation, is expected to lead to an ever-worsening socioeconomic burden. AD pathoetiologic mechanisms are believed to involve chronic microglial activation. This phenomenon is associated with increased expression of membrane-bound CD40 with its cognate ligand, CD40 ligand (CD40L), as well as increased circulating levels of soluble forms of CD40 (sCD40) and CD40L (sCD40L). Here, we review the role of this inflammatory dyad in the pathogenesis of AD. In addition, we examine potential therapeutic strategies such as statins, flavonoids, and human umbilical cord blood transplantation, all of which have been shown to modulate CD40-CD40L interaction in mouse models of AD. Importantly, therapeutic approaches focusing on CD40-CD40L dyad regulation, either alone or in combination with amyloid-? immunotherapy, may provide for a safe and effective AD prophylaxis or treatment in the near future. PMID:20205645

  20. Friendship in high-functioning children with autism spectrum disorder: mixed and non-mixed dyads.

    PubMed

    Bauminger, Nirit; Solomon, Marjorie; Aviezer, Anat; Heung, Kelly; Brown, John; Rogers, Sally J

    2008-08-01

    Friendships containing a child with autism and a friend with typical development ("mixed" friendships, n = 26) and those of children with autism and a friend with a disability ("non-mixed," n = 16) were contrasted with friendships of typically developing subjects and their friends (n = 31). Measures included dyadic interaction samples, and interview and questionnaire data from subjects, friends, and parents. Mixed friendship interactions resembled typical friendships. Participants in mixed friendships were more responsive to one another, had stronger receptive language skills, exhibited greater positive social orientation and cohesion, and demonstrated more complex coordinated play than in the non-mixed dyads. Exposure to typical peers appears to have significant effects on friendship behaviors. PMID:18058212

  1. Use of student clinical partner dyads as a teaching strategy to facilitate learning.

    PubMed

    Ott, Lora K; Succheralli, Lauren

    2015-03-01

    Collaborative learning has been used effectively in the classroom, but it is not well understood in the clinical setting. Student clinical partner (SCP) dyads were used as an intentional teaching method to foster teamwork, learning, and confidence. Students were assigned a patient and a student partner. SCP dyads were expected to provide complete care to their assigned patient, listen to report for their partner's patient, prioritize patient needs, participate in learning experiences for all assigned patients, and function as a team. Students (n = 26) compared their clinical rotation with SCP dyads to their clinical rotations without SCP dyads. The majority strongly agreed that SCP dyads had a positive impact on teamwork (74%), learning experiences (58%), and student clinical confidence (62%). Reflective journals stated that SCP dyads increased exposure to patient care activities, confidence in management, prioritization, teamwork, and time with the faculty. [J Nurs Educ. 2015;54(3):169-172.]. PMID:25692339

  2. Emotional References in Mother-Daughter and Mother-Son Dyads' Conversations About School

    Microsoft Academic Search

    Dorothy Flannagan; San Perese

    1998-01-01

    The conversations of 100 mother-child (mean age4.5 years) dyads about the children's school experienceswere examined for their emotional content. Dyads variedalong the dimensions of gender of child (53 girls; 57 boys), ethnicity (31African-American, 39 Anglo-American, and 40Mexican-American), and SES (55 lower and 55 higher).When compared to mother-son dyads, mother-daughter dyadsmade more emotional references, particularly when discussing topicsrelated to interpersonal relationships

  3. Photoinduced electron transfer in zinc naphthalocyanine-naphthalenediimide supramolecular dyads.

    PubMed

    El-Khouly, Mohamed E; Moiseev, Andrey G; van der Est, Art; Fukuzumi, Shunichi

    2012-04-10

    Photoinduced electron transfer was studied in self-assembled donor-acceptor dyads, formed by axial coordination of pyridine appended with naphthalenediimide (NDI) to zinc naphthalocyanine (ZnNc). The NDI-py:ZnNc (1) and NDI(CH(2))(2)-py:ZnNc (2) self-assembled dyads absorb light over a wide region of the UV/Vis/near infrared (NIR) spectrum. The formation constants of the dyads 1 and 2 in toluene were found to be 2.5×10(4) and 2.2×10(4) M(-1), respectively, from the steady-state absorption and emission measurements, suggesting moderately stable complex formation. Fluorescence quenching was observed upon the coordination of the pyridine-appended NDI to ZnNc in toluene. The energy-level diagram derived from electrochemical and optical data suggests that exergonic charge separation through the singlet state of ZnNc ((1)ZnNc*) provides the main quenching pathway. Clear evidence for charge separation from the singlet state of ZnNc to NDI was provided by femtosecond laser photolysis measurements of the characteristic absorption bands of the ZnNc radical cation in the NIR region at 960 nm and the NDI radical anion in the visible region. The rates of charge-separation of 1 and 2 were found to be 2.2×10(10) and 4.4×10(9) s(-1), respectively, indicating fast and efficient charge separation (CS). The rates of charge recombination (CR) and the lifetimes of the charge-separated states were found to be 8.50×10(8) s(-1) (1.2 ns) for 1 and 1.90×10(8) s(-1) (5.3 ns) for 2. These values indicate that the rates of the CS and CR processes decrease as the length of the spacer increases. Their absorption over a wide portion of the solar spectrum and the high ratio of the CS/CR rates suggests that the self-assembled NDI-py:ZnNc and NDI(CH(2))(2)-py:ZnNc dyads are useful as photosynthetic models. PMID:22290735

  4. Beyond the ‘dyad’: a qualitative re-evaluation of the changing clinical consultation

    PubMed Central

    Swinglehurst, Deborah; Roberts, Celia; Li, Shuangyu; Weber, Orest; Singy, Pascal

    2014-01-01

    Objective To identify characteristics of consultations that do not conform to the traditionally understood communication ‘dyad’, in order to highlight implications for medical education and develop a reflective ‘toolkit’ for use by medical practitioners and educators in the analysis of consultations. Design A series of interdisciplinary research workshops spanning 12?months explored the social impact of globalisation and computerisation on the clinical consultation, focusing specifically on contemporary challenges to the clinician–patient dyad. Researchers presented detailed case studies of consultations, taken from their recent research projects. Drawing on concepts from applied sociolinguistics, further analysis of selected case studies prompted the identification of key emergent themes. Setting University departments in the UK and Switzerland. Participants Six researchers with backgrounds in medicine, applied linguistics, sociolinguistics and medical education. One workshop was also attended by PhD students conducting research on healthcare interactions. Results The contemporary consultation is characterised by a multiplicity of voices. Incorporation of additional voices in the consultation creates new forms of order (and disorder) in the interaction. The roles ‘clinician’ and ‘patient’ are blurred as they become increasingly distributed between different participants. These new consultation arrangements make new demands on clinicians, which lie beyond the scope of most educational programmes for clinical communication. Conclusions The consultation is changing. Traditional consultation models that assume a ‘dyadic’ consultation do not adequately incorporate the realities of many contemporary consultations. A paradox emerges between the need to manage consultations in a ‘super-diverse’ multilingual society, while also attending to increasing requirements for standardised protocol-driven approaches to care prompted by computer use. The tension between standardisation and flexibility requires addressing in educational contexts. Drawing on concepts from applied sociolinguistics and the findings of these research observations, the authors offer a reflective ‘toolkit’ of questions to ask of the consultation in the context of enquiry-based learning. PMID:25270858

  5. Intramolecular electronic communication in a dimethylaminoazobenzene-fullerene C60 dyad: an experimental and TD-DFT study.

    PubMed

    Kumar, K Senthil; Patnaik, Archita

    2010-04-30

    An electronically push-pull type dimethylaminoazobenzene-fullerene C(60) hybrid was designed and synthesized by tailoring N,N-dimethylaniline as an electron donating auxochrome that intensified charge density on the beta-azonitrogen, and on N-methylfulleropyrrolidine (NMFP) as an electron acceptor at the 4 and 4' positions of the azobenzene moiety, respectively. The absorption and charge transfer behavior of the hybrid donor-bridge-acceptor dyad were studied experimentally and by performing TD-DFT calculations. The TD-DFT predicted charge transfer interactions of the dyad ranging from 747 to 601 nm were experimentally observed in the UV-vis spectra at 721 nm in toluene and dichloromethane. A 149 mV anodic shift in the first reduction potential of the N=N group of the dyad in comparison with the model aminoazobenzene derivative further supported the phenomenon. Analysis of the charge transfer band through the orbital picture revealed charge displacement from the n((N=N)) (nonbonding) and pi ((N=N)) type orbitals centered on the donor part to the purely fullerene centered LUMOs and LUMO+n orbitals, delocalized over the entire molecule. The imposed electronic perturbations on the aminoazobenzene moiety upon coupling it with C(60) were analyzed by comparing the TD-DFT predicted and experimentally observed electronic transition energies of the dyad with the model compounds, NMFP and (E)-N,N-dimethyl-4-(p-tolyldiazenyl)aniline (AZNME). The n((N=N)) --> pi*((N=N)) and pi((N=N)) --> pi*((N=N)) transitions of the dyad were bathochromically shifted with a significant charge transfer character. The shifting of pi((N=N)) --> pi*((N=N)) excitation energy closer to the n --> pi*((N=N)) in comparison with the model aminoazobenzene emphasized the predominant existence of charge separated quinonoid-like ground state electronic structure. Increasing solvent polarity introduced hyperchromic effect in the pi((N=N)) --> pi*((N=N)) electronic transition at the expense of transitions involved with benzenic states, and the extent of intensity borrowing was quantified adopting the Gaussian deconvolution method. On a comparative scale, the predicted excitation energies were in reasonable agreement with the observed values, demonstrating the efficiency of TD-DFT in predicting the localized and the charge transfer nature of transitions involved with large electronically asymmetric molecules with HOMO and LUMO centered on different parts of the molecular framework. PMID:19827143

  6. Photoinduced mixed valency in zinc porphyrin dimer of triruthenium cluster dyads.

    PubMed

    Henderson, Jane; Kubiak, Clifford P

    2014-10-20

    The preparation, electrochemistry, and spectroscopic characterization of three new species, (ZnTPPpy)Ru3O(OAc)6(CO)-pz-Ru3O(OAc)6(CO)L, where ZnTPPpy = zinc(II) 5-(4-pyridyl)-10,15,20-triphenylporphyin, L = pyridyl ligand, and pz = pyrazine, are reported. These porphyrin-coordinated Ru3O–BL–Ru3O (BL = bridging ligand) dyads are capable of undergoing intramolecular electron transfer from the photoexcited Zn porphyrin to Ru3O donor–bridge–acceptor dimer systems. Seven reversible redox processes are observed in the cyclic voltammograms of the newly synthesized dyads, showing no significant electrochemical interaction between the redox active porphyrin and the pyrazine-bridged ruthenium dimer of Ru3O trimers. From the electrochemical behavior of the dyads, large comproportionation constants (Kc = 6.0 × 10(7) for L = dmap) were calculated from the reduction potentials of the Ru(III)Ru(III)Ru(II) clusters, indicating a stable mixed-valence state. Electronic absorption spectra of the singly reduced mixed-valence species show two intervalence charge transfer (IVCT) bands assigned within the Brunschwig–Creutz–Sutin semiclassical three-state model as metal-to-bridge and metal-to-metal in character. The progression from most to least delocalized mixed-valence dimer ions, as determined by the divergence of the IVCT bands and in agreement with electrochemical data, follows the order of L = 4-dimethylaminopyridine (dmap) > pyridine (py) > 4-cyanopyridine (cpy). These systems show dynamic coalescence of the infrared spectra in the ?(CO) region of the singly reduced state. This sets the time scale of electron exchange at <10 ps. The electron transfer from the S1 excited state of the coordinated porphyrin to the dimer is predicted to be thermodynamically favorable, with ?GFET(0) ranging from ?0.54 eV for L = dmap to ?0.62 eV for L = cpy. Observation of IVCT band growth under continual photolysis (?exc = 568 nm) confirms a phototriggered intramolecular electron transfer process resulting in a strongly coupled singly reduced mixed-valence species. PMID:25260187

  7. Emotional Reactions of Mothers Facing Premature Births: Study of 100 Mother-Infant Dyads 32 Gestational Weeks

    PubMed Central

    Eutrope, Julien; Thierry, Aurore; Lempp, Franziska; Aupetit, Laurence; Saad, Stéphanie; Dodane, Catherine; Bednarek, Nathalie; De Mare, Laurence; Sibertin-Blanc, Daniel; Nezelof, Sylvie; Rolland, Anne-Catherine

    2014-01-01

    Objectives This current study has been conducted to clarify the relationship between the mother's post-traumatic reaction triggered by premature birth and the mother-infant interactions. In this article, the precocious maternal feelings are described. Methods A multicenter prospective study was performed in three French hospitals. 100 dyads with 100 very premature infants and their mothers were recruited. Mothers completed, at two different times self-questionnaires of depression/anxiety, trauma and social support. The quality of interactions in the dyads was evaluated. Results Thirty-nine percent of the mothers obtained a score at HADS suggesting a high risk of depression at the first visit and approximately one-third at visit two. Seventy-five percent of the mothers were at risk of suffering from an anxiety disorder at visit one and half remained so at visit two. A “depressed” score at visits one and two correlated with a hospitalization for a threatened premature labor. We noted a high risk of trauma for 35% of the mothers and high interactional synchrony was observed for approximately two-thirds of the dyads. The mothers' psychological reactions such as depression and anxiety or postnatal depression correlate strongly with the presence of an initial trauma. At visit one and visit two, a high score of satisfaction concerning social support correlates negatively with presence of a trauma. A maternal risk of trauma is more frequent with a C-section delivery. Conclusions Mothers' psychological reactions such as depression and anxiety correlate greatly with the presence of an initial trauma. The maternal traumatic reaction linked to premature birth does not correlate with the term at birth, but rather with the weight of the baby. Social support perceived by the mother is correlated with the absence of maternal trauma before returning home, and also seems to inhibit from depressive symptoms from the time of the infant's premature birth. PMID:25153825

  8. Vibrational coherence transfer in an electronically decoupled molecular dyad.

    PubMed

    Schweighöfer, Felix; Dworak, Lars; Braun, Markus; Zastrow, Marc; Wahl, Jan; Burghardt, Irene; Rück-Braun, Karola; Wachtveitl, Josef

    2015-01-01

    The ring opening of a dithienylethene photoswitch incorporated in a bridged boron-dipyrromethene - dithienylethene molecular dyad was investigated with ultrafast spectroscopy. Coherent vibrations in the electronic ground state of the boron-dipyrromethene are triggered after selective photoexcitation of the closed dithienylethene indicating vibrational coupling although the two moieties are electronically isolated. A distribution of short-lived modes and a long-lived mode at 143?cm(-1) are observed. Analysis of the theoretical frequency spectrum indicates two modes at 97?cm(-1) and 147?cm(-1) which strongly modulate the electronic transition energy. Both modes exhibit a characteristic displacement of the bridge suggesting that the mechanical momentum of the initial geometry change after photoexcitation of the dithienylethene is transduced to the boron-dipyrromethene. The relaxation to the dithienylethene electronic ground state is accompanied by significant heat dissipation into the surrounding medium. In the investigated dyad, the boron-dipyrromethene acts as probe for the ultrafast photophysical processes in the dithienylethene. PMID:25797419

  9. Vibrational coherence transfer in an electronically decoupled molecular dyad

    PubMed Central

    Schweighöfer, Felix; Dworak, Lars; Braun, Markus; Zastrow, Marc; Wahl, Jan; Burghardt, Irene; Rück-Braun, Karola; Wachtveitl, Josef

    2015-01-01

    The ring opening of a dithienylethene photoswitch incorporated in a bridged boron-dipyrromethene - dithienylethene molecular dyad was investigated with ultrafast spectroscopy. Coherent vibrations in the electronic ground state of the boron-dipyrromethene are triggered after selective photoexcitation of the closed dithienylethene indicating vibrational coupling although the two moieties are electronically isolated. A distribution of short-lived modes and a long-lived mode at 143?cm?1 are observed. Analysis of the theoretical frequency spectrum indicates two modes at 97?cm?1 and 147?cm?1 which strongly modulate the electronic transition energy. Both modes exhibit a characteristic displacement of the bridge suggesting that the mechanical momentum of the initial geometry change after photoexcitation of the dithienylethene is transduced to the boron-dipyrromethene. The relaxation to the dithienylethene electronic ground state is accompanied by significant heat dissipation into the surrounding medium. In the investigated dyad, the boron-dipyrromethene acts as probe for the ultrafast photophysical processes in the dithienylethene. PMID:25797419

  10. The Fractured Conjugal Family: A Comparison of Married and Divorced Dyads

    ERIC Educational Resources Information Center

    McKenry, Patrick C.; And Others

    1978-01-01

    This study compared 20 married dyads and 20 divorced dyads on the dimensions of affect, marital adjustment, personality homogamy, value homogamy, and selected demographic variables. Instruments included the Caring Relationship Inventory, the Modified Form of Locke's Marital Questionnaire, the Sixteen Personality Factor Questionnaire, and the…

  11. Exercises of power in marketing channel dyads: Power advantage versus power disadvantage

    Microsoft Academic Search

    Guijun Zhuang; Neil C. Herndon Jr; Nan Zhou

    2006-01-01

    Taking the channel dyad as the unit of analysis, this study investigated the impact of channel members' power on their uses of power in two distinct conditions: in power advantage and in power disadvantage. The study found that channel members' power has a positive impact on their uses of non-coercive power regardless of their relative position in channel dyads; their

  12. Prevalence and Predictors of Early Breastfeeding Among Late Preterm Mother–Infant Dyads

    PubMed Central

    Sereika, Susan M.; Bogen, Debra

    2013-01-01

    Abstract Background Although late preterm infants (LPIs), at 340/7–366/7 weeks of gestation, are reported to have suboptimal rates of breastfeeding, there is a lack of quantitative evidence describing this trend. This study examined the prevalence of breastfeeding initiation and factors associated with breastfeeding non-initiation within a Pennsylvania population-based cohort of late preterm mother–infant dyads. Subjects and Methods Descriptive statistics and odds ratios were used to assess and compare breastfeeding initiation rates in 2003–2009 among LPI mothers (n=62,451) and their infants (n=68,886) with moderately preterm (n=17,325) and term (n=870,034) infants. Binary logistic regression was used to determine the association of system/provider, sociodemographic, and medical factors with breastfeeding non-initiation in late preterm mother–infant dyads for the year 2009 (n=7,012). Results Although LPI breastfeeding initiation in Pennsylvania increased significantly from 2003 (54%) to 2009 (61.8%) (p<0.001), the 2009 prevalence remained well below rates in term infant populations and national standards. The regression model indicated that interactions involving sociodemographic variables, including marital status, age, race/ethnicity, education, parity, Women, Infants and Children Program participation, and smoking status were among the most significant factors associated with LPI breastfeeding non-initiation (p<0.05). The univariate results were similar to those reported in preterm and term populations. Conclusions Our data suggest that certain, unexpected demographic groups in the late preterm population be prioritized for further analysis and possibly greater breastfeeding support. More research is indicated to understand the effect of modifiable psychosocial factors on LPI breastfeeding initiation. PMID:23199304

  13. The Relationship of Sexual Dyad and Personal Network Characteristics and Individual Attributes to Unprotected Sex Among Young Injecting Drug Users

    Microsoft Academic Search

    V. Anna Gyarmathy; Alan Neaigus

    2009-01-01

    We examine in the heterosexual partnerships (dyads) of IDUs the correlates of engaging in unprotected sex on three levels:\\u000a individual attributes, social network characteristics, and dyad characteristics. Unprotected sex was significantly less likely\\u000a to occur in dyads where the participant injected daily or had high safe-sex attitude scores, and in dyads where both members\\u000a encouraged each other to use condoms.

  14. Theoretical study on a corrole-azafullerene dyad: Electronic structure, spectra and photoinduced electron transfer

    NASA Astrophysics Data System (ADS)

    Petsalakis, Ioannis D.; Theodorakopoulos, Giannoula

    2014-08-01

    Density Functional Theory and Time-Dependent Density Functional Theory calculations have been carried out on a recently synthesized amino-corrole and a corrole-azafullerene dyad which exhibits photoinduced electron transfer (PET). Good agreement of the theoretical results with experiment is obtained regarding the absorption and emission spectra of the corrole, the absorption spectra of the corrole-azafullerene dyad and the transient anionic and cationic radicals of azafullerene and corrole respectively. Application of Mulliken's theory for charge-transfer states yields the excitation energy of the charge-separated state of the dyad very close to the S1 excitation of amino-corrole, consistent with a PET process.

  15. Angular relationships regulate coordination tendencies of performers in attacker-defender dyads in team sports.

    PubMed

    Esteves, Pedro T; Araújo, Duarte; Vilar, Luís; Travassos, Bruno; Davids, Keith; Esteves, Carlos

    2015-04-01

    This study examined the continuous interpersonal interactions of performers in dyadic systems in team sports, as a function of changing information constraints. As a task vehicle, we investigated how attackers attained success in 1v1 sub-phases of basketball by exploring angular relations with immediate opponents and the basket. We hypothesized that angular relations would convey information for the attackers to dribble past defenders. Four basketball players performed as an attacker and defender in 1v1 sub-phases of basketball, in which the co-positioning and orientation of participants relative to the basket was manipulated. After video recording performance behaviors, we digitized participant movement displacement trajectories and categorized trials as successful or unsuccessful (from the attackers' viewpoint). Results revealed that, to successfully dribble past a defender, attackers tended to explore the left hand side of the space by defenders by increasing their angular velocity and decreasing their angular variability, especially in the center of the court. Interpersonal interactions and goal-achievement in attacker-defender dyads appear to have been constrained by the angular relations sustained between participants relative to the scoring target. Results revealed the functionality of exploratory behaviors of participants attempting re-align spatial relations with an opponent in 1v1 sub-phases of team games. PMID:25625811

  16. Porphyrin-cobaloxime dyads for photoinduced hydrogen production: investigation of the primary photochemical process.

    PubMed

    Natali, Mirco; Orlandi, Michele; Chiorboli, Claudio; Iengo, Elisabetta; Bertolasi, Valerio; Scandola, Franco

    2013-10-01

    Three porphyrin-cobaloxime dyads, suitable for application in photoinduced hydrogen generation with sacrificial donors, are characterized by ultrafast spectroscopy in order to clarify the primary photochemical events. PMID:23900713

  17. Photo-induced charge transfer in fullerene-oligothiophene dyads - A quantum-chemical study

    NASA Astrophysics Data System (ADS)

    Beenken, Wichard J. D.

    2009-02-01

    The excited states of fullerene-oligothiophene dyads were studied by quantum-chemical methods in respect of their theoretical suitability as solar-cell materials. Compared to the constituents a significant extension of the absorption spectra to the red has been found caused by optically excitable charge transfer states. These states seem to be responsible for the low energy conversion efficiency of fullerene-oligothiophene dyads in photovoltaic devices.

  18. Mother-daughter dyads view the family: Associations between divergent perceptions and daughter well-being

    Microsoft Academic Search

    Roberta L. Paikoff; Steven Carlton-Ford; Jeanne Brooks-Gunn

    1993-01-01

    Divergent perceptions (or “disagreements”) within the mother-daughter dyad and the association of such divergence with daughter's affective and behavioral well-being were examined in the current study. One hundred sixty-one mother-daughter dyads (daughters aged 14–18 years; mothers aged 37–59 years) completed paper- and-pencil measures assessing their perceptions of family cohesion and family conflict; daughters also rated their own depressive affect and

  19. The Indefinite Dyad and the Golden Section: Uncovering Plato’s Second Principle

    Microsoft Academic Search

    Scott Olsen

    2002-01-01

    .  Scott Olsen examines the philosophy of Plato to bring to light the nature of Plato’s Second Principle, known as the Indefinite\\u000a Dyad, sometimes called the Greater and the Lesser, and its relation to the Golden Section, ? . He responds to the challenge\\u000a posed in 1983 by Kenneth Sayre, and explains how the the Indefinite Dyad can be used to

  20. CONVERGENCE OF DEPRESSION AND ANXIETY SYMPTOMS IN FRIENDSHIP DYADS

    PubMed Central

    GROS, DANIEL F.; MILANAK, MELISSA e.; HERSHENBERG, RACHEL

    2014-01-01

    Despite psychometric rationale to include multiple informants, psychological assessment typically involves data collected from the patient (target) only, particularly with regard to depressive and anxious symptomatology. This study addressed this gap in the literature by assessing convergence between targets and their close friends (informants) in an ethnically diverse sample of young adults. One hundred and thirty-nine friendship dyads completed a packet of questionnaires including different versions administered to the targets and informants, with targets completing the standard questionnaire battery focused on their own symptoms and informants completing questionnaires on their view of the target participants’ symptoms, rather than their own characteristics. Measures were included to assess a wide range of symptomatology, including behavioral, cognitive, and physiological symptoms of anxiety and depression. The target-informant correlations were largely significant and of small-to-medium magnitude. In addition, target-informant agreement was higher in more visible symptoms (e.g., behavioral) than in less visible symptoms (e.g., physiological) of anxiety and depression. Interestingly, level of closeness in the relationship did not influence the magnitude of correlations. Implications for future research and integration into clinical assessment practices are discussed. PMID:25089072

  1. You smile–I smile: Emotion expression in social interaction

    Microsoft Academic Search

    Ursula Hess; Patrick Bourgeois

    2010-01-01

    Two studies were conducted to assess the influence of emotional context and social context, in terms of gender and status, on speaker expressivity and observer mimicry in a dyadic interactive setting. For Study 1, 96 same sex dyads and for Study 2, 72 mixed sex dyads participated in a social sharing paradigm. The results showed that in both same sex

  2. Current perspectives on attachment and bonding in the dog–human dyad

    PubMed Central

    Payne, Elyssa; Bennett, Pauleen C; McGreevy, Paul D

    2015-01-01

    This article reviews recent research concerning dog–human relationships and how attributes that arise from them can be measured. It highlights the influence of human characteristics on dog behavior, and consequently, the dog–human bond. Of particular importance are the influences of human attitudes and personality. These themes have received surprisingly little attention from researchers. Identifying human attributes that contribute to successful dog–human relationships could assist in the development of a behavioral template to ensure dyadic potential is optimized. Additionally, this article reveals how dyadic functionality and working performance may not necessarily be mutually inclusive. Potential underpinnings of various dog–human relationships and how these may influence dogs’ perceptions of their handlers are also discussed. The article considers attachment bonds between humans and dogs, how these may potentially clash with or complement each other, and the effects of different bonds on the dog–human dyad as a whole. We review existing tools designed to measure the dog–human bond and offer potential refinements to improve their accuracy. Positive attitudes and affiliative interactions seem to contribute to the enhanced well-being of both species, as reflected in resultant physiological changes. Thus, promoting positive dog–human relationships would capitalize on these benefits, thereby improving animal welfare. Finally, this article proposes future research directions that may assist in disambiguating what constitutes successful bonding between dogs and the humans in their lives.

  3. You smile--I smile: emotion expression in social interaction.

    PubMed

    Hess, Ursula; Bourgeois, Patrick

    2010-07-01

    Two studies were conducted to assess the influence of emotional context and social context, in terms of gender and status, on speaker expressivity and observer mimicry in a dyadic interactive setting. For Study 1, 96 same sex dyads and for Study 2, 72 mixed sex dyads participated in a social sharing paradigm. The results showed that in both same sex and mixed sex dyads women smile more than men and members of both sexes use Duchenne smiles rather than non-Duchenne smiles to signal social intent. In same sex dyads facial expressivity and facial mimicry were determined by both the emotional and the social context of the situation. However, whereas emotional context effects maintained, social context effects were absent in mixed sex dyads. The study is the first to show evidence for facial mimicry in an interactional setting and supports the notion that mimicry is dependent on social context. PMID:19913071

  4. Role of the bridge in photoinduced electron transfer in porphyrin-fullerene dyads.

    PubMed

    Pelado, Beatriz; Abou-Chahine, Fawzi; Calbo, Joaquín; Caballero, Rubén; de la Cruz, Pilar; Junquera-Hernández, José M; Ortí, Enrique; Tkachenko, Nikolai V; Langa, Fernando

    2015-04-01

    The role of ?-conjugated molecular bridges in through-space and through-bond electron transfer is studied by comparing two porphyrin-fullerene donor-acceptor (D-A) dyads. One dyad, ZnP-Ph-C60 (ZnP=zinc porphyrin), incorporates a phenyl bridge between D and A and behaves very similarly to analogous dyads studied previously. The second dyad, ZnP-EDOTV-C60 , introduces an additional 3,4-ethylenedioxythienylvinylene (EDOTV) unit into the conjugated bridge, which increases the distance between D and A, but, at the same time, provides increased electronic communication between them. Two essential outcomes that result from the introduction of the EDOTV unit in the bridge are as follows: 1)?faster charge recombination, which indicates enhanced electronic coupling between the charge-separated and ground electronic states; and 2)?the disappearance of the intramolecular exciplex, which mediates photoinduced charge separation in the ZnP-Ph-C60 dyad. The latter can be interpreted as a gradual decrease in electronic coupling between locally excited singlet states of D and A when introducing the EDOTV unit into the D-A bridge. PMID:25737468

  5. Self-organization of phthalocyanine--[60]fullerene dyads in liquid crystals.

    PubMed

    de la Escosura, Andrés; Martínez-Díaz, M Victoria; Barbera, Joaquín; Torres, Tomas

    2008-02-15

    The use of blends in which a mesogen induces mesomorphism into a non-mesogenic compound has made possible the self-organization of phthalocyanine--[60]fullerene (Pc-C60) dyads into liquid crystals. Pc-C60 dyads 1, 2, or 3, in which two photoactive units are brought together by a phenylenevinylene spacer, have been synthesized through a Heck reaction that links 4-vinylbenzaldehyde to a monoiodophthalocyanine precursor, followed by standard cycloaddition of azomethine ylides--generated from the formylPc derivative and N-methylglycine--to one of the double bonds of C60. The mesomorphic and thermal properties of different mixtures formed by the liquid-crystalline phthalocyanine 4 and dyads 1, 2, or 3 were examined using polarizing optical microscopy (POM), differential scanning calorimetry (DSC), and X-ray diffraction (XRD). DSC diagrams of the blends show clear transitions from the crystalline state to a mesophase, and the measured structural parameters obtained from the powder diffraction experiments are consistent with a discotic hexagonal columnar (Col h) structure. Considering that segregation in domains of separated molecules of Pc-C60 dyad and phthalocyanine 4 would preclude mesomorphism due to the mismatch in the column diameter and to the lack of mesogenic character of the pure dyads, a predominance of alternating stacking is proposed. Additionally, the observed decrease in the calculated density of the blend mesophases relative to the mesophase of pure compound 4 is important evidence in this direction. PMID:18197683

  6. Let the force be with us: dyads exploit haptic coupling for coordination.

    PubMed

    van der Wel, Robrecht P R D; Knoblich, Guenther; Sebanz, Natalie

    2011-10-01

    People often perform actions that involve a direct physical coupling with another person, such as when moving furniture together. Here, we examined how people successfully coordinate such actions with others. We tested the hypothesis that dyads amplify their forces to create haptic information to coordinate. Participants moved a pole (resembling a pendulum) back and forth between two targets at different amplitudes and frequencies. They did so by pulling on cords attached to the base of the pole, one on each side. In the individual condition, one participant performed this task bimanually, and in the joint condition two participants each controlled one cord. We measured the moment-to-moment pulling forces on each cord and the pole kinematics to determine how well individuals and dyads performed. Results indicated that dyads produced much more overlapping forces than individuals, especially for tasks with higher coordination requirements. Thus, the results suggest that dyads amplify their forces to generate a haptic information channel. This likely reflects a general coordination principle in haptic joint action, where force amplification allows dyads to perform at the same level as individuals. PMID:21417545

  7. Coregulation in mother-infant dyads: links to infants' cardiac vagal tone.

    PubMed

    Porter, Christin L

    2003-02-01

    This investigation explored links between mother-infant coregulated communication patterns and infants' emerging parasympathetic regulatory processes (cardiac vagal tone). Participants included 56 first-time mothers and their 6-mo.-old infants (31 girls, 25 boys). A 4-min. baseline EKG was gathered from the infant and an ensuing 15-min. mother-infant dyadic free-play episode was videotaped and coded using Fogel's 1994 Regional Coding System. This system was developed to describe variations in coregulated features of communication among dyads, ranging from symmetrical patterns to disruptive patterns of coregulation. Analysis suggests a positive link between infants' cardiac vagal tone and more symmetrical features of coregulated communication patterns in mother-infant dyads. Cardiac vagal tone was also negatively correlated with unilateral features of coregulation communication systems. These findings point toward the potential relation between emerging physiological regulatory abilities of infants and the more relational regulatory processes in mother-infant dyads. PMID:12674298

  8. Effects of Gender Role and Task Content on Performance in Same-Gender Dyads: Transactive Memory as a Potential Mediator

    ERIC Educational Resources Information Center

    Michinov, Estelle; Michinov, Nicolas; Huguet, Pascal

    2009-01-01

    This experiment was designed to examine the effects of gender role and task content on performance in learning dyads and to test the potential mediator effect of an intragroup process related to transactive memory. A total of 44 same-gender dyads participated in the study and were asked to collaborate on a stereotypically masculine or feminine…

  9. Protein Geometry and Placement in the Cardiac Dyad Influence Macroscopic Properties of Calcium-Induced Calcium Release

    E-print Network

    Sun, Sean

    Protein Geometry and Placement in the Cardiac Dyad Influence Macroscopic Properties of Calcium-Induced Calcium Release Antti J. Tanskanen,*yz Joseph L. Greenstein,*yz Alex Chen,*yz Sean X. Sun,y§ and Raimond L of calcium (Ca21 ) ions in the dyad have often been described by assigning continuously valued Ca21

  10. The effects of animations on verbal interaction in computer supported collaborative learning

    Microsoft Academic Search

    Mirweis Sangin; Pierre Dillenbourg; Cyril Rebetez; Mireille Bétrancourt; Gaëlle Molinari

    2008-01-01

    This paper focuses on the interaction patterns of learners studying in pairs who were provided with multimedia learning material. In a previous article, we reported that learning scores were higher for dyads of an 'animations' condition than for dyads of a 'static pictures' condition. Results also showed that offering a persistent display of one snapshot of each animated sequence hindered

  11. Attachment Style, Vagal Tone, and Empathy during Mother-Adolescent Interactions

    ERIC Educational Resources Information Center

    Diamond, Lisa M.; Fagundes, Christopher P.; Butterworth, Molly R.

    2012-01-01

    We tested associations among empathic responsiveness, attachment style, and vagal tone (a physiologic index of emotion regulation) in 103 mother-adolescent dyads. Dyads discussed positive and negative topics and then separately reviewed a videotape of the interaction and rated their own and the other person's affect at one-minute intervals. We…

  12. High-Resolution Spectroscopy and Analysis of the ?_3/2?_4 Dyad of CF_4

    NASA Astrophysics Data System (ADS)

    Boudon, V.; Domanskaya, A.; Maul, C.; Georges, R.; Mitchell, J.

    2009-06-01

    CF_4 is a strong greenhouse gas of both anthropogenic and natural origin. However, high-resolution infrared spectroscopy of this molecule has received only a limited interest up to now. The public databases only contain cross-sections for this species, but no detailed line list. We reinvestigate here the strongly absorbing ?_3 region around 7.3 ?m. Two new Fourier transform infrared spectra at a 0.003 cm^{-1} resolution have been recorded: i) a room-temperature spectrum in a static cell with a 5 mb pressure and ii) a supersonic expansion jet spectrum at a 15 K estimated temperature. Following the work of Gabard et al., we perform a simultaneous analysis of both the ?_3 and 2?_4 bands since a strong Coriolis interaction occurs between them, perturbing the ?_3 R-branch rotational clusters around J=20. As in Ref. ref{gab}, we also include ?_3-?_3 microwave data in the fit. The analysis is performed thanks to the XTDS and SPVIEW programs. Compared to Ref. ref{gab}, the present work extends the analysis up to higher J values (56 instead of 32). Absorption intensities are estimated thanks to the dipole moment derivative value of D. Papoušek et al. and compare well with the experiment. The rotational energy surfaces for the ?_3/2?_4 dyad are also examined in order to understand the distribution of rovibrational levels. D. R. Worton, W. T. Sturges, L. K. Gohar et al., Environ. Sci. Technol. 41, 2184-2189 (2007). T. Gabard, G. Pierre and M. Takami, Mol. Phys. 85, 735-744 (1995) Ch. Wenger, V. Boudon, M. Rotger, M. Sanzharov and J.-P. Champion, J. Mol. Spectrosc., 251 102-113 (2008). D. Papoušek, Z. Papou\\vsková and D. P. Chong, J. Phys. Chem. 99, 15387-15395 (1995).

  13. Psychological adaptation to life-threatening injury in dyads: the role of dysfunctional disclosure of trauma

    PubMed Central

    Pielmaier, Laura; Maercker, Andreas

    2011-01-01

    Background Certain modes of trauma disclosure have been found to be associated with more severe symptoms of posttraumatic stress (PTS) in different trauma populations: the reluctance to disclose trauma-related thoughts and feelings, a strong urge to talk about it, and physical as well as emotional reactions during disclosure. Although social-contextual influences gain more and more interest in trauma research, no study has yet investigated these “dysfunctional disclosure tendencies” and their association with PTS from an interpersonal perspective. Objective (1) To replicate previous findings on dysfunctional disclosure tendencies in patients with life-threatening injury and their significant others and (2) to study interpersonal associations between dysfunctional disclosure style and PTS at a dyadic level. Method PTS symptom severity and self-reports on dysfunctional disclosure tendencies were assessed in N=70 dyads comprising one individual with severe traumatic brain injury and a significant other (“proxy”) 3 months after injury. Results Regression analyses predicting PTS symptom severity revealed dysfunctional disclosure tendencies to have incremental validity above and beyond sex, age, and trauma severity within the individual (both patient and proxy), with moderate effect sizes. The interaction between patient's and proxy's disclosure style explained additional portions of the variance in patients’ PTS symptom severity. Conclusions Findings suggest that dysfunctional disclosure tendencies are related to poorer psychological adaptation to severe traumatic brain injury. This intrapersonal association may be exacerbated by dysfunctional disclosure tendencies on the part of a significant other. Although the results require replication in other trauma samples without brain injury to further generalize the findings beyond the observed population, the study contributes to the expanding literature on the crucial role of interpersonal relationships in trauma recovery. PMID:22893822

  14. Males' and females' conversational behavior in cross-sex dyads: From gender differences to gender similarities

    Microsoft Academic Search

    Agnesa Pillon; Catherine Degauquier; François Duquesne

    1992-01-01

    We investigated gender differences in conversational behavior in an experimental setting. Twenty men and 20 women were randomly paired in 20 dyads and were asked to discuss a given topic. We examined the transcripts through a varied range of behavioral variables. First we analyzed the sequential ordering of utterances in order to establish the way male and female speakers take

  15. Similarity of Bacterial Populations in Saliva from African-American Mother-Child Dyads?

    PubMed Central

    Li, Yihong; Ismail, Amid I.; Ge, Yao; Tellez, Marisol; Sohn, Woosung

    2007-01-01

    Using PCR-based denaturing gradient gel electrophoresis analyses of oral bacterial samples in 20 mother-child dyads, this study demonstrated a high degree of similarity of bacterial compositions between the mothers and their children; the two may share as much as 94% of their oral bacterial spectra, including cariogenic species. PMID:17634300

  16. Similarity of Bacterial Populations in Saliva from African-American Mother-Child Dyads

    Microsoft Academic Search

    Yihong Li; Amid I. Ismail; Yao Ge; Marisol Tellez; Woosung Sohn

    2007-01-01

    Using PCR-based denaturing gradient gel electrophoresis analyses of oral bacterial samples in 20 mother- child dyads, this study demonstrated a high degree of similarity of bacterial compositions between the mothers and their children; the two may share as much as 94% of their oral bacterial spectra, including cariogenic species. Early childhood caries (ECC) is a particularly destructive form of tooth

  17. Corrective Feedback via Instant Messenger Learning Activities in NS-NNS and NNS-NNS Dyads

    ERIC Educational Resources Information Center

    Sotillo, Susana

    2005-01-01

    This exploratory study examines corrective feedback in native speaker-nonnative speaker (NS-NNS) and NNS-NNS dyads while participants were engaged in communicative and problem-solving activities via "Yahoo! Instant Messenger" (YIM). As "negotiation of meaning" studies of the 1990s have shown, linguistic items which learners negotiate in…

  18. Identity Styles and Conflict Resolution Styles: Associations in Mother-Adolescent Dyads

    ERIC Educational Resources Information Center

    Missotten, Lies Christine; Luyckx, Koen; Branje, Susan; Vanhalst, Janne; Goossens, Luc

    2011-01-01

    Adolescent identity and parent-adolescent conflict have each attracted considerable research interest. However, few studies have examined the important link between the two constructs. The present study examined the associations between adolescent identity processing styles and adolescent conflict resolution styles in the mother-adolescent dyad.…

  19. Revisiting the Generation Gap: Exploring the Relationships of Parent/Adult-Child Dyads

    ERIC Educational Resources Information Center

    Shapiro, Adam

    2004-01-01

    There is some evidence that older parents and their adult children may evaluate their relationships with each other in different ways. To date, we know little about what may account for these discrepancies. This investigation compares the perceptions of intergenerational solidarity among 2,590 adult-child/older-parent dyads from the National…

  20. The automatic conversion of spinor equations to dyad form in MAPLE

    NASA Astrophysics Data System (ADS)

    Czapor, S. R.; McLenaghan, R. G.; Carminati, J.

    1992-09-01

    A new package in the symbolic algebra system MAPLE is presented for the conversion of complicated spinor equations to their expansions with respect to a normalized spinor dyad. By following a simple index convention, we obtain a powerful computational tool with a straightforward and easy to use syntax. A number of examples, including nontrivial applications of the package to recent research, are provided.

  1. Nonverbal Communication Among Black Female Dyads: An Assessment of Intimacy, Gender, and Race.

    ERIC Educational Resources Information Center

    Smith, Althea

    1983-01-01

    Studied three types of nonverbal intimacy cues (smiling behavior, eye contact, and synchronous leaning forward) in Black female, Black male, and White male dyads. Results indicated that combined effects of race and gender make it incorrect to generalize previous research on "Blacks" or on "women" to Black women. (GC)

  2. Couple Coping and Adjustment to Multiple Sclerosis in Care Receiver-Carer Dyads.

    ERIC Educational Resources Information Center

    Pakenham, Kenneth I.

    1998-01-01

    The utility of "coping congruency" and "average level of couple coping" in explaining adjustment to multiple sclerosis was examined. Interview and questionnaire data was collected for 45 dyads with a 12-month follow-up. Predictors include Time 1 illness, caregiving, and coping variables. Findings support both concepts for explaining collective and…

  3. Effects of a Cooperative Learning Program on the Elaborations of Students Working in Dyads

    ERIC Educational Resources Information Center

    Krol, Karen; Janssen, Jeroen; Veenman, Simon; van der Linden, Jos

    2004-01-01

    In this study, the effects of a school improvement program on cooperative learning (CL) with respect to the elaborations of 6th grade students working in mixed ability and mixed sex dyads on 2 cooperative tasks were examined. A post test only design with a control group was used to investigate the provision and receipt of elaborations within the…

  4. Explanations from the marketing\\/human resources dyad for marketing strategy implementation effectiveness in service firms

    Microsoft Academic Search

    Jacqueline Chimhanzi; Robert E. Morgan

    2005-01-01

    The marketing strategy literature is often criticized for the dearth of conceptual, theoretical, and empirical studies focusing on antecedents to effective marketing strategy implementation. Despite some related research on the constituency-based theory of the firm, even less is understood concerning the interplay between functional areas on marketing strategy implementation effectiveness. We examine the marketing\\/human resources (HR) dyad and contribute to

  5. Custodial Grandmother-Grandfather Dyads: Pathways among Marital Distress, Grandparent Dysphoria, Parenting Practice, and Grandchild Adjustment

    ERIC Educational Resources Information Center

    Smith, Gregory C.; Hancock, Gregory R.

    2010-01-01

    An adaptation of the Family Stress Model was examined using structural equation modeling with data from 193 custodial grandmother-grandfather dyads. The model's measurement and structural components were largely invariant by grandparent gender. For grandmothers and grandfathers alike, the effects of their psychological and marital distress on…

  6. Measuring Dyadic Adjustment: New Scales for Assessing the Quality of Marriage and Similar Dyads

    ERIC Educational Resources Information Center

    Spanier, Graham B.

    1976-01-01

    This study reports on the development of the Dyadic Adjustment Scale, a new measure for assessing the quality of marriage and other similar dyads. This factor analytic study suggests four empirically verified components of dyadic adjustment to be used as subscales (dyadic satisfaction, dyadic cohesion, dyadic consensus and affectional expression).…

  7. Acceptability and Feasibility Results of a Strength-Based Skills Training Program for Dementia Caregiving Dyads

    ERIC Educational Resources Information Center

    Judge, Katherine S.; Yarry, Sarah J.; Orsulic-Jeras, Silvia

    2010-01-01

    Purpose: The current article provides an in-depth description of a dyadic intervention for individuals with dementia and their family caregivers. Using a strength-based approach, caregiving dyads received skills training across 5 key areas: (a) education regarding dementia and memory loss, (b) effective communication, (c) managing memory loss, (d)…

  8. Tridimensional Acculturation and Adaptation among Jamaican Adolescent-Mother Dyads in the United States

    ERIC Educational Resources Information Center

    Ferguson, Gail M.; Bornstein, Marc H.; Pottinger, Audrey M.

    2012-01-01

    A bidimensional acculturation framework cannot account for multiple destination cultures within contemporary settlement societies. A "tridimensional model" is proposed and tested among Jamaican adolescent-mother dyads in the United States compared to Jamaican Islander, European American, African American, and other Black and non-Black U.S.…

  9. Investigation of an Activity-Based Text-Processing Strategy in Mixed-Age Child Dyads

    ERIC Educational Resources Information Center

    Marley, Scott C.; Szabo, Zsuzsanna; Levin, Joel R.; Glenberg, Arthur M.

    2011-01-01

    The authors examined an activity-based listening strategy with first- and third-grade children in mixed-grade dyads. On the basis of theories of cognitive development and previous research, the authors predicted the following: (a) children in an activity-based strategy would recall more story events compared with those in a repetition strategy and…

  10. Switching of the triplet excited state of rhodamine-C60 dyads.

    PubMed

    Wang, Fen; Cui, Xiaoneng; Lou, Zhangrong; Zhao, Jianzhang; Bao, Ming; Li, Xingwei

    2014-12-21

    Acid-switching of the triplet excited state in rhodamine-C60 dyads was achieved. The rhodamine moiety acts as an acid-activated visible light-harvesting antenna and C60 as the singlet energy acceptor and the spin converter, and production of the triplet state was enhanced in the presence of acid. PMID:25360461

  11. Mother Infant Interactions in Western Lowland Gorillas (Gorilla gorilla gorilla): Spatial Relationships, Communication, and Opportunities

    E-print Network

    Maestripieri, Dario

    Mother Infant Interactions in Western Lowland Gorillas (Gorilla gorilla gorilla): Spatial This study investigated mother infant interactions in lowland gorillas (Gorilla gorilla gorilla conducive to infant social learning. Eleven gorilla mother infant dyads were focally observed in weekly 1-hr

  12. "New beginnings" in South african shelters for the homeless: piloting of a group psychotherapy intervention for high-risk mother-infant dyads.

    PubMed

    Bain, Katherine

    2014-11-01

    The New Beginnings program was developed at the Anna Freud Centre and originally piloted in Her Majesty Prisons in the United Kingdom. This study aimed to explore the use of this manualized parent-infant psychotherapy group model in an African setting with high-risk mother-infant dyads, and describes the implementation and investigation of this 12-week group psychotherapy intervention in two Johannesburg shelters for homeless women. The measures used to investigate treatment efficacy were the Parent Development Interview (A. Slade, J.L. Aber, I. Bresgi, B. Berger, & M. Kaplan, ), the Emotional Availability Scales (Z. Biringen, J.L. Robinson, & R.N. Emde, ), the Kessler-10 (R.C. Kessler et al., ), and the Griffiths Scales of Mental Development (D. Luiz et al., ). At pretesting, infants exhibited delays in a number of developmental areas, and mothers showed high levels of depression and generally low capacities for reflective function. While significant shifts in the mothers' capacities for reflective function were not found in the treatment condition, significant shifts were found in the infants' speech abilities and in the mothers' abilities to structure their interactions with their infants. This suggests that the program enabled mothers to become more sensitized to their infants' needs in interaction and that communication between mother and infant increased. The number of sessions attended by the dyads correlated with improvements made by the mothers and their infants. PMID:25798508

  13. Factors Affecting Co-Operative vs. Competitive Behavior in Dyads.

    ERIC Educational Resources Information Center

    O'Day, Gerald; Phelan, Joseph G.

    Theoretical interpretations of cooperation and competition are discussed in relation to motivational and situational determinants. It is suggested that the degree of competition exhibited in an interaction is an inverse function of the quantity of resources available, and that the effect of situational characteristics on cooperative behavior is…

  14. Complex Mathematical Problem Solving by Individuals and Dyads.

    ERIC Educational Resources Information Center

    Vye, Nancy J.; Goldman, Susan R.; Voss, James F.; Hmelo, Cindy; Williams, Susan; Cognition and Technology Group at Vanderbilt University

    1997-01-01

    Describes two studies of mathematical problem solving using an episode from "The Adventures of Jasper Woodbury," a set of curriculum materials that afford complex problem-solving opportunities. Discussion focuses on characteristics of problems that make solutions difficult, kinds of reasoning that dyadic interactions support, and considerations of…

  15. Effect of Side Chains on Charge Transfer in Quaterthiophene-Naphthalene Diimide Based Donor-Bridge-Acceptor Dyads

    SciTech Connect

    Bheemaraju, A.; Pourmand, M.; Yang, B.; Surampudi, S.; Benanti, T.; Achermann, M.; Barnes, M. D.; Venkataraman, D.

    2011-01-01

    We have probed the effect of side chains on the charge transfer dynamics in dyads containing quaterthiophene (QT) donor and naphthalene diimide (NDI) acceptor. The donor and the acceptor are covalently linked using a flexible linker. Four dyads (1–4) were synthesized with the quaterthiophene bearing hexyl side chain and the naphthalene diimide bearing hydrocarbon, fluorocarbon, branched or polar side chains. The UV-Vis spectra for these dyads showed the existence of a donor-acceptor complex. The time-resolved fluorescence (TRF) decay studies show a rapid quenching of fluorescence in all the dyads upon excitation of the donor. We found that the side chains on the NDI did not alter the quenching rates in solution.

  16. Electron Exchange and the Photophysics of Metal-Quinone Complexes. 1. Synthesis and Spectroscopy of Chromium-Quinone Dyads

    E-print Network

    McCusker, James K.

    of Chromium-Quinone Dyads Daniel E. Wheeler and James K. McCusker* Department of Chemistry, University and spectroscopic characterization of monosemiquinone and monocatechol complexes of chromium(III) are described

  17. HIV-related traumatic stress symptoms in AIDS caregiving family dyads.

    PubMed

    Wight, R G; Beals, K P; Miller-Martinez, D; Murphy, D A; Aneshensel, C S

    2007-08-01

    This study assesses HIV-related traumatic stress symptoms in 135 AIDS caregiving family dyads in which the caregiver is a midlife or older mother or wife, and the care-recipient is her HIV-infected adult son or husband. Symptoms of HIV-related traumatic stress can be reliably measured in these dyads, with both caregivers and care-recipients reporting avoidant and intrusive thoughts. Among care-recipients, high symptoms are associated with high daily living assistance requirements, low dyadic adjustment, and high constriction of social activities. Among caregivers, high symptoms of traumatic stress are associated with being HIV positive, feeling overloaded by caregiving demands, and perceiving high levels of HIV stigma. Caregiving mothers and wives may feel traumatized 'courtesy' of their loved one's HIV infection, the caregiving scenario, or the resultant caregiving stress. PMID:17712694

  18. The Early Stages of the Transition to Adulthood: Similarities and Differences between Mother-Daughter and Mother-Son Dyads

    Microsoft Academic Search

    José F. Domene; Krista D. Socholotiuk; Richard A. Young

    2011-01-01

    The action-project method was used to explore similarities and differences in the goals and activities of mothers and sons, and mothers and daughters, working together to facilitate a successful future transition to adulthood. Participants were 10 mother?daughter dyads and 8 mother-son dyads, with a range of ethnicities and income levels. Data included video-recordings of conversations, transcripts of interviews, and self-report

  19. Protein Geometry and Placement in the Cardiac Dyad Influence Macroscopic Properties of Calcium-Induced Calcium Release

    Microsoft Academic Search

    Antti J. Tanskanen; Joseph L. Greenstein; Alex Chen; Sean X. Sun; Raimond L. Winslow

    2007-01-01

    In cardiac ventricular myocytes, events crucial to excitation-contraction coupling take place in spatially restricted microdomains known as dyads. The movement and dynamics of calcium (Ca2+) ions in the dyad have often been described by assigning continuously valued Ca2+ concentrations to one or more dyadic compartments. However, even at its peak, the estimated number of free Ca2+ ions present in a

  20. On the photo-induced charge-carrier generation within monolayers of self-assembled organic donor-acceptor dyads.

    PubMed

    Fuchs, Franz; Linares, Mathieu; de Vet, Christiaan; Leclère, Philippe; Demadrille, Renaud; Grévin, Benjamin

    2014-10-01

    By means of STM and nc-AFM the self-assembly of a new donor-acceptor (DA) dyad molecule on highly oriented pyrolytic graphite is identified and compared to molecular simulations. Kelvin probe force microscopy (KPFM) measurements clearly show the photovoltaic activity of this model system under illumination. The optoelectronic properties and the local morphology of the DA dyad assembly are simultaneously probed by KPFM down to the level of one molecular monolayers. PMID:25123291

  1. Studies of Porphyrin-fullerene dyads with oligoethylene glycols spacers in solution

    NASA Astrophysics Data System (ADS)

    Ogura, Reiko; Toida, Tatuo; Tsunoda, Katsunori; Yajima, Hirofumi; Ishii, Tadahiro

    2001-10-01

    Two novel Porphyrin-fullerene dyads (PFDs) were synthesized, in which flexible spacers of oligoethylene glycol chains were incorporated with different numbers of ethylene glycol moieties. And the emission and electrochemical properties were examined. From the estimations of the quantum yields and free energy, ?G, for the electron transfer reaction in the excited state, our novel PFDs were suggested to have an efficient electron transfer capability required for compounds constituting artificial photosynthesis system.

  2. Successful daily home hemodialysis patient-care partner dyads: benefits outweigh burdens.

    PubMed

    Wise, Meg; Schatell, Dorian; Klicko, Kristi; Burdan, Amy; Showers, Mary

    2010-07-01

    Understanding and communicating the benefits vs. burdens of short daily home hemodialysis (SDHD) is presumed to be important to the success of recruiting patients and care partners and preventing dropout. We conducted an in-depth qualitative study of 13 patient and care partner couples (dyads) who completed at least 6 months of SDHD after at least 6 months of in-center hemodialysis to inform strategies for screening, training, and support to improve SDHD retention. In this exploratory descriptive study, all patients reported better well-being since starting SDHD. Considering the relationship and psychosocial factors, 4 profiles for dyadic coping emerged: (1) Thriving (n=5)--patients and care partners were flourishing; (2) Surviving (n=4)--strong couples were adjusting to challenges; (3) Martyrdom (n=3)--1 partner defers his/her needs and resentments to make SDHD work; and (4) Seeking another option (n=1)--patient unwilling to burden an anxious partner. Overall, patients who did more SDHD self-care, particularly self-cannulation, were more likely to thrive, regardless of dyad profile, and strong relationships tended to become stronger when faced with the challenge of SDHD. Training that was unhurried and valued care partners as well as patients, used a mix of learning strategies, and provided a home visit for the first home treatment was associated with Thriving dyads; training that was directive, inflexible, and focused on the patient at the expense of the partner was not. We recommend that centers screen dyads for relationship quality and integrate couple relationship education into SDHD training as required. Further, we recommend a large-scale, multi-center prospective study to test this model of how couple relationship and coping styles affect clinical outcomes and rates of continuation with SDHD. PMID:20491970

  3. An organic spin crossover material in water from a covalently linked radical dyad.

    PubMed

    Geraskina, Margarita R; Buck, Alexander T; Winter, Arthur H

    2014-08-15

    A covalently linked viologen radical cation dyad acts as a reversible thermomagnetic switch in water. Cycling between diamagnetic and paramagnetic forms by heating and cooling is accompanied by changes in optical and magnetic properties with high radical fidelity. Thermomagnetic switches in water may eventually find use as novel biological thermometers and in temperature-responsive organic materials where the changes in properties originate from a change in electronic spin configuration rather than a change in structure. PMID:25068840

  4. Perceptual Judgments of Triads and Dyads: Assessment of a Psychoacoustic Model

    Microsoft Academic Search

    WILLIAM FORDE THOMPSON; RICHARD P ARNCUTT

    1997-01-01

    In two experiments, goodness-of-fit ratings of pairs of musical elements (triads, dyads, and octave-complex tones) were examined in view of a psychoacoustic model. The model, referred to as the pitch commonality model, evaluates the sharing of fundamental frequencies, overtones, and subharmonic tone sensations between sequential elements and also con- siders the effects of auditory masking within each element. Two other

  5. Three-way analysis of dyadic social interactions

    Microsoft Academic Search

    Mary B. Seay; Edwin J. Kay

    1983-01-01

    Proposes a method for analyzing data from dyadic social interactions across 3 dichotomous variables. By accounting for the likely interdependency between 2 scores from a dyad, problems incurred with traditional analyses are circumvented. The analysis is demonstrated by an examination of data from 4 groups of 41 parent–child dyads: mother–daughter, mother–son, father–daughter, and father–son. The effects of sex-of-S, sex-of-partner, familial

  6. Motherhood in adolescent mothers: maternal attachment, mother-infant styles of interaction and emotion regulation at three months.

    PubMed

    Riva Crugnola, Cristina; Ierardi, Elena; Gazzotti, Simona; Albizzati, Alessandro

    2014-02-01

    Early motherhood is considered a risk factor for an adequate relationship between mother and infant and for the subsequent development of the infant. The principal aim of the study is to analyze micro-analytically the effect of motherhood in adolescence on the quality of mother-infant interaction and emotion regulation at three months, considering at the same time the effect of maternal attachment on these variables. Participants were 30 adolescent mother-infant dyads compared to 30 adult mother-infant dyads. At infant 3 months, mother-infant interaction was video-recorded and coded with a modified version of the Infant Caregiver Engagement Phases and the Adult Attachment Interview was administered to the mother. Analysis showed that adolescent mothers (vs. adult mothers) spent more time in negative engagement and their infants spent less time in positive engagement and more time in negative engagement. Adolescent mothers are also less involved in play with their infants than adult mothers. Adolescent mother-infant dyads (vs. adult mother-infant dyads) showed a greater duration of negative matches and spent less time in positive matches. Insecure adolescent mother-infant dyads (vs. insecure adult mother-infant dyads) demonstrated less involvement in play with objects and spent less time in positive matches. To sum up adolescent mother-infant dyads adopt styles of emotion regulation and interaction with objects which are less adequate than those of dyads with adult mothers. Insecure maternal attachment in dyads with adolescent mothers (vs. adult mother infant dyads) is more influential as risk factor. PMID:24463037

  7. DiiodoBodipy-Perylenebisimide Dyad/Triad: Preparation and Study of the Intramolecular and Intermolecular Electron/Energy Transfer.

    PubMed

    Mahmood, Zafar; Xu, Kejing; Küçüköz, Betül; Cui, Xiaoneng; Zhao, Jianzhang; Wang, Zhijia; Karatay, Ahmet; Yaglioglu, Halime Gul; Hayvali, Mustafa; Elmali, Ayhan

    2015-03-20

    2,6-diiodoBodipy-perylenebisimide (PBI) dyad and triad were prepared, with the iodoBodipy moiety as the singlet/triplet energy donor and the PBI moiety as the singlet/triplet energy acceptor. IodoBodipy undergoes intersystem crossing (ISC), but PBI is devoid of ISC, and a competition of intramolecular resonance energy transfer (RET) with ISC of the diiodoBodipy moiety is established. The photophysical properties of the compounds were studied with steady-state and femtosecond/nanosecond transient absorption and emission spectroscopy. RET and photoinduced electron transfer (PET) were confirmed. The production of the triplet state is high for the iodinated dyad and the triad (singlet oxygen quantum yield ?? = 80%). The Gibbs free energy changes of the electron transfer (?GCS) and the energy level of the charge transfer state (CTS) were analyzed. With nanosecond transient absorption spectroscopy, we confirmed that the triplet state is localized on the PBI moiety in the iodinated dyad and the triad. An exceptionally long lived triplet excited state was observed (?T = 150 ?s) for PBI. With the uniodinated reference dyad and triad, we demonstrated that the triplet state localized on the PBI moiety in the iodinated dyad and triad is not produced by charge recombination. These information are useful for the design and study of the fundamental photochemistry of multichromophore organic triplet photosensitizers. PMID:25710451

  8. Porphyrin-perylene bisimide dyads and triads: synthesis and optical and coordination properties.

    PubMed

    You, Chang-Cheng; Würthner, Frank

    2004-07-01

    [structure: see text] Novel porphyrin perylene dyad and triad dyes have been prepared by the coupling of aminophenyltrisphenylporphyrin and tetraphenoxy-substituted perylenetetracarboxylic acid bisanhydrides in a one-step synthesis. Fluorescence spectra of these compounds reveal features that are attributable to emission of perylene bisimides as well as porphyrin excited states. The self-assembly behavior of zinc-metalated compounds with 4,4'-bipyridine and diazabenzoperylene has been investigated by (1)H NMR spectroscopy in CDCl(3), showing that oligomeric zigzag assemblies are formed. PMID:15228289

  9. Superabsorbing Fullerenes: Spectral and Kinetic Characterization of Photoinduced Interactions in Perylenediimide-Fullerene-C60 Dyads

    E-print Network

    van Stokkum, Ivo

    one of the most promising n-type material components in polymer solar cells,2,3 and the reported power light region of C60 and its derivatives impedes attaining very high efficiencies of solar energy to their combination and will partly determine their efficiency in solar cells, has eluded. Here we report

  10. BODIPY functionalized o-carborane dyads for low-energy photosensitization.

    PubMed

    Jin, Guo Fan; Cho, Yang-Jin; Wee, Kyung-Ryang; Hong, Seong Ahn; Suh, Il-Hwan; Son, Ho-Jin; Lee, Jong-Dae; Han, Won-Sik; Cho, Dae Won; Kang, Sang Ook

    2015-02-14

    A new type of organic dyad that can induce low-energy photosensitization has been developed; electron donor and electron acceptor units are boron dipyrromethene (BODIPY) and ortho-carborane (o-Cb), respectively. The new dyads consist of a V-shaped BODIPY-(o-Cb)-BODIPY molecular array in which two BODIPY units are substituted onto two adjacent carbon atoms of the central o-Cb. In the presence of the o-Cb unit, as an electron acceptor, significant fluorescence quenching was observed which indicated that photoinduced electron transfer (PET) had occurred from the end-on BODIPY units to the central o-Cb with PET efficiencies of 63-71%. As a result, the corresponding cationic and anionic species that are responsible for the charge transfer state were detected by the serial spectroelectrochemical studies: cationic BODIPY radicals at 400 nm at the applied voltage of 1.44 V and broad absorption bands of anionic o-Cb radicals in the range of 250-490 nm at -1.84 V. Transient absorption studies further confirmed the BODIPY radical anion at 540 nm and the o-Cb radical anion at 350-475 nm with a structureless broad band. PMID:25482506

  11. Tuning the Charge-Separated Lifetimes of Ruthenium(II)polypyridyl-Viologen Dyads and Ruthenium(II)polypyridyl-Viologen Triads by the Formation of Supramolecular Assemblies

    E-print Network

    Turro, Claudia

    ARTICLES Tuning the Charge-Separated Lifetimes of Ruthenium(II)polypyridyl-Viologen Dyads and Ruthenium(II)polypyridyl-Viologen Triads by the Formation of Supramolecular Assemblies with Crown Ethers and photophysical properties of a ruthenium dyad (4) and triad (5) are reported. Both biomimetic systems

  12. A Conserved Tyrosyl–Glutamyl Catalytic Dyad in Evolutionarily Linked Enzymes: Carbapenam Synthetase and ?-Lactam Synthetase

    PubMed Central

    Raber, Mary L.; Arnett, Samantha O.; Townsend, Craig A.

    2010-01-01

    ?-Lactam-synthesizing enzymes carbapenam synthetase (CPS) and ?-lactam synthetase (?-LS) are evolutionarily linked to a common ancestor, asparagine synthetase B (AS-B). These three relatives catalyze substrate acyl-adenylation and nucleophilic acyl substitution by either an external (AS-B) or internal (CPS, ?-LS) nitrogen source. Unlike AS-B, crystal structures of CPS and ?-LS revealed a putative Tyr-Glu dyad (CPS, Y345/E380; ?-LS, Y348/E382) proposed to deprotonate the respective internal nucleophile. CPS and ?-LS site-directed mutagenesis (Y345/8A, Y345/8F, E380/2D, E380/2Q, E380A) resulted in the reduction of their catalytic efficiency, with Y345A, E380A, and E382Q producing undetectable amounts of ?-lactam product. However, [32P]PPi–ATP exchange assays demonstrated Y345A and E380A undergo the first half-reaction, with the remaining active mutants showing decreased forward commitment to ?-lactam cyclization. pH–rate profiles of CPS and ?-LS supported the importance of a Tyr-Glu dyad in ?-lactam formation and suggested its reverse protonation in ?-LS. The kinetics of CPS double-site mutants reinforced the synergism of Tyr-Glu in catalysis. Furthermore, significant solvent isotope effects on kcat (Dkcat) for Y345F (1.9) and Y348F (1.7) maintained the assignment of Y345/8 in proton transfer. A proton inventory on Y348F determined its D(kcat/Km) = 0.2 to arise from multiple reactant-state fractionation factors, presumably from water molecule(s) replacing the missing Tyr hydroxyl. The role of a CPS and ?-LS Tyr-Glu catalytic dyad was solidified by a significant decrease in mutant kcat viscosity dependence with respect to the wild-type enzymes. The evolutionary relation and potential for engineered biosynthesis were demonstrated by ?-LS acting as a carbapenam synthetase. PMID:19371088

  13. Protege and Mentor Self-Disclosure: Levels and Outcomes within Formal Mentoring Dyads in a Corporate Context

    ERIC Educational Resources Information Center

    Wanberg, Connie R.; Welsh, Elizabeth T.; Kammeyer-Mueller, John

    2007-01-01

    This study examined the role of self-disclosure within protege/mentor dyads in formal mentoring partnerships within a corporate context as a means of learning more about specific relationship processes that may enhance the positive outcomes of mentoring. While both proteges and mentors self-disclosed in their relationships, proteges disclosed at a…

  14. Resemblance of dietary intakes of snacks, sweets, fruit, and vegetables among mother-child dyads from low income families

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this study was to determine the correlation between intake of snacks, sweets, fruit, vegetables, and energy in low-income mother–child dyads. This was a secondary analysis of data collected from Head Start centers in Houston, Texas, and Birmingham, Alabama. Twenty-four-hour dietary ...

  15. JUST AMONG FRIENDS: ASSOCIATIONS AMONG EMOTIONAL EXPRESSION, FRIEND BEHAVIOR, AND FRIENDSHIP QUALITY IN EARLY ADOLESCENT SAME-SEX FRIEND DYADS

    E-print Network

    Legerski, John-Paul

    2010-08-31

    To better understand emotional expression within the context of close same-sex friendships of young adolescents, this study examined emotional expressivity among 116 adolescents (58 friend dyads) in Grades 7-8 (12-14 years of age) utilizing a multi...

  16. Crystal Structure of a Bacterial Signal Peptidase Apoenzyme IMPLICATIONS FOR SIGNAL PEPTIDE BINDING AND THE SER-LYS DYAD MECHANISM*

    E-print Network

    Paetzel, Mark

    AND THE SER-LYS DYAD MECHANISM* Received for publication, November 15, 2001 Published, JBC Papers in Press is consistent with SPase utilizing an unusual oxyanion hole containing one side-chain hydroxyl hy- drogen (Ser-88 O H) and one main-chain amide hydro- gen (Ser-90 NH). Analysis of the apoenzyme active site

  17. American Indian Grand Families: Eight Adolescent and Grandparent Dyads Share Perceptions on Various Aspects of the Kinship Care Relationship

    ERIC Educational Resources Information Center

    Cross, Suzanne L.; Day, Angelique G.

    2008-01-01

    A qualitative study of eight grand family dyads was conducted to gain the perspective of the grandparents and grandchildren regarding the kinship care relationship. A phenomenological approach of the "lived experience" developed by P.A. Gibson (2002) was incorporated in the design of the study. Several major themes emerged from data analysis using…

  18. The Catalytic Histidine Dyad of High Density Lipoprotein-associated Serum Paraoxonase-1 (PON1) Is Essential for

    E-print Network

    Tawfik, Dan S.

    The Catalytic Histidine Dyad of High Density Lipoprotein- associated Serum Paraoxonase-1 (PON1) Is Essential for PON1-mediated Inhibition of Low Density Lipoprotein Oxidation and Stimulation of Macrophage)-associated paraoxonase-1 (PON1) anti-atherogenic properties in macrophages, i.e. inhibition of cell-mediated oxidation

  19. A "click-chemistry" approach for the synthesis of porphyrin dyads as sensitizers for dye-sensitized solar cells.

    PubMed

    Nikolaou, Vasilis; Angaridis, Panagiotis A; Charalambidis, Georgios; Sharma, Ganesh D; Coutsolelos, Athanassios G

    2015-01-28

    Two novel porphyrin dyads (9 and 11) consisting of two zinc-metallated porphyrin units, covalently linked at their peripheries through 1,2,3-triazole containing bridges and functionalized by a terminal carboxylic acid group, have been synthesized via "click" reactions, which are Cu-catalyzed Huisgen 1,3-dipolar cycloadditions between azide- and acetylene-containing porphyrins. Photophysical and electrochemical measurements, together with DFT calculations, showed that the two dyads possess suitable frontier orbital energy levels for use as sensitizers in DSSCs. The 9 and 11 based solar cells were fabricated resulting in power conversion efficiencies (PCEs) of 3.82 and 5.16%, respectively. As shown by photovoltaic measurements (J-V curves) and incident photon to current conversion efficiency (IPCE) spectra of the two solar cells, the higher PCE value of the latter is attributed to its enhanced photovoltaic parameters, and particularly its enhanced short circuit current (Jsc). This is related to the stronger absorption profile of the sensitizing dyad 11 (the dyad with the shorter triazole containing bridge) and the higher dye loading of the corresponding solar cell. Furthermore, electrochemical impedance spectra (EIS) demonstrated that the 11 based solar cell exhibits longer electron lifetime (?e) and more effective suppression of the recombination between the injected electrons and the electrolyte. PMID:25465056

  20. A Comparison Study of Functional Communication in Deaf vs. Hearing Mother-Child Dyads: Descriptive Analysis and Intervention Implications.

    ERIC Educational Resources Information Center

    Carmichael, Heather; Greenberg, Mark T.

    A study of 28 mother/child dyads (children aged 3 to 6) in which half the children were deaf was undertaken to compare communication skills between hearing and deaf children and the characteristics of functional communication between mothers and their children. Tapes of a half hour free play situation between mother and child were studied for each…

  1. Behavioral Autonomy Age Expectations among Mexican-Origin Mother-Daughter Dyads: An Examination of Within-Group Variability

    ERIC Educational Resources Information Center

    Bamaca-Colbert, Mayra Y.; Umana-Taylor, Adriana J.; Espinosa-Hernandez, Graciela; Brown, Ashley M.

    2012-01-01

    This study examined differences in behavioral autonomy age expectations between Mexican-origin mothers and their adolescent daughters (N = 319 dyads); variability in behavioral autonomy age expectations as a function of nativity and maternal educational attainment also was examined. Findings indicated significant differences between mothers and…

  2. Enhanced photocatalytic hydrogen production from an MCM-41-immobilized photosensitizer-[Fe-Fe] hydrogenase mimic dyad.

    PubMed

    Wang, Wen; Yu, Tianjun; Zeng, Yi; Chen, Jinping; Yang, Guoqiang; Li, Yi

    2014-11-01

    A covalently linked photosensitizer-catalytic center dyad Ps-Hy, consisting of two bis(2-phenylpyridine)(2,2'-bipyridine)iridium(iii) chromophores (Ps) and a diiron hydrogenase mimic (Hy) was constructed by using click reaction. Ps-Hy was incorporated into K(+)-exchanged molecular sieve MCM-41 to form a composite (Ps-Hy@MCM-41), which has been successfully applied to the photochemical production of hydrogen. The catalytic activity of Ps-Hy@MCM-41 is ?3-fold higher as compared with that of Ps-Hy in the absence of MCM-41. The incorporation of Ps-Hy into MCM-41 stabilizes the catalyst, and consequently, advances the photocatalysis. The present study provides a potential strategy for improving catalytic efficiency of artificial photosynthesis systems using mesoporous molecular sieves. PMID:25238441

  3. Mutual interplay of light harvesting and triplet sensitizing in a perylene bisimide antenna-fullerene dyad.

    PubMed

    Hofmann, Christiane C; Lindner, Stefan M; Ruppert, Michaela; Hirsch, Andreas; Haque, Saif A; Thelakkat, Mukundan; Köhler, Jürgen

    2010-07-22

    A flexible organic dyad consisting of a perylene bisimide antenna covalently linked to a [60]fullerene has been synthesized and studied by electrochemistry, steady-state spectroscopy, and time-resolved spectroscopy. We found that the energy absorbed by the perylene bisimide is transferred to the fullerene with an efficiency close to 100%. The fullerene in turn undergoes intersystem crossing followed by triplet energy transfer back to the perylene bisimide with an efficiency of at least 20%. Hence the perylene bisimide unit acts as an antenna for the fullerene, i.e., effectively extending the fullerene absorption far into the visible spectral range, while at the same time the fullerene acts as a triplet sensitizer for the perylene bisimide. This has severe consequences for the exploitation of the dye antenna-fullerene concept for light harvesting in solar cells. PMID:20578770

  4. Neutrality in the field: alpha-function and the dreaming dyad in psychoanalytic process.

    PubMed

    Schwartz, Henry P

    2013-07-01

    Analysts have interpreted the concept of neutrality in a variety of ways, beginning with Strachey's use of that word to translate Freud's (1915) term, Indifferenz. In this paper, neutrality is linked to Freud's notions of free association and evenly suspended attention. A history of psychoanalytic attempts to clarify the concept are presented, with special attention to issues of ambiguity and the patient's role in the determination of neutrality. Neutrality is further elaborated in relation to the bipersonal field as described by the Barangers and contemporary field theorists. Understood in terms of the field, neutrality becomes a transpersonal concept, here conceived in terms of alpha-function and a dreaming dyad. Two clinical examples cast in the light of a Bionian perspective are discussed to suggest an alternative understanding of analytic impasses and their relation to alpha-function and neutrality. PMID:23824648

  5. Preen secretions encode information on MHC similarity in certain sex-dyads in a monogamous seabird.

    PubMed

    Leclaire, Sarah; van Dongen, Wouter F D; Voccia, Steeve; Merkling, Thomas; Ducamp, Christine; Hatch, Scott A; Blanchard, Pierrick; Danchin, Etienne; Wagner, Richard H

    2014-01-01

    Animals are known to select mates to maximize the genetic diversity of their offspring in order to achieve immunity against a broader range of pathogens. Although several bird species preferentially mate with partners that are dissimilar at the major histocompatibility complex (MHC), it remains unknown whether they can use olfactory cues to assess MHC similarity with potential partners. Here we combined gas chromatography data with genetic similarity indices based on MHC to test whether similarity in preen secretion chemicals correlated with MHC relatedness in the black-legged kittiwake (Rissa tridactyla), a species that preferentially mates with genetically dissimilar partners. We found that similarity in preen secretion chemicals was positively correlated with MHC relatedness in male-male and male-female dyads. This study provides the first evidence that preen secretion chemicals can encode information on MHC relatedness and suggests that odor-based mechanisms of MHC-related mate choice may occur in birds. PMID:25370306

  6. Preen secretions encode information on MHC similarity in certain sex-dyads in a monogamous seabird

    PubMed Central

    Leclaire, Sarah; van Dongen, Wouter F. D.; Voccia, Steeve; Merkling, Thomas; Ducamp, Christine; Hatch, Scott A.; Blanchard, Pierrick; Danchin, Étienne; Wagner, Richard H.

    2014-01-01

    Animals are known to select mates to maximize the genetic diversity of their offspring in order to achieve immunity against a broader range of pathogens. Although several bird species preferentially mate with partners that are dissimilar at the major histocompatibility complex (MHC), it remains unknown whether they can use olfactory cues to assess MHC similarity with potential partners. Here we combined gas chromatography data with genetic similarity indices based on MHC to test whether similarity in preen secretion chemicals correlated with MHC relatedness in the black-legged kittiwake (Rissa tridactyla), a species that preferentially mates with genetically dissimilar partners. We found that similarity in preen secretion chemicals was positively correlated with MHC relatedness in male-male and male-female dyads. This study provides the first evidence that preen secretion chemicals can encode information on MHC relatedness and suggests that odor-based mechanisms of MHC-related mate choice may occur in birds. PMID:25370306

  7. Interactive book reading between bilingual caregiver and Head Start child

    Microsoft Academic Search

    Victoria Bishop McLaughlin

    2006-01-01

    The main purpose of this qualitative study was to explore the nature of interactions between bilingual caregiver and Head Start child during interactive book reading. The changes across time as a book became familiar and the effects of the educational level and language background of the caregiver also were examined. Four participant dyads, each with 1 caregiver and 1 child,

  8. Parental stress, parenting behavior and observed parent-child interaction

    Microsoft Academic Search

    Katrina L Adams

    2006-01-01

    This study investigated the relationship between parental stress, social support, and directly observed parenting behavior and dyadic interaction in a non-clinical sample of 26 parent-child dyads, in which the child was age five or younger. This study also explored the differential impact of various types of stress on parenting behavior and dyadic interaction, including life stress as measured by the

  9. Interactions between Turkish Mothers and Preschool Children with Autism

    ERIC Educational Resources Information Center

    Diken, Ozlem; Mahoney, Gerald

    2013-01-01

    This study explored the relationship between Turkish mothers' style of interaction and the engagement of their preschool-aged children with autism. Data were collected from fifty mother-child dyads in which all children had diagnoses of autism. Video recordings of mother-child interaction were analyzed using the Turkish versions of the…

  10. Incidental Noticing and EFL Students’ Subsequent Second Language Learning in Synchronous Text-based Discussion: An Investigation of Both NES-NNES and NNES-NNES Dyads

    E-print Network

    Kung, Wan-Tsai

    2010-10-12

    the two dyadic types, and (2) no significant differences were found between learners of different proficiency levels within and across both NES-NNS and NNES-NNES dyads. Logistic regression analyses revealed that five LRE characteristics (type, source...

  11. Development of Unsymmetrical Dyads As Potent Noncarbohydrate-Based Inhibitors against Human ?-N-Acetyl-d-hexosaminidase

    PubMed Central

    2013-01-01

    Human ?-N-acetyl-d-hexosaminidase has gained much attention due to its roles in several pathological processes and been considered as potential targets for disease therapy. A novel and efficient skeleton, which was an unsymmetrical dyad containing naphthalimide and methoxyphenyl moieties with an alkylamine spacer linkage as a noncarbohydrate-based inhibitor, was synthesized, and the activities were valuated against human ?-N-acetyl-d-hexosaminidase. The most potent inhibitor exhibits high inhibitory activity with Ki values of 0.63 ?M. The straightforward synthetic manners of these unsymmetrical dyads and understanding of the binding model could be advantageous for further structure optimization and development of new therapeutic agents for Hex-related diseases. PMID:24900704

  12. Pyrene-based dyad and triad leading to a reversible chemical and redox optical and magnetic switch.

    PubMed

    Franco, Carlos; Mas-Torrent, Marta; Caballero, Antonio; Espinosa, Arturo; Molina, Pedro; Veciana, Jaume; Rovira, Concepció

    2015-03-27

    Two new pyrene-polychlorotriphenylmethyl (PTM) dyads and triads have been synthesized and characterized by optical, magnetic, and electrochemical methods. The interplay between the different electronic states of the PTM moiety in the dyads and triads and the optical and magnetic properties of the molecules have been studied. The electronic spectra of the radicals 5(.) and 6(.) show the intramolecular charge-transfer transition at around 700?nm due to the acceptor character of the PTM radical. In the diamagnetic protonated derivatives 3 and 4 the fluorescence due to the pyrene is maintained, whereas in the radicals 5(.) and 6(.) and the corresponding anions 5(-) and 6(-) there is a clear quenching of the fluorescence, which is more efficient in the case of radicals. The redox activity of PTM radicals that are easily reduced to the corresponding carbanion has been exploited to fabricate electrochemical switches with optical and magnetic response. PMID:25694181

  13. Joint attention in parent-child dyads involving children with selective mutism: a comparison between anxious and typically developing children.

    PubMed

    Nowakowski, Matilda E; Tasker, Susan L; Cunningham, Charles E; McHolm, Angela E; Edison, Shannon; Pierre, Jeff St; Boyle, Michael H; Schmidt, Louis A

    2011-02-01

    Although joint attention processes are known to play an important role in adaptive social behavior in typical development, we know little about these processes in clinical child populations. We compared early school age children with selective mutism (SM; n = 19) versus mixed anxiety (MA; n = 18) and community controls (CC; n = 26) on joint attention measures coded from direct observations with their parent during an unstructured free play task and two structured tasks. As predicted, the SM dyads established significantly fewer episodes of joint attention through parental initiation acts than the MA and CC dyads during the structured tasks. Findings suggest that children with SM may withdraw from their parents during stressful situations, thus missing out on opportunities for learning other coping skills. We discuss the implications of the present findings for understanding the maintenance and treatment of SM. PMID:20960051

  14. Nonverbal synchrony and affect in dyadic interactions

    PubMed Central

    Tschacher, Wolfgang; Rees, Georg M.; Ramseyer, Fabian

    2014-01-01

    In an experiment on dyadic social interaction, we invited participants to verbal interactions in cooperative, competitive, and ‘fun task’ conditions. We focused on the link between interactants’ affectivity and their nonverbal synchrony, and explored which further variables contributed to affectivity: interactants’ personality traits, sex, and the prescribed interaction tasks. Nonverbal synchrony was quantified by the coordination of interactants’ body movement, using an automated video-analysis algorithm (motion energy analysis). Traits were assessed with standard questionnaires of personality, attachment, interactional style, psychopathology, and interpersonal reactivity. We included 168 previously unacquainted individuals who were randomly allocated to same-sex dyads (84 females, 84 males, mean age 27.8 years). Dyads discussed four topics of general interest drawn from an urn of eight topics, and finally engaged in a fun interaction. Each interaction lasted 5 min. In between interactions, participants repeatedly assessed their affect. Using hierarchical linear modeling, we found moderate to strong effect sizes for synchrony to occur, especially in competitive and fun task conditions. Positive affect was associated positively with synchrony, negative affect was associated negatively. As for causal direction, data supported the interpretation that synchrony entailed affect rather than vice versa. The link between nonverbal synchrony and affect was strongest in female dyads. The findings extend previous reports of synchrony and mimicry associated with emotion in relationships and suggest a possible mechanism of the synchrony-affect correlation. PMID:25505435

  15. High-potential perfluorinated phthalocyanine-fullerene dyads for generation of high-energy charge-separated states: formation and photoinduced electron-transfer studies.

    PubMed

    Das, Sushanta K; Mahler, Andrew; Wilson, Angela K; D'Souza, Francis

    2014-08-25

    High oxidation potential perfluorinated zinc phthalocyanines (ZnF(n)Pcs) are synthesised and their spectroscopic, redox, and light-induced electron-transfer properties investigated systematically by forming donor-acceptor dyads through metal-ligand axial coordination of fullerene (C60) derivatives. Absorption and fluorescence spectral studies reveal efficient binding of the pyridine- (Py) and phenylimidazole-functionalised fullerene (C60Im) derivatives to the zinc centre of the F(n)Pcs. The determined binding constants, K, in o-dichlorobenzene for the 1:1 complexes are in the order of 10(4) to 10(5) M(-1); nearly an order of magnitude higher than that observed for the dyad formed from zinc phthalocyanine (ZnPc) lacking fluorine substituents. The geometry and electronic structure of the dyads are determined by using the B3LYP/6-31G* method. The HOMO and LUMO levels are located on the Pc and C60 entities, respectively; this suggests the formation of ZnF(n)Pc(.+)-C60Im(.-) and ZnF(n)Pc(.+)-C60Py(.-) (n=0, 8 or 16) intra-supramolecular charge-separated states during electron transfer. Electrochemical studies on the ZnPc-C60 dyads enable accurate determination of their oxidation and reduction potentials and the energy of the charge-separated states. The energy of the charge-separated state for dyads composed of ZnF(n)Pc is higher than that of normal ZnPc-C60 dyads and reveals their significance in harvesting higher amounts of light energy. Evidence for charge separation in the dyads is secured from femtosecond transient absorption studies in nonpolar toluene. Kinetic evaluation of the cation and anion radical ion peaks reveals ultrafast charge separation and charge recombination in dyads composed of perfluorinated phthalocyanine and fullerene; this implies their significance in solar-energy harvesting and optoelectronic device building applications. PMID:24850373

  16. Mealtime Television Viewing and Dietary Quality in Low-Income African American and Caucasian Mother–Toddler Dyads

    Microsoft Academic Search

    Mildred A. Horodynski; Manfred Stommel; Holly E. Brophy-Herb; Lorraine Weatherspoon

    2010-01-01

    To examine maternal demographic characteristics and depressive symptoms as predictors of TV viewing during mealtimes, and\\u000a to investigate how mealtime TV viewing predicts mothers’ and toddlers’ food consumption. A prospective, cross-sectional survey\\u000a design was employed with 199 African American and 200 Caucasian, low-income, mother–toddler dyads enrolled in eight Early\\u000a Head Start programs in a Midwestern state. Mothers completed the Toddler–Parent

  17. Latina Mother–Daughter Dyads: Relations Between Attachment and Sexual Behavior Under the Influence of Alcohol or Drugs

    Microsoft Academic Search

    Mario De La Rosa; Frank R. Dillon; Patria Rojas; Seth J. Schwartz; Rui Duan

    2010-01-01

    Associations among mother–daughter attachment, mother and daughter substance abuse, and daughter’s sexual behavior under the\\u000a influence of drugs and alcohol were investigated among 158 adult U.S. Latina daughters. Latina daughters were sampled from\\u000a four mother–daughter dyad types: substance abusing mother and daughter, substance abusing mother only, substance abusing daughter\\u000a only, and non-substance-abusing mother and daughter. Substance abusing daughters with substance

  18. Structural and Kinetic Analysis of Bacillus subtilis N-Acetylglucosaminidase Reveals a Unique Asp-His Dyad Mechanism*

    PubMed Central

    Litzinger, Silke; Fischer, Stefanie; Polzer, Patrick; Diederichs, Kay; Welte, Wolfram; Mayer, Christoph

    2010-01-01

    Three-dimensional structures of NagZ of Bacillus subtilis, the first structures of a two-domain ?-N-acetylglucosaminidase of family 3 of glycosidases, were determined with and without the transition state mimicking inhibitor PUGNAc bound to the active site, at 1.84- and 1.40-? resolution, respectively. The structures together with kinetic analyses of mutants revealed an Asp-His dyad involved in catalysis: His234 of BsNagZ acts as general acid/base catalyst and is hydrogen bonded by Asp232 for proper function. Replacement of both His234 and Asp232 with glycine reduced the rate of hydrolysis of the fluorogenic substrate 4?-methylumbelliferyl N-acetyl-?-d-glucosaminide 1900- and 4500-fold, respectively, and rendered activity pH-independent in the alkaline range consistent with a role of these residues in acid/base catalysis. N-Acetylglucosaminyl enzyme intermediate accumulated in the H234G mutant and ?-azide product was formed in the presence of sodium azide in both mutants. The Asp-His dyad is conserved within ?-N-acetylglucosaminidases but otherwise absent in ?-glycosidases of family 3, which instead carry a “classical” glutamate acid/base catalyst. The acid/base glutamate of Hordeum vulgare exoglucanase (Exo1) superimposes with His234 of the dyad of BsNagZ and, in contrast to the latter, protrudes from a second domain of the enzyme into the active site. This is the first report of an Asp-His catalytic dyad involved in hydrolysis of glycosides resembling in function the Asp-His-Ser triad of serine proteases. Our findings will facilitate the development of mechanism-based inhibitors that selectively target family 3 ?-N-acetylglucosaminidases, which are involved in bacterial cell wall turnover, spore germination, and induction of ?-lactamase. PMID:20826810

  19. DiiodoBodipy-Rhodamine Dyads: Preparation and Study of the Acid-Activatable Competing Intersystem Crossing and Energy Transfer Processes.

    PubMed

    Xu, Kejing; Xie, Yun; Cui, Xiaoneng; Zhao, Jianzhang; Glusac, Ksenija D

    2015-03-19

    Iodo-bodipy/rhodamine dyads with cyanuric chloride linker were prepared with the goal of achieving pH switching of the triplet excited state formation. The pH switching takes advantage of the acid-activated reversible cyclic lactam?opened amide transformation of the rhodamine unit and the fluorescence resonance energy transfer (FRET). The photophysical properties of the dyads were studied with steady-state and femtosecond/nanosecond time-resolved transient absorption spectroscopies, electrochemical methods, as well as TD-DFT calculations. Our results show that the model dyad is an efficient triplet state generator under neutral condition, when the rhodamine unit adopts the closed form. The triplet generation occurs at the iodo-bodipy moiety and the triplet state is long-lived, with a lifetime of 51.7 ?s. In the presence of the acid, the rhodamine unit adopts an opened amide form, and in this case, the efficient FRET occurs from iodo-bodipy to the rhodamine moiety. The FRET is much faster (?FRET = 81 ps) than the intersystem crossing of iodo-bodipy (?ISC = 178 ps), thus suppressing the triplet generation is assumed. However, we found that the additional energy transfer occurs at the longer timescale, which eventually converts the rhodamine-based S1 state to the T1 state localized on the iodo-bodipy unit. PMID:25699638

  20. A Culturally Appropriate Intervention To Improve Health Behaviors in Hispanic Mother–Child Dyads

    PubMed Central

    Nader, Philip R.; Kennedy, Christine; Gahagan, Sheila

    2013-01-01

    Abstract Background Obesity interventions targeting Hispanic preschool children are still nascent, and few are culturally appropriate. We evaluated the feasibility of a culturally relevant 9-month intervention program to improve health behaviors in low-income Mexican mothers with 3- to 5-year-old children. Methods A community engagement approach was used to culturally and linguistically tailor an intervention program that was pilot tested with 33 mother–child dyads enrolled from a large California urban health center. A one-group, pretest–posttest design assessed changes in children's consumption of sugar-sweetened beverages (SSB), mothers' pedometer steps, and BMI. Data were collected at baseline, postintervention and at 6 months postintervention. Results At postintervention, SSB consumption had significantly decreased for soda and other sugary drinks with a modest reduction for 100% juice. Consumption of water had significantly increased, whereas milk had an increased trend. Maternal step counts significantly increased for weekdays by 69% and weekend days by 49%. Overall, maternal BMI decreased while children's BMI% remained stable. At 6 months postintervention, children's soda and juice consumption reverted toward baseline levels, as did maternal step counts, but children's consumption of sugary drinks remained lower, while water and milk remained higher. Conclusions Findings suggest that a culturally relevant intervention was feasible for improving target health behaviors in a low-income Mexican community. Future work should assess an enhanced intervention including a maintenance phase for long-term adherence to health behavior changes and influence on maternal and child BMI. PMID:23514697

  1. Crystal Structure of a Novel Viral Protease with a Serine/Lysine Catalytic Dyad Mechanism

    SciTech Connect

    Feldman,A.; Lee, J.; Delmas, B.; Paetzel, M.

    2006-01-01

    The blotched snakehead virus (BSNV), an aquatic birnavirus, encodes a polyprotein (NH2-pVP2-X-VP4-VP3-COOH) that is processed through the proteolytic activity of its own protease (VP4) to liberate itself and the viral proteins pVP2, X and VP3. The protein pVP2 is further processed by VP4 to give rise to the capsid protein VP2 and four structural peptides. We report here the crystal structure of a VP4 protease from BSNV, which displays a catalytic serine/lysine dyad in its active site. This is the first crystal structure of a birnavirus protease and the first crystal structure of a viral protease that utilizes a lysine general base in its catalytic mechanism. The topology of the VP4 substrate binding site is consistent with the enzymes substrate specificity and a nucleophilic attack from the si-face of the substrates scissile bond. Despite low levels of sequence identity, VP4 shows similarities in its active site to other characterized Ser/Lys proteases such as signal peptidase, LexA protease and Lon protease. Together, the structure of VP4 provides insights into the mechanism of a recently characterized clan of serine proteases that utilize a lysine general base and reveals the structure of potential targets for antiviral therapy, especially for other related and economically important viruses, such as infectious bursal disease virus in poultry and infectious pancreatic necrosis virus in aquaculture.

  2. Surrogate utility estimation by long-term partners and unfamiliar dyads

    PubMed Central

    Tunney, Richard J.; Ziegler, Fenja V.

    2015-01-01

    To what extent are people able to make predictions about other people's preferences and values?We report two experiments that present a novel method assessing some of the basic processes in surrogate decision-making, namely surrogate-utility estimation. In each experiment participants formed dyads who were asked to assign utilities to health related items and commodity items, and to predict their partner's utility judgments for the same items. In experiment one we showed that older adults in long-term relationships were able to accurately predict their partner's wishes. In experiment two we showed that younger adults who were relatively unfamiliar with one another were also able to predict other people's wishes. Crucially we demonstrated that these judgments were accurate even after partialling out each participant's own preferences indicating that in order to make surrogate utility estimations people engage in perspective-taking rather than simple anchoring and adjustment, suggesting that utility estimation is not the cause of inaccuracy in surrogate decision-making. The data and implications are discussed with respect to theories of surrogate decision-making.

  3. Turkish Mothers' Self-Efficacy Beliefs and Styles of Interactions with Their Children with Language Delays

    ERIC Educational Resources Information Center

    Diken, Ibrahim H.

    2009-01-01

    Turkish mothers' self-efficacy beliefs and their interactional behaviors with their children with language delays are described and explored. Participants included 19 mother-child dyads. Mothers' interaction with their children with language delays was videotaped for 30 minutes in a free-play context. Regarding mothers' interactional behaviors,…

  4. Interactive Behaviors of Ethnic Minority Mothers and their Premature Infants

    PubMed Central

    Brooks, Jada L.; Holditch-Davis, Diane; Landerman, Lawrence R.

    2013-01-01

    Objective To compare the interactive behaviors of American Indian mothers and their premature infants with those of African American mothers and their premature infants. Design Descriptive, comparative study. Setting Three neonatal intensive care units and two pediatric clinics in the southeast. Participants Seventy-seven mother-infant dyads: 17 American Indian mother-infant dyads and 60 African American mother-infant dyads. Methods Videotapes of mother-infant interactions and the Home Observation for Measurement of the Environment (HOME) were used to assess the interactions of the mothers and their premature infants at six months corrected age. Results American Indian mothers looked more, gestured more, and were more often the primary caregivers to their infants than the African American mothers. American Indian infants expressed more positive affect and gestured more to their mothers, whereas African American infants engaged in more non-negative vocalization toward their mothers. African American mothers scored higher on the HOME subscales of provision of appropriate play materials and parental involvement with the infant. American Indian mothers scored higher on the opportunities for variety in daily living subscale. Conclusion Although many of the interactive behaviors of American Indian and African American mother-infant dyads were similar, some differences did occur. Clinicians need to be aware of the cultural differences in mother-infant interactions. To optimize child developmental outcomes, nurses need to support mothers in their continuation or adoption of positive interactive behaviors. PMID:23682698

  5. Knowing your audience affects male-male interactions in Siamese fighting fish (Betta splendens).

    PubMed

    Bertucci, Frédéric; Matos, Ricardo J; Dabelsteen, Torben

    2014-03-01

    Aggressive interactions between animals often occur in the presence of third parties. By observing aggressive signalling interactions, bystanders may eavesdrop and gain relevant information about conspecifics without the costs of interacting. On the other hand, interactants may also adjust their behaviour when an audience is present. This study aimed to test how knowledge about fighting ability of an audience affects aggressive interactions in male Siamese fighting fish. Subjects were positioned between two dyads of non-interacting males and allowed to observe both dyads shortly before the view to one of the dyads was blocked, and the dyads were allowed to interact. Subjects were subsequently exposed to an unknown opponent in the presence of either the winner or the loser of the seen or unseen interaction. The results suggest a complex role of the characteristic of an audience in the agonistic behaviours of a subject engaged in an interaction. The presence of a seen audience elicited more aggressive displays towards the opponent if the audience was a loser. This response was different in the presence of an unseen audience. Subjects then directed a higher aggressiveness against their opponent if the audience was a winner. These results also suggest a potentially more complex and interesting process allowing individuals to gain information about the quality and threat level of an unknown audience while it is interacting with a third party. The importance of information acquisition for an individual to adapt its behaviour and the role of communication networks in shaping social interactions are discussed. PMID:23794074

  6. Maternal-child dyads of functioning: the intergenerational impact of violence against women on children.

    PubMed

    McFarlane, Judith; Symes, Lene; Binder, Brenda K; Maddoux, John; Paulson, Rene

    2014-11-01

    Violence against women is a global epidemic with potential consequences of injury, illness, and death. Children exposed to the violence may also be impacted with functional impairments. Little is known of the inter-generational impact of violence experienced by the mother from an intimate partner on functioning of her children. No dyad analysis was found in the literature. To examine the inter-generational impact of violence against women on the behavioral functioning of children, 300 mothers reporting intimate partner abuse and one randomly chosen child, age 18 months to 16 years of age; were evaluated for borderline and clinical diagnostic levels of problem behaviors. Linear, Logistic, and Ordinal regression models were applied. Mothers' problem behavior scores were significantly related to children's problem behavior scores (internalizing r = 0.611, externalizing r = 0.494, total problems r = 0.662, all ps < 0.001). Mothers who reported clinical and borderline clinical internalized problems (i.e., depression, anxiety) were 7 times more likely to have children with the same problems and mothers with borderline clinical and clinical external problems (i.e., aggression, hostility) were 4.5 times more likely to have children with the same external problems. These dyadic analyses provide evidence of a direct relationship of maternal functioning on child behavioral functioning. Intervention strategies to decrease internalizing maternal behavioral problems, such as depression, anxiety, and post traumatic stress disorder, and/or externalizing problems, such as hostility and aggression, can be expected to have a pass through, secondary impact on the behavioral functioning of children. Awareness of the relationship between intimate partner violence against mothers and child behavioral function can support interventions that decrease the distress experienced by mothers and their children, interrupt intergenerational transmission of abusive behaviors, and promote better maternal child functioning. PMID:24740718

  7. Dyadic interracial interactions: a meta-analysis.

    PubMed

    Toosi, Negin R; Babbitt, Laura G; Ambady, Nalini; Sommers, Samuel R

    2012-01-01

    This meta-analysis examined over 40 years of research on interracial interactions by exploring 4 types of outcomes: explicit attitudes toward interaction partners, participants' self-reports of their own emotional state, nonverbal or observed behavior, and objective measures of performance. Data were collected from 108 samples (N = 12,463) comparing dyadic interracial and same-race interactions, predominantly featuring Black and White Americans. Effect sizes were small: Participants in same-race dyads tended to express marginally more positive attitudes about their partners (r = .07), reported feeling less negative affect (r = .10), showed more friendly nonverbal behavior (r = .09), and scored higher on performance measures (r = .07) than those in interracial dyads. Effect sizes also showed substantial heterogeneity, and further analyses indicated that intersectional, contextual, and relational factors moderated these outcomes. For example, when members of a dyad were the same sex, differences between interracial and same-race dyads in negative affect were reduced. Structured interactions led to more egalitarian performance outcomes than did free-form interactions, but the effects of interaction structure on nonverbal behavior depended on participant gender. Furthermore, benefits of intergroup contact were apparent: Differences in emotional state across dyadic racial composition disappeared in longer term interactions, and racial minorities, who often have greater experience with intergroup contact, experienced less negative affect in interracial interactions than did majority group members. Finally, there was a significant historical trend toward more egalitarian outcomes across dyadic racial composition for explicit attitudes and for nonverbal behavior; however, participants' emotional responses and performance have remained consistent. PMID:22061690

  8. Adolescents' Interactions with a Best Friend: Associations with Attachment Style

    ERIC Educational Resources Information Center

    Weimer, Barbara L.; Kerns, Kathryn A.; Oldenburg, Christopher M.

    2004-01-01

    This study tested whether adolescents' attachment style is related to friendship interactions and perceptions of friendship quality. Attachment pairings were contrasted to examine whether dyad members' security of attachment or their models of others was more related to friendship. A total of 44 pairs of same-sex adolescent friends were videotaped…

  9. Predictability of Observed Mother-Child Interaction from Preschool to Middle Childhood in a High-Risk Sample.

    ERIC Educational Resources Information Center

    Weinfield, Nancy S.; Ogawa, John R.; Egeland, Byron

    2002-01-01

    Examined predictability of observed parent-child interaction from preschool to middle childhood among 283 mother-child dyads who were welfare recipients enrolled in a job training program. Found that interaction in middle childhood could be predicted from observed interaction 4 years earlier. Families with greater risk factors tended to show more…

  10. The Association between Parental Interaction Style and Children's Joint Engagement in Families with Toddlers with Autism

    ERIC Educational Resources Information Center

    Patterson, Stephanie Y.; Elder, Lauren; Gulsrud, Amanda; Kasari, Connie

    2014-01-01

    Purpose: This study examines the relationship between parental interaction style (responsive vs directive) and child-initiated joint engagement within caregiver-child interactions with toddlers diagnosed with autism spectrum disorders. Method: Videotaped interactions of 85 toddler-caregiver dyads were coded for child engagement and both parental…

  11. Candidate gene analysis of spontaneous preterm delivery: New insights from re-analysis of a case-control study using case-parent triads and control-mother dyads

    PubMed Central

    2011-01-01

    Background Spontaneous preterm delivery (PTD) has a multifactorial etiology with evidence of a genetic contribution to its pathogenesis. A number of candidate gene case-control studies have been performed on spontaneous PTD, but the results have been inconsistent, and do not fully assess the role of how two genotypes can impact outcome. To elucidate this latter point we re-analyzed data from a previously published case-control candidate gene study, using a case-parent triad design and a hybrid design combining case-parent triads and control-mother dyads. These methods offer a robust approach to genetic association studies for PTD compared to traditional case-control designs. Methods The study participants were obtained from the Norwegian Mother and Child Cohort Study (MoBa). A total of 196 case triads and 211 control dyads were selected for the analysis. A case-parent triad design as well as a hybrid design was used to analyze 1,326 SNPs from 159 candidate genes. We compared our results to those from a previous case-control study on the same samples. Haplotypes were analyzed using a sliding window of three SNPs and a pathway analysis was performed to gain biological insight into the pathophysiology of preterm delivery. Results The most consistent significant fetal gene across all analyses was COL5A2. The functionally similar COL5A1 was significant when combining fetal and maternal genotypes. PON1 was significant with analytical approaches for single locus association of fetal genes alone, but was possibly confounded by maternal effects. Focal adhesion (hsa04510), Cell Communication (hsa01430) and ECM receptor interaction (hsa04512) were the most constant significant pathways. Conclusion This study suggests a fetal association of COL5A2 and a combined fetal-maternal association of COL5A1 with spontaneous PTD. In addition, the pathway analysis implied interactions of genes affecting cell communication and extracellular matrix. PMID:22208904

  12. A Longitudinal Examination of the Associations between Fathers' and Children's Attributions and Negative Interactions

    Microsoft Academic Search

    Carol MacKinnon-Lewis; Domini R. Castellino; Gene H. Brody; Frank D. Fincham

    2001-01-01

    The present investigation examined the concurrent and longitudinal relations between attributions and negative behavioral interactions in the context of the father-child dyad. Participants were 177 fathers and their young adolescents recruited from non- metropolitan counties in the southeast. Results indicated that for children, attributions about their father play a significant role in their negative behavioral interactions with their father both

  13. Non-Native Speaker Interaction Management Strategies in a Network-Based Virtual Environment

    ERIC Educational Resources Information Center

    Peterson, Mark

    2008-01-01

    This article investigates the dyad-based communication of two groups of non-native speakers (NNSs) of English involved in real time interaction in a type of text-based computer-mediated communication (CMC) tool known as a MOO. The object of this semester long study was to examine the ways in which the subjects managed their L2 interaction during…

  14. Effects of Parental Interaction on Infant Vocalization Rate, Variability and Vocal Type

    ERIC Educational Resources Information Center

    Franklin, Beau; Warlaumont, Anne S.; Messinger, Daniel; Bene, Edina; Iyer, Suneeti Nathani; Lee, Chia-Chang; Lambert, Brittany; Oller, D. Kimbrough

    2014-01-01

    Examination of infant vocalization patterns across interactive and noninteractive contexts may facilitate better understanding of early communication development. In the current study, with 24 infant-parent dyads, infant volubility increased significantly when parent interaction ceased (presenting a "still face," or SF) after a period of…

  15. Parent Cognitions and Parent-Infant Interaction: The Relationship with Development in the First 12 Months

    ERIC Educational Resources Information Center

    Ferrier-Lynn, Melissa; Skouteris, Helen

    2008-01-01

    This study examined parent cognitions and parent-infant interaction in terms of their contribution to infant development in the first 12 months. With a sample of 95 mother-infant dyads, results using structural equation modelling confirmed the expected finding that parent-infant interaction mediates the association between parent cognitions and…

  16. Synthesis, electrochemistry, and photophysical properties of a series of luminescent pyrene-thiophene dyads and the corresponding Co2(CO)6 complexes.

    PubMed

    Coleman, Anthony; Pryce, Mary T

    2008-12-01

    A series of pyrene based dyad systems together with their dicobalt hexacarbonyl complexes (1b-6b) were synthesized. The pyrene-thiophene dyads are luminescent in room temperature solution with luminescence lifetimes on the nanosecond time scale. At room temperature the dyad emission is quenched by coordination to a Co(2)(CO)(6) moiety via an acetylene bridge. However, at 77 K this emission is not fully quenched following complexation. Electrochemical studies suggest that an intraligand state is responsible for the emission. Photochemical studies in the presence of PPh(3) indicate that CO loss occurs following broadband irradiation with lambda(exc) > 400 nm, resulting in the formation of both -pentacarbonyl and -tetracarbonyl photoproducts. PMID:18959383

  17. Photophysical properties of new bis-perylene dyads for potential upconversion use

    NASA Astrophysics Data System (ADS)

    Ribas, Marcos R.; Steer, Ronald P.; Rüther, Ricardo

    2014-06-01

    Two new bis-perylenes, BPC with a meta-disubstituted benzene linker, and BPD with a p,p?-disubstituted biphenyl linker, have been synthesized and their photophysical parameters measured. Their singlet and triplet energies decrease incrementally in the order perylene, BPC, BPD, making them ideally matched with C60 for triplet-triplet energy transfer in sensitized photon upconversion schemes. Following photosensitization by triplet C60, BPC exhibits strong fluorescence upconversion by triplet-triplet annihilation, indicating that these bis-perylene dyads (and the multimers that can be constructed from them) will be interesting candidates for use in organic devices such as bulk-heterojunction and dye-sensitized solar cells employing non-coherent photon upconversion. Excitation of C60 at 532 nm will produce its long-lived lowest triplet state with near unit quantum efficiency under the conditions of this experiment [33]. The thermal energy loss usually associated with triplet-triplet energy transfer, Eq. (2), is minimal in this system as the triplet energies of the donor and acceptor are nearly identical at ca. 1.5 eV. In the absence of self-quenching of the fluorescing singlet state, increasing the relative concentrations of acceptor to donor can raise the overall efficiency of the sensitization process to nearly 100%, even if their triplet energies are the same, due to entropic assistance [34]. This was confirmed by measuring the upconversion intensity as a function of dyad concentration at constant absorbed power (Supplementary Information), and by transient absorption measurements of C60 (T1) at 740 nm (Supplementary Information). The latter show that C60(T1) decays with a lifetime on the order of 400 ns for equimolar C60 + BPC concentrations, i.e. at a rate at least 100 times faster (due to quenching by energy transfer) than it would decay in the absence of the BPC triplet energy acceptor. Note also that the dimers with their slightly lower triplet energies are expected to exhibit greater net C60 donor to acceptor triplet energy transfer efficiencies than perylene itself [23], albeit with a slight incremental thermal energy loss of ca. 0.05-0.10 eV. The lifetime of the BPC triplet could not be measured by transient absorption because of its weak absorption cross-section in the probe wavelength region. Nevertheless, the unquenched lifetime of the BPC triplet is expected to be long. The lifetime of the triplet of perylene itself is ca. 5 ms in fluid degassed solution at room temperature [22], and mono- or di-substitution of the perylene ring system with light-atom substituents does not produce an order-of-magnitude decrease in this value [35]. The measured first order rate constant in this case would, however, be the sum of all first order and pseudo-first order processes, with the latter dominating the overall triplet decay rate under the experimental conditions employed. Using anthanthrene or bis-tetracene as a reasonable model [18,23], the lifetime of BPC(T1) is likely to be about two orders of magnitude shorter than its unquenched lifetime under the conditions of these experiments, i.e. of the order of a few tens of ?s, consistent with the generally first order decay found at the low to moderate laser excitation power density range shown in Figure 3. Again using well-known upconverters as models [15,22,23], the rate constant for TTA of BPC is likely to approach within a factor of 2 or 3 of the diffusion-controlled limit (1.1 × 1010 M-1 s-1), spin statistical limitations notwithstanding, as described by Schmidt et al. [36]. The rate constants for the relaxation of the product S1 state of TTA in the bis-perylenes are provided in Table 1. In an upconverting solar photovoltaic cell, the thermal energy losses in excess of those associated with the Shockley-Queisser limit will be small in this system. Using the zero point energies of the electronic excited states involved in the absorption, sensitization and upconversion steps as reference data, the S1-T1 thermal energy loss in the C60 absorber is 0.20 eV per absorbed p

  18. Computational Insights into Substrate and Site Specificities, Catalytic Mechanism, and Protonation States of the Catalytic Asp Dyad of ? -Secretase.

    PubMed

    Barman, Arghya; Prabhakar, Rajeev

    2014-01-01

    In this review, information regarding substrate and site specificities, catalytic mechanism, and protonation states of the catalytic Asp dyad of ?-secretase (BACE1) derived from computational studies has been discussed. BACE1 catalyzes the rate-limiting step in the generation of Alzheimer amyloid beta peptide through the proteolytic cleavage of the amyloid precursor protein. Due to its biological functioning, this enzyme has been considered as one of the most important targets for finding the cure for Alzheimer's disease. Molecular dynamics (MD) simulations suggested that structural differences in the key regions (inserts A, D, and F and the 10s loop) of the enzyme are responsible for the observed difference in its activities towards the WT- and SW-substrates. The modifications in the flap, third strand, and insert F regions were found to be involved in the alteration in the site specificity of the glycosylphosphatidylinositol bound form of BACE1. Our QM and QM/MM calculations suggested that BACE1 hydrolyzed the SW-substrate more efficiently than the WT-substrate and that cleavage of the peptide bond occurred in the rate-determining step. The results from molecular docking studies showed that the information concerning a single protonation state of the Asp dyad is not enough to run an in silico screening campaign. PMID:25309776

  19. Perylenediimide-based donor-acceptor dyads and triads: impact of molecular architecture on self-assembling properties.

    PubMed

    Schwartz, Pierre-Olivier; Biniek, Laure; Zaborova, Elena; Heinrich, Benoît; Brinkmann, Martin; Leclerc, Nicolas; Méry, Stéphane

    2014-04-23

    Perylenediimide-based donor-acceptor co-oligomers are particularly attractive in plastic electronics because of their unique electro-active properties that can be tuned by proper chemical engineering. Herein, a new class of co-oligomers has been synthesized with a dyad structure (AD) or a triad structure (DAD and ADA) in order to understand the correlations between the co-oligomer molecular architecture and the structures formed by self-assembly in thin films. The acceptor block A is a perylene tetracarboxyl diimide (PDI), whereas the donor block D is made of a combination of thiophene, fluorene, and 2,1,3-benzothiadiazole derivatives. D and A blocks are linked by a short and flexible ethylene spacer to ease self-assembling in thin films. Structural studies using small and wide X-ray diffraction and transmission electron microscopy demonstrate that AD and ADA lamellae are made of a double layer of co-oligomers with overlapping and strongly ?-stacked PDI units because the sectional area of the PDI is about half that of the donor block. These structural models allow rationalizing the absence of organization for the DAD co-oligomer and therefore to draw general rules for the design of PDI-based dyads and triads with proper self-assembling properties of use in organic electronics. PMID:24669830

  20. Computational Insights into Substrate and Site Specificities, Catalytic Mechanism, and Protonation States of the Catalytic Asp Dyad of ?-Secretase

    PubMed Central

    Barman, Arghya; Prabhakar, Rajeev

    2014-01-01

    In this review, information regarding substrate and site specificities, catalytic mechanism, and protonation states of the catalytic Asp dyad of ?-secretase (BACE1) derived from computational studies has been discussed. BACE1 catalyzes the rate-limiting step in the generation of Alzheimer amyloid beta peptide through the proteolytic cleavage of the amyloid precursor protein. Due to its biological functioning, this enzyme has been considered as one of the most important targets for finding the cure for Alzheimer's disease. Molecular dynamics (MD) simulations suggested that structural differences in the key regions (inserts A, D, and F and the 10s loop) of the enzyme are responsible for the observed difference in its activities towards the WT- and SW-substrates. The modifications in the flap, third strand, and insert F regions were found to be involved in the alteration in the site specificity of the glycosylphosphatidylinositol bound form of BACE1. Our QM and QM/MM calculations suggested that BACE1 hydrolyzed the SW-substrate more efficiently than the WT-substrate and that cleavage of the peptide bond occurred in the rate-determining step. The results from molecular docking studies showed that the information concerning a single protonation state of the Asp dyad is not enough to run an in silico screening campaign. PMID:25309776

  1. The importance of ethnic similarity in the therapist-patient dyad among Surinamese migrants in Dutch mental health care.

    PubMed

    Knipscheer, Jeroen W; Kleber, Rolf J

    2004-06-01

    Empirical evidence is equivocal on whether ethnic matching in the therapist-patient dyad is preferred by ethnic minority patients and whether it leads to treatment satisfaction. The aim of this study was to establish the importance of ethnic similarity in mental health care among Surinamese migrants in the Netherlands. A convenience sample of Surinamese out-patients in community mental health care (N = 96) was interviewed. Data were analysed using logistic multivariate techniques. The majority of the Surinamese out-patients (in particular recently residing participants) rated ethnic matching as relevant; a considerable minority considered compassion and expertise to be more relevant than ethnic background. Most out-patients reported to be satisfied with the services, especially females and respondents treated by an ethnically similar therapist. Ethnic similarity in the patient-therapist dyad is a strong predictor for satisfaction with mental health care services. However, although it is preferred by many, ethnic matching per se is no must - empathy, expertise and world view sharing are reported to be of considerable importance as well. PMID:15193197

  2. Evidence for substrate binding-induced zwitterion formation in the catalytic Cys-His dyad of the SARS-CoV main protease.

    PubMed

    Paasche, Alexander; Zipper, Andreas; Schäfer, Simon; Ziebuhr, John; Schirmeister, Tanja; Engels, Bernd

    2014-09-23

    The coronavirus main protease (M(pro)) represents an attractive drug target for antiviral therapy of coronavirus (CoV) infections, including severe acute respiratory syndrome (SARS). The SARS-CoV M(pro) and related CoV proteases have several distinct features, such as an uncharged Cys-His catalytic dyad embedded in a chymotrypsin-like protease fold, that clearly separate these enzymes from archetypical cysteine proteases. To further characterize the catalytic system of CoV main proteases and to obtain information about improved inhibitors, we performed comprehensive simulations of the proton-transfer reactions in the SARS-CoV M(pro) active site that lead to the Cys(-)/His(+) zwitterionic state required for efficient proteolytic activity. Our simulations, comprising the free enzyme as well as substrate-enzyme and inhibitor-enzyme complexes, lead us to predict that zwitterion formation is fostered by substrate binding but not inhibitor binding. This indicates that M(pro) employs a substrate-induced catalytic mechanism that further enhances its substrate specificity. Our computational data are in line with available experimental results, such as X-ray geometries, measured pKa values, mutagenesis experiments, and the measured differences between the kinetic parameters of substrates and inhibitors. The data also provide an atomistic picture of the formerly postulated electrostatic trigger involved in SARS-CoV M(pro) activity. Finally, they provide information on how a specific microenvironment may finely tune the activity of M(pro) toward specific viral protein substrates, which is known to be required for efficient viral replication. Our simulations also indicate that the low inhibition potencies of known covalently interacting inhibitors may, at least in part, be attributed to insufficient fostering of the proton-transfer reaction. These findings suggest ways to achieve improved inhibitors. PMID:25196915

  3. Interaction

    NSDL National Science Digital Library

    Wolfgang Christian

    Set values for the initial position, velocity, and mass of the two particles, and click on the button "Initialize Animation" to play the animation using your specified values. Note, if m or v are too large, the particles may actually pass through one another which will seem a little strange. Note: the interaction between the particles is a "non-contact" interaction, much like the electrostatic force on two charges. Mathematically, it is actually a Hooke's law interaction.

  4. Effect of mutual position of electron donor and acceptor on photoinduced electron transfer in supramolecular chlorophyll-fullerene dyads.

    PubMed

    Stranius, Kati; Iashin, Vladimir; Nikkonen, Taru; Muuronen, Mikko; Helaja, Juho; Tkachenko, Nikolai

    2014-02-27

    In this study we have explored the influence of mutual position of chlorin electron donor and fullerene C60 electron acceptor on photoinduced electron transfer. Two zinc-chlorin-aza-[18]crown-6 compounds and three pyrrolidino[60]fullerenes with alkyl aminium and varying coordinative moieties were synthesized and used for self-assembling of a set of complexes via two-point binding. The aza[18]crown6 moieties were connected to chlorins via amide linker either at 13(4) or 17(4) position, hence, being attached on different sides of the chlorin plane. Furthermore, in the former case, the linker holds the crown closely spaced, whereas, in the latter, the linker gives more space and conformational freedom for the crown with respect to the chlorin macrocycle. The coordinative moieties at fullerene site, 3-pyridine, 4-pyridine, and 3-furan, were built by utilizing the Prato reaction. The two-point binding drove the molecules into specific complex formation by self-assembling; aminium ion was chelated by crown ether, while zinc moiety of chlorin was coordinated by pyridine and furan. Such pairing resulted in distinct supramolecular chlorin-fullerene dyads with defined distance and orientation. The performed computational studies at DFT level in solution, with TPSS-D3/def2-TZVP//def2-SVP, indicated different geometries and binding energies for the self-assembling complexes. Notably, the computations pointed out that for all the studied complexes, the donor-acceptor distances and binding energies were dictated by chirality of pyrrolidino ring at C60. The selective excitation of chlorin chromophore revealed efficient emission quenching in all dyads. The ultrafast spectroscopy studies suggested a fast and efficient photoinduced charge transfer in the dyads. The lifetimes of the charge separated states range from 55 to 187 ps in o-dichlorobenzene and from 14 to 60 ps in benzonitrile. Expectedly, the electron transfer rate was found to be critically dependent on the donor-acceptor distance; additionally, the mutual orientation of these entities was found to have significant contribution on the rate. PMID:24495002

  5. Developmental Continuity and Stability of Emotional Availability in the Family: Two Ages and Two Genders in Child-Mother Dyads from Two Regions in Three Countries

    ERIC Educational Resources Information Center

    Bornstein, Marc H.; Suwalsky, Joan T. D.; Putnick, Diane L.; Gini, Motti; Venuti, Paola; de Falco, Simona; Heslington, Marianne; de Galperin, Celia Zingman

    2010-01-01

    This study employs an intra-national and cross-national, prospective, and longitudinal design to examine age, gender, region, and country variation in group mean-level continuity and individual-differences stability of emotional availability in child-mother dyads. Altogether, 220 Argentine, Italian, and US American metropolitan and rural residence…

  6. Similarities amid the Difference: Caregiving Burden and Adaptation Outcomes in Dyads of Parents and Their Children with and without Cerebral Palsy

    ERIC Educational Resources Information Center

    Carona, C.; Crespo, C.; Canavarro, M. C.

    2013-01-01

    This study had two main objectives: first, to examine the direct and indirect effects, via social support, of caregiving burden on the adaptation outcomes of children/adolescents with cerebral palsy and their parents; and second, to assess the invariance of such models in clinical vs. healthy subsamples. Participants were 210 dyads of…

  7. Taking Stress Response out of the Box: Stability, Discontinuity, and Temperament Effects on HPA and SNS across Social Stressors in Mother-Infant Dyads

    ERIC Educational Resources Information Center

    Laurent, Heidemarie K.; Ablow, Jennifer C.; Measelle, Jeffrey

    2012-01-01

    This study investigated continuity and stability of hypothalamic-pituitary-adrenal (HPA) and sympathetic nervous system (SNS) response measures in mother-infant dyads across 2 different types of social stress sessions. Synchrony of response trajectories across systems (SNS-HPA coordination) and partners (mother-infant attunement) was addressed, as…

  8. Effects of Electroacupuncture with Dominant Frequency at SP 6 and ST 36 Based on Meridian Theory on Pain-Depression Dyad in Rats

    PubMed Central

    Wu, Yuan-yuan; He, Xiao-fen; Zhao, Xiao-yun; Shao, Xiao-mei; Du, Jun-ying; Fang, Jian-qiao

    2015-01-01

    Epidemic investigations reveal an intimate interrelationship between pain and depression. The effect of electroacupuncture (EA) on pain or depression has been demonstrated individually, but its effect on pain-depression dyad is unknown. Our study aimed to screen a dominant EA frequency on pain-depression dyad and determine the validity of acupoint selection based on meridian theory. The pain-depression dyad rat model was induced by reserpine and treated using EA with different frequencies at identical acupoints to extract a dominant frequency and then administrated dominant-frequency EA at different acupoints in the above models. Paw withdrawal latency (PWL), emotional behavior of elevated zero maze (EZM) test, and open field (OF) test were conducted. We found that 100?Hz EA at Zusanli (ST 36) and Sanyinjiao (SP 6) (classical acupoints for spleen-deficiency syndrome) were the most effective in improving PWL, travelling distance in the EZM, and maximum velocity in OF compared to EA with other frequencies; ST 36 and SP 6 were proved more effective than other acupoints beyond the meridian theory and nonacupoints under the same administration of EA. Therefore, we concluded that 100?Hz is the dominant frequency for treating the pain-depression dyad with EA, and acupoints on spleen and stomach meridians are preferable choices.

  9. Autism Spectrum Disorder: Does Neuroimaging Support the DSM-5 Proposal for a Symptom Dyad? A Systematic Review of Functional Magnetic Resonance Imaging and Diffusion Tensor Imaging Studies

    ERIC Educational Resources Information Center

    Pina-Camacho, Laura; Villero, Sonia; Fraguas, David; Boada, Leticia; Janssen, Joost; Navas-Sanchez, Francisco J.; Mayoral, Maria; Llorente, Cloe; Arango, Celso; Parellada, Mara

    2012-01-01

    A systematic review of 208 studies comprising functional magnetic resonance imaging and diffusion tensor imaging data in patients with "autism spectrum disorder" (ASD) was conducted, in order to determine whether these data support the forthcoming DSM-5 proposal of a social communication and behavioral symptom dyad. Studies consistently reported…

  10. Models of dyadic social interaction.

    PubMed

    Griffin, Dale; Gonzalez, Richard

    2003-03-29

    We discuss the logic of research designs for dyadic interaction and present statistical models with parameters that are tied to psychologically relevant constructs. Building on Karl Pearson's classic nineteenth-century statistical analysis of within-organism similarity, we describe several approaches to indexing dyadic interdependence and provide graphical methods for visualizing dyadic data. We also describe several statistical and conceptual solutions to the 'levels of analytic' problem in analysing dyadic data. These analytic strategies allow the researcher to examine and measure psychological questions of interdependence and social influence. We provide illustrative data from casually interacting and romantic dyads. PMID:12689382

  11. Reciprocal Peer Learning with Task Cards: Analysis of Behaviour and Verbal Interactions in Structured and Unstructured Dyads

    ERIC Educational Resources Information Center

    Iserbyt, Peter

    2015-01-01

    Background: This study is a part of a larger research project where the effect of instructional guidance in terms of role definition and role switching was investigated on students' learning of Basic Life Support (BLS) during a 20-minute reciprocal learning episode with task cards. BLS is a lifesaving skill consisting of nine sub skills to be…

  12. Do Verbal Interactions with Infants during Electronic Media Exposure Mitigate Adverse Impacts on Their Language Development as Toddlers?

    ERIC Educational Resources Information Center

    Mendelsohn, Alan L.; Brockmeyer, Carolyn A.; Dreyer, Benard P.; Fierman, Arthur H.; Berkule-Silberman, Samantha B.; Tomopoulos, Suzy

    2010-01-01

    The goal of this study was to determine whether verbal interactions between mothers and their 6-month-old infants during media exposure ("media verbal interactions") might have direct positive impacts, or mitigate any potential adverse impacts of media exposure, on language development at 14 months. For 253 low-income mother-infant dyads

  13. Dyads at Risk: Methadone-Maintained Women and Their Four-Month-Old Infants.

    ERIC Educational Resources Information Center

    Jeremy, Rita Jeruchimowicz; Bernstein, Victor J.

    1984-01-01

    Compares 17 methadone-exposed and 23 control four-month-old infants in interactions with their mothers. Results indicate that methadone is only one of several risk factors affecting interaction. Mothers rated poor in communication have poor psychosocial and psychological resources, and infants rated poor in communication showed problematic motor…

  14. Identification of Parent-Child Interaction Characteristics of High and Low Achieving Elementary Students.

    ERIC Educational Resources Information Center

    Portes, Pedro R.; And Others

    The present study was designed to identify parent-child interaction patterns that might differentiate bright from below average elementary students in order to test the hypothesis that environmental processes related to regulation of executive processes influence both children's learning and developmental level. Thirty-two mother-child dyads (16…

  15. Stability of Maternal Discipline Practices and the Quality of Mother-Child Interaction during Toddlerhood

    ERIC Educational Resources Information Center

    Huang, Keng-Yen; Caughy, Margaret O'Brien; Lee, Li-Ching; Miller, Therese; Genevro, Janice

    2008-01-01

    This study examined the stability of maternal punitive/high-power discipline (PD) and inductive/authoritative discipline (ID) over the second and third years of life and the effect of maternal discipline on quality of mother-child interactions. Data from a longitudinal sample with 179 mother-toddler dyads were analyzed, and selected factors (i.e.,…

  16. Gender roles, computer attitudes, and dyadic computer interaction performance in college students

    Microsoft Academic Search

    Sue Winkle Williams; Shirley M. Ogletree; William Woodburn; Paul Raffeld

    1993-01-01

    Females tend to score lower than males on measures of computer aptitude and attitudes. This study examined the potential effects of several mediating factors, sex of experimenter, sex of experimental partner, sex typing (Bem Sex Role Inventory score), and level of past experience, on a computer interaction task involving a dyad. College students, drawn from a primarily white college population,

  17. Locus of Control and Task Effects in Mother-Son Interactions.

    ERIC Educational Resources Information Center

    Mead-Fox, Merrill F.; Kralj, Mary M.

    This study examines the interaction of mother-son dyads as a function of mothers' and sons' locus of control and the demand characteristics of specific tasks. The subjects were 32 third grade boys from parochial schools in the District of Columbia area and their mothers. They were assigned to internal or external locus of control groups based on a…

  18. Gender Clues and Cues: Online Interactions as Windows into Lay Theories about Men and Women

    Microsoft Academic Search

    Melissa J. Williams; Gerald A. Mendelsohn

    2008-01-01

    The Internet allows the process of “doing gender” (West & Zimmerman, 1987) to be examined in ways previously unavailable. In the studies presented here, dyads conversed online while (a) knowing or, (b) not knowing each other's gender, or (c) with one participant feigning the opposite gender. Not knowing gender had a surprisingly small effect on the interaction. The results further

  19. Gravitating toward Science: Parent-Child Interactions at a Gravitational-Wave Observatory

    ERIC Educational Resources Information Center

    Szechter, Lisa E.; Carey, Elizabeth J.

    2009-01-01

    This research examined the nature of parent-child conversations at an informal science education center housed in an active gravitational-wave observatory. Each of 20 parent-child dyads explored an interactive exhibit hall privately, without the distraction of other visitors. Parents employed a variety of strategies to support their children's…

  20. Playing with Technology: Mother-Toddler Interaction Scores Lower during Play with Electronic Toys

    ERIC Educational Resources Information Center

    Wooldridge, Michaela B.; Shapka, Jennifer

    2012-01-01

    To investigate play with electronic toys (battery-operated or digital), 25 mother-toddler (16-24 months old) dyads were videotaped in their homes playing with sets of age-appropriate electronic and non-electronic toys for approximately 10 min each. Parent-child interactions were coded from recorded segments of both of the play conditions using the…

  1. Affect Decoding Measures and Human-Computer Interaction L.D. Riek, S. Afzal, P. Robinson

    E-print Network

    Robinson, Peter

    , this area has not yet been applied to HCI. Decoding affect is defined as "the ability to sense, perceive]. Objective measurement of affect decoding is relevant for a variety of HCI applications, such as designing nonverbal behavior during dyad and group interaction studies. We are used to adapting interfaces for users

  2. Interactional justice, negotiator outcome satisfaction, and desire for future negotiations : RESPECT at the negotiating table

    Microsoft Academic Search

    Edward Kass

    2008-01-01

    Purpose – This paper aims to explore the relationship between procedural, interpersonal, informational, and distributive justice and negotiator outcome satisfaction and desire for future negotiations (DFNs). Design\\/methodology\\/approach – This research invokes and builds theories suggesting a link between perceptions of fair treatment and counterfactual generation. Data come from freely interacting negotiating dyads comprised of undergraduate students. Findings – One's own

  3. Social signal processing for studying parent–infant interaction

    PubMed Central

    Avril, Marie; Leclère, Chloë; Viaux, Sylvie; Michelet, Stéphane; Achard, Catherine; Missonnier, Sylvain; Keren, Miri; Cohen, David; Chetouani, Mohamed

    2014-01-01

    Studying early interactions is a core issue of infant development and psychopathology. Automatic social signal processing theoretically offers the possibility to extract and analyze communication by taking an integrative perspective, considering the multimodal nature and dynamics of behaviors (including synchrony). This paper proposes an explorative method to acquire and extract relevant social signals from a naturalistic early parent–infant interaction. An experimental setup is proposed based on both clinical and technical requirements. We extracted various cues from body postures and speech productions of partners using the IMI2S (Interaction, Multimodal Integration, and Social Signal) Framework. Preliminary clinical and computational results are reported for two dyads (one pathological in a situation of severe emotional neglect and one normal control) as an illustration of our cross-disciplinary protocol. The results from both clinical and computational analyzes highlight similar differences: the pathological dyad shows dyssynchronic interaction led by the infant whereas the control dyad shows synchronic interaction and a smooth interactive dialog. The results suggest that the current method might be promising for future studies. PMID:25540633

  4. A Model for Early Intervention in Maladaptive Mother-Child Dyads.

    ERIC Educational Resources Information Center

    Milar, Christopher R.; Schroeder, Carolyn S.

    This conference presentation describes a six-week intervention training program for parents with children who exhibit negative behavior (noncompliance, temper tantrums, whining). The focus of the program is to increase positive parent-child interaction, as well as to teach parents how to make and follow through on commands to their children.…

  5. A Comparison of Dyadic Interactions and Coping with Still-Face in Healthy Pre-Term and Full-Term Infants

    ERIC Educational Resources Information Center

    Montirosso, Rosario; Borgatti, Renato; Trojan, Sabina; Zanini, Rinaldo; Tronick, Ed

    2010-01-01

    Pre-term birth has a significant impact on infants' social and emotional competence, however, little is known about regulatory processes in pre-term mother-infant dyads during normal or stressful interactions. The primary goals of this study were to investigate the differences in infant and caregiver interactive behaviour and dyadic coordination…

  6. Difference without dominance: Children's talk in mixed- and same-sex dyads

    Microsoft Academic Search

    Laura A. McCloskey; Lerita M. Coleman

    1992-01-01

    This study explores whether third graders verbalize gender differences in dominance in mixed- and same-sex interaction. We tape-recorded the conversations of 43 pairs of Caucasian working-class children playing checkers in same- or mixed-sex conditions. Children appear to develop gender-differentiated speech styles. Boys brag and insult their opponents in both mixed- and same-sex conditions more often than do girls. Girls talk

  7. Predictors of Parenting Stress Trajectories in Premature Infant–Mother Dyads

    PubMed Central

    Spinelli, Maria; Poehlmann, Julie; Bolt, Daniel

    2014-01-01

    This prospective longitudinal study examined predictors of parenting stress trajectories over time in a sample of 125 mothers and their preterm infants. Infant (multiple birth, gestational age, days hospitalized, and neonatal health risks) and maternal (socioeconomic, education, depressive symptoms, social support, and quality of interaction during infant feeding) characteristics were collected just prior to infant hospital discharge. Parenting stress and maternal interaction quality during play were measured at 4, 24, and 36 months corrected age. Hierarchical linear modeling was used to analyze infant and maternal characteristics as predictors of parenting stress scores and change over time. Results indicated significant variability across individuals in parenting stress at 4 months and in change trajectories. Mothers of multiples and infants with more medical risks and shorter hospitalization, and mothers with lower education and more depressive symptoms, reported more parenting stress at 4 months of age. Parenting stress decreased over time for mothers of multiples and for mothers with lower education more than for mothers of singletons or for mothers with higher educational levels. Changes in parenting stress scores over time were negatively associated with maternal behaviors during mother–infant interactions. Results are interpreted for their implications for preventive interventions. PMID:24188086

  8. Mapping Cardiac Physiology and Parenting Processes in Maltreating Mother–Child Dyads

    PubMed Central

    Skowron, Elizabeth A.; Loke, Eric; Gatzke-Kopp, Lisa M.; Cipriano-Essel, Elizabeth A.; Woehrle, Petra L.; Van Epps, John J.; Gowda, Anjali; Ammerman, Robert T.

    2013-01-01

    Child maltreatment (CM) lies on an extreme end of the continuum of parenting-at-risk, and while CM has been linked with a variety of behavioral indicators of dysregulation in children, less is known about how physiological markers of regulatory capacity contribute to this association. The present study examined patterns of mother and child physiological regulation and their relations with observed differences in parenting processes during a structured interaction. Abusing, neglecting, and non-CM mothers and their 3- to 5-year-old children completed a resting baseline and moderately challenging joint task. The structural analysis of social behavior was used to code mother–child interactions while simultaneous measures of respiratory sinus arrhythmia were obtained. Results indicated that physically abusive mothers were more likely to react to children’s positive bids for autonomy with strict and hostile control, than either neglecting or non-CM mothers. CM exposure and quality of maternal responding to children’s autonomous bids were uniquely associated with lower parasympathetic tone in children. Results provide evidence of neurodevelopmental associations between early CM exposure, the immediate interactive context of parenting, and children’s autonomic physiology. PMID:21842991

  9. Cyanuric Acid Hydrolase from Azorhizobium caulinodans ORS 571: Crystal Structure and Insights into a New Class of Ser-Lys Dyad Proteins

    PubMed Central

    Cho, Seunghee; Shi, Ke; Seffernick, Jennifer L.; Dodge, Anthony G.; Wackett, Lawrence P.; Aihara, Hideki

    2014-01-01

    Cyanuric acid hydrolase (CAH) catalyzes the hydrolytic ring-opening of cyanuric acid (2,4,6-trihydroxy-1,3,5-triazine), an intermediate in s-triazine bacterial degradation and a by-product from disinfection with trichloroisocyanuric acid. In the present study, an X-ray crystal structure of the CAH-barbituric acid inhibitor complex from Azorhizobium caulinodans ORS 571 has been determined at 2.7 Å resolution. The CAH protein fold consists of three structurally homologous domains forming a ?-barrel-like structure with external ?-helices that result in a three-fold symmetry, a dominant feature of the structure and active site that mirrors the three-fold symmetrical shape of the substrate cyanuric acid. The active site structure of CAH is similar to that of the recently determined AtzD with three pairs of active site Ser-Lys dyads. In order to determine the role of each Ser-Lys dyad in catalysis, a mutational study using a highly sensitive, enzyme-coupled assay was conducted. The 109-fold loss of activity by the S226A mutant was at least ten times lower than that of the S79A and S333A mutants. In addition, bioinformatics analysis revealed the Ser226/Lys156 dyad as the only absolutely conserved dyad in the CAH/barbiturase family. These data suggest that Lys156 activates the Ser226 nucleophile which can then attack the substrate carbonyl. Our combination of structural, mutational, and bioinformatics analyses differentiates this study and provides experimental data for mechanistic insights into this unique protein family. PMID:24915109

  10. Child-Directed Interaction: Prediction of Change in Impaired Mother–Child Functioning

    Microsoft Academic Search

    Michelle D. Harwood; Sheila M. Eyberg

    2006-01-01

    The first phase of parent–child interaction therapy (PCIT), called child-directed interaction, teaches parents to use positive and differential social attention to improve the parent–child relationship. This study examined predictors of change in mother and child functioning during the child-directed interaction for 100 mother–child dyads. The children were 3–6-years-old and diagnosed with oppositional defiant disorder. After establishing that significant improvements occurred

  11. Face-to-Face Interactions of Postpartum Depressed and Nondepressed Mother–Infant Pairs at 2 Months

    Microsoft Academic Search

    Jeffrey F. Cohn; Susan B. Campbell; Reinaldo Matias; Joyce Hopkins

    1990-01-01

    Depression’s influence on mother–infant interactions at 2 months postpartum was studied in 24 depressed and 22 nondepressed mother–infant dyads. Depression was diagnosed using the SADS-L and RDC. In S’s homes, structured interactions of 3 min duration were videotaped and later coded using behavioral descriptors and a 1-s time base. Unstructured interactions were described using rating scales. During structured interactions, depressed

  12. Ru(II) dyads derived from 2-(1-pyrenyl)-1H-imidazo[4,5-f][1,10]phenanthroline: versatile photosensitizers for photodynamic applications.

    PubMed

    Stephenson, Mat; Reichardt, Christian; Pinto, Mitch; Wächtler, Maria; Sainuddin, Tariq; Shi, Ge; Yin, Huimin; Monro, Susan; Sampson, Eric; Dietzek, Benjamin; McFarland, Sherri A

    2014-11-13

    Combining the best attributes of organic photosensitizers with those of coordination complexes is an elegant way to achieve prolonged excited state lifetimes in Ru(II) dyads. Not only do their reduced radiative and nonradiative rates provide ample time for photosensitization of reactive oxygen species at low oxygen tension but they also harness the unique properties of (3)IL states that can act as discrete units or in concert with (3)MLCT states. The imidazo[4,5-f][1,10]phenanthroline framework provides a convenient tether for linking ?-expansive ligands such as pyrene to a Ru(II) scaffold, and the stabilizing coligands can fine-tune the chemical and biological properties of these bichromophoric systems. The resulting dyads described in this study exhibited nanomolar light cytotoxicities against cancer cells with photocytotoxicity indices exceeding 400 for some coligands employed. This potency extended to bacteria, where concentrations as low as 10 nM destroyed 75% of a bacterial population. Notably, these dyads remained extremely active against biofilm with light photocytotoxicities against these more resistant bacterial populations in the 10-100 nM regime. The results from this study demonstrate the versatility of these highly potent photosensitizers in destroying both cancer and bacterial cells and expand the scope of compounds that utilize low-lying (3)IL states for photobiological applications. PMID:24927113

  13. The Dutch HEXACO Personality Inventory: psychometric properties, self-other agreement, and relations with psychopathy among low and high acquaintanceship dyads.

    PubMed

    de Vries, Reinout E; Lee, Kibeom; Ashton, Michael C

    2008-03-01

    The HEXACO model (Lee & Ashton, 2004, 2006) of personality structure is based on 6 dimensions that have been recovered in lexical studies of personality in various languages. In this study, we examined a Dutch version of the HEXACO Personality Inventory (HEXACO-PI; Lee & Ashton, 2004) and found it to have satisfactory psychometric properties. Additionally, we examined the level of self-other agreement for the HEXACO-PI variables and the relation of HEXACO-PI Honesty-Humility with the Self-Report Psychopathy Scale (Williams, Paulhus, & Hare, 2007) at varying levels of self-other acquaintanceship. Self-other agreement was found to be high, especially among dyads with high levels of acquaintanceship. Self-reported and other-reported Honesty-Humility and Emotionality were the strongest predictors of psychopathy. The relation between other-reported Honesty-Humility and self-reported psychopathy was near zero for dyads with low levels of acquaintanceship but was moderately strong for dyads with high levels of acquaintanceship. PMID:18444108

  14. The Ugi four-component reaction as a concise modular synthetic tool for photo-induced electron transfer donor-anthraquinone dyads

    PubMed Central

    Bay, Sarah; Makhloufi, Gamall; Janiak, Christoph

    2014-01-01

    Summary Phenothiazinyl and carbazolyl-donor moieties can be covalently coupled to an anthraquinone acceptor unit through an Ugi four-component reaction in a rapid, highly convergent fashion and with moderate to good yields. These novel donor–acceptor dyads are electronically decoupled in the electronic ground state according to UV–vis spectroscopy and cyclic voltammetry. However, in the excited state the inherent donor luminescence is efficiently quenched. Previously performed femtosecond spectroscopic measurements account for a rapid exergonic depopulation of the excited singlet states into a charge-separated state. Calculations of the Gibbs energy of photo-induced electron transfer from readily available UV–vis spectroscopic and cyclovoltammetric data applying the Weller approximation enables a quick evaluation of these novel donor–acceptor dyads. In addition, the X-ray structure of a phenothiazinyl–anthraquinone dyad supports short donor–acceptor distances by an intramolecular ?-stacking conformation, an important assumption also implied in the calculations of the Gibbs energies according to the Weller approximation. PMID:24991251

  15. The Ugi four-component reaction as a concise modular synthetic tool for photo-induced electron transfer donor-anthraquinone dyads.

    PubMed

    Bay, Sarah; Makhloufi, Gamall; Janiak, Christoph; Müller, Thomas J J

    2014-01-01

    Phenothiazinyl and carbazolyl-donor moieties can be covalently coupled to an anthraquinone acceptor unit through an Ugi four-component reaction in a rapid, highly convergent fashion and with moderate to good yields. These novel donor-acceptor dyads are electronically decoupled in the electronic ground state according to UV-vis spectroscopy and cyclic voltammetry. However, in the excited state the inherent donor luminescence is efficiently quenched. Previously performed femtosecond spectroscopic measurements account for a rapid exergonic depopulation of the excited singlet states into a charge-separated state. Calculations of the Gibbs energy of photo-induced electron transfer from readily available UV-vis spectroscopic and cyclovoltammetric data applying the Weller approximation enables a quick evaluation of these novel donor-acceptor dyads. In addition, the X-ray structure of a phenothiazinyl-anthraquinone dyad supports short donor-acceptor distances by an intramolecular ?-stacking conformation, an important assumption also implied in the calculations of the Gibbs energies according to the Weller approximation. PMID:24991251

  16. Emotional Relationships in Mothers and Infants: Culture-Common and Community-Specific Characteristics of Dyads from Rural and Metropolitan Settings in Argentina, Italy, and the United States

    PubMed Central

    Bornstein, Marc H.; Putnick, Diane L.; Suwalsky, Joan T. D.; Venuti, Paola; de Falco, Simona; de Galperín, Celia Zingman; Gini, Motti; Tichovolsky, Marianne Heslington

    2010-01-01

    This study uses country and regional contrasts to examine culture-common and community-specific variation in mother-infant emotional relationships. Altogether, 220 Argentine, Italian, and U.S. American mothers and their daughters and sons, living in rural and metropolitan settings, were observed at home at infant age 5 months. Both variable- and person-centered perspectives of dyadic emotional relationships were analyzed. Supporting the notion that adequate emotional relationships are a critical and culture-common characteristic of human infant development, across all samples most dyads scored in the adaptive range in terms of emotional relationships. Giving evidence of community-specific characteristics, Italian mothers were more sensitive, and Italian infants more responsive, than Argentine and U.S. mothers and infants; in addition, rural mothers were more intrusive than metropolitan mothers, and rural dyads more likely than expected to be classified as mid-range in emotional relationships and less likely to be classified as high in emotional relationships. Adaptive emotional relationships appear to be a culture-common characteristic of mother-infant dyads near the beginning of life, but this relational construct is moderated by community-specific (country and regional) context. PMID:22247569

  17. A Network Analysis of Relationship Dynamics in Sexual Dyads as Correlates of HIV Risk Misperceptions among High-risk MSM

    PubMed Central

    Fujimoto, Kayo; Williams, Mark L.; Ross, Michael W.

    2014-01-01

    Objectives Relationship dynamics influence the perception of HIV risk in sexual dyads. The objective of this study was to examine the effect of relational dynamics on knowledge or perception of a partner’s HIV status in a sample of most at-risk MSM: drug-using male sex workers. The study identified relationship dimensions and examined their association with misperceptions about a particular partner’s HIV status. Methods The analytic sample for the study consisted of 168 sexual partnerships of 116 male sex workers and their associates. Exploratory factor analysis was conducted to identify dimensions of the interpersonal relationships in sexual partnerships that were then regressed on “risky misperceptions” (misperceiving HIV negative when partner’s self-report was positive or unknown). Results Six relationship dimensions of intimate, commitment, socializing, financial, trust, and honesty were extracted. Commitment was found to be protective against misperception (Adjusted Odds Ratio [AOR] = 0.45), while trust was not (AOR = 2.78). Other factors also were found to be associated with misperception. HIV negative MSM (AOR = 7.69) and partners who were both self-identified as gay (AOR = 3.57) were associated with misperception, while encounters identified as sex work (AOR = 0.29), in which both partners were White (AOR = 0.16), and involved with an older partner (AOR = 0.90) were protective. Conclusions Couple-based HIV intervention efforts among MSM should consider that less trust and more commitment are protective factors in sexual partnerships. PMID:25305211

  18. The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

    PubMed Central

    Grichnik, J M; French, B A; Schwartz, R J

    1988-01-01

    The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

  19. Effectiveness of Parent-Child Interaction Therapy Delivered to At-Risk Families in the Home Setting

    ERIC Educational Resources Information Center

    Galanter, Rachel; Self-Brown, Shannon; Valente, Jessica R.; Dorsey, Shannon; Whitaker, Daniel J.; Bertuglia-Haley, Michelle; Prieto, Metta

    2012-01-01

    An evaluation was conducted for 83 parent-child dyads who participated in parent-child interaction therapy (PCIT) delivered in-home by community agency therapists. Data included self-report measures and therapist observations at baseline and posttreatment. Results indicated significant positive changes in child/parent behavior and parent attitudes…

  20. Patterns in Early Interaction between Young Preschool Children with Severe Speech and Physical Impairments and Their Parents

    ERIC Educational Resources Information Center

    Sandberg, Annika Dahlgren; Liliedahl, Marie

    2008-01-01

    The aim of this study is to examine whether the asymmetrical pattern of communication usually found between people who use augmentative and alternative communication and their partners using natural speech was also found in the interaction between non-vocal young preschool children with cerebral palsy and their parents. Three parent-child dyads

  1. Examining Peer Acceptance in Verbal and Non-Verbal Interaction during Computer-Supported Collaborative Learning: Implications for Inclusion

    ERIC Educational Resources Information Center

    Mavrou, Katerina

    2012-01-01

    This paper discusses the results of peer acceptance in a study investigating the interactions of pairs of disabled and non-disabled pupils working together on computer-based tasks in mainstream primary schools in Cyprus. Twenty dyads of pupils were observed and videotaped while working together at the computer. Data analyses were based on the…

  2. Sensitivity in Interactions between Hearing Mothers and their Toddlers with Hearing Loss: The Effect of Cochlear Implantation

    ERIC Educational Resources Information Center

    Bakar, Zaharah Abu; Brown, P. Margaret; Remine, Maria D.

    2010-01-01

    This study investigated the potential effects of cochlear implantation and age at implantation on maternal interactional sensitivity. Three groups of dyads were studied at two points over 1 year. The hearing aid (HA) group wore hearing aids throughout the study, the early cochlear implanted (ECI) group were implanted prior to 22 months of age, and…

  3. Marital interaction in dyadic and triadic contexts: continuities and discontinuities.

    PubMed

    Deal, J E; Hagan, M S; Bass, B; Hetherington, E M; Clingempeel, G

    1999-01-01

    While the systemic metaphor used in much current family research requires examination of the interrelationships among individuals, relationships, and the family as a whole, work on triadic relationships has generally been missing. This research examined the presence of second-order effects in marital interaction: changes in interactions between spouses when the husband-wife dyad became a parent-parent-child triad. Results indicated the presence of consistent context effects. Parental behavior when alone was not a good predictor of parental behavior in the presence of a child: behaviors occurred at significantly lower levels in parental dyads than in parent-parent-child triads, and correlations across the two contexts were less than consistent. Results are discussed in light of their implications for observations of families. PMID:10207713

  4. Playmates and teachers: reciprocal and complementary interactions between siblings.

    PubMed

    Howe, Nina; Recchia, Holly

    2005-12-01

    Associations between siblings' reciprocal (i.e., play) and complementary (i.e., teaching) interactions in 70 sibling dyads (1st-born siblings' mean age=81.6 months, range=59-119 months; 2nd-born siblings' mean age = 56.1 months, range = 5-79 months) were examined. Dyads participated in 2 sessions (play, teaching) and completed a sibling relationship quality measure. Findings revealed modest associations across play and teaching sessions; for example, greater learner involvement in the teaching task was associated with more collaboration and less negative affect during play. In addition, the 2nd-born's teaching style was related to perceptions of relationship quality. Results indicate that reciprocal and complementary types of interactions may provide important contexts for development of individual differences in dyadic and individual behaviors and may afford opportunities for siblings to influence one another's development. PMID:16402864

  5. Involving family members in the implementation and evaluation of technologies for dementia: a dyad case study.

    PubMed

    Lazar, Amanda; Demiris, George; Thompson, Hilaire J

    2015-04-01

    An increasing number of individuals worldwide are affected by dementia and it is important to examine nonpharmacological care approaches. A dyadic case study of a 6-month evaluation of a technology designed to engage individuals with dementia in activities in a memory care unit is presented. Findings show one caretaker of an individual with dementia (i.e., her mother) used the computer in a manner consistent with her usual style of interaction and supportive care; she continued to maintain awareness of her mother's activity preferences and cultivated her mother's quality of life by using the provided technology. These findings demonstrate a use for technology to support activities of older adults with dementia while engaging family and provide future directions for technology design and research in this population. [Journal of Gerontological Nursing, 41(4), 21-26.]. PMID:25800405

  6. Synchrony, complexity and directiveness in mothers' interactions with infants pre- and post-cochlear implantation.

    PubMed

    Fagan, Mary K; Bergeson, Tonya R; Morris, Kourtney J

    2014-08-01

    This study investigated effects of profound hearing loss on mother-infant interactions before and after cochlear implantation with a focus on maternal synchrony, complexity, and directiveness. Participants included two groups of mother-infant dyads: 9 dyads of mothers and infants with normal hearing; and 9 dyads of hearing mothers and infants with profound hearing loss. Dyads were observed at two time points: Time 1, scheduled to occur before cochlear implantation for infants with profound hearing loss (mean age=13.6 months); and Time 2 (mean age=23.3 months), scheduled to occur approximately six months after cochlear implantation. Hearing infants were age-matched to infants with hearing loss at both time points. Dependent variables included the proportion of maternal utterances that overlapped infant vocalizations, maternal mean length of utterance, infant word use, and combined maternal directives and prohibitions. Results showed mothers' utterances overlapped the vocalizations of infants with hearing loss more often before cochlear implantation than after, mothers used less complex utterances with infants with cochlear implants compared to hearing peers (Time 2), and mothers of infants with profound hearing loss used frequent directives and prohibitions both before and after cochlear implantation. Together, mothers and infants adapted relatively quickly to infants' access to cochlear implants, showing improved interactional synchrony, increased infant word use, and levels of maternal language complexity compatible with infants' word use, all within seven months of cochlear implant activation. PMID:24793733

  7. The Contribution of the Dyadic Parent-Child Interaction Coding System (DPICS) Warm-Up Segments in Assessing Parent-Child Interactions

    Microsoft Academic Search

    Jenelle R. Shanley; Larissa N. Niec

    2011-01-01

    This study evaluated the inclusion of uncoded segments in the Dyadic Parent-Child Interaction Coding System, an analogue observation of parent-child interactions. The relationships between warm-up and coded segments were assessed, as well as the segments’ associations with parent ratings of parent and child behaviors. Sixty-nine non-referred parent-child dyads engaged in the observation. Parents completed measures about their parenting and children's

  8. The development of delinquency and perceived friendship quality in adolescent best friendship dyads.

    PubMed

    Selfhout, Maarten H W; Branje, Susan J T; Meeus, Wim H J

    2008-05-01

    The present study examines both the unique and the combined role of best friends' delinquency and perceived friendship quality in the development of adolescent delinquency. Questionnaire data were gathered from 435 Dutch adolescent best friends (mean age at first wave = 12.97) over a period of 5 years with annual assessments. Results showed that mean levels of delinquency and perceived friendship quality increased over time. Adolescent best friends were highly similar in both mean levels and changes in delinquency over time. For boys, similarity in mean level delinquency between best friends was higher than for girls. In addition, only for boys, friends' delinquency is associated with increases in adolescent delinquency over time, and adolescents' delinquency is associated with increases in friends' delinquency over time. No bidirectional longitudinal associations were found between perceived friendship quality and adolescent delinquency. No interaction effects between friendship quality and friends' delinquency on adolescent delinquency were found. Thus, findings were more in support of the differential association theory than of the social control theory. PMID:18066660

  9. Hunter-Gatherer Inter-Band Interaction Rates: Implications for Cumulative Culture

    PubMed Central

    Hill, Kim R.; Wood, Brian M.; Baggio, Jacopo; Hurtado, A. Magdalena; Boyd, Robert T.

    2014-01-01

    Our species exhibits spectacular success due to cumulative culture. While cognitive evolution of social learning mechanisms may be partially responsible for adaptive human culture, features of early human social structure may also play a role by increasing the number potential models from which to learn innovations. We present interview data on interactions between same-sex adult dyads of Ache and Hadza hunter-gatherers living in multiple distinct residential bands (20 Ache bands; 42 Hadza bands; 1201 dyads) throughout a tribal home range. Results show high probabilities (5%–29% per year) of cultural and cooperative interactions between randomly chosen adults. Multiple regression suggests that ritual relationships increase interaction rates more than kinship, and that affinal kin interact more often than dyads with no relationship. These may be important features of human sociality. Finally, yearly interaction rates along with survival data allow us to estimate expected lifetime partners for a variety of social activities, and compare those to chimpanzees. Hadza and Ache men are estimated to observe over 300 men making tools in a lifetime, whereas male chimpanzees interact with only about 20 other males in a lifetime. High intergroup interaction rates in ancestral humans may have promoted the evolution of cumulative culture. PMID:25047714

  10. Hunter-gatherer inter-band interaction rates: implications for cumulative culture.

    PubMed

    Hill, Kim R; Wood, Brian M; Baggio, Jacopo; Hurtado, A Magdalena; Boyd, Robert T

    2014-01-01

    Our species exhibits spectacular success due to cumulative culture. While cognitive evolution of social learning mechanisms may be partially responsible for adaptive human culture, features of early human social structure may also play a role by increasing the number potential models from which to learn innovations. We present interview data on interactions between same-sex adult dyads of Ache and Hadza hunter-gatherers living in multiple distinct residential bands (20 Ache bands; 42 Hadza bands; 1201 dyads) throughout a tribal home range. Results show high probabilities (5%-29% per year) of cultural and cooperative interactions between randomly chosen adults. Multiple regression suggests that ritual relationships increase interaction rates more than kinship, and that affinal kin interact more often than dyads with no relationship. These may be important features of human sociality. Finally, yearly interaction rates along with survival data allow us to estimate expected lifetime partners for a variety of social activities, and compare those to chimpanzees. Hadza and Ache men are estimated to observe over 300 men making tools in a lifetime, whereas male chimpanzees interact with only about 20 other males in a lifetime. High intergroup interaction rates in ancestral humans may have promoted the evolution of cumulative culture. PMID:25047714

  11. Mother-child interactional patterns in high-and low-risk mothers

    Microsoft Academic Search

    Joel S. Milner

    1997-01-01

    Objective: The aim of the present study was to determine the extent to which mother-child interactional patterns in high-and low-risk (for child physical abuse) mothers were similar to patterns observed in physically abusive parents.Method: Ten high-risk and 10 demographically similar low-risk mother-child dyads were studied. Trained observers coded maternal-child interaction patterns in the home during five 1-hour periods using the

  12. Analyzing the Utility of Dyadic Parent-Child Interaction Coding System (DPICS) Warm-Up Segments

    Microsoft Academic Search

    Timothy Thornberry Jr; Elizabeth Brestan-Knight

    2011-01-01

    Analogue behavioral observations are an important component of multi-modal, multi-informant assessments. The Dyadic Parent-Child\\u000a Interaction Coding System (DPICS) is a structured behavior observation system developed to assess the frequency and quality\\u000a of parent and child behaviors during a structured dyadic interaction. The DPICS includes two, five-minute warm-up (WU) segments\\u000a before coded segments; these WU segments are thought to allow dyads

  13. Attenuation of reserpine-induced pain/depression dyad by gentiopicroside through downregulation of GluN2B receptors in the amygdala of mice.

    PubMed

    Liu, Shui-bing; Zhao, Rong; Li, Xu-sheng; Guo, Hong-ju; Tian, Zhen; Zhang, Nan; Gao, Guo-dong; Zhao, Ming-gao

    2014-06-01

    Epidemiological studies demonstrate that pain frequently occurs comorbid with depression. Gentiopicroside (Gent) is a secoiridoid compound isolated from Gentiana lutea that exhibits analgesic properties and inhibits the expression of GluN2B-containing N-methyl-D-aspartate (NMDA) receptors in the anterior cingulate cortex of mice. However, the effects of Gent on the reserpine-induced pain/depression dyad and its underlying mechanisms are unclear. Reserpine administration (1 mg/kg subcutaneous daily for 3 days) caused a significant decrease in the nociceptive threshold as evidenced by the reduced paw withdrawal latency in response to a radiant heat source and mechanical allodynia. Behavioral detection indicated a significant increase in immobility time during a forced swim test, as well as decreased time in the central area and total travel distance in an open field test. Furthermore, reserpinized animals exhibited increased oxidative stress. Systemic Gent administration dose-dependently ameliorated the behavioral deficits associated with reserpine-induced pain/depression dyad. At the same time, the decrease in biogenic amine levels (norepinephrine, dopamine, and serotonin) was integrated with the increase in caspase-3 levels and GluN2B-containing NMDA receptors in the amygdala of the reserpine-injected mice. Gent significantly reversed the changes in the levels of biogenic amines, caspase-3, and GluN2B-containing NMDA receptors in amygdala. However, Gent did not affect the expression of GluN2A-containing NMDA receptors. The inhibitory effects of Gent on oxidative stress were occluded by simultaneous treatment of GluN2B receptors antagonist Ro25-6981. Our study provides strong evidence that Gent inhibits reserpine-induced pain/depression dyad by downregulating GluN2B receptors in the amygdala. PMID:24584520

  14. It's Not Just Your Goal, but Also Who You Know: How the Cognitive Associations among Goals and Relationships Influence Goal Detection in Social Interaction

    ERIC Educational Resources Information Center

    Palomares, Nicholas A.

    2009-01-01

    An experiment tested a theoretical framework for goal detection in dyadic interactions of close friends and unacquainted strangers wherein one conversationalist pursued a goal unbeknownst to a detector. The extent to which pursuers' conversation goal was cognitively associated with the dyad's relational type was manipulated. As hypothesized,…

  15. Postpartum Depression: Is It a Condition Affecting the Mother-Infant Interaction and the Development of the Child across the First Year of Life?

    ERIC Educational Resources Information Center

    Figueiredo, B.

    Noting that maternal depression is common during a baby's first year, this study examined the interaction of depressed and non-depressed mother-child dyads. A sample of 26 first-time mothers with postpartum depression at the third month after birth and their 3-month-old infants was compared to a sample of 25 first-time mothers with no postpartum…

  16. Communication: Charge-transfer rate constants in zinc-porphyrin-porphyrin-derived dyads: A Fermi golden rule first-principles-based study

    SciTech Connect

    Manna, Arun K.; Dunietz, Barry D., E-mail: bdunietz@kent.edu [Department of Chemistry, Kent State University, Kent, Ohio 44242 (United States)

    2014-09-28

    We investigate photoinduced charge transfer (CT) processes within dyads consisting of porphyrin derivatives in which one ring ligates a Zn metal center and where the rings vary by their degree of conjugation. Using a first-principles approach, we show that molecular-scale means can tune CT rates through stabilization affected by the polar environment. Such means of CT tuning are important for achieving high efficiency optoelectronic applications using organic semiconducting materials. Our fully quantum mechanical scheme is necessary for reliably modeling the CT process across different regimes, in contrast to the pervading semi-classical Marcus picture that grossly underestimates transfer in the far-inverted regime.

  17. Emotional variability during mother-adolescent conflict interactions: longitudinal links to adolescent disclosure and maternal control.

    PubMed

    Van der Giessen, Daniëlle; Branje, Susan; Keijsers, Loes; Van Lier, Pol A C; Koot, Hans M; Meeus, Wim

    2014-01-01

    The aim of this study was to examine relations of emotional variability during mother-adolescent conflict interactions in early adolescence with adolescent disclosure and maternal control in early and late adolescence. Data were used from 92 mother-adolescent dyads (M age T1 = 13.05; 65.20% boys) that were videotaped at T1 while discussing a conflict. Emotional variability was derived from these conflict interactions. Mothers also completed questionnaires at the start of the study (T1) and five years later (T6) on adolescent disclosure and maternal control. Path analysis showed that more emotional variability during conflict interactions in early adolescence was associated with higher levels of adolescent disclosure in early adolescence and with relative decreases in maternal control from early to late adolescence. More emotional variability of mother-adolescent dyads serves an important function in adaptively dealing with relational challenges that arise during adolescence. PMID:24331301

  18. Generation of Phosphorescent Triplet States via Photoinduced Electron Transfer: Energy and Electron Transfer Dynamics in Pt Porphyrin-Rhodamine B Dyads

    PubMed Central

    Mani, Tomoyasu; Niedzwiedzki, Dariusz M.; Vinogradov, Sergei A.

    2012-01-01

    Control over generation and dynamics of excited electronic states is fundamental to their utilization in all areas of technology. We present the first example of multichromophoric systems in which emissive triplet states are generated via a pathway involving photoinduced electron transfer (ET), as opposed to local intrachromophoric processes. In model dyads, PtP-Phn-pRhB+ (1-3, n=1-3), comprising platinum(II) meso-tetraarylporphyrin (PtP) and rhodamine B piperazine derivative (pRhB+), linked by oligo-p-phenylene bridges (Phn), upon selective excitation of pRhB+ at a frequency below that of the lowest allowed transition of PtP, room-temperature T1?S0 phosphorescence of PtP was observed. The pathway leading to the emissive PtP triplet state includes excitation of pRhB+, ET with formation of the singlet radical pair, intersystem crossing within that pair and subsequent radical recombination. Due to the close proximity of the triplet energy levels of PtP and pRhB+, reversible triplet-triplet (TT) energy transfer between these states was observed in dyads 1 and 2. As a result, the phosphorescence of PtP was extended in time by the long decay of the pRhB+ triplet. Observation of ET and TT in the same series of molecules enabled direct comparison of the distance attenuation factors ? between these two closely related processes. PMID:22400988

  19. 2-(2-Hydroxyphenyl)-benzothiazole (HBT)-Rhodamine Dyad: Acid-Switchable Absorption and Fluorescence of Excited-State Intramolecular Proton Transfer (ESIPT).

    PubMed

    Majumdar, Poulomi; Zhao, Jianzhang

    2015-02-12

    Dyad was prepared by link rhodamine and excited state intramolecular proton transfer (ESIPT) chromophore 2-(2-hydroxyphenyl)-benzothiazole (HBT) using Click reaction, with the goal to switch the absorption/emission property of ESIPT chromophore. The photophysical properties of the dyad were studied with steady state and time-resolved absorption and emission spectroscopy. In the absence of acid, that is, with rhodamine is in spirolactam structure, ESIPT was observed, the enol form emission of HBT unit was observed at 404 nm in protic solvents. In aprotic solvents, emission of the keto form of HBT was observed at 543 nm. With addition of acid such as trifluoroacetic acid, the rhodamine unit transforms to the opened amide structure, intense absorption band at 554 nm developed, as well as a strong fluorescence band at 579 nm; in EtOH, the enol emission of HBT at 406 nm was not quenched by the resonance energy transfer (RET), thus, dual fluorescence was observed. In dichloromethane, however, the fluorescence of the keto form of HBT unit was completely quenched. Thus, the absorption and emission of the ESIPT chromophore were switched by a acid/base-activatable rhodamine chromophore. Such studies will add additional modulability to the ESIPT chromophores. PMID:25207667

  20. Perpendicular bands of 1,3,5-triazine: the ? 10\\/2 ? 14 dyad of 12C 3 14N 3H 3, 12C 3 15N 3H 3 and 13C 3 14N 3H 3

    Microsoft Academic Search

    W. Bodenmüller; M. Pfeffer; A. Ruoff; J. Schroderus; J. Walrand; G. Blanquet

    2001-01-01

    The analysis of the high resolution FTIR spectra and the diode laser spectra of the ?10(E?)\\/2?14(A?1?E?) dyad of 12C314N3H3, 12C315N3H3 and 13C314N3H3 is reported. The components of this dyad are found to form a system coupled by Fermi, l(?1,2)- and l(2,2)-resonances causing an ‘infinite chain’. A truncated model of dimensions 6×6 including a virtual level was chosen accounting well for

  1. Comparative studies by using spectroscopic tools on the charge transfer (CT) band of a novel synthesized short-chain dyad in isotropic media and in a gel (P123)

    Microsoft Academic Search

    Munmun Bardhan; Tapas Misra; Joydeep Chowdhury; Tapan Ganguly

    2009-01-01

    In the present investigation the photophysics of the synthesized short-chain organic dyad, 1-(4-chloro-phenyl)-3-(4-methoxy-naphthalen-1-yl)-propenone (MNCA) has been studied both in isotropic media and gel (P123) environment by using steady state, time-resolved spectroscopic techniques and fluorescence anisotropy decay. From the NMR and time-resolved spectroscopic studies E-isomeric form (elongated nature) of the charge-transfer species of the dyad MNCA appears to be the only

  2. BODIPY–BODIPY dyad: assessing the potential as a viscometer for molecular and ionic liquids† †Electronic supplementary information (ESI) available: Details on the synthesis and purification of BODIPY dyes and ILs, sample preparations and physical properties of ILs as well as spectral data. See DOI: 10.1039/c4ra09757b Click here for additional data file.

    PubMed Central

    Kimball, Joseph D.; Raut, Sangram; Jameson, Laramie P.; Smith, Nicholas W.

    2015-01-01

    A symmetrical BODIPY–BODIPY dyad with a diyne linker was prepared in two steps; the lifetime decay of this rotor appeared to correlate with the viscosity of the media, thus making this dyad a suitable small molecule viscometer for molecular solvents. The potential of using the rotor to probe the viscosity of ionic liquids was also investigated. PMID:25844163

  3. Parental Concordance on Child Rearing and the Interactive Emphases of Parents: Sex-Differentiated Relationships During the Preschool Years

    Microsoft Academic Search

    Per F. Gjerde

    1988-01-01

    An objective index of parental concordance on child-rearing values was generated in families of 3-year-old children by comparing the independent responses of 70 parent dyads with the set of 91 Child-rearing Practices Report (CRPR) Q-items. The CRPR agreement index was then related to mother-child and father-child interaction observed 2 years later in a structured interaction situation. In families of boys,

  4. Efficacy of a Crisis Intervention in Improving Mother-Child Interaction and Children's Play Functioning.

    PubMed

    Waldman-Levi, Amiya; Weintraub, Naomi

    2015-01-01

    OBJECTIVE. We examined the efficacy of a crisis-based intervention in improving mother-child interaction and children's play functioning for families who had experienced domestic violence. METHOD. Using a pretest-posttest two-group control study design, we assigned the intervention group (n = 20 mother-child dyads) to the Family Intervention for Improving Occupational Performance (FI-OP) program and the control group (n = 17 dyads) to a playroom program. Both programs consisted of eight 30-min sessions. We videotaped dyads during free play and used standardized tools to assess interactions, play skills, and playfulness. RESULTS. After the intervention, mother-child interaction was significantly better in the FI-OP group than in the playroom group. The children in the FI-OP group also demonstrated significantly greater improvement in play skills, but not in playfulness. CONCLUSION. FI-OP is a promising program for improving aspects of mother-child interaction and children's play functioning among survivors of domestic violence. PMID:25553747

  5. Relationships among parental, event-, parenting, and life-stresses, parental behavior, and parent-child interaction

    Microsoft Academic Search

    Steven E Zimmerman

    2009-01-01

    This study examined the relationships among parental event-, parenting-, and life- stress, parental behavior, and parent-child interaction, in a non-clinical sample of 26 parent-child dyads with children 11 to 53 months, building upon a prior study (Adams, 2006), by investigating the relevance of additional parent- and parent-child dyadic behaviors. Hypotheses were: Greater event stress would be positively associated with improved

  6. Mother–child feeding interactions in children with and without weight faltering; nested case control study

    Microsoft Academic Search

    Joanne Robertson; Christine Puckering; Kathryn Parkinson; Lauren Corlett; Charlotte Wright

    2011-01-01

    Aims: To explore whether the Mellow Parenting assessment system can detect any difference in parent–child meal time interaction between children with weight faltering (failure to thrive) and normally growing children. Subjects and methods: Thirty mother–infant dyads with weight faltering and 29 healthy controls nested within the Gateshead Millennium prospective cohort study were assessed at mean age 15.6months (range 13–20). Video-tapes

  7. Developmental Continuity and Stability of Emotional Availability in the Family: Two Ages and Two Genders in Child-Mother Dyads from Two Regions in Three Countries

    PubMed Central

    Bornstein, Marc H.; Suwalsky, Joan T. D.; Putnick, Diane L.; Gini, Motti; Venuti, Paola; de Falco, Simona; Heslington, Marianne; de Galperín, Celia Zingman

    2010-01-01

    This study employs an intra-national and cross-national, prospective and longitudinal design to examine age, gender, region, and country variation in group mean-level continuity and individual-differences stability of emotional availability in child-mother dyads. Altogether, 220 Argentine, Italian, and U.S. American metropolitan and rural residence mothers and their daughters and sons were observed at home when children were 5 and 20 months of age. Similar patterns of continuity and discontinuity of emotional availability from 5 to 20 months were observed across regions and countries, but not between genders. Stability of emotional availability from 5 to 20 months was moderate and similar across genders, regions, and countries. Universal and gender-specific developmental processes in child-mother emotional availability as revealed in intra- and cross-national study are discussed. PMID:20824179

  8. Effects of Maternal Stimulant Medication on Observed Parenting in Mother-Child Dyads with Attention-Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Chronis-Tuscano, Andrea; Rooney, Mary; Seymour, Karen E.; Lavin, Heather Jones; Pian, Jessica; Robb, Adelaide; Efron, Lisa; Conlon, Charles; Stein, Mark A.

    2010-01-01

    This pilot study of 23 mothers with attention-deficit/hyperactivity disorder (ADHD) and their offspring with ADHD examined the effects of maternal stimulant medication on observed interactions. Parent-child interactions were observed using a structured protocol before and after mothers underwent a 5-week, double-blind stimulant titration. Despite…

  9. Fruits and vegetables as a healthier snack throughout the day among families with older children: Findings from a survey of parent-child dyads.

    PubMed

    Smith, Teresa M; Pinard, Courtney A; Byker Shanks, Carmen; Wethington, Holly; Blanck, Heidi M; Yaroch, Amy L

    2015-04-01

    Most U.S. youth fail to eat the recommended amount of fruits and vegetables (FV) however many consume too many calories as added sugars and solid fats, often as snacks. The aim of this study was to assess factors associated with serving FV as snacks and with meals using parent-child dyads. A cross-sectional sample of U.S. children aged 9 to 18, and their caregiver/parent (n=1522) were part of a Consumer Panel of households for the 2008 YouthStyles mail survey. Chi-square test of independence and multivariable logistic regression were used to assess associations between serving patterns of FV as snacks with variations in serving patterns, and covariates including dietary habits. Most parents (72%) reported serving FV at meals and as snacks. Fruit was most frequently served as a snack during the day (52%) and vegetables were most frequently served as a snack during the day (22%) but rarely in the morning. Significant differences in child FV intake existed among FV as a snack serving patterns by parents. Compared to children whose parents served FV only at meals, children whose parents reported serving FV as snacks in addition to meals were significantly more likely to have consumed FV the day before (using a previous day screener), P<0.05. Contributing to the growing collection of literature describing parent-child dyad dietary behaviors, these findings suggest promoting FV access and intake throughout the day, not only at meals, by including serving as snacks, may increase FV intake among older children and adolescents. PMID:25706949

  10. Crystal structures of yellowtail ascites virus VP4 protease: trapping an internal cleavage site trans acyl-enzyme complex in a native Ser/Lys dyad active site.

    PubMed

    Chung, Ivy Yeuk Wah; Paetzel, Mark

    2013-05-01

    Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala(716)) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser(633) as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637

  11. Effects of Maternal Stimulant Medication on Observed Parenting in Mother–Child Dyads With Attention-Deficit\\/Hyperactivity Disorder

    Microsoft Academic Search

    Andrea Chronis-Tuscano; Mary Rooney; Karen E. Seymour; Heather Jones Lavin; Jessica Pian; Adelaide Robb; Lisa Efron; Charles Conlon; Mark A. Stein

    2010-01-01

    This pilot study of 23 mothers with attention-deficit\\/hyperactivity disorder (ADHD) and their offspring with ADHD examined the effects of maternal stimulant medication on observed interactions. Parent–child interactions were observed using a structured protocol before and after mothers underwent a 5-week, double-blind stimulant titration. Despite dramatic effects of medication on adult ADHD symptoms, this small pilot and open label laboratory-based study

  12. Dyadic Interaction: Greater than the Sum of its Parts?

    PubMed Central

    Moore, Ginger A.; Powers, Christopher J.; Bass, Anneliese J.; Cohn, Jeffrey F.; Propper, Cathi B.; Allen, Nicholas B.; Lewinsohn, Peter M.

    2012-01-01

    The study of dyadic interaction plays a major role in infancy research. To advance conceptually-informed measurement of dyadic interaction and integration across studies, we examined factor structure of individual parents’ and infants’ measures and dyadic measures from face-to-face interactions in two samples of 6-mo-old infants and their parents: mothers from a demographically heterogeneous sample (N = 164) and mothers and fathers (N = 156) from a Caucasian middle-class sample. Results suggested: a) individual and dyadic measures, and parents’ and infants’ behaviors contribute independent information, b) measures of both valence and process are needed, c) there are context-general and context-specific qualities, and d) structure of dyadic interaction is more similar among mother-infant dyads from independent samples than between mother- and father-infant dyads within the same sample. Future research should use multiple measures incorporating valence, temporal processes, contextual influences, and behaviors of individual partners along with dyadic measures to adequately assess the quality of dyadic interaction. PMID:24187518

  13. Moving beyond the mother-child dyad: exploring the link between maternal sensitivity and siblings' attachment styles.

    PubMed

    Kennedy, Mark; Betts, Lucy R; Underwood, Jean D M

    2014-01-01

    Attachment theory asserts that secure attachment representations are developed through sensitive and consistent caregiving. If sensitive caregiving is a constant characteristic of the parent, then siblings should have concordant attachment classifications. The authors explored maternal attachment quality assessed by the Attachment Q-Set, maternal sensitivity, and specific mother-child interactions between siblings. Hour-long observations took place in the homes of 9 preschool sibling pairs and their immediate caregivers. The interactions were analyzed using a modified version of Bales' Small Group Analysis. The results reveal attachment discordance in a third of sibling pairs. While maternal sensitivity was higher with older siblings and mothers displayed more positive emotions when interacting with their younger siblings, attachment quality was not associated with birth order. Therefore, a shift toward a more contextual, family-based perspective of attachment is recommended to further understand how attachment strategies are created and maintained within the child's everyday context. PMID:25175679

  14. Acceleration of an Aromatic Claisen Rearrangement via a Designed Spiroligozyme Catalyst that Mimics the Ketosteroid Isomerase Catalytic Dyad

    PubMed Central

    2015-01-01

    A series of hydrogen-bonding catalysts have been designed for the aromatic Claisen rearrangement of a 1,1-dimethylallyl coumarin. These catalysts were designed as mimics of the two-point hydrogen-bonding interaction present in ketosteroid isomerase that has been proposed to stabilize a developing negative charge on the ether oxygen in the migration of the double bond.1 Two hydrogen bond donating groups, a phenol alcohol and a carboxylic acid, were grafted onto a conformationally restrained spirocyclic scaffold, and together they enhance the rate of the Claisen rearrangement by a factor of 58 over the background reaction. Theoretical calculations correctly predict the most active catalyst and suggest that both preorganization and favorable interactions with the transition state of the reaction are responsible for the observed rate enhancement. PMID:24456160

  15. Acceleration of an aromatic Claisen rearrangement via a designed spiroligozyme catalyst that mimics the ketosteroid isomerase catalytic dyad.

    PubMed

    Parker, Matthew F L; Osuna, Sílvia; Bollot, Guillaume; Vaddypally, Shivaiah; Zdilla, Michael J; Houk, K N; Schafmeister, Christian E

    2014-03-12

    A series of hydrogen-bonding catalysts have been designed for the aromatic Claisen rearrangement of a 1,1-dimethylallyl coumarin. These catalysts were designed as mimics of the two-point hydrogen-bonding interaction present in ketosteroid isomerase that has been proposed to stabilize a developing negative charge on the ether oxygen in the migration of the double bond.1 Two hydrogen bond donating groups, a phenol alcohol and a carboxylic acid, were grafted onto a conformationally restrained spirocyclic scaffold, and together they enhance the rate of the Claisen rearrangement by a factor of 58 over the background reaction. Theoretical calculations correctly predict the most active catalyst and suggest that both preorganization and favorable interactions with the transition state of the reaction are responsible for the observed rate enhancement. PMID:24456160

  16. Determination of preferential molecular orientation in porphyrin-fullerene dyad ZnDHD6ee monolayers by the X-ray standing-wave method and X-ray reflectometry

    NASA Astrophysics Data System (ADS)

    Seregin, A. Yu.; D'yakova, Yu. A.; Yakunin, S. N.; Makhotkin, I. A.; Alekseev, A. S.; Klechkovskaya, V. V.; Tereschenko, E. Yu.; Tkachenko, N. V.; Lemmetyinen, H.; Feigin, L. A.; Kovalchuk, M. V.

    2013-11-01

    Monolayers of porphyrin-fullerene dyad molecules with zinc atoms incorporated into the porphyrin ring (ZnDHD6ee) on the surface of aqueous subphase and on Si substrates have been investigated by the X-ray standing-wave method and X-ray reflectometry. The experiments have been performed under laboratory conditions and on synchrotron radiation sources (KMC-2 station of BESSY II (Berlin) and Langmuir station at the National Research Centre "Kurchatov Institute"). Depth distributions of Zn atoms and electron density in the monolayer film are calculated. On the basis of the analysis of these distributions, it is concluded that ZnDHD6ee dyad molecules in monolayers have preferential orientation. The data obtained indicate that the molecules in monolayer film retain their orientation when the monolayer is transferred from a liquid subphase surface onto a solid substrate.

  17. Conflict in the Latino Parent–Youth Dyad: The Role of Emotional Support From the Opposite Parent

    Microsoft Academic Search

    Hugh F. Crean

    2008-01-01

    In the present study, the author examined the independent and interactive effects of support and conflict within a triadic familial context (mother–father–youth). The sample consisted of 6th- and 7th-grade inner-city Latino youths (N = 329; 142 boys, 187 girls). Using multiple regression techniques, level of conflict with either mother or father was consistently related to higher levels of both boys'

  18. A compact tetrathiafulvalene-benzothiadiazole dyad and its highly symmetrical charge-transfer salt: ordered donor ?-stacks closely bound to their acceptors.

    PubMed

    Geng, Yan; Pfattner, Raphael; Campos, Antonio; Hauser, Jürg; Laukhin, Vladimir; Puigdollers, Joaquim; Veciana, Jaume; Mas-Torrent, Marta; Rovira, Concepció; Decurtins, Silvio; Liu, Shi-Xia

    2014-06-01

    A compact and planar donor-acceptor molecule 1 comprising tetrathiafulvalene (TTF) and benzothiadiazole (BTD) units has been synthesised and experimentally characterised by structural, optical, and electrochemical methods. Solution-processed and thermally evaporated thin films of 1 have also been explored as active materials in organic field-effect transistors (OFETs). For these devices, hole field-effect mobilities of ?FE = (1.3±0.5)×10(-3) and (2.7±0.4)×10(-3) ?cm(2) ?V?s(-1) were determined for the solution-processed and thermally evaporated thin films, respectively. An intense intramolecular charge-transfer (ICT) transition at around 495?nm dominates the optical absorption spectrum of the neutral dyad, which also shows a weak emission from its ICT state. The iodine-induced oxidation of 1 leads to a partially oxidised crystalline charge-transfer (CT) salt {(1)2I3}, and eventually also to a fully oxidised compound {1I3}?1/2I2. Single crystals of the former CT compound, exhibiting a highly symmetrical crystal structure, reveal a fairly good room temperature electrical conductivity of the order of 2?S?cm(-1). The one-dimensional spin system bears compactly bonded BTD acceptors (spatial localisation of the LUMO) along its ridge. PMID:24737663

  19. A highly selective and sensitive photoswitchable fluorescent probe for Hg2+ based on bisthienylethene-rhodamine 6G dyad and for live cells imaging

    NASA Astrophysics Data System (ADS)

    Xu, Li; Wang, Sheng; Lv, Yingnian; Son, Young-A.; Cao, Derong

    2014-07-01

    A new photochromic diarylethene derivative bearing rhodamine 6G dimmer as a fluorescent molecular probe is designed and synthesized successfully. All the compounds are characterized by nuclear magnetic resonance and mass spectrometry. The bisthienylethene-rhodamine 6G dyad exhibit excellent phtochromism with reversibly color and fluorescence changes alternating irradiation with ultraviolet and visible light. Upon addition of Hg2+, its color changes from colorless to red and its fluorescence is remarkably enhanced. Whereas other ions including K+, Na+, Ca2+, Mg2+, Fe2+, Co2+, Ni2+, Cu2+, Zn2+, Mn2+, Pb2+, Ni2+, Fe3+, Al3+, Cr3+ and so on induce basically no spectral changes, which constitute a highly selective and sensitive photoswitchable fluorescent probe toward Hg2+. Furthermore, by means of laser confocal scanning microscopy experiments, it is demonstrated that this probe can be applied for live cell imaging and monitoring Hg2+ in living lung cancer cells with satisfying results, which shows its value of potential application in environmental and biological systems.

  20. School-based nutrition programs are associated with reduced child food insecurity over time among Mexican-origin mother-child dyads in Texas Border Colonias.

    PubMed

    Nalty, Courtney C; Sharkey, Joseph R; Dean, Wesley R

    2013-05-01

    In 2011, an estimated 50.2 million adults and children lived in US households with food insecurity, a condition associated with adverse health effects across the life span. Relying solely on parent proxy may underreport the true prevalence of child food insecurity. The present study sought to understand mothers' and children's (aged 6-11 y) perspectives and experiences of child food insecurity and its seasonal volatility, including the effects of school-based and summertime nutrition programs. Forty-eight Mexican-origin mother-child dyads completed standardized, Spanish-language food-security instruments during 2 in-home visits between July 2010 and March 2011. Multilevel longitudinal logistic regression measured change in food security while accounting for correlation in repeated measurements by using a nested structure. Cohen's ? statistic assessed dyadic discordance in child food insecurity. School-based nutrition programs reduced the odds of child food insecurity by 74% [OR = 0.26 (P < 0.01)], showcasing the programs' impact on the condition. Single head of household was associated with increased odds of child food insecurity [OR = 4.63 (P = 0.03)]. Fair dyadic agreement of child food insecurity was observed [? = 0.21 (P = 0.02)]. Obtaining accurate prevalence rates and understanding differences of intrahousehold food insecurity necessitate measurement at multiple occasions throughout the year while considering children's perceptions and experiences of food insecurity in addition to parental reports. PMID:23486977

  1. Conflict in the Latino parent-youth dyad: the role of emotional support from the opposite parent.

    PubMed

    Crean, Hugh F

    2008-06-01

    In the present study, the author examined the independent and interactive effects of support and conflict within a triadic familial context (mother-father-youth). The sample consisted of 6th- and 7th-grade inner-city Latino youths (N = 329; 142 boys, 187 girls). Using multiple regression techniques, level of conflict with either mother or father was consistently related to higher levels of both boys' and girls' internalizing and externalizing symptoms. Interaction effects were significant in predicting boys' externalizing behavior problems--a supportive parental relationship significantly reduced the risk associated with high conflict with the opposite parent. For boys' internalizing problems, mother and father support served a protective function regardless of the level of conflict with the opposite parent. Conflict with the mother was especially detrimental for Latina girls--highly conflictive mother-daughter relationships were associated with increased internalizing and externalizing symptomatology, and father support added little in predicting symptomatology. The study adds to the understanding of risk and protection in Latino families and underscores the importance of examining the parent-youth relationship from a triadic perspective, noting similarities and differences in mother-son, mother-daughter, father-son, and father-daughter relations. PMID:18540777

  2. Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.

    PubMed

    Yoon, S O; Chikaraishi, D M

    1994-07-15

    The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo. PMID:7913462

  3. Activation During Observed Parent–Child Interactions with Anxious Youths: A Pilot Study

    Microsoft Academic Search

    Araceli Gonzalez; Phoebe S. Moore; Abbe M. Garcia; Margo Thienemann; Lynne Huffman

    2011-01-01

    Parent–child interaction paradigms are often used to observe dysfunctional family processes; however, the influence of such\\u000a tasks on a participant’s level of activation remain unclear. The aim of this pilot project is to explore the stimulus value\\u000a of interaction paradigms that have been commonly used in child anxiety research. Twenty-nine parent–child dyads with clinically\\u000a anxious (n?=?16) and non-anxious (n?=?13) youths

  4. Electrochemistry of the self-assembled monolayers of dyads consisting of tripod-shaped trithiol and bithiophene on gold.

    PubMed

    Kitagawa, Toshikazu; Matsubara, Hiroaki; Okazaki, Takao; Komatsu, Koichi

    2014-01-01

    Self-assembled monolayers (SAMs) of tripod-shaped trithiols, consisting of an adamantane core with three CH2SH legs and a bithiophene group, were prepared on a Au(111) surface. Adsorption in a tripod-like fashion was supported by polarization modulation-infrared reflection absorption spectroscopy (PM-IRRAS) of the SAMs, which indicated the absence of free SH groups. Cyclic voltammetry showed an irreversible cathodic wave due to reductive desorption. The SAM also showed an anodic wave due to the single-electron oxidation of the bithiophene moiety without concomitant desorption of the molecules. Although oxidation was irreversible in the absence of a protecting group, it became reversible with the introduction of a terminal phenyl group. The charge of the oxidation was one-third that of the reductive desorption, confirming a three-point adsorption. The surface coverage was ca. 50% of that expected for the anti bithiophene conformation, which suggested that an increase in the surface area per molecule had been caused by the presence of an energetically high-lying syn conformer. In accordance with this, the line shape of the oxidation wave suggested an electrostatic repulsive interaction between neighboring molecules. PMID:25255246

  5. Brain-Mind Dyad, Human Experience, the Consciousness Tetrad and Lattice of Mental Operations: And Further, The Need to Integrate Knowledge from Diverse Disciplines

    PubMed Central

    Singh, Ajai R.; Singh, Shakuntala A.

    2011-01-01

    Brain, Mind and Consciousness are the research concerns of psychiatrists, psychologists, neurologists, cognitive neuroscientists and philosophers. All of them are working in different and important ways to understand the workings of the brain, the mysteries of the mind and to grasp that elusive concept called consciousness. Although they are all justified in forwarding their respective researches, it is also necessary to integrate these diverse appearing understandings and try and get a comprehensive perspective that is, hopefully, more than the sum of their parts. There is also the need to understand what each one is doing, and by the other, to understand each other’s basic and fundamental ideological and foundational underpinnings. This must be followed by a comprehensive and critical dialogue between the respective disciplines. Moreover, the concept of mind and consciousness in Indian thought needs careful delineation and critical/evidential enquiry to make it internationally relevant. The brain-mind dyad must be understood, with brain as the structural correlate of the mind, and mind as the functional correlate of the brain. To understand human experience, we need a triad of external environment, internal environment and a consciousness that makes sense of both. We need to evolve a consensus on the definition of consciousness, for which a working definition in the form of a Consciousness Tetrad of Default, Aware, Operational and Evolved Consciousness is presented. It is equally necessary to understand the connection between physical changes in the brain and mental operations, and thereby untangle and comprehend the lattice of mental operations. Interdisciplinary work and knowledge sharing, in an atmosphere of healthy give and take of ideas, and with a view to understand the significance of each other’s work, and also to critically evaluate the present corpus of knowledge from these diverse appearing fields, and then carry forward from there in a spirit of cooperative but evidential and critical enquiry – this is the goal for this monograph, and the work to follow. PMID:21694960

  6. Maternal post-traumatic stress disorder, depression and alcohol dependence and child behaviour outcomes in mother–child dyads infected with HIV: a longitudinal study

    PubMed Central

    Nöthling, Jani; Martin, Cherie L; Laughton, Barbara; Cotton, Mark F; Seedat, Soraya

    2013-01-01

    Objectives HIV and psychiatric disorders are prevalent and often concurrent. Childbearing women are at an increased risk for both HIV and psychiatric disorders, specifically depression and post-traumatic stress disorder (PTSD). Poor mental health in the peripartum period has adverse effects on infant development and behaviour. Few studies have investigated the relationship between maternal PTSD and child behaviour outcomes in an HIV vertically infected sample. The aim of this study was to investigate whether maternal postpartum trauma exposure and PTSD were risk factors for child behaviour problems. In addition, maternal depression, alcohol abuse and functional disability were explored as cofactors. Setting The study was conducted in Cape Town, South Africa. Participants 70 mother–child dyads infected with HIV were selected from a group of participants recruited from community health centres. Design The study followed a longitudinal design. Five measures were used to assess maternal trauma exposure, PTSD, depression, alcohol abuse and functional disability at 12?months postpartum: Life Events Checklist (LEC), Harvard Trauma Scale (HTS), Alcohol Use Disorders Identification Test (AUDIT), Center for Epidemiological Studies Depression (CESD) Scale and the Sheehan Disability Scale (SDS). Child behaviour was assessed at 42?months with the Child Behaviour Checklist (CBCL). Results The rate of maternal disorder was high with 50% scoring above the cut-off for depression, 22.9% for PTSD and 7% for alcohol abuse. Half of the children scored within the clinical range for problematic behaviour. Children of mothers with depression were significantly more likely to display total behaviour problems than children of mothers without depression. Maternal PTSD had the greatest explanatory power for child behaviour problems, although it did not significantly predict child outcomes. Conclusions This study highlights the importance of identifying and managing maternal PTSD and depression in mothers of children infected with HIV. The relationship between maternal PTSD and child behaviour warrants further investigation. PMID:24334155

  7. Brain-mind dyad, human experience, the consciousness tetrad and lattice of mental operations: and further, the need to integrate knowledge from diverse disciplines.

    PubMed

    Singh, Ajai R; Singh, Shakuntala A

    2011-01-01

    Brain, Mind and Consciousness are the research concerns of psychiatrists, psychologists, neurologists, cognitive neuroscientists and philosophers. All of them are working in different and important ways to understand the workings of the brain, the mysteries of the mind and to grasp that elusive concept called consciousness. Although they are all justified in forwarding their respective researches, it is also necessary to integrate these diverse appearing understandings and try and get a comprehensive perspective that is, hopefully, more than the sum of their parts. There is also the need to understand what each one is doing, and by the other, to understand each other's basic and fundamental ideological and foundational underpinnings. This must be followed by a comprehensive and critical dialogue between the respective disciplines. Moreover, the concept of mind and consciousness in Indian thought needs careful delineation and critical/evidential enquiry to make it internationally relevant. The brain-mind dyad must be understood, with brain as the structural correlate of the mind, and mind as the functional correlate of the brain. To understand human experience, we need a triad of external environment, internal environment and a consciousness that makes sense of both. We need to evolve a consensus on the definition of consciousness, for which a working definition in the form of a Consciousness Tetrad of Default, Aware, Operational and Evolved Consciousness is presented. It is equally necessary to understand the connection between physical changes in the brain and mental operations, and thereby untangle and comprehend the lattice of mental operations. Interdisciplinary work and knowledge sharing, in an atmosphere of healthy give and take of ideas, and with a view to understand the significance of each other's work, and also to critically evaluate the present corpus of knowledge from these diverse appearing fields, and then carry forward from there in a spirit of cooperative but evidential and critical enquiry - this is the goal for this monograph, and the work to follow. PMID:21694960

  8. Direct observation of hole shift and characterization of spin states in radical ion pairs generated from photoinduced electron transfer of (phenothiazine)(n)-anthraquinone (n = 1, 3) dyads.

    PubMed

    Karimata, Ayumu; Suzuki, Shuichi; Kozaki, Masatoshi; Kimoto, Kenshi; Nozaki, Koichi; Matsushita, Hironori; Ikeda, Noriaki; Akiyama, Kimio; Kosumi, Daisuke; Hashimoto, Hideki; Okada, Keiji

    2014-11-26

    Photoinduced intramolecular electron transfer of dyad PTZ3-PTZ2-PTZ1-B-AQ consisting of phenothiazine trimer (PTZ3-PTZ2-PTZ1), bicyclo[2.2.2]octane (B), and anthraquinone (AQ) was investigated. After excitation (?20 ps) of the AQ moiety in THF, a metastable radical ion pair (RIP) PTZ3-PTZ2-PTZ1(+)-B-AQ(-) appeared at ?620 nm. From 500 ps to 6 ns the spectrum changed to a new absorption (?950 nm), which was assigned to the hole-shifted stable RIP state PTZ3-PTZ2(+)-PTZ1-B-AQ(-). The time constant of the hole-shift process was determined to be 6.0 ns. The hole-shifted RIP state had a lifetime (?) of 250 ns and was characterized by spin-polarized signals as a spin-correlated radical pair (SCRP) by means of time-resolved ESR. These results were compared with those for the phenothiazine monomer analog PTZ-B-AQ, which also produced the RIP state PTZ(+)-B-AQ(-) with ? = 1.9 ?s. Time-resolved ESR showed an all emission signal pattern showing the triplet mechanism of PTZ-B-(3)AQ* ? (3)[PTZ(+)-B-AQ(-)]. The origin of the difference in the lifetimes between the trimer and the monomer RIP states was discussed from various points of view, including free energy difference in the RIP states, reorganization energy difference in the charge recombination process, and the spin-state difference. Of these, the spin-state difference effect provided the most reasonable explanation. PMID:25347200

  9. Maternal cocaine use: estimated effects on mother-child play interactions in the preschool period.

    PubMed

    Johnson, Arnise L; Morrow, Connie E; Accornero, Veronica H; Xue, Lihua; Anthony, James C; Bandstra, Emmalee S

    2002-08-01

    The study objective was to evaluate the quality of parent-child interactions in preschool-aged children exposed prenatally to cocaine. African-American mothers and their full-term newborns (n = 343) were enrolled prospectively at birth and classified as either prenatally cocaine-exposed (n = 157) or non-cocaine-exposed (n = 186) on the basis of maternal self-report and bioassays. Follow-up evaluations at 3 years of age (mean age, 40 mo) included a videotaped dyadic play session and maternal interviews to assess ongoing drug use and maternal psychological distress. Play interactions were coded using a modified version of Egeland et al's Teaching Task coding scheme. Regression analyses indicated cocaine-associated deficits in mother-child interaction, even with statistical adjustment for multiple suspected influences on interaction dynamics. Mother-child interactions were most impaired in cocaine-exposed dyads when the mother continued to report cocaine use at the 3-year follow-up. Multivariate profile analysis of the Egeland interaction subscales indicated greater maternal intrusiveness and hostility, poorer quality of instruction, lower maternal confidence, and diminished child persistence in the cocaine-exposed dyads. PMID:12177564

  10. Cobalt(IV) corroles as catalysts for the electroreduction of O 2: Reactions of heterobimetallic dyads containing a face-to-face linked Fe(III) or Mn(III) porphyrin

    Microsoft Academic Search

    Karl M. Kadish; Laurent Frémond; Fabien Burdet; Jean-Michel Barbe; Claude P. Gros; Roger Guilard

    2006-01-01

    A series of heterobinuclear cofacial porphyrin–corrole dyads containing a Co(IV) corrole linked by one of four different spacers in a face-to-face arrangement with an Fe(III) or Mn(III) porphyrin have been examined as catalysts for the electroreduction of O2 to H2O and\\/or H2O2 when adsorbed on the surface of a graphite electrode in air-saturated aqueous solutions containing 1M HClO4. The examined

  11. Sensitisation of Eu(III)- and Tb(III)-based luminescence by Ir(III) units in Ir/lanthanide dyads: evidence for parallel energy-transfer and electron-transfer based mechanisms.

    PubMed

    Sykes, Daniel; Cankut, Ahmet J; Ali, Noorshida Mohd; Stephenson, Andrew; Spall, Steven J P; Parker, Simon C; Weinstein, Julia A; Ward, Michael D

    2014-05-01

    A series of blue-luminescent Ir(III) complexes with a pendant binding site for lanthanide(III) ions has been synthesized and used to prepare Ir(III)/Ln(III) dyads (Ln = Eu, Tb, Gd). Photophysical studies were used to establish mechanisms of Ir?Ln (Ln = Tb, Eu) energy-transfer. In the Ir/Gd dyads, where direct Ir?Gd energy-transfer is not possible, significant quenching of Ir-based luminescence nonetheless occurred; this can be ascribed to photoinduced electron-transfer from the photo-excited Ir unit (*Ir, (3)MLCT/(3)LC excited state) to the pendant pyrazolyl-pyridine site which becomes a good electron-acceptor when coordinated to an electropositive Gd(III) centre. This electron transfer quenches the Ir-based luminescence, leading to formation of a charge-separated {Ir(4+)}?-(pyrazolyl-pyridine)?(-) state, which is short-lived possibly due to fast back electron-transfer (<20 ns). In the Ir/Tb and Ir/Eu dyads this electron-transfer pathway is again operative and leads to sensitisation of Eu-based and Tb-based emission using the energy liberated from the back electron-transfer process. In addition direct Dexter-type Ir?Ln (Ln = Tb, Eu) energy-transfer occurs on a similar timescale, meaning that there are two parallel mechanisms by which excitation energy can be transferred from *Ir to the Eu/Tb centre. Time-resolved luminescence measurements on the sensitised Eu-based emission showed both fast and slow rise-time components, associated with the PET-based and Dexter-based energy-transfer mechanisms respectively. In the Ir/Tb dyads, the Ir?Tb energy-transfer is only just thermodynamically favourable, leading to rapid Tb?Ir thermally-activated back energy-transfer and non-radiative deactivation to an extent that depends on the precise energy gap between the *Ir and Tb-based (5)D4 states. Thus, the sensitised Tb(iii)-based emission is weak and unusually short-lived due to back energy transfer, but nonetheless represents rare examples of Tb(III) sensitisation by a energy donor that could be excited using visible light as opposed to the usually required UV excitation. PMID:24608523

  12. Intimate Partner Violence Functions as both a Risk Marker and Risk Factor for Women’s HIV Infection: Findings from Indian Husband-Wife Dyads

    PubMed Central

    Decker, Michele R.; Seage, George R.; Hemenway, David; Raj, Anita; Saggurti, Niranjan; Balaiah, Donta; Silverman, Jay G.

    2012-01-01

    Context and Objective Female victims of intimate partner violence (IPV) consistently demonstrate elevated STI/HIV prevalence. IPV is thought to function indirectly as a marker of abusive men’s elevated STI/HIV infection and/or directly via facilitating transmission to wives. The present examination utilizes a nationally representative sample of married Indian couples to test these mechanisms and determine whether 1) abusive husbands demonstrate higher HIV infection prevalence compared with non-abusive husbands, and 2) the risk of wives’ HIV infection based on husbands’ HIV infection varies as a function of their exposure to IPV. Design, Setting and Participants The Indian National Family Health Survey-3 (NFHS-3) was conducted across all Indian states in 2005-2006. Analyses were limited to 20,425 husband-wife dyads which provided both IPV data and HIV test results. Analyses Logistic regression models estimated the odds ratios and 95% confidence intervals to evaluate the following associations: 1) husband’s HIV acquisition outside the marital relationship based on their perpetration of IPV and 2) wives’ HIV infection based on husbands’ HIV infection, as a function of their IPV exposure. Results One-third (37.4%) of wives experienced IPV; 0.4% of husbands and 0.2% of wives were HIV infected. Compared with non-abusive husbands, abusive husbands demonstrated increased odds of HIV acquisition outside the marital relationship in adjusted models (AOR=1.91; 95% CI 1.11, 3.27). Husband HIV infection was associated with increased HIV risk among wives; this risk was elevated sevenfold in abusive relationships in adjusted models (AOR =7.22; 95% CI 1.05, 49.88). Conclusions Findings provide the first empirical evidence that abused wives face increased HIV risk based both on the greater likelihood of HIV infection among abusive husbands, as well elevated HIV transmission within abusive relationships. Thus, IPV appears to function both as a risk marker and as a risk factor for HIV among women, indicating the need for interwoven efforts to prevent both men’s sexual risk and IPV perpetration. PMID:19421070

  13. Relational Demography in Coaching Dyads

    ERIC Educational Resources Information Center

    Sagas, Michael; Paetzold, Ramona; Ashley, Frank

    2005-01-01

    The decline in the proportion of female head coaches in the intercollegiate ranks is one of the most significant issues in the realm of women's sports today. To extend the body of research that has studied this topic, we investigated the impact relational demographic effects on the work attitudes of coaches, which differs from previous research…

  14. Parent-child interactions in autism: characteristics of play.

    PubMed

    Freeman, Stephanny; Kasari, Connie

    2013-03-01

    Although the literature on parent-child interactions in young children with autism has examined dyadic style, synchrony, and sustained engagement, the examination of parental skill in sustaining and developing play skills themselves has not been targeted. This study examined the extent to which parents of young children with autism match and scaffold their child's play. Sixteen dyads of parents and their children with autism participated in this study along with 16 matched dyads of typically developing children. Both groups were administered a structured play assessment and were observed during a 10-min free play situation. Strategies of play were examined and results revealed that parents of children with autism initiated more play schemes and suggested and commanded play acts more than parents of typical children. They also responded to their child's play acts more often with a higher level play act, while parents of typical children matched/expanded their responses to their child. Parent imitation was also related to longer sequences of play. The findings can guide further research and play intervention for parents. PMID:23382513

  15. Effects of familiar and unfamiliar objects on mother-infant interaction

    Microsoft Academic Search

    Agnés Danis

    1997-01-01

    The purpose of this study was to determine whether the dynamics and structure of mother-child interactions around toys vary\\u000a with the familiarity of toys. Twelve mother-child dyads with a 5- or 9-month-old infant were filmed two consecutive 5-minute\\u000a sessions in the presence of familiar or novel objects. By relating the mother’s behaviour to her infant’s, we were able to\\u000a define

  16. Information flow between interacting human brains: Identification, validation, and relationship to social expertise.

    PubMed

    Bilek, Edda; Ruf, Matthias; Schäfer, Axel; Akdeniz, Ceren; Calhoun, Vince D; Schmahl, Christian; Demanuele, Charmaine; Tost, Heike; Kirsch, Peter; Meyer-Lindenberg, Andreas

    2015-04-21

    Social interactions are fundamental for human behavior, but the quantification of their neural underpinnings remains challenging. Here, we used hyperscanning functional MRI (fMRI) to study information flow between brains of human dyads during real-time social interaction in a joint attention paradigm. In a hardware setup enabling immersive audiovisual interaction of subjects in linked fMRI scanners, we characterize cross-brain connectivity components that are unique to interacting individuals, identifying information flow between the sender's and receiver's temporoparietal junction. We replicate these findings in an independent sample and validate our methods by demonstrating that cross-brain connectivity relates to a key real-world measure of social behavior. Together, our findings support a central role of human-specific cortical areas in the brain dynamics of dyadic interactions and provide an approach for the noninvasive examination of the neural basis of healthy and disturbed human social behavior with minimal a priori assumptions. PMID:25848050

  17. Compulsory citizenship behavior and organizational citizenship behavior: the role of organizational identification and perceived interactional justice.

    PubMed

    Zhao, Hongdan; Peng, Zhenglong; Chen, Hsiu-Kuei

    2014-01-01

    This article examines the psychological mechanism underlying the relationship between compulsory citizenship behavior (CCB) and organizational citizenship behavior (OCB) by developing a moderated mediation model. The model focuses on the mediating role of organizational identification and the moderating role of interactional justice in influencing the mediation. Using a time-lagged research design, the authors collected two waves of data from 388 supervisor-subordinate dyads in 67 teams to test the moderated mediation model. Results revealed that CCB negatively influenced OCB via impairing organizational identification. Moreover, interactional justice moderated the strength of the indirect effect of CCB on OCB (through organizational identification), such that the mediated relationship was stronger under low interactional justice than under high interactional justice. PMID:24684078

  18. Control of Sarcoplasmic Reticulum Ca2+ Release by Stochastic RyR Gating within a 3D Model of the Cardiac Dyad and Importance of Induction Decay for CICR Termination

    PubMed Central

    Cannell, M.B.; Kong, C.H.T.; Imtiaz, M.S.; Laver, D.R.

    2013-01-01

    The factors responsible for the regulation of regenerative calcium-induced calcium release (CICR) during Ca2+ spark evolution remain unclear. Cardiac ryanodine receptor (RyR) gating in rats and sheep was recorded at physiological Ca2+, Mg2+, and ATP levels and incorporated into a 3D model of the cardiac dyad, which reproduced the time course of Ca2+ sparks, Ca2+ blinks, and Ca2+ spark restitution. The termination of CICR by induction decay in the model principally arose from the steep Ca2+ dependence of RyR closed time, with the measured sarcoplasmic reticulum (SR) lumen Ca2+ dependence of RyR gating making almost no contribution. The start of CICR termination was strongly dependent on the extent of local depletion of junctional SR Ca2+, as well as the time course of local Ca2+ gradients within the junctional space. Reducing the dimensions of the dyad junction reduced Ca2+ spark amplitude by reducing the strength of regenerative feedback within CICR. A refractory period for Ca2+ spark initiation and subsequent Ca2+ spark amplitude restitution arose from 1), the extent to which the regenerative phase of CICR can be supported by the partially depleted junctional SR, and 2), the availability of releasable Ca2+ in the junctional SR. The physical organization of RyRs within the junctional space had minimal effects on Ca2+ spark amplitude when more than nine RyRs were present. Spark amplitude had a nonlinear dependence on RyR single-channel Ca2+ flux, and was approximately halved by reducing the flux from 0.6 to 0.2 pA. Although rat and sheep RyRs had quite different Ca2+ sensitivities, Ca2+ spark amplitude was hardly affected. This suggests that moderate changes in RyR gating by second-messenger systems will principally alter the spatiotemporal properties of SR release, with smaller effects on the amount released. PMID:23708355

  19. The Origins of 12-Month Attachment: A Microanalysis of 4-Month Mother-Infant Interaction

    PubMed Central

    Beebe, Beatrice; Jaffe, Joseph; Markese, Sara; Buck, Karen; Chen, Henian; Cohen, Patricia; Bahrick, Lorraine; Andrews, Howard; Feldstein, Stanley

    2013-01-01

    A detailed microanalysis of 4-month mother-infant face-to-face communication revealed a fine-grained specification of essential communication processes that predicted 12-month insecure attachment outcomes, particularly resistant and disorganized classifications. An urban community sample of 84 dyads were videotaped at 4 months during a face-to-face interaction, and at 12 months during the Ainsworth Strange Situation. Four-month mother and infant communication modalities of attention, affect, touch, and spatial orientation were coded from split-screen videotape on a 1s time base; mother and infant facial-visual “engagement” variables were constructed. We used contingency measures (multi-level time-series modeling) to examine the dyadic temporal process over time, and specific rates of qualitative features of behavior to examine the content of behavior. Self-contingency (auto-correlation) measured the degree of stability/lability within an individual’s own rhythms of behavior; interactive contingency (lagged cross-correlation) measured adjustments of the individual’s behavior that were correlated with the partner’s previous behavior. We documented that both self- and interactive contingency, as well as specific qualitative features, of mother and infant behavior were mechanisms of attachment formation by 4 months, distinguishing 12-month insecure, resistant, and disorganized attachment classifications from secure; avoidant were too few to test. All communication modalities made unique contributions. The separate analysis of different communication modalities identified intermodal discrepancies or conflict, both intrapersonal and interpersonal, that characterized insecure dyads. Contrary to dominant theories in the literature on face-to-face interaction, measures of maternal contingent coordination with infant yielded the fewest associations with 12-month attachment, whereas mother and infant self-contingency, and infant contingent coordination with mother, yielded comparable numbers of findings. Rather than the more usual hypothesis that more contingency is “better,” we partially supported our hypothesis that 12-month insecurity is associated with both higher and lower 4-month self- and interactive contingency values than secure, as a function of mother vs. infant and communication modality. Thus, in the origins of attachment security, more contingency is not necessarily better. A remarkable degree of differentiation was identified in the 4-month patterns of “future” C and D infants, classified as resistant and disorganized, respectively, at 12 months. Only future D infants were emotionally distressed, with simultaneous positive and negative discrepant affect; only their mothers showed difficulty in sharing infant affect, particularly distress, and lowered their contingent coordination with infant facial-visual engagement. This lowered contingent coordination makes it more difficult for infants to come to expect that their emotional/attentional states can influence mothers to coordinate with them and thus compromises the infant’s sense of interactive efficacy. Only future C dyads showed the spatial approach/avoid pattern of “chase and dodge;” only mothers of future D infants showed the spatial intrusion pattern of “looming” into the infant’s face. Both future C and D dyads showed patterns of touch dysregulation. Future C infants inhibited their emotional coordination with mothers’ less affectionate touch, as if tuning it out. Future D dyads showed a dyadic touch dysregulation, in which mothers lowered their coordination with infant touch, while infants had a lowered ability to use their own touch. Both mothers of future C and D infants disturbed the stability of the spatial “frame” of the encounter by transitioning among upward, forward and loom orientations in less predictable ways than mothers of future B infants. Only mothers of future D infants disturbed the attentional “frame” as

  20. Maternal anxiety, mother-infant interactions, and infants' response to challenge.

    PubMed

    Kaitz, Marsha; Maytal, Hilla Rubin; Devor, Noa; Bergman, Liat; Mankuta, David

    2010-04-01

    Children of anxious mothers are at risk for social-emotional difficulties and disturbed, early interactions with their mother may account for some of the risk. This study evaluated the association between maternal anxiety, features of mother-infant interactions, and infants' emotion regulation during stressful situations (still-face, play with a stranger). Thirty-four anxiety-disordered mothers of 6-month-old infants and 59 typical dyads comprised the sample. Dyads were filmed during free play, teaching, care giving, and face-to-face play; and monadic (e.g., maternal sensitivity, infant affect) and dyadic measures (e.g., synchrony) were derived by global or time-event coding of the films. Results indicate that, compared to controls, more anxious mothers showed exaggerated behavior with their infant during free play and teaching, and infants of anxious mothers were less likely to show negative affect during the still-face and stranger challenges. We conclude that anxious maternal behavior reflects the hyperarousal that is characteristic of most anxiety disorders; and infants of anxious mothers and controls show differences in the manner in which they cope with social challenges. PMID:20116860

  1. Method of assessing parent-child grocery store purchasing interactions using a micro-camcorder.

    PubMed

    Calloway, Eric E; Roberts-Gray, Cindy; Ranjit, Nalini; Sweitzer, Sara J; McInnis, Katie A; Romo-Palafox, Maria J; Briley, Margaret E

    2014-12-01

    The purpose of this study was to assess the validity of using participant worn micro-camcorders (PWMC) to collect data on parent-child food and beverage purchasing interactions in the grocery store. Parent-child dyads (n?=?32) were met at their usual grocery store and shopping time. Parents were mostly Caucasian (n?=?27, 84.4%), mothers (n?=?30, 93.8%). Children were 2-6 years old with 15 girls and 17 boys. A micro-camcorder was affixed to a baseball style hat worn by the child. The dyad proceeded to shop while being shadowed by an in-person observer. Video/audio data were coded for behavioral and environmental variables. The PWMC method was compared to in-person observation to assess sensitivity and relative validity for measuring parent-child interactions, and compared to receipt data to assess criterion validity for evaluating purchasing decisions. Inter-rater reliability for coding video/audio data collected using the PWMC method was also assessed. The PWMC method proved to be more sensitive than in-person observation revealing on average 1.4 (p?interactions per shopping trip. Inter-rater reliability for coding PWMC data showed moderate to almost perfect agreement (Cohen's kappa?=?0.461-0.937). The PWMC method was significantly correlated with in-person observation for measuring occurrences of parent-child food purchasing interactions (rho?=?0.911, p?interactions (rho?=?0.345-0.850, p?interactions in the grocery store. PMID:25091810

  2. A comparison of dyadic interactions and coping with still-face in healthy pre-term and full-term infants.

    PubMed

    Montirosso, Rosario; Borgatti, Renato; Trojan, Sabina; Zanini, Rinaldo; Tronick, Ed

    2010-06-01

    Pre-term birth has a significant impact on infants' social and emotional competence, however, little is known about regulatory processes in pre-term mother-infant dyads during normal or stressful interactions. The primary goals of this study were to investigate the differences in infant and caregiver interactive behaviour and dyadic coordination of clinically healthy pre-term compared to full-term infant-mother dyads and to examine pre-term infants' capacity for coping with stress using the face-to-face still-face paradigm (FFSF). Fifty mother-infant dyads, including 25 pre-term infants and 25 full-term infants were videotaped during the FFSF. All infants were 6-9 months of age (corrected for gestational age in the pre-term group). Infant and maternal socio-emotional expressivity and self-regulatory behaviours were coded and measures of dyadic coordination (Matching, Reparation Rate, and Synchrony) were calculated. There were no significant differences in infant and caregiver socio-emotional behaviours between the two groups and both groups demonstrated the still-face (SF) effect and the reunion effect. There was a difference in self-regulatory behaviour. Pre-term infants were more likely than full-term infants to use distancing (e.g., by turning away, twisting, or arching) from their mothers during the FFSF. Additionally, during the Reunion episode of the FFSF pre-term infants showed more social monitoring compared to full-term infants. Regardless of the birth status, the dyads showed less coordination and a slower rate of reparation during the Reunion episode than during the Play episode. The higher proportion of distancing in the pre-term group and the increase in social monitoring suggest that even in normal interactions pre-term infants may experience a higher level of stress and have less capacity for self-regulation compared to the full-terms and that pre-term infants appear to use a compensatory strategy of increased social monitoring to cope with the stress of renegotiating the interaction during Reunion. The findings suggest that pre-term infants have different regulatory and interactive capacities than full-term infants. PMID:20481392

  3. The relationship between neonatal characteristics and three-month mother-infant interaction in high-risk infants.

    PubMed

    Greene, J G; Fox, N A; Lewis, M

    1983-10-01

    The behavior of 4 groups of infants--healthy term, healthy preterm, sick preterm, and sick full-term--was assessed in the neonatal period using the Neonatal Behavioral Assessment Scale (NBAS). At 3 months postterm, infants and their mothers were observed and videotaped in a free-play session. Both the NBAS and mother-infant interaction data were analyzed to assess the effects of maturity (term vs. preterm), illness (sick vs. healthy), and their interaction. Results revealed that illness of the infant affected both NBAS performance and maternal behavior during the interaction at 3 moths. Infants who were ill performed poorly on the NBAS orientation dimension; this dimension was found to be significantly associated with maternal and infant behaviors at 3 months. These data demonstrate an association between early infant characteristics and subsequent mother and child interactive behaviors. They also identify postnatal illness as an important influence on the development of the mother-infant dyad. PMID:6354634

  4. ADHD Medication Vacations and Parent-Child Interactions by Gender

    ERIC Educational Resources Information Center

    Barnard-Brak, Lucy; Schmidt, Marcelo; Sulak, Tracey

    2013-01-01

    Objective: The purpose of the current study was to examine medication vacations among children with ADHD according to parent-child dyads (e.g., mother-son, father-daughter, mother-daughter, and father-son). Method: In a survey study of 259 parents of children with ADHD, the use of medication vacations according to parent-child sex dyads was…

  5. Synthesis and Characterization of Ru(II) Tris(1,1O-phenanthroline)-Electron Acceptor Dyads Incorporating the 4-benzoyl-N-methylpyridinium Cation or N-Benzyl-N'-methyl-viologen. Improving the Dynamic Range, Sensitivity and Response Time of Sol-Gel Based Optical Oxygen Sensors

    NASA Technical Reports Server (NTRS)

    Leventis, Nicholas; Rawashdeh, Abdel-Monen M.; Elder, Ian A.; Yang, Jinhua; Dass, Amala; Sotiriou-Leventis, Chariklia

    2004-01-01

    The title compounds (1 and 2, above) were synthesized by Sonogashira coupling reactions of appropriate Ru(1I) complexes with the electron a cceptors. Characterization was conducted in solution and in frozen ma trices. Finally, the title compounds were evaluated as dopants of sol-gel materials. It was found that the intramolecular quenching efficie ncy of 4-benzoyl-Nmethylpyridinium cation in solution depends on the solvent: photoluminescence is quenched completely in CH,CN, but not i n methanol or ethanol. On the other hand, intramolecular emission que nching by 4-benzyl-N-methyl viologen is complete in all solvents. The difference between the two quenchers is traced electrochemically to t he solvation of the 4-benzoyl-Nmethylpyridiniums by alcohol. In froze n matrices or adsorbed on the surfaces of silica aerogel, both Ru(I1) complex/electron acceptor dyads of this study are photoluminescent, and the absence of quenching has been traced to the environmental rigi dity. When doped aerogels are cooled at 77 K, the emission intensity increases by approximately 4x, and the spectra shift to the blue, analogous to what is observed with Ru(I1) complexes in solutions undergoi ng fluid-to-rigid transition. However, in contrast to frozen solution s, the luminescent moieties in the bulk of aerogels kept at low tempe ratures are still accessible to gas-phase quenchers diffusing through the mesopores, leading to more sensitive platforms for sensors than o ther room-temperature configurations. Thus the photoluminescence of o ur Ru(I1) complex dyads adsorbed on aerogel is quenchable by O2 both at room temperature and at 77 K. Furthermore, it was also found that O 2 modulates the photoluminescence of aerogels doped with 4-benzoyl -N -methylpyridinium-based dyads over a wider dynamic range compared wi th aerogels doped with either our vislogen-based dyads or with Ru(I1) tris(1,lO-phenanthroline) itself.

  6. Tunable one-, two-, and three-dimensional self-assemblies from an acceptor-donor fullerene-N,N-dimethylaminoazobenzene dyad: interfacial geometry and temporal evolution.

    PubMed

    Kumar, K Senthil; Patnaik, Archita

    2011-09-01

    Controllable fabrication of spontaneously ordered and varied geometry fullerene C(60) based molecular architecture was achieved upon hierarchical self-assembly of the fullerene-N,N-dimethylaminoazobenzene acceptor-donor hybrid (DPNME). Simple preparation techniques, such as Langmuir-Blodgett (LB), solution-cast, and immersion at the liquid-air and solid-air interfaces, were used without templates as a function of DPNME concentration, media pH, time, and supporting substrate characteristics. The resulting structures depending upon the preparation methods were investigated with field emission scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), atomic force microscopy (AFM), and molecular modeling, which revealed a delicate role of intermolecular donor-acceptor, ?-?, and van der Waals interactions between the electron deficient fullerene core and the N,N-dimethylaminoazobenzene electron donor under neutral conditions. Upon protonation, the electrostatics associated with the charged DPNME moiety and the dominant intermolecular fullerene-fullerene interactions guided the self-assembly process. Increased time scales led the molecular subunits to grow by maximizing the most favored orientations and yielded one-dimensional (1D) and two-dimensional (2D) structures in neutral and acidic conditions, respectively, which upon solvent evaporation formed the final multipods or stacked squares upon oriented attachment. For the protonated DPNME, 2D lamellar sheets formed from the bilayers gained cohesive energy, forming ultimately rectangular sheets. Interestingly, the Si(100) supported multilayer DPNME Langmuir films as a function of surface pressure and pH yielded a uniform and directional structure pattern in comparison with the geometry obtained from drop casting methods. This controllable structure architecture of the fullerene-azobenzene hybrid opens up a new alley in fullerene C(60) based self-assembly. PMID:21766824

  7. d?f Energy Transfer in Ir(III)/Eu(III) Dyads: Use of a Naphthyl Spacer as a Spatial and Energetic “Stepping Stone”

    PubMed Central

    2013-01-01

    A series of luminescent complexes based on {Ir(phpy)2} (phpy = cyclometallating anion of 2-phenylpyridine) or {Ir(F2phpy)2} [F2phpy = cyclometallating anion of 2-(2?,4?-difluorophenyl)pyridine] units, with an additional 3-(2-pyridyl)-pyrazole (pypz) ligand, have been prepared; fluorination of the phenylpyridine ligands results in a blue-shift of the usual 3MLCT/3LC luminescence of the Ir unit from 477 to 455 nm. These complexes have pendant from the coordinated pyrazolyl ring an additional chelating 3-(2-pyridyl)-pyrazole unit, separated via a flexible chain containing a naphthalene-1,4-diyl or naphthalene-1,5-diyl spacer. Crystal structures show that the flexibility of the pendant chain allows the naphthyl group to lie close to the Ir core and participate in a ?-stacking interaction with a coordinated phpy or F2phpy ligand. Luminescence spectra show that, whereas the {Ir(phpy)2(pypz)} complexes show typical Ir-based emission—albeit with lengthened lifetimes because of interaction with the stacked naphthyl group—the {Ir(F2phpy)2(pypz)} complexes are nearly quenched. This is because the higher energy of the Ir-based 3MLCT/3LC excited state can now be quenched by the adjacent naphthyl group to form a long-lived naphthyl-centered triplet (3nap) state which is detectable by transient absorption. Coordination of an {Eu(hfac)3} unit (hfac = 1,1,1,5,5,5-hexafluoro-pentane-2,4-dionate) to the pendant pypz binding site affords Ir–naphthyl–Eu triads. For the triads containing a {Ir(phpy)2} core, the unavailability of the 3nap state (not populated by the Ir-based excited state which is too low in energy) means that direct Ir?Eu energy-transfer occurs in the same way as in other flexible Ir/Eu complexes. However for the triads based on the{Ir(F2phpy)2} core, the initial Ir?3nap energy-transfer step is followed by a second, slower, 3nap?Eu energy-transfer step: transient absorption measurements clearly show the 3nap state being sensitized by the Ir center (synchronous Ir-based decay and 3nap rise-time) and then transferring its energy to the Eu center (synchronous 3nap decay and Eu-based emission rise time). Thus the 3nap state, which is energetically intermediate in the {Ir(F2phpy)2}–naphthyl–Eu systems, can act as a “stepping stone” for two-step d?f energy-transfer. PMID:24007190

  8. Interactive Calendar.

    ERIC Educational Resources Information Center

    Ritterskamp, Pegge; Singleton, Jan

    2001-01-01

    Describes the use of an interactive calendar that incorporates reading and writing in its use. Discusses a typical lesson, managing the interactive calendar, changes throughout the year, extensions and variations of the interactive calendar, and benefits of using the interactive calendar. Urges every primary teacher to learn about interactive

  9. Interactional Counseling.

    ERIC Educational Resources Information Center

    Claiborn, Charles D.; Lichtenberg, James W.

    1989-01-01

    Provides an integrative review of interactional concepts within counseling and shows that the interactional view is a unique and valuable perspective for counseling psychology. Provides conceptual coherence to interactional views on theory, practice, and research. (Author/ABL)

  10. Drug/protein interactions studied by time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Gustavsson, Thomas; Markovitsi, Dimitra; Vayá, Ignacio; Bonancía, Paula; Jiménez, M. C.; Miranda, Miguel A.

    2014-09-01

    We report here on a recent time-resolved fluorescence study [1] of the interaction between flurbiprofen (FBP), a chiral non-steroidal anti-inflammatory drug, and human serum albumin (HSA), the main transport protein in the human body. We compare the results obtained for the drug-protein complex with those of various covalently linked flurbiprofentryptophan dyads having well-defined geometries. In all cases stereoselective dynamic fluorescence quenching is observed, varying greatly from one system to another. In addition, the fluorescence anisotropy decays also display a clear stereoselectivity. For the drug-protein complexes, this can be interpreted in terms of the protein microenvironment playing a significant role in the conformational relaxation of FBP, which is more restricted in the case of the (R)- enantiomer.

  11. Same-Sex and Cross-Sex Siblings: Activity Choices, Roles, Behavior, and Gender Stereotypes.

    ERIC Educational Resources Information Center

    Stoneman, Zolinda; And Others

    1986-01-01

    At-home observation of 40 sibling dyads was conducted to describe sex-role characteristics of school-aged same-sex and cross-sex siblings. Male dyads interacted less than other sibling groups, while older sisters in female or male-female dyads engaged in the most teaching and managing. Older sister dyads exhibited the greatest role asymmetrics.…

  12. A critical examination of indices of dynamic interaction for wildlife telemetry studies.

    PubMed

    Long, Jed A; Nelson, Trisalyn A; Webb, Stephen L; Gee, Kenneth L

    2014-01-15

    Wildlife scientists continue to be interested in studying ways to quantify how the movements of animals are inter-dependent - dynamic interaction. While a number of applied studies of dynamic interaction exist, little is known about the comparative effectiveness and applicability of available methods used for quantifying interactions among animals. We highlight the formulation, implementation, and interpretation of a suite of eight currently available indices of dynamic interaction. Point- and path-based approaches are contrasted to demonstrate differences between methods and underlying assumptions on telemetry data. Correlated and biased-correlated random walks were simulated at a range of sampling resolutions to generate scenarios with dynamic interaction present and absent. We evaluate the effectiveness of each index at identifying differing types of interactive behaviour at each sampling resolution. Each index is then applied to an empirical telemetry dataset of three white-tailed deer (Odocoileus virginianus) dyads. Results from the simulated data show that three indices of dynamic interaction reliant on statistical testing procedures are susceptible to Type I error, which increases at fine sampling resolutions. In the white-tailed deer examples, a recently developed index for quantifying local-level cohesive movement behaviour (the di index) provides revealing information on the presence of infrequent and varying interactions in space and time. Point-based approaches implemented with finely sampled telemetry data over-estimate the presence of interactions (Type I errors). Indices producing only a single global statistic (7 of the 8 indices) are unable to quantify infrequent and varying interactions through time. The quantification of infrequent and variable interactive behaviour has important implications for the spread of disease, and the prevalence of social behaviour in wildlife. Guidelines are presented to inform researchers wishing to study dynamic interaction patterns in their own telemetry datasets. Finally, we make openly available our code, in the statistical software R, for computing each index of dynamic interaction presented herein. This article is protected by copyright. All rights reserved. PMID:24428545

  13. Construction of Trust Judgments within Cooperative Dyads

    ERIC Educational Resources Information Center

    Evin, Agathe; Sève, Carole; Saury, Jacques

    2014-01-01

    Introduction: One of the aims of physical education (PE) is to develop social skills such as cooperation, teamwork, and mutual helping among students. Cooperation is a broad research topic, implicating several disciplines in the human sciences (e.g. psychology, sociology, linguistics, philosophy). It is also an important topic in various domains…

  14. Mother-Infant Person- and Object-Directed Interactions in Latino Immigrant Families: A Comparative Approach

    ERIC Educational Resources Information Center

    Cote, Linda R.; Bornstein, Marc H.; Haynes, O. Maurice; Bakeman, Roger

    2008-01-01

    Cultural variation in durations, relations, and contingencies of mother-infant person- and object-directed behaviors were examined for 121 nonmigrant Latino mother-infant dyads in South America, Latina immigrants from South America and their infants living in the United States, and European American mother-infant dyads. Nonmigrant Latina mothers…

  15. An Observational Investigation of Sibling Interactions in Married and Divorced Families.

    ERIC Educational Resources Information Center

    MacKinnon, Carol E.

    1989-01-01

    Results of this study of 96 sibling dyads demonstrated necessity of going beyond the examination of between-group differences in the study of divorce effects to look at the processes by which developmental outcomes for children are enhanced or undermined. Findings draw attention to the heightened vulnerability of dyads containing older boys in…

  16. Longitudinal associations between the quality of parent-child interactions and children's sleep at preschool age.

    PubMed

    Bordeleau, Stéphanie; Bernier, Annie; Carrier, Julie

    2012-04-01

    This study aimed to examine the prospective longitudinal links between the quality of mother-child and father-child interactions and preschoolers' sleep. Three dimensions of maternal interactive behavior were considered using 70 mother-child dyads, while the quality of father-child interactions was assessed using 41 of these families. Maternal mind-mindedness was assessed at 12 months during a mother-infant free-play sequence, maternal sensitivity was rated at 12 months based on observations performed throughout a home visit, maternal autonomy support was assessed at 15 months with a 10-min problem-solving situation, and the quality of father-child interactions was scored at 18 months, during father-child free play. Children's sleep was assessed at 3 and 4 years using a sleep diary completed by mothers during 3 consecutive days. Results indicated that, after controlling for family socioeconomic status and daycare attendance, the quality of both mother-infant and father-infant interactions was positively related to children's percentage of night-time sleep at preschool age. These findings add to previous literature in suggesting that early caregiving behavior by both mothers and fathers is related to subsequent child sleep. PMID:22369463

  17. Mother-infant interaction and quality of child's attachment: a nonlinear dynamical systems approach.

    PubMed

    Cerezo, M Angeles; Trenado, Rosa M; Pons-Salvador, Gemma

    2012-07-01

    The traditional classification of infant attachment described three distinct types (Ainsworth et al. 1978): Secure (B), Insecure-avoidant (A), and Insecure-resistant (C). Research shows that the quality of infant attachment reflects the child's history of interaction with their primary caregiver and, therefore, maternal sensitivity and appropriateness of maternal responses during the first year of life has been found to predict infant attachment. In this study Nonlinear Dynamic Systems (NDS) approach was applied to broaden the study of maternal sensitivity into the overall temporal organization of mother-infant relationship exchanges. The study focuses on understanding the differences between secure and insecure attached children by applying NDS in two temporal scales: real time and a developmental scale, with the notions of 'flexibility' and 'self-organization', respectively. Infants, classified as securely or insecurely attached at 15 months, had free-play situations with their mothers, at 6 and 12 months of age, videotaped and coded in real time. Results showed that at 6 months dyads from the B group, compared to the non-B group, showed higher flexibility through several NDS indices derived from the State-Space Grid method (SSG). The dyads at 12 months did not show differences in those indices. Moreover, B group showed self-organization by decreasing the number of attractors, from 6 to 12 months of infant's age, in contrast with A and C groups that either showed less self-organization, by increasing the number of attractors, or stayed basically as they were at 6 months. Furthermore, the B group showed an increase in the proportion of attractors with higher values from time 1 to time 2, in contrast to the non-B groups. Findings provide some grounds for using a SSG approach to deepen the construct of maternal sensitivity in dyadic terms. PMID:22695148

  18. Partial Mediation Role of Self-Efficacy between Positive Social Interaction and Mental Health in Family Caregivers for Dementia Patients in Shanghai

    PubMed Central

    Zhang, Shuying; Edwards, Helen; Yates, Patsy; Guo, Qihao; Li, Chunbo

    2013-01-01

    We explored the mediation effect of caregiver self-efficacy on the influences of behavioral and psychological symptoms (BPSD) of dementia care recipients (CRs) or family caregivers’ (CGs) social supports (informational, tangible and affectionate support and positive social interaction) on CGs’ mental health. We interviewed 196 CGs, using a battery of measures including demographic data of the dyads, CRs’ dementia-related impairments, and CGs’ social support, self-efficacy and the Medical Outcome Study (MOS) Short-Form (SF-36) Health Survey. Multiple regression analyses showed that gathering information on self-efficacy and managing CG distress self-efficacy were the partial mediators of the relationship between positive social interaction and CG mental health. Managing caregiving distress self-efficacy also partial mediated the impact of BPSD on CG mental health. We discuss implications of the results for improving mental health of the target population in mainland China. PMID:24386178

  19. Do you put your best foot forward? Interactive effects of task performance and impression management tactics on career outcomes.

    PubMed

    Cheng, Jen-Wei; Chiu, Wei-La; Chang, Yi-Ying; Johnstone, Stewart

    2014-01-01

    This study aims to investigate the interactive effects of task performance and impression management tactics on career outcomes from the socioanalytic perspective. Based on a survey of 195 employee-supervisor dyads from various industries in Taiwan, a hierarchical regression analysis revealed that (1) the relationship between task performance and a one-year salary adjustment was greater among employees who frequently employ ingratiation than among those who do not, (2) the relationship between task performance and a one-year salary adjustment was greater among employees who frequently employ exemplification than among those who do not, and (3) the relationship between task performance and career satisfaction was greater among employees who frequently employ self-promotion than among those who do not. This study concludes by suggesting implications for research and practice, and offers some directions for future research. PMID:25175887

  20. Father-Infant Interaction and Sex Role.

    ERIC Educational Resources Information Center

    Campbell, Nayna D.

    An investigation was made of the relationship between sex-role orientation (as measured by the Bem Sex Role Inventory) and responsiveness in infant care (as determined by observations on the Nursing Child Assessment Feeding Scale). Subjects participating in the study consisted of 44 father/infant dyads. It was hypothesized that androgynous fathers…

  1. Why Synchrony Matters during Mother-Child Interactions: A Systematic Review

    PubMed Central

    Leclère, Chloë; Viaux, Sylvie; Avril, Marie; Achard, Catherine; Chetouani, Mohamed; Missonnier, Sylvain; Cohen, David

    2014-01-01

    Background Assessment of mother-child interactions is a core issue of early child development and psychopathology. This paper focuses on the concept of “synchrony” and examines (1) how synchrony in mother-child interaction is defined and operationalized; (2) the contribution that the concept of synchrony has brought to understanding the nature of mother-child interactions. Method Between 1977 and 2013, we searched several databases using the following key-words: « synchrony » « interaction » and « mother-child ». We focused on studies examining parent-child interactions among children aged 2 months to 5 years. From the 63 relevant studies, we extracted study description variables (authors, year, design, number of subjects, age); assessment conditions and modalities; and main findings. Results The most common terms referring to synchrony were mutuality, reciprocity, rhythmicity, harmonious interaction, turn-taking and shared affect; all terms were used to characterize the mother-child dyad. As a consequence, we propose defining synchrony as a dynamic and reciprocal adaptation of the temporal structure of behaviors and shared affect between interactive partners. Three main types of assessment methods for studying synchrony emerged: (1) global interaction scales with dyadic items; (2) specific synchrony scales; and (3) micro-coded time-series analyses. It appears that synchrony should be regarded as a social signal per se as it has been shown to be valid in both normal and pathological populations. Better mother-child synchrony is associated with familiarity (vs. unknown partner), a healthy mother (vs. pathological mother), typical development (vs. psychopathological development), and a more positive child outcomes. Discussion Synchrony is a key feature of mother-infant interactions. Adopting an objective approach in studying synchrony is not a simple task given available assessment tools and due to its temporality and multimodal expression. We propose an integrative approach combining clinical observation and engineering techniques to improve the quality of synchrony analysis. PMID:25469637

  2. Interacting parasites

    USGS Publications Warehouse

    Lafferty, Kevin D.

    2010-01-01

    Parasitism is the most popular life-style on Earth, and many vertebrates host more than one kind of parasite at a time. A common assumption is that parasite species rarely interact, because they often exploit different tissues in a host, and this use of discrete resources limits competition (1). On page 243 of this issue, however, Telfer et al. (2) provide a convincing case of a highly interactive parasite community in voles, and show how infection with one parasite can affect susceptibility to others. If some human parasites are equally interactive, our current, disease-by-disease approach to modeling and treating infectious diseases is inadequate (3).

  3. Interactive Investigator

    NSDL National Science Digital Library

    Interactive Investigator, available through Virtual Museum Canada, is a website "for anyone with an interest in the different scientific methods used to solve crimes." Users will find a database of forensic science, containing short but informative essays on forensic entomology, toxicology, alcohol analysis, and various other forensic science topics. A simple timeline reviews key dates in the development of forensics, starting with the creation of the Paris Institute for Forensic Science in 1868. But the main feature (and the most fun) is an interactive game, in which players collect and analyze crime scene clues to solve a murder case. Interactive Investigator is also available in French.

  4. The role of an early intervention on enhancing the quality of mother-infant interaction.

    PubMed

    Wendland-Carro, J; Piccinini, C A; Millar, W S

    1999-01-01

    The study examines an intervention designed to influence mothers' sensitive responsiveness toward their infant by presenting information about the newborn's competence to interact and promoting affectionate handling and interaction with the infant. Thirty-six primiparous mothers and their newborn infants participated in the study. On day 2/3 after delivery, mother-infant dyads were assigned to either: (1) an experimental group that received an intervention program designed to enhance mother-infant interaction; or (2) a control group that was presented with an intervention that emphasized basic caregiving skills. One month later an observation was undertaken in the home to assess mother-infant synchronous and asynchronous co-occurrences during free-play and infant bathing. The enhancement group showed a reliably greater frequency of co-occurrences involving vocal exchanges, looking to the partner, and physical contact. There also were differences in mothers' responsiveness to infant crying and involuntary responses. The findings show that even a modest videotaped early intervention can enhance mothers' sensitive responsiveness to the infant. PMID:10368917

  5. Perceiving nonverbal behavior: neural correlates of processing movement fluency and contingency in dyadic interactions.

    PubMed

    Georgescu, Alexandra L; Kuzmanovic, Bojana; Santos, Natacha S; Tepest, Ralf; Bente, Gary; Tittgemeyer, Marc; Vogeley, Kai

    2014-04-01

    Despite the fact that nonverbal dyadic social interactions are abundant in the environment, the neural mechanisms underlying their processing are not yet fully understood. Research in the field of social neuroscience has suggested that two neural networks appear to be involved in social understanding: (1) the action observation network (AON) and (2) the social neural network (SNN). The aim of this study was to determine the differential contributions of the AON and the SNN to the processing of nonverbal behavior as observed in dyadic social interactions. To this end, we used short computer animation sequences displaying dyadic social interactions between two virtual characters and systematically manipulated two key features of movement activity, which are known to influence the perception of meaning in nonverbal stimuli: (1) movement fluency and (2) contingency of movement patterns. A group of 21 male participants rated the "naturalness" of the observed scenes on a four-point scale while undergoing fMRI. Behavioral results showed that both fluency and contingency significantly influenced the "naturalness" experience of the presented animations. Neurally, the AON was preferentially engaged when processing contingent movement patterns, but did not discriminate between different degrees of movement fluency. In contrast, regions of the SNN were engaged more strongly when observing dyads with disturbed movement fluency. In conclusion, while the AON is involved in the general processing of contingent social actions, irrespective of their kinematic properties, the SNN is preferentially recruited when atypical kinematic properties prompt inferences about the agents' intentions. PMID:23813661

  6. Effects of Parental Interaction on Infant Vocalization Rate, Variability and Vocal Type

    PubMed Central

    Franklin, Beau; Warlaumont, Anne S.; Messinger, Daniel; Bene, Edina; Iyer, Suneeti Nathani; Lee, Chia-Chang; Lambert, Brittany; Oller, D. Kimbrough

    2014-01-01

    Examination of infant vocalization patterns across interactive and noninteractive contexts may facilitate better understanding of early communication development. In the current study, with 24 infant-parent dyads, infant volubility increased significantly when parent interaction ceased (presenting a “still face,” or SF) after a period of normal interaction (“face-to-face,” or FF). Infant volubility continued at the higher rate than in FF when the parent re-engaged (“reunion,” or RE). Additionally, during SF, the variability in volubility across infants decreased, suggesting the infants adopted relatively similar rates of vocalization to re-engage the parent. The pattern of increasing volubility in SF was seen across all of the most common speech-like vocal types of the first half-year of life (e.g., full vowels, quasivowels, squeals, growls). Parent and infant volubility levels were not significantly correlated. The findings suggest that by six months of age infants have learned that their vocalizations have social value and that changes in volubility can affect parental engagement. PMID:25383061

  7. Attachment style dimensions are associated with brain activity in response to gaze interaction.

    PubMed

    Cecchini, Marco; Iannoni, Maria Elena; Pandolfo, Anna Lucia; Aceto, Paola; Lai, Carlo

    2015-06-01

    Aim of the present study was to investigate the time course of brain processes involved in the visual perception of different gaze interactions in woman-child dyads and the association between attachment dimensions and brain activation during the presentation of gaze interactions. The hypothesis was that the woman avoidance will produce a greater activation of primary somatosensory and limbic areas. The attachment styles dimensions avoidant-related will be associated with fronto-limbic brain intensity during the convergence of gaze. Electroencephalogram (EEG) data were recorded using a 256-channel HydroCel Geodesic Sensor Net in 44 female subjects (age: 24 ± 2 years). Event-related potential (ERP) components and standardized low-resolution electromagnetic tomography (sLORETA) were analyzed. Participants were administered the attachment style questionnaire before EEG task. A lower P350 latency was found in the fronto-central montage in response to woman avoidance. sLORETA analysis showed a greater intensity of limbic and primary somatosensory areas in response to woman avoidance compared to the others gaze interactions. In response to convergence gaze, the confidence attachment dimension was negatively correlated with the intensities of the right temporal and limbic areas, and the relationships as secondary attachment dimension were positively correlated with the intensities of the bilateral frontal areas and of the left parietal area. PMID:25568957

  8. Drug Interactions

    MedlinePLUS

    ... involve the liver. Several drugs slow down or speed up the action of liver enzymes. This can ... www.drugdigest.org/wps/portal/ddigest THE BOTTOM LINE Many ARVs can interact with other medications, drugs, ...

  9. The impact of prenatal serotonin reuptake inhibitor (SRI) antidepressant exposure and maternal mood on mother-infant interactions at 3 months of age.

    PubMed

    Weikum, Whitney M; Mayes, Linda C; Grunau, Ruth E; Brain, Ursula; Oberlander, Tim F

    2013-12-01

    Exposure to maternal depression increases risks for altered mother-infant interactions. Serotonin reuptake inhibitor (SRI) antidepressants are increasingly prescribed to manage antenatal maternal illness. The impact of SRIs on early mother-infant interactions was unknown. Three-month-old infants of 32 depressed mothers treated with SRI medications during pregnancy and 43 non-medicated mothers were studied. Using an established face-to-face mother-infant interaction paradigm, dyad interactions were studied with and without a toy. Videotaped sessions yielded 4 measures: maternal sensitivity, dyadic organization, infant readiness to interact, and maternal interruptive behaviors. Even with prenatal SRI treatment, depressed mothers interrupted their infants more during toy play. In the absence of prenatal SRI treatment, maternal postnatal depression adversely influenced infant behavior. Higher levels of maternal depression symptoms at 3 months predicted poorer infant readiness to interact during the toy session. Conversely, in the SRI-exposed group, higher prenatal depression scores predicted greater infant readiness to interact at 3 months. Increased infant readiness with SRI exposure suggests a "fetal programming effect" whereby prenatal maternal mood disturbances shaped a future response to a postnatal depressed maternal environment. PMID:23728194

  10. Hadronic Interactions

    E-print Network

    Takeshi Yamazaki

    2015-03-30

    Understanding hadronic interactions is crucial for investigating the properties of unstable hadrons, since measuring physical quantities for unstable hadrons including the resonance mass and decay width requires simultaneous calculations of final scattering states. Recent studies of hadronic scatterings and decays are reviewed from this point of view. The nuceon-nucleon and multi-nucleon interactions are very important to understand the formation of nucleus from the first principle of QCD. These interactions have been studied mainly by two methods, due originally to L\\"uscher and to HALQCD. The results obtained from the two methods are compared in three channels, $I=2$ two-pion, H-dibaryon, and two-nucleon channels. So far the results from the two methods for the two-nucleon channels are different even at the level of the presence or absence of bound states. We then discuss possible uncertainties in each method. Recent results on the binding energy for helium nuclei are also reviewed.

  11. Genetic and Biochemical Analysis of PadR-padC Promoter Interactions during the Phenolic Acid Stress Response in Bacillus subtilis 168 ?¶

    PubMed Central

    Nguyen, Thi Kim Chi; Tran, Ngoc Phuong; Cavin, Jean-François

    2011-01-01

    Bacillus subtilis 168 is resistant to phenolic acids by expression of an inducible enzyme, the phenolic acid decarboxylase (PadC), that decarboxylates these acids into less toxic vinyl derivatives. In the phenolic acid stress response (PASR), the repressor of padC, PadR, is inactivated by these acids. Inactivation of PadR is followed by a strong expression of padC. To elucidate the functional interaction between PadR and the padC promoter, we performed (i) footprinting assays to identify the region protected by PadR, (ii) electrophoretic mobility shift assays (EMSAs) with a modified padC promoter protected region to determine the interacting sequences, and (iii) random mutagenesis of padR to identify amino acid residues essential for the function of PadR. We identified an important consensus dyad sequence called IR1-2 (ATGT-8N-ACAT) overlapping a second dyad element (GTGT-8N-ACAT) that we named dIR1-2bis. The entire dIR1-2bis/IR1-2 sequence permits binding of two PadR dimers in EMSAs, which may be observed for bacteria grown under noninduced conditions where the padC promoter is completely repressed. Three groups of modified PadRs giving a PASR phenotype were characterized in vivo. The DNA sequences of certain mutant padR alleles indicate that important residues are all located in the region containing the coiled-coil leucine zipper domain that is involved in dimerization. These substitutions reduce the affinity of PadR binding to the padC promoter. Of particular interest are residue L128, located at the center of the putative coiled-coil leucine zipper domain, and residue E97, which is conserved among all PadRs. PMID:21685295

  12. Single-base resolution mapping of H1-nucleosome interactions and 3D organization of the nucleosome.

    PubMed

    Syed, Sajad Hussain; Goutte-Gattat, Damien; Becker, Nils; Meyer, Sam; Shukla, Manu Shubhdarshan; Hayes, Jeffrey J; Everaers, Ralf; Angelov, Dimitar; Bednar, Jan; Dimitrov, Stefan

    2010-05-25

    Despite the key role of the linker histone H1 in chromatin structure and dynamics, its location and interactions with nucleosomal DNA have not been elucidated. In this work we have used a combination of electron cryomicroscopy, hydroxyl radical footprinting, and nanoscale modeling to analyze the structure of precisely positioned mono-, di-, and trinucleosomes containing physiologically assembled full-length histone H1 or truncated mutants of this protein. Single-base resolution *OH footprinting shows that the globular domain of histone H1 (GH1) interacts with the DNA minor groove located at the center of the nucleosome and contacts a 10-bp region of DNA localized symmetrically with respect to the nucleosomal dyad. In addition, GH1 interacts with and organizes about one helical turn of DNA in each linker region of the nucleosome. We also find that a seven amino acid residue region (121-127) in the COOH terminus of histone H1 was required for the formation of the stem structure of the linker DNA. A molecular model on the basis of these data and coarse-grain DNA mechanics provides novel insights on how the different domains of H1 interact with the nucleosome and predicts a specific H1-mediated stem structure within linker DNA. PMID:20457934

  13. Interactive Spreadsheets

    NSDL National Science Digital Library

    Interactive Excel spreadsheets display hard-to-understand concepts in statistics, quantum mechanics, physics, and more. Parameters are adjusted by clicking on easy-to-use buttons or by using numeric input boxes. Graphs, tables, and/or figures are then created reflecting the change in parameters.

  14. Environmental Interactions

    NSDL National Science Digital Library

    2014-09-18

    In this activity, students create a "web" to identify and demonstrate the interactions among the living and non-living parts of an environment. This information allows students to better understand what an environment is and to also consider how engineers use teamwork to solve problems.

  15. Pressure Interactions

    NSDL National Science Digital Library

    Wolfgang Christian

    This page allows you to change the state variables in the two ensembles and observe the interactions between the state variables. The piston mass is 50x the particles mass. This large piston mass produces a slow mechanical oscillation about the equal-pressure equilibrium point whenever a disequilibrium is created.

  16. MATTER & INTERACTIONS

    Microsoft Academic Search

    Ruth Chabay; Bruce Sherwood

    Matter & Interactions is a modern calculus-based introductory curriculum that em- phasizes the power of fundamental principles, and guides students through the proc- ess of starting from these principles in analyzing physical systems, on both the mac- roscopic and the microscopic level. The continual emphasis on the application of fundamental principles and on the atomic nature of matter makes possible

  17. Constructive Interaction.

    ERIC Educational Resources Information Center

    Miyake, Naomi

    To identify conditions that make a conversational interaction constructive--in the sense that the participants can find the way toward the success of what they wanted to accomplish--two situations were examined. In one, a professional researcher explained her data to a statistician. In the other, three groups of two people cooperated with each…

  18. INTERACTIVE IMMUNITY

    NSDL National Science Digital Library

    European Federation of Immunological Societies, EFIS

    2012-07-19

    The resource is an interactive on-line book based upon the book “Your Amazing Immune System” which brings students to an exploration on how our immune system protects our body from infectious diseases. In addition, it gives students background on autoimmune diseases, immune reactions, and how immunology can be used in fighting cancer.

  19. Interactive Astronomy.

    ERIC Educational Resources Information Center

    Martin, Jean K.

    1997-01-01

    Presents guiding principles for developing interactive lessons for the World Wide Web. Describes "Amazing Space: Education Online from the Hubble Space Telescope", a program where students study spectacular Hubble Space Telescope images of stars and star-forming regions to learn about the life cycle of stars and the creation of atoms. (JRH)

  20. Dinosaur Interaction

    NSDL National Science Digital Library

    Rick Crosslin

    2004-01-01

    In this activity, learners explore why animals, specifically dinosaurs, live in families. Learners examine Dinosphere scenes (drawing of dinosaurs in groups) and sort the scenes by reasons the animals are living in groups. Then, learners glue together geometric shapes to create dinosaurs interacting in groups and families. This activity is featured on page 26 of the "Dinosphere" unit of study for K-2 learners.

  1. Interacting Compasses

    ERIC Educational Resources Information Center

    Riveros, Hector G.; Betancourt, Julian

    2009-01-01

    The use of multiple compasses to map and visualize magnetic fields is well-known. The magnetic field exerts a torque on the compasses aligning them along the lines of force. Some science museums show the field of a magnet using a table with many compasses in a closely packed arrangement. However, the very interesting interactions that occur…

  2. Infant Television and Video Exposure Associated With Limited Parent-Child Verbal Interactions in Low Socioeconomic Status Households

    PubMed Central

    Mendelsohn, Alan L.; Berkule, Samantha B.; Tomopoulos, Suzy; Tamis-LeMonda, Catherine S.; Huberman, Harris S.; Alvir, Jose; Dreyer, Benard P.

    2011-01-01

    Objective To assess verbal interactions related to television and other electronic media exposure among mothers and 6 month-old-infants. Design Cross-sectional analysis of 154 mother-infant dyads participating in a long-term study related to early child development. Setting Urban public hospital. Participants Low socioeconomic status mothers of 6-month-old infants. Main Exposure Media exposure and content. Main Outcome Measures Mother-infant verbal interaction associated with media exposure and maternal coviewing. Results Of 154 low socioeconomic status mothers, 149 (96.8%) reported daily media exposure in their infants, with median exposure of 120 (interquartile range, 60-210) minutes in a 24-hour period. Among 426 program exposures, mother-infant interactions were reported during 101 (23.7%). Interactions were reported most frequently with educational young child–oriented media (42.8% of programs), compared with 21.3% of noneducational young child–oriented programs (adjusted odds ratio, 0.4; 95% confidence interval, 0.1-0.98) and 14.7% of school-age/teenage/adult–oriented programs (adjusted odds ratio, 0.2; 95% confidence interval, 0.1-0.3). Among coviewed programs with educational content, mothers reported interactions during 62.7% of exposures. Coviewing was not reported more frequently for educational young child–oriented programs. Conclusions We found limited verbal interactions during television exposure in infancy, with interactions reported for less than one-quarter of exposures. Although interactions were most commonly reported among programs with educational content that had been coviewed, programs with educational content were not more likely to be coviewed than were other programs. Our findings do not support development of infant-directed educational programming in the absence of strategies to increase coviewing and interactions. PMID:18458186

  3. The stress-buffering effects of a brief dyadic interaction before an acute stressor.

    PubMed

    Pauley, Perry M; Floyd, Kory; Hesse, Colin

    2015-07-01

    Although previous studies have confirmed that affectionate interaction can reduce the effects of stress, whether or not this effect is due more to habituation or the accumulation of affection remains an area of debate. The goal of the present study was to determine how specific acts of affection mitigate the effects of stress. Sixty mixed-sex dyads (half platonic friends and half dating partners) were randomly assigned to one of three conditions, affectionate interaction, quiet rest with the friend/romantic partner present, or separation from the friend/romantic partner, before one of the partners experienced a series of stressful activities. Results revealed that participants in the affection condition experienced the smallest increase in cardiovascular arousal regardless of relationship status. Participants' endocrine responses were more nuanced and depended on both their biological sex and the nature of the relationship with the companion. Given that these systems did not act in concert with one another, results provide mixed evidence for both an accumulation and habituation effect. PMID:25090099

  4. Too Many Motives? The Interactive Effects of Multiple Motives on Organizational Citizenship Behavior.

    PubMed

    Takeuchi, Riki; Bolino, Mark C; Lin, Cheng-Chen

    2014-09-01

    Prior research indicates that employees engage in organizational citizenship behaviors (OCBs) because of prosocial values, organizational concern, and impression management motives. Building upon and extending prior research, we investigate all 3 OCB motives by developing a categorization scheme to differentiate their distinctiveness and by building a contextualized argument regarding their interactive effects on OCB in a more collectivistic culture. In a sample of 379 Chinese employee-supervisor dyads from Taiwan, we found that the relationship between prosocial values motives and OCBs directed at individuals was strengthened by organizational concern motives; likewise, the relationship between organizational concern and OCBs directed at the organization was strengthened by prosocial values motives. However, in contrast to prior research (Grant & Mayer, 2009), the relationship between prosocial values motives and OCBs directed at individuals was weakened by impression management motives. A 3-way interaction between all 3 motives further suggests that, in Asian cultures, impression management motives may undermine the positive effects of prosocial values and organizational concern motives on OCBs directed at individuals but not OCBs directed at the organization. (PsycINFO Database Record (c) 2014 APA, all rights reserved). PMID:25198096

  5. Math Interactives

    NSDL National Science Digital Library

    2012-03-09

    Math Interactives is part of a larger site, called LearnAlberta.ca, which is "designed and developed to assist kindergarten to Grade 12 teachers in Alberta locate and utilize digital learning and teaching resources. The design of the site is reflective of how teachers think and work in an online environment." Visitors interested in multiple ways to learn math will love the print and video math activities available on the site. There are four categories from which visitors can choose, on the left hand side of the homepage: Number, Pattern and Relations, Shape and Space and Statistics and Probability. Each section contains a video and an interactive that encourages students to explore the concept in question. For example, students may learn about linear equations through a video about the costs of feeding animals at the Calgary Zoo, and later come up with their own linear equations to predict the costs, accounting for price of food, amount needed, and delivery fees.

  6. Interactives: Garbage

    NSDL National Science Digital Library

    2007-01-01

    With a heading that includes the phrase "How can my community reduce waste?", this educational site provided by the Annenberg Media group is one that's hard to ignore. This resource is one of their "Interactives", and educators can use these various tools to help students learn "how to improve next year's environmental record." Educators and students can choose between one of five topical areas, all of which include various interactive components and activities. These sections cover solid waste, hazardous waste, sewage, global efforts to reduce solid waste, and links to related resources. Along the way, users will get the opportunity to test their knowledge about hazardous waste in their home, and they can even step up to try their hand at shrinking a landfill.

  7. Interacting binaries

    Microsoft Academic Search

    P. P. Eggleton; J. E. Pringle

    1985-01-01

    This volume contains 15 review articles in the field of binary stars. The subjects reviewed span considerably, from the shortest period of interacting binaries to the longest, symbiotic stars. Also included are articles on Algols, X-ray binaries and Wolf-Rayet stars (single and binary). Contents: Preface. List of Participants. Activity of Contact Binary Systems. Wolf-Rayet Stars and Binarity. Symbiotic Stars. Massive

  8. Organism Interactions

    NSDL National Science Digital Library

    Mrs. Marsh

    2008-09-16

    Complete both parts in the assignment below. At the conclusion of this assignment, you will go to our class testing site on nutips and take a short quiz called \\"Organism Interactions.\\" Objectives: In this activity: 1. Students will define symbiosis and distinguish the type of symbiotic relationship that is occurring; mutualism, commensalism, or parasitism. 2. Students will distinguish competition from symbiosis. Part I. Link to the following website and read the information provided on Symbiosis. As you are reading you ...

  9. Seasons Interactive

    NSDL National Science Digital Library

    The representation contains several interactive features: An orbital panel (labeled Seasons) is an interactive animation of the Earth's axis of rotation which is tilted relative to the plane of the Earth?s yearly orbit around the sun. A location on the revolving Earth is marked with an 'X' at the 45 degree latitude which is depicted in an animated landscape panel which shows the path of the Sun in the sky over the course of 24 hour day. (For this learning goal, the orbital season panel and landscape panel will be used.) Additional components of the resource include the changing sunlight angle at this latitude hitting the earth and a thermometer showing the average daily temperature through one orbit of the planet around the sun. Two control panels located on the bottom right hand side allows changes to the tilt of the Earth's axis of rotation with respect to the plane of its orbit and the speed of the rotation and orbit around the Sun. The Sun's path can also be set to trace across the sky for each season. Two other planets, Venus and Uranus, are included for axis tilt comparison. Clickable buttons on top of screen provide a text Introduction, How To, Interactive, Exercises, and Solutions.

  10. Mother-infant interaction in mother and baby unit patients: before and after treatment.

    PubMed

    Kenny, Maeve; Conroy, Susan; Pariante, Carmine M; Seneviratne, Gertrude; Pawlby, Susan

    2013-09-01

    Maternal severe mental illness (SMI) disrupts mother-infant interaction in the immediate postpartum and is associated with less than optimal offspring development. In-patient mother and baby units (MBUs) provide the opportunity of supporting mothers with SMI in developing their relationships with their infants in order to minimise this disruption. One way is through an individualised video feedback intervention, delivered as part of a multidisciplinary inpatient treatment package. The present study prospectively measured changes in mother-infant interaction following video feedback intervention, during admission to an MBU (N = 49). Comparisons were made with mother-infant interactions of (1) a community-based ill group of mothers (N = 67) with a mental health diagnosis of similar severity, living at home and without the intervention and (2) a group of healthy mothers (N = 22). Maternal sensitivity and unresponsiveness, and infant cooperativeness and passiveness, were measured from a 3-min videotaped play session, using the CARE-Index. Following admission and the video feedback intervention, the MBU mothers (irrespective of diagnosis) and their infants showed improvements in their interactions. Moreover, on discharge the MBU dyads were significantly more sensitive, cooperative and responsive than the community ill group, and as attuned as the healthy group. While the design of the study does not allow us to conclude unequivocally that the video feedback intervention has effects on the outcome for the mothers and babies independent from the whole inpatient therapeutic package, the results do show that the dyadic interaction of mothers with SMI and their infants improves following the focussed treatment package in a specialised MBU. PMID:23786913

  11. Prenatal Ultrasound Screening: False Positive Soft Markers May Alter Maternal Representations and Mother-Infant Interaction

    PubMed Central

    Viaux-Savelon, Sylvie; Dommergues, Marc; Rosenblum, Ouriel; Bodeau, Nicolas; Aidane, Elizabeth; Philippon, Odile; Mazet, Philippe; Vibert-Guigue, Claude; Vauthier-Brouzes, Danièle; Feldman, Ruth; Cohen, David

    2012-01-01

    Background In up to 5% of pregnancies, ultrasound screening detects a “soft marker” (SM) that places the foetus at risk for a severe abnormality. In most cases, prenatal diagnostic work-up rules out a severe defect. We aimed to study the effects of false positive SM on maternal emotional status, maternal representations of the infant, and mother-infant interaction. Methodology and Principal Findings Utilizing an extreme-case prospective case control design, we selected from a group of 244 women undergoing ultrasound, 19 pregnant women whose foetus had a positive SM screening and a reassuring diagnostic work up, and 19 controls without SM matched for age and education. In the third trimester of pregnancy, within one week after delivery, and 2 months postpartum, we assessed anxiety, depression, and maternal representations. Mother-infant interactions were videotaped during feeding within one week after delivery and again at 2 months postpartum and coded blindly using the Coding Interactive Behavior (CIB) scales. Anxiety and depression scores were significantly higher at all assessment points in the SM group. Maternal representations were also different between SM and control groups at all study time. Perturbations to early mother-infant interactions were observed in the SM group. These dyads showed greater dysregulation, lower maternal sensitivity, higher maternal intrusive behaviour and higher infant avoidance. Multivariate analysis showed that maternal representation and depression at third trimester predicted mother-infant interaction. Conclusion False positive ultrasound screenings for SM are not benign and negatively affect the developing maternal-infant attachment. Medical efforts should be directed to minimize as much as possible such false diagnoses, and to limit their psychological adverse consequences. PMID:22292077

  12. Infant physiological regulation and maternal risks as predictors of dyadic interaction trajectories in families with a preterm infant.

    PubMed

    Poehlmann, Julie; Schwichtenberg, A J Miller; Bolt, Daniel M; Hane, Amanda; Burnson, Cynthia; Winters, Jill

    2011-01-01

    This longitudinal study examined predictors of rates of growth in dyadic interaction quality in children born preterm who did not experience significant neurological findings during neonatal intensive care unit (NICU) hospitalization. Multiple methods were used to collect data from 120 preterm infants (48% girls, 52% boys) and their mothers. Infant heart rate variability (HRV), gestational age, neonatal health, feeding route, and maternal socioeconomic (SES) risks were assessed at NICU discharge (mean of 36 weeks postconception). Mother-child interactions were observed at 4, 9, 16, and 24 months postterm and analyzed with hierarchical linear modeling. On average, children's quality of play, interest, and attention increased over time while their dysregulation and irritability decreased, whereas average maternal positive affect and involvement declined in quality (ps < .05), although there was individual variation in rates of change. Mothers of infants with higher postfeeding HRV (i.e., vagal regulation) exhibited less decrease in positive affect and involvement between 4 months and 24 months, compared with mothers of infants with lower HRV (p < .05). Although infants with higher postfeeding HRV showed less positive affect and communication at 4 months, they exhibited significantly greater increases in positive affect and social competence and decreases in dysregulation and irritability between 4 months and 24 months, compared with infants with lower HRV (ps < .05). Dyads experiencing more SES risks showed less optimal interactions at 4 months; this difference remained as children grew older (ps < .05). Results have implications for our understanding of social development in preterm infants. PMID:21244152

  13. Interactive atmosphere

    NSDL National Science Digital Library

    University of Utah. Astrophysics Science Project Integrating Research and Education (ASPIRE)

    2003-01-01

    Where is ozone located in the atmosphere? This informational activity, part of an interactive laboratory series for grades 8-12, explores the changes in ozone concentration with altitude. Students are introduced to layers of the atmosphere and the amount of ozone found at each layer of the troposphere, stratosphere, mesosphere, thermosphere, and exosphere. The activity also discusses why the addition of ozone to the atmosphere at different levels determines the temperatures of those levels. Students can move up and down to different layers of the atmosphere. A temperature scale is shown that runs from the surface of the Earth to the outer most reaches of the atmosphere. Copyright 2005 Eisenhower National Clearinghouse

  14. Interactive Physlets

    NSDL National Science Digital Library

    2012-02-10

    What, you may ask, is a physlet? It is a portmanteau combining the words "physics" and "applet" which can be used "to demonstrate a concept in physics through animation or interaction." Physlets are handy tools, especially for visual learners. These physlets were created by scholars at the Grenfell Campus of Memorial University in Corner Brook, Newfoundland. Designed to be used in several different introductory physics courses, the physlets cover a range of topics, including friction, conservation of energy, projectile motion, magnetism, and simple harmonic motion. Visitors will find that they can play each physlet, pause it along the way, or skip ahead to the next one as they see fit.

  15. DNA Interactive

    NSDL National Science Digital Library

    Fifty years ago, one of the most important landmarks in the history of science was reached when James Watson and Francis Crick discovered the double-helical structure of DNA. Developed by the Dolan DNA Learning Center at the legendary Cold Spring Harbor Laboratory, this Web site provides a host of interactive exhibits and background material about DNA, the human genome project, and the various applications that are gleaned through an intimate and detailed knowledge of human DNA specifically. From the home page, visitors can traverse an interactive timeline, complete with biographical profiles of different scientists and information about preliminary experiments that helped provide some of the fundamental groundwork leading up to the work of Watson and Crick, and which continues to the present. One other section that should not be missed is the Genome area, where visitors can explore the features of the genetic landscape, learn more about the methods used to map and sequence the entire human genome, and learn how genomes are utilized. Finally, there is a section for teachers which includes helpful learning guides and lesson builders.

  16. Cosmic Interactions

    NASA Astrophysics Data System (ADS)

    2008-01-01

    An image based on data taken with ESO's Very Large Telescope reveals a triplet of galaxies intertwined in a cosmic dance. ESO PR Photo 02/08 ESO PR Photo 02/08 NGC 7173, 7174, and 7176 The three galaxies, catalogued as NGC 7173 (top), 7174 (bottom right) and 7176 (bottom left), are located 106 million light-years away towards the constellation of Piscis Austrinus (the 'Southern Fish'). NGC 7173 and 7176 are elliptical galaxies, while NGC 7174 is a spiral galaxy with quite disturbed dust lanes and a long, twisted tail. This seems to indicate that the two bottom galaxies - whose combined shape bears some resemblance to that of a sleeping baby - are currently interacting, with NGC 7176 providing fresh material to NGC 7174. Matter present in great quantity around the triplet's members also points to the fact that NGC 7176 and NGC 7173 have interacted in the past. Astronomers have suggested that the three galaxies will finally merge into a giant 'island universe', tens to hundreds of times as massive as our own Milky Way. ESO PR Photo 02/08 ESO PR Photo 02b/08 NGC 7173, 7174, and 7176 The triplet is part of a so-called 'Compact Group', as compiled by Canadian astronomer Paul Hickson in the early 1980s. The group, which is the 90th entry in the catalogue and is therefore known as HCG 90, actually contains four major members. One of them - NGC 7192 - lies above the trio, outside of this image, and is another peculiar spiral galaxy. Compact groups are small, relatively isolated, systems of typically four to ten galaxies in close proximity to one another. Another striking example is Robert's Quartet. Compact groups are excellent laboratories for the study of galaxy interactions and their effects, in particular the formation of stars. As the striking image reveals, there are many other galaxies in the field. Some are distant ones, while others seem to be part of the family. Studies made with other telescopes have indeed revealed that the HCG 90 group contains 16 members, most of them much smaller in size than the four members with an entry in the NGC catalogue.

  17. Interactive Lectures

    NSDL National Science Digital Library

    2012-09-26

    The Science & Education Research Center (SERC) at Carleton College provides access to high-quality teaching materials for those in the earth sciences. This particular resource offers materials designed to help teachers involve students in large and small lecture-based classes. The materials here were originally created for the Starting Point: Introductory Geology site for geology teachers and the contributing partners came from the College of William and Mary, the University of Kentucky, and several others. The site delves into its teaching philosophy in the section titled How to Give Interactive Lectures. The Examples area provides over 30 specific examples of activities (such as geologic puzzles) that can be used to create a highly engaging classroom experience.

  18. Maternal Emotion Socialization in Maltreating and Non-Maltreating Families: Implications for Children's Emotion Regulation

    ERIC Educational Resources Information Center

    Shipman, Kimberly L.; Schneider, Renee; Fitzgerald, Monica M.; Sims, Chandler; Swisher, Lisa; Edwards, Anna

    2007-01-01

    This study investigated the socialization of children's emotion regulation in physically maltreating and non-maltreating mother-child dyads (N = 80 dyads). Mother-child dyads participated in the parent-child emotion interaction task (Shipman & Zeman, 1999) in which they talked about emotionally-arousing situations. The PCEIT was coded for maternal…

  19. Collaboration in Children: Dyadic Interaction Skills in Problem Solving.

    ERIC Educational Resources Information Center

    Cooper, Catherine R.

    Communication behaviors which facilitate cooperative problem solving were investigated in 3- to 5-year-old children. Thirty-two dyads, matched on age, sex and friendship were videotaped as they used balance scales to locate pairs of blocks of varying weight and surface design, but identical in size. All subjects had conventional labels for the…

  20. Guggenheim: Interact

    NSDL National Science Digital Library

    Interacting with the Guggenheim museums' collections is a great experience, and if you can't make it to one of their physical locations, this is the next best thing. The site is replete with creative assemblages of video ("YouTube Play"), blogs ("The Take"), and electronic newsletter options. Visitors shouldn't miss the "Voices from the Archives" area. Here they can listen to recent podcasts and as well as events from the past, including a conversation with Kandinsky scholar Rose-Carol Washton Long from 1964. Perhaps the most interesting part of the site is the "Declarations" section. Here, the Guggenheim has invited a "wide range of artists, scholars, activists, businesspeople, and government leaders to contribute concise remarks on related topical themes." One of the recent queries was "How is the idea of progress part of your practice?", and the responses are quite revealing. Finally, visitors can also make their way through their scrolling Twitter feed, and they are also encouraged to use the social media connections on the site to stay up-to-date.

  1. Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osteocalcin gene.

    PubMed Central

    Markose, E R; Stein, J L; Stein, G S; Lian, J B

    1990-01-01

    By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, we have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACTGACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. We have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. Our results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3. Images PMID:2308930

  2. Functional mapping of protein-protein interactions in an enzyme complex by directed evolution.

    PubMed

    Roderer, Kathrin; Neuenschwander, Martin; Codoni, Giosiana; Sasso, Severin; Gamper, Marianne; Kast, Peter

    2014-01-01

    The shikimate pathway enzyme chorismate mutase converts chorismate into prephenate, a precursor of Tyr and Phe. The intracellular chorismate mutase (MtCM) of Mycobacterium tuberculosis is poorly active on its own, but becomes >100-fold more efficient upon formation of a complex with the first enzyme of the shikimate pathway, 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase (MtDS). The crystal structure of the enzyme complex revealed involvement of C-terminal MtCM residues with the MtDS interface. Here we employed evolutionary strategies to probe the tolerance to substitution of the C-terminal MtCM residues from positions 84-90. Variants with randomized positions were subjected to stringent selection in vivo requiring productive interactions with MtDS for survival. Sequence patterns identified in active library members coincide with residue conservation in natural chorismate mutases of the AroQ? subclass to which MtCM belongs. An Arg-Gly dyad at positions 85 and 86, invariant in AroQ? sequences, was intolerant to mutation, whereas Leu88 and Gly89 exhibited a preference for small and hydrophobic residues in functional MtCM-MtDS complexes. In the absence of MtDS, selection under relaxed conditions identifies positions 84-86 as MtCM integrity determinants, suggesting that the more C-terminal residues function in the activation by MtDS. Several MtCM variants, purified using a novel plasmid-based T7 RNA polymerase gene expression system, showed that a diminished ability to physically interact with MtDS correlates with reduced activatability and feedback regulatory control by Tyr and Phe. Mapping critical protein-protein interaction sites by evolutionary strategies may pinpoint promising targets for drugs that interfere with the activity of protein complexes. PMID:25551646

  3. Functional Mapping of Protein-Protein Interactions in an Enzyme Complex by Directed Evolution

    PubMed Central

    Roderer, Kathrin; Neuenschwander, Martin; Codoni, Giosiana; Sasso, Severin; Gamper, Marianne; Kast, Peter

    2014-01-01

    The shikimate pathway enzyme chorismate mutase converts chorismate into prephenate, a precursor of Tyr and Phe. The intracellular chorismate mutase (MtCM) of Mycobacterium tuberculosis is poorly active on its own, but becomes >100-fold more efficient upon formation of a complex with the first enzyme of the shikimate pathway, 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase (MtDS). The crystal structure of the enzyme complex revealed involvement of C-terminal MtCM residues with the MtDS interface. Here we employed evolutionary strategies to probe the tolerance to substitution of the C-terminal MtCM residues from positions 84–90. Variants with randomized positions were subjected to stringent selection in vivo requiring productive interactions with MtDS for survival. Sequence patterns identified in active library members coincide with residue conservation in natural chorismate mutases of the AroQ? subclass to which MtCM belongs. An Arg-Gly dyad at positions 85 and 86, invariant in AroQ? sequences, was intolerant to mutation, whereas Leu88 and Gly89 exhibited a preference for small and hydrophobic residues in functional MtCM-MtDS complexes. In the absence of MtDS, selection under relaxed conditions identifies positions 84–86 as MtCM integrity determinants, suggesting that the more C-terminal residues function in the activation by MtDS. Several MtCM variants, purified using a novel plasmid-based T7 RNA polymerase gene expression system, showed that a diminished ability to physically interact with MtDS correlates with reduced activatability and feedback regulatory control by Tyr and Phe. Mapping critical protein-protein interaction sites by evolutionary strategies may pinpoint promising targets for drugs that interfere with the activity of protein complexes. PMID:25551646

  4. Substantial Contribution of the Two Imidazole Rings of the His13–His14 Dyad to Cu(II) Binding in Amyloid-? (1–16) at Physiological pH and Its Significance

    PubMed Central

    Shin, Byong-kyu; Saxena, Sunil

    2011-01-01

    The interaction of amyloid-? (A?) peptide with Cu(II) appears to play an important role in the etiology of Alzheimer’s disease. At physiological pH, the Cu(II) coordination in A? is heterogeneous, and there exist at least two binding modes in which Cu(II) is coordinated by histidine residues. Electron spin resonance studies have revealed a picture of the Cu(II) binding at a higher or lower pH, where only one of the two binding modes is almost exclusively present. We describe a procedure to directly examine the coordination of Cu(II) to each histidine residue in the dominant binding mode at physiological pH. We use nonlabeled and residue-specifically 15N-labeled A?(1–16). For quantitative analysis, the intensities of three-pulse electron spin-echo envelope modulation (ESEEM) spectra are analyzed. Spectral simulations show that ESEEM intensities provide information about the contribution of each histidine residue. Indeed, the ESEEM experiments at pH 6.0 confirm the dominant contribution of His6 to the Cu(II) coordination as expected from the work of other researchers. Interestingly, however, the ESEEM data obtained at pH 7.4 reveal that the contributions of the three residues to the Cu(II) coordination are in the order of His14 ? His6 > His13 in the dominant binding mode. The order indicates a significant contribution from the simultaneous coordination by His13 and His14 at physiological pH, which has been underappreciated. These findings are supported by hyperfine sublevel correlation spectroscopy experiments. The simultaneous coordination by the two adjacent residues is likely to be present in a non–?-sheet structure. The coexistence of different secondary structures is possibly the molecular origin for the formation of amorphous aggregates rather than fibrils at relatively high concentrations of Cu(II). Through our approach, precise and useful information about Cu(II) binding in A?(1–16) at physiological pH is obtained without any side-chain modification, amino acid residue replacement, or pH change, each of which might lead to an alteration in the peptide structure or the coordination environment. PMID:21491887

  5. Substantial contribution of the two imidazole rings of the His13-His14 dyad to Cu(II) binding in amyloid-?(1-16) at physiological pH and its significance.

    PubMed

    Shin, Byong-kyu; Saxena, Sunil

    2011-09-01

    The interaction of amyloid-? (A?) peptide with Cu(II) appears to play an important role in the etiology of Alzheimer's disease. At physiological pH, the Cu(II) coordination in A? is heterogeneous, and there exist at least two binding modes in which Cu(II) is coordinated by histidine residues. Electron spin resonance studies have revealed a picture of the Cu(II) binding at a higher or lower pH, where only one of the two binding modes is almost exclusively present. We describe a procedure to directly examine the coordination of Cu(II) to each histidine residue in the dominant binding mode at physiological pH. We use nonlabeled and residue-specifically (15)N-labeled A?(1-16). For quantitative analysis, the intensities of three-pulse electron spin-echo envelope modulation (ESEEM) spectra are analyzed. Spectral simulations show that ESEEM intensities provide information about the contribution of each histidine residue. Indeed, the ESEEM experiments at pH 6.0 confirm the dominant contribution of His6 to the Cu(II) coordination as expected from the work of other researchers. Interestingly, however, the ESEEM data obtained at pH 7.4 reveal that the contributions of the three residues to the Cu(II) coordination are in the order of His14 ? His6 > His13 in the dominant binding mode. The order indicates a significant contribution from the simultaneous coordination by His13 and His14 at physiological pH, which has been underappreciated. These findings are supported by hyperfine sublevel correlation spectroscopy experiments. The simultaneous coordination by the two adjacent residues is likely to be present in a non-?-sheet structure. The coexistence of different secondary structures is possibly the molecular origin for the formation of amorphous aggregates rather than fibrils at relatively high concentrations of Cu(II). Through our approach, precise and useful information about Cu(II) binding in A?(1-16) at physiological pH is obtained without any side-chain modification, amino acid residue replacement, or pH change, each of which might lead to an alteration in the peptide structure or the coordination environment. PMID:21491887

  6. Interactive portraiture : designing intimate interactive experiences

    E-print Network

    Zuckerman, Orit

    2006-01-01

    In this thesis I present a set of interactive portrait experiences that strive to create an intimate connection between the viewer and the portrayed subject; an emotional experience, one of personal reflection. My interactive ...

  7. The Relationship Development Assessment - Research Version: Preliminary validation of a clinical tool and coding schemes to measure parent-child interaction in autism.

    PubMed

    Larkin, Fionnuala; Guerin, Suzanne; Hobson, Jessica A; Gutstein, Steven E

    2015-04-01

    The aim of this project was to replicate and extend findings from two recent studies on parent-child relatedness in autism (Beurkens, Hobson, & Hobson, 2013; Hobson, Tarver, Beurkens, & Hobson, 2013, under review) by adapting an observational assessment and coding schemes of parent-child relatedness for the clinical context and examining their validity and reliability. The coding schemes focussed on three aspects of relatedness: joint attentional focus (Adamson, Bakeman, & Deckner, 2004), the capacity to co-regulate an interaction and the capacity to share emotional experiences. The participants were 40 children (20 with autism, 20 without autism) aged 6-14, and their parents. Parent-child dyads took part in the observational assessment and were coded on these schemes. Comparisons were made with standardised measures of autism severity (Autism Diagnostic Observation Schedule, ADOS: Lord, Rutter, DiLavore, & Risi, 2001; Social Responsiveness Scale, SRS: Constantino & Gruber, 2005), relationship quality (Parent Child Relationship Inventory, PCRI: Gerard, 1994) and quality of parent-child interaction (Dyadic Coding Scales, DCS: Humber & Moss, 2005). Inter-rater reliability was very good and, as predicted, codes both diverged from the measure of parent-child relationship and converged with a separate measure of parent-child interaction quality. A detailed profile review revealed nuanced areas of group and individual differences which may be specific to verbally-able school-age children. The results support the utility of the Relationship Development Assessment - Research Version for clinical practice. PMID:24366957

  8. A meta-analytic review of relationship-based interventions for low-income families with infants and toddlers: facilitating supportive parent-child interactions.

    PubMed

    Mortensen, Jennifer A; Mastergeorge, Ann M

    2014-07-01

    Relationship-based intervention programs are increasingly being implemented as a way to enhance parent-child interaction quality. In this meta-analytic review, we examined the effectiveness of 19 recent relationship-based interventions serving socioeconomically disadvantaged families with infants and toddlers (N = 6,807). This review specifically focused on intervention effectiveness in terms of improving supportive parenting behaviors, as measured by observational assessments of dyadic parent-child interactions. Meta-analytic results indicated significant, yet modest, effectiveness across all interventions (d = .23). Intervention characteristics such as participant randomization, breadth of intervention services offered, duration, child age at the start of the intervention, professional qualifications of the intervenor, and type of play task used during assessment were tested as possible moderators of effectiveness. Significant differences in effectiveness were found between randomized and nonrandomized interventions. Within the subsample of randomized interventions, programs that were shorter in duration, that provided direct services to the parent-child dyad, used intervenors with professional qualifications, and assessed parent-child interactions with free-play tasks were the most effective, highlighting important considerations for designing effective intervention protocol tailored to the needs of this high-risk population. PMID:25798486

  9. The role of quaternary interactions on the stability and activity of ascorbate peroxidase.

    PubMed

    Mandelman, D; Schwarz, F P; Li, H; Poulos, T L

    1998-10-01

    Point mutations at the dimer interface of the homodimeric enzyme ascorbate peroxidase (APx) were constructed to assess the role of quaternary interactions in the stability and activity of APx. Analysis of the APx crystal structure shows that Glu112 forms a salt bridge with Lys20 and Arg24 of the opposing subunit near the axis of dyad symmetry between the subunits. Two point mutants, E112A and E112K, were made to determine the effects of a neutral (alanine) and repulsive (lysine) mutation on dimerization, stability, and activity. Gel filtration analysis indicated that the ratio of the monomer to dimer increased as the dimer interface interactions went from attractive to repulsive. Differential scanning calorimetry (DSC) data exhibited a decrease in both the transition temperature (Tm) and enthalpy of unfolding (deltaHc) with Tm = 58.3 +/- 0.5 degrees C, 56.0 +/- 0.8 degrees C, and 53.0 +/- 0.9 degrees C and deltaHc = 245 +/- 29 kcal/mol, 199 +/- 38 kcal/mol, and 170 +/- 25 kcal/mol for wild-type APx, E112A, and E112K, respectively. Similar changes were observed based on thermal melting curves obtained by absorption spectroscopy. No change in enzyme activity was found for the E112A mutant, and only a 25% drop in activity was observed for the E112K mutant which demonstrates that the non-Michaelis Menten kinetics of APx is not due to the APx oligomeric structure. The cryogenic crystal structures of the wild-type and mutant proteins show that mutation induced changes are limited to the dimer interface including an alteration in solvent structure. PMID:9792095

  10. Interactions Between Computational Verbs

    Microsoft Academic Search

    Tao Yang

    2008-01-01

    Different types of interactions between computa- tional verbs are studied in a general context. The interactions can be categorized by their strengthes and directions as well as the configurations of interactions. Two interaction types; namely, coupling and parameter modulation are studied. The identical synchronization and generalized synchronization between com- putational verbs and their linguistic implications are investigated. The merge and

  11. Help-seeking and attractiveness in cross-sex dyads

    Microsoft Academic Search

    MICHEL ALAIN

    1985-01-01

    People usually do not like to appear in unfavourable ways in front of others and will sometimes avoid such situations. Because physical attractiveness is very much valued in our society, it could be embarrassing for an individual to appear incompetent in front of an attractive person. For example, Nadler (1980) showed that female subjects asked for significantly less help from

  12. The Atonement–Forgiveness Dyad: Identification With the Aggressed

    Microsoft Academic Search

    Irwin C. Rosen

    2009-01-01

    In an effort to assuage the dystonicities of guilt and anxiety, the atoner forms an identification with his victim. Such an identification is, for the most part, unconscious and, to follow Racker's categorization, is either a concordant or a complementary one, with each pattern generating a distinct atonement narrative. Atonement is synonymous with neither reparation nor guilt, although each of

  13. Breastfeeding and Health Outcomes for the Mother-Infant Dyad

    PubMed Central

    Dieterich, Christine M.; Felice, Julia P.; O’Sullivan, Elizabeth

    2012-01-01

    Synopsis Worldwide, breastfeeding saves the lives of infants and reduces their disease burden. Breastfeeding also reduces the disease burden for mothers. This article examines who chooses to breastfeed and for how long in the American context. It also reviews the latest evidence about the consequences of breastfeeding for the health of both the infant and mother. The results of this review provide support for current national and international recommendations that support breastfeeding. PMID:23178059

  14. Evidence for Catalytic CysteineHistidine Dyad in Chalcone Synthase

    E-print Network

    Suh, Dae-Yeon

    (Fab H) and Saccharomyces cerevisiae thiolase I (7­10). All these proteins display five-layered coreH-independent in the range of pH 5.8 to 7.8; however, its inhibitory effect on CHS-C164S increased as pH increased from 6

  15. Effective Leadership in Superior-Subordinate Dyads: Theory and Data

    ERIC Educational Resources Information Center

    Mawhinney, Thomas C.

    2006-01-01

    This paper describes and experimentally demonstrates the main tenets of an operant theory of leadership. Leadership is characterized in the current paper as involving problem solving operant behavior (Cerutti, 1989; Skinner, 1969) in a social context (Skinner, 1953). The theory was assessed under two experimental analogs modeled from generic…

  16. Differences in intergender communication within task-oriented dyads

    E-print Network

    McAfee, Joanna Lynn

    1999-01-01

    This study examines the influence of the task structure on intergender communication. The primary goal of this research is to find out whether a cooperative or competitive task structure has an effect on inequalities in communication between women...

  17. Developmental trends in television coviewing of parent-child dyads

    Microsoft Academic Search

    Fritz Sang; Bernhard Schmitz; Karl Tasche

    1993-01-01

    In this study, long-term trends in joint parent-child television viewing are taken as prototype for developmental changes of the parent-child relationship during adolescence. To describe and compare trends of television coviewing in different configurations of family members, trajectories of daily television viewing, tmeasured with Nielsen-type people meters over a time period of three years, were analyzed using time series methods.

  18. Buyouts, information asymmetry and the family management dyad

    Microsoft Academic Search

    Carole Howorth; Paul Westhead; Mike Wright

    2004-01-01

    Management buyouts (MBOs) and buyins (MBIs) are an alternative solution to the private family firm ownership succession issue. It is typically assumed that MBO\\/MBIs of private family firms progress more smoothly than other types of MBO\\/MBI, due to fewer information asymmetries and closer relationships between the parties involved. This study provides novel evidence from eight private family firms that had

  19. Young Mother-Father Dyads and Maternal Harsh Parenting Behavior

    ERIC Educational Resources Information Center

    Lee, Yookyong; Guterman, Neil B.

    2010-01-01

    Objective: This study examined whether the age of parents predicted maternal harsh parenting behavior, specifically whether younger mothers might be at higher risk than older mothers, and which paternal characteristics might be associated with maternal parenting behavior. Methodology: This study used data from the Fragile Families and Child…

  20. Perceptions of Conflict Management Styles in Chinese Intergenerational Dyads

    E-print Network

    Zhang, Yan Bing; Harwood, Jake; Hummert, Mary Lee

    2005-03-01

    We examined intergenerational communication and conflict management styles in China. Older and younger Chinese adults were randomly assigned to evaluate one of four conversation transcripts in which an older worker criticizes a young co...

  1. Interacting dark sector with transversal interaction

    NASA Astrophysics Data System (ADS)

    Chimento, Luis P.; Richarte, Martín G.

    2015-03-01

    We investigate the interacting dark sector composed of dark matter, dark energy, and dark radiation for a spatially flat Friedmann-Robertson-Walker (FRW) background by introducing a three-dimensional internal space spanned by the interaction vector Q and solve the source equation for a linear transversal interaction. Then, we explore a realistic model with dark matter coupled to a scalar field plus a decoupled radiation term, analyze the amount of dark energy in the radiation era and find that our model is consistent with the recent measurements of cosmic microwave background anisotropy coming from Planck along with the future constraints achievable by CMBPol experiment.

  2. Cardiovascular Interactions CVI Project

    NSDL National Science Digital Library

    PhD Carl F. Rothe (Indiana University School of Medicine Department of Cellular and Integrative Physiology)

    2005-06-22

    The Cardiovascular Interactions Project is an electronic active learning tool that demonstrates the complex and intricate interactions between the functions of the heart and peripheral circulation to provide an adequate cardiac output during various stresses.

  3. Interactive Worksheets and More

    MedlinePLUS

    ... currently configured not to display inline frames. Home > Interactive worksheets & more See where you stand Check your ... for quitting Social support Professional help Resources Tools Interactive worksheets Calculators Info & help links Q & As About ...

  4. Sepup Seasons Interactive

    NSDL National Science Digital Library

    Regents of the University of California

    An interactive that illustrates the relationships between the axial tilt of the Earth, latitude, and temperature. Several data sets (including temperature, Sun-Earth distance, daylight hours) can be collected using this interactive.

  5. The cation-? interaction.

    PubMed

    Dougherty, Dennis A

    2013-04-16

    The chemistry community now recognizes the cation-? interaction as a major force for molecular recognition, joining the hydrophobic effect, the hydrogen bond, and the ion pair in determining macromolecular structure and drug-receptor interactions. This Account provides the author's perspective on the intellectual origins and fundamental nature of the cation-? interaction. Early studies on cyclophanes established that water-soluble, cationic molecules would forego aqueous solvation to enter a hydrophobic cavity if that cavity was lined with ? systems. Important gas phase studies established the fundamental nature of the cation-? interaction. The strength of the cation-? interaction (Li(+) binds to benzene with 38 kcal/mol of binding energy; NH4(+) with 19 kcal/mol) distinguishes it from the weaker polar-? interactions observed in the benzene dimer or water-benzene complexes. In addition to the substantial intrinsic strength of the cation-? interaction in gas phase studies, the cation-? interaction remains energetically significant in aqueous media and under biological conditions. Many studies have shown that cation-? interactions can enhance binding energies by 2-5 kcal/mol, making them competitive with hydrogen bonds and ion pairs in drug-receptor and protein-protein interactions. As with other noncovalent interactions involving aromatic systems, the cation-? interaction includes a substantial electrostatic component. The six (four) C(?-)-H(?+) bond dipoles of a molecule like benzene (ethylene) combine to produce a region of negative electrostatic potential on the face of the ? system. Simple electrostatics facilitate a natural attraction of cations to the surface. The trend for (gas phase) binding energies is Li(+) > Na(+) > K(+) > Rb(+): as the ion gets larger the charge is dispersed over a larger sphere and binding interactions weaken, a classical electrostatic effect. On other hand, polarizability does not define these interactions. Cyclohexane is more polarizable than benzene but a decidedly poorer cation binder. Many studies have documented cation-? interactions in protein structures, where lysine or arginine side chains interact with phenylalanine, tyrosine, or tryptophan. In addition, countless studies have established the importance of the cation-? interaction in a range of biological processes. Our work has focused on molecular neurobiology, and we have shown that neurotransmitters generally use a cation-? interaction to bind to their receptors. We have also shown that many drug-receptor interactions involve cation-? interactions. A cation-? interaction plays a critical role in the binding of nicotine to ACh receptors in the brain, an especially significant case. Other researchers have established important cation-? interactions in the recognition of the "histone code," in terpene biosynthesis, in chemical catalysis, and in many other systems. PMID:23214924

  6. Elements of Interaction

    Microsoft Academic Search

    Farhad Arbab

    2010-01-01

    \\u000a The most challenging aspect of concurrency involves the study of interaction and its properties. Interaction refers to what\\u000a transpires among two or more active entities whose (communication) actions mutually affect each other. In spite of the long-standing\\u000a recognition of the significance of interaction, classical models of concurrency resort to peculiarly indirect means to express\\u000a interaction and study its properties. Formalisms

  7. Dynamic Interactive Learning Systems

    ERIC Educational Resources Information Center

    Sabry, Khaled; Barker, Jeff

    2009-01-01

    This paper reviews and discusses the notions of interactivity and dynamicity of learning systems in relation to information technologies and design principles that can contribute to interactive and dynamic learning. It explores the concept of dynamic interactive learning systems based on the emerging generation of information as part of a…

  8. Father-Infant Interaction.

    ERIC Educational Resources Information Center

    Yogman, Michael W.; And Others

    This study compares the face-to-face interaction of infants with fathers to their interaction with mothers and with strangers. Five infants were videotaped in individual interaction with their mothers, fathers, and unfamiliar adults at weekly intervals from the second week until the infants were 6 months old. Infants were seated in a laboratory…

  9. Differences in forebrain androgen receptor expression in winners and losers of male anole aggressive interactions.

    PubMed

    Hattori, Tomoko; Wilczynski, Walter

    2014-09-25

    Size matched male green anoles (Anolis carolinensis) were paired in a neutral setting and allowed to engage in aggressive displays. Winners and losers were apparent in each pair within 90min, resulting in stable dominant/subordinate dyads. Androgen receptor (AR) expression was assessed at three time points after the initial pairing, 2h, 3 days, and 10 days in dominants, subordinates, and two groups of control males housed alone or with a female for an equal period of time. Expression was quantified in three forebrain areas that have been implicated in aggression and reproductive social behavior in this species, the preoptic area (POA), the anterior hypothalamus (AH), septal area (SEP), and ventromedial nucleus of the posterior division of the dorsal ventricular ridge (PDVRVM ). There were significant overall group differences in AR mRNA expression in the POA and AH that appeared to result from higher POA AR expression in dominant males compared to other groups, and generally lower AR expression in subordinate males. Pairwise comparison revealed that dominants' AR mRNA expression in the POA was significantly higher in the 2h and 3 day groups compared to that of subordinates, with a similar, but nonsignificant, difference in the 10 day group. Dominants had significantly higher AR mRNA expression in the AH compared to that of subordinates in the 2h group, but differences were not significant at later times. The results suggest that POA and AH sensitivity to androgens is increased in dominants compared to subordinates, and that the difference can be seen soon after the agonistic interaction establishing winners and losers. PMID:25069090

  10. The interactive brain hypothesis

    PubMed Central

    Di Paolo, Ezequiel; De Jaegher, Hanne

    2012-01-01

    Enactive approaches foreground the role of interpersonal interaction in explanations of social understanding. This motivates, in combination with a recent interest in neuroscientific studies involving actual interactions, the question of how interactive processes relate to neural mechanisms involved in social understanding. We introduce the Interactive Brain Hypothesis (IBH) in order to help map the spectrum of possible relations between social interaction and neural processes. The hypothesis states that interactive experience and skills play enabling roles in both the development and current function of social brain mechanisms, even in cases where social understanding happens in the absence of immediate interaction. We examine the plausibility of this hypothesis against developmental and neurobiological evidence and contrast it with the widespread assumption that mindreading is crucial to all social cognition. We describe the elements of social interaction that bear most directly on this hypothesis and discuss the empirical possibilities open to social neuroscience. We propose that the link between coordination dynamics and social understanding can be best grasped by studying transitions between states of coordination. These transitions form part of the self-organization of interaction processes that characterize the dynamics of social engagement. The patterns and synergies of this self-organization help explain how individuals understand each other. Various possibilities for role-taking emerge during interaction, determining a spectrum of participation. This view contrasts sharply with the observational stance that has guided research in social neuroscience until recently. We also introduce the concept of readiness to interact to describe the practices and dispositions that are summoned in situations of social significance (even if not interactive). This latter idea links interactive factors to more classical observational scenarios. PMID:22701412

  11. [Drug-drug interactions: interactions between xenobiotics].

    PubMed

    Haen, E

    2014-04-01

    Drug-drug interactions (DDI) are a major topic in programs for continuous medical education (CME). Many physicians are afraid of being trapped into charges of malpractice; however, DDI cannot be avoided in many cases. They belong to routine medical practice and it is often impossible to avoid them. Moreover, they do not just occur between drugs but between any kind of foreign substance (xenobiotica), such as food (e.g. grapefruit juice, broccoli, barbecue) as well as legal (e.g. tobacco smoke, caffeine and alcohol) and illegal drugs. Therefore, the medical challenge is not just to avoid any interaction. Instead the physician faces the question of how to proceed with drug treatment in the presence of such interactions. Based on the medical education a physician has to judge first of all whether there is a risk for interactions in the prescription being planned for an individual patient. The classification of interactions proposed in this article (PD1-PD4, PK1-PK3) might help as a sort of check list. For more detailed information the physician can then consult one of the many databases available on the internet, such as PSIAConline (http://www.psiac.de) and MediQ (http://www.mediq.ch). Pharmacokinetic interactions can be easily assessed, monitored and controlled by therapeutic drug monitoring (TDM). Besides these tools it is important to keep in mind that nobody knows everything; even physicians do not know everything. So take pride in asking someone who might help and for this purpose AGATE offers a drug information service AID (http://www.amuep-agate.de). Just good for nothing, without being based on any kind of medical approach are computer programs that judge prescriptions without taking into account a patient's individual peculiarities. In case these types of programs produce red exclamation marks or traffic lights to underline their judgment, they might even work in a contrapuntal way by just eliciting insecurity and fear. PMID:24619146

  12. Cation-alkane interaction.

    PubMed

    Premkumar, J Richard; Sastry, G Narahari

    2014-12-01

    Ab initio computations, up to CCSD(T)/CBS on model systems, and MP2/cc-pVTZ and DFT calculations are performed on cation-alkane and cation-alkene complexes, cation = Li(+), Na(+), Be(2+), Mg(2+), Ca(2+), Cu(+) and Zn(2+); alkane = C(n)H2(n+2) (n = 1-10) and C6H12; and alkene = C2H4 and C6H6. Density functional theory-symmetry adapted perturbation theory (DFT-SAPT) calculations reveal that the cation-alkane interactions are predominantly constituted of induction component. The dramatic modulation of the strength of their interaction and the topological features obtained from atoms in molecules (AIM) analysis are consistent with the characteristics of a typical noncovalent interaction. In contrast to many of the conventional noncovalent interactions, cation-alkane interactions are substantially strong and are comparable in strength to the well studied cation-? interactions. PMID:25384257

  13. Food-Drug Interactions

    PubMed Central

    Bushra, Rabia; Aslam, Nousheen; Khan, Arshad Yar

    2011-01-01

    The effect of drug on a person may be different than expected because that drug interacts with another drug the person is taking (drug-drug interaction), food, beverages, dietary supplements the person is consuming (drug-nutrient/food interaction) or another disease the person has (drug-disease interaction). A drug interaction is a situation in which a substance affects the activity of a drug, i.e. the effects are increased or decreased, or they produce a new effect that neither produces on its own. These interactions may occur out of accidental misuse or due to lack of knowledge about the active ingredients involved in the relevant substances. Regarding food-drug interactions physicians and pharmacists recognize that some foods and drugs, when taken simultaneously, can alter the body's ability to utilize a particular food or drug, or cause serious side effects. Clinically significant drug interactions, which pose potential harm to the patient, may result from changes in pharmaceutical, pharmacokinetic, or pharmacodynamic properties. Some may be taken advantage of, to the benefit of patients, but more commonly drug interactions result in adverse drug events. Therefore it is advisable for patients to follow the physician and doctors instructions to obtain maximum benefits with least food-drug interactions. The literature survey was conducted by extracting data from different review and original articles on general or specific drug interactions with food. This review gives information about various interactions between different foods and drugs and will help physicians and pharmacists prescribe drugs cautiously with only suitable food supplement to get maximum benefit for the patient. PMID:22043389

  14. OTV impacts and interactions

    NASA Technical Reports Server (NTRS)

    Roberts, Barney B.

    1986-01-01

    The possible impacts and interactions of the agency's planning activities for the Orbit Transfer Vehicle (OTV) that is tentatively scheduled for initial operational capability in the late 1990's are identified. In general, the various Mars missions require vehicles of significant size and performance far greater than that provided by any OTV configuration currently being seriously considered. Therefore, interactions and impacts on these current concepts are minimal. These impacts and interactions fall into categories of technologies, systems, and operations. Each category is addressed.

  15. Beam-Bem interactions

    SciTech Connect

    Kim, Hyung Jin; /Fermilab

    2011-12-01

    In high energy storage-ring colliders, the nonlinear effect arising from beam-beam interactions is a major source that leads to the emittance growth, the reduction of beam life time, and limits the collider luminosity. In this paper, two models of beam-beam interactions are introduced, which are weak-strong and strong-strong beam-beam interactions. In addition, space-charge model is introduced.

  16. Nerve-pulse interactions

    SciTech Connect

    Scott, A.C.

    1982-01-01

    Some recent experimental and theoretical results on mechanisms through which individual nerve pulses can interact are reviewed. Three modes of interactions are considered: (1) interaction of pulses as they travel along a single fiber which leads to velocity dispersion; (2) propagation of pairs of pulses through a branching region leading to quantum pulse code transformations; and (3) interaction of pulses on parallel fibers through which they may form a pulse assembly. This notion is analogous to Hebb's concept of a cell assembly, but on a lower level of the neural hierarchy.

  17. The Science of Interaction

    SciTech Connect

    Pike, William A.; Stasko, John T.; Chang, Remco; O'Connell, Theresa

    2009-09-23

    There is a growing recognition with the visual analytics community that interaction and inquiry are inextricable. It is through the interactive manipulation of a visual interface – the analytic discourse – that knowledge is constructed, tested, refined, and shared. This paper reflects on the interaction challenges raised in the original visual analytics research and development agenda and further explores the relationship between interaction and cognition. It identifies recent exemplars of visual analytics research that have made substantive progress toward the goals of a true science of interaction, which must include theories and testable premises about the most appropriate mechanisms for human-information interaction. Six areas for further work are highlighted as those among the highest priorities for the next five years of visual analytics research: ubiquitous, embodied interaction; capturing user intentionality; knowledge-based interfaces; principles of design and perception; collaboration; and interoperability. Ultimately, the goal of a science of interaction is to support the visual analytics community through the recognition and implementation of best practices in the representation of and interaction with visual displays.

  18. Characteristics of Mother-Child Interactions Related to Adolescents' Positive Values and Behaviors

    ERIC Educational Resources Information Center

    Padilla-Walker, Laura M.

    2007-01-01

    The purpose of this study was to examine a theoretical model that considered accurate perception and acceptance of maternal values in relation to adolescents' positive values and behaviors. One hundred fifty-one mother-adolescent dyads completed measures targeting adolescent and maternal perceptions of prosocial values and adolescent behaviors (M…

  19. Automated Measurement of Facial Expression in Infant-Mother Interaction: A Pilot Study

    ERIC Educational Resources Information Center

    Messinger, Daniel S.; Mahoor, Mohammad H.; Chow, Sy-Miin; Cohn, Jeffrey F.

    2009-01-01

    Automated facial measurement using computer vision has the potential to objectively document continuous changes in behavior. To examine emotional expression and communication, we used automated measurements to quantify smile strength, eye constriction, and mouth opening in two 6-month-old infant-mother dyads who each engaged in a face-to-face…

  20. Socio-Emotional Climate of Storybook Reading Interactions for Mothers and Preschoolers with Language Impairment

    ERIC Educational Resources Information Center

    Skibbe, Lori E.; Moody, Amelia J.; Justice, Laura M.; McGinty, Anita S.

    2010-01-01

    The current study describes the storybook reading behaviors of 45 preschoolers [30 with language impairment (LI) and 15 with typical language (TL)] and their mothers. Each dyad was observed reading a storybook within their homes, and sessions were subsequently coded for indicators of emotional and instructional quality as well as for child…

  1. Contingent Interactions between Parents and Young Children with Severe Expressive Communication Impairments

    ERIC Educational Resources Information Center

    Cress, Cynthia J.; Grabast, Jodi; Burgers Jerke, Kimberly

    2013-01-01

    Parents and their children with severe expressive impairments may have limited successful communicative exchanges due to each partner's difficulty in recognizing and responding to communicative behaviors of the other. This study examined the communicative functions and modes of communication that received contingent responses in 20 dyads of…

  2. Interactive Whiteboards: Interactive or Just Whiteboards?

    ERIC Educational Resources Information Center

    Northcote, Maria; Mildenhall, Paula; Marshall, Linda; Swan, Paul

    2010-01-01

    Over the last decade, interactive whiteboards have become popular teaching and learning tools, especially in primary school classrooms. Research studies from recent literature report on high levels of student motivation, teacher enthusiasm and whole-school support associated with these technological tools. Much research to date has reported on the…

  3. How Interactive Is the Interactive Whiteboard?

    ERIC Educational Resources Information Center

    Quashie, Valerie

    2009-01-01

    An interactive whiteboard (IWB) is simply a surface onto which a computer screen can be displayed, via a projector. It is touch-sensitive and lets one use a pen like a mouse, controlling the computer from the board itself. Everything that can be displayed on a computer can be displayed onto the whiteboard and, if the computer is linked to speakers…

  4. Venus: Interaction with Solar Wind

    NASA Astrophysics Data System (ADS)

    Russell, C.; Luhmann, J.; Murdin, P.

    2002-07-01

    The solar wind interaction with VENUS provides the archetypal interaction of a flowing magnetized PLASMA with a PLANETARY IONOSPHERE. Mars interacts with the solar wind in much the same way as does Venus, while the rotating plasma in the Saturnian magnetosphere is believed to interact similarly with its moon, Titan (see SATURN: MAGNETOSPHERE INTERACTION WITH TITAN). The interaction of the Jovian ...

  5. Visualizing Dispersion Interactions

    ERIC Educational Resources Information Center

    Gottschalk, Elinor; Venkataraman, Bhawani

    2014-01-01

    An animation and accompanying activity has been developed to help students visualize how dispersion interactions arise. The animation uses the gecko's ability to walk on vertical surfaces to illustrate how dispersion interactions play a role in macroscale outcomes. Assessment of student learning reveals that students were able to develop…

  6. [Drug interactions in dentistry].

    PubMed

    Torres, J H; Bons, P; Bayssière, J; Blayac, J P; Boucard, R

    1990-09-01

    The authors describe the various interactions which may exist between the medical treatments followed by patients and various groups of substances used in odonto-stomatology: non-steroid anti-inflammatory drugs, antibiotics, antifungicides, vasoconstrictors and local anaesthetics. They clarify the clinical risk relating to each of these medicament interactions. PMID:2239411

  7. Interaction Analysis in MANOVA.

    ERIC Educational Resources Information Center

    Betz, M. Austin

    Simultaneous test procedures (STPS for short) in the context of the unrestricted full rank general linear multivariate model for population cell means are introduced and utilized to analyze interactions in factorial designs. By appropriate choice of an implying hypothesis, it is shown how to test overall main effects, interactions, simple main,…

  8. Interactive Presentation of Content

    ERIC Educational Resources Information Center

    Magdin, Martin; Turcáni, Milan; Vrábel, Marek

    2009-01-01

    In the paper we discus about design of universal environment for solution of creating effective multimedia applications with accent on the implementation of interactive elements with the possibility of using the adaptive systems (AS). We also discuss about possibilities of offline presentation of this interactive multimedia adaptive animations…

  9. Evolution of interaction

    Microsoft Academic Search

    Christian V. Forst; Christian Reidys

    1996-01-01

    Interactions between replicating entities is a crucial part in the emergence of individuals at the early stages of prebiotic evolution. The interplay between cooperative and competitive behavior of interacting species explains the evolution of functional reaction networks. Motivated by RNA secondary-structure folding-landscapes based on computer algorithms we construct a mathematical framework which provides a comprehensive and coherent description of these

  10. Distributed Interactive Learning Environment

    Microsoft Academic Search

    Jim X. Chen; Christopher J. Dede; Xiaodong Fu; Yonggao Yang

    1999-01-01

    We present strategies and approaches used to implement a synthetic learning environment which includes networking, distributed interactive simulation, physically-based modeling, computational steering, and virtual reality for learning abstract scientific concepts. The resulting technology is a testbed that reflects the benefits of a schoolhouse for training and education, especially for learning scientific abstract concepts. Students are allowed to interact with one

  11. Interacting with America

    NSDL National Science Digital Library

    American Human Development Project

    "Interacting With America" is comprised of rich data on human development in the US that readers can explore through a clearly depicted, interactive map on health, wealth and education in the 50 states. Teachers and students alike can draw comparisons between states through the use of the intuitively constructed histograms which display the human development indexes measured for each state.

  12. Media Embedded Interactions.

    ERIC Educational Resources Information Center

    Johnson, J. David

    A review of literature and two surveys, one of college students and one of a random sample of adults, were used to examine four aspects of media embedded interactions (social behavior in front of a TV or radio): their functions, their environment, their effects, and the reactions of the interactants to them. Television is seen as performing a…

  13. Interactive Visualization of Dependencies

    ERIC Educational Resources Information Center

    Moreno, Camilo Arango; Bischof, Walter F.; Hoover, H. James

    2012-01-01

    We present an interactive tool for browsing course requisites as a case study of dependency visualization. This tool uses multiple interactive visualizations to allow the user to explore the dependencies between courses. A usability study revealed that the proposed browser provides significant advantages over traditional methods, in terms of…

  14. Molecular interactions on microarrays

    Microsoft Academic Search

    Kalim Mir; Mikhail Shchepinov

    1999-01-01

    The structural features of nucleic acid probes tethered to a solid support and the molecular basis of their interaction with targets in solution have direct implications for the hybridization process. We discuss how arrays of oligonucleotides provide powerful tools to study the molecular basis of these interactions on a scale which is impossible using conventional analysis.

  15. Climate: A Complex Interaction

    NSDL National Science Digital Library

    Kimberly Lightle

    This article continues an examination of each of the seven essential principles of climate literacy on which the online magazine Beyond Weather and the Water Cycle is structured. Principle 2 covers the complex interactions among the components of the Earth system. The author discusses the scientific concepts underlying the interactions and expands the discussion with diagrams, photos, and online resources.

  16. Interaction Online: A Reevaluation

    ERIC Educational Resources Information Center

    Battalio, John

    2007-01-01

    Instructors commonly assume that the successful online course must replicate its live counterpart by including a variety of interactions among student, instructor, and computer. Given the changing lifestyles prompted by an evolving Internet, an increasing student need for autonomy, and student learning styles, highly interactive courses may not…

  17. An Interactive Multimedia Review.

    ERIC Educational Resources Information Center

    Benedicks, William, Jr.; Felton, Randall G.

    1994-01-01

    Presents a review of "Communism and the Cold War," an interactive multimedia videodisk designed for teaching about the post-World War II world. Concludes that, although the program is a first step in the use of interactive media in the classroom, it provides a vision of an exciting and dynamic social studies classroom in the future. (CFR)

  18. Elementary particle interactions

    SciTech Connect

    Bugg, W.M.; Condo, G.T.; Handler, T.; Hart, E.L.; Ward, B.F.L.; Close, F.E.; Christophorou, L.G.

    1990-10-01

    This report discusses freon bubble chamber experiments exposed to {mu}{sup +} and neutrinos, photon-proton interactions; shower counter simulations; SLD detectors at the Stanford Linear Collider, and the detectors at the Superconducting Super Collider; elementary particle interactions; physical properties of dielectric materials used in High Energy Physics detectors; and Nuclear Physics. (LSP)

  19. Interaction Relation Ontology Learning

    PubMed Central

    Li, Chuan-Xi; Wang, Ru-Jing; Huang, He; Su, Ya-Ru

    2014-01-01

    Abstract Ontology is widely used in semantic computing and reasoning, and various biomedicine ontologies have become institutionalized to make the heterogeneous knowledge computationally amenable. Relation words, especially verbs, play an important role when describing the interaction between biological entities in molecular function, biological process, and cellular component; however, comprehensive research and analysis are still lacking. In this article, we propose an automatic method to build interaction relation ontology by investigating relation verbs, analyzing the syntactic relation of PubMed abstracts to perform relation vocabulary expansion, and integrating WordNet into our method to construct the hierarchy of relation vocabulary. Five attributes are populated automatically for each word in interaction relation ontology. As a result, the interaction relation ontology is constructed; it contains a total of 963 words and covers the most relation words used in existing methods of proteins interaction relation. PMID:24377790

  20. Interaction relation ontology learning.

    PubMed

    Li, Chuan-Xi; Wang, Ru-Jing; Chen, Peng; Huang, He; Su, Ya-Ru

    2014-01-01

    Ontology is widely used in semantic computing and reasoning, and various biomedicine ontologies have become institutionalized to make the heterogeneous knowledge computationally amenable. Relation words, especially verbs, play an important role when describing the interaction between biological entities in molecular function, biological process, and cellular component; however, comprehensive research and analysis are still lacking. In this article, we propose an automatic method to build interaction relation ontology by investigating relation verbs, analyzing the syntactic relation of PubMed abstracts to perform relation vocabulary expansion, and integrating WordNet into our method to construct the hierarchy of relation vocabulary. Five attributes are populated automatically for each word in interaction relation ontology. As a result, the interaction relation ontology is constructed; it contains a total of 963 words and covers the most relation words used in existing methods of proteins interaction relation. PMID:24377790

  1. The ADAMS interactive interpreter

    SciTech Connect

    Rietscha, E.R.

    1990-12-17

    The ADAMS (Advanced DAta Management System) project is exploring next generation database technology. Database management does not follow the usual programming paradigm. Instead, the database dictionary provides an additional name space environment that should be interactively created and tested before writing application code. This document describes the implementation and operation of the ADAMS Interpreter, an interactive interface to the ADAMS data dictionary and runtime system. The Interpreter executes individual statements of the ADAMS Interface Language, providing a fast, interactive mechanism to define and access persistent databases. 5 refs.

  2. Protoplanet Magnetosphere Interactions

    E-print Network

    John C. B. Papaloizou

    2007-01-11

    In this paper, we study a simple model of an orbiting protoplanet in a central magnetospheric cavity, the entry into such a cavity having been proposed as a mechanism for halting inward orbital migration. We have calculated the gravitational interaction of the protoplanet with the magnetosphere using a local model and determined the rate of evolution of the orbit. The interaction is found to be determined by the outward flux of MHD waves and thus the possibility of the existence of such waves in the cavity is significant. The estimated orbital evolution rates due to gravitational and other interactions with the magnetosphere are unlikely to be significant during protoplanetary disk lifetimes.

  3. Interactive Office user's manual

    NASA Technical Reports Server (NTRS)

    Montgomery, Edward E.; Lowers, Benjamin; Nabors, Terri L.

    1990-01-01

    Given here is a user's manual for Interactive Office (IO), an executive office tool for organization and planning, written specifically for Macintosh. IO is a paperless management tool to automate a related group of individuals into one productive system.

  4. Human Body Systems Interactive

    NSDL National Science Digital Library

    ScienceNetLinks.org

    2010-06-02

    In this online interactive, studens are presented with a body system and a variety of organs. Students drag and drop all the organs that belong in that particular body system to a body who is missing his parts.

  5. Interactive Lecture Demonstrations

    NSDL National Science Digital Library

    Mark Maier

    Created by Dorothy Merritts, Robert Walter (Franklin & Marshall College), Bob MacKay (Clark College). Enhanced by Mark Maier with assistance from Rochelle Ruffer, Sue Stockly and Ronald Thornton Interactive ...

  6. Dawn's Framing Camera Interactive

    NSDL National Science Digital Library

    2012-12-06

    This interactive illustrates how images from space get to earth and how we interpret the images. Users are encouraged to experiment with images to get a firm grasp of how scientists use color filters to interpret data.

  7. Personality and group interaction

    E-print Network

    Hair, Elizabeth Catherine

    1996-01-01

    also hypothesized that individual differences in agreeableness would be related to self-perception of competitiveness and perception of their partners' competitiveness. Exploratory analyses were performed to probe how triad composition interacts...

  8. Historical Milestones: Interactive Timeline

    Cancer.gov

    BBRB has achieved several major milestones that are driving improvements in biospecimen quality. Use this interactive tool to learn more about how NCI is addressing biospecimen issues that impact cancer research and patient care.

  9. STATE System Interactive Maps

    MedlinePLUS

    ... Reproductive Health More CDC Sites STATE System Interactive Maps Recommend on Facebook Tweet Share Compartir Highlights 2012 Abstract Highlights 2012 (by section) Highlights 2012 State Map Highlights 2012 Buttons Highlights 2012 Download [Zip–16. ...

  10. Species Interactions Competition

    E-print Network

    Cochran-Stafira, D. Liane

    will become limiting 2 types of competition Intraspecific: Between individuals of same species (conspecifics with competitors, predators, etc. Interspecific competition: Paramecium George Gause Paramecium aurelia1 Species Interactions Competition Competition Consumers compete when 2 or more consumers utilize

  11. Strongly interacting Fermi gases

    E-print Network

    Bakr, W.

    Strongly interacting gases of ultracold fermions have become an amazingly rich test-bed for many-body theories of fermionic matter. Here we present our recent experiments on these systems. Firstly, we discuss high-precision ...

  12. Sample Interactive Health Tutorial

    MedlinePLUS

    ... Supplements Videos & Cool Tools ESPAÑOL Sample Interactive Health Tutorial – Download Instructions To use the sharing features on this page, please enable JavaScript. These sample tutorials are for demonstration purposes only and can be ...

  13. Brain-Gut Interactions

    NSDL National Science Digital Library

    Shanthi Srinivasan (Emory University)

    2012-04-01

    This powerpoint presentation file from the EB 2012 Refresher Course on Endocrinology discusses brain-gut interactions in diabetes, including a review of basic brain-gut anatomy, the role of gut hormones, and the central regulation of appetite.

  14. Brain-Gut Interactions

    NSDL National Science Digital Library

    Shanthi Srinivasan (Emory University)

    2012-04-01

    This recorded presentation from the EB 2012 Refresher Course on Endocrinology discusses brain-gut interactions in diabetes, including a review of basic brain-gut anatomy, the role of gut hormones, and the central regulation of appetite.

  15. Interactive Reflective Logs

    NSDL National Science Digital Library

    Benjamin E. Deaton

    2010-11-01

    The authors created an interactive reflective log (IRL) to provide teachers with an opportunity to use a journal approach to record, evaluate, and communicate student understanding of science concepts. Unlike a traditional journal, the IRL incorporates pr

  16. Strongly interacting Higgs bosons

    Microsoft Academic Search

    Thomas Appelquist; Claude Bernard

    1980-01-01

    The sensitivity of present-energy weak interactions to a strongly interacting heavy-Higgs-boson sector is discussed. The gauged nonlinear sigma model, which is the limit of the linear model as the Higgs-boson mass goes to infinity, is used to organize and catalogue all possible heavy-Higgs-boson effects. As long as the SU(2)L×SU(2)R symmetry of the Higgs sector is preserved, these effects are found

  17. Flank solar wind interaction

    NASA Technical Reports Server (NTRS)

    Moses, Stewart L.; Greenstadt, Eugene W.; Coroniti, Ferdinand V.

    1994-01-01

    In this report we will summarize the results of the work performed under the 'Flank Solar Wind Interaction' investigation in support of NASA's Space Physics Guest Investigator Program. While this investigation was focused on the interaction of the Earth's magnetosphere with the solar wind as observed by instruments on the International Sun-Earth Explorer (ISEE) 3 spacecraft, it also represents the culmination of decades of research performed by scientists at TRW on the rich phenomenology of collisionless shocks in space.

  18. GPCR Interacting Proteins

    Microsoft Academic Search

    Hongyan Wang; Catherine B. Willmore; Jia Bei Wang

    The complex transduction of ligand stimulation events at G-protein coupled receptors (GPCRs) by heterotrimetric G proteins\\u000a has long been appreciated. In addition to this, recent data shows that other protein interactions assist and can fine-tune\\u000a cellular signals. Scientists have identified other membrane and intracellular proteins that interact, directly or indirectly,\\u000a with GPCRs. In fact, 50 or more proteins are described

  19. Interactive Tutorial About Diffraction

    NSDL National Science Digital Library

    The Interactive Tutorial About Diffraction is a joint effort by professors from Michigan State University, the University of Wuerzburg, and Ludwig-Maximilians University at Munich. A multitude of examples are used to present atom scattering, crystal structure, convolution theorem, Fourier transformations of crystal phase, and other topics. The interactive examples are simulations, using software developed by the authors, where students can input the number of atoms or atom type, etc. and view results as .gif images.

  20. Evaluating Interactive Question Answering

    Microsoft Academic Search

    William Hersh

    This volume is filled with a variety of innovative approaches to helping users answer questions. In much of the research,\\u000a however, one part of the solution is missing, namely the user. This chapter describes evaluation of interactive question answering\\u000a with a focus on two initiatives: the Text REtrieval Conference (TREC) Interactive Track and studies in the medical domain.\\u000a As is

  1. Human-machine interactions

    DOEpatents

    Forsythe, J. Chris (Sandia Park, NM); Xavier, Patrick G. (Albuquerque, NM); Abbott, Robert G. (Albuquerque, NM); Brannon, Nathan G. (Albuquerque, NM); Bernard, Michael L. (Tijeras, NM); Speed, Ann E. (Albuquerque, NM)

    2009-04-28

    Digital technology utilizing a cognitive model based on human naturalistic decision-making processes, including pattern recognition and episodic memory, can reduce the dependency of human-machine interactions on the abilities of a human user and can enable a machine to more closely emulate human-like responses. Such a cognitive model can enable digital technology to use cognitive capacities fundamental to human-like communication and cooperation to interact with humans.

  2. Economics Interactive Lectures List

    NSDL National Science Digital Library

    Baker, Samuel L.

    Samuel Baker, Associate Professor in the Department of Health Administration at the University of South Carolina, has developed a series of interactive economics lectures. The lectures are at the level of introductory microeconomics. Lecture topics cover: demand, supply, elasticity, market equilibrium, costs, discounting, and internal rate of return. Each lecture features Java based interactive questions and examples. Users receive immediate feedback and hints on their responses to questions.

  3. Interactive Real Analysis

    NSDL National Science Digital Library

    Wachsmuth, Bert G.

    Interactive Real Analysis is an online, interactive textbook for Real Analysis or Advanced Calculus in one real variable. Organized into the topics of sets and relations, infinity and induction, sequences of numbers, topology, continuity and differentiation, the integral (Riemann and Lebesgue), sequences of functions, and metric spaces. Features Java tools Function Plotter, Continuity Checker, Root Finder, Family Plotter, and Derivative Checker. Also includes a glossary of calculus terms and biographies, with definitions, theorems, and problems.

  4. BasketMath Interactive

    NSDL National Science Digital Library

    Robert Cummings

    2003-01-01

    BasketMath Interactive is an Educational Online Interactive for grades 4-10. Students click on a topic from the table of contents and they are given a mathematics question and animation. When a question is correctly answered, students will see a basketball animation. When they incorrectly answer the question, students are given the correct response and, at times, the solution. Incorrect responses are tracked and areas of improvement are shown.

  5. Interactive Frog Dissection

    NSDL National Science Digital Library

    University of Virginia Curry School of Education's Instructional Technology Program has announced Interactive Frog Dissection. The tutorial combines text with 60 in-line color images and 17 QuickTime movies illustrating dissection procedures and internal organs. Numerous clickable image maps provide interactive practice. Research with pre-Web versions of the program suggests it is a valuable preparation tool or even a useful substitute for laboratory dissection.

  6. Interaction as stochastic noise

    E-print Network

    Roberto D'Agosta

    2015-01-16

    Interaction is so ubiquitous that imaging a world free from it is a difficult fantasy exercise. At the same time, in understanding any complex physical system, our ability of accounting for the mutual interaction of its constituents is often insufficient when not the restraining factor. Many strategies have been devised to control particle-particle interaction and explore the diverse regimes, from weak to strong interaction. Beautiful examples of these achievements are the experiments on Bose condensates, or the recent experiments on the dynamics of spin chains. Here I introduce another possibility, namely replacing the particle-particle interaction with an external stochastic field, and once again reducing the dynamics of a many-body system to the dynamics of single-particle systems. The theory is exact, in the sense that no approximations are introduced in decoupling the many-body system in its non-interacting sub-parts. Moreover, the equations of motion are linear, and no unknown external potential is inserted.

  7. Vortex/wall Interaction

    NASA Astrophysics Data System (ADS)

    Chang, Tae Young

    The evolution of a 2:1 aspect ratio elliptic vortex rings moving parallel to a wall has been studied by an inviscid model using the vortex filament method, a viscous direct numerical simulation, and flow visualization experiments. In the inviscid simulation a free slip wall was simulated by placement of an image vortex ring underneath the wall located perpendicular to the initial minor axis of the vortex ring. As the vortex ring undergoes an axis switching motion, a part of the vortex ring approaches the wall leading to the vortex/wall interaction. The simulation of a ring in the vicinity of a wall becomes invalid when the cores of the vortex ring and the image vortex ring overlap. The vortex ring with a core radius of 10% of the semi-major axis length fails to continue the second axis switching motion due to the interaction, if the initial distance from the wall to the closest point on the vortex ring is less than 70% of the semi-major axis length. This critical wall distance for the interaction is a function of core radius. Viscous interactions become important as the vortex ring approaches the wall. A viscous direct numerical simulation is used to study the details of the final stage of the interaction. The vortex ring propagating near the wall induces a boundary layer on the wall and then interacts with this boundary layer. After the vortex ring impacts the wall, strong upward flows exist near the wall which causes fluid on the wall surface to be entrained into the vortex ring. Flow visualization experiments in air using titanium tetrachloride smoke were conducted. The trajectory of the vortex core at the symmetry plane is quantified and the distortion of the vortex ring due to a wall is measured using an image processing system. The critical wall distance for the wall interaction suggested from the inviscid simulation is confirmed.

  8. Drug interactions with quinolones.

    PubMed

    Davies, B I; Maesen, F P

    1989-01-01

    Numerous drug interactions with the new 4-quinolone antimicrobial agents have now been established. Many, but not all, quinolones are extensively metabolized and can have inhibitory effects on the liver cytochrome P450 enzyme system, leading to reduced metabolism and clearance of certain other drugs that are normally thus eliminated. Examples include the highly significant interaction between enoxacin and theophylline and the interaction between ciprofloxacin and theophylline, which may also be important clinically. The quinolone-caffeine interaction does not usually cause problems. Absorption of all quinolones from the stomach and small intestine is greatly reduced by antacids containing magnesium or aluminium salts, including sucralfate, probably as a result of the formation of nonabsorbable chelates. Cimetidine can reduce the clearance of pefloxacin (but not of ciprofloxacin) through its effects on liver metabolism, although newer H2-inhibitors appear not to have these effects. Probenecid reduces the renal elimination of some quinolones by inhibiting tubular secretion. New evidence is now coming to light of interactions between certain nonsteroid antiinflammatory drugs (e.g., fenbufen), quinolones, and gamma-aminobutyric acid (GABA) receptors, producing increased cerebral excitation and, sometimes, epileptiform convulsions. PMID:2570456

  9. Asthma and family interaction.

    PubMed Central

    Gustafsson, P A; Kjellman, N I; Ludvigsson, J; Cederblad, M

    1987-01-01

    Patterns of family interaction were compared in the families of 22 children with chronic asthma, 30 children with diabetes mellitus, and six healthy children. The groups were similar in terms of age (range 4-14 years and mean 10.2 years). Peak expiratory flow and signs of allergy were correlated with family interaction in the subjects with asthma. The following significant findings were made. Family interaction was more disturbed in asthma compared with both the diabetic and the healthy groups. In most of the disturbed families interaction patterns were rigid and enmeshed, but a few showed chaotic and disengaged patterns. There was a negative correlation between peak expiratory flow and disturbed cohesion in non-steroid dependent cases. The severely ill children with asthma living in families with a normal cohesion score had higher IgE concentrations than children living in disturbed families. It is concluded that family interaction should be considered to be an important dimension in the investigation of severe childhood asthma. PMID:3566317

  10. Interaction relabelling and extreme characters: methods for exploring aesthetic interactions

    Microsoft Academic Search

    J. P. Djajadiningrat; W. W. Gaver; J. W. Frens

    2000-01-01

    Aesthetics and interaction are interwoven concepts, rather than separate entities. An aesthetics of interaction must consider richness in appearance, actions, and role. Moving beyond a narrow focus on usability in this way requires new methods for understanding design possibilities. Here we describe two: interaction relabelling, in which possible interactions with a known mechanical device are mapped to the functions of

  11. Children's Interactions and Learning Outcomes with Interactive Talking Books.

    ERIC Educational Resources Information Center

    Underwood, Geoffrey; Underwood, Jean D. M.

    1998-01-01

    This article on childrens' interactive talking books examines: (1) how pairs of children interact when using the Broderbund multimedia CD-ROM storybook "Living Books"; (2) whether their patterns of interaction reflect the gender composition of the pair; and (3) if different types of pairs interact differently and remember the activity differently.…

  12. Interactive Concepts in Biochemistry

    NSDL National Science Digital Library

    Boyer, Rodney F.

    Interactive Concepts in Biochemistry is a nicely designed companion website to Dr. Rodney Boyer's _Concepts in Biochemistry, second edition_. Developed collaboratively by Science Technologies and others, this multimedia site is archived on the Wiley Publishers website. Site visitors will enjoy exploring the engaging and instructive collection of Interactive Animations. The collection includes Animations about DNA Replication, Signal Transduction, Photosynthesis, Cell Structure, Protein Synthesis, and more. The site also features a number of tutorials regarding Kinesin, Myoglobin & Hemoglobin, tRNA, and Protein-DNA Interactions, to name a few. In addition, the website offers reviews of such concepts as Logarithms, Thermodynamics, and Elementary Kinetics; quizzes that correspond to chapters in Boyer's book; and a collection of articles that consider the role of biochemistry in addressing issues like Lactose Intolerance, Alcohol Abuse, and using Methanol as Fuel.

  13. Dike/Drift Interactions

    SciTech Connect

    E. Gaffiney

    2004-11-23

    This report presents and documents the model components and analyses that represent potential processes associated with propagation of a magma-filled crack (dike) migrating upward toward the surface, intersection of the dike with repository drifts, flow of magma in the drifts, and post-magma emplacement effects on repository performance. The processes that describe upward migration of a dike and magma flow down the drift are referred to as the dike intrusion submodel. The post-magma emplacement processes are referred to as the post-intrusion submodel. Collectively, these submodels are referred to as a conceptual model for dike/drift interaction. The model components and analyses of the dike/drift interaction conceptual model provide the technical basis for assessing the potential impacts of an igneous intrusion on repository performance, including those features, events, and processes (FEPs) related to dike/drift interaction (Section 6.1).

  14. Light and Matter Interactions

    NSDL National Science Digital Library

    In this activity, by the Concord Consortium's Molecular Literacy project, students â??are introduced to the basic concepts of light, followed by several interactive simulations that model the interactions of light with matter." The activity itself is a java-based interactive resource built upon the free, open source Molecular Workbench software. In the activity, students are allowed to explore at their own pace in a digital environment full of demonstrations, questions to answer, and models they can manipulate. The content of the module is divided into eight pages: Introducing Light and Photons, The Electromagnetic Spectrum, Photon Absorption and Emission 1 and II, Different Substances Have Different Photon Absorptions and Emissions, Light Can Heat Matter, Simulating Black Color, and Heated Matter Can Emit Light. In addition to the activity, visitors will find an overview of the activity, assessments and rubric, details of the central concepts, and correlation of the concepts to AAAS and NSES standards.

  15. Achromatic Interaction Point Design

    SciTech Connect

    Guimei Wang,, Yaroslav Derbenev, S.Alex Bogacz, P. Chevtsov, Andre Afanaciev, Charles Ankenbrandt, Valentin Ivanov, Rolland P. Johnson

    2009-05-01

    Designers of high-luminosity energy-frontier muon colliders must provide strong beam focusing in the interaction regions. However, the construction of a strong, aberration-free beam focus is difficult and space consuming, and long straight sections generate an off-site radiation problem due to muon decay neutrinos that interact as they leave the surface of the earth. Without some way to mitigate the neutrino radiation problem, the maximum c.m. energy of a muon collider will be limited to about 3.5 TeV. A new concept for achromatic low beta design is being developed, in which the interaction region telescope and optical correction elements, are installed in the bending arcs. The concept, formulated analytically, combines space economy, a preventative approach to compensation for aberrations, and a reduction of neutrino flux concentration. An analytical theory for the aberration-free, low beta, spatially compact insertion is being developed.

  16. Propeller tip vortex interactions

    NASA Technical Reports Server (NTRS)

    Johnston, Robert T.; Sullivan, John P.

    1990-01-01

    Propeller wakes interacting with aircraft aerodynamic surfaces are a source of noise and vibration. For this reason, flow visualization work on the motion of the helical tip vortex over a wing and through the second stage of a counterrotation propeller (CRP) has been pursued. Initially, work was done on the motion of a propeller helix as it passes over the center of a 9.0 aspect ratio wing. The propeller tip vortex experiences significant spanwise displacements when passing across a lifting wing. A stationary propeller blade or stator was installed behind the rotating propeller to model the blade vortex interaction in a CRP. The resulting vortex interaction was found to depend on the relative vortex strengths and vortex sign.

  17. LHS Interactive Showcase

    NSDL National Science Digital Library

    2000-01-01

    The Lawrence Hall of Science of the University of California Berkeley maintains the Interactive Showcase Web site. Eleven interactive Shockwave activities are presented based on various science themes. One called Variables allows users to change a human cannonballer's weight, angle of flight, the gun powder amount, and wind direction and speed with the goal of getting him to land in a net. Others deal with space flight, auto fuel efficiency, the human body, ideas and inventions, and more. Although the activities do not offer a huge amount of educational content, their fun quotient will surely draw students in and hopefully spark their interest in the sciences.

  18. Interacting Chaplygin gas

    NASA Astrophysics Data System (ADS)

    Zhang, Hongsheng; Zhu, Zong-Hong

    2006-02-01

    We investigate a kind of interacting Chaplygin gas model in which the Chaplygin gas plays the role of dark energy and interacts with cold dark matter particles. We find that there exists a stable scaling solution at late times with the Universe evolving into a phase of steady state. Furthermore, the effective equation of state of Chaplygin gas may cross the so-called phantom divide w=-1. The above results are derived from continuity equations, which means that they are independent of any gravity theories. Assuming standard general relativity and a spatially flat Friedamnn-Robertson-Walker (FRW) metric, we also find the deceleration parameter is well consistent with current observations.

  19. Interacting Chaplygin gas

    SciTech Connect

    Zhang Hongsheng; Zhu Zonghong [Department of Astronomy, Beijing Normal University, Beijing 100875 (China)

    2006-02-15

    We investigate a kind of interacting Chaplygin gas model in which the Chaplygin gas plays the role of dark energy and interacts with cold dark matter particles. We find that there exists a stable scaling solution at late times with the Universe evolving into a phase of steady state. Furthermore, the effective equation of state of Chaplygin gas may cross the so-called phantom divide w=-1. The above results are derived from continuity equations, which means that they are independent of any gravity theories. Assuming standard general relativity and a spatially flat Friedamnn-Robertson-Walker (FRW) metric, we also find the deceleration parameter is well consistent with current observations.

  20. Interactive atmosphere lab

    NSDL National Science Digital Library

    University of Utah. Astrophysics Science Project Integrating Research and Education (ASPIRE)

    2003-01-01

    The ozone layer makes up an important part of our atmosphere. This informational activity, part of an interactive laboratory series for grades 8-12, explores changes in ozone concentration with altitude. Students view a diagram that shows the layers of the atmosphere with a temperature scale running from the surface of the Earth to the outermost reaches of the atmosphere. After reading introductory material, students are presented with nine questions about the layers of the atmosphere and interactions with ozone. Copyright 2005 Eisenhower National Clearinghouse

  1. Interacting Agegraphic Dark Energy

    E-print Network

    Hao Wei; Rong-Gen Cai

    2009-01-10

    A new dark energy model, named "agegraphic dark energy", has been proposed recently, based on the so-called K\\'{a}rolyh\\'{a}zy uncertainty relation, which arises from quantum mechanics together with general relativity. In this note, we extend the original agegraphic dark energy model by including the interaction between agegraphic dark energy and pressureless (dark) matter. In the interacting agegraphic dark energy model, there are many interesting features different from the original agegraphic dark energy model and holographic dark energy model. The similarity and difference between agegraphic dark energy and holographic dark energy are also discussed.

  2. Contact Interactions at the LHC

    E-print Network

    Monica Vazquez Acosta

    2007-09-17

    Contact interactions offer a general framework for describing a new interaction with a scale above the energy scale probed. These interactions can occur if the Standard Model particles are composite or if new heavy particles are exchanged. The discovery potential of contact interactions at the LHC in dimuon and dijet final states at startup and the asymptotic reach are presented.

  3. Forces and Interactions

    NSDL National Science Digital Library

    Joseph S. Krajcik

    2009-10-14

    The content related to forces and interactions is important to most science disciplines. While chemistry is the most obvious place to introduce these ideas, it is important to connect aspects of this big idea to phenomena in biology, physics, and Earth sc

  4. Towards interactive robots

    Microsoft Academic Search

    Kerstin Dautenhahn; Iain Werry

    This article discusses the potential of using interactive environments in autism therapy. We specifically address issues relevant to the Aurora project, which studies the possible role of autonomous, mobile robots as therapeutic tools for children with autism. Theories of mindreading, social cognition and imitation that informed the Aurora project are discussed and their relevance to the project is outlined. Our

  5. TeachingTeaching Interactive

    E-print Network

    Jones, Michelle

    of these departments include: The College of Nursing, The College of Education, The College of Food, Agriculture educational goals otherwise out of reach due to their location. Teaching a multi-site class can facilitateTeachingTeaching with Interactive Video: A Faculty Orientation Presented by OSU Extension and OSU

  6. Interactive Tabletops in Education

    ERIC Educational Resources Information Center

    Dillenbourg, Pierre; Evans, Michael

    2011-01-01

    Interactive tabletops are gaining increased attention from CSCL researchers. This paper analyses the relation between this technology and teaching and learning processes. At a global level, one could argue that tabletops convey a socio-constructivist flavor: they support small teams that solve problems by exploring multiple solutions. The…

  7. Data Interactive Publications Revisited

    NASA Astrophysics Data System (ADS)

    Domenico, B.; Weber, W. J.

    2011-12-01

    A few years back, the authors presented examples of online documents that allowed the reader to interact directly with datasets, but there were limitations that restricted the interaction to specific desktop analysis and display tools that were not generally available to all readers of the documents. Recent advances in web service technology and related standards are making it possible to develop systems for publishing online documents that enable readers to access, analyze, and display the data discussed in the publication from the perspective and in the manner from which the author wants it to be represented. By clicking on embedded links, the reader accesses not only the usual textual information in a publication, but also data residing on a local or remote web server as well as a set of processing tools for analyzing and displaying the data. With the option of having the analysis and display processing provided on the server, there are now a broader set of possibilities on the client side where the reader can interact with the data via a thin web client, a rich desktop application, or a mobile platform "app." The presentation will outline the architecture of data interactive publications along with illustrative examples.

  8. Pulsed Laser Tissue Interaction

    NASA Astrophysics Data System (ADS)

    Walsh, Joseph T.; van Leeuwen, Ton G.; Jansen, E. Duco; Motamedi, Massoud; Welch, Ashley J.

    Pulsed lasers, by virtue of their ability to deliver energy in a spatially and temporally confined fashion, are able to micromachine biological tissues. The clinical success of pulsed laser treatment, however, is often limited by the extent of damage that is caused to the tissue in the vicinity of the ablation crater. In general, pulsed ablation is a trade off between thermal damage to surrounding tissue, caused by relatively long pulses (>100 ms), and mechanical damage to surrounding tissue, caused by relatively short pulses (<1 ms). To identify the origin of pulsed laser induced damage, the possible laser tissue interactions and ablation are discussed here and in Chapter 14. The purpose of this chapter is to provide the reader with a condensed overview of the parameters that must be considered in the process of pulsed laser ablation of soft tissue. In this chapter, pulsed infrared ablation of biological soft tissue is used as a paradigm to illustrate the concepts and design considerations. Generally speaking, the absorption of laser light may lead to photothermal, photomechanical or photochemical interaction with the irradiated tissue [1-5]. The vast majority of therapeutic laser-tissue interactions is based on photothermal interactions where laser energy is converted into heat. Subsequent to thermalization of the absorbed optical energy, heat transfer mechanisms, in particular conduction allow thermal diffusion from high temperature areas to surrounding regions. When laser penetration depth is less than the laser spot radius, the thermal diffusion time, ? th, can be defined as:

  9. Types for dyadic interaction

    Microsoft Academic Search

    Kohei Honda

    We formulate a typed formalism for concurrency where types denote freely composable structure of dyadic interaction in the symmetric scheme. The resulting calculus is a typed reconstruction of name passing process calculi. Systems with both the explicit and implicit typing disciplines, where types form a simple hierarchy of types, are presented, which are proved to be in accordance with each

  10. CHAPTER 1 RNA INTERACTIONS

    E-print Network

    Formation of base pairs between complementary nucleic acids are the key for both the structure formation of individual RNAs as well as for interactions between RNA and/or DNA molecules. The patterns of base pairing constitute the secondary structures. They characterize functional classes of ncRNAs and are often wellconserved

  11. Creating Interaction Techniques by

    E-print Network

    Myers, Brad A.

    Creating Interaction Techniques by Demonstration Brad A. Myers University of ]bronto* Peridot interfaces. A previous article' presented an overview of Peridot, concentrating on how the static displays of the user interface can be specified by demonstration. The full description of Peridot and the research

  12. Nucleon-nucleon interactions

    SciTech Connect

    Wiringa, R.B.

    1996-12-31

    Nucleon-nucleon interactions are at the heart of nuclear physics, bridging the gap between QCD and the effective interactions appropriate for the shell model. We discuss the current status of {ital NN} data sets, partial-wave analyses, and some of the issues that go into the construction of potential models. Our remarks are illustrated by reference to the Argonne {ital v}{sub 18} potential, one of a number of new potentials that fit elastic nucleon-nucleon data up to 350 MeV with a {Chi}{sup 2} per datum near 1. We also discuss the related issues of three-nucleon potentials, two-nucleon charge and current operators, and relativistic effects. We give some examples of calculations that can be made using these realistic descriptions of {ital NN} interactions. We conclude with some remarks on how our empirical knowledge of {ital NN} interactions may help constrain models at the quark level, and hence models of nucleon structure.

  13. Interactions of cosmic superstrings

    SciTech Connect

    Jackson, Mark G.; /Fermilab

    2007-06-01

    We develop methods by which cosmic superstring interactions can be studied in detail. These include the reconnection probability and emission of radiation such as gravitons or small string loops. Loop corrections to these are discussed, as well as relationships to (p; q)-strings. These tools should allow a phenomenological study of string models in anticipation of upcoming experiments sensitive to cosmic string radiation.

  14. Creating an Interactive PDF

    ERIC Educational Resources Information Center

    Branzburg, Jeffrey

    2008-01-01

    There are many ways to begin a PDF document using Adobe Acrobat. The easiest and most popular way is to create the document in another application (such as Microsoft Word) and then use the Adobe Acrobat software to convert it to a PDF. In this article, the author describes how he used Acrobat's many tools in his project--an interactive

  15. The Digital Interactive Video

    E-print Network

    Paris-Sud XI, Université de

    The Digital Interactive Video Exploration and Reflection (Diver) system lets users create virtual pathways through existing video content using a virtual camera and an annotation window for commentary repurposing, and discussion. W ith the inexorable growth of low-cost consumer video elec- tronics

  16. Interactive Cell Animations

    NSDL National Science Digital Library

    http://www.wiley.com/college/boyer/0470003790/animations/cell_structure/cell_structure.htm

    2011-09-28

    This is an online resource that uses interactive models for students to click on to learn about the cell. The visual representation will have students distinguish between animal and plant cells and also learn about the permeability of the cell membrane.

  17. School/Community Interaction.

    ERIC Educational Resources Information Center

    Koeller, Shirley; And Others

    1989-01-01

    Looks at the way community interaction with students developed from the "The McWhorter Book" project at McWhorter Elementary School (Lubbock, Texas). States that the project was designed to respond to drop-out problems. Preparing advertisements for local businesses helped students develop a deeper understanding of the community and of their value…

  18. Opioid Interactions with Alcohol

    Microsoft Academic Search

    Mary Jeanne Kreek

    1984-01-01

    Concomitant alcohol and narcotic abuse, and also combined addictive diseases or narcotic addiction and alcoholism are very common. Interactions of both a pharmacodynamic and also dispositional type may occur between ethanol and either the short-acting exogenous opioids, such as heroin and morphine, or the long-acting exogenous opioid, methadone. Over half of the so-called \\

  19. Interactions of antiepileptic drugs.

    PubMed

    Kutt, H

    1975-06-01

    Several interactions involving antiepileptic drugs are based on changes in the rate of their metabolism and elimination, with concomitant rise or fall of plasma levels. Thus, phenobarbital generally induces the production of the DPH metabolizing enzyme, but its presence inhibits the action of that enzyme. The net result depends upon the balance between these factors in individual patients. Either a decline, a rise, or no change of the DPH plasma level may occur after the onset of administration of phenobarbital. Drugs that may cause elevation of the DPH plasma level include disulfiram, sulthiame, bishydroxycoumarin, chloramphenicol, phenyramidol, benzodiazepines, sulfamethizole, and isoniazid. Isoniazid has been shown experimentally to be a strong inhibitor of DPH metabolism. The extent of DPH plasma level elevation by INH is related to the genetic make-up of individual patients. The highest and frequently toxic DPH plasma levels were seen in very slow INH inactivators. The incidence of clinically significant interactions is not high with most drug combinations; marked changes of antiepileptic drug levels occur only in apparently susceptible individuals. The effects of interactions are not necessarily detrimental; elevation of a low ineffective level may improve seizure control. A rise to a toxic level range requires reduction of the dose of primary drug or elimination of interfering drugs. Monitoring the blood levels of anti-epileptic drugs provides the best means to anticipate interactions and to regulate the doses when multiple medications have to be used. PMID:50232

  20. Herb-drug interactions

    Microsoft Academic Search

    Adriane Fugh-Berman

    Concurrent use of herbs may mimic, magnify, or oppose the effect of drugs. Plausible cases of herb-drug interactions include: bleeding when warfarin is combined with ginkgo (Ginkgo biloba), garlic (Allium sativum), dong quai (Angelica sinensis), or danshen (Salvia miltiorrhiza); mild serotonin syndrome in patients who mix St John's wort (Hypericum perforatum) with serotonin-reuptake inhibitors; decreased bioavailability of digoxin, theophylline, cyclosporin,

  1. Interactive E-Learning

    Microsoft Academic Search

    Claude Ghaoui; William A. Janvier

    2004-01-01

    This paper introduces the new concept of improving student memory rentention using a Distance Learning Tool by establishing the student's Communication Preference and Learning Style BEFORE the student uses the module contents. It argues that incorporating a Distance Learning Tool with an Intelligent\\/Interactive Tutoring System using various components (Psychometric tests, Communication Preference , Learning Styles, mapping Learning\\/Teaching Styles, Neurolinguistic Programming

  2. MARKERAUGMENTED ROBOTENVIRONMENT INTERACTION

    E-print Network

    Mali, Amol D.

    an increasing interest in developing computational theories of autonomous robots. However the previous work hasMARKER­AUGMENTED ROBOT­ENVIRONMENT INTERACTION Amol Dattatraya Mali Electrical Engg. & Computer focused on intelligent modifications to internal com­ putational structure of a robot, ignoring

  3. Interactive Multimedia Presentation Capabilities

    E-print Network

    Boll, Susanne

    in a client/server environment. We consider an e cient management of multimedia data by means of a database management system to be reasonable and develop concepts for the extension of a database management system of interactive multimedia presentations into a database management system to give full support for distributed

  4. Electron interaction in matter

    NASA Technical Reports Server (NTRS)

    Dance, W. E.; Rainwater, W. J.; Rester, D. H.

    1969-01-01

    Data on the scattering of 1-MeV electrons in aluminum for the case of non-normal incidence, electron-bremsstrahlung cross-sections in thin targets, and the production of bremstrahlung by electron interaction in thick targets, are presented both in tabular and graphic form. These results may interest physicists and radiologists.

  5. Computers for Interactive Learning.

    ERIC Educational Resources Information Center

    Grabowski, Barbara; Aggen, William

    1984-01-01

    Analyzes features of computer-based interactive video including sophisticated answer judging, diagnostic feedback, simulation, animation, audible tones, touch sensitive screen, function keys, and video enhancements, and matches these to the characteristics and pedagogical styles of learners. The learner characteristics discussed include internal…

  6. NFB Interactive: Bla Bla

    NSDL National Science Digital Library

    Morisset, Vincent

    2012-07-06

    What does it mean to interact with art? To communicate? And what unique wrinkles may develop as an exploration of these questions is designed specifically for a computer? The National Film Board commissioned Vincent Morisset to create this interactive tale, and it is an experience that warrants several return trips. Morisset has a rather fascinating resume, as he has worked on creating music videos for Sigur Ros and Arcade Fire. Much like his films, this interactive online project requires the participation of the viewer. As the introduction to the film states: "without him or her, the characters remain inert, waiting for the next interaction. The spectator clicks, plays and searches through the simple, uncluttered scenes, truly driving the experience." Without saying too much about the film, visitors can get started by responding to the opening screen's request to "Click Anywhere." There are six "chapters" to the film, each one of which examines a principle of human communication. Visitors will find the playfulness, interesting characters, and unique shapes a real treat.

  7. Codeon Interactions with Healthcare

    E-print Network

    Chapman, Michael S.

    Codeon Interactions with Healthcare Professionals #12;#12;Table of Contents Preamble 1 Basis 7 Speaker Programs and Speaker Training Meetings 8 Healthcare Professionals Who Are Members and healthier lives. Ethical relationships with healthcare professionals are critical to our mission of helping

  8. Data Interactive Publications

    NASA Astrophysics Data System (ADS)

    Domenico, B.; Weber, J.

    2012-04-01

    For some years now, the authors have developed examples of online documents that allowed the reader to interact directly with datasets, but there were limitations that restricted the interaction to specific desktop analysis and display tools that were not generally available to all readers of the documents. Recent advances in web service technology and related standards are making it possible to develop systems for publishing online documents that enable readers to access, analyze, and display the data discussed in the publication from the perspective and in the manner from which the author wants it to be represented. By clicking on embedded links, the reader accesses not only the usual textual information in a publication, but also data residing on a local or remote web server as well as a set of processing tools for analyzing and displaying the data. With the option of having the analysis and display processing provided on the server (or in the cloud), there are now a broader set of possibilities on the client side where the reader can interact with the data via a thin web client, a rich desktop application, or a mobile platform "app." The presentation will outline the architecture of data interactive publications along with illustrative examples.

  9. Mother\\/Child Interaction Among Homeless Women and Their Children in a Public Night Shelter in Atlanta, Georgia

    Microsoft Academic Search

    Nancy A. Boxill; Anita L. Beaty

    1990-01-01

    Public night shelters across the nation serve as a temporary resting place for hundreds of thousands of homeless families. In this article the delicate and important dyad of mother and child is described as observed in one such shelter. Through participant\\/observation the authors provide a look at the impact that circumstance may have on the nature and quality of mother\\/child

  10. Alcohol-medical drug interactions.

    PubMed

    Johnson, Bankole A; Seneviratne, Chamindi

    2014-01-01

    Concomitant use of alcohol and medications may lead to potentially serious medical conditions. Increasing prescription medication abuse in today's society necessitates a deeper understanding of the mechanisms involved in alcohol-medication interactions in order to help prevent adverse events. Interactions of medications with alcohol result in altered bioavailability of the medication or alcohol (pharmacokinetic interactions) or modification of the effects at receptor or ion channel sites to alter behavioral or physical outcome (pharmacodynamic interactions). The nature of pharmacokinetic or pharmacodynamic interactions involved in alcohol-medication interactions may differ between acute and chronic alcohol use and be influenced by race, gender, or environmental or genetic factors. This review focuses on the mechanisms underlying pharmacokinetic and pharmacodynamic interactions between alcohol and medications and provides examples for such interactions from replicated research studies. In conclusion, further translational research is needed to address several gaps in our current knowledge of alcohol-medication interactions, including those under various pathologic conditions. PMID:25307595

  11. Volcanism-Climate Interactions

    NASA Technical Reports Server (NTRS)

    Walter, Louis S. (editor); Desilva, Shanaka (editor)

    1991-01-01

    The range of disciplines in the study of volcanism-climate interactions includes paleoclimate, volcanology, petrology, tectonics, cloud physics and chemistry, and climate and radiation modeling. Questions encountered in understanding the interactions include: the source and evolution of sulfur and sulfur-gaseous species in magmas; their entrainment in volcanic plumes and injection into the stratosphere; their dissipation rates; and their radiative effects. Other issues include modeling and measuring regional and global effects of such large, dense clouds. A broad-range plan of research designed to answer these questions was defined. The plan includes observations of volcanoes, rocks, trees, and ice cores, as well as satellite and aircraft observations of erupting volcanoes and resulting lumes and clouds.

  12. Interactive design center.

    SciTech Connect

    Pomplun, Alan R. (Sandia National Laboratories, Livermore, CA)

    2005-07-01

    Sandia's advanced computing resources provide researchers, engineers and analysts with the ability to develop and render highly detailed large-scale models and simulations. To take full advantage of these multi-million data point visualizations, display systems with comparable pixel counts are needed. The Interactive Design Center (IDC) is a second generation visualization theater designed to meet this need. The main display integrates twenty-seven projectors in a 9-wide by 3-high array with a total display resolution of more than 35 million pixels. Six individual SmartBoard displays offer interactive capabilities that include on-screen annotation and touch panel control of the facility's display systems. This report details the design, implementation and operation of this innovative facility.

  13. USC: The Interaction Lab

    NSDL National Science Digital Library

    The Interaction Lab at the University of Southern California is part of the Center for Robotics and Embedded Systems (CRES) and the USC Robotics Labs. Its work involves "using a behavior-based approach to control, favoring solutions that are distributed, scalable, and robust" and when possible, validating algorithms in embodied domains. Areas of study include: Multi-Robot Coordination and Learning, Humanoid Robot Control and Learning, Learning by Imitation, Assistive Human-Robot Interaction, and Activity Modeling. The website provides short descriptions and research goals for each of these areas and related projects. Several publications and videos resulting from these projects are also posted online. The "fun" section offers a glimpse of the good times shared by the lab researchers.

  14. Interactives: The Periodic Table

    NSDL National Science Digital Library

    It can be tricky to remember the position of lanthanides within the periodic table of elements, but this interactive feature from Annenberg Media's "Interactive" series will keep students in the know about those so-called "rare earth" elements. This particular feature begins with "Atomic Basics", which provides an overview of the atom and its various functions. After completing this section, visitors can test their knowledge with the "Name That Atom" game. The game is full of protons, neutrons, and electrons, but it should be no problem for students who've been paying attention to this lively exploration of the atom. Moving on through the site, visitors will learn about the periodic table's organization, isotopes, and the groups within the table, all the way from the alkali metals to the boron family.

  15. Diabetes Interactive Atlas

    PubMed Central

    Burrows, Nilka R.; Geiss, Linda S.

    2014-01-01

    The Diabetes Interactive Atlas is a recently released Web-based collection of maps that allows users to view geographic patterns and examine trends in diabetes and its risk factors over time across the United States and within states. The atlas provides maps, tables, graphs, and motion charts that depict national, state, and county data. Large amounts of data can be viewed in various ways simultaneously. In this article, we describe the design and technical issues for developing the atlas and provide an overview of the atlas’ maps and graphs. The Diabetes Interactive Atlas improves visualization of geographic patterns, highlights observation of trends, and demonstrates the concomitant geographic and temporal growth of diabetes and obesity. PMID:24503340

  16. Ion-Solid Interactions

    NASA Astrophysics Data System (ADS)

    Nastasi, Michael; Mayer, James; Hirvonen, James K.

    2004-12-01

    Modern technology depends on materials with precisely controlled properties. Ion beams are an excellent way to achieve controlled modification of surface and near-surface regions. In every integrated circuit production line, for example, there are ion implantation systems. In addition to integrated circuit technology, ion beams can modify the mechanical, tribological, and chemical properties of metal, intermetallic, and ceramic materials without altering their bulk properties. Ion-solid interactions are the foundation that underlies the broad application of ion beams to the modification of materials. This text covers the fundamentals and applications of ion-solid interactions, and is aimed at graduate students and researchers interested in electronic devices, surface engineering, reactor and nuclear engineering, and materials science issues associated with metastable phase synthesis.

  17. NAACP Interactive Timeline

    NSDL National Science Digital Library

    This interactive timeline from the National Association for the Advancement of Colored People (NAACP) highlights interconnected events from the past 100 years of African American history. Visitors should start by selecting a year from the Milestones map. The important event from that year will shown in a visual web, connecting it with other events around the United States in the Impact map. Clicking on More Info after opening a year on the timeline will direct users to a wealth of related information, including history, impact, important people, rich multimedia, and related resources. The well-tooled design of this site means that the seemingly few individual top-level years lead to a deep understanding of struggle for fair and equitable treatment of minority Americans, and of how individual laws, protests, and other events interacted with one another to lead to today's United States.

  18. Interactive digital signal processor

    NASA Technical Reports Server (NTRS)

    Mish, W. H.; Wenger, R. M.; Behannon, K. W.; Byrnes, J. B.

    1982-01-01

    The Interactive Digital Signal Processor (IDSP) is examined. It consists of a set of time series analysis Operators each of which operates on an input file to produce an output file. The operators can be executed in any order that makes sense and recursively, if desired. The operators are the various algorithms used in digital time series analysis work. User written operators can be easily interfaced to the sysatem. The system can be operated both interactively and in batch mode. In IDSP a file can consist of up to n (currently n=8) simultaneous time series. IDSP currently includes over thirty standard operators that range from Fourier transform operations, design and application of digital filters, eigenvalue analysis, to operators that provide graphical output, allow batch operation, editing and display information.

  19. DNA interactive timeline

    NSDL National Science Digital Library

    Dolan DNA Learning Center. Cold Spring Harbor Laboratory

    2005-01-01

    In need of an interactive, chronological account of genetic discoveries and the scientists who made them? The scrolling timeline on this module provides just that. Arranged in segments of time that begin in pre-1920's and end with post-2000, visitors can explore a range of videos, photographs, and personal accounts, as well as biographical information of scientists by clicking on their images. As visitors move their cursors over the images, they are prompted to click on pop-up windows for further information and additional interactive features. For instance, one image shows Linus Pauling?s proposed triple-stranded DNA. When visitors click on this image, they learn about the elementary mistake that Pauling made when proposing this structure. The timeline also incorporates notable world events that put the genetic discoveries into perspective. Copyright 2005 Eisenhower National Clearinghouse

  20. Interactives: 3D Shapes

    NSDL National Science Digital Library

    How much liquid can that glass hold? What are the dimensions of that package that's heading off to a friend overseas? Answers to both of those questions (and many more) can be found in this lovely interactive feature on 3D shapes created by experts at the Annenberg Media group. Visitors to this site will learn about three-dimensional geometric shapes by examining a number of objects through a number of interactive exercises and games. The materials are divided into four sections, which include "3D Shapes", "Surface Area & Volume", and "Platonic Solids". The "Platonic Solids" area is quite a bit of fun, as visitors will get the opportunity to print out foldable shapes such as a tetrahedron. A short fifteen question quiz that tests the materials covered by these various activities rounds out the site.

  1. Interactive optical panel

    DOEpatents

    Veligdan, J.T.

    1995-10-03

    An interactive optical panel assembly includes an optical panel having a plurality of ribbon optical waveguides stacked together with opposite ends thereof defining panel first and second faces. A light source provides an image beam to the panel first face for being channeled through the waveguides and emitted from the panel second face in the form of a viewable light image. A remote device produces a response beam over a discrete selection area of the panel second face for being channeled through at least one of the waveguides toward the panel first face. A light sensor is disposed across a plurality of the waveguides for detecting the response beam therein for providing interactive capability. 10 figs.

  2. Interactive optical panel

    DOEpatents

    Veligdan, James T. (Manorville, NY)

    1995-10-03

    An interactive optical panel assembly 34 includes an optical panel 10 having a plurality of ribbon optical waveguides 12 stacked together with opposite ends thereof defining panel first and second faces 16, 18. A light source 20 provides an image beam 22 to the panel first face 16 for being channeled through the waveguides 12 and emitted from the panel second face 18 in the form of a viewable light image 24a. A remote device 38 produces a response beam 40 over a discrete selection area 36 of the panel second face 18 for being channeled through at least one of the waveguides 12 toward the panel first face 16. A light sensor 42,50 is disposed across a plurality of the waveguides 12 for detecting the response beam 40 therein for providing interactive capability.

  3. Interactive protein manipulation

    SciTech Connect

    SNCrivelli@lbl.gov

    2003-07-01

    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures.

  4. The Interactive Astronomy Textbook

    NASA Astrophysics Data System (ADS)

    Fluke, Christopher J.; Barnes, David G.

    We introduce the use of in situ interactive three-dimensional (3-d) figures in digital astronomy textbooks as a means of enhancing student learning. The recent 3-d extensions to the Adobe Portable Document Format (PDF), combined with simple JavaScript, provide new ways to present intrinsically 3-d models, data sets, and instructional diagrams in digital publications. This is an enhancement to the usual method of presenting static, two-dimensional views, or "comic strip" sequences, to indicate changes in viewpoint. Interactive figures provide opportunities for students to undertake active learning while reading a textbook: they are able to explore and uncover the connections between viewpoint, orientation, and the 3-d nature of models and data sets for themselves.

  5. Diabetes Interactive Atlas.

    PubMed

    Kirtland, Karen A; Burrows, Nilka R; Geiss, Linda S

    2014-01-01

    The Diabetes Interactive Atlas is a recently released Web-based collection of maps that allows users to view geographic patterns and examine trends in diabetes and its risk factors over time across the United States and within states. The atlas provides maps, tables, graphs, and motion charts that depict national, state, and county data. Large amounts of data can be viewed in various ways simultaneously. In this article, we describe the design and technical issues for developing the atlas and provide an overview of the atlas' maps and graphs. The Diabetes Interactive Atlas improves visualization of geographic patterns, highlights observation of trends, and demonstrates the concomitant geographic and temporal growth of diabetes and obesity. PMID:24503340

  6. Interacting warm dark matter

    SciTech Connect

    Cruz, Norman; Palma, Guillermo; Zambrano, David [Departamento de Física, Facultad de Ciencia, Universidad de Santiago de Chile, Casilla 307, Santiago (Chile); Avelino, Arturo, E-mail: norman.cruz@usach.cl, E-mail: guillermo.palma@usach.cl, E-mail: david.zambrano@gmail.com, E-mail: avelino@fisica.ugto.mx [Departamento de Física, DCI, Campus León, Universidad de Guanajuato, CP. 37150, León, Guanajuato (Mexico)

    2013-05-01

    We explore a cosmological model composed by a dark matter fluid interacting with a dark energy fluid. The interaction term has the non-linear ??{sub m}{sup ?}?{sub e}{sup ?} form, where ?{sub m} and ?{sub e} are the energy densities of the dark matter and dark energy, respectively. The parameters ? and ? are in principle not constrained to take any particular values, and were estimated from observations. We perform an analytical study of the evolution equations, finding the fixed points and their stability properties in order to characterize suitable physical regions in the phase space of the dark matter and dark energy densities. The constants (?,?,?) as well as w{sub m} and w{sub e} of the EoS of dark matter and dark energy respectively, were estimated using the cosmological observations of the type Ia supernovae and the Hubble expansion rate H(z) data sets. We find that the best estimated values for the free parameters of the model correspond to a warm dark matter interacting with a phantom dark energy component, with a well goodness-of-fit to data. However, using the Bayesian Information Criterion (BIC) we find that this model is overcame by a warm dark matter – phantom dark energy model without interaction, as well as by the ?CDM model. We find also a large dispersion on the best estimated values of the (?,?,?) parameters, so even if we are not able to set strong constraints on their values, given the goodness-of-fit to data of the model, we find that a large variety of theirs values are well compatible with the observational data used.

  7. Dynamics of interacting quintessence

    E-print Network

    M. Shahalam; S. D. Pathak; M. M. Verma; M. Yu. Khlopov; R. Myrzakulov

    2015-03-27

    In this paper, we investigate coupled quintessence with scaling potential assuming specific forms of the coupling as $A$ namely, $\\alpha \\dot{\\rho_m}$, $\\beta \\dot{\\rho_{\\phi}}$ and $\\sigma (\\dot{\\rho_m}+\\dot{\\rho_{\\phi}})$, and present phase space analysis for three different interacting models. We focus on the attractor solutions that can give rise to late time acceleration with $\\Omega_{DE}/\\Omega_{DM}$ of order unity in order to alleviate the coincidence problem.

  8. Ozone depletion interactive lab

    NSDL National Science Digital Library

    University of Utah. Astrophysics Science Project Integrating Research and Education (ASPIRE)

    2003-01-01

    What is the process by which CFCs destroy ozone? This informational piece, part of an interactive laboratory series for grades 8-12, explores the destruction of the ozone layer by chlorofluorocarbons. Here students view a four-step animation that shows how ultraviolet light breaks chlorine free from a CFC molecule. The chlorine then destroys an ozone molecule. Additional steps show how the process can be continuous. Copyright 2005 Eisenhower National Clearinghouse

  9. Interactive tabletops in education

    Microsoft Academic Search

    Pierre Dillenbourg; Michael Evans

    Interactive tabletops are gaining increased attention from CSCL researchers. This paper analyses the relation between this\\u000a technology and teaching and learning processes. At a global level, one could argue that tabletops convey a socio-constructivist\\u000a flavor: they support small teams that solve problems by exploring multiple solutions. The development of tabletop applications\\u000a also witnesses the growing importance of face-to-face collaboration in

  10. TIME DEPENDENT MAGNETIC INTERACTION

    E-print Network

    Low, Robert

    effects · Analyze the time dependent interactions · How nonlinearity of waves affects the cell stability as the wave shape changes Bz 0 2 4 6 8 10 12 14 16 X0 2 4 Y BZ: -0.0039 -0.0023 -0.0007 0.0009 0.0025 0 predictions? #12;Typical model geometry #12;Flow and waves in Al electrolysis cell · At the interface

  11. BioInteractive Neuroscience

    NSDL National Science Digital Library

    HHMI (Howard Hughes Medical Institute)

    2011-08-01

    This website is a collection of lectures (the annual Holiday Lecture on Science series by leading neuroscientists) , animations, virtual labs, and images presented by nationally recognized neuroscientists. BioInteractive is a great resource for complex biological systems information. Particularly noteworthy is the Animations section, which presents high-quality movies of development of the human embryonic brain, molecular basis of early LTP, molecular mechanism of synaptic function, and many other dynamic phenomena. Provided by Howard Hughes Medical Institute.

  12. Cotton and Protein Interactions

    Microsoft Academic Search

    Steven C. Goheen; J. Vincent Edwards; Alfred R. Rayburn; Kari A. Gaither; Nathan J. Castro

    2006-01-01

    The adsorbent properties of important wound fluid proteins and cotton cellulose are reviewed. This review focuses on the adsorption\\u000a of albumin to cotton-based wound dressings and some chemically modified derivatives targeted for chronic wounds. Adsorption\\u000a of elastase in the presence of albumin was examined as a model to understand the interactive properties of these wound fluid\\u000a components with cotton fibers.

  13. ELEMENTARY PARTICLE INTERACTIONS

    SciTech Connect

    EFREMENKO, YURI; HANDLER, THOMAS; KAMYSHKOV, YURI; SIOPSIS, GEORGE; SPANIER, STEFAN

    2013-07-30

    The High-Energy Elementary Particle Interactions group at UT during the last three years worked on the following directions and projects: Collider-based Particle Physics; Neutrino Physics, particularly participation in “NO?A”, “Double Chooz”, and “KamLAND” neutrino experiments; and Theory, including Scattering amplitudes, Quark-gluon plasma; Holographic cosmology; Holographic superconductors; Charge density waves; Striped superconductors; and Holographic FFLO states.

  14. Sphericalization of nonspherical interactions

    SciTech Connect

    Lebowitz, J.L.; Percus, J.K.

    1983-07-01

    A density and temperature-independent spherically symmetric reference potential is constructed for an interacting classical fluid of nonspherical molecules. It annuls the first order correction to the free energy and, in special cases, the second as well. The potential is a limiting form of that used successfully for N/sub 2/ by Shaw et al., and reproduces numerically the Y/sub 4/ approximation of Barboy and Gelbart for homonuclear dumbbell molecules.

  15. Microbial Interactions - student worksheet

    NSDL National Science Digital Library

    Joanna Verran

    This is a downloadable Microsoft Word document containing a 10-question student assessment worksheet to accompany the Microbial Interactions video segment of the Unseen Life on Earth series from Annenberg Media. The questions mirror language used in the video and focus on clearly stated facts. Thus, the worksheet assesses listening skills more than concept comprehension. This assessment would be appropriate for the secondary or introductory undergraduate level.

  16. Interactive Astronomy Games

    NSDL National Science Digital Library

    Cherilynn Morrow

    These two interactive astronomy games, 'Small and Large' and 'Near and Far', help to introduce important basic concepts about the size of the Universe. In 'Small and Large', students examine pictures of various astronomical objects and arrange them numerically by size. In 'Near and Far, they arrange pictures of objects by their distance from Earth. The games serve as motivators for further discussion and learning and may be used with large groups, a few students or with just one other person.

  17. Interactive Courseware for PC's

    NSDL National Science Digital Library

    Samuel Borenstein

    This website from the Institute on Climate and Planets (ICP), a division of NASA, is host to a number of software curriculum modules. These interactive modules have been developed as teaching tools to help students learn basic physical concepts as well as several meteorological applications. The modules cover topics such as sunlight and latitude, albedo and distance, Kepler's laws of planetary motion, Newton's laws of motion, the Coriolis effect, cloud formation, and the Greenhouse effect.

  18. Interactive Holographic Cinema

    E-print Network

    Portales, Christopher

    2012-07-16

    record and reconstruct a 3D scene. When transparency is desirable as an artistic choice, for example overlaying two images, Pepper?s Ghost can be used to present a hologram against a transparent surface. B. Recording for Reconstruction The essential.... 10. Radiohead. ?RA DIOHEA_D / HOU SE OF_C ARDS ? Google Code.? 13 July 2008. Google. 30 April 2010. . 11. Red Hot Chili Peppers. Look Around: Interactive Video. 6 February 2012. 6 February 2012.

  19. Interactive separating streak surfaces.

    PubMed

    Ferstl, Florian; Bürger, Kai; Theisel, Holger; Westermann, Rüdiger

    2010-01-01

    Streak surfaces are among the most important features to support 3D unsteady flow exploration, but they are also among the computationally most demanding. Furthermore, to enable a feature driven analysis of the flow, one is mainly interested in streak surfaces that show separation profiles and thus detect unstable manifolds in the flow. The computation of such separation surfaces requires to place seeding structures at the separation locations and to let the structures move correspondingly to these locations in the unsteady flow. Since only little knowledge exists about the time evolution of separating streak surfaces, at this time, an automated exploration of 3D unsteady flows using such surfaces is not feasible. Therefore, in this paper we present an interactive approach for the visual analysis of separating streak surfaces. Our method draws upon recent work on the extraction of Lagrangian coherent structures (LCS) and the real-time visualization of streak surfaces on the GPU. We propose an interactive technique for computing ridges in the finite time Lyapunov exponent (FTLE) field at each time step, and we use these ridges as seeding structures to track streak surfaces in the time-varying flow. By showing separation surfaces in combination with particle trajectories, and by letting the user interactively change seeding parameters such as particle density and position, visually guided exploration of separation profiles in 3D is provided. To the best of our knowledge, this is the first time that the reconstruction and display of semantic separable surfaces in 3D unsteady flows can be performed interactively, giving rise to new possibilities for gaining insight into complex flow phenomena. PMID:20975199

  20. Spacecraft Charging Interactive Handbook

    Microsoft Academic Search

    V. A. Davis; I. Katz; M. J. Mandell; B. M. Gardner

    1998-01-01

    Recent spacecraft failures have brought into focus the need for increased understanding and modeling of spacecraft charging by spacecraft designers. Spacecraft charging assessments are needed for designing all geosynchronous, mid-altitude, and polar, low-earth orbit spacecraft. Under contract to the Spacecraft Environment Effects Program office at NASA\\/Marshall, we are developing a CD-ROM\\/web based multimedia interactive Spacecraft Charging Handbook with integrated, updated