Note: This page contains sample records for the topic c-coriolis interacting dyad from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: November 12, 2013.
1

Antecedents of Coordination Effectiveness of Software Developer Dyads From Interacting Teams: An Empirical Investigation  

Microsoft Academic Search

Among the numerous reasons for software project failure, coordination problems are especially salient. Prior studies on coordination in software development are confined to team internal coordination and do not explicitly differentiate team internal and external coordination processes. This study presents a research model to explain the antecedents of coordination effectiveness of software developer dyads from interacting teams. Dyads in this

Minghui Yuan; Xi Zhang; Zhenjiao Chen; Douglas R. Vogel; Xuelin Chu

2009-01-01

2

Behavior-State Matching and Synchrony in Mother-Infant Interactions of Nondepressed versus Depressed Dyads.  

ERIC Educational Resources Information Center

Assessed behavior-state matching and synchrony in interactions in 48 depressed and nondepressed mother-infant dyads when infants were 3 months old. Depressed mothers and their infants matched negative behavior states more often and positive behavior states less often than did nondepressed dyads. (RH)

Field, Tiffany; And Others

1990-01-01

3

Modalities of infant-mother interaction in Japanese, Japanese American immigrant, and European American dyads.  

PubMed

Cultural variation in relations and moment-to-moment contingencies of infant-mother person-oriented and object-oriented interactions were compared in 118 Japanese, Japanese American immigrant, and European American dyads with 5.5-month-olds. Infant and mother person-oriented behaviors were related in all cultural groups, but infant and mother object-oriented behaviors were related only among European Americans. Infant and mother behaviors within each modality were mutually contingent in all groups. Culture moderated lead-lag relations: Japanese infants were more likely than their mothers to respond in object-oriented interactions; European American mothers were more likely than their infants to respond in person-oriented interactions. Japanese American dyads behaved like European American dyads. Interactions, infant effects, and parent socialization findings are set in cultural and accultural models of infant-mother transactions. PMID:22860874

Bornstein, Marc H; Cote, Linda R; Haynes, O Maurice; Suwalsky, Joan T D; Bakeman, Roger

2012-08-03

4

Modalities of Infant-Mother Interaction in Japanese, Japanese American Immigrant, and European American Dyads  

PubMed Central

Cultural variation in relations and moment-to-moment contingencies of infant-mother person-oriented and object-oriented interactions were examined and compared in 118 Japanese, Japanese American immigrant, and European American dyads with 5.5-month-olds. Infant and mother person-oriented behaviors were positively related in all cultural groups, but infant and mother object-oriented behaviors were positively related only among European Americans. In all groups, infant and mother behaviors within each modality were mutually contingent. Culture moderated lead-lag relations: Japanese infants were more likely than their mothers to respond in object-oriented interactions, European American mothers were more likely than their infants to respond in person-oriented interactions. Japanese American dyads behaved more like European American dyads. Interaction, infant effects, and parent socialization findings are set in cultural and accultural models of transactions between young infants and their mothers.

Bornstein, Marc H.; Cote, Linda R.; Haynes, O. Maurice; Suwalsky, Joan T. D.; Bakeman, Roger

2011-01-01

5

Interaction in High-Risk Dyads: Maternal Affect and Child Synchrony.  

ERIC Educational Resources Information Center

This study examined both maternal and child interaction styles, focusing on the association between differences in maternal level and quality of involvement and the synchrony and affective quality of child interaction behaviors. The subjects were 55 mother-child dyads in which the children (ages 2-5) had been referred to a mental health center…

Johnson, Helen L.; Cohen, Michele

6

Modalities of Infant-Mother Interaction in Japanese, Japanese American Immigrant, and European American Dyads  

ERIC Educational Resources Information Center

|Cultural variation in relations and moment-to-moment contingencies of infant-mother person-oriented and object-oriented interactions were compared in 118 Japanese, Japanese American immigrant, and European American dyads with 5.5-month-olds. Infant and mother person-oriented behaviors were related in all cultural groups, but infant and mother…

Bornstein, Marc H.; Cote, Linda R.; Haynes, O. Maurice; Suwalsky, Joan T. D.; Bakeman, Roger

2012-01-01

7

Parent-Child Interaction Therapy: Application to maltreating parent-child dyads  

Microsoft Academic Search

Objective:Parent-Child Interaction Training (PCIT), which uses a social learning framework, is a dyadic intervention that is designed to alter specific patterns of interaction found in parent-child relationships. Previous research suggests that maladaptive and high-risk characteristics found in maltreating parent-child dyads may be responsive to PCIT. The primary focus of this study is to examine the effectiveness of PCIT with maltreating

Susan G. Timmer; Anthony J. Urquiza; Nancy M. Zebell; Jean M. McGrath

2005-01-01

8

Maternal Holding of Preterm Infants During the Early Weeks After Birth and Dyad Interaction at Six Months  

PubMed Central

Objective To examine whether a supportive nursing intervention that promoted kangaroo holding of healthy preterm infants by their mothers during the early weeks of the infant’s life facilitated co-regulation between mother and infant at six months of age. Design Randomized controlled trial. Participants Sixty-five mother-infant dyads with mean gestational age at birth of 33 weeks. Fifty percent of infants were male, and 50% were non-White. Interventions An eight week home intervention encouraged daily one hour, uninterrupted holding with either blanket (baby wrapped in blanket and held in mother’s arms) or the kangaroo (baby in skin-to-skin contact on mother’s chest) method. In both conditions, weekly home visits by an experienced RN included encouragement to hold the infant, emotional support, and information about infant behavior and development. A control group received brief social visits, had no holding constraints, and participated in all assessments. Main Outcome Measures When infants were six months of age, the Still-Face Procedure was used to assess mother-infant interaction. Outcome measures were co-regulation of the dyad’s responses during the play episodes of the Still Face Procedure and vitality in infant efforts to re-engage the mother during the neutral face portion of the Still Face procedure. Results Significant differences among groups were found in mother-infant co-regulation. Post hoc analysis showed that dyads who were supported in kangaroo holding displayed more co-regulation behavior during play than dyads in the blanket holding group. No differences were found between groups in infant vitality during the neutral face portion of the Still Face Procedure. Conclusion Dyads supported in practicing kangaroo holding in the early weeks of life may develop more co-regulated interactional strategies than other dyads.

Neu, Madalynn; Robinson, JoAnn

2010-01-01

9

Patterns of Conflict Interaction in Mother–Toddler Dyads: Differences Between Depressed and Non-depressed Mothers  

Microsoft Academic Search

We examined the differences in conflict interaction between depressed mothers and their toddler and non-depressed dyads and\\u000a whether these differences mediated the association of maternal depression with compromised child socioemotional development.\\u000a Mother\\/child interaction was videotaped during a teaching task and during a free play task as part of a home visit when the\\u000a target child was between 16 and 18 months

Margaret O’Brien Caughy; Keng-Yen Huang; Julie Lima

2009-01-01

10

Interpersonal Behavior, Perception, and Affect in Status-Discrepant Dyads: Social Interaction of Gay and Heterosexual Men  

Microsoft Academic Search

Social stigma theory guided this study of social interaction in status-discrepant dyads. Interpersonal trait judgments were characterized by out-group covariation bias at the individual and dyadic levels. Men used shared stereotypes and idiosyncratic generalizations regarding characteristics of out-group members when judging their traits, and this was most pronounced in heterosexual men's judgments of gays. Heterosexual men were accurately aware of

Scott Miller; Thomas E. Malloy

2003-01-01

11

Information Interactions between Members of Science-Profession Dyads as Reflected by Journal Use: Ichthyology and Fisheries Biology.  

ERIC Educational Resources Information Center

|This study examined the science-profession dyad of ichthyology and fisheries biology through citation analysis of the journal literature. It found that the fields overlap in the journals cited, and, although differences in citation behavior were identified, some exchange of information within the dyad was indicated. (38 references) (Author/MES)|

Martin, F. Douglas

1992-01-01

12

Information Interactions between Members of Science-Profession Dyads as Reflected by Journal Use: Ichthyology and Fisheries Biology.  

ERIC Educational Resources Information Center

This study examined the science-profession dyad of ichthyology and fisheries biology through citation analysis of the journal literature. It found that the fields overlap in the journals cited, and, although differences in citation behavior were identified, some exchange of information within the dyad was indicated. (38 references) (Author/MES)

Martin, F. Douglas

1992-01-01

13

Beyond the dyad: do family interactions influence children's attachment representations in middle childhood?  

PubMed

This study examines the influence of mother-child and family interactions on the development of child attachment representations in middle childhood for a sample of 49 families. Mother-child interactions were observed during a snacktime in a lab setting (Moss, Rousseau, Parent, St-Laurent, & Saintonge, 1998) when children were 5-6 years old. Three years later, children's attachment representations were assessed using a doll play narrative procedure (Solomon, George, & DeJong, 1995) in the lab setting. Within 6 months of the second lab visit, family interactions were filmed during mealtime and coded using the Mealtime Interaction Coding System (MICS; Dickstein, Hayden, Schiller, Seifer, & San Antonio, 1994). Results showed clear differences between attachment groups on quality of mother-child and family interaction with the secure/confident group showing highest and the disorganized/frightened group showing lowest quality interactions. Family interactions predicted children's attachment representations, after controlling variance explained by prior mother-child interactions. PMID:19016050

Dubois-Comtois, Karine; Moss, Ellen

2008-12-01

14

Dialogues with preadolescents and adolescents: Mother-child interaction patterns in affectively ill and well dyads  

Microsoft Academic Search

This study examined affective\\/communicative patterns in the interactions of unipolar, bipolar, and well mothers with their preadolescent and adolescent children. As part of a large longitudinal project, mother-child interaction was assessed for two siblings ages 8 to 11 and 12 to 16. Interactional difficulties were linked to both maternal affective illness and child problem status. Preadolescent children appeared more comfortable\\/happy

Louisa B. Tarullo; Elizabeth K. DeMulder; Pedro E. Martinez; Marian Radke-Yarrow

1994-01-01

15

Excited state interactions between flurbiprofen and tryptophan in drug-protein complexes and in model dyads. Fluorescence studies from the femtosecond to the nanosecond time domains.  

PubMed

We report here on the interaction dynamics between flurbiprofen (FBP) and tryptophan (Trp) covalently linked in model dyads and in a complex of FBP with human serum albumin (HSA) probed by time-resolved fluorescence spectroscopy from the femto- to the nano-second timescales. In the dyads, a rapid (k > 10(10) s(-1)) dynamic quenching of the (1)FBP* fluorescence is followed by a slower (k > 10(9) s(-1)) quenching of the remaining (1)Trp* fluorescence. Both processes display a clear stereoselectivity; the rates are 2-3 times higher for the (R,S)-dyad. In addition, a red-shifted exciplex emission is observed, rising in the range of 100-200 ps. A similar two-step dynamic fluorescence quenching is also observed in the FBP-HSA complex, although the kinetics of the involved processes are slower. The characteristic reorientational times determined for the two enantiomeric forms of FBP in the protein show that the interaction is stronger for the (R)-form. This is, to our knowledge, the first observation of stereo-selective flurbiprofen-tryptophan interaction dynamics with femtosecond time resolution. PMID:23426282

Vayá, Ignacio; Bonancía, Paula; Jiménez, M Consuelo; Markovitsi, Dimitra; Gustavsson, Thomas; Miranda, Miguel A

2013-04-01

16

Interactive effects of eye contact and verbal content on interpersonal attraction in dyads  

Microsoft Academic Search

Studied the effects of amount of eye contact and verbal content on interpersonal-attraction ratings in 2 experiments using televised dyadic interactions. A 3rd experiment varied amount of eye contact, physical attractiveness, and social competence. A total of 462 male and 49 female undergraduates served as Ss. Exp. I used a 3 * 3 factorial design with 3 levels of eye

Larry Scherwitz; Robert Helmreich

1973-01-01

17

Electron donor-acceptor interactions in regioselectively synthesized exTTF(2)-C(70)(CF(3))(10) dyads.  

PubMed

The decakis(trifluoromethyl)fullerene C(1)-C(70)(CF(3))(10), in which the CF(3) groups are arranged on a para(7)-meta-para ribbon of C(6)(CF(3))(2) edge-sharing hexagons, and which has now been prepared in quantities of hundreds of milligrams, was reacted under standard Bingel-Hirsch conditions with a bis-pi-extended tetrathiafulvalene (exTTF) malonate derivative to afford a single exTTF(2)-C(70)(CF(3))(10) regioisomer in 80 % yield based on consumed starting material. The highly soluble hybrid was thoroughly characterized by using 1D (1)H, (13)C, and (19)F NMR, 2D NMR, and UV/Vis spectroscopy; matrix-assisted laser desorption ionization (MALDI) mass spectrometry; and electrochemistry. The cyclic voltammogram of the exTTF(2)-C(70)(CF(3))(10) dyad revealed an irreversible second reduction process, which is indicative of a typical retro-Bingel reaction; whereas the usual phenomenon of exTTF inverted potentials (E1ox>E2ox), resulting in a single, two-electron oxidation process, was also observed. Steady-state and time-resolved photolytic techniques demonstrated that the C(1)-C(70)(CF(3))(10) singlet excited state is subject to a rapid electron-transfer quenching. The resulting charge-separated states were identified by transient absorption spectroscopy, and radical pair lifetimes of the order of 300 ps in toluene were determined. The exTTF(2)-C(70)(CF(3))(10) dyad represents the first example of exploitation of the highly soluble trifluoromethylated fullerenes for the construction of systems able to mimic the photosynthetic process, and is therefore of interest in the search for new materials for photovoltaic applications. PMID:20209515

Takano, Yuta; Herranz, M Angeles; Martín, Nazario; de Miguel Rojas, Gustavo; Guldi, Dirk M; Kareev, Ivan E; Strauss, Steven H; Boltalina, Olga V; Tsuchiya, Takahiro; Akasaka, Takeshi

2010-05-10

18

Scaffolding interaction in parent-child dyads: Multimodal analysis of parental scaffolding with task and non-task oriented children  

Microsoft Academic Search

In this exploratory study we conceptualized and explored socio-cognitive, emotional and motivational regulatory processes\\u000a displayed in scaffolding interaction between parents and their non-task and taskoriented children. Based on the dynamic systems\\u000a view and findings from developmental research, we assumed that parents with non-task oriented and task-oriented children have\\u000a formed differential multimodal interaction patterns which have been stabilized during repeated parent-child

Pekka Salonen; Janne Lepola; Marja Vauras

2007-01-01

19

Scaffolding Interaction in Parent-Child Dyads: Multimodal Analysis of Parental Scaffolding with Task and Non-Task Oriented Children  

ERIC Educational Resources Information Center

In this exploratory study we conceptualized and explored socio-cognitive, emotional and motivational regulatory processes displayed in scaffolding interaction between parents and their non-task and task-oriented children. Based on the dynamic systems view and findings from developmental research, we assumed that parents with non-task oriented and…

Salonen, Pekka; Lepola, Janne; Vauras, Marja

2007-01-01

20

Gender Role Self-Concept and Gender-Typed Communication Behavior in Mixed-Sex and Same-Sex Dyads  

Microsoft Academic Search

The focus of this study was the relation between both gender role self-concept and gender role attitudes with gender-related behavior of interacting partners. We observed gender-typed communication behaviors of mixed-sex and same-sex dyads and measured gender role self-concept and gender role attitudes. Thirty mixed-sex dyads, 19 women dyads, and 15 men dyads participated in a behavior observation study. The results

Ursula Athenstaedt; Elisabeth Haas; Stephanie Schwab

2004-01-01

21

Shyness and physical attractiveness in mixed-sex dyads  

Microsoft Academic Search

Male and female strangers' shyness and physical attractiveness strongly affected their own and their partners' behavior during initial, unstructured interactions. First, dyad-level measures of behav- ioral involvement and perceived interaction quality were independently predicted by the men's shyness and the women's physical attractiveness. Second, shy men exerted avoidant control over mutual gazing by denying their female partners (but not themselves)

Stella Garcia; Linda Stinson; William Ickes; Victor Bissonnette; Stephen R. Briggs

1991-01-01

22

Synthesis, spectroscopic properties, and electropolymerization of azulene dyads.  

PubMed

Four azulene dyads have been synthesized and studied by spectroscopic and electrochemical methods. A triarylamine, a boron-dipyrromethene (BDP or BODIPY), a porphyrin, and an isoalloxazine moiety have been linked to an extended ? electron system at the 2-position of azulene, leading to the dyads 1-4, respectively. For the synthesis of 1-4, first 2-(4-ethynyl-phenyl)azulene (EPA) was prepared, which was further reacted with the halogenated chromophores by Pd-catalyzed cross-coupling reactions. The dyads 1-4 exhibit strong absorption bands in the visible range, which are dominated by the absorption spectra of the individual subchromophores. Fluorometric studies of 2-4 revealed that after excitation of the subchromophoric unit attached to the parent azulene moiety, quenching mainly through energy transfer to azulene is effective, whereas possible charge-transfer interactions play only a minor role. Potentiodynamic oxidation of the dyads 1-4 leads to the formation of polymer films, which are deposited at the electrode. The polymer film derived from 1 was further characterized by spectroelectrochemistry. During positive doping of poly-1, a strong absorption band appears at 13,200 cm(-1), which is typical for triarylamine radical cations. This band is overlapping with a broad absorption band in the low-energy region that might be caused by charge-transfer interactions within the polymer. PMID:21506604

Nöll, Gilbert; Daub, Jörg; Lutz, Michaela; Rurack, Knut

2011-05-16

23

ATTRACTION AND ACCURACY OF PERCEPTION IN DYADS  

Microsoft Academic Search

216 STUDENTS, SELECTED FROM A PRETEST AS PRO OR CON CAPITAL PUNISHMENT, WERE ASSIGNED TO DYADS IN 1 OF 6 EXPERIMENTAL CONDITIONS VARYING INITIAL ATTRACTION (HIGH POSITIVE, LOW POSITIVE, OR NONE) AND SIMILARITY OF ATTITUDE (SIMILAR OR NOT SIMILAR). DYADS WERE DEFINED AS BALANCED OR IMBALANCED ACCORDING TO NEWCOMB'S THEORY OF SYSTEMS OF ORIENTATION. FOLLOWING 20 MIN. OF DISCUSSION OF

ROBERT E. BREWER; MARILYNN B. BREWER

1968-01-01

24

Gaze and Vocalization in Mother-Infant Dyads: Conversation or Coincidence?  

ERIC Educational Resources Information Center

This paper reports two studies which examined sequential dependence in the dyadic interaction between mother and infant. In the first study, brief videotaped behavioral samples were collected for 24 primiparous mother-infant (M - I) dyads to examine the degree of reciprocal contingency in M - I interactions. Two coders, using a computer interfaced…

Hayes, Alan; Elliott, Tony

25

Tetrathiafulvalene–flavin dyads: electron transfer promoted by metal cations  

Microsoft Academic Search

Tetrathiafulvalene–flavin dyads 1 and 2 are reported. Both absorption and ESR spectral studies show that the intramolecular electron transfer occurs from TTF to flavin units in dyads 1 and 2 in the presence of Pb2+\\/Sc3+. But, the electron transfer is more efficient for dyad 1 in the presence of Pb2+\\/Sc3+. Electrochemical studies manifest that coordination of dyads 1 and 2

Lina Jia; Guanxin Zhang; Deqing Zhang; Daoben Zhu

2010-01-01

26

Facile synthesis of new fullerene–Ru(bpy) 3 dyads bearing phosphonate groups for hybrid organic–inorganic materials  

Microsoft Academic Search

Fullerene reacted with mono- and diphosphonate-bearing bipyridines by way of Bingel-type reactions to give adducts which were easily transformed in the corresponding dyads by forming Ru(bpy)3 complexes. Electrochemical measurements and the observation of heavy quenching of the Ru(bpy)3 luminescence manifested strong interactions between the active moieties. Attempts to include the dyads into inorganic matrices derived from zirconium phosphate are reported.

Ernesto Brunet; Marina Alonso; Ma Carmen Quintana; Olga Juanes; Juan-Carlos Rodríguez-Ubis

2007-01-01

27

Can opposites attract? Personality heterogeneity in supervisor-subordinate dyads as a predictor of subordinate outcomes.  

PubMed

Unlike the majority of research hypothesizing that similarity between individuals results in positive individual outcomes, this article examines whether dissimilarity results in positive outcomes. On the basis of interpersonal interaction theory, the authors hypothesized that dissimilarity in the personality dimension of control within supervisor-subordinate dyads is positively associated with the subordinate's satisfaction with the supervisor; results obtained with polynomial regression techniques were supportive. However, for 2 other outcomes, organizational citizenship behaviors and work withdrawal, neither similarity nor dissimilarity within the dyad was important; subordinate level of control was related to organizational citizenship behaviors reported by subordinates, and supervisor level of control was related to work withdrawal reported by subordinates. These findings portray the importance of examining relationship complexities beyond similarity in organizational dyad research. PMID:16060791

Glomb, Theresa M; Welsh, Elizabeth T

2005-07-01

28

Can Opposites Attract? Personality Heterogeneity in Supervisor–Subordinate Dyads as a Predictor of Subordinate Outcomes  

Microsoft Academic Search

Unlike the majority of research hypothesizing that similarity between individuals results in positive individual outcomes, this article examines whether dissimilarity results in positive outcomes. On the basis of interpersonal interaction theory, the authors hypothesized that dissimilarity in the personality dimension of control within supervisor–subordinate dyads is positively associated with the subordinate's satisfaction with the supervisor; results obtained with polynomial regression

Theresa M. Glomb; Elizabeth T. Welsh

2005-01-01

29

Structural Equation Models for Interchangeable Dyads: Being the Same Makes a Difference  

ERIC Educational Resources Information Center

|Structural equation modeling (SEM) offers a flexible method for studying the patterns of interdependence in partners' behavior, which lie at the heart of interactions and relationships. Although SEM has been applied to the study of distinguishable dyads, in which partners are distinguishable by type, such as male and female, it has rarely been…

Woody, Erik; Sadler, Pamela

2005-01-01

30

Fullerene-coumarin dyad as a selective metal receptor: synthesis, photophysical properties, electrochemistry and ion binding studies.  

PubMed

A coumarin derivative with a malonate unit has been synthesized and used for the preparation of a fullerene-coumarin dyad through the Bingel cyclopropanation method. The newly synthesized dyad is soluble in organic solvents and has been fully characterized with traditional spectroscopic techniques. Electronic interactions between the two components of the dyad were probed with the aid of UV/Vis spectroscopy, fluorescence emission, and electrochemistry measurements. Our studies clearly show the presence of electronic interactions between C(60) and modified coumarin in the ground state; efficient electron-transfer quenching of the singlet excited state of the coumarin moiety by the appended fullerene sphere was also observed. Time-resolved fluorescence measurements revealed lifetimes for the coumarin-C(60) dyad at a maximum of 50 ps, while the quantum yield was reaching unity. Additionally, the redox potentials of the C(60)-coumarin dyad were determined and the energetics of the electron-transfer processes were evaluated. Finally, after alkaline treatment of C(60)-coumarin, which resulted in the deprotection of carboxylate units, the dyad was tested as a metal receptor for divalent metal cations; ion competition studies and fluorescence experiments showed binding selectivity for lead ions. PMID:20836097

Pagona, Georgia; Economopoulos, Solon P; Tsikalas, George K; Katerinopoulos, Haralambos E; Tagmatarchis, Nikos

2010-10-18

31

College Students' Perceptions of Employment-Based Marital Dyad Types  

Microsoft Academic Search

This study examined college students' perceptions of different marital dyads: head-complement, husband-as-senior-partner, equal-partner, wife-as-senior-partner. Data from 461 college students were collected using a person perception experiment within a self-administered questionnaire. Results include: the head-complement dyad was perceived as least stable, least fair for the wife and husband, least satisfying for the wife, and least acceptable. The husband-as-senior partner dyad was

Laura A. Cobb; Brenda L. Seery; Kathleen McKinney

2003-01-01

32

The diffusion of novel signs beyond the dyad  

PubMed Central

We present a study aimed at investigating how novel signs emerge and spread through a community of interacting individuals. Ten triads of participants played a game in which players created novel signs in order to communicate with each other while constantly rotating between the role of interlocutor and that of observer. The main result of the study was that, for a majority of the triads, communicative success was not shared by the three dyads of players in a triad. This imbalance appears to be due to individual differences in game performance as well as to uncooperative behaviors. We suggest that both of these are magnified by the social dynamics induced by the role rotations in the game.

Galantucci, Bruno; Theisen, Carrie; Gutierrez, Elkin Dario; Kroos, Christian; Rhodes, Theo

2012-01-01

33

Spin effects in intramolecular electron transfer in naproxen- N -methylpyrrolidine dyad  

NASA Astrophysics Data System (ADS)

Intramolecular electron transfer in chiral dyads has been investigated by spin chemistry methods. It is observed intramolecular photoelectron transfer in the dyads. The study of spin effects shows the exciplex formation during excited state quenching of the dyad.

Magin, I. M.; Polyakov, N. E.; Khramtsova, E. A.; Kruppa, A. I.; Tsentalovich, Yu. P.; Leshina, T. V.; Miranda, M. A.; Nuin, E.; Marin, M. L.

2011-11-01

34

A Comparison of Deception Behavior in Dyad and Triadic Group Decision Making in Synchronous Computer-Mediated Communication  

Microsoft Academic Search

Deception can be detrimental to individual and organizational decision mak- ing. Existing research on behavioral cues to deception has focused mainly on monologue and dyadic interaction. No studies have empirically examined the impact of group size on behavioral cues to deception. This study is the first attempt to investigate whether deceivers behave differently in dyads and triadic groups in synchronous

Lina Zhou; Dongsong Zhang

2006-01-01

35

Synthesis of a linear benzo[3]phenylene–[60]fullerene dyad  

Microsoft Academic Search

The synthesis of a new linear benzo[3]phenylene–[60]fullerene dyad 1 is achieved over 10 steps in 15% overall yield by using an efficient sequence combining a double cobalt(I)-mediated cyclotrimerization with a Bingel reaction.

Sébastien Taillemite; Corinne Aubert; Denis Fichou; Max Malacria

2005-01-01

36

Injecting equipment sharing in Russian drug injecting dyads.  

PubMed

In this study, we investigated how individual attributes, dyad characteristics and social network characteristics may influence engaging in receptive syringe sharing, distributive syringe sharing and sharing cookers in injecting partnerships of IDUs in St Petersburg, Russia. We found that all three levels were associated with injecting equipment sharing, and that dyad characteristics were modified by characteristics of the social network. Self-reported HIV discordance and male gender concordance played a role in the risk of equipment sharing. Dyad interventions may not be sufficient to reduce injecting risk in IDU partnerships, but a combination of dyad and network interventions that target both IDU partnerships and the entire IDU population may be more appropriate to address injecting risk among IDUs. PMID:19214731

Gyarmathy, V Anna; Li, Nan; Tobin, Karin E; Hoffman, Irving F; Sokolov, Nikolai; Levchenko, Julia; Batluk, Julia; Kozlov, Andrei A; Kozlov, Andrei P; Latkin, Carl A

2009-02-13

37

Evidence for unintentional emotional contagion beyond dyads.  

PubMed

Little is known about the spread of emotions beyond dyads. Yet, it is of importance for explaining the emergence of crowd behaviors. Here, we experimentally addressed whether emotional homogeneity within a crowd might result from a cascade of local emotional transmissions where the perception of another's emotional expression produces, in the observer's face and body, sufficient information to allow for the transmission of the emotion to a third party. We reproduced a minimal element of a crowd situation and recorded the facial electromyographic activity and the skin conductance response of an individual C observing the face of an individual B watching an individual A displaying either joy or fear full body expressions. Critically, individual B did not know that she was being watched. We show that emotions of joy and fear displayed by A were spontaneously transmitted to C through B, even when the emotional information available in B's faces could not be explicitly recognized. These findings demonstrate that one is tuned to react to others' emotional signals and to unintentionally produce subtle but sufficient emotional cues to induce emotional states in others. This phenomenon could be the mark of a spontaneous cooperative behavior whose function is to communicate survival-value information to conspecifics. PMID:23840683

Dezecache, Guillaume; Conty, Laurence; Chadwick, Michele; Philip, Leonor; Soussignan, Robert; Sperber, Dan; Grèzes, Julie

2013-06-28

38

Problem-solving strategies in dementia patient-caregiver dyads.  

PubMed

Examined was the applicability of concepts of the zone of proximal development and scaffolding to the study of dementia. Caregiver-patient dyads were compared to normal elderly dyads in the instructional strategies they used to complete the Block Design subtest of the WAIS-R. Shown by the results was that the use of a detailed behavioral coding scheme was successful in documenting systematic differences between the two groups. Potential use in assessment and intervention is discussed. PMID:2753376

Cavanaugh, J C; Dunn, N J; Mowery, D; Feller, C; Niederehe, G; Frugé, E; Volpendesta, D

1989-04-01

39

Injecting Equipment Sharing in Russian Drug Injecting Dyads  

Microsoft Academic Search

In this study, we investigated how individual attributes, dyad characteristics and social network characteristics may influence\\u000a engaging in receptive syringe sharing, distributive syringe sharing and sharing cookers in injecting partnerships of IDUs\\u000a in St Petersburg, Russia. We found that all three levels were associated with injecting equipment sharing, and that dyad characteristics\\u000a were modified by characteristics of the social network.

V. Anna Gyarmathy; Nan Li; Karin E. Tobin; Irving F. Hoffman; Nikolai Sokolov; Julia Levchenko; Julia Batluk; Andrei A. Kozlov; Andrei P. Kozlov; Carl A. Latkin

2010-01-01

40

Distinct photophysical and electronic characteristics of strongly coupled dyads containing a perylene accessory pigment and a porphyrin, chlorin, or bacteriochlorin.  

PubMed

The synthesis, photophysical, redox, and molecular-orbital characteristics of three perylene-tetrapyrrole dyads were investigated to elucidate characteristics favorable for use in next-generation light-harvesting assemblies. Each dyad contains a common perylene-monoimide that is linked at the 9-position via an ethynyl group to the meso-position of the tetrapyrrole. The tetrapyrroles include a porphyrin, chlorin, and bacteriochlorin, which have zero, one, and two reduced pyrrole rings, respectively. The increased pyrrole-ring reduction results in a progressive red shift and intensification of the lowest-energy absorption band, as exemplified by benchmark monomers. The direct ethyne linkage and accompanying strong perylene-tetrapyrrole electronic coupling in the dyads is evident by significant differences in optical absorption versus the sum of the features of the constituents. The perturbations decrease for the tetrapyrrole constituent along the series porphyrin > chlorin > bacteriochlorin. This trend is explained by the relative configurational mixing in the tetrapyrrole excited states and how the configuration-interaction energy (and not simply the energies of the configurations) is affected by coupling to the perylene. The perylene-tetrapyrrole electronic coupling is further evidenced in the redox and MO characteristics of the three dyads. All three dyads in nonpolar solvents exhibit relatively long singlet excited-state lifetimes (3.3-6.5 ns) and relatively large fluorescence quantum yields (0.14-0.40). Collectively, the physicochemical characteristics of the strongly coupled perylene-tetrapyrrole dyads render these architectures excellent candidates for light-harvesting materials with significant, even panchromatic, near-ultraviolet to near-infrared absorption. PMID:23895240

Wang, Jieqi; Yang, Eunkyung; Diers, James R; Niedzwiedzki, Dariusz M; Kirmaier, Christine; Bocian, David F; Lindsey, Jonathan S; Holten, Dewey

2013-07-29

41

Stereodifferentiation in the intramolecular singlet excited state quenching of hydroxybiphenyl-tryptophan dyads.  

PubMed

The photochemical processes occurring in diastereomeric dyads (S,S)-1 and (S,R)-1, prepared by conjugation of (S)-2-(2-hydroxy-1,1'-biphenyl-4-yl)propanoic acid ((S)-BPOH) with (S)- and (R)-Trp, have been investigated. In acetonitrile, the fluorescence spectra of (S,S)-1 and (S,R)-1 were coincident in shape and position with that of (S)-BPOH, although they revealed a markedly stereoselective quenching. Since singlet energy transfer from BPOH to Trp is forbidden (5 kcal mol(-1) uphill), the quenching was attributed to thermodynamically favoured (according to Rehm-Weller) electron transfer or exciplex formation. Upon addition of 20% water, the fluorescence quantum yield of (S)-BPOH decreased, while only minor changes were observed for the dyads. This can be explained by an enhancement of the excited state acidity of (S)-BPOH, associated with bridging of the carboxy and hydroxy groups by water, in agreement with the presence of water molecules in the X-ray structure of (S)-BPOH. When the carboxy group was not available for coordination with water, as in the methyl ester (S)-BPOHMe or in the dyads, this effect was prevented; accordingly, the fluorescence quantum yields did not depend on the presence or absence of water. The fluorescence lifetimes in dry acetonitrile were 1.67, 0.95 and 0.46 ns for (S)-BPOH, (S,S)-1 and (S,R)-1, respectively, indicating that the observed quenching is indeed dynamic. In line with the steady-state and time-resolved observations, molecular modelling pointed to a more favourable geometric arrangement of the two interacting chromophores in (S,R)-1. Interestingly, this dyad exhibited a folded conformation in the solid state. PMID:23381012

Bonancía, Paula; Vayá, Ignacio; Markovitsi, Dimitra; Gustavsson, Thomas; Jiménez, M Consuelo; Miranda, Miguel A

2013-02-05

42

Gender and Career Development Projects in Early Adolescence: Similarities and Differences between Mother-Daughter and Mother-Son Dyads  

Microsoft Academic Search

The way that mother-son and mother-daughter dyads engage in career projects was explored using the action-project differentiation procedure, a variant of the action-project method. The goal-directed actions, joint projects, and interactions of ten early adolescent boys and their mothers were examined in relation to the actions, projects, and interactions of ten early adolescent girls and their mothers. Many more similarities

José F. Domene; Rübab G. Arim; Richard A. Young

2007-01-01

43

Children's Peer Relations: Sociometric Status, Dyads, and Triads.  

ERIC Educational Resources Information Center

|Most sociometric research is based on same-age, mixed-gender classroom groups. By contrast, this study examined eight ad hoc play groups of mixed ages (6 and 7 years) and same gender at three levels of social organization: individual status, mutual dyads, and mutual triads. A total of 96 children in groups of 12 nominated three most- and…

Shantz, Carolyn U.; And Others

44

Photodynamics of pyrene-flavin and phenothiazine-flavin dyads  

NASA Astrophysics Data System (ADS)

A pyrene-flavin (isoalloxazine) dyad (PFD) and a phenothiazine-phenylene-isoalloxazine dyad (PPF), dissolved in dichloromethane are characterized by absorption and emission spectroscopy. These dyads are model compounds for flavin based blue-light photoreceptors. Absorption cross-section spectra, fluorescence quantum distributions, fluorescence quantum yields, and fluorescence decay times are determined. The absorption spectra of the dyads resemble the superposition of the absorption spectra of the constituents (1-methylpyrene, isoalloxazine, and phenylphenothiazine). Photo-excitation of the flavin moiety causes fluorescence quenching by reductive electron transfer in thermodynamic equilibrium with the exited flavin subunit. The charge-separated states recover by charge recombination. Photo-excitation of the pyrene or phenylphenothiazine moiety causes oxidative electron transfer with successive recombination, and additionally Förster-type energy transfer and Dexter-type energy transfer. For PFD in dichloromethane the rates of reductive electron transfer and oxidative electron transfer were determined to be (5 ps)-1 and (77 ps)-1, respectively, and a charge recombination time of about 16 ps was found. For PPF in dichloromethane the rates of reductive electron transfer and oxidative electron transfer were determined to be (700 fs)-1 and (100 ps)-1, respectively. The HOMO level position of the pyrene radical cation subunit relative to the HOMO level of the excited isoalloxazine subunit is determined from the delayed fluorescence emission of the PFD sample.

Shirdel, J.; Penzkofer, A.; Procházka, R.; Shen, Z.; Daub, J.

2007-07-01

45

The Therapy Dyad: Yet Another Look at Diagnostic Assessment  

Microsoft Academic Search

Psychological assessment has been attacked both from within and outisde of psychology. Current research and opinion suggests that usual assessment procedures provide only marginally useful information at best and often yield unreliable, invalid, and unwanted data. It is argued that a new approach should be treatment oriented. The model proposed emphasizes the evaluation of therapy dyads extrapolating from relevant social

Larry E. Beutler

1973-01-01

46

Morphological stability of organic solar cells based upon an oligo(p-phenylenevinylene)-C70 dyad.  

PubMed

An oligo(p-phenylenevinylene)-C(70) dyad achieves the highest power conversion efficiency (1.92%) in dyad-based organic solar cells to date. Covalent attachment in the dyad prevents large phase separation, resulting in good morphological and device stability at high temperatures as compared with mixed bulk heterojunction devices. PMID:23108576

Izawa, Seiichiro; Hashimoto, Kazuhito; Tajima, Keisuke

2012-12-14

47

Assessing the Dyadic Approach to Interstate Conflict Processes: A.k.a. “Dangerous” Dyad-Years  

Microsoft Academic Search

The “dyad” has become the analytical cornerstone of quantitative interstate conflict studies. Stuart Bremer, in no small part due to his “Dangerous Dyads” article, has been identified with the dyadic\\/dyad-year approach. We think this has come at the expense of his interest in “process models” of interstate conflict. Our examination of his writings on The Process of War indicate that

Sarah E. Croco; Tze Kwang Teo

2005-01-01

48

Multivariate Models of Parent-Late Adolescent Gender Dyads: The Importance of Parenting Processes in Predicting Adjustment  

Microsoft Academic Search

Although parent-adolescent interactions have been examined, relevant variables have not been integrated into a multivariate\\u000a model. As a result, this study examined a multivariate model of parent-late adolescent gender dyads in an attempt to capture\\u000a important predictors in late adolescents’ important and unique transition to adulthood. The sample for this study consisted\\u000a of 151 male and 324 female late adolescents,

Cliff McKinney; Kimberly Renk

2008-01-01

49

Dynamic Infant-Parent Affect Coupling during the Face-to-Face and Still-Face Paradigm: Inter- and Intra-Dyad Differences  

PubMed Central

We examined dynamic infant-parent affect coupling using the Face-to-Face/Still-Face (FFSF) paradigm. The sample included 20 infants whose older siblings had been diagnosed with Autism Spectrum Disorders (ASD-sibs), and 18 infants with comparison siblings (COMP-sibs). A series of extended autoregressive models was used to represent the self-regulation and interactive dynamics of infants and parents during FFSF. Significant bidirectional affective coupling was found between infants and parents, with the former serving as the “leading members” of the dyads. Further analysis of within-dyad dynamics revealed ongoing changes in concurrent infant-parent linkages both within and across different FFSF episodes. The importance of considering both inter- and intra-dyad differences is discussed.

Chow, Sy-Miin; Haltigan, John D.; Messinger, Daniel S.

2010-01-01

50

Homeopath & patient–a dyad of harmony?  

Microsoft Academic Search

Within the last 20yr, heterodox medicine has become increasingly popular in western societies. Critics and advocates argue that the physician–patient relationship is a key factor to this success. This study which is based on 20 semi-structured interviews with homeopathic physicians in Berlin questions the notion of a purely consensual interaction. While we can find a certain degree of partnership between

R. Frank

2002-01-01

51

Supporting the Breast-feeding Dyad  

PubMed Central

Although there has been a resurgence of breast-feeding in the last decade, 50% of women discontinue exclusive breast-feeding by the third month postpartum. Practices known to interfere with breast-feeding are often begun in hospital and continued at home. The physiology of lactation, the need for interaction between mother and infant during breast-feeding, and research findings indicate that scheduled feeds, feeds of limited duration, supplementation, and separation of mothers and infants interfere with the success of breast-feeding. Health care providers can promote breast-feeding duration by advising unlimited feeds, promoting ‘rooming-in’ at hospitals, and providing support and information.

Ellis, Donelda

1986-01-01

52

Beverage intake in low-income parent–child dyads  

Microsoft Academic Search

Beverage consumption adds to daily energy intake and often exceeds the recommended amount for discretionary energy. Previous research has shown that children are consuming sugar-sweetened beverages (SSB) in greater frequency and the relationship between parent–child dyads in beverage consumption is meaningful due to the parental influence on the development of beverage consumption behaviors. In particular, low-income families are at greater

Courtney A. Pinard; Brenda M. Davy; Paul A. Estabrooks

2011-01-01

53

First triazole-bridged unsymmetrical porphyrin dyad via click chemistry.  

PubMed

Click chemistry has been successfully applied in the synthesis of the first example of a triazole-bridged porphyrin dyad containing N(2)S(2) porphyrin and N(4) or ZnN(4) porphyrin subunits, and fluorescence study indicated a possibility of singlet-singlet energy transfer from the N(4) or ZnN(4) porphyrin subunit to the N(20S(2) porphyrin subunit. PMID:18069851

Punidha, Sokkalingam; Sinha, Jasmine; Kumar, Anil; Ravikanth, Mangalampalli

2007-12-11

54

Impact of the CD40-CD40L Dyad in Alzheimer's Disease  

PubMed Central

As the number of elderly individuals rises, Alzheimer’s disease (AD), marked by amyloid-? deposition, neurofibrillary tangle formation, and low-level neuroinflammation, is expected to lead to an ever-worsening socioeconomic burden. AD pathoetiologic mechanisms are believed to involve chronic microglial activation. This phenomenon is associated with increased expression of membrane-bound CD40 with its cognate ligand, CD40 ligand (CD40L), as well as increased circulating levels of soluble forms of CD40 (sCD40) and CD40L (sCD40L). Here, we review the role of this inflammatory dyad in the pathogenesis of AD. In addition, we examine potential therapeutic strategies such as statins, flavonoids, and human umbilical cord blood transplantation, all of which have been shown to modulate CD40-CD40L interaction in mouse models of AD. Importantly, therapeutic approaches focusing on CD40-CD40L dyad regulation, either alone or in combination with amyloid-? immunotherapy, may provide for a safe and effective AD prophylaxis or treatment in the near future.

Giunta, Brian; Rezai-Zadeh, Kavon; Tan, Jun

2010-01-01

55

Beverage intake in low-income parent-child dyads.  

PubMed

Beverage consumption adds to daily energy intake and often exceeds the recommended amount for discretionary energy. Previous research has shown that children are consuming sugar-sweetened beverages (SSB) in greater frequency and the relationship between parent-child dyads in beverage consumption is meaningful due to the parental influence on the development of beverage consumption behaviors. In particular, low-income families are at greater risk for obesity and higher levels of SSB consumption. The current investigation assessed habitual beverage intake among low-income parent-child dyads (N=95) with children between the ages of 9-17 years. The sample (46% African American; 45% Caucasian) had a mean body mass index (BMI) for the parents of 31.8±8.9 kg/m(2), while the mean BMI percentile for age and gender for the children was 70.3±31.3. Both parents and children consumed fewer nutrient-dense beverages and more energy-dense beverages than the recommended amount. The mean daily energy intake from beverages was 451±236 kcal for the parents and 457±237 kcal for the children. Correlations between parent-child dyad intake was also evident, identifying parents as potential role models and gatekeepers of the home food environment. Future interventions to prevent childhood obesity in low-income populations should address beverage intake, particularly SSB consumption, and determine the degree to which this behavior is learned behavior in the home. PMID:22051366

Pinard, Courtney A; Davy, Brenda M; Estabrooks, Paul A

2011-08-01

56

Exchange and cohesion in dyads and triads: A test of Simmel's hypothesis.  

PubMed

This paper uses social exchange theory to address a classic question posed by Simmel (1964) regarding dyads and triads. The question is whether exchanges in a triad will generate more cohesion at the group level than exchanges in an isolated dyad. The main hypotheses, integrating several ideas from Simmel and social exchange theories, are as follows. First, triads generate less variability of behavior than dyads; that is, there is more uniformity or convergence in triads. Second, in the context of repeated exchange, we predict higher levels of cohesion in triads than in dyads. Third, positive emotion or affect has a stronger impact on cohesion in dyads than in triads, whereas uncertainty reduction has a stronger impact on cohesion in triads. To test these hypotheses, an experiment compared isolated dyads to dyads nested in a triadic exchange network. Subjects engaged in exchanges across a series of distinct episodes, using standard experimental procedures from research on relational cohesion (Lawler and Yoon, 1996) and exchange networks (Molm and Cook, 1995; Willer, 1999). Consistent with the hypotheses, the results reveal more convergence of behavior and higher cohesion in triads than in dyads; moreover, uncertainty reduction is the primary basis for cohesion in the triad, whereas positive affect was the primary basis for cohesion in the dyad. These results are discussed in relation to Simmelian dyad-triad dynamics and the theory of relational cohesion. PMID:24090845

Yoon, Jeongkoo; Thye, Shane R; Lawler, Edward J

2013-06-21

57

Coordination dynamics in horse-rider dyads.  

PubMed

The sport of equestrianism is defined through close horse-rider interaction. However, no consistent baseline parameters currently exist describing the coordination dynamics of horse-rider movement across different equine gaits. The study aims to employ accelerometers to investigate and describe patterns of motor coordination between horse and rider across the equine gaits of walk, rising trot, sitting trot and canter. Eighteen female (N=18; mean age±SD: 37.57±13.04) Dutch horse-rider combinations were recruited to participate in the study. Horse-rider coordination was recorded using two tri-axial wireless accelerometers during a standard ridden protocol. Multiple measures of horse-rider coordination were calculated to investigate the relationship between the horse and rider, while the unpredictability of the acceleration-time series of the horse and rider during task performance were determined separately by means of approximate entropy analysis. The kinematic variables of horse-rider correlation, mean relative phase, mean standard deviation of the relative phase, approximate entropy rider, approximate entropy horse and spectral edge frequency at 95% of the power in the 0-10 Hz frequency band were examined using multiple correlational analyses and multivariate analysis of variance (MANOVA). Findings showed significantly different coordination dynamics between equine gaits, with the gait of canter allowing for the highest levels of horse-rider synchronicity. It may be concluded that accelerometers are a valuable tool to map distinct coordination patterns of horse-rider combinations. PMID:23290116

Wolframm, Inga A; Bosga, Jurjen; Meulenbroek, Ruud G J

2013-01-04

58

Disrupting aggregation of tethered rhodamine B dyads through inclusion in cucurbit[7]uril.  

PubMed

Hexano- and dodecano-tethered diesters of rhodamine B were prepared. The absorption and fluorescence spectra of these flexibly tethered dyads were compared with those of the rhodamine 3B ethyl ester. Increased J- and H-type dimer formation and decreased fluorescence emission were observed for the tethered dyads. Complexation of the cationic chromophoric units in cucurbit[7]uril (CB7) hosts decreased H-dimer aggregation, especially for the dodecano-tethered dyad. The monomeric dye and both dye dyads exhibited enhanced fluorescence upon addition of CB7. PMID:18366221

Halterman, Ronald L; Moore, Jason L; Mannel, Lisa M

2008-03-27

59

Multiscale modeling of calcium signaling in the cardiac dyad.  

PubMed

Calcium (Ca(2+))-induced Ca(2+)-release (CICR) takes place in spatially restricted microdomains known as dyads. The length scale over which CICR occurs is on the order of nanometers and relevant time scales range from micro- to milliseconds. Quantitative understanding of CICR therefore requires development of models that are applicable over a range of spatio-temporal scales. We will present several new approaches for multiscale modeling of CICR. First, we present a model of dyad Ca(2+) dynamics in which the Fokker-Planck equation (FPE) is solved for the probability P(x, t) that a Ca(2+) ion is located at dyad position x at time t. Using this model, we demonstrate that (a) Ca(2+) signaling in the dyad is mediated by approximately tens of Ca(2+) ions; (b) these signaling events are noisy due to the small number of ions involved; and (c) the geometry of the RyR (ryanodine receptors) protein may function to restrict the diffusion of and to "funnel" Ca(2+) ions to activation-binding sites on the RyR, thus increasing RyR open probability and excitation-contraction (EC) coupling gain. Simplification of this model to one in which the dyadic space is represented using a single compartment yields the stochastic local-control model of CICR developed previously. We have shown that this model captures fundamental properties of CICR, such as graded release and voltage-dependent gain, may be integrated within a model of the myocyte and may be simulated in reasonable times using a combination of efficient numerical methods and parallel computing, but remains too complex for general use in cell simulations. To address this problem, we show how separation of time scales may be used to formulate a model in which nearby L-type Ca(2+) channels (LCCs) and RyRs gate as a coupled system that may be described using low-dimensional systems of ordinary differential equations, thus reducing computational complexity while capturing fundamentally important properties of CICR. The simplified model may be solved many orders of magnitude faster than can either of the more detailed models, thus enabling incorporation into tissue-level simulations. PMID:17132795

Winslow, Raimond L; Tanskanen, Antti; Chen, Mindao; Greenstein, Joseph L

2006-10-01

60

Perspective Taking and Communication Satisfaction in Coworker Dyads  

Microsoft Academic Search

Purpose  This study addressed whether or not self-rated and other-rated perspective taking would converge and questioned the relationship\\u000a between perspective taking and communication satisfaction among coworkers.\\u000a \\u000a \\u000a \\u000a \\u000a Design\\/methodology\\/approach  A sample of 114 participants, all coworkers at 27 kindergartens in Korea, provided data to form 350 dyads. The participants\\u000a rated their own perspective-taking tendency, their coworkers’ perspective-taking tendency, and how satisfied they were when

Hee Sun Park; Amber N. W. Raile

2010-01-01

61

Absorption and fluorescence spectroscopic characterisation of a phenothiazine flavin dyad  

NASA Astrophysics Data System (ADS)

The phenothiazine phenylene isoalloxazine dyad, 3-methyl-10-[4-(10-heptyl-10H-phenothiazin-3-yl)-phenyl]-10H-benzo[g]pteridine-2,4-dione, dissolved in either dichloromethane or acetonitrile is characterized by absorption and emission spectroscopy. Absorption cross-section spectra, stimulated emission cross-section spectra, fluorescence quantum distributions, fluorescence quantum yields, and degrees of fluorescence polarisation are determined. The fluorescence decay is determined by time-resolved measurements. The dye photo-stability is investigated by observation of absorption spectral changes due to prolonged blue-light excitation. The absorption spectrum of the dyad resembles the superposition of the absorption of the isoalloxazine (flavin) moiety and of the phenylphenothiazine moiety. Photo-excitation of the flavin moiety causes fluorescence quenching by ground-state reductive electron transfer from phenylphenothiazine to isoalloxazine followed by charge recombination. Photo-excitation of the phenothiazine moiety causes (i) efficient excited-state oxidative electron transfer from phenothiazine to isoalloxazine with successive recombination, and (ii) moderate energy transfer followed by ground-state phenothiazine electron transfer and recombination.

Shirdel, J.; Penzkofer, A.; Procházka, R.; Shen, Z.; Daub, J.

2007-07-01

62

Ultrastructure of lower Paleozoic dyads from southern Ohio II: Dyadospora murusattenuata, functional and evolutionary considerations  

Microsoft Academic Search

Fossil cryptospore dyads consistent with published descriptions of Dyadospora murusattenuata fall into two general categories when examined with the TEM. Type I dyads are enclosed, and have a wall consisting of (1) an outer homogeneous layer that is present on non-contact surfaces, but absent in large part over the contact surface, (2) a middle layer composed of plate-shaped units, and

Wilson A. Taylor

1997-01-01

63

Intergenerational Transmission of Attachment in Father-Child Dyads: The Case of Single Parenthood  

ERIC Educational Resources Information Center

Researchers have repeatedly found that intergenerational transmission of attachment is more robust in mother-child dyads than it is in father-child dyads. They have proposed several explanations for the inconsistent father-child findings, including the use of the strange situation procedure, the young age of the children, and the fact that fathers…

Bernier, Annie; Miljkovitch, Raphaele

2009-01-01

64

A facile synthetic access to porphyrin fullerene dyads and their optical properties  

Microsoft Academic Search

Porphyrin fullerene dyads 5 and 6 can be derived by Bingel reaction from a deuteroporphyrin derivative 3 with an attached macrocyclic bislactone moiety. The porphyrin bislactone 3 on the other hand is easily formed in an esterification reaction between malonic acid and a deuteroporphyrin bisalcohol 2. Missing fluorescence in the dyads 5 and 6 indicates a light induced intramolecular electron

Michael Wedel; Franz-Peter Montforts

1999-01-01

65

Socially Shared Metacognition of Dyads of Pupils in Collaborative Mathematical Problem-Solving Processes  

ERIC Educational Resources Information Center

|This study investigated how metacognition appears as a socially shared phenomenon within collaborative mathematical word-problem solving processes of dyads of high-achieving pupils. Four dyads solved problems of different difficulty levels. The pupils were 10 years old. The problem-solving activities were videotaped and transcribed in terms of…

Iiskala, Tuike; Vauras, Marja; Lehtinen, Erno; Salonen, Pekka

2011-01-01

66

Perceptions of Conflict Strategies and Communication Competence in Task-Oriented Dyads  

ERIC Educational Resources Information Center

|Individuals in temporary task-oriented dyads or groups must manage conflict competently if they hope to be successful in reaching their goals. Thus far, however, research on the associations between conflict styles and communication competence has focused on acquainted dyads, such as relational partners and coworkers, rather than unacquainted…

Gross, Michael A.; Guerrero, Laura K.; Alberts, Jess K.

2004-01-01

67

Intergenerational Transmission of Attachment in Father-Child Dyads: The Case of Single Parenthood  

ERIC Educational Resources Information Center

|Researchers have repeatedly found that intergenerational transmission of attachment is more robust in mother-child dyads than it is in father-child dyads. They have proposed several explanations for the inconsistent father-child findings, including the use of the strange situation procedure, the young age of the children, and the fact that…

Bernier, Annie; Miljkovitch, Raphaele

2009-01-01

68

Examining White Counselor Trainees' Reactions to Racial Issues in Counseling and Supervision Dyads  

ERIC Educational Resources Information Center

This study examined the reactions of White counselor trainees to hypothetical, provocative, cross-racial counseling and supervision dyads. It employed a qualitative methodology of inquiry to explore the underlying dynamics associated with cross-racial counseling and supervision dyads. Working with a sample of 8 White male and female counselor…

Utsey, Shawn O.; Gernat, Carol A.; Hammar, Lawrence

2005-01-01

69

Similarity in Depressive Symptoms in Adolescents' Friendship Dyads: Selection or Socialization?  

PubMed Central

This study examined friendship selection and socialization as mechanisms explaining similarity in depressive symptoms in adolescent same-gender best friend dyads. The sample consisted of 1,752 adolescents (51% male) ages 12–16 years (M = 13.77, SD = 0.73) forming 487 friend dyads and 389 nonfriend dyads (the nonfriend dyads served as a comparison group). To test our hypothesis, we applied a multigroup actor–partner interdependence model to 3 friendship types that started and ended at different time points during the 2 waves of data collection. Results showed that adolescents reported levels of depressive symptoms at follow-up that were similar to those of their best friends. Socialization processes explained the increase in similarity exclusively in female dyads, whereas no evidence for friendship selection emerged for either male or female dyads. Additional analyses revealed that similarity between friends was particularly evident in the actual best friend dyads (i.e., true best friends), in which evidence for socialization processes emerged for both female and male friend dyads. Findings highlight the importance of examining friendship relations as a potential context for the development of depressive symptoms.

Giletta, Matteo; Scholte, Ron H. J.; Burk, William J.; Engels, Rutger C. M. E.; Larsen, Junilla K.; Prinstein, Mitchell J.; Ciairano, Silvia

2012-01-01

70

The Fractured Conjugal Family: A Comparison of Married and Divorced Dyads  

ERIC Educational Resources Information Center

|This study compared 20 married dyads and 20 divorced dyads on the dimensions of affect, marital adjustment, personality homogamy, value homogamy, and selected demographic variables. Instruments included the Caring Relationship Inventory, the Modified Form of Locke's Marital Questionnaire, the Sixteen Personality Factor Questionnaire, and the…

McKenry, Patrick C.; And Others

1978-01-01

71

Developing psychotherapists' competence through clinical supervision: protocol for a qualitative study of supervisory dyads  

PubMed Central

Background Mental health professionals face unique demands and stressors in their work, resulting in high rates of burnout and distress. Clinical supervision is a widely adopted and valued mechanism of professional support, development, and accountability, despite the very limited evidence of specific impacts on therapist or client outcomes. The current study aims to address this by exploring how psychotherapists develop competence through clinical supervision and what impact this has on the supervisees’ practice and their clients’ outcomes. This paper provides a rationale for the study and describes the protocol for an in-depth qualitative study of supervisory dyads, highlighting how it addresses gaps in the literature. Methods/Design The study of 16–20 supervisor-supervisee dyads uses a qualitative mixed method design, with two phases. In phase one, supervisors who are nominated as expert by their peers are interviewed about their supervision practice. In phase two, supervisors record a supervision session with a consenting supervisee; interpersonal process recall interviews are conducted separately with supervisor and supervisee to reflect in depth on the teaching and learning processes occurring. All interviews will be transcribed, coded and analysed to identify the processes that build competence, using a modified form of Consensual Qualitative Research (CQR) strategies. Using a theory-building case study method, data from both phases of the study will be integrated to develop a model describing the processes that build competence and support wellbeing in practising psychotherapists, reflecting the accumulated wisdom of the expert supervisors. Discussion The study addresses past study limitations by examining expert supervisors and their supervisory interactions, by reflecting on actual supervision sessions, and by using dyadic analysis of the supervisory pairs. The study findings will inform the development of future supervision training and practice and identify fruitful avenues for future research.

2013-01-01

72

Proximity-to-goal as a constraint on patterns of behaviour in attacker-defender dyads in team games.  

PubMed

The aim of this study was to determine whether spatiotemporal interactions between footballers and the ball in 1 vs. 1 sub-phases are influenced by their proximity to the goal area. Twelve participants (age 15.3 ± 0.5 years) performed as attackers and defenders in 1 vs. 1 dyads across three field positions: (a) attacking the goal, (b) in midfield, and (c) advancing away from the goal area. In each position, the dribbler was required to move beyond an immediate defender with the ball towards the opposition goal. Interactions of attacker-defender dyads were filmed with player and ball displacement trajectories digitized using manual tracking software. One-way repeated measures analysis of variance was used to examine differences in mean defender-to-ball distance after this value had stabilized. Maximum attacker-to-ball distance was also compared as a function of proximity-to-goal. Significant differences were observed for defender-to-ball distance between locations (a) and (c) at the moment when the defender-to-ball distance had stabilized (a: 1.69 ± 0.64 m; c: 1.15 ± 0.59 m; P < 0.05). Findings indicate that proximity-to-goal influenced the performance of players, particularly when attacking or advancing away from goal areas, providing implications for training design in football. In this study, the task constraints of football revealed subtly different player interactions than observed in previous studies of dyadic systems in basketball and rugby union. PMID:22176036

Headrick, Jonathon; Davids, Keith; Renshaw, Ian; Araújo, Duarte; Passos, Pedro; Fernandes, Orlando

2011-12-19

73

Charge transfer in model bioinspired carotene-porphyrin dyads.  

PubMed

We present a computational study based on accurate DFT and TD-DFT methods on model bioinspired donor-acceptor dyads, formed by a carotenoid covalently linked to a tetraphenylporphyrin (TPP) at the ortho position of one of the TPP phenyl rings. Dyadic systems can be used in the construction of organic solar cells and development of efficient photocatalytic systems for the solar energy conversion, due to the unique advantages they offer in terms of synthetic feasibility. This study aims to describe the influence of chemical modifications on the absorption spectra, in particular on the lowest energy charge transfer bands. Effects of different metals of biological interest, i.e., Mg, Fe, Ni, and Zn, and of H(2)O and histidine molecules coordinated to the metals in different axial positions are rationalized. PMID:22429261

Orian, Laura; Carlotto, Silvia; Di Valentin, Marilena; Polimeno, Antonino

2012-04-05

74

CO2 photoreduction with long-wavelength light: dyads and monomers of zinc porphyrin and rhenium bipyridine.  

PubMed

Photocatalytic CO(2) reduction has been studied for two dyads with porphyrin covalently attached to rhenium tricarbonyl bipyridine moieties, and on separate components consisting of [Re(CO)(3)(Picoline)Bpy](+) and either zinc porphyrin or zinc chlorin. TONs decrease in the order: zinc porphyrin + Re > long spacer dyad > zinc chlorin + Re > short spacer dyad. PMID:22785349

Windle, Christopher D; Câmpian, Marius V; Duhme-Klair, Anne-K; Gibson, Elizabeth A; Perutz, Robin N; Schneider, Jacob

2012-07-12

75

Enhancing early attachment: Design and pilot study of an intervention for primary health care dyads.  

PubMed

The attachment style of an infant with his caregiver can greatly influence his future development. Many interventions have been proposed to enhance early secure attachment styles, but few have characteristics that make them suitable for primary health care. The objective of the study wasto design a complex intervention for promoting secure attachment in dyads detected in Primary Health Care with altered patterns of attachment styles. The methodology proposed by the UK Medical Research Council was used: (1) theoretical phase: literature review; (2) modelling phase: the main components of the intervention were defined through qualitative research; and (3) exploration phase: pilot study of the preliminary intervention. The attachment style of the dyads was evaluated using the Massie-Campbell scale prior to and four months after the pilot intervention. The preliminary intervention was designed: a group workshop (five to seven dyads, with children aged between 6 and 12 months and two health care professional monitors) structured around various activities that specifically dealt with the skills associated with parental sensitivity and addressed relevant issues to child rearing. The intervention was then tested in a pilot study of 11 dyads in two primary health care centres. The analysis was done with nine dyads (two were lost in the second evaluation), and showed an improvement of 33 per cent in the secure attachment style in the dyads (not statistically significant). An original intervention is designed and proposed for dyads who have early indicators of altered styles of attachment in primary health care. PMID:23162050

Leigh, Francisca Figueroa; Vergara, Victoria Binda; Santelices, María Pía

2012-11-16

76

Styryl Bodipy-C(60) Dyads as Efficient Heavy-Atom-Free Organic Triplet Photosensitizers.  

PubMed

C(60)-styryl Bodipy dyads that show strong absorption of visible light (? = 64?600 M(-1) cm(-1) at 657 nm) and a long-lived triplet excited state (?(T) = 123.2 ?s) are prepared. The dyads were used as heavy-atom-free organic triplet photosensitizers for photooxidation of 1,5-dihydroxynaphthalene via the photosensitizing of singlet oxygen ((1)O(2)). The photooxidation efficiency of the dyads compared to the conventional Ir(III) complex (1)O(2) photosensitizer increased 19-fold. PMID:22571170

Huang, Ling; Yu, Xuerong; Wu, Wanhua; Zhao, Jianzhang

2012-05-01

77

Porphyrin-cobaloxime dyads for photoinduced hydrogen production: investigation of the primary photochemical process.  

PubMed

Three porphyrin-cobaloxime dyads, suitable for application in photoinduced hydrogen generation with sacrificial donors, are characterized by ultrafast spectroscopy in order to clarify the primary photochemical events. PMID:23900713

Natali, Mirco; Orlandi, Michele; Chiorboli, Claudio; Iengo, Elisabetta; Bertolasi, Valerio; Scandola, Franco

2013-10-23

78

Photoinduced energy and charge transfer in a p-phenylene-linked dyad of boron dipyrromethene and monostyryl boron dipyrromethene.  

PubMed

Boron dipyrromethenes (BDPs) are excellent building blocks for design of artificial light harvesting and charge separation systems. In the present work, we report the results of photophysical studies of a novel dyad, in which a BDP and a mono-styryl BDP (MSBDP) are covalently linked to each other at the meso-position via a p-phenylene unit. It was found that the photophysical properties of the dyad dissolved in polar as well as nonpolar solvents are strongly affected by two different types of interactions between the BDP and MSBDP parts, namely excitation energy transfer and photoinduced electron transfer. The first process delivers the excitation energy to the first excited singlet state of the MSBDP-part upon excitation of the BDP unit. The direct or indirect (via excitation energy transfer) population of the first excited singlet state of the MSBDP moiety is followed by hole transfer to generate the charge-separated state. In non-polar toluene, the probability of charge separation is low, whereas in polar acetonitrile the charge separation quantum yield is close to unity, resulting in strong quenching of the MSBDP fluorescence. PMID:23549348

Menting, Roel; Liu, Jian-Yong; Huang, Ying-Si; Ng, Dennis K P; Röder, Beate; Ermilov, Eugeny A

2013-04-02

79

Intergenerational Transmission of Attachment in Father-Child Dyads: The Case of Single Parenthood  

Microsoft Academic Search

Researchers have repeatedly found that intergenerational transmission of attachment is more robust in mother-child dyads than it is in father-child dyads. They have proposed several explanations for the inconsistent father-child findings, including the use of the strange situation procedure, the young age of the children, and the fact that fathers are often less involved in early caregiving than are mothers.

Annie Bernier; Raphaéle Miljkovitch

2009-01-01

80

Intramolecular electron transfer in fullerene\\/ferrocene based donor-bridge-acceptor dyads  

Microsoft Academic Search

A systematic steady-state fluorescence and time-resolved flash photolytic investigation of a series of covalently linked fullerene\\/ferrocene based donor-bridge-acceptor dyads is reported as a function of the nature of the spacer between the donor site (ferrocene) and acceptor site (fullerene) and the dielectric constant of the medium. The fluorescence of the investigated dyads 2, 3, 4, 5, and 6 in methylcyclohexane

Dirk M. Guldi; Michele Maggini; Gianfranco Scorrano; Maurizio Prato

1997-01-01

81

Escalation of interstate crises of conflictual dyads: Greece–Turkey and India–Pakistan  

Microsoft Academic Search

This article examines the causation and extent of interstate crisis escalation among two conflictual dyads, namely Greece–Turkey and India–Pakistan. It draws from the International Crisis Behaviour dataset to present a new sub-dataset of 12 interstate crises involving the two dyads in the period 1987 to 2002. While crisis behaviour in Greece–Turkey has frequently been analysed within the context of two

Akisato Suzuki; Neophytos Loizides

2011-01-01

82

Smoking Concordance in Lung and Colorectal Cancer Patient-Caregiver Dyads and Quality of Life  

PubMed Central

Background Distress may be heightened among members of cancer patient-caregiver dyads that are mismatched on smoking status (either the patient or caregiver smokes, but the other does not), negatively affecting quality of life (QoL). The purpose of this study was to examine associations between patient-caregiver smoking concordance, caregiver psychological adjustment, and caregiver and patient mental and physical QoL. Methods Lung and colorectal patient-caregiver dyads (N= 742) were identified from the Cancer Care Outcomes Research and Surveillance (CanCORS) and CanCORS Caregiver studies. The majority of the cancer patients were male (67.0 %) with local (45.6 %) or regional (12.9 %) disease. The majority of the informal caregivers were females (78.6%), under 65 years of age (69.6%), and often spouses (57.8%) of the patients. Results Lung and colorectal cancer caregivers who were members of dyads where one or both members continued to smoke, reported worse mental health QoL than non-smoking dyads. For colorectal cancer patients, continuing to smoke when the caregiver did not was associated with worse mental health QoL compared to non-smoking dyads. Dyad smoking was less strongly associated with physical QoL for both caregivers and patients. Conclusion Results highlight the importance of assessing smoking in both cancer patients and their caregivers and referring families to appropriate psychosocial and smoking cessation services. Impact This is the first study to show associations between cancer patient-caregiver smoking status and QoL for both dyad members. Future studies will need to confirm these associations longitudinally and investigate potential mechanisms linking dyad smoking and QoL.

Weaver, Kathryn E.; Rowland, Julia H.; Augustson, Erik; Atienza, Audie A.

2011-01-01

83

A Sequential Analysis of Depressive Behaviors Within Adolescent Peer Interactions  

Microsoft Academic Search

This study examined depressive and positive patterns of interactions among clinical and nonclinical adolescent peers within an interpersonal context. Ten clinical dyads with a depressed partner and 10 nonclinical dyads engaged in 16-min audiotaped conversations under positive and negative task instructions discussing positive and negative experiences. Conversations were unitized and coded according to depressive, aggressive, positive, and neutral behaviors. The

Michelle C. Heller; Junko Tanaka-Matsumi

1999-01-01

84

Light-harvesting fullerene dyads as organic triplet photosensitizers for triplet-triplet annihilation upconversions.  

PubMed

Visible light-harvesting C(60)-bodipy dyads were devised as universal organic triplet photosensitizers for triplet-triplet annihilation (TTA) upconversion. The antennas in the dyad were used to harvest the excitation energy, and then the singlet excited state of C(60) will be populated via the intramolecular energy transfer from the antenna to C(60) unit. In turn with the intrinsic intersystem crossing (ISC) of the C(60), the triplet excited state of the C(60) will be produced. Thus, without any heavy atoms, the triplet excited states of organic dyads are populated upon photoexcitation. Different from C(60), the dyads show strong absorption of visible light at 515 nm (C-1, ? = 70400 M(-1) cm(-1)) or 590 nm (C-2, ? = 82500 M(-1) cm(-1)). Efficient intramolecular energy transfer from the bodipy moieties to C(60) unit and localization of the triplet excited state on C(60) were confirmed by steady-state and time-resolved spectroscopy as well as DFT calculations. The dyads were used as triplet photosensitizers for TTA upconversion, and an upconversion quantum yield up to 7.0% was observed. We propose that C(60)-organic chromophore dyads can be used as a general molecular structural motif for organic triplet photosensitizers, which can be used for photocatalysis, photodynamic therapy, and TTA upconversions. PMID:22616881

Wu, Wanhua; Zhao, Jianzhang; Sun, Jifu; Guo, Song

2012-05-30

85

Near-infrared molecular imaging probes based on chlorin-bacteriochlorin dyads  

NASA Astrophysics Data System (ADS)

Chlorin-bacteriochlorin dyads as a new class of near-infrared fluorophores were synthesized and spectroscopically characterized. Each dyad is comprised of a chlorin macrocycle (free base or zinc chelate) as an energy donor (and absorber) and a free base bacteriochlorin as an energy acceptor (and emitter). Excitation of the chlorin (?= 650 nm, zinc chelate; 675 nm, free base) results in fast (5 ps) and nearly quantitative (>99%) energy transfer to the adjacent bacteriochlorin moiety, and consequently bacteriochlorin fluorescence (?= 760 nm). Thus, each chlorinbacteriochlorin dyad behaves as a single chromophore, with a large effective Stokes shift (85 or 110 nm), a significant fluorescence quantum yield (?f = 0.19), long excited-state lifetime (? = 5.4 ns), narrow excitation and emission bands (<20 nm), and high chemical stability. Imaging experiments performed using phantoms show that the chlorin-bacteriochlorin dyads exhibit a range of superior properties compare with commercially available imaging dyes. While the latter are six-fold brighter (comparing ?•?f values), the chlorin-bacteriochlorin dyads exhibit narrower excitation and emission bands and larger Stokes shift, therefore allowing more efficient and selective excitation and detection of fluorescence. The high selectivity is further demonstrated with in vivo imaging studies using mice. This selectivity together with the tunability of absorption and emission wavelengths using substituent effects under synthetic control make the chlorin-bacteriochlorin dyads ideal candidates for multicolor imaging applications. In addition, the long fluorescence lifetimes make those probes suitable for lifetime-imaging applications.

Ptaszek, Marcin; Kee, Hooi Ling; Muthiah, Chinnasamy; Nothdurft, Ralph; Akers, Walter; Achilefu, Samuel; Culver, Joseph P.; Holten, Dewey

2010-02-01

86

Csy4 relies on an unusual catalytic dyad to position and cleave CRISPR RNA  

PubMed Central

CRISPR-Cas adaptive immune systems protect prokaryotes against foreign genetic elements. crRNAs derived from CRISPR loci base pair with complementary nucleic acids, leading to their destruction. In Pseudomonas aeruginosa, crRNA biogenesis requires the endoribonuclease Csy4, which binds and cleaves the repetitive sequence of the CRISPR transcript. Biochemical assays and three co-crystal structures of wild-type and mutant Csy4/RNA complexes reveal a substrate positioning and cleavage mechanism in which a histidine deprotonates the ribosyl 2?-hydroxyl pinned in place by a serine, leading to nucleophilic attack on the scissile phosphate. The active site catalytic dyad lacks a general acid to protonate the leaving group and positively charged residues to stabilize the transition state, explaining why the observed catalytic rate constant is ?104-fold slower than that of RNase A. We show that this RNA cleavage step is essential for assembly of the Csy protein-crRNA complex that facilitates target recognition. Considering that Csy4 recognizes a single cellular substrate and sequesters the cleavage product, evolutionary pressure has likely selected for substrate specificity and high-affinity crRNA interactions at the expense of rapid cleavage kinetics.

Haurwitz, Rachel E; Sternberg, Samuel H; Doudna, Jennifer A

2012-01-01

87

Let the force be with us: dyads exploit haptic coupling for coordination.  

PubMed

People often perform actions that involve a direct physical coupling with another person, such as when moving furniture together. Here, we examined how people successfully coordinate such actions with others. We tested the hypothesis that dyads amplify their forces to create haptic information to coordinate. Participants moved a pole (resembling a pendulum) back and forth between two targets at different amplitudes and frequencies. They did so by pulling on cords attached to the base of the pole, one on each side. In the individual condition, one participant performed this task bimanually, and in the joint condition two participants each controlled one cord. We measured the moment-to-moment pulling forces on each cord and the pole kinematics to determine how well individuals and dyads performed. Results indicated that dyads produced much more overlapping forces than individuals, especially for tasks with higher coordination requirements. Thus, the results suggest that dyads amplify their forces to generate a haptic information channel. This likely reflects a general coordination principle in haptic joint action, where force amplification allows dyads to perform at the same level as individuals. PMID:21417545

van der Wel, Robrecht P R D; Knoblich, Guenther; Sebanz, Natalie

2011-10-01

88

Epistasis between COMT and MTHFR in Maternal-Fetal Dyads Increases Risk for Preeclampsia  

PubMed Central

Preeclampsia is a leading cause of perinatal morbidity and mortality. This disorder is thought to be multifactorial in origin, with multiple genes, environmental and social factors, contributing to disease. One proposed mechanism is placental hypoxia-driven imbalances in angiogenic and anti-angiogenic factors, causing endothelial cell dysfunction. Catechol-O-methyltransferase (Comt)-deficient pregnant mice have a preeclampsia phenotype that is reversed by exogenous 2-methoxyestradiol (2-ME), an estrogen metabolite generated by COMT. 2-ME inhibits Hypoxia Inducible Factor 1?, a transcription factor mediating hypoxic responses. COMT has been shown to interact with methylenetetrahydrofolate reductase (MTHFR), which modulates the availability of S-adenosylmethionine (SAM), a COMT cofactor. Variations in MTHFR have been associated with preeclampsia. By accounting for allelic variation in both genes, the role of COMT has been clarified. COMT allelic variation is linked to enzyme activity and four single nucleotide polymorphisms (SNPs) (rs6269, rs4633, rs4680, and rs4818) form haplotypes that characterize COMT activity. We tested for association between COMT haplotypes and the MTHFR 677 C?T polymorphism and preeclampsia risk in 1103 Chilean maternal-fetal dyads. The maternal ACCG COMT haplotype was associated with reduced risk for preeclampsia (P?=?0.004), and that risk increased linearly from low to high activity haplotypes (P?=?0.003). In fetal samples, we found that the fetal ATCA COMT haplotype and the fetal MTHFR minor “T” allele interact to increase preeclampsia risk (p?=?0.022). We found a higher than expected number of patients with preeclampsia with both the fetal risk alleles alone (P?=?0.052) and the fetal risk alleles in combination with a maternal balancing allele (P<0.001). This non-random distribution was not observed in controls (P?=?0.341 and P?=?0.219, respectively). Our findings demonstrate a role for both maternal and fetal COMT in preeclampsia and highlight the importance of including allelic variation in MTHFR.

Hill, Lori D.; York, Timothy P.; Kusanovic, Juan P.; Gomez, Ricardo; Eaves, Lindon J.; Romero, Roberto; Strauss, Jerome F.

2011-01-01

89

Synthesis, conformational interconversion, and photophysics of tethered porphyrin-fullerene dyads with parachute topology.  

PubMed

The synthesis of a porphyrin-fullerene dyad with "parachute" topology is reported. To determine whether the dyad is "flexing" at room temperature, low-temperature NMR experiments were used. Computational modeling has shown the low-energy conformation of the dyad to be nonsymmetric. Although, (1)H NMR spectroscopy at room temperature is consistent with a molecule with C(2v) symmetry, the spectrum changes on lowering the temperature consistent with "windshield wiper"-like motion, in which the porphyrin moiety rotates from one side of the C(60) sphere to the other. Nanosecond and picosecond fluorescence lifetime experiments show two components contribute to the fluorescence decay, also consistent with the presence of more than one conformer. PMID:19569134

Fazio, Michael A; Durandin, Alexander; Tkachenko, Nikolai V; Niemi, Marja; Lemmetyinen, Helge; Schuster, David I

2009-08-01

90

Tridimensional acculturation and adaptation among Jamaican adolescent-mother dyads in the United States.  

PubMed

A bidimensional acculturation framework cannot account for multiple destination cultures within contemporary settlement societies. A tridimensional model is proposed and tested among Jamaican adolescent-mother dyads in the United States compared to Jamaican Islander, European American, African American, and other Black and non-Black U.S. immigrant dyads (473 dyads, M adolescent age?=?14?years). Jamaican immigrants evidence tridimensional acculturation, orienting toward Jamaican, African American, and European American cultures. Integration is favored (70%), particularly tricultural integration; moreover, Jamaican and other Black U.S. immigrants are more oriented toward African American than European American culture. Jamaican immigrant youth adapt at least as well as nonimmigrant peers in Jamaica and the United States. However, assimilated adolescents, particularly first generation immigrants, have worse sociocultural adaptation than integrated and separated adolescents. PMID:22966917

Ferguson, Gail M; Bornstein, Marc H; Pottinger, Audrey M

91

Squarylium-triazine dyad as a highly sensitive photoradical generator for red light.  

PubMed

New dyads, based on squarylium dye and substituted-triazine, were synthesized that exhibit an intramolecular photodissociative electron-transfer reaction. The compounds were used as a red-light photoradical generator. The photochemical activity of the dyad was compared to the corresponding unlinked systems (S+T) by determining the rate constant of electron transfer. The efficiency of the radical generation from the dyad compared to the unlinked system was demonstrated by measuring the maximum rate of free radical polymerization of acrylates in film. An excellent relationship between the rate of electron transfer and the rate of polymerization was found, evidencing the interest of this new approach to efficiently produce radicals under red light. PMID:23918594

Kawamura, Koichi; Schmitt, Julien; Barnet, Maxime; Salmi, Hanene; Ley, Christian; Allonas, Xavier

2013-08-05

92

Synthesis, crystal structure, and photodynamics of ?-expanded porphyrin-fullerene dyads synthesized by Diels-Alder reaction.  

PubMed

Free base and zinc porphyrins are linked with fullerene (C(60)) through ?,?'-pyrrolic positions rather than meso-positions by Diels-Alder reaction of monoanthraporphyrins (H(2)P-mA and ZnP-mA) and C(60) to afford a ?-expanded free base porphyrin-fullerene dyad (H(2)P-C(60)) and its zinc porphyrin-fullerene dyad (ZnP-C(60)) in 86 and 51% yield, respectively. The X-ray crystallographic analysis of ZnP-C(60) showed two comma-shaped swirls-like structure in a unit cell. The intramolecular center-to-center and edge-to-edge distances between the porphyrin and fullerene moieties were 11.5 and 2.5 Å, respectively. The porphyrins and fullerenes were packed in layer-by-layer structure and the porphyrins lied down in parallel. The intermolecular center-to-center distances between the neighboring fullerenes were 10.252, 10.028, and 10.129 Å, which were less than typical van der Waals distance and the ?-? interaction spread two-dimensionally. The energy of the charge-separated (CS) state of ZnP-C(60) (1.11 eV) determined by differential-pulse voltammetry measurements in benzonitrile is significantly lower than those of zinc porphyrin-C(60) dyads linked at meso positions because of the low oxidation potential of the ?-expanded ZnP moiety. The CS energy of ZnP-C(60) in a nonpolar solvent such as toluene (1.40 V) is lower than the triplet excited state of C(60) ((3)C(60)*), enabling us to attain a long lived triplet CS state (8.1 ?s) in toluene, detected by nanosecond laser flash photolysis experiments. The distance between unpaired electrons in the triplet CS state was determined by the EPR spectrum to be 9.1 Å, which agreed with the distance between a zinc atom of the porphyrin and a carbon edge of C(60) in the crystal structure of ZnP-C(60). The rate constants of photoinduced electron transfer and back electron transfer of H(2)P-C(60) and ZnP-C(60), which were determined by femtosecond and nanosecond laser flash photolysis measurements, were analyzed in light of the Marcus theory of electron transfer. PMID:20527754

Yamada, Hiroko; Ohkubo, Kei; Kuzuhara, Daiki; Takahashi, Tetsuro; Sandanayaka, Atula S D; Okujima, Tetsuo; Ohara, Keishi; Ito, Osamu; Uno, Hidemitsu; Ono, Noboru; Fukuzumi, Shunichi

2010-06-07

93

Synthesis of C 60-diphenylaminofluorene dyads with two-photon absorbing characteristics  

Microsoft Academic Search

Linear A-sp3-D molecular conjugates as 9,9-dialkyl-2-diphenylaminofluorene (DPAF-C,)-C60 monoadducts were demonstrated using methanoketo unit as a linker to bridge the DPAF donor moiety and the fullerene acceptor chromophore together within a short distance of roughly 2.0Å. Target products of C60-diphenylaminofluorene dyads C60(>DPAF-C2) and C60(>DPAF-C18) were synthesized using Bingel cycloproanation reaction from the corresponding 7-?-bromoacetyl-9,9-dialkyl-2-diphenylaminofluorene precursors. Both dyads C60(>DPAF-C2) and C60(>DPAF-C18) were

Prashant A. Padmawar; Taizoon Canteenwala; Sarika Verma; Loon-Seng Tan; Guang S. He; Paras N. Prasad; Long Y. Chiang

2005-01-01

94

High-resolution spectroscopy and analysis of the ?1/?3 stretching dyad of osmium tetroxide  

NASA Astrophysics Data System (ADS)

OsO4 is a heavy tetrahedral molecule that may constitute a benchmark for quantum chemistry calculations. Its favorable spin statistics (due to the zero nuclear spin of oxygen atoms) is such that only A1 and A2 rovibrational levels are allowed, leading to a dense, but quite easily resolved spectrum. Most lines are single ones, instead of complex line clusters as in the case of other heavy spherical-tops like SF6, for instance. It is thus possible to fully assign and fit the spectrum and to obtain precise experimental effective molecular parameters. The strong ?3 stretching fundamental has been studied a long time ago as an isolated band [McDowell RS, Radziemski LJ, Flicker H, Galbraith HW, Kennedy RC, Nereson NG, et al. Journal of Chemical Physics 1978;88:1513-21; Bobin B, Valentin A, Henry L. Journal of Molecular Spectroscopy 1987;122:229-41]. We reinvestigate here this region and perform new assignments and effective Hamiltonian parameter fits for the four main isotopologues (192OsO4, 190OsO4, 189OsO4, 188OsO4), by considering the ?1/?3 stretching dyad. A new experimental spectrum has been recorded at room temperature, thanks to a Bruker IFS 125 HR interferometer and using a natural abundance OsO4 sample. Assignments and analyses were performed thanks to the SPVIEW and XTDS softwares, respectively [Wenger Ch, Boudon V, Rotger M, Sanzharov M, Champion J-P. Journal of Molecular Spectroscopy 2008;251:102-13]. We provide precise effective Hamiltonian parameters, including band centers and Coriolis interaction parameters. We discuss isotopic shifts and estimate the band centers for the three minor isotopologues (187OsO4, 186OsO4, 184OsO4). The Q branches of the first two of them are clearly identified in the experimental spectrum.

Louviot, M.; Boudon, V.; Manceron, L.; Roy, P.; Balcon, D.

2012-01-01

95

Effects of Gender Role and Task Content on Performance in Same-Gender Dyads: Transactive Memory as a Potential Mediator  

ERIC Educational Resources Information Center

|This experiment was designed to examine the effects of gender role and task content on performance in learning dyads and to test the potential mediator effect of an intragroup process related to transactive memory. A total of 44 same-gender dyads participated in the study and were asked to collaborate on a stereotypically masculine or feminine…

Michinov, Estelle; Michinov, Nicolas; Huguet, Pascal

2009-01-01

96

Counselling Australian Baby Boomers: Examining the Loss and Grief Issues Facing Aging Distance-Separated Sibling Dyads  

ERIC Educational Resources Information Center

|It has long been recognised that mature-aged sibling dyads provide each other with emotional support. What has yet to be determined is whether this support function is maintained within the baby boomer generational cohort of sibling dyads who through economic relocation/migration have become separated by distance. As such, this paper highlights…

Taylor, Myra Frances; Clark, Nadia; Newton, Elaine

2008-01-01

97

Effects of Dyad Reading Instruction on the Reading Achievement of Hispanic Third-Grade English Language Learners  

ERIC Educational Resources Information Center

|This study investigated the effects of a cooperative peer-assisted reading strategy, dyad reading instruction, on the reading achievement of Hispanic third-grade English language learners (ELLs). Specifically, dyad reading is unison reading of a "lead reader," who reads well, and an "assisted reader," who does not read well, simultaneously…

Almaguer, Isela

2005-01-01

98

The effects of animations on verbal interaction in computer supported collaborative learning  

Microsoft Academic Search

This paper focuses on the interaction patterns of learners studying in pairs who were provided with multimedia learning material. In a previous article, we reported that learning scores were higher for dyads of an 'animations' condition than for dyads of a 'static pictures' condition. Results also showed that offering a persistent display of one snapshot of each animated sequence hindered

Mirweis Sangin; Pierre Dillenbourg; Cyril Rebetez; Mireille Bétrancourt; Gaëlle Molinari

2008-01-01

99

Infant Abuse, Neglect, and Failure-to-Thrive: Mother-Infant Interaction.  

ERIC Educational Resources Information Center

|This study was designed to investigate whether or not degree of child maltreatment is related in some meaningful way to the interactional characteristics of the mother/infant dyad and to the infant's developmental status. A group of 53 mother/infant dyads was divided into five diagnostic groups: nonaccidental trauma combined with…

Dietrich, Kim N.; And Others

100

Efficient sensitization of dye-sensitized solar cells by novel triazine-bridged porphyrin-porphyrin dyads.  

PubMed

Two novel porphyrin-porphyrin dyads, the symmetrical Zn[Porph]-Zn[Porph] (2) and unsymmetrical Zn[Porph]-H2[Porph] (4), where Zn[Porph] and H2[Porph] are the metalated and free-base forms of 5-(4-aminophenyl)-10,15,20-triphenylporphyrin, respectively, in which two porphyrin units are covalently bridged by 1,3,5-triazine, have been synthesized via the stepwise amination of cyanuric chloride. The dyads are also functionalized by a terminal carboxylic acid group of a glycine moiety attached to the triazine group. Photophysical measurements of 2 and 4 showed broaden and strengthened absorptions in their visible spectra, while electrochemistry experiments and density functional theory calculations revealed negligible interaction between the two porphyrin units in their ground states but appropriate frontier orbital energy levels for use in dye-sensitized solar cells (DSSCs). The 2- and 4-based solar cells have been fabricated and found to exhibit power conversion efficiencies (PCEs) of 3.61% and 4.46%, respectively (under an illumination intensity of 100 mW/cm(2) with TiO2 films of 10 ?m thickness). The higher PCE value of the 4-based DSSC, as revealed by photovoltaic measurements (J-V curves) and incident photon-to-current conversion efficiency (IPCE) spectra of the two cells, is attributed to its enhanced short-circuit current (Jsc) under illumination, high open-circuit voltage (Voc), and fill factor (FF) values. Electrochemical impedance spectra demonstrated shorter electron-transport time (?d), longer electron lifetime (?e), and high charge recombination resistance for the 4-based cell, as well as larger dye loading onto TiO2. PMID:23944691

Zervaki, Galateia E; Roy, Mahesh S; Panda, Manas K; Angaridis, Panagiotis A; Chrissos, Emmanouel; Sharma, Ganesh D; Coutsolelos, Athanassios G

2013-08-14

101

Dyadic interactions in accepted and rejected children  

Microsoft Academic Search

Forty same-sex dyads were separated into three groups (accepted, rejected, and mixed status) on the basis of their scores on the likability and rejection scales of the Pupil Evaluation Inventory [Pekarik, E.,et al. (1976).Journal of Abnormal Child Psychology, 4, 83–97]. These dyads participated in a 10-min videotaped interaction which was separated into three segments: waiting period, cooperative task, and conversational

Susan Phillips Keane; Anthony J. Conger; Joyce Vogel

1984-01-01

102

The Dialectic in Autonomy and Recognition: A View Into the Analytic Dyad  

Microsoft Academic Search

This article contextualizes autonomy and refines it as a dialectical, developmental experience with resulting paradoxes in the relational and the self psychological dyad. In approaching the analytic conversation, the finer nuances of the tension between attachment and autonomy are delineated. Aspects of narrative difference and opposition, as they emerge between the self and the other, are emphasized as they impact

Leslie Maxson

2008-01-01

103

Acceptability and Feasibility Results of a Strength-Based Skills Training Program for Dementia Caregiving Dyads  

ERIC Educational Resources Information Center

|Purpose: The current article provides an in-depth description of a dyadic intervention for individuals with dementia and their family caregivers. Using a strength-based approach, caregiving dyads received skills training across 5 key areas: (a) education regarding dementia and memory loss, (b) effective communication, (c) managing memory loss,…

Judge, Katherine S.; Yarry, Sarah J.; Orsulic-Jeras, Silvia

2010-01-01

104

Couple Coping and Adjustment to Multiple Sclerosis in Care Receiver-Carer Dyads.  

ERIC Educational Resources Information Center

|The utility of "coping congruency" and "average level of couple coping" in explaining adjustment to multiple sclerosis was examined. Interview and questionnaire data was collected for 45 dyads with a 12-month follow-up. Predictors include Time 1 illness, caregiving, and coping variables. Findings support both concepts for explaining collective…

Pakenham, Kenneth I.

1998-01-01

105

Males' and females' conversational behavior in cross-sex dyads: From gender differences to gender similarities  

Microsoft Academic Search

We investigated gender differences in conversational behavior in an experimental setting. Twenty men and 20 women were randomly paired in 20 dyads and were asked to discuss a given topic. We examined the transcripts through a varied range of behavioral variables. First we analyzed the sequential ordering of utterances in order to establish the way male and female speakers take

Agnesa Pillon; Catherine Degauquier; François Duquesne

1992-01-01

106

Capitalizing on Franchisee Autonomy: Relational Forms of Governance as Controls in Idiosyncratic Franchise Dyads &ast  

Microsoft Academic Search

Franchisee autonomy not only fosters system-wide adaptability and outlet owners' satisfaction but also raises the costs from agency problems present in franchisee–franchisor dyads. Advancing upon the understanding of agency issues involved in franchising, we test the argument that chains counterbalance the loss in control inherent to autonomy with relational governance mechanisms. The empirical results provided strong support for this presumption.

Olivier Cochet; Julian Dormann; Thomas Ehrmann

2008-01-01

107

Couple Coping and Adjustment to Multiple Sclerosis in Care Receiver-Carer Dyads.  

ERIC Educational Resources Information Center

The utility of "coping congruency" and "average level of couple coping" in explaining adjustment to multiple sclerosis was examined. Interview and questionnaire data was collected for 45 dyads with a 12-month follow-up. Predictors include Time 1 illness, caregiving, and coping variables. Findings support both concepts for explaining collective and…

Pakenham, Kenneth I.

1998-01-01

108

Investigation of an Activity-Based Text-Processing Strategy in Mixed-Age Child Dyads  

ERIC Educational Resources Information Center

|The authors examined an activity-based listening strategy with first- and third-grade children in mixed-grade dyads. On the basis of theories of cognitive development and previous research, the authors predicted the following: (a) children in an activity-based strategy would recall more story events compared with those in a repetition strategy…

Marley, Scott C.; Szabo, Zsuzsanna; Levin, Joel R.; Glenberg, Arthur M.

2011-01-01

109

Tridimensional Acculturation and Adaptation among Jamaican Adolescent-Mother Dyads in the United States  

ERIC Educational Resources Information Center

|A bidimensional acculturation framework cannot account for multiple destination cultures within contemporary settlement societies. A "tridimensional model" is proposed and tested among Jamaican adolescent-mother dyads in the United States compared to Jamaican Islander, European American, African American, and other Black and non-Black U.S.…

Ferguson, Gail M.; Bornstein, Marc H.; Pottinger, Audrey M.

2012-01-01

110

Intramolecular electron transfer in fullerene/ferrocene based donor-bridge-acceptor dyads  

SciTech Connect

A systematic steady-state fluorescence and time-resolved flash photolytic investigation of a series of covalently linked fullerene/ferrocene based donor-bridge-acceptor dyads is reported as a function of the nature of the spacer between the donor site (ferrocene) and acceptor site (fullerene) and the dielectric constant of the medium. The fluorescence of the investigated dyads 2, 3, 4, 5, and 6 in methylcyclohexane at 77 K were substantially quenched, relative to N-methylfulleropyrrolidine 1, indicating intramolecular quenching of the fullerene excited singlet state. Excitation of N-methylfulleropyrrolidine revealed the immediate formation of the excited singlet state, with {lambda}{sub max} around 886 nm. A rapid intersystem crossing ({tau}{sub 1/2} = 1.2 ps ) to the excited triplet state was observed with characteristic absorption around 705 nm. Picosecond resolved photolysis of dyads 2-6 in toluene showed light-induced formation of the excited singlet state which undergoes rapid intramolecular quenching. Nanosecond-resolved photolysis of dyads 3 and 4 in degassed benzonitrile revealed long-lived charge separated states with characteristic fullerene radical-anion bands at {lambda}{sub max} = 1055 nm. 30 refs., 5 figs., 3 tabs.

Guldi, D.M. [Univ. of Notre Dame, IN (United States); Maggini, M.; Scorrano, G. [Universita di Padova (Italy); Prato, M. [Universita di Trieste (Italy)

1997-02-05

111

Analysis of Cross-Sectional Univariate Measurements for Family Dyads Using Linear Mixed Modeling  

Microsoft Academic Search

Outcome measurements from members of the same family are likely correlated. Such intrafamilial correlation (IFC) is an important dimension of the family as a unit but is not always accounted for in analyses of family data. This article demonstrates the use of linear mixed modeling to account for IFC in the important special case of univariate measurements for family dyads

George J. Knafl; Jane K. Dixon; Jean P. OMalley; Margaret Grey; Janet A. Deatrick; Agatha M. Gallo; Kathleen A. Knafl

2009-01-01

112

Value creation architecture and engineering : A business model encompassing the firm-customer dyad  

Microsoft Academic Search

Purpose – The purpose of this paper is to develop a conceptual framework for a value creation business (VCB) model. It seeks to unlock two essential research questions: “what constitutes value”, and “how do firms create value for customers?” in the context of the firm-customer dyad. Design\\/methodology\\/approach – The paper is conceptual and is premised on a review of the

Liem Viet Ngo; Aron OCass

2010-01-01

113

[Influence of ferulic acid on the pain-depression dyad induced by reserpine].  

PubMed

This study is to offer a clinical pain-depression dyad therapy of ferulic acid, the pain-depression dyad induced by reserpine was established and the dose-effect relationship of ferulic acid on ameliorating pain-depression dyad was explored. Mice were randomly divided into control group, reserpine + vechile and reserpine + ferulic acid (5, 10, 20, 40 and 80 mg x kg(-1)) groups. The reserpine treated mice were tested with thermal hyperalgesia, mechanicial allodynia and forced swimming tests, and the SOD and NO levels of hippocampus and frontal cortex were measured. Moreover, the HPLC-ECD was used to detect the changes of central monoamines concentrations. Compared with control group, reserpine can induce a significant decrease in the nociceptive threshold and increase in the immobility time of the forced swimming test. The results suggested that reserpine significantly increased the level of nitrite in hippocampus and frontal cortex and reduced the levels of SOD, 5-HT and NE in these two brain regions. However, these indexes can be a dose-dependently reversed by ferulic acid (5, 10, 20, 40 and 80 mg x kg(-1)). Ferulic acid can reverse pain-depression dyad, especially at the dose of 80 mg x kg(-1). In addition, it can influence oxidative stress and monoamine level. PMID:23600138

Zhang, Lu; Wang, Qian-Dong; Shi, Hua-Meng; Pan, Jian-Chun

2013-01-01

114

Multi-electron-acceptor dyad and triad systems based on perylene bisimides and fullerenes.  

PubMed

Fullerene (C(60)) and 3,4,9,10-perylene tetracarboxylic diimide (PTDCI) were used as building blocks for an electron acceptor dyad (C(60)-PTCDI) and triad (C(60)-PTCDI-C(60)). As the first reduction potentials for C(60) and PTCDI are very close, simultaneous introduction of two or three electrons is possible into the dyad and triad, respectively. Further stepwise electrochemical reduction leads to formation of a series of well-defined anionic species in which electrons associated with the fullerene or the PTDCI components of the molecule can be clearly distinguished. In total, up to four electrons can be reversibly injected into the dyad C(60)-PTCDI and up to six into the triad C(60)-PTCDI-C(60) system. The optical absorption properties in the UV/Vis range are also crucially defined by the distribution of electrons between the acceptor parts, as the injection/removal of electrons causes drastic colour changes in the dyad and the triad systems. PMID:21365704

Chamberlain, Thomas W; Davies, E Stephen; Khlobystov, Andrei N; Champness, Neil R

2011-03-01

115

An overview of the dog–human dyad and ethograms within it  

Microsoft Academic Search

This article reviews the literature on the complex and variable nature of the dog–human dyad and describes the influence of terms such as dominance on attitudes that humans have toward dogs. It highlights a legacy of tension between ethology and psychology and notes that some practitioners have skills with dogs that elude the best learning theorists. Despite the widespread appeal

Paul D. McGreevy; Melissa Starling; Nick J. Branson; Mia L. Cobb; Debbie Calnon

116

Tridimensional Acculturation and Adaptation among Jamaican Adolescent-Mother Dyads in the United States  

ERIC Educational Resources Information Center

A bidimensional acculturation framework cannot account for multiple destination cultures within contemporary settlement societies. A "tridimensional model" is proposed and tested among Jamaican adolescent-mother dyads in the United States compared to Jamaican Islander, European American, African American, and other Black and non-Black U.S.…

Ferguson, Gail M.; Bornstein, Marc H.; Pottinger, Audrey M.

2012-01-01

117

Counseling Supervisors' Assessment of Race, Racial Identity, and Working Alliance in Supervisory Dyads  

ERIC Educational Resources Information Center

|The authors investigated the role of race, racial identity attitudes and working alliance in counseling supervision using data obtained from supervisors in supervisory dyads. Results revealed the strongest working alliance for supervisor-supervisee pairs with high racial identity development and the weakest working alliance for pairs with low…

Bhat, Christine Suniti; Davis, Thomas E.

2007-01-01

118

Let the Force Be with Us: Dyads Exploit Haptic Coupling for Coordination  

ERIC Educational Resources Information Center

People often perform actions that involve a direct physical coupling with another person, such as when moving furniture together. Here, we examined how people successfully coordinate such actions with others. We tested the hypothesis that dyads amplify their forces to create haptic information to coordinate. Participants moved a pole (resembling a…

van der Wel, Robrecht P. R. D.; Knoblich, Guenther; Sebanz, Natalie

2011-01-01

119

Rough-and-Tumble Play and the Regulation of Aggression: An Observational Study of Father-Child Play Dyads  

PubMed Central

Rough-and-tumble play (RTP) is a common form of play between fathers and children. It has been suggested that RTP can contribute to the development of selfregulation. This study addressed the hypothesis that the frequency of father–child RTP is related to the frequency of physically aggressive behavior in early childhood. This relationship was expected to be moderated by the dominance relationship between father and son during play. Eighty-five children between the ages of 2 and 6 years were videotaped during a free-play session with their fathers in their homes and questionnaire data was collected about father–child RTP frequency during the past year. The play dyads were rated for the degree to which the father dominated play interactions. A significant statistical interaction revealed that RTP frequency was associated with higher levels of physical aggression in children whose fathers were less dominant. These results indicate that RTP is indeed related to physical aggression, though this relationship is moderated by the degree to which the father is a dominant playmate.

Flanders, Joseph L.; Leo, Vanessa; Paquette, Daniel; Pihl, Robert O.; Seguin, Jean R.

2012-01-01

120

Empathy, diversity, and telepathy in mother-daughter dyads: an empirical investigation utilizing Rogers' conceptual framework.  

PubMed

The purpose of this study was to examine empathy, diversity, and telepathy in natural mother-daughter dyads. The investigation was conceptualized and conducted according to the concepts and principles of the Rogerian Science of Unitary Human Beings. The sample for this descriptive study consisted of 180 volunteer mother-daughter dyads; the mother served as the receiver and the child as sender of telepathic messages. Empathy and diversity were expected to be related to telepathy levels. Results indicated that one form of empathy (personal distress) and diversity were significantly (p less than .05) related to telepathy. When the components of the diversity score were further examined, only those subjects who were moderately differentiated and mobile demonstrated significant telepathy scores. Multiple regression analysis showed that 6% of the variance in telepathy was accounted for by diversity and empathy. Findings added to what is known about living systems that manifest negentrophy and evolve toward increasing diversity. PMID:2772449

Sanchez, R

1989-01-01

121

The sense of agency during skill learning in individuals and dyads.  

PubMed

The sense of agency has received much attention in the context of individual action but not in the context of joint action. We investigated how the sense of agency developed during individual and dyadic performance while people learned a haptic coordination task. The sense of agency increased with better performance in all groups. Individuals and dyads showed a differential sense of agency after initial task learning, with dyads showing a minimal increase. The sense of agency depended on the context in which the task was first learnt, as transfer from joint to individual performance resulted in an illusory boost in the sense of agency. Whereas the quality of performance related to the sense of agency, the generated forces to achieve the task did not. Our findings are consistent with a predictive model account at the perceptual level, such that the sense of agency relies most strongly on sharable perceptual information. PMID:22541646

van der Wel, Robrecht P R D; Sebanz, Natalie; Knoblich, Guenther

2012-04-25

122

Analysis of Cross-Sectional Univariate Measurements for Family Dyads Using Linear Mixed Modeling  

PubMed Central

Outcome measurements from members of the same family are likely correlated. Such intrafamilial correlation (IFC) is an important dimension of the family as a unit but is not always accounted for in analyses of family data. This article demonstrates the use of linear mixed modeling to account for IFC in the important special case of univariate measurements for family dyads collected at a single point in time. Example analyses of data from partnered parents having a child with a chronic condition on their child's adaptation to the condition and on the family's general functioning and management of the condition are provided. Analyses of this kind are reasonably straightforward to generate with popular statistical tools. Thus, it is recommended that IFC be reported as standard practice reflecting the fact that a family dyad is more than just the aggregate of two individuals. Moreover, not accounting for IFC can affect the conclusions.

Knafl, George J.; Dixon, Jane K.; O'Malley, Jean P.; Grey, Margaret; Deatrick, Janet A.; Gallo, Agatha M.; Knafl, Kathleen A.

2010-01-01

123

Origins and consequences of tripartite efficacy beliefs within elite athlete dyads.  

PubMed

Drawing from Lent and Lopez's (2002) "tripartite" model of relational efficacy, the overall purpose of this study was to examine antecedents and consequences of self-efficacy, other-efficacy, and relation-inferred self-efficacy (RISE) within six international-level athlete dyads. Semistructured interviews were conducted and data were content analyzed using deductive and inductive procedures. Sources of efficacy emerged in relation to perceptions regarding (i) oneself, (ii) one's partner, (iii) the dyad/relationship, and (iv) external factors. Results also revealed the emergence of a number of salient intrapersonal and interpersonal outcomes, incorporating cognitive, affective, as well as behavioral consequences. Implications for theory development and future research are considered, and applied propositions are discussed with regard to effective relationship management in elite sport. PMID:18971510

Jackson, Ben; Knapp, Peter; Beauchamp, Mark R

2008-10-01

124

Personality traits and relationship perceptions in coach–athlete dyads: Do opposites really attract?  

Microsoft Academic Search

ObjectivesThe resurgence in mainstream personality research over recent decades has provided substantive insight into the way in which dyad members’ traits shape their relational experiences. Surprisingly, researchers are yet to examine these issues within coach–athlete contexts, and the present study sought to explore how Big Five traits predicted relationship commitment and relatedness (i.e., closeness, trust) for members of established coach–athlete

Ben Jackson; James A. Dimmock; Daniel F. Gucciardi; J. Robert Grove

2011-01-01

125

A Framework for Incorporating Dyads in Models of HIV-Prevention  

Microsoft Academic Search

Although HIV is contracted by individuals, it is typically transmitted in dyads. Most efforts to promote safer sex practices,\\u000a however, focus exclusively on individuals. The goal of this paper is to provide a theoretical framework that specifies how\\u000a models of dyadic processes and relationships can inform models of HIV-prevention. At the center of the framework is the proposition\\u000a that safer

Benjamin R. Karney; Hyman Hops; Colleen A. Redding; Harry T. Reis; Alexander J. Rothman; Jeffry A. Simpson

2010-01-01

126

Adrenocortical attunement in mother–child dyads: Importance of situational and behavioral characteristics  

Microsoft Academic Search

Synchronization of behavior, emotions and autonomic physiology in mother–child dyads is related to adaptive functioning in children. It is important to explore the possibility of “attunement”, or systematic synchronization, of the hypothalamic-pituitary-adrenal (HPA) axis because it is sensitive to social information processing at an unconscious level. Due to limited research in humans, the present study aimed to demonstrate mother–child cortisol

Paula L. Ruttle; Lisa A. Serbin; Dale M. Stack; Alex E. Schwartzman; Elizabeth A. Shirtcliff

2011-01-01

127

Nondestructive photoluminescence read-out by intramolecular electron transfer in a perylene bisimide-diarylethene dyad.  

PubMed

A novel, highly stable photochromic dyad 3 based on a perylene bisimide (PBI) fluorophore and a diarylethene (DAE) photochrome was synthesized and the optical and photophysical properties of this dyad were studied in detail by steady-state and time-resolved ultrafast spectroscopy. This photochromic dyad can be switched reversibly by UV-light irradiation of its ring-open form 3 o leading to the ring-closed form 3 c, and back reaction of 3 c to 3 o by irradiation with visible light. Solvent-dependent fluorescence studies revealed that the emission of ring-closed form 3 c is drastically quenched in solvents of medium (e.g., chloroform) to high (e.g., acetone) polarities, while the emission of the ring-open form 3 o is appreciably quenched only in highly polar solvents like DMF. The strong fluorescence quenching of 3 c is attributed to a photoinduced electron-transfer (PET) process from the excited PBI unit to ring-closed DAE moiety, as this process is thermodynamically highly favorable with a Gibbs free energy value of -0.34 eV in dichloromethane. The electron-transfer mechanism for the fluorescence quenching of ring-closed 3 c is substantiated by ultrafast transient measurements in dichloromethane and acetone, revealing stabilization of charge-separated states of 3 c in these solvents. Our results reported here show that the new photochromic dyad 3 has potential for nondestructive read-out in write/read/erase fluorescent memory systems. PMID:22969018

Berberich, Martin; Natali, Mirco; Spenst, Peter; Chiorboli, Claudio; Scandola, Franco; Würthner, Frank

2012-09-11

128

A comparison of primiparous and multiparous mother-infant dyads in Macaca mulatta  

Microsoft Academic Search

The relationships of 42 rhesus monkey mother-infant dyads were examined to investigate the effects of the mothers' parity.\\u000a Primiparous mothers were found to be younger, more excitable and less confident than the multiparous mothers. They also received\\u000a more aggression from other adult females living in their social group and were more anxious about their infants, approaching\\u000a and leaving them more

Jill M. Holley; Michael J. A. Simpson

1981-01-01

129

Investigation of an Activity-Based Text-Processing Strategy in Mixed-Age Child Dyads  

Microsoft Academic Search

The authors examined an activity-based listening strategy with first- and third-grade children in mixed-grade dyads. On the basis of theories of cognitive development and previous research, the authors predicted the following: (a) children in an activity-based strategy would recall more story events compared with those in a repetition strategy and (b) children who performed activity would recall more events compared

Scott C. Marley; Zsuzsanna Szabo; Joel R. Levin; Arthur M. Glenberg

2011-01-01

130

Some aspects of the interpersonal phenomenology of heterosexual dyads with respect to sex-role stereotypes  

Microsoft Academic Search

A technique based upon recently developed Boolean calculi for interpersonal phenomenology was used to study sex-role attributions within 59 heterosexual dyads. The interpersonal and intrapersonal variables studied include perceived similarity, validation of self-concept, expectations of agreement, feelings of being understood, predictions that the partner expects agreement, understanding, accurate perception of understanding\\/misunderstanding, and accurate perception of expectations on agreement\\/disagreement. All variables

Burton L. Alperson; Will J. Friedman

1983-01-01

131

The Early Stages of the Transition to Adulthood: Similarities and Differences between Mother-Daughter and Mother-Son Dyads  

Microsoft Academic Search

The action-project method was used to explore similarities and differences in the goals and activities of mothers and sons, and mothers and daughters, working together to facilitate a successful future transition to adulthood. Participants were 10 mother?daughter dyads and 8 mother-son dyads, with a range of ethnicities and income levels. Data included video-recordings of conversations, transcripts of interviews, and self-report

José F. Domene; Krista D. Socholotiuk; Richard A. Young

2011-01-01

132

Photoinduced electron transfer in supramolecular donor-acceptor dyads of Zn corrphycene.  

PubMed

Porphyrins have been used by various researchers as important building blocks of photofunctional molecules, while the number of studies on the excitation properties of the structural isomers of porphyrins is small when compared to those of porphyrins. In the present study, photoinduced electron transfer (ET) processes of supramolecular donor-acceptor dyads of 2,3,6,7,11,12,17,18-octaethylcorrphycenatozinc (ZnCn), one of the porphyrin isomers, and some imide compounds, which can coordinate to the central Zn ion as an electron acceptor, were investigated. Formation of the supramolecular donor-acceptor dyads was confirmed by steady state absorption change. Charge separation and charge recombination processes upon photoexcitation of ZnCn of the supramolecular dyads were successfully observed by subpicosecond laser flash photolysis. The estimated ET rates (kET) were compared with those of other porphyrin isomers. Differences in the driving force dependence of kET values of porphyrin isomers were attributed to the electronic coupling and internal reorganization energy. Electronic and structural factors, which brought about the difference in kET values, were reasonably explained on the basis of the theoretical calculation. PMID:23474749

Fujitsuka, Mamoru; Shimakoshi, Hisashi; Tei, Yui; Noda, Kazumasa; Tojo, Sachiko; Hisaeda, Yoshio; Majima, Tetsuro

2013-04-21

133

Acceptability and Feasibility Results of a Strength-Based Skills Training Program for Dementia Caregiving Dyads  

PubMed Central

Purpose:?The current article provides an in-depth description of a dyadic intervention for individuals with dementia and their family caregivers. Using a strength-based approach, caregiving dyads received skills training across 5 key areas: (a) education regarding dementia and memory loss, (b) effective communication, (c) managing memory loss, (d) staying active, and (e) recognizing emotions and behaviors. Results of the acceptability and feasibility of the intervention protocols are also presented.?Design and Methods:?Caregiving dyads were randomly assigned to participate in the intervention. Participants in the treatment condition were asked to complete a series of evaluation questions after each intervention session and an overall evaluation of the program. Data were also collected from the intervention specialists who implemented the protocols.?Results:?Overall, the evaluation data indicated that the content and process of the intervention were viewed as highly acceptable and feasible by both participants and intervention specialists.?Implications:?This article highlights the merit of using a strength-based approach for working with caregiving dyads with dementia and how a single intervention protocol can be used to address the goals of both care partners. Furthermore, the intervention program was found to be highly acceptable and feasible, which is an important aspect of developing dyadic protocols.

Judge, Katherine S.; Yarry, Sarah J.; Orsulic-Jeras, Silvia

2010-01-01

134

Space-time coordination dynamics in basketball: Part 1. Intra- and inter-couplings among player dyads.  

PubMed

We examined space-time patterns of basketball players during competition by analysing movement data obtained from six game sequences. Strong in-phase relations in the longitudinal (basket-to-basket) direction were observed for all playing dyads, especially player-opponent dyads matched for playing position, indicating that these movements were very constrained by the game demands. Similar findings for in-phase relations were observed for the most part in the lateral direction, the main exception being dyads comprising the two wing players from the same team. These dyads instead demonstrated strong attractions to anti-phase, a consequence perhaps of seeking to increase and decrease team width in tandem. Single instances from select dyads and game sequences demonstrated further evidence of phase stabilities and phase transitions on some occasions. Together, these findings demonstrate that space-time movement patterns of playing dyads in basketball, while unique, nonetheless conform to a uniform description in keeping with universal principles of dynamical self-organizing systems as hypothesized. PMID:20131146

Bourbousson, Jérôme; Sève, Carole; McGarry, Tim

2010-02-01

135

Superexchange-mediated electronic energy transfer in a model dyad.  

PubMed

On the basis of time-dependent density functional theory (TD-DFT) calculations coupled to the polarizable continuum model (PCM) and single molecule spectroscopic studies, we provide a detailed investigation of excitation energy transfer within a model bi-chromophoric system where a perylene monoimide (PMI) donor is bridged to a terrylene diimide (TDI) acceptor through a ladder-type pentaphenylene (pPh) spacer. We find that the electronic excitation on the PMI donor significantly extends over the bridge giving rise to a partial charge transfer character and inducing a approximately 3-fold increase in the electronic interaction between the chromophores, which explains the failure of the Förster model in reproducing the observed energy migration rates when treating PMI as the donor. However, despite an increased charge transfer contribution in the effective donor state, the increase in solvent polarity is not accompanied by an enhancement in the electronic coupling between the subunits, which is rationalized from a detailed analysis of the excited-state wavefunctions. PMID:20544101

Curutchet, Carles; Feist, Florian A; Van Averbeke, Bernard; Mennucci, Benedetta; Jacob, Josemon; Müllen, Klaus; Basché, Thomas; Beljonne, David

2010-06-12

136

Supramolecular BODIPY-Zn(II)-bisporphyrin dyad and trinitrofluorenone encapsulated triad as models of antenna-reaction center: synthesis, structure and photophysical properties.  

PubMed

We describe the synthesis, characterization and photophysical properties of the dyads Zn2DEP·TNF (1) and Zn2DEP·2Py-BDP (2) and triad Zn2DEP·2Py-BDP·TNF (3), which enable us to investigate the changes in the spectroscopic properties upon the axial coordination of pyridine substituted bodipy (Py-BDP) to Zn2DEP in the dyads and the further encapsulation of TNF in the triad. Zn2DEP·TNF (1) is structurally characterized while the other compounds, Py-BDP, 2 and 3, are geometrically optimized using DFT in the absence of X-ray crystallography. It has been found that the encapsulated TNF guest within the bisporphyrin cavity is involved in strong ?-? interactions with the host resulting in robust host-guest assemblies that also retain the structural integrity in solution for a long time. The association constants, K, between the host and guests are calculated at 298 K by measuring the change in the fluorescence emission in solution and are found to be 1.0 × 10(7) M(-2) for the 1?:?2 binding in 2 and 1.2 × 10(3) M(-1) for the 1?:?1 binding in 3. The solution (1)H NMR spectrum of the supramolecular dyad 2 shows an upfield shift of the Py-BDP protons due to the strong ring current of the porphyrin rings. Similarly, upon the encapsulation of TNF in triad 3, the guest protons undergo an upfield shift owing to the ring current effect. Electrochemical studies of dyad 2 indicate that the Py-BDP and Zn-bisporphyrin subunits in the dyads interact very weakly. The negative and positive shifts of the reduction and oxidation potentials indicate that it is difficult to reduce/oxidize the encapsulated complex 3. The steady state emission spectrum shows that the fluorescence intensity of the axially coordinated Py-BDP in 2 (excited at 500 nm) is remarkably quenched in comparison to free Py-BDP due to efficient photoinduced intramolecular singlet-to-singlet energy transfer from the excited state of Py-BDP to the zinc-bisporphyrin in 2. The remarkable quenching of the fluorescence intensity of Py-BDP upon excitation at 500 nm in 3 is due to photoinduced electron transfer from the excited states of Py-BDP to TNF, which is also thermodynamically favorable. The location of the electron densities on the HOMO and LUMO further support the formation of a charge-separated state in which the zinc-bisporphyrin acts as an electron donor whilst TNF acts as an electron acceptor in the supramolecular triad 3. The electrochemically evaluated HOMO-LUMO gap also maintains a good agreement with the computed HOMO-LUMO gap. PMID:23860746

Mondal, Pritam; Chaudhary, Arvind; Rath, Sankar Prasad

2013-07-16

137

Effects of preinteraction expectancies on interaction involvement and behavioral responses in initial interaction  

Microsoft Academic Search

The link between preinteraction expectancies and the structure of interaction was examined in initial interaction. Unacquainted dyads were taped having a five minute interaction in which they talked about anything they desired. A 3 × 2 × 5 between-within subjects design was used to determine the impact of preinteraction expectancies on conversational behaviors reflecting friendliness and affiliation. The first between-factor

James M. Honeycutt

1989-01-01

138

A new tetrathiafulvalene–perylene diimide dyad with a pentaoxa-heptadecane chain as the spacer: metal-ions-induced aggregation  

Microsoft Academic Search

A new TTF–perylene diimide dyad 1 with a pentaoxa-heptadecane chain as the spacer was synthesized and characterized. Absorption and fluorescent spectral studies of dyad 1 and reference compounds 2 and 3 indicate that aggregation of dyad 1 and compound 2 occurs in the presence of metal ions. Such metal-ions-induced aggregation is likely due to the synergic action of the coordination

Xiaoping Zheng; Deqing Zhang; Daoben Zhu

2006-01-01

139

[Multidisciplinary care during peripartum: mother-baby dyad in the center of the relational constellations].  

PubMed

Pregnancy and new motherhood may be crisis and vulnerability periods and therefore increase the risk of psychiatric disorders. Liaison psychiatry plays a major role in the first psychiatric evaluation of mothers in order to specify a diagnosis and to initiate a treatment when necessary. This article describes the care of mothers suffering from peripartum psychiatric disorders by the liaison psychiatry in the maternity ward, an outpatient practice, as well as an in-patient care unit where mother and baby can stay together. The multidisciplinary approach and its constellation around the mother-baby dyad are detailed and two clinical cases are reported. PMID:23477067

Girard, E; Ortiz, N; Alberque, C; Almeida Heymans, A; Epiney, M; Canuto, A; Weber, K

2013-02-13

140

Synthesis and characterization of a novel [60]fullerene-tetrathiafulvalene dyad  

Microsoft Academic Search

A novel [60]fullerene-tetrathiafulvalene dyad (4) was prepared by Bingel reaction of C60 and 2,3-bis{[(methoxycarbonyl)acetoxy]ethylthio}-6,7-bis(hexadecylthio)tetrathiafulvalene (3) in the presence of iodine and diazabicyclo[5.4.0]undec-7-ene, and characterized by spectroscopy and electrochemical study. It was found that the paramagnetic signals (g=2.0027, line width 0.1540mT) were shown in the EPR spectrum of the derivative at room temperature without photoinduction, indicating efficient intramolecular electron transfer between

Pengju Zeng; Yunqi Liu; Deqing Zhang; Chunhe Yang; Yongfang Li; Daoben Zhu

2000-01-01

141

Effect of halide binding on intramolecular exciplex of double-linked zinc porphyrin-fullerene dyad  

NASA Astrophysics Data System (ADS)

The effect of chloride or bromide ion coordination to a doubly-linked zinc porphyrin-fullerene dyad was studied by quantitative analysis of the absorption band in the red and near infrared spectral range. The absorption band in question corresponds to the direct excitation to the intramolecular exciplex and it can be analyzed using the semi-quantum charge transfer theory. Compared to the nonligated compounds the energy of the exciplex decreased by ˜0.3 eV and the oscillator strength of the transition increased by ˜15-20%. This is explained by the effect of the electric field created by the negative charge of the halide.

Al-Subi, Ali H.; Niemi, Marja; Ranta, Jenni; Tkachenko, Nikolai V.; Lemmetyinen, Helge

2012-04-01

142

Marital Dyads  

Microsoft Academic Search

\\u000a Marriage in the United States is very clearly in a state of dynamic evolution, reflecting dramatically shifting social values\\u000a and norms. Since the publication of the last edition of this book, the institution of marriage has continued to experience\\u000a seismic change; perhaps most notably the legalization is some states of gay marriage (and heated legislative battles in many\\u000a others). Contemporary

William Fals-Stewart; Wendy K. K. Lam; Michelle L. Kelley

143

Curcumin ameliorates reserpine-induced pain-depression dyad: behavioural, biochemical, neurochemical and molecular evidences.  

PubMed

An apparent clinical relationship between pain and depression has long been recognized. Depression and pain are often diagnosed in the same patients. The emerging concept for pain-depression pathogenesis is the dysfunction of biogenic amine-mediated pain-depression control and the possible involvement of nitrodative stress-induced neurogenic inflammation. The present study was designed to investigate the effect of curcumin on reserpine-induced pain-depression dyad in rats. Administration of reserpine (1mg/kg subcutaneous daily for three consecutive days) led to a significant decrease in nociceptive threshold as evident from reduced paw withdrawal threshold in Randall Sellitto and von-Frey hair test as well as significant increase in immobility time in forced swim test. This behavioural deficit was integrated with decrease in the biogenic amine (dopamine, norepinephrine and serotonin) levels along with increased substance P concentration, nitrodative stress, inflammatory cytokines, NF-?? and caspase-3 levels in different brain regions (cortex and hippocampus) of the reserpinised rats. Curcumin (100, 200, 300mg/kg; ip) dose dependently ameliorated the behavioural deficits associated with pain and depression by restoring behavioural, biochemical, neurochemical and molecular alterations against reserpine-induced pain-depression dyad in rats. PMID:21612876

Arora, V; Kuhad, A; Tiwari, V; Chopra, K

2011-05-25

144

Dyads of father and son suicide separated by time and circumstances.  

PubMed

We encountered 2 dyadic suicides among fathers and sons. In the first dyad, the father was a 64-year-old man with complications of heart surgery. He committed suicide with a shotgun. The decedent's son was a 38-year-old man. Five years after his father's death, the son had an argument with his wife. That morning, he drove to the house where his father had lived and inflicted a handgun wound to his head. In the second dyad, the son was a 22-year-old man whose girlfriend left him. He inflicted a shotgun injury to the head. His blood alcohol level was 294 mg/dL. The father of this decedent was a 43-year-old man who 1 year later was despondent after a fight with his girlfriend. He was found dead at home with a single handgun wound to the chest. His blood alcohol level was 173 mg/dL. All 4 suicides appear to have been premeditated and all 4 men used guns. Suicide in a family tends to cause depression and complicate bereavement in survivors more than other types of death. Copycat suicide is well-documented in high-profile cases. The effect of father-son relationships is likely closer and more influential than celebrity suicides. PMID:19935393

Carson, Henry J

2010-03-01

145

Absorption and emission spectroscopic characterisation of a pyrene-flavin dyad  

NASA Astrophysics Data System (ADS)

The pyrene-flavin (isoalloxazine) dyad, PFD {C44H31N5O5; CA Index name: 1-pyrenepropanoic acid, ?-[[4,10-dihydro-2,4-dioxo-10-phenylbenzo[g]pteridin-3(2H)-yl)acetyl]amino]-, phenylmethyl ester, (?R) (9Cl); CA Registry number: 618907-57-6}, dissolved in either dichloromethane or acetonitrile is characterized by absorption and emission spectroscopy. Absorption cross-section spectra, stimulated emission cross-section spectra, fluorescence quantum distributions, quantum yields, and degrees of fluorescence polarisation are determined. The fluorescence decay after femtosecond pulse excitation is determined by fluorescence up-conversion. The ground-state absorption recovery is determined by picosecond pump and probe transmission measurements. The dye photo-stability is investigated by observation of absorption spectral changes due to prolonged blue-light excitation. The absorption spectrum of PFD dyad resembles the superposition of the absorption of isoalloxazine (flavin) and 1-methylpyrene. Long-wavelength photo-excitation of the flavin moiety causes fluorescence quenching by ground-state electron transfer from pyrene to isoalloxazine. Short-wavelength photo-excitation of the pyrene moiety causes (i) excited-state electron transfer from pyrene to isoalloxazine, and (ii) Förster-type energy transfer from pyrene to flavin followed by ground-state electron transfer from pyrene to flavin.

Shirdel, J.; Penzkofer, A.; Procházka, R.; Shen, Z.; Strauss, J.; Daub, J.

2007-01-01

146

Ultrafast excited-state dynamics of strongly coupled porphyrin/core-substituted-naphthalenediimide dyads.  

PubMed

The photophysics and excited-state dynamics of two dyads consisting of either a free-base or a zinc-tetraphenylporphyrin linked through a rigid bridge to a core-substituted naphthalenediimide (NDI) have been investigated by femtosecond-resolved spectroscopy. The absorption and fluorescence spectra differ substantially from those of the individual units, pointing to a substantial coupling and to a delocalisation of the excitation over the whole molecule, as confirmed by quantum chemistry calculations. A strong dependence of their excited-state dynamics on the solvent polarity has been observed. In toluene, the fluorescence quantum yield of the dyads is of the order of a few percent and the main decay channel of the emitting state is proposed as intersystem-crossing to the triplet state. However, in a medium polarity solvent like dichloromethane, the emitting state undergoes charge separation from the porphyrin to the NDI unit within 1-3 ps, and the ensuing charge-separated state recombines in about 10-20 ps. This solvent dependence can be explained by the weak driving force for charge separation in polar solvents and the large electronic coupling between the porphyrin and NDI moieties, making charge separation a solvent-controlled adiabatic process. PMID:21063622

Banerji, Natalie; Bhosale, Sheshanath V; Petkova, Irina; Langford, Steven J; Vauthey, Eric

2010-11-10

147

Saturation Spectrum of the nu2/nu4 Dyad of AsH3  

PubMed

The nu2/nu4 dyad of arsine, AsH3, has been investigated between 875 and 1100 cm-1 by laser sideband spectroscopy. In total 189 transitions have been observed with sub-Doppler resolution ( approximately 300 kHz) and measured to an absolute accuracy of about 100 kHz. These data may be useful to serve as a secondary frequency standard. Our observations include four perturbation-allowed transitions with Delta(k - l) = 3. Saturation spectra of dipole forbidden transitions had not been previously reported for arsine. Quadrupole hyperfine structure, as well as vibration-rotation splitting of |k - l| = 3N levels in both fundamentals, has been analyzed. Combining our results with MW and RF data (239 frequencies) reported in the literature, a total of 882 transition frequencies were available to fit 15 ground state parameters and 48 excited state parameters of the nu2/nu4 dyad. The standard deviation of the fit is 245 kHz. Copyright 1998 Academic Press. Copyright 1998Academic Press PMID:9473432

Spiegl; Kreiner

1998-02-01

148

Enhanced photocatalytic degradation of methylene blue under visible irradiation on graphene@TiO 2 dyade structure  

Microsoft Academic Search

Electron–hole recombination limits the efficiency of TiO2. We have investigated the efficacy with which the graphene@TiO2 “dyade”-like structure reduced charge recombination and enhanced reactivity. A visible-light photocatalysis of graphene@TiO2 “dyade”-like structure was synthesized, and photocatalytic degradation of organic compounds over the UV and visible-light spectrum regions was investigated. The graphene@TiO2 had anatase phase and was able to absorb a high

Donglin Zhao; Guodong Sheng; Changlun Chen; Xiangke Wang

149

Visible light-harvesting perylenebisimide-fullerene (C60) dyads with bidirectional "ping-pong" energy transfer as triplet photosensitizers for photooxidation of 1,5-dihydroxynaphthalene.  

PubMed

Visible light-harvesting perylenebisimide (PBI)-C(60) dyads were prepared as organic triplet photosensitizers for photooxidation of 1,5-dihydroxynaphthalene and the efficiency of the dyads is 6-fold of the conventional Ir(III) complex triplet photosensitizer. PMID:22398407

Liu, Yifan; Zhao, Jianzhang

2012-03-08

150

His ... Asp catalytic dyad of ribonuclease A: histidine pKa values in the wild-type, D121N, and D121A enzymes.  

PubMed

Bovine pancreatic ribonuclease A (RNase A) has a conserved His ... Asp catalytic dyad in its active site. Structural analyses had indicated that Asp121 forms a hydrogen bond with His119, which serves as an acid during catalysis of RNA cleavage. The enzyme contains three other histidine residues including His12, which is also in the active site. Here, 1H-NMR spectra of wild-type RNase A and the D121N and D121A variants were analyzed thoroughly as a function of pH. The effect of replacing Asp121 on the microscopic pKa values of the histidine residues is modest: none change by more than 0.2 units. There is no evidence for the formation of a low-barrier hydrogen bond between His119 and either an aspartate or an asparagine residue at position 121. In the presence of the reaction product, uridine 3'-phosphate (3'-UMP), protonation of one active-site histidine residue favors protonation of the other. This finding is consistent with the phosphoryl group of 3'-UMP interacting more strongly with the two active-site histidine residues when both are protonated. Comparison of the titration curves of the unliganded enzyme with that obtained in the presence of different concentrations of 3'-UMP shows that a second molecule of 3'-UMP can bind to the enzyme. Together, the data indicate that the aspartate residue in the His ... Asp catalytic dyad of RNase A has a measurable but modest effect on the ionization of the adjacent histidine residue. PMID:10049337

Quirk, D J; Raines, R T

1999-03-01

151

The effects of cued interaction and ability grouping during cooperative computer-based science instruction  

Microsoft Academic Search

The purpose of this study was to investigate the effects of verbal interaction cues and ability grouping within a cooperative learning computer-based program. We blocked 231 eighth graders in a required science class by ability and randomly assigned them to homogeneous lower-ability, homogeneous higher-ability, or heterogeneous mixed-ability dyads. Each dyad was randomly assigned to a computer program that either did

Gregory P. Sherman; James D. Klein

1995-01-01

152

Effects of daily stress at work on mothers' interactions with preschoolers  

Microsoft Academic Search

Thirty mother-preschooler dyads were studied for 5 consecutive weekdays. In addition to daily maternal reports of job stressors and parent-child interaction, a subsaraple of 13 dyads was videotaped during the parent-child reunion at the end of each workday. Mothers were much more likely to respond to an increase in job stressors by with- drawing than by becoming more irritable. Both

Rena L. Repetti; Jenifer Wood

1997-01-01

153

American Indian Grand Families: Eight Adolescent and Grandparent Dyads Share Perceptions on Various Aspects of the Kinship Care Relationship  

Microsoft Academic Search

A qualitative study of eight grand family dyads was conducted to gain the perspective of the grandparents and grandchildren regarding the kinship care relationship. A phenomenological approach of the “lived experience” developed by P.A. Gibson (2002) was incorporated in the design of the study. Several major themes emerged from data analysis using a phenomenological perspective. The themes are: (1) American

Suzanne L. Cross; Angelique G. Day

2008-01-01

154

Dual emissive borane-BODIPY dyads: molecular conformation control over electronic properties and fluorescence response towards fluoride ions.  

PubMed

Facile synthesis of two new dimesitylboryl appended BODIPYs is reported. The two dyads have similar fluorescent chromophores but differ in their molecular conformations. They exhibit dual fluorescence, intramolecular energy transfer between boryl and BODIPY chromophores and different fluorescence responses (emission enhancement and quenching) upon fluoride binding. PMID:23254480

Swamy, Chinna Ayya P; Mukherjee, Sanjoy; Thilagar, Pakkirisamy

2012-12-20

155

Photoresponsive J-aggregation behavior of a novel azobenzene-phthalocyanine dyad and its third-order optical nonlinearity.  

PubMed

The photoresponsive J-aggregation behaviors of a novel azobenzene-substituted zinc phthalocyanine (azo-ZnPc dyad) were studied by UV/vis, fluorescence, and (1)H NMR spectroscopy. Upon illumination with 365 nm UV light, the trans-cis isomerization of azobenzene can efficiently reduce the steric hindrance around the peripheral oxygen atom of azo-ZnPc, shortening the possible distance between two phthalocyanine molecules and, consequently, greatly improving the tendency of J-aggregation of azo-ZnPc dyad. The third-order optical nonlinearities of the photoresponsive J-aggregates (before and after illumination) were measured by a Z-scan technique at 532 nm with a pulse duration of 25 ps. The Z-scan spectra revealed that all the samples possessed large positive nonlinear refraction and positive nonlinear absorption, exhibiting a self-focusing effect and reverse saturable absorption, respectively. The second molecular hyperpolarizabilities of the dyad in two conditions were measured to be 3.87 x 10(-30) and 4.82 x 10(-30) esu, respectively. All the results suggest that the azo-ZnPc dyad has potential in the field of nonlinear optics applications. PMID:18512976

Chen, Zihui; Zhong, Cheng; Zhang, Zhi; Li, Zhongyu; Niu, Lihong; Bin, Yuejing; Zhang, Fushi

2008-05-31

156

American Indian Grand Families: Eight Adolescent and Grandparent Dyads Share Perceptions on Various Aspects of the Kinship Care Relationship  

ERIC Educational Resources Information Center

|A qualitative study of eight grand family dyads was conducted to gain the perspective of the grandparents and grandchildren regarding the kinship care relationship. A phenomenological approach of the "lived experience" developed by P.A. Gibson (2002) was incorporated in the design of the study. Several major themes emerged from data analysis…

Cross, Suzanne L.; Day, Angelique G.

2008-01-01

157

Fluorescence patterning in films of a photoswitchable BODIPY-spiropyran dyad.  

PubMed

A BODIPY-spiropyran dyad was embedded within poly(methyl methacrylate) films spin-coated on glass slides. Visible illumination of the resulting materials excites selectively the BODIPY fragment, which then deactivates radiatively by emitting light in the form of fluorescence. Ultraviolet irradiation promotes the isomerization of the spiropyran component to the corresponding merocyanine. This photoinduced transformation activates electron and energy transfer pathways from the fluorescent to the photochromic fragment. Consistently, the BODIPY fluorescence is effectively suppressed within the photogenerated isomer. As a result, ultraviolet illumination with a laser, producing a doughnut-shaped spot on the sample, confines the fluorescent species within the doughnut hole. This behavior is an essential requisite for the implementation of super-resolution imaging schemes based on fluorescence photodeactivation. Thus, the operating principles governing the photochemical and photophysical response of this molecular switch can ultimately lead to the development of innovative probes for fluorescence nanoscopy. PMID:20714479

Deniz, Erhan; Tomasulo, Massimiliano; Defazio, Richard A; Watson, Brant D; Raymo, Françisco M

2010-08-16

158

Exploring eating and activity behaviors with parent-child dyads using event history calendars.  

PubMed

Despite advances in science, the prevalence of childhood obesity persists and outcomes remain inconsistent. An event history calendar (EHC) is a tool to facilitate understanding of family life dynamics influencing eating and activity choices. This tool uses reflection to assess temporally linked behavior in the context of life events so that choices related to eating and activity are more explicit. Fourteen parent-child (6-14 years) dyads completed an EHC and interview 2 months following a healthy eating/activity intervention. Phenomenological analysis revealed themes including "awareness" of activity/eating behaviors, "healthy lessons," "family time," and "barriers" to change. The EHC facilitated participant communication and understanding by making connections between behaviors, habits, and events in family context, so that eating and activity behaviors could be realistically reviewed. This tool has potential to guide development of individualized interventions through barrier identification and goal establishment in research and clinical settings to help counteract childhood obesity over time. PMID:23783521

Danford, Cynthia A; Martyn, Kristy K

2013-06-19

159

Energy- and charge-transfer processes in flexible organic donor-acceptor dyads  

NASA Astrophysics Data System (ADS)

Organic donor-bridge-acceptor dyads consisting of a triphenyldiamine donor that was linked to a perylenebisimide acceptor by a flexible nonconjugated bridge have been investigated by complementary spectroscopic techniques as a function of the length and the polarity of the linker. Time-resolved fluorescence spectroscopy revealed a quenching of the donor emission accompanied by a corresponding rise in the acceptor fluorescence, which indicates an efficient energy transfer between the donor and acceptor moieties. A second fluorescence quenching process that affects the acceptor emission is ascribed to a ground-state electron transfer from the donor to the acceptor. The lifetimes of the radicals that were determined by transient-absorption spectroscopy covered the range from 10 to 100 ms.

Hofmann, Christiane C.; Bauer, Peter; Haque, Saif A.; Thelakkat, Mukundan; Köhler, Jürgen

2009-10-01

160

Contaminated and uncontaminated feeding influence perceived intimacy in mixed-sex dyads.  

PubMed

It was expected that viewers watching adult mixed-sex pairs dining together will give higher ratings of the perceived intimacy and involvement of the pair if feeding is displayed while eating, especially if the feeding involves contaminated (i.e., with potential germ transfer) foods. Our hypotheses were tested using a design in which participants viewed five videotapes in varying order. Each video showed different mixed-sex pairs of actors sharing meal and included a distinct form of food sharing or none. These were shown to 50 small groups of young adults in quasi-random sequences to control for order effects. Immediately after each video, viewers were asked about the attractiveness, attraction and intimacy in the dyad they had just observed. As predicted, videos featuring contaminated feeding consistently produced higher ratings on involvement and attraction than those showing uncontaminated feeding which, in turn, mostly produced higher ratings on involvement and attraction than those showing no feeding behaviors. PMID:22387714

Alley, Thomas R

2012-03-02

161

Photo-induced charge-transfer processes in fullerene-containing dyad and triad molecules  

NASA Astrophysics Data System (ADS)

We report on pulsed electron-spin-resonance (ESR) investigations of novel model systems for photo-induced electron-transfer processes. The schematic structures of the molecules are T5-C60 and A-T5-C60, i.e., the fullerene C60 is used as the acceptor, and quinquethiophene (T5) or anthracene (A) act as a donor. In frozen solutions of both the dyad and triad, we find rather long-lived radical signals (lifetime ~2 ?s) after laser-pulse excitation. The observed signals can be assigned by the g factor and the linewidth to the anion C60- and the cation T5+. We have examined the influence of the solvent polarity (toluene or benzonitrile) and of the excitation wavelength (355 nm or 532 nm) on the efficiency of the charge transfer.

Knorr, S.; Grupp, A.; Mehring, M.; Grube, G.; Effenberger, F.

1999-09-01

162

Structure of porphyrin-fullerene dyad monolayer on the water surface and solid substrate  

NASA Astrophysics Data System (ADS)

Monolayers of porphyrin-fullerene dyad TBD6a were formed on the surface of a water subphase and then transported on a solid substrate by the Langmuir-Schaefer method. A simulation was performed for the structure of a single molecule and for a molecular monolayer, according to the area per molecule in the monolayer formed, which was calculated based on an analysis of the ?-A isotherm. A unit cell was chosen for the proposed molecular packing ( a = 1.54 nm, b = 1.50 nm, c = 1.75 nm, ? = 80.0°, ? = 90.0°, and ? = 90.0°), and the atomic coordinates were calculated. A comparison of the interplanar spacings and diffraction peak intensities in the experimental and calculated (for the unit cell proposed) diffraction patterns indicates that a platelike texture is formed in the monolayer and that the crystal structure of the domains corresponds to the model chosen.

D'yakova, Yu. A.; Suvorova, E. I.; Orekhov, A. S.; Alekseev, A. S.; Klechkovskaya, V. V.; Tereshchenko, E. Yu.; Tkachenko, N. V.; Lemmetyinen, H.; Feigin, L. A.; Kovalchuk, M. V.

2011-01-01

163

FRET sensitization of tungsten-alkylidyne complexes by zinc porphyrins in self-assembled dyads.  

PubMed

The photophysical properties of self-assembled zinc-porphyrin/tungsten-alkylidyne dyads have been investigated with the aim of determining whether the porphyrin S excited state sensitizes the tungsten-alkylidyne (3)[d?*] state. The luminescent metalloligand W(?CC(6)H(4)CCpy)(dppe)(2)Cl (1; dppe = 1,2-bis(diphenylphosphino)ethane) has been synthesized and shown by electronic and NMR spectroscopy to coordinate axially to ZnTPP and ZnTP(Cl)P (TP(Cl)P = tetra(p-chlorophenyl)porphyrin) via the terminal pyridyl group. Coordination of 1 to ZnPor results in partial quenching of porphyrin S(1) fluorescence and a decrease in the (3)[d?*] excited-state lifetime of 1. Transient-absorption spectroscopy shows that fluorescence quenching occurs via intramolecular Förster resonance energy transfer from the porphyrin S(1) state to the (1)[d?*] excited state of 1, which then undergoes rapid singlet-triplet intersystem crossing to produce the (3)[d?*] excited state. Sensitization of the (3)[d?*] state occurs with high overall efficiency (?(EnT) ? 80%), thus strongly enhancing light harvesting for the tungsten-alkylidyne compound. The mechanism and rates of the net S(1)?(3)[d?*] energy transfer are found to differ significantly from those for previously reported zinc-porphyrin/tungsten-alkylidyne dyads that are constructed from similar components but connected instead with covalent bonds at the porphyrin edge. Density functional theory calculations indicate that these differences are due in part to the degree of orbital mixing between the porphyrin and metal-alkylidyne subunits. PMID:23374026

Moravec, Davis B; Hopkins, Michael D

2013-02-15

164

Formation, spectral, electrochemical, and photochemical behavior of zinc N-confused porphyrin coordinated to imidazole functionalized fullerene dyads.  

PubMed

Donor-acceptor dyads were constructed using zinc N-confused porphyrin (ZnNCP), a structural isomer of zinc tetraphenylporphyrin, as a donor, and fullerene as an electron acceptor. Two derivatives, pyridine-coordinated zinc N-confused porphyrin (Py:ZnNCP) and the zinc N-confused porphyrin dimer (ZnNCP-dimer) were utilized to form the dyads with an imidazole-appended fulleropyrrolidine (C60Im). These porphyrin isomers formed well-defined 1:1 supramolecular dyads (C60Im:ZnNCP) via axial coordination. The dyads were characterized by optical absorption and emission, ESI-mass, 1H NMR, and electrochemical methods. The binding constant, K, was found to be 2.8 x 10(4) M(-1) for C60Im:ZnNCP. The geometric and electronic structure of C60Im:ZnNCP were probed by using DFT B3LYP/3-21G methods. The HOMO was found to be on the ZnNCP entity, while the LUMO was primarily on the fullerene entity. The electrochemical properties of C60Im:ZnNCP was probed using cyclic voltammetry in o-dichlorobenzene, 0.1 n-Bu4NClO4. The Py:ZnNCP was found to be easier to oxidize by over 340 mV compared to Py:ZnTPP. Upon dyad formation via axial coordination, the first oxidation revealed an anodic shift of nearly 90 mV. Evidence of photoinduced charge separation from the singlet excited ZnNCP to the appended fullerene was established from time-resolved emission and nanosecond transient absorption studies. PMID:16780327

D'Souza, Francis; Smith, Phillip M; Rogers, Lisa; Zandler, Melvin E; Shafiqul Islam, D-M; Araki, Yasuyaki; Ito, Osamu

2006-06-26

165

Influence of donor-acceptor distance variation on photoinduced electron and proton transfer in rhenium(I)-phenol dyads.  

PubMed

A homologous series of four molecules in which a phenol unit is linked covalently to a rhenium(I) tricarbonyl diimine photooxidant via a variable number of p-xylene spacers (n = 0-3) was synthesized and investigated. The species with a single p-xylene spacer was structurally characterized to get some benchmark distances. Photoexcitation of the metal complex in the shortest dyad (n = 0) triggers release of the phenolic proton to the acetonitrile/water solvent mixture; a H/D kinetic isotope effect (KIE) of 2.0 ± 0.4 is associated with this process. Thus, the shortest dyad basically acts like a photoacid. The next two longer dyads (n = 1, 2) exhibit intramolecular photoinduced phenol-to-rhenium electron transfer in the rate-determining excited-state deactivation step, and there is no significant KIE in this case. For the dyad with n = 1, transient absorption spectroscopy provided evidence for release of the phenolic proton to the solvent upon oxidation of the phenol by intramolecular photoinduced electron transfer. Subsequent thermal charge recombination is associated with a H/D KIE of 3.6 ± 0.4 and therefore is likely to involve proton motion in the rate-determining reaction step. Thus, some of the longer dyads (n = 1, 2) exhibit photoinduced proton-coupled electron transfer (PCET), albeit in a stepwise (electron transfer followed by proton transfer) rather than concerted manner. Our study demonstrates that electronically strongly coupled donor-acceptor systems may exhibit significantly different photoinduced PCET chemistry than electronically weakly coupled donor-bridge-acceptor molecules. PMID:22809316

Kuss-Petermann, Martin; Wolf, Hilke; Stalke, Dietmar; Wenger, Oliver S

2012-07-18

166

Dyads Affected by Chronic Heart Failure: A Randomized Study Evaluating Effects of Education and Psychosocial Support to Patients With Heart Failure and Their Partners  

PubMed Central

Background Chronic heart failure (CHF) causes great suffering for both patients and their partners. The aim of this study was to evaluate the effects of an integrated dyad care program with education and psychosocial support to patients with CHF and their partners during a postdischarge period after acute deterioration of CHF. Methods One hundred fifty-five patient-caregiver dyads were randomized to usual care (n = 71) or a psychoeducation intervention (n = 84) delivered in 3 modules through nurse-led face-to-face counseling, computer-based education, and other written teaching materials to assist dyads to develop problem-solving skills. Follow-up assessments were completed after 3 and 12 months to assess perceived control, perceived health, depressive symptoms, self-care, and caregiver burden. Results Baseline sociodemographic and clinical characteristics of dyads in the experimental and control groups were similar at baseline. Significant differences were observed in patients’ perceived control over the cardiac condition after 3 (P < .05) but not after 12 months, and no effect was seen for the caregivers. No group differences were observed over time in dyads’ health-related quality of life and depressive symptoms, patients’ self-care behaviors, and partners’ experiences of caregiver burden. Conclusions Integrated dyad care focusing on skill-building and problem-solving education and psychosocial support was effective in initially enhancing patients’ levels of perceived control. More frequent professional contact and ongoing skills training may be necessary to have a higher impact on dyad outcomes and warrants further research.

AGREN, SUSANNA; EVANGELISTA, LORRAINE S.; HJELM, CARINA; STROMBERG, ANNA

2012-01-01

167

Metal nitride cluster fullerene M3N@C80 (M=Y, Sc) based dyads: synthesis, and electrochemical, theoretical and photophysical studies.  

PubMed

The first pyrrolidine and cyclopropane derivatives of the trimetallic nitride templated (TNT) endohedral metallofullerenes I(h)-Sc(3)N@C(80) and I(h)-Y(3)N@C(80) connected to an electron-donor unit (i.e., tetrathiafulvalene, phthalocyanine or ferrocene) were successfully prepared by 1,3-dipolar cycloaddition reactions of azomethine ylides and Bingel-Hirsch-type reactions. Electrochemical studies confirmed the formation of the [6,6] regioisomers for the Y(3)N@C(80)-based dyads and the [5,6] regioisomers in the case of Sc(3)N@C(80)-based dyads. Similar to other TNT endohedral metallofullerene systems previously synthesized, irreversible reductive behavior was observed for the [6,6]-Y(3)N@C(80)-based dyads, whereas the [5,6]-Sc(3)N@C(80)-based dyads exhibited reversible reductive electrochemistry. Density functional calculations were also carried out on these dyads confirming the importance of these structures as electron transfer model systems. Furthermore, photophysical investigations on a ferrocenyl-Sc(3)N@C(80)-fulleropyrrolidine dyad demonstrated the existence of a photoinduced electron-transfer process that yields a radical ion pair with a lifetime three times longer than that obtained for the analogous C(60) dyad. PMID:19053104

Pinzón, Julio R; Cardona, Claudia M; Herranz, Maria Angeles; Plonska-Brzezinska, Marta E; Palkar, Amit; Athans, Andreas J; Martín, Nazario; Rodríguez-Fortea, Antonio; Poblet, Josep M; Bottari, Giovanni; Torres, Tomás; Gayathri, S Shankara; Guldi, Dirk M; Echegoyen, Luis

2009-01-01

168

A Motivational System for Regulating Human-Robot Interaction  

Microsoft Academic Search

This paper presents a motivational system for an autonomous robot which is designed to regulate human-robot interaction. The mode of social in- teraction is that of a caretaker-infant dyad where a human acts as the caretaker for the robot. An infant's emotions and drives play a very impor- tant role in generating meaningful interactions with the caretaker, and regulating these

Cynthia Breazeal

1998-01-01

169

Self-Monitoring and Control in Dyadic Interactions  

Microsoft Academic Search

This study sought to examine individual differences in the level of planning and monitoring involved in actual interpersonal interactions between pairs of friends and strangers, as measured by Snyder's (1974) Self-Monitoring Scale. The experiment required same- and opposite-sex dyads of friends or strangers to converse for 10 min, before completing a questionnaire rating their behavior and feelings in the interaction.

Dorothy Miell; Martin Le Voi

1985-01-01

170

Big Five predictors of behavior and perceptions in initial dyadic interactions: personality similarity helps extraverts and introverts, but hurts "disagreeables".  

PubMed

The authors used the unstructured dyadic interaction paradigm to examine the effects of gender and the Big Five personality traits on dyad members' behaviors and perceptions in 87 initial, unstructured interactions. Most of the significant Big Five effects (84%) were associated with the traits of Extraversion and Agreeableness. There were several significant actor and partner effects for both of these traits. However, the most interesting and novel effects took the form of significant Actor x Partner interactions. Personality similarity resulted in relatively good initial interactions for dyads composed of 2 extraverts or 2 introverts, when compared with dissimilar (extravert-introvert) pairs. However, personality similarity resulted in uniquely poor initial interactions for dyads composed of 2 "disagreeables." In summary, the Big Five traits predict behavior and perceptions in initial dyadic interactions, not just in the form of actor and partner "main effects" but also in the form of Actor x Partner interactions. PMID:19785485

Cuperman, Ronen; Ickes, William

2009-10-01

171

Joint attention in parent-child dyads involving children with selective mutism: a comparison between anxious and typically developing children.  

PubMed

Although joint attention processes are known to play an important role in adaptive social behavior in typical development, we know little about these processes in clinical child populations. We compared early school age children with selective mutism (SM; n = 19) versus mixed anxiety (MA; n = 18) and community controls (CC; n = 26) on joint attention measures coded from direct observations with their parent during an unstructured free play task and two structured tasks. As predicted, the SM dyads established significantly fewer episodes of joint attention through parental initiation acts than the MA and CC dyads during the structured tasks. Findings suggest that children with SM may withdraw from their parents during stressful situations, thus missing out on opportunities for learning other coping skills. We discuss the implications of the present findings for understanding the maintenance and treatment of SM. PMID:20960051

Nowakowski, Matilda E; Tasker, Susan L; Cunningham, Charles E; McHolm, Angela E; Edison, Shannon; Pierre, Jeff St; Boyle, Michael H; Schmidt, Louis A

2011-02-01

172

Attachment representations in people with dementia and their carers: Implications for well-being within the dyad  

Microsoft Academic Search

Objectives: The process of developing and living with dementia may activate attachment feelings and behaviours in people with dementia (PwD) and their carers. By obtaining information from both PwD and carer, we aimed to provide information on the nature and concordance of attachment patterns within the dyad and to examine the relative contribution of attachment representations in PwD and carers

Sharon M. Nelis; Linda Clare; Christopher J. Whitaker

2012-01-01

173

Typing of Nonencapsulated Haemophilus Strains by Repetitive-Element Sequence-Based PCR Using Intergenic Dyad Sequences  

Microsoft Academic Search

Intergenic dyad sequences (IDS) are short repeated elements that have been described for several Hae- mophilus genomes and for only two other bacterial genera. We developed a repetitive-element sequence-based PCR using an IDS-specific primer as a typing method (IDS-PCR) for nonencapsulated Haemophilus strains and compared this technique with pulsed-field gel electrophoresis (PFGE) of DNA restricted with SmaI. IDS-PCR was rapid,

Guillaume Bruant; Stephane Watt; Roland Quentin; Agnes Rosenau

2003-01-01

174

Structural and Kinetic Analysis of Bacillus subtilis N-Acetylglucosaminidase Reveals a Unique Asp-His Dyad Mechanism*  

PubMed Central

Three-dimensional structures of NagZ of Bacillus subtilis, the first structures of a two-domain ?-N-acetylglucosaminidase of family 3 of glycosidases, were determined with and without the transition state mimicking inhibitor PUGNAc bound to the active site, at 1.84- and 1.40-? resolution, respectively. The structures together with kinetic analyses of mutants revealed an Asp-His dyad involved in catalysis: His234 of BsNagZ acts as general acid/base catalyst and is hydrogen bonded by Asp232 for proper function. Replacement of both His234 and Asp232 with glycine reduced the rate of hydrolysis of the fluorogenic substrate 4?-methylumbelliferyl N-acetyl-?-d-glucosaminide 1900- and 4500-fold, respectively, and rendered activity pH-independent in the alkaline range consistent with a role of these residues in acid/base catalysis. N-Acetylglucosaminyl enzyme intermediate accumulated in the H234G mutant and ?-azide product was formed in the presence of sodium azide in both mutants. The Asp-His dyad is conserved within ?-N-acetylglucosaminidases but otherwise absent in ?-glycosidases of family 3, which instead carry a “classical” glutamate acid/base catalyst. The acid/base glutamate of Hordeum vulgare exoglucanase (Exo1) superimposes with His234 of the dyad of BsNagZ and, in contrast to the latter, protrudes from a second domain of the enzyme into the active site. This is the first report of an Asp-His catalytic dyad involved in hydrolysis of glycosides resembling in function the Asp-His-Ser triad of serine proteases. Our findings will facilitate the development of mechanism-based inhibitors that selectively target family 3 ?-N-acetylglucosaminidases, which are involved in bacterial cell wall turnover, spore germination, and induction of ?-lactamase.

Litzinger, Silke; Fischer, Stefanie; Polzer, Patrick; Diederichs, Kay; Welte, Wolfram; Mayer, Christoph

2010-01-01

175

HIV seroadaptation among individuals, within sexual dyads, and by sexual episodes, men who have sex with men, San Francisco, 2008  

Microsoft Academic Search

“Seroadaptation” comprises sexual behaviors to reduce the risk of HIV acquisition and transmission based on knowing one's own and one's sexual partners' serostatus. We measured the prevalence of seroadaptive behaviors among men who have sex with men (MSM) recruited through time–location sampling (TLS) across three perspectives: by individuals (N=1207 MSM), among sexual dyads (N=3746 partnerships), and for sexual episodes (N=63,789

Willi McFarland; Yea-Hung Chen; H. Fisher Raymond; Binh Nguyen; Grant Colfax; Jason Mehrtens; Tyler Robertson; Ron Stall; Deb Levine; Hong-Ha M. Truong

2011-01-01

176

Photo-responsive perylene diimid–azobenzene dyad: Photochemistry and its morphology control by self-assembly  

Microsoft Academic Search

A new type of photo-responsive perylene diimide–azobenzene dyad (PDI–AZO) was synthesized by covalently adjoining azobenzene chromophore to N-imide position of perylene diimide. The optical properties, photoisomerization and self-assembly morphology of the resultant composites were characterized by UV–vis absorption, photoluminescence (PL) spectra and scanning electron microscope. Larger one-dimension nanobelts were observed in self-assembly PDI–AZO due to the strong molecule stacking. The

Yiyu Feng; Wei Feng

2008-01-01

177

Teenage motherhood among low-income, urban Hispanics: Familial and cultural considerations of mother-daughter dyads  

Microsoft Academic Search

The present hypothesis generating, qualitative study employed a family-systems perspective to investigate teenage motherhood among low-income, Hispanic families living in high-crime areas. The study focused primarily on the mother-daughter relationship. A semi-structured interview was administered separately to mothers and daughters in 11 mother-daughter dyads. A system of open and axial coding was used to categorize, analyze, and name the core

Daniel Thomas Sciarra

1994-01-01

178

Photophysical and electrochemical properties of platinum(II) complexes bearing a chromophore-acceptor dyad and their photocatalytic hydrogen evolution.  

PubMed

A series of platinum(II) complexes bearing a chromophore-acceptor dyad obtained by reacting 4-(p-bromomethylphenyl)-6-phenyl-2,2'-bipyridine or 4'-(p-bromomethylphenyl)-2,2':6',2''-terpyridine with pyridine, 4-phenylpyridine, 4,4'-bipyridine, 1-methyl-4-(pyridin-4'-yl)pyridinium hexafluorophosphate respectively, were synthesized. Their photophysical properties, emission quenching studies by Pt nanoparticles and methyl viologen, electrochemical properties and photoinduced electron-transfer reactions in a photocatalytic hydrogen-generating system containing triethanolamine and colloidal Pt without an extra electron relay, were investigated. A comparison of the rates of hydrogen production for the two photocatalytic systems, one containing a metal-organic dyad and the other comprising a 1:1 mixture of the parental platinum(II) complexes and the corresponding electron relay, showed that intramolecular electron transfer improves the photocatalytic efficiency. Compared with cyclometalated platinum(II) complexes, the related platinum(II) terpyridyl complexes exhibited poor performance for photocatalytic hydrogen evolution. An investigation into the amount of hydrogen generated by three platinum(II) complexes containing cyclometalated ligands with methyl groups located on different phenyl rings revealed that the efficiency of hydrogen evolution was affected by a subtle change of functional group on ligand, and the hydrogen-generating efficiency in the presence or absence of methyl viologen is comparable, indicating electron transfer from the excited [Pt(C^N^N)] chromophore to colloidal Pt. (1)H NMR spectroscopy of the metal-organic dyads in an aqueous solution in the presence of excess triethanolamine revealed that the dyad with a viologen unit was unstable, and a chemical reaction in the compound occurred prior to irradiation by visible light under basic conditions. PMID:22643575

Zhang, Gui-Ju; Gan, Xin; Xu, Quan-Qing; Chen, Yong; Zhao, Xi-Juan; Qin, Biao; Lv, Xiao-Jun; Lai, Siu-Wai; Fu, Wen-Fu; Che, Chi-Ming

2012-05-29

179

A photo- and electrochemically-active porphyrin-fullerene dyad electropolymer.  

PubMed

A hole- and electron-conducting polymer has been prepared by electropolymerization of a porphyrin-fullerene monomer. The porphyrin units are linked by aminophenyl groups to form a linear chain in which the porphyrin is an integral part of the polymer backbone. The absorption spectrum of a film formed on indium-tin-oxide-coated glass resembles that of a model porphyrin-fullerene dyad, but with significant peak broadening. The film demonstrates a first oxidation potential of 0.75 V vs. SCE, corresponding to oxidation of the porphyrin polymer, and a first reduction potential of -0.63 V vs. SCE, corresponding to fullerene reduction. Time-resolved fluorescence studies show that the porphyrin first excited singlet state is strongly quenched by photoinduced electron transfer to fullerene. Transient absorption investigations reveal that excitation generates mobile charge carriers that recombine by both geminate and nongeminate pathways over a large range of time scales. Similar studies on a related polymer that lacks the fullerene component show complex, laser-intensity-dependent photoinduced electron transfer behavior. The properties of the porphyrin-fullerene electropolymer suggest that it may be useful in organic photovoltaic applications, wherein light absorption leads to charge separation within picoseconds in a "molecular heterojunction" with no requirement for exciton migration. PMID:20358126

Gervaldo, Miguel; Liddell, Paul A; Kodis, Gerdenis; Brennan, Bradley J; Johnson, Christopher R; Bridgewater, James W; Moore, Ana L; Moore, Thomas A; Gust, Devens

2010-04-01

180

Excitation energy transfer and quenching in a heterodimer: applications to the carotenoid-phthalocyanine dyads.  

PubMed

The dynamics of a molecular heterodimer composed of a long-lived excitation donor and a short-lived acceptor (quencher) is examined. In order to consider various dynamical regimes without any restrictions on the system parameters, the energy transfer is modeled employing the hierarchical equations of motion, while the relaxation to the ground state is treated by assuming a phenomenological spontaneous nonradiative decay rate. Time scales of the resulting two-exponential evolution are investigated as functions of the energy gap and the resonance coupling between the monomeric constituents of the dimer. Relevance of the present analysis to the recent experimental findings on artificial carotenoid-phthalocyanine dyads is discussed. By examining the first two time scales of the reported time-resolved spectra, it is shown that upon the increase of carotenoid conjugation length its first excited state approaches the first excited state of phthalocyanine from above, thereby inducing a remarkable quenching. The proposed model also provides a unified treatment of quenching in the regimes previously distinguished as energy transfer and excitonic state formation. PMID:23574274

Balevi?ius, V; Gelzinis, A; Abramavicius, D; Valkunas, L

2013-05-07

181

Nucleosomes stacked with aligned dyad axes are found in native compact chromatin in vitro.  

PubMed

In this study, electron tomograms of plunge-frozen isolated chromatin in both open and compacted form were recorded. We have resolved individual nucleosomes in these tomograms in order to provide a 3D view of the arrangement of nucleosomes within chromatin fibers at different compaction states. With an optimized template matching procedure we obtained accurate positions and orientations of nucleosomes in open chromatin in "low-salt" conditions (5 mM NaCl). The mean value of the planar angle between three consecutive nucleosomes is 70°, and the mean center-to-center distance between consecutive nucleosomes is 22.3 nm. Since the template matching approach was not effective in crowded conditions, for nucleosome detection in compact fibers (40 mM NaCl and 1 mM MgCl(2)) we developed the nucleosome detection procedure based on the watershed algorithm, followed by sub-tomogram alignment, averaging, and classification by Principal Components Analysis. We find that in compact chromatin the nucleosomes are arranged with a predominant face-to-face stacking organization, which has not been previously shown for native isolated chromatin. Although the path of the DNA cannot be directly seen in compact conditions, it is evident that the nucleosomes stack with their dyad axis aligned in forming a "double track" conformation which is a consequence of DNA joining adjacent nucleosome stacks. Our data suggests that nucleosome stacking is an important mechanism for generating chromatin compaction in vivo. PMID:22138167

Scheffer, Margot P; Eltsov, Mikhail; Bednar, Jan; Frangakis, Achilleas S

2011-11-22

182

Structure of porphyrin-fullerene dyad monolayer on the water surface and solid substrate  

SciTech Connect

Monolayers of porphyrin-fullerene dyad TBD6a were formed on the surface of a water subphase and then transported on a solid substrate by the Langmuir-Schaefer method. A simulation was performed for the structure of a single molecule and for a molecular monolayer, according to the area per molecule in the monolayer formed, which was calculated based on an analysis of the {pi}-A isotherm. A unit cell was chosen for the proposed molecular packing (a = 1.54 nm, b = 1.50 nm, c = 1.75 nm, {alpha} = 80.0 Degree-Sign , {beta} = 90.0 Degree-Sign , and {gamma} = 90.0 Degree-Sign ), and the atomic coordinates were calculated. A comparison of the interplanar spacings and diffraction peak intensities in the experimental and calculated (for the unit cell proposed) diffraction patterns indicates that a platelike texture is formed in the monolayer and that the crystal structure of the domains corresponds to the model chosen.

D'yakova, Yu. A.; Suvorova, E. I.; Orekhov, A. S. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Alekseev, A. S. [Russian Academy of Sciences, Prokhorov General Physics Institute (Russian Federation); Klechkovskaya, V. V., E-mail: klechvv@ns.crys.ras.ru; Tereshchenko, E. Yu. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Tkachenko, N. V.; Lemmetyinen, H. [Tampere Technological University (Finland); Feigin, L. A.; Kovalchuk, M. V. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

2011-01-15

183

Photoinduced CC-coupling reactions of rigid diastereomeric benzophenone-methionine dyads.  

PubMed

The reactions of ketone/methionine systems are widely used as efficient and selective sources of biorelevant radical species. In this study, we address intramolecular variants of this couple with respect to its photosynthetic utility and as a mechanistic model of underlying elementary reaction steps of biological importance, especially with respect to the study of photoinitiated electron transport in complex peptides. The outcomes of this study are two-fold: (1) steady-state irradiation of sterically constrained benzophenone/methionine dyads afforded stable photocyclization products with high yield and product selectivity. (2) Mechanistic insights into the triplet-triggered product formation were obtained from an analysis of the flash photolysis results and the molecular structure of the stable product formed upon irradiation. Time-resolved experiments identified (net) hydrogen-atom transfer from the methionine as the mechanism of the triplet quenching and the resulting biradicals as the major precursor of the isolated stable product. Both the analyses of triplet quenching and stable-product formation in the diastereomeric pairs point to effects of chiral center configuration, i.e., significant stereoselectivity is observed for all elementary steps. The underlying stereochemical restraints were quantitatively addressed by means of molecular dynamics simulations. PMID:22817341

Lewandowska-Andralojc, Anna; Kazmierczak, Franciszek; Hug, Gordon L; Hörner, Gerald; Marciniak, Bronislaw

2012-08-30

184

Taking Stress Response Out of the Box: Stability, Discontinuity, and Temperament Effects on HPA and SNS Across Social Stressors in Mother–Infant Dyads  

Microsoft Academic Search

This study investigated continuity and stability of hypothalamic–pituitary–adrenal (HPA) and sympathetic nervous system (SNS) response measures in mother–infant dyads across 2 different types of social stress sessions. Synchrony of response trajectories across systems (SNS–HPA coordination) and partners (mother–infant attunement) was addressed, as were associations with infant temperament. Primiparous mothers and their 18-month-old infants (n = 86 dyads) completed an attachment

Heidemarie K. Laurent; Jennifer C. Ablow; Jeffrey Measelle

2012-01-01

185

Turkish Mothers' Self-Efficacy Beliefs and Styles of Interactions with Their Children with Language Delays  

ERIC Educational Resources Information Center

Turkish mothers' self-efficacy beliefs and their interactional behaviors with their children with language delays are described and explored. Participants included 19 mother-child dyads. Mothers' interaction with their children with language delays was videotaped for 30 minutes in a free-play context. Regarding mothers' interactional behaviors,…

Diken, Ibrahim H.

2009-01-01

186

Near-IR Emissive Chlorin-Bacteriochlorin Energy-Transfer Dyads with a Common Donor and Acceptors with Tunable Emission Wavelength.  

PubMed

Design, synthesis, and optical properties of a series of novel chlorin-bacteriochlorin energy transfer dyads are described. Each dyad is composed of a common red-absorbing (645-646 nm) chlorin, as an energy donor, and a different near-IR emitting bacteriochlorin, as an energy acceptor. Each bacteriochlorin acceptor is equipped with a different set of auxochromes, so that each of them emits at a different wavelength. Dyads exhibit an efficient energy transfer (?0.77) even for chlorin-bacteriochlorin pairs with large (up to 122 nm) separation between donor emission and acceptor absorption. Excitation of the chlorin donor results in relatively strong emission of the bacteriochlorin acceptor, with a quantum yield ?f range of 0.155-0.23 in toluene and 0.12-0.185 in DMF. The narrow, tunable emission band of bacteriochlorins enables the selection of a series of three dyads with well-resolved emissions at 732, 760, and 788 nm, and common excitation at 645 nm. Selected dyads have been also converted into bioconjugatable N-succinamide ester derivatives. The optical properties of the described dyads make them promising candidates for development of a family of near-IR fluorophores for simultaneous imaging of multiple targets, where the whole set of fluorophores can be excited with the common wavelength, and fluorescence from each can be independently detected. PMID:24079536

Yu, Zhanqian; Ptaszek, Marcin

2013-10-14

187

Interaction  

NSDL National Science Digital Library

Set values for the initial position, velocity, and mass of the two particles, and click on the button "Initialize Animation" to play the animation using your specified values. Note, if m or v are too large, the particles may actually pass through one another which will seem a little strange. Note: the interaction between the particles is a "non-contact" interaction, much like the electrostatic force on two charges. Mathematically, it is actually a Hooke's law interaction.

Christian, Wolfgang; Belloni, Mario

2008-02-19

188

Light harvesting zinc naphthalocyanine-perylenediimide supramolecular dyads: long-lived charge-separated states in nonpolar media.  

PubMed

Photoinduced electron-transfer dynamics of self-assembled donor-acceptor dyads formed by axial coordination of zinc naphthalocyanine, ZnNc, and perylenediimide (PDI) bearing either pyridine (py) or imidazole (im) coordinating ligands were investigated. The PDIim unit was functionalized with tert-octylphenoxy groups at the bay positions, which avoid aggregation providing solubility, to examine the effect of the bulky substituents at the bay positions on the rates of electron-transfer reactions. The combination between zinc naphthalocyanine and perylenediimide entities absorbs light over a wide region of the visible and near infrared (NIR) spectrum. The binding constants of the self-assembled ZnNc:PDIpy (1) and ZnNc:PDIim (2) in toluene were found to be 2.40 × 10(4) and 1.10 × 10(5) M(-1), respectively, from the steady-state absorption and emission measurements, indicating formation of moderately stable complexes. The geometric and electronic calculations by using an ab initio B3LYP/6-311G method showed the majority of the highest occupied frontier molecular orbital (HOMO) on the zinc naphthalocyanine entity, while the lowest unoccupied molecular orbital (LUMO) was on the perylenediimide entities, suggesting that the charge-separated states of the supramolecular dyads are ZnNc?(+):PDI?(-). The electrochemical results suggest the exothermic charge-separation process via the singlet states of both ZnNc and PDI entities in nonpolar toluene. Upon coordination of perylenediimide to ZnNc, the main quenching pathway involved charge separation via the singlet-excited states of ZnNc and PDIs. Clear evidence of the intramolecular electron transfer from the singlet-excited state of ZnNc to PDI within the supramolecular dyads in toluene was monitored by the femtosecond laser photolysis by observing the characteristic absorption band of the PDI radical anion (PDI?(-)) and the ZnNc radical cation (ZnNc?(+)) in the visible and NIR regions. The rate constants of charge-separation (k(CS)) processes of the self-assembled dyads 1 and 2 were determined to be 4.05 × 10(10) and 1.20 × 10(9) s(-1), respectively. The rate constant of charge recombination (k(CR)) and the lifetime of charge-separated states (?(CS)) of dyad 1 were determined to be 2.34 × 10(8) s(-1) and 4.30 ns, respectively. Interestingly, a slower charge recombination (2.20 × 10(7) s(-1)) and a longer lifetime of the charge separated state (45 ns) were observed in dyad 2 in nonpolar toluene by utilizing the nanosecond transient measurements. The absorption in a wide section of the solar spectrum and the high charge-separation/charge-recombination ratio suggest the usefulness of the self-assembled zinc naphthalocyanine-perylenediimide dyads as good photosynthetic models. PMID:22311067

El-Khouly, Mohamed E; Gutiérrez, Ana M; Sastre-Santos, Ángela; Fernández-Lázaro, Fernando; Fukuzumi, Shunichi

2012-02-07

189

Electronic origin for enhanced nonlinear optical response of complexes from tetraalkylammonium halide and carbon tetrabromide: electrostatic potentials of intermolecular donor-acceptor dyads.  

PubMed

Electronic origin for nonresonant enhancement of nonlinear optical response in the complexes formed from tetraalkylammonium halide and carbon tetrabromide is provided in view of electrostatic potentials of intermolecular donor (halide ion)-acceptor (CBr(4)). The calculated electrostatic potentials of donor-acceptor range from -4.83 to -7.70 kcal mol(-1) and show a decreasing order of [Et(4)Cl(-)Br] > [Et(4)Br(-)Br] congruent with [Et(4)I(-)Br] > [Bu(4)Br(-)Br]. The calculated second-order susceptibilities of solid complexes are in an increasing order of [NEt(4)ClCBr(4)] < [NEt(4)BrCBr(4)] congruent with [NEt(4)ICBr(4)] < [NBu(4)BrCBr(4)C(3)H(6)O]. It has been shown that the donor/acceptor dyads make the exclusive contribution to nonlinear optical response. A large size of halide or tetraalkylammonium ion results in a small electrostatic potential and large nonlinear optical response in these charge-transfer complexes. It indicates that a small supermolecular interaction will create a large nonlinear optical response, and it gives a clue to design the molecular complexes with large non-linear optical susceptibility. PMID:16791904

Cheng, Wendan; Shen, Juan; Wu, Dongsheng; Li, Xiaodong; Lan, Youzhao; Li, Feifei; Huang, Shuping; Zhang, Hao; Gong, Yajing

2006-09-01

190

Dyadic interracial interactions: a meta-analysis.  

PubMed

This meta-analysis examined over 40 years of research on interracial interactions by exploring 4 types of outcomes: explicit attitudes toward interaction partners, participants' self-reports of their own emotional state, nonverbal or observed behavior, and objective measures of performance. Data were collected from 108 samples (N = 12,463) comparing dyadic interracial and same-race interactions, predominantly featuring Black and White Americans. Effect sizes were small: Participants in same-race dyads tended to express marginally more positive attitudes about their partners (r = .07), reported feeling less negative affect (r = .10), showed more friendly nonverbal behavior (r = .09), and scored higher on performance measures (r = .07) than those in interracial dyads. Effect sizes also showed substantial heterogeneity, and further analyses indicated that intersectional, contextual, and relational factors moderated these outcomes. For example, when members of a dyad were the same sex, differences between interracial and same-race dyads in negative affect were reduced. Structured interactions led to more egalitarian performance outcomes than did free-form interactions, but the effects of interaction structure on nonverbal behavior depended on participant gender. Furthermore, benefits of intergroup contact were apparent: Differences in emotional state across dyadic racial composition disappeared in longer term interactions, and racial minorities, who often have greater experience with intergroup contact, experienced less negative affect in interracial interactions than did majority group members. Finally, there was a significant historical trend toward more egalitarian outcomes across dyadic racial composition for explicit attitudes and for nonverbal behavior; however, participants' emotional responses and performance have remained consistent. PMID:22061690

Toosi, Negin R; Babbitt, Laura G; Ambady, Nalini; Sommers, Samuel R

2011-11-07

191

The dyad symmetry element of Epstein-Barr virus is a dominant but dispensable replication origin.  

PubMed

OriP, the latent origin of Epstein-Barr virus (EBV), consists of two essential elements: the dyad symmetry (DS) and the family of repeats (FR). The function of these elements has been predominantly analyzed in plasmids transfected into transformed cells. Here, we examined the molecular functions of DS in its native genomic context and at an ectopic position in the mini-EBV episome. Mini-EBV plasmids contain 41% of the EBV genome including all information required for the proliferation of human B cells. Both FR and DS function independently of their genomic context. We show that DS is the most active origin of replication present in the mini-EBV genome regardless of its location, and it is characterized by the binding of the origin recognition complex (ORC) allowing subsequent replication initiation. Surprisingly, the integrity of oriP is not required for the formation of the pre-replicative complex (pre-RC) at or near DS. In addition we show that initiation events occurring at sites other than the DS are also limited to once per cell cycle and that they are ORC-dependent. The deletion of DS increases initiation from alternative origins, which are normally used very infrequently in the mini-EBV genome. The sequence-independent distribution of ORC-binding, pre-RC-assembly, and initiation patterns indicates that a large number of silent origins are present in the mini-EBV genome. We conclude that, in mini-EBV genomes lacking the DS element, the absence of a strong ORC binding site results in an increase of ORC binding at dispersed sites. PMID:21603652

Ott, Elisabeth; Norio, Paolo; Ritzi, Marion; Schildkraut, Carl; Schepers, Aloys

2011-05-16

192

Effects of furniture arrangement, props, and personality on social interaction  

Microsoft Academic Search

Explored the facilitating and inhibiting effects of various furniture arrangements and 2 types of objects on social interaction. 2 experiments with 144 male and 144 female undergraduates each included all possible combinations of 4 distances and 3 orientations for the seating of dyads who were left alone to wait in a room. Results show no main effects of distance on

Albert Mehrabian; Shirley G. Diamond

1971-01-01

193

Modeling Heterogeneity in Social Interaction Processes Using Multilevel Survival Analysis  

ERIC Educational Resources Information Center

|More than 15 years ago, survival or hazard regression analyses were introduced to psychology (W. Gardner & W. A. Griffin, 1989; W. A. Griffin & W. Gardner, 1989) as powerful methodological tools for studying real time social interaction processes among dyads. Almost no additional published applications have appeared, although such data are…

Stoolmiller, Mike; Snyder, James

2006-01-01

194

A Motivational System for Regulating Human-Robot Interaction  

Microsoft Academic Search

This paper presents a motivational system for anautonomous robot which is designed to regulatehuman-robot interaction. The mode of social interactionis that of a caretaker-infant dyad wherea human acts as the caretaker for the robot. Aninfant's emotions and drives play a very importantrole in generating meaningful interactionswith the caretaker, and regulating these interactionsto maintain an environment suitable forthe learning process (Bullowa

Cynthia Breazeal Ferrell

1998-01-01

195

Maternal Positive and Negative Interaction Behaviors and Early Adolescents' Depressive Symptoms: Adolescent Emotion Regulation as a Mediator  

ERIC Educational Resources Information Center

|This study examined the relation between mothers' positive and negative interaction behaviors during mother-child interactions and the emotion regulation (ER) and depressive symptoms of their adolescent offspring. Event-planning (EPI) and problem-solving interactions (PSI) were observed in 163 mother-adolescent dyads, and adolescents also…

Yap, Marie B. H.; Schwartz, Orli S.; Byrne, Michelle L.; Simmons, Julian G.; Allen, Nicholas B.

2010-01-01

196

Maternal Positive and Negative Interaction Behaviors and Early Adolescents' Depressive Symptoms: Adolescent Emotion Regulation as a Mediator  

ERIC Educational Resources Information Center

This study examined the relation between mothers' positive and negative interaction behaviors during mother-child interactions and the emotion regulation (ER) and depressive symptoms of their adolescent offspring. Event-planning (EPI) and problem-solving interactions (PSI) were observed in 163 mother-adolescent dyads, and adolescents also provided…

Yap, Marie B. H.; Schwartz, Orli S.; Byrne, Michelle L.; Simmons, Julian G.; Allen, Nicholas B.

2010-01-01

197

Predictability of Observed Mother-Child Interaction from Preschool to Middle Childhood in a High-Risk Sample.  

ERIC Educational Resources Information Center

Examined predictability of observed parent-child interaction from preschool to middle childhood among 283 mother-child dyads who were welfare recipients enrolled in a job training program. Found that interaction in middle childhood could be predicted from observed interaction 4 years earlier. Families with greater risk factors tended to show more…

Weinfield, Nancy S.; Ogawa, John R.; Egeland, Byron

2002-01-01

198

State as an Infant-Environment Interaction: An Analysis of Mother-Infant Behavior as a Function of Sex.  

ERIC Educational Resources Information Center

|The literature on the psychological construct of state is reviewed, and it is proposed that state be defined in terms of an infant-environment interaction. Interactive behavior of 32 mother-infant dyads was observed in the home for a total of 2 hours for each pair, in order to explore various types of interactive processes and analyses. A…

Lewis, Michael

199

Ca transients from Ca channel activity in rat cardiac myocytes reveal dynamics of dyad cleft and troponin C Ca binding.  

PubMed

The properties of the dyad cleft can in principle significantly impact excitation-contraction coupling, but these properties are not easily amenable to experimental investigation. We simultaneously measured the time course of the rise in integrated Ca current (ICa) and the rise in concentration of fura 2 with Ca bound ([Ca-fura 2]) with high time resolution in rat myocytes for conditions under which Ca entry is only via L-type Ca channels and sarcoplasmic reticulum (SR) Ca release is blocked, and compared these measurements with predictions from a finite-element model of cellular Ca diffusion. We found that 1) the time course of the rise of [Ca-fura 2] follows the time course of integrated ICa plus a brief delay (1.36 +/- 0.43 ms, n = 6 cells); 2) from the model, high-affinity Ca binding sites in the dyad cleft at the level previously envisioned would result in a much greater delay (>/=3 ms) and are therefore unlikely to be present at that level; 3) including ATP in the model promoted Ca efflux from the dyad cleft by a factor of 1.57 when low-affinity cleft Ca binding sites were present; 4) the data could only be fit to the model if myofibrillar troponin C (TnC) Ca binding were low affinity (4.56 microM), like that of soluble troponin C, instead of the high-affinity value usually used (0.38 microM). In a "good model," the rate constants for Ca binding and dissociation were 0.375 times the values for soluble TnC; and 5) consequently, intracellular Ca buffering at the rise of the Ca transient is inferred to be low. PMID:14534082

Vadakkadath Meethal, Sivan; Potter, Katherine T; Redon, David; Heisey, Dennis M; Haworth, Robert A

2003-10-08

200

Pico and nano-second laser flash photolysis study on photoinduced charge separation in oligothiophene-C 60 dyad molecules  

Microsoft Academic Search

Photoinduced charge separation (CS) and charge recombination (CR) processes of octathiophene-C60 and dodecathiophene-C60 dyad molecules (8T-C60 and 12T-C60, respectively) have been investigated by time-resolved absorption spectroscopy in the visible and near-IR regions. In toluene, 18T*-C60 and 112T*-C60 showed energy transfer to 1C*-moiety predominantly, while 60 contribution of CS was small. In various polar solvents, on the other hand, CS states

Mamoru Fujitsuka; Keisuke Matsumoto; Osamu Ito; Takashi Yamashiro; Yoshio Aso; Tetsuo Otsubo

2001-01-01

201

Synthesis and structural characterization of some new porphyrin-fullerene dyads and their application in photoinduced H2 evolution.  

PubMed

The [3 + 2] cycloaddition reaction of C(60) with ethyl isonicotinoylacetate in the presence of piperidine in PhCl at room temperature or in the presence of Mn(OAc)(3) in refluxing PhCl gave the pyridyl-containing dihydrofuran-fused C(60) derivative (4-C(5)H(4)N)C(O)?C(C(60))CO(2)Et (1), whereas the phenyl-containing C(60) derivative PhC(O)?C(C(60))CO(2)Et (2) was similarly prepared by [3 + 2] cycloaddition reaction of C(60) with ethyl benzoylacetate in the presence of piperidine or Mn(OAc)(3). More interestingly, one of the new porphyrin-fullerene dyads, i.e., [4-C(5)H(4)NC(O)?C(C(60))CO(2)Et]·ZnTPPH (3, ZnTPPH = tetraphenylporphyrinozinc), could be prepared by coordination reaction of the pyridyl-containing C(60) derivative 1 with equimolar ZnTPPH in CS(2)/hexane at room temperature. In addition, the ?-keto ester-substituted porphyrin derivative H(2)TPPC(O)CH(2)CO(2)Et (4) was prepared by a sequential reaction of HO(2)CCH(2)CO(2)Et with n-BuLi in 1:2 molar ratio followed by treatment with H(2)TPPC(O)Cl in the presence of Et(3)N and then hydrolysis with diluted HCl, whereas the porphyrinozinc derivative ZnTPPC(O)CH(2)CO(2)Et (5) could be prepared by coordination reaction of 4 with Zn(OAc)(2) in refluxing CHCl(3)/MeOH. Particularly interesting is that the second new porphyrin-fullerene dyad H(2)TPPC(O)?C(C(60))CO(2)Et (6) could be prepared by [3 + 2] cycloaddition reaction of 4 with C(60) in the presence of piperidine in PhCl at room temperature. In addition, treatment of 6 with Zn(OAc)(2) in refluxing CHCl(3)/MeOH afforded the third new dyad ZnTPPC(O)?C(C(60))CO(2)Et (7). All the new compounds 1-7 were characterized by elemental analysis and various spectroscopic methods and particularly for 2, 3, and 5 by X-ray crystallography. The five-component system consisting of an electron donor EDTA, dyad 3, an electron mediator methylviologen (MV(2+)), the catalyst colloidal Pt, and a proton source HOAc was proved to be effective for photoinduced H(2) evolution. A possible pathway for such a type of H(2) evolution was proposed. PMID:21999524

Song, Li-Cheng; Liu, Xu-Feng; Xie, Zhao-Jun; Luo, Fei-Xian; Song, Hai-Bin

2011-10-14

202

Feeding styles and child weight status among recent immigrant mother-child dyads  

PubMed Central

Background Research has shown that parental feeding styles may influence children’s food consumption, energy intake, and ultimately, weight status. We examine this relationship, among recent immigrants to the US. Given that immigrant parents and children are at greater risk for becoming overweight/obese with increased time in the US, identification of risk factors for weight gain is critical. Methods Baseline data was collected on 383 mother-child dyads enrolled in Live Well, a community-based, participatory, randomized controlled lifestyle intervention to prevent weight gain in recent immigrant mothers. Socio-demographic information together with heights and weights were collected for both mother and child. Acculturation, behavioral data, and responses to the Caregiver’s Feeding Styles Questionnaire (CFSQ) were also obtained from the mother. Results The children’s average age was 6.2 ± 2.7 years, 58% male. Mothers had been in the country for an average of 6.0 ± 3.3 years, and are Brazilian (36%), Haitian (34%) and Latino (30%). Seventy-two percent of the mothers were overweight/obese, while 43% of the children were overweight/obese. Fifteen percent of mothers reported their feeding style as being high demanding/high responsive; 32% as being high demanding/low responsive; 34% as being low demanding/high responsive and 18% as being low demanding/low responsive. In bivariate analyses, feeding styles significantly differed by child BMIz-score, ethnic group, and mother’s perceived stress. In multiple linear regression, a low demanding/high responsive feeding style was found to be positively associated (ß = 0.56) with a higher child weight as compared to high demanding/high responsive, controlling for known covariates (p = 0.01). Conclusions Most mothers report having a low demanding/high responsive feeding style, which is associated with higher child weight status in this diverse immigrant population. This finding adds to the growing literature that suggests this type of feeding style may be a risk factor for childhood obesity. Further research is needed to help understand the larger socio-cultural context and its influence on feeding dynamics among immigrant families and families of lower incomes. How parents establish a certain feeding style in their home country compared to when they move to the US “obesogenic” environment, should also be explored.

2012-01-01

203

Non-Native Speaker Interaction Management Strategies in a Network-Based Virtual Environment  

ERIC Educational Resources Information Center

This article investigates the dyad-based communication of two groups of non-native speakers (NNSs) of English involved in real time interaction in a type of text-based computer-mediated communication (CMC) tool known as a MOO. The object of this semester long study was to examine the ways in which the subjects managed their L2 interaction during…

Peterson, Mark

2008-01-01

204

The Timing of Puberty and Its Relationship to Adolescent and Parent Perceptions of Family Interactions  

Microsoft Academic Search

This study addresses whether the timing of pubescence influences the perceptions of intrafamilial interactions. The sample consisted of 133 parent-adolescent dyads enrolled in a 1-week university summer program. Both parents and adolescents were given questionnaires evaluating family interactions in terms of support, control, and conflict. Pubertal maturation was assessed by visible signs of secondary sex characteristics. Results indicate that the

Ritch C. Savin-Williams; Stephen A. Small

1986-01-01

205

Mother-Infant Interaction and Infant Development Among the Wolof of Senegal.  

ERIC Educational Resources Information Center

|Ten mother-infant dyads were observed in their homes for four hours each during one month in order to measure interactive aspects of their behavior. Demographic data are included for the participating families, who are members of the Wolof in Senegal, Africa. For this study, interaction was defined as a sequence of behaviors involving both…

Lusk, Diane; Lewis, Michael

206

A general framework for the statistical analysis of sequential dyadic interaction data  

Microsoft Academic Search

Recent interest in sequential dyadic interactions has motivated researchers to develop methods ap- propriate for the analysis of such data. After briefly reviewing a series of methodological papers focusing on the analysis of discrete-valued observations, we present a general framework for studying many substantive effects, including dominance and autodependencies, in social interactions mea- sured on dyads. We show how this

Dawn Iacobucci; Stanley Wasserman

1988-01-01

207

Candidate gene analysis of spontaneous preterm delivery: New insights from re-analysis of a case-control study using case-parent triads and control-mother dyads  

PubMed Central

Background Spontaneous preterm delivery (PTD) has a multifactorial etiology with evidence of a genetic contribution to its pathogenesis. A number of candidate gene case-control studies have been performed on spontaneous PTD, but the results have been inconsistent, and do not fully assess the role of how two genotypes can impact outcome. To elucidate this latter point we re-analyzed data from a previously published case-control candidate gene study, using a case-parent triad design and a hybrid design combining case-parent triads and control-mother dyads. These methods offer a robust approach to genetic association studies for PTD compared to traditional case-control designs. Methods The study participants were obtained from the Norwegian Mother and Child Cohort Study (MoBa). A total of 196 case triads and 211 control dyads were selected for the analysis. A case-parent triad design as well as a hybrid design was used to analyze 1,326 SNPs from 159 candidate genes. We compared our results to those from a previous case-control study on the same samples. Haplotypes were analyzed using a sliding window of three SNPs and a pathway analysis was performed to gain biological insight into the pathophysiology of preterm delivery. Results The most consistent significant fetal gene across all analyses was COL5A2. The functionally similar COL5A1 was significant when combining fetal and maternal genotypes. PON1 was significant with analytical approaches for single locus association of fetal genes alone, but was possibly confounded by maternal effects. Focal adhesion (hsa04510), Cell Communication (hsa01430) and ECM receptor interaction (hsa04512) were the most constant significant pathways. Conclusion This study suggests a fetal association of COL5A2 and a combined fetal-maternal association of COL5A1 with spontaneous PTD. In addition, the pathway analysis implied interactions of genes affecting cell communication and extracellular matrix.

2011-01-01

208

Mutation of the c-fos gene dyad symmetry element inhibits serum inducibility of transcription in vivo and the nuclear regulatory factor binding in vitro.  

PubMed Central

In vitro mutagenesis of a 61-base-pair DNA sequence element that is necessary for induction of the c-fos proto-oncogene by growth factors revealed that a small region of dyad symmetry within the sequence element is critical for c-fos transcriptional activation. The same c-fos dyad symmetry element was found to bind a nuclear protein in vitro, causing a specific mobility shift of this c-fos regulatory sequence. An analysis of insertion and deletion mutants established a strict correlation between the ability of the dyad symmetry element to promote serum activation of c-fos transcription and in vitro nuclear protein binding. These experiments suggest that the DNA mobility shift assay detects a nuclear protein that mediates growth factor stimulation of c-fos expression. In vitro competition experiments indicate that the c-fos regulatory factor also binds to sequences within another growth factor-inducible gene, the beta-actin gene. Images

Greenberg, M E; Siegfried, Z; Ziff, E B

1987-01-01

209

Segregated and alternately stacked donor/acceptor nanodomains in tubular morphology tailored with zinc porphyrin-C60 amphiphilic dyads: clear geometrical effects on photoconduction.  

PubMed

Amphiphilic zinc porphyrin (P(Zn); electron donor, D)-fullerene (C(60); electron acceptor, A) dyads 2 and 3, bearing an identical hydrophilic wedge with triethylene glycol chains but different linkers between the P(Zn) and C(60) units, self-assemble into nanotubes with essentially different dimensional and geometrical features from one another. The nanotube from dyad 2 with an ester linker consists of a bilayer wall formed with coaxially segregated D and A nanodomains along the tube axis (coaxial D-A heterojunction), thereby displaying explicit photoconductivity with ambipolar carrier transport properties. In contrast, the nanotube from dyad 3 with a rigid arylacetylene linker consists of a monolayer wall with an alternate geometry of D/A stacking, resulting in poor photoconducting outputs. Such a geometrical difference also significantly affects the photovoltaic properties. PMID:22280067

Charvet, Richard; Yamamoto, Yohei; Sasaki, Takayuki; Kim, Jungeun; Kato, Kenichi; Takata, Masaki; Saeki, Akinori; Seki, Shu; Aida, Takuzo

2012-01-27

210

Autism spectrum disorder: does neuroimaging support the DSM-5 proposal for a symptom dyad? A systematic review of functional magnetic resonance imaging and diffusion tensor imaging studies.  

PubMed

A systematic review of 208 studies comprising functional magnetic resonance imaging and diffusion tensor imaging data in patients with 'autism spectrum disorder' (ASD) was conducted, in order to determine whether these data support the forthcoming DSM-5 proposal of a social communication and behavioral symptom dyad. Studies consistently reported abnormal function and structure of fronto-temporal and limbic networks with social and pragmatic language deficits, of temporo-parieto-occipital networks with syntactic-semantic language deficits, and of fronto-striato-cerebellar networks with repetitive behaviors and restricted interests in ASD patients. Therefore, this review partially supports the DSM-5 proposal for the ASD dyad. PMID:21932156

Pina-Camacho, Laura; Villero, Sonia; Fraguas, David; Boada, Leticia; Janssen, Joost; Navas-Sánchez, Francisco J; Mayoral, Maria; Llorente, Cloe; Arango, Celso; Parellada, Mara

2012-07-01

211

Models of dyadic social interaction.  

PubMed Central

We discuss the logic of research designs for dyadic interaction and present statistical models with parameters that are tied to psychologically relevant constructs. Building on Karl Pearson's classic nineteenth-century statistical analysis of within-organism similarity, we describe several approaches to indexing dyadic interdependence and provide graphical methods for visualizing dyadic data. We also describe several statistical and conceptual solutions to the 'levels of analytic' problem in analysing dyadic data. These analytic strategies allow the researcher to examine and measure psychological questions of interdependence and social influence. We provide illustrative data from casually interacting and romantic dyads.

Griffin, Dale; Gonzalez, Richard

2003-01-01

212

Hydrogen-bond strengthening upon photoinduced electron transfer in ruthenium-anthraquinone dyads interacting with hexafluoroisopropanol or water.  

PubMed

Quinones play a key role as primary electron acceptors in natural photosynthesis, and their reduction is known to be facilitated by hydrogen-bond donors or protonation. In this study, the influence of hydrogen-bond donating solvents on the thermodynamics and kinetics of intramolecular electron transfer between Ru(bpy)(3)(2+) (bpy = 2,2'-bipyridine) and 9,10-anthraquinone redox partners linked together via one up to three p-xylene units was investigated. Addition of relatively small amounts of hexafluoroisopropanol to dichloromethane solutions of these rigid rodlike donor-bridge-acceptor molecules is found to accelerate intramolecular Ru(bpy)(3)(2+)-to-anthraquinone electron transfer substantially because anthraquinone reduction occurs more easily in the presence of the strong hydrogen-bond donor. Similarly, the rates for intramolecular electron transfer are significantly higher in acetonitrile/water mixtures than in dry acetonitrile. In dichloromethane, an increase in the association constant between hexafluoroisopropanol and anthraquinone by more than 1 order of magnitude following quinone reduction points to a significant strengthening of the hydrogen bonds between the hydroxyl group of hexafluoroisopropanol and the anthraquinone carbonyl functions. The photoinduced intramolecular long-range electron transfer process thus appears to be followed by proton motion; hence the overall photoinduced reaction may be considered a variant of stepwise proton-coupled electron transfer (PCET) in which substantial proton density (rather than a full proton) is transferred after the electron transfer has occurred. PMID:22435604

Hankache, Jihane; Hanss, David; Wenger, Oliver S

2012-03-21

213

Parent-Child Interactions in Anxious Families  

Microsoft Academic Search

A considerable amount of research has examined factors associated with the etiology and maintenance of anxiety disorders in children. The familial nature of anxiety has been well-established, with genetic studies showing that approximately 30% of the variance is accounted for by genetic factors. Research into the family environment documents behavioral differences in interactions between non-anxious parent-child and anxious parent-child dyads,

Matthew Schrock; Janet Woodruff-Borden

2010-01-01

214

Do Verbal Interactions with Infants during Electronic Media Exposure Mitigate Adverse Impacts on Their Language Development as Toddlers?  

ERIC Educational Resources Information Center

|The goal of this study was to determine whether verbal interactions between mothers and their 6-month-old infants during media exposure ("media verbal interactions") might have direct positive impacts, or mitigate any potential adverse impacts of media exposure, on language development at 14 months. For 253 low-income mother-infant dyads

Mendelsohn, Alan L.; Brockmeyer, Carolyn A.; Dreyer, Benard P.; Fierman, Arthur H.; Berkule-Silberman, Samantha B.; Tomopoulos, Suzy

2010-01-01

215

Interaction Domains and Suicide: A Population-Based Panel Study of Suicides in Stockholm, 1991-1999  

ERIC Educational Resources Information Center

This article examines how suicides influence suicide risks of others within two interaction domains: the family and the workplace. A distinction is made between dyad-based social-interaction effects and degree-based exposure effects. A unique database including all individuals who ever lived in Stockholm during the 1990s is analyzed. For about 5.6…

Hedstrom, Peter; Liu, Ka-Yuet; Nordvik, Monica K.

2008-01-01

216

Taking Stress Response out of the Box: Stability, Discontinuity, and Temperament Effects on HPA and SNS across Social Stressors in Mother-Infant Dyads  

ERIC Educational Resources Information Center

|This study investigated continuity and stability of hypothalamic-pituitary-adrenal (HPA) and sympathetic nervous system (SNS) response measures in mother-infant dyads across 2 different types of social stress sessions. Synchrony of response trajectories across systems (SNS-HPA coordination) and partners (mother-infant attunement) was addressed,…

Laurent, Heidemarie K.; Ablow, Jennifer C.; Measelle, Jeffrey

2012-01-01

217

Developmental Continuity and Stability of Emotional Availability in the Family: Two Ages and Two Genders in Child-Mother Dyads from Two Regions in Three Countries  

ERIC Educational Resources Information Center

This study employs an intra-national and cross-national, prospective, and longitudinal design to examine age, gender, region, and country variation in group mean-level continuity and individual-differences stability of emotional availability in child-mother dyads. Altogether, 220 Argentine, Italian, and US American metropolitan and rural residence…

Bornstein, Marc H.; Suwalsky, Joan T. D.; Putnick, Diane L.; Gini, Motti; Venuti, Paola; de Falco, Simona; Heslington, Marianne; de Galperin, Celia Zingman

2010-01-01

218

Growth Curve Models for Indistinguishable Dyads Using Multilevel Modeling and Structural Equation Modeling: The Case of Adolescent Twins' Conflict With Their Mothers  

Microsoft Academic Search

Growth modeling is a useful tool for studying change over time, and it is becoming increasingly popular with developmental researchers. There is a considerable methodological literature surrounding growth modeling for individuals; however, far less attention has been focused on growth models for pairs of related individuals (i.e., dyads). In this article, the authors consider dyadic growth models for those cases

Deborah A. Kashy; M. Brent Donnellan; S. Alexandra Burt; Matt McGue

2008-01-01

219

Similarities amid the Difference: Caregiving Burden and Adaptation Outcomes in Dyads of Parents and Their Children with and without Cerebral Palsy  

ERIC Educational Resources Information Center

|This study had two main objectives: first, to examine the direct and indirect effects, via social support, of caregiving burden on the adaptation outcomes of children/adolescents with cerebral palsy and their parents; and second, to assess the invariance of such models in clinical vs. healthy subsamples. Participants were 210 dyads of…

Carona, C.; Crespo, C.; Canavarro, M. C.

2013-01-01

220

Developmental Continuity and Stability of Emotional Availability in the Family: Two Ages and Two Genders in Child-Mother Dyads from Two Regions in Three Countries  

ERIC Educational Resources Information Center

|This study employs an intra-national and cross-national, prospective, and longitudinal design to examine age, gender, region, and country variation in group mean-level continuity and individual-differences stability of emotional availability in child-mother dyads. Altogether, 220 Argentine, Italian, and US American metropolitan and rural…

Bornstein, Marc H.; Suwalsky, Joan T. D.; Putnick, Diane L.; Gini, Motti; Venuti, Paola; de Falco, Simona; Heslington, Marianne; de Galperin, Celia Zingman

2010-01-01

221

Autism Spectrum Disorder: Does Neuroimaging Support the DSM-5 Proposal for a Symptom Dyad? A Systematic Review of Functional Magnetic Resonance Imaging and Diffusion Tensor Imaging Studies  

ERIC Educational Resources Information Center

|A systematic review of 208 studies comprising functional magnetic resonance imaging and diffusion tensor imaging data in patients with "autism spectrum disorder" (ASD) was conducted, in order to determine whether these data support the forthcoming DSM-5 proposal of a social communication and behavioral symptom dyad. Studies consistently reported…

Pina-Camacho, Laura; Villero, Sonia; Fraguas, David; Boada, Leticia; Janssen, Joost; Navas-Sanchez, Francisco J.; Mayoral, Maria; Llorente, Cloe; Arango, Celso; Parellada, Mara

2012-01-01

222

The Ability of Nash's Theory of Cooperative Games to Predict the Outcomes of Buyer-Seller Negotiations: A Dyad-Level Test  

Microsoft Academic Search

This research develops and implements a dyad-level procedure for testing whether the outcomes of buyer-seller negotiations correspond to settlements prescribed by Nash's theory of cooperative games. The procedure entails a multivariate statistical test in which some parameters are estimated by simulation, while others are provided directly from the assessment of negotiator utility functions by means of conjoint analysis. The procedure

Scott A. Neslin; Leonard Greenhalgh

1986-01-01

223

Composites of C60 based poly(phenylene vinylene) dyad and conjugated polymer for polymer light-emitting devices  

NASA Astrophysics Data System (ADS)

A C60-based poly(phenylene vinylene) (PPV) dyad poly{(2,5-di-pentoxyl-phenylene)-4diylvinylene-3,6-[9-(1-azafulleroid-propyl)-carbazolenevinylene]} (PPV-AFCAR) and an emissive conjugated polymer poly{1,4[2-(3,7-dimethyloctyloxy)-3,5,6-trimethoxy]phenylene vinylene} (POMPV) were prepared to investigate the role of [60]fullerene in conjugated polymer composites. Multilayer organic light-emitting devices with the configuration of indium tin oxide/poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS)/blends/2-(4-biphenylyl)-5-(4-tert-butylphenyl)-1,3,4-oxadiazole(Bu-PBD)/LiF/Al were fabricated using PPV-AFCAR as a dopant and POMPV as an emissive material.

Wang, Shu; Yang, Junlin; Li, Yuliang; Lin, Hongzhen; Guo, Zhixin; Xiao, Shengxiong; Shi, Zhiqiang; Zhu, Daoben; Woo, Hyung-Suk; Carroll, David L.; Kee, In-Seo; Lee, Ji-Hoon

2002-05-01

224

Latina mother-daughter dyads: relations between attachment and sexual behavior under the influence of alcohol or drugs.  

PubMed

Associations among mother-daughter attachment, mother and daughter substance abuse, and daughter's sexual behavior under the influence of drugs and alcohol were investigated among 158 adult U.S. Latina daughters. Latina daughters were sampled from four mother-daughter dyad types: substance abusing mother and daughter, substance abusing mother only, substance abusing daughter only, and non-substance-abusing mother and daughter. Substance abusing daughters with substance abusing mothers, and daughters who were less strongly attached to their mothers, reported more sex under the influence of drugs. Age, marital status, substance abuse, and mother's substance abuse all influenced the daughter's sex under the influence of alcohol. An unexpected positive association between attachment and sex under the influence of alcohol was found for daughters who were more closely attached to a substance abusing mother. Implications for future research, and HIV/AIDS and drug prevention and treatment programs for Latinas are discussed. PMID:19399605

De La Rosa, Mario; Dillon, Frank R; Rojas, Patria; Schwartz, Seth J; Duan, Rui

2009-04-28

225

The silane isotopomers (Si-29)H4 and (Si-30)H4 constants of the nu2/nu4 dyad  

NASA Astrophysics Data System (ADS)

Silane isotopomers may be of some importance in IR astronomy, since the main isotopomer (with Si-28) has already been discovered in a planetary nebula surrounding the IR star IRC + 10216. With a view toward future isotope investigations of stellar objects, the IR spectrum of two silane isotopomers containing Si-29 and Si-30 is investigated with tunable CO2 laser sidebands in the 877-954-kayser range at a resolution of 0.00002 kayser. An analysis is performed of the nu2 and nu4 dyad, including data by Henry and Valentin (1986) from a Fourier transform spectrum and sub-Doppler lines observed by Borde (1983) and Skrzypczak et al. (1989). Forty-one vibration-rotation constants of the nu2/nu4 Hamiltonian are determined from the spectrum fitting.

Prinz, H.; Kreiner, W. A.; Pierre, G.

1990-08-01

226

The social network structure of a wild meerkat population: 1. Intergroup interactions  

Microsoft Academic Search

Groups of individuals frequently interact with each other, but typically analysis of such interactions is restricted to isolated\\u000a dyads. Social network analysis (SNA) provides a method of analysing polyadic interactions and is used to analyse interactions\\u000a between individuals. We use a population of 12 groups (ca. 250 animals) of wild meerkats (Suricata suricatta) to test whether SNA can also be

J. A. Drewe; J. R. Madden; G. P. Pearce

2009-01-01

227

Marine Rhodobacteraceae L-haloacid dehalogenase contains a novel His/Glu dyad that could activate the catalytic water.  

PubMed

The putative L-haloacid dehalogenase gene (DehRhb) from a marine Rhodobacteraceae family was cloned and overexpressed in Escherichia coli. The DehRhb protein was shown to be an L-haloacid dehalogenase with highest activity towards brominated substrates with short carbon chains (? C3). The optimal temperature for enzyme activity was 55 °C, and the Vmax and Km were 1.75 ?m·min(-1) ·mg(-1) of protein and 6.72 mm, respectively, when using monobromoacetic acid as a substrate. DehRhb showed moderate thermal stability, with a melting temperature of 67 °C. The enzyme demonstrated high tolerance to solvents, as shown by thermal shift experiments and solvent incubation assays. The DehRhb protein was crystallized and structures of the native, reaction intermediate and substrate-bound forms were determined. The active site of DehRhb had significant differences from previously studied L-haloacid dehalogenases. The asparagine and arginine residues shown to be essential for catalytic activity in other L-haloacid dehalogenases are not present in DehRhb. The histidine residue which replaces the asparagine residue in DehRhb was coordinated by a conformationally strained glutamate residue that replaces a conserved glycine. The His/Glu dyad is positioned for deprotonation of the catalytic water which attacks the ester bond in the reaction intermediate. The catalytic water in DehRhb is shifted by ~ 1.5 Å from its position in other L-haloacid dehalogenases. A similar His/Glu or Asp dyad is known to activate the catalytic water in haloalkane dehalogenases. The DehRhb enzyme represents a novel member within the L-haloacid dehalogenase family and it has potential to be used as a commercial biocatalyst. PMID:23384397

Novak, Halina R; Sayer, Christopher; Isupov, Michail N; Paszkiewicz, Konrad; Gotz, Dorothee; Spragg, Andrew Mearns; Littlechild, Jennifer A

2013-03-08

228

Maternal Interactive Behaviour in Early Infancy and Later Attachment  

Microsoft Academic Search

Evolutionary considerations (cf. MacDonald, 1992) suggest that emotional closeness and security of attachment address different functional systems. We assume that maternal sensitivity during early face-to-face interactions is related to later emotional closeness, whereas the contingency of maternal reactions towards the infant’s signals is related to later security of attachment. Forty-three mother-infant dyads were videotaped at home during face-to-face interactions when

Susanne Völker; Heidi Keller; Arnold Lohaus; Martina Cappenberg; Athanasios Chasiotis

1999-01-01

229

Behavior State Matching During Interactions of Preadolescent Friends Versus Acquaintances  

Microsoft Academic Search

Face-to-face interactions of 56 sixth-grade friend and acquaintance pairs were videotaped, heart rate was recorded, and saliva cortisol was sampled. During interactions the friend dyads were more attentive, affectively positive, vocal, active, involved, relaxed, and playful, and their cortisol values suggested lower stress levels. They also spent more time together in mutually interested and animated states, and they assigned higher

Tiffany M. Field; Paul Greenwald; Connie J. Morrow; Brian T. Healy; Tamar Foster; Moshe Guthertz; Patricia Frost

1992-01-01

230

Dyadic Interaction Profiles in Infancy and Preschool Intelligence  

Microsoft Academic Search

The present study reports the results of a 2-year longitudinal study of a sample of 23 mother–infant dyads observed during a free-play interaction session when infants were 6 and 8 months of age and then assessed for language and intellectual outcomes during the second and third years of life. Analyses of interaction variables during infancy showed developmental trends across these

Terrill F. Saxon; John Colombo; Eric L. Robinson; Janet E. Frick

2000-01-01

231

Gravitating toward Science: Parent-Child Interactions at a Gravitational-Wave Observatory  

ERIC Educational Resources Information Center

This research examined the nature of parent-child conversations at an informal science education center housed in an active gravitational-wave observatory. Each of 20 parent-child dyads explored an interactive exhibit hall privately, without the distraction of other visitors. Parents employed a variety of strategies to support their children's…

Szechter, Lisa E.; Carey, Elizabeth J.

2009-01-01

232

Gender roles, computer attitudes, and dyadic computer interaction performance in college students  

Microsoft Academic Search

Females tend to score lower than males on measures of computer aptitude and attitudes. This study examined the potential effects of several mediating factors, sex of experimenter, sex of experimental partner, sex typing (Bem Sex Role Inventory score), and level of past experience, on a computer interaction task involving a dyad. College students, drawn from a primarily white college population,

Sue Winkle Williams; Shirley M. Ogletree; William Woodburn; Paul Raffeld

1993-01-01

233

Gender differences of children's social skills and parenting using Interaction Rating Scale (IRS)  

Microsoft Academic Search

Background: The purpose of this paper is to describe the gender differences of the Interaction Rating Scale (IRS) as an evidence-based practical index of children's social skills and parenting.Methods: The participants in our study, which was conducted as part of a Japan Science and Technology Agency (JST) cohort study project, were 370 dyads of children with their caregivers were followed

T. Anme; R. Shinohara; Y. Sugisawa; L. Tong; E. Tanaka; T. Watanabe; Y. Onda; Y. Kawashima; M. Hirano; E. Tomisaki; H. Mochizuki; K. Morita; A. Gan-Yadam; Y. Yato; N. Yamakawa

2010-01-01

234

Gender Clues and Cues: Online Interactions as Windows into Lay Theories about Men and Women  

Microsoft Academic Search

The Internet allows the process of “doing gender” (West & Zimmerman, 1987) to be examined in ways previously unavailable. In the studies presented here, dyads conversed online while (a) knowing or, (b) not knowing each other's gender, or (c) with one participant feigning the opposite gender. Not knowing gender had a surprisingly small effect on the interaction. The results further

Melissa J. Williams; Gerald A. Mendelsohn

2008-01-01

235

Playing with Technology: Mother-Toddler Interaction Scores Lower during Play with Electronic Toys  

ERIC Educational Resources Information Center

To investigate play with electronic toys (battery-operated or digital), 25 mother-toddler (16-24 months old) dyads were videotaped in their homes playing with sets of age-appropriate electronic and non-electronic toys for approximately 10 min each. Parent-child interactions were coded from recorded segments of both of the play conditions using the…

Wooldridge, Michaela B.; Shapka, Jennifer

2012-01-01

236

A Comparison of Dyadic Interactions and Coping with Still-Face in Healthy Pre-Term and Full-Term Infants  

ERIC Educational Resources Information Center

|Pre-term birth has a significant impact on infants' social and emotional competence, however, little is known about regulatory processes in pre-term mother-infant dyads during normal or stressful interactions. The primary goals of this study were to investigate the differences in infant and caregiver interactive behaviour and dyadic coordination…

Montirosso, Rosario; Borgatti, Renato; Trojan, Sabina; Zanini, Rinaldo; Tronick, Ed

2010-01-01

237

Meeting your match: how attractiveness similarity affects approach behavior in mixed-sex dyads.  

PubMed

This experimental study investigated approach behavior toward opposite-sex others of similar versus dissimilar physical attractiveness. Furthermore, it tested the moderating effects of sex. Single participants interacted with confederates of high and low attractiveness. Observers rated their behavior in terms of relational investment (i.e., behavioral efforts related to the improvement of interaction fluency, communication of positive interpersonal affect, and positive self-presentation). As expected, men displayed more relational investment behavior if their own physical attractiveness was similar to that of the confederate. For women, no effects of attractiveness similarity on relational investment behavior were found. Results are discussed in the light of positive assortative mating, preferences for physically attractive mates, and sex differences in attraction-related interpersonal behaviors. PMID:19336540

van Straaten, Ischa; Engels, Rutger C M E; Finkenauer, Catrin; Holland, Rob W

2009-03-31

238

Difference without dominance: Children's talk in mixed- and same-sex dyads  

Microsoft Academic Search

This study explores whether third graders verbalize gender differences in dominance in mixed- and same-sex interaction. We tape-recorded the conversations of 43 pairs of Caucasian working-class children playing checkers in same- or mixed-sex conditions. Children appear to develop gender-differentiated speech styles. Boys brag and insult their opponents in both mixed- and same-sex conditions more often than do girls. Girls talk

Laura A. McCloskey; Lerita M. Coleman

1992-01-01

239

Multivariate assessment of conflict in distressed and nondistressed mother-adolescent dyads  

PubMed Central

A battery of measures was used to assess conflict between mothers and young adolescents (females and males, 11 to 15 years of age). Two groups of families, one composed of a distressed clinical sample (N = 38), the other a nondistressed normative sample (N = 40), participated. The assessment battery included retrospective judgments, frequency estimates, self-monitored home recording, and tape-recorded discussion of a home problem. Content of assessment measures tapped aspects of parental control, decision-making, self-reported interaction behavior, arguments, interaction behavior rated by independent “blind” observers, frequency and anger-intensity of specific problematic issues, and perceptions of positive and negative behaviors of the other family member. Based on univariate analyses, 21 of the 26 defined variables discriminated significantly in the predicted direction. Maternal and adolescent reports of behavior and independent ratings of tape-recorded interaction emerged as strong and consistent discriminators. Stepwise multivariate discriminant analysis provided successful classification of 100% of the families based on the inclusion of nine variables. In a cross-validation sample, 84% of the families were correctly classified. Implications for systematic outcome research as well as clinical application are discussed.

Prinz, Ronald J.; Foster, Sharon; Kent, Ronald N.; O'Leary, K. Daniel

1979-01-01

240

Constraints on competitive performance of attacker-defender dyads in team sports.  

PubMed

Previous research on coordination dynamics of 1 vs. 1 sub-phases in team sports has reported stable emergent patterns of coordination in the displacement trajectories of attackers and defenders. The aim of this study was to use attacker-defender interactions in competitive team match-play to investigate how the locations of the goal and ball constrain the pattern-forming dynamics of attacker-defender dyadic systems. Ten high-level futsal matches were filmed and 13 goal sequences selected for analysis. Displacements of the players and the ball were filmed and digitized from 52 attacker-defender dyadic system interactions. Results showed that, although attackers and defenders exhibited similar angular orientations to the goal, the latter always remained closer to the goal than attackers. Observations revealed that in-phase patterns of coordination emerged from changes to both the distances and angles of attackers and defenders to the goal. Attackers always remained closer to the ball than defenders, while the latter exhibited a lower angle to the ball than attackers. A pattern of in-phase coordination modes emerged between the attackers and defenders' distances and angles to the ball. This study helps us to understand interpersonal interactions in team sports by explaining how attackers and defenders use information about their relative positioning to the goal and the ball to perform successfully. PMID:22260194

Vilar, Luís; Araújo, Duarte; Davids, Keith; Travassos, Bruno

2012-01-19

241

Longitudinal Associations Between the Quality of Parent?Child Interactions and Children's Sleep at Preschool Age  

Microsoft Academic Search

This study aimed to examine the prospective longitudinal links between the quality of mother?child and father?child interactions and preschoolers' sleep. Three dimensions of maternal interactive behavior were considered using 70 mother?child dyads, while the quality of father?child interactions was assessed using 41 of these families. Maternal mind?mindedness was assessed at 12 months during a mother?infant free-play sequence, maternal sensitivity was

Stéphanie Bordeleau; Annie Bernier; Julie Carrier

2012-01-01

242

Child-Directed Interaction: Prediction of Change in Impaired Mother–Child Functioning  

Microsoft Academic Search

The first phase of parent–child interaction therapy (PCIT), called child-directed interaction, teaches parents to use positive and differential social attention to improve the parent–child relationship. This study examined predictors of change in mother and child functioning during the child-directed interaction for 100 mother–child dyads. The children were 3–6-years-old and diagnosed with oppositional defiant disorder. After establishing that significant improvements occurred

Michelle D. Harwood; Sheila M. Eyberg

2006-01-01

243

Turkish mothers’ self?efficacy beliefs and styles of interactions with their children with language delays  

Microsoft Academic Search

Turkish mothers’ self?efficacy beliefs and their interactional behaviors with their children with language delays are described and explored. Participants included 19 mother–child dyads. Mothers’ interaction with their children with language delays was videotaped for 30 minutes in a free?play context. Regarding mothers’ interactional behaviors, results indicate that most mothers were sensitive to the behaviors of their children, responsive and effective

Ibrahim H. Diken

2009-01-01

244

Highly Efficient Singlet-Singlet Energy Transfer in Light-Harvesting [60,70]Fullerene-4-Amino-1,8-naphthalimide Dyads.  

PubMed

New C60 and C70 fullerene dyads formed with 4-amino-1,8-naphthalimide chromophores have been prepared by the Bingel cyclopropanation reaction. The resulting monoadducts were investigated with respect to their fluorescence properties (quantum yields and lifetimes) to unravel the role of the charge-transfer naphthalimide chromophore as a light-absorbing antenna and excited-singlet-state sensitizer of fullerenes. The underlying intramolecular singlet-singlet energy transfer (EnT) process was fully characterized and found to proceed quantitatively (?EnT ?1) for all dyads. Thus, these conjugates are of considerable interest for applications in which fullerene excited states have to be created and photonic energy loss should be minimized. In polar solvents (tetrahydrofuran and benzonitrile), fluorescence quenching of the fullerene by electron transfer from the ground-state aminonaphthalimide was postulated as an additional path. PMID:23868354

Remón, Patricia; Parente Carvalho, Cátia; Baleizão, Carlos; Berberan-Santos, Mario Nuno; Pischel, Uwe

2013-07-19

245

His···Asp Catalytic Dyad of Ribonuclease A:  Structure and Function of the Wild-Type, D121N, and D121A Enzymes †  

Microsoft Academic Search

The side chains of histidine and aspartate residues form a hydrogen bond in the active sites of many enzymes. In serine proteases, the His‚‚‚Asp hydrogen bond of the catalytic triad is known to contribute greatly to catalysis, perhaps via the formation of a low-barrier hydrogen bond. In bovine pancreatic ribonuclease A (RNase A), the His‚‚‚Asp dyad is composed of His119

L. Wayne Schultz; David J. Quirk; Ronald T. Raines

1998-01-01

246

A selective redox and chromogenic probe for Hg(II) in aqueous environment based on a ferrocene-azaquinoxaline dyad.  

PubMed

A new chemosensor molecule 4 based on a ferrocene-azaquinoxaline dyad effectively recognizes Hg(2+) in an aqueous environment as well as Pb(2+) and Zn(2+) metal cations in CH(3)CN solution through three different channels. Upon recognition, an anodic shift of the ferrocene/ferrocenium oxidation peaks and a progressive red shift (Deltalambda = 112-40 nm) of the low energy band, in their absorption spectra, is produced. These changes in the absorption spectra are accompanied by color changes from orange to deep green, for Hg(2+), and to purple in the cases of Pb(2+) and Zn(2+). Remarkably, the redox and colorimetric responses toward Hg(2+) are preserved in the presence of water (CH(3)CN/H(2)O, 3/7). The emission spectrum of 4 in CH(3)CN (lambda(exc) = 270 nm) undergoes important chelation enhancement of fluorescence (CHEF) in the presence of Hg(2+) (CHEF = 204), Pb(2+) (CHEF = 90), and Zn(2+) (CHEF = 184) metal cations. Along with the spectroscopic data, the combined (1)H NMR data of the complexes and the theoretical calculation suggest the proposed bridging coordination modes. PMID:19925015

Zapata, Fabiola; Caballero, Antonio; Espinosa, Arturo; Tárraga, Alberto; Molina, Pedro

2009-12-21

247

Testing the perfectionism model of binge eating in mother-daughter dyads: a mixed longitudinal and daily diary study.  

PubMed

The perfectionism model of binge eating is an integrative model explaining why perfectionism is tied to binge eating. This study extended and tested this emerging model by proposing daughters' socially prescribed perfectionism (i.e., perceiving one's mother is harshly demanding perfection of oneself) and mothers' psychological control (i.e., a negative parenting style involving control and demandingness) contribute indirectly to daughters' binge eating by generating situations or experiences that trigger binge eating. These binge triggers include discrepancies (i.e., viewing oneself as falling short of one's mother's expectations), depressive affect (i.e., feeling miserable and sad), and dietary restraint (i.e., behaviors aimed at reduced caloric intake). This model was tested in 218 mother-daughter dyads studied using a mixed longitudinal and daily diary design. Daughters were undergraduate students. Results largely supported hypotheses, with bootstrapped tests of mediation suggesting daughters' socially prescribed perfectionism and mothers' psychological control contribute to binge eating through binge triggers. For undergraduate women who believe their mothers rigidly require them to be perfect and whose mothers are demanding and controlling, binge eating may provide a means of coping with or escaping from an unhealthy, unsatisfying mother-daughter relationship. PMID:23557815

Mushquash, Aislin R; Sherry, Simon B

2013-02-20

248

Typing of Nonencapsulated Haemophilus Strains by Repetitive-Element Sequence-Based PCR Using Intergenic Dyad Sequences  

PubMed Central

Intergenic dyad sequences (IDS) are short repeated elements that have been described for several Haemophilus genomes and for only two other bacterial genera. We developed a repetitive-element sequence-based PCR using an IDS-specific primer as a typing method (IDS-PCR) for nonencapsulated Haemophilus strains and compared this technique with pulsed-field gel electrophoresis (PFGE) of DNA restricted with SmaI. IDS-PCR was rapid, easy to perform, and reproducible, with a high discriminatory capacity for nontypeable Haemophilus influenzae (NTHI) strains. The 69 NTHI strains tested generated 65 different banding patterns. Epidemiologically related strains gave similar or identical fingerprints, and all of the unrelated strains except two showed different patterns. These results were in agreement with those obtained by PFGE. For 20 genital strains usually identified as being biotype IV NTHI and belonging to a cryptic genospecies of Haemophilus with remarkable genetic homogeneity, four bands were significantly present and six bands were significantly absent from the fingerprints. The 20 strains were gathered in 11 closely related profiles, whereas PFGE provided no band when DNA was treated with SmaI. IDS-PCR improved the differentiation previously obtained within this species by ribotyping and multilocus enzyme electrophoresis. Our findings suggest that IDS-PCR is a rapid, reliable, and discriminatory method for typing NTHI strains and is currently the most efficient method for distinguishing strains within the cryptic genospecies of Haemophilus.

Bruant, Guillaume; Watt, Stephane; Quentin, Roland; Rosenau, Agnes

2003-01-01

249

Improving the efficiency of the photoinduced charge-separation process in a rhenium(I)-zinc porphyrin dyad by simple chemical functionalization.  

PubMed

We demonstrate here that, whereas the rhenium(I)-zinc porphyrin dyad fac-[Re(CO)3(bpy)(Zn·4'MPyP)](CF3SO3) [1; 4'MPyP = 5-(4'-pyridyl)-10,15,20-triphenylporphyrin] shows no evidence for photoinduced electron transfer upon excitation in the visible region because the charge-separated state ZnP(+)-Re(-) is almost isoenergetic with the singlet excited state of the zinc porphyrin (?G = -0.05 eV), the introduction of electron-withdrawing ethyl ester groups on the bpy ligand significantly improves the thermodynamics of the process (?G = -0.42 eV). As a consequence, in the new dyad fac-[Re(CO)3(4,4'-DEC-bpy)(Zn·4'MPyP)](CF3SO3) (4; 4,4'-DEC-bpy = 4,4'-diethoxycarbonyl-2,2'-bipyridine), an efficient and ultrafast intramolecular electron-transfer process occurs from the excited zinc porphyrin to the rhenium unit upon excitation with visible light. Conversely, the introduction of electron-donor tert-butyl groups on the meso-phenyl moieties of the zinc porphyrin has a negligible effect on the photophysics of the system. For dyad 4, the time constants for the charge-separation and charge-recombination processes in solvents of different polarity (PrCN, DCM, and toluene) were measured by an ultrafast time-resolved absorption technique (?(exc) = 560 nm). PMID:23461643

Gatti, Teresa; Cavigli, Paolo; Zangrando, Ennio; Iengo, Elisabetta; Chiorboli, Claudio; Indelli, Maria Teresa

2013-03-05

250

Emotional Relationships in Mothers and Infants: Culture-Common and Community-Specific Characteristics of Dyads from Rural and Metropolitan Settings in Argentina, Italy, and the United States  

PubMed Central

This study uses country and regional contrasts to examine culture-common and community-specific variation in mother-infant emotional relationships. Altogether, 220 Argentine, Italian, and U.S. American mothers and their daughters and sons, living in rural and metropolitan settings, were observed at home at infant age 5 months. Both variable- and person-centered perspectives of dyadic emotional relationships were analyzed. Supporting the notion that adequate emotional relationships are a critical and culture-common characteristic of human infant development, across all samples most dyads scored in the adaptive range in terms of emotional relationships. Giving evidence of community-specific characteristics, Italian mothers were more sensitive, and Italian infants more responsive, than Argentine and U.S. mothers and infants; in addition, rural mothers were more intrusive than metropolitan mothers, and rural dyads more likely than expected to be classified as mid-range in emotional relationships and less likely to be classified as high in emotional relationships. Adaptive emotional relationships appear to be a culture-common characteristic of mother-infant dyads near the beginning of life, but this relational construct is moderated by community-specific (country and regional) context.

Bornstein, Marc H.; Putnick, Diane L.; Suwalsky, Joan T. D.; Venuti, Paola; de Falco, Simona; de Galperin, Celia Zingman; Gini, Motti; Tichovolsky, Marianne Heslington

2010-01-01

251

Mexican American Mothers of Low and Middle Socioeconomic Status: Communication Behaviors and Interactive Strategies during Shared Book Reading  

ERIC Educational Resources Information Center

|Purpose: The aim of this investigation was to describe and compare the communication behaviors and interactive reading strategies used by Mexican American mothers of low- and middle-socioeconomic status (SES) background during shared book reading. Method: Twenty Mexican American mother-child dyads from the Southwestern United States were observed…

Rodriguez, Barbara L.; Hines, Rachel; Montiel, Miguel

2009-01-01

252

Examining Peer Acceptance in Verbal and Non-Verbal Interaction during Computer-Supported Collaborative Learning: Implications for Inclusion  

ERIC Educational Resources Information Center

|This paper discusses the results of peer acceptance in a study investigating the interactions of pairs of disabled and non-disabled pupils working together on computer-based tasks in mainstream primary schools in Cyprus. Twenty dyads of pupils were observed and videotaped while working together at the computer. Data analyses were based on the…

Mavrou, Katerina

2012-01-01

253

Mexican American Mothers of Low and Middle Socioeconomic Status: Communication Behaviors and Interactive Strategies during Shared Book Reading  

ERIC Educational Resources Information Center

Purpose: The aim of this investigation was to describe and compare the communication behaviors and interactive reading strategies used by Mexican American mothers of low- and middle-socioeconomic status (SES) background during shared book reading. Method: Twenty Mexican American mother-child dyads from the Southwestern United States were observed…

Rodriguez, Barbara L.; Hines, Rachel; Montiel, Miguel

2009-01-01

254

Effectiveness of Parent-Child Interaction Therapy Delivered to At-Risk Families in the Home Setting  

ERIC Educational Resources Information Center

|An evaluation was conducted for 83 parent-child dyads who participated in parent-child interaction therapy (PCIT) delivered in-home by community agency therapists. Data included self-report measures and therapist observations at baseline and posttreatment. Results indicated significant positive changes in child/parent behavior and parent…

Galanter, Rachel; Self-Brown, Shannon; Valente, Jessica R.; Dorsey, Shannon; Whitaker, Daniel J.; Bertuglia-Haley, Michelle; Prieto, Metta

2012-01-01

255

Effects of the STAR Intervention Program on Interactions between Campers with and without Disabilities during Inclusive Summer Day Camp Activities  

ERIC Educational Resources Information Center

|The purpose of this study was to examine the effects of a peer intervention program designed to increase interactions between children with and without disabilities in an inclusive summer camp. A multiple probe single subject design was used to determine the effects of the STAR intervention on six dyads of campers aged five through ten over two…

Boyd, Christina M.; Fraiman, Jeffrey L.; Hawkins, Kelly A.; Labin, Jennifer M.; Sutter, Mary Beth; Wahl, Meghan R.

2008-01-01

256

Parent–child interaction and children’s number learning  

Microsoft Academic Search

Two groups of Chinese four?year?olds and their parents’ interaction in joint activities were analyzed and compared. The children in Group 1 were high scorers in written number skills and the children in Group 2 were low scorers. Eighty?five dyads participated in four separate 15?minute joint activities such as book reading, mathematical worksheets, blank paper and blocks. A mini?questionnaire was also

Xin Zhou; Jin Huang; Zhengke Wang; Bin Wang; Zhenguo Zhao; Lei Yang; Zhengzheng Yang

2006-01-01

257

The Contribution of the Dyadic Parent-Child Interaction Coding System (DPICS) Warm-Up Segments in Assessing Parent-Child Interactions  

Microsoft Academic Search

This study evaluated the inclusion of uncoded segments in the Dyadic Parent-Child Interaction Coding System, an analogue observation of parent-child interactions. The relationships between warm-up and coded segments were assessed, as well as the segments’ associations with parent ratings of parent and child behaviors. Sixty-nine non-referred parent-child dyads engaged in the observation. Parents completed measures about their parenting and children's

Jenelle R. Shanley; Larissa N. Niec

2011-01-01

258

Coupled sensitizer-catalyst dyads: electron-transfer reactions in a perylene-polyoxometalate conjugate.  

PubMed

Ultrafast discharge of a single-electron capacitor: A variety of intramolecular electron-transfer reactions are apparent for polyoxometalates functionalized with covalently attached perylene monoimide chromophores, but these are restricted to single-electron events. (et=electron transfer, cr=charge recombination, csr=charge-shift reaction, PER=perylene, POM=polyoxometalate).A new strategy is introduced that permits covalent attachment of an organic chromophore to a polyoxometalate (POM) cluster. Two examples are reported that differ according to the nature of the anchoring group and the flexibility of the linker. Both POMs are functionalized with perylene monoimide units, which function as photon collectors and form a relatively long-lived charge-transfer state under illumination. They are reduced to a stable pi-radical anion by electrolysis or to a protonated dianion under photolysis in the presence of aqueous triethanolamine. The presence of the POM opens up an intramolecular electron-transfer route by which the charge-transfer state reduces the POM. The rate of this process depends on the molecular conformation and appears to involve through-space interactions. Prior reduction of the POM leads to efficient fluorescence quenching, again due to intramolecular electron transfer. In most cases, it is difficult to resolve the electron-transfer products because of relatively fast reverse charge shift that occurs within a closed conformer. Although the POM can store multiple electrons, it has not proved possible to use these systems as molecular-scale capacitors because of efficient electron transfer from the one-electron-reduced POM to the excited singlet state of the perylene monoimide. PMID:19197929

Odobel, Fabrice; Séverac, Marjorie; Pellegrin, Yann; Blart, Errol; Fosse, Céline; Cannizzo, Caroline; Mayer, Cédric R; Elliott, Kristopher J; Harriman, Anthony

2009-01-01

259

Positive Socialization Mechanisms in Secure and Insecure Parent-Child Dyads: Two Longitudinal Studies  

PubMed Central

Background Implications of early attachment have been extensively studied, but little is known about its long-term indirect sequelae, where early security organization moderates future parent-child relationships, serving as a catalyst for adaptive and maladaptive processes. Two longitudinal multi-trait multi-method studies examined whether early security amplified beneficial effects of children's willing, receptive stance toward the parent on socialization outcomes. Methods We examined parent-child early attachment organization, assessed in Strange Situation at 14–15 months, as moderating links between children's willing stance toward parents and socialization outcomes in Study 1 (108 mothers and children, followed to 73 months) and Study 2 (101 mothers, fathers, and children, followed to 80 months). Children's willing stance was observed as committed compliance at 14 and 22 months in Study 1, and as responsiveness to the parent in naturalistic interactions and teaching contexts at 25 and 67 months in Study 2. Socialization outcomes included children's internalization of maternal prohibition, observed at 33, 45, and 56 months, and maternal ratings of children's externalizing problems at 73 months in Study 1, and mothers' and fathers' ratings of children's Oppositional Defiant Disorder and Conduct Disorder symptoms at 80 months in Study 2. Results Indirect effects of attachment were replicated across both studies and diverse measures: Attachment security significantly amplified the links between children's willing stance to mothers and all outcomes. Secure children's willing, cooperative stance to mothers predicted future successful socialization outcomes. Insecure children's willing stance conferred no beneficial effects. Conclusions Implications of early attachment extend to long-term, indirect developmental sequelae. Security in the first year serves as a catalyst for future positive socialization processes.

Kochanska, Grazyna; Woodard, Jarilyn; Kim, Sanghag; Koenig, Jamie L.; Yoon, Jeung Eun; Barry, Robin A.

2010-01-01

260

Análisis de dos conceptos clave en el estudio de las interacciones: formato y zona de desarrollo próximo Analysis of two key concepts in the study of interactions: formats and zone of proximal development  

Microsoft Academic Search

In this paper two key concepts of great relevance for the study of interactions are revised: format and zone of proximal development, one derived from Bruner and the other from the early works of Vygotsky. Traits and applications in family and scholar contexts are analysed when they are applied to dyads and in school interactions. Extending the analysis we go

261

Mealtime television viewing and dietary quality in low-income African American and Caucasian mother-toddler dyads.  

PubMed

To examine maternal demographic characteristics and depressive symptoms as predictors of TV viewing during mealtimes, and to investigate how mealtime TV viewing predicts mothers' and toddlers' food consumption. A prospective, cross-sectional survey design was employed with 199 African American and 200 Caucasian, low-income, mother-toddler dyads enrolled in eight Early Head Start programs in a Midwestern state. Mothers completed the Toddler-Parent Mealtime Behavior Questionnaire to assess toddler mealtime behavior. Data were analyzed using a three-step multiple regression: (a) step one was to determine what characteristics predicted family TV viewing during mealtime; (b) step two was to determine whether TV viewing during mealtime predicted maternal food consumption, and (c) step three was to determine whether TV viewing during mealtime predicted toddler food consumption. Direct and indirect effects of TV watching were explored via path models. Maternal race, education, and depressive symptoms predicted 8% of the variance in TV viewing during mealtime (P < or = 0.001). African American mothers and mothers who had fewer years of schooling and exhibited more depressive symptoms tended to watch more TV during mealtime. More TV viewing during mealtime predicted mothers' intake of 'more' unhealthy foods. Mothers' food consumption was the single best predictor of toddlers' food consumption, while TV viewing during mealtime had an indirect effect through mothers' TV viewing. TV viewing practices affect mothers' food consumption and mealtime behaviors; this, in turn, impacts toddlers' food consumption. Practical interventions are needed to positively influence the nutritional habits of lower-income mothers. Reducing mothers' "unhealthy" food consumption while watching TV may offer one effective strategy. PMID:19629662

Horodynski, Mildred A; Stommel, Manfred; Brophy-Herb, Holly E; Weatherspoon, Lorraine

2009-07-23

262

Ruthenium-phenothiazine electron transfer dyad with a photoswitchable dithienylethene bridge: flash-quench studies with methylviologen.  

PubMed

A molecular ensemble composed of a phenothiazine (PTZ) electron donor, a photoisomerizable dithienylethene (DTE) bridge, and a Ru(bpy)(3)(2+) (bpy = 2,2'-bipyridine) electron acceptor was synthesized and investigated by optical spectroscopic and electrochemical means. Our initial intention was to perform flash-quench transient absorption studies in which the Ru(bpy)(3)(2+) unit is excited selectively ("flash") and its (3)MLCT excited state is quenched oxidatively ("quench") by excess methylviologen prior to intramolecular electron transfer from phenothiazine to Ru(III) across the dithienylethene bridge. However, after selective Ru(bpy)(3)(2+1)MLCT excitation of the dyad with the DTE bridge in its open form, (1)MLCT ? (3)MLCT intersystem crossing on the metal complex is followed by triplet-triplet energy transfer to a (3)?-?* state localized on the DTE unit. This energy transfer process is faster than bimolecular oxidative quenching with methylviologen at the ruthenium site (Ru(III) is not observed); only the triplet-excited DTE then undergoes rapid (10 ns, instrumentally limited) bimolecular electron transfer with methylviologen. Subsequently, there is intramolecular electron transfer with PTZ. The time constant for formation of the phenothiazine radical cation via intramolecular electron transfer occurring over two p-xylene units is 41 ns. When the DTE bridge is photoisomerized to the closed form, PTZ(+) cannot be observed any more. Irrespective of the wavelength at which the closed isomer is irradiated, most of the excitation energy appears to be funneled rapidly into a DTE-localized singlet excited state from which photoisomerization to the open form occurs within picoseconds. PMID:22435739

He, Bice; Wenger, Oliver S

2012-03-22

263

Change in mother-infant interactive behavior: Relations to change in the mother, the infant, and the social context  

Microsoft Academic Search

This study examines relations between change in mother-infant interaction and change in parental and infant traits. Forty-seven mother-infant dyads were observed at 3 months in face-to-face interaction and at 9 months in two play situations, face-to-face social play and exploratory play interaction. Following Belsky's (1984) “determinants of parenting” model, changes in maternal anxiety, infant temperament, and spousal support were assessed.

Shmuel H. Erlich

1997-01-01

264

Physical and relational aggression in young children: the role of mother–child interactional synchrony  

Microsoft Academic Search

This study examined the relationships between the quality of parent–child interactions, specifically interactional synchrony (IS), and physical and relational aggression in young children. Seventy-three children (3–6 years; 44 males, 29 females) and their mothers participated in this study. The children's level of aggression was assessed through questionnaires completed by their mothers and teachers\\/caregivers. Mother–child dyads engaged in a free play

Holly N. Ambrose; Rosanne Menna

2012-01-01

265

Preschool Children's Collaborative Problem-Solving Interactions: The Role of Gender, Pair Type, and Task  

Microsoft Academic Search

The purpose of this study was to investigate gender differences in problem-solving and conflict-resolution skills in preschool children. Children between 4 and 5 years of age completed 3 problem-solving tasks with either a same-sex or a different-sex peer. Children's verbal and nonverbal interactions were analyzed. Girls used mitigation more often than did boys. Mixed-sex dyads engaged in controlling verbal interactions

Heather A. Holmes-Lonergan

2003-01-01

266

Psychopathology in Adolescent Mothers and Its Effects on Mother-Infant Interactions: A Pilot Study  

Microsoft Academic Search

Objective: This study assessed adolescent maternal psychopathology and its relation to the quality of mother-infant interactions. Method: Twenty-one mother-infant pairs recruited from an adolescent medicine clinic were assessed for socio-demo- graphic background, psychosocial adversity, conduct disorder, alcohol or substance dependence, and depression. Dyads were videotaped during free play and their interactions rated using the Crittenden Child-Adult Relational Experimental (CARE) Index.

Beverley Cassidy; Mark Zoccolillo; Susan Hughes

267

Parent—child interaction in Nigerian families: conversation analysis, context and culture  

Microsoft Academic Search

This paper uses a conversation analysis (CA) approach to explore parent—child interaction (PCI) within Nigerian families. We illustrate how speech and language therapists (SLTs), by using CA, can tailor recommendations according to the interactional style of each individual family that are consonant with the family's cultural beliefs. Three parent—child dyads were video-taped playing and talking together in their home environments.

Annabel Burns; Julie Radford

2008-01-01

268

Interpersonal Space in Virtual Space: An Examination of Interactions in Second Life  

Microsoft Academic Search

The current study compares interactions in Second Life with typical face-to-face interactions. In Second Life, we compare interpersonal distance (IPD) between 1) female-male and female-female dyad, 2) participant avatars and overweight and normal weight confederate avatars, and 3) participant avatars greeted with a neutral newbie greeting, an uncomfortable disclosure greeting, and no greeting at all. Finding suggests that while the

Andrea P. Francis; Ning Li; Anny Fritzen

269

Analyzing the Utility of Dyadic Parent-Child Interaction Coding System (DPICS) Warm-Up Segments  

Microsoft Academic Search

Analogue behavioral observations are an important component of multi-modal, multi-informant assessments. The Dyadic Parent-Child\\u000a Interaction Coding System (DPICS) is a structured behavior observation system developed to assess the frequency and quality\\u000a of parent and child behaviors during a structured dyadic interaction. The DPICS includes two, five-minute warm-up (WU) segments\\u000a before coded segments; these WU segments are thought to allow dyads

Timothy Thornberry Jr; Elizabeth Brestan-Knight

2011-01-01

270

The role of sex and self-monitoring in unstructured dyadic interactions  

Microsoft Academic Search

Determined how sex and level of self-monitoring (SM) are related to behavior during an initial interaction in same-sex dyads. 60 male and 64 female undergraduates who had been previously tested with Snyder's Self-Monitoring Scale were covertly videotaped during an unstructured 5-min interaction with a same-sex stranger. They were then asked to give impressions of their own and the other person's

William Ickes; Richard D. Barnes

1977-01-01

271

Pediatric Cancer and the Quality of Children's Dyadic Peer Interactions  

PubMed Central

Objective?To use observational methods to assess the quality of peer relationships in 51 7- to 12-year-old acute lymphoblastic leukemia survivors as compared to healthy children.?Methods?Children were audiotaped as they engaged in free play with their best friend and interactions were coded to assess their ability to maintain engagement with one another during play as well as the affective dimension of their play.?Results?Results indicated that dyads with survivors of childhood cancer were less likely to be highly engaged with their best friend and more likely to experience disengagement than dyads with healthy participants. There were no group differences in positive or negative affect. Conclusions? Overall, these data suggest that survivors of childhood cancer’s relationships with their best friend may be compromised in some specific areas when compared to the relations of healthy children. Implications for intervention are discussed.

Leary, Alison; Breiger, David; Friedman, Debra

2011-01-01

272

It's Not Just Your Goal, but Also Who You Know: How the Cognitive Associations among Goals and Relationships Influence Goal Detection in Social Interaction  

ERIC Educational Resources Information Center

An experiment tested a theoretical framework for goal detection in dyadic interactions of close friends and unacquainted strangers wherein one conversationalist pursued a goal unbeknownst to a detector. The extent to which pursuers' conversation goal was cognitively associated with the dyad's relational type was manipulated. As hypothesized,…

Palomares, Nicholas A.

2009-01-01

273

Postpartum Depression: Is It a Condition Affecting the Mother-Infant Interaction and the Development of the Child across the First Year of Life?  

ERIC Educational Resources Information Center

|Noting that maternal depression is common during a baby's first year, this study examined the interaction of depressed and non-depressed mother-child dyads. A sample of 26 first-time mothers with postpartum depression at the third month after birth and their 3-month-old infants was compared to a sample of 25 first-time mothers with no postpartum…

Figueiredo, B.

274

Patterns of Change in Early Childhood Aggressive-Disruptive Behavior: Gender Differences in Predictions from Early Coercive and Affectionate Mother-Child Interactions.  

ERIC Educational Resources Information Center

|Examined mother-child interaction predictors of initial levels and changes in child aggressive and disruptive behavior at school from kindergarten to third grade in 585 mother-child dyads. Found that for boys, high coercion and nonaffection were particularly associated with the high-increasing-aggression trajectory, but for girls, high levels of…

McFadyen-Ketchum, Steven A.; And Others

1996-01-01

275

The experience of story reading: deaf children and hearing mothers' interactions at story time.  

PubMed

THE STUDY EXAMINED scaffolding interactions between deaf children and hearing mothers in which story reading was used as a tool to aid in the development of narrative comprehension and linguistic reasoning. The dyadic interactions were examined from the perspective of the theoretical works of Vygotsky (1934/1962, 1978, 1929/1981, 1960/1981). The sample group consisted of 7 dyads of hearing mothers and their deaf children ages 4.2 to 9.5 years. The mothers signed a story to their children. The dyadic interactions reflected the different levels of scaffolding and functioning within the zone of proximal development (Vygotsky, 1934/1962, 1978). The researchers found that story reading provides an excellent framework for both cognitive and emotional growth within the parent/child dyad. Mothers who engaged their children in mutual dialogue also used elaboration. This was reflected in their children's linguistic reasoning. PMID:16466192

Plessow-Wolfson, Sabine; Epstein, Flavio

2005-01-01

276

The relationship of preschool and early school age attachment to mother-child interaction.  

PubMed

This article focuses on the description and meaning of attachment relationships and their relation to patterns of caregiver-child interaction. Concepts fundamental to coding separation-reunion behavior in older children (J. Cassidy & R. S. Marvin, 1992; M. Main & J. Cassidy, 1988) are discussed and then applied to delineating the distinct patterns characterizing secure, avoidant, dependent, and disorganized/controlling at preschool and school age. A scale for rating the quality and relationship structure of adult-child interaction is described. Analyses comparing the interactive patterns of 121 mother-child (ages 5-7 years) dyads revealed a significant difference among the 4 attachment groups and specifically distinguished disorganized/controlling dyads. The study validates current school age attachment measures as well as a new taxonomy suitable for further research in naturalistic or clinical settings. PMID:15709856

Humber, Nancy; Moss, Ellen

2005-01-01

277

The minimal self-sufficient element in a murine G+C-rich promoter is a large element with imperfect dyad symmetry.  

PubMed Central

The murine adenosine deaminase gene has a structurally archetypal TATAA-box-deficient G+C-rich promoter. The three Sp1 binding sites of the promoter are neither necessary nor sufficient for promoter function. Minimal basal promoter activity resides within a 48-bp element downstream of the Sp1 binding sites. This element shows an imperfect dyad symmetry around the promoter's major transcriptional initiation site and contains at least two nuclear protein binding sites. The distinctive sequence characteristics and nuclear protein binding locations of this element led us to propose a model for how such promoters may function. Images Fig. 1 Fig. 3 Fig. 4 Fig. 6

Ackerman, S L; Minden, A G; Yeung, C Y

1993-01-01

278

Protest or pleasure? The response of first-born children to interactions between their mothers and infant siblings.  

PubMed

Triadic interactions between mother, pre-school age first-born, and 14-month-old second-born siblings were studied in 40 families as part of a longitudinal study using home observations. Interactions between mother and second-born exerted as important influence on the behaviour of the first-born; individual differences in the response of the first-born children were associated with difference in temperament of the first child, their reaction to the sibling birth, and with the sex of the sibling dyad. The age gap between siplings and the sex of sibling dyad influenced the time mother and second-born spent in interaction and the quality of this interaction. PMID:7068789

Kendrick, C; Dunn, J

1982-04-01

279

The horse–human dyad: Can we align horse training and handling activities with the equid social ethogram?  

Microsoft Academic Search

This article examines the recently completed equid ethogram and shows how analogues of social interactions between horses may occur in various human–horse interactions. It discusses how some specific horse–horse interactions have a corresponding horse–human interaction – some of which may be directly beneficial for the horse while others may be unusual or even abnormal. It also shows how correspondent behaviours

P. D. McGreevy; C. Oddie; F. L. Burton; A. N. McLean

2009-01-01

280

Infection disclosure in the injecting dyads of Hungarian and Lithuanian injecting drug users who self-reported being infected with hepatitis C virus or human immunodeficiency virus.  

PubMed

The aim of this study was to assess the prevalence and correlates of disclosure to network members of being hepatitis C virus (HCV)- or human immunodeficiency virus (HIV)-infected among injecting dyads of infected injection drug users (IDUs) in Budapest, Hungary and Vilnius, Lithuania,. Multivariate generalized estimating equations (GEE) were used to assess associations. Very strong infection disclosure norms exist in Hungary, and HCV disclosure was associated with using drugs and having sex within the dyad. Non-ethnic Russian IDUs in Lithuania were more likely to disclose HCV infection to non-Roma, emotionally close and HCV-infected network members, and to those with whom they shared cookers, filters, drug solutions or rinse water or got used syringes from, and if they had fewer non-IDU or IDU network members. Ethnic Russian Lithuanian IDUs were more likely to disclose HCV if they had higher disclosure attitude and knowledge scores, 'trusted' network members, and had lower non-injecting network density and higher injecting network density. HIV-infected Lithuanian IDUs were more likely to disclose to 'trusted' network members. Disclosure norms matched disclosure behaviour in Hungary, while disclosure in Lithuania to 'trusted' network members suggests possible stigmatization. Ongoing free and confidential HCV/HIV testing services for IDUs are needed to emphasize and strengthen disclosure norms, and to decrease stigma. PMID:20840002

Gyarmathy, V Anna; Neaigus, Alan; Li, Nan; Ujhelyi, Eszter; Caplinskiene, Irma; Caplinskas, Saulius; Latkin, Carl A

2010-09-15

281

Interactions Between Depressed Mothers and Their Infants: Maternal Verbal Joint Attention and its Effect on the Infant's Cognitive Development  

Microsoft Academic Search

This study compared the interaction between depressed and nondepressed mother?infant dyads with joint attention during mother?infant play. The cognitive development of the child was analyzed as an outcome of the interactions. The sample consisted of 41 mothers and their infants who were 13 and 18 months of age. Twenty?three mothers were depressed and 19 mothers were nondepressed. In the total

Taiko Hirose; Kathryn Barnard

1997-01-01

282

[Observation of family interaction with video].  

PubMed

This article presents an overview on how to structure, carry out and evaluate observed family interaction with video. The emphasis lays on tasks used to stimulate family interaction. The examples cited illustrate different approaches to evaluation. Results of our latest research are presented which refer to (1) the clinical differentiation possibilities of macroanalytic observational scales, (2) the situational specificity of interactive behaviour in a comparison between a structured game situation and a minimally-structured planning discussion, and (3) the relation between various levels of family organisation (individuals, dyads of parent, parent-child-relationship, and family system). Families of 31 children with internalizing disorders and 30 children with externalizing disorders (age: 4-15 years) were included in the study and compared to a healthy control group (21 Children). Family interactions showing the family either as a group playing or planning something together were videotaped and rated independently in each case by two trained and "blind" observers using the Munich Interactional Scales and the Beavers Interactional Scales approaches. Characteristics of the interaction could be identified which were consistent/stable for all children in both situations, or which changed depending on the situation. Individual patterns of behaviour of children with emotional or behavioural problems depend on the level of structure and demands in the situation. Different levels of family organisation (individuals, dyads of parent, parent-child-relationship and family system) are related. The advantages of using videotapes of family interactions in family assessment could be demonstrated. These findings should be taken into account in child treatment, family counselling and therapy. PMID:20408273

Steininger, Christine

2010-01-01

283

Infant, mother, and contextual predictors of mother-very low birth weight infant interaction at 9 months of age.  

PubMed

This prospective study examined how characteristics of infants (i.e., birth weight and perinatal illness severity), mothers (i.e., anxiety and level of education), and the social context (i.e., maternal received and perceived helpfulness of support) related to mother-very low birth weight (VLBW) infant interaction in 72 dyads. Infant, mother, and contextual factors were assessed at 3 and 9 months of age, and mothers and infants were observed in teaching interactions at 9 months. Dyads whose interaction was more sensitive and responsive included mothers who were better educated and less anxious at 3 months and reported higher perceived support at 3 months. The findings highlight the importance of maternal education and well-being in the parenting of VLBW infants. PMID:15718880

Feeley, Nancy; Gottlieb, Laurie; Zelkowitz, Phyllis

2005-02-01

284

Parent-Child Interaction Therapy with a Family at High Risk for Physical Abuse  

Microsoft Academic Search

The use of empirically validated treatments with physically abusive and at-risk families continues to be an issue requiring further clinical and research attention. This single-case study discusses the effectiveness of Parent-Child Interaction Therapy (PCIT) with a mother-child dyad considered to be at high risk for physical abuse. Although PCIT is effective with different populations and in different settings, no study

Joaquin Borrego; Anthony J. Urquiza; Rebecca A. Rasmussen; Nancy Zebell

1999-01-01

285

Parent-Child Interaction Therapy With a Spanish-Speaking Family  

Microsoft Academic Search

There is relatively little information on the treatment effectiveness of child behavior-management programs with Spanish-speaking populations. Though there are several empirically supported treatments available in English, research on the applicability of these programs in Spanish is virtually nonexistent. This single-case study discusses the application of Parent-Child Interaction Therapy (PCIT) with a Spanish-speaking mother-child dyad to address the child’'s externalizing behavior

Joaquin Borrego; Karla Anhalt; Sherri Y. Terao; Eric C. Vargas; Anthony J. Urquiza

2006-01-01

286

Challenging foster caregiver–maltreated child relationships: The effectiveness of parent–child interaction therapy  

Microsoft Academic Search

This study describes the effectiveness of parent–child interaction therapy (PCIT), an evidence-based treatment for abused children, for 75 non-relative foster parents and their foster children compared with 98 non-abusive biological parent–child dyads referred for treatment because of the children's behavior problems. Results showed decreases in child behavior problems and caregiver distress from pre- to post-treatment for both foster and biological

Susan G. Timmer; Anthony J. Urquiza; Nancy Zebell

2006-01-01

287

Stability of maternal discipline practices and the quality of mother–child interaction during toddlerhood  

Microsoft Academic Search

This study examined the stability of maternal punitive\\/high-power discipline (PD) and inductive\\/authoritative discipline (ID) over the second and third years of life and the effect of maternal discipline on quality of mother–child interactions. Data from a longitudinal sample with 179 mother–toddler dyads were analyzed, and selected factors (i.e., child sex, temperament) that might moderate the association between maternal discipline and

Keng-Yen Huang; Margaret O'Brien Caughy; Li-Ching Lee; Therese Miller; Janice Genevro

2009-01-01

288

A Longitudinal Study of Mothers' and Preschool Children's Aversive Behaviors During Dyadic Interactions  

Microsoft Academic Search

The development of self-regulation of preschool children (21-48 months old) was explored by assessing age-related changes in (a) children's aversive behaviors (e.g., noncompliance, physically negative behavior), (b) mothers' aversive behaviors, and (c) each party's reinforcement of the other's aversive behaviors. Mother-child interactions of 44 dyads were observed in a variety of experimental situations. The results indicated a decrease in aversive

Maria D. Kalpidou; Fred Rothbaum; Karen Schneider Rosen

1998-01-01

289

Interaction of Origin Binding Protein with an Origin of Replication of Herpes Simplex Virus 1  

Microsoft Academic Search

Herpes simplex virus 1 encodes a protein that binds specifically to a viral DNA replication origin (oriS). This origin-binding protein has been purified to homogeneity by means of sequence-specific DNA affinity chromatography. The purified origin-binding protein, which has a molecular weight of 83,000, interacts with both parts of the oriS dyad; however, the affinity for the two sites differs by

Per Elias; I. R. Lehman

1988-01-01

290

Intra-familial and ethnic effects on attitudinal and perceptual body image: a cohort of South African mother-daughter dyads  

PubMed Central

Background International studies suggest ethnic differences in obesity prevalence may be due, in part, to differences in body image and body size dissatisfaction between groups. Further, there is evidence to suggest that there is a familial resemblance in body image between mothers and their younger (preadolescent) daughters. This research was therefore conducted to specifically identify the extent to which family status (presented as mother-daughter resemblance) and ethnicity impact on body image attitudes and perceptions of South African mothers and their pre-adolescent daughters. Methods Mother-daughter dyads (n = 201, 31% black, 37% mixed ancestry and 32% white) answered questions regarding their body image perception (the way they saw their body size status), their body image ideals, and body image attitudes (body size dissatisfaction in particular, presented as the Feel-Ideal Difference [FID] index score). Mothers' and daughters' body image results were compared within dyads and across ethnic groups using repeated measures of ANOVA. Results Overall, body image resemblances exist between South African mothers and their pre-adolescent daughters. Mothers and daughters chose similarly weighted silhouettes to represent their body size ideals (p = 0.308), regardless of their ethnicity or body mass index (BMI). The FID index scores were similar between mothers and their daughters only after the confounding effects of maternal BMI were removed (p = 0.685). The silhouettes chosen to represent thinness were also similar between mothers and their daughters (p = 0.960) regardless of ethnicity and maternal BMI. On the other hand, the silhouettes chosen to represent fatness were similar (p = 0.342) between mothers and their daughters, only after the confounding effects of maternal BMI were removed. Lastly, mothers and their daughters chose similarly weighted silhouettes as engendering feelings of beauty, respect and happiness (p = 0.813; p = 0.615 and p = 0.693, respectively). In this instance, black mother-daughter dyads chose significantly heavier silhouettes than the other ethnic groups. This implies that black mothers and daughters associate beauty, respect and happiness with a bigger body size. Conclusion Resemblances exist between pre-adolescent girls and their mothers on issues related to ideal and attitudinal body image. In this regard, South African researchers should consider the effects ethnicity and family status on body image of women when developing targeted interventions to prevent or manage obesity.

2011-01-01

291

Effects of Maternal Stimulant Medication on Observed Parenting in Mother-Child Dyads with Attention-Deficit/Hyperactivity Disorder  

ERIC Educational Resources Information Center

This pilot study of 23 mothers with attention-deficit/hyperactivity disorder (ADHD) and their offspring with ADHD examined the effects of maternal stimulant medication on observed interactions. Parent-child interactions were observed using a structured protocol before and after mothers underwent a 5-week, double-blind stimulant titration. Despite…

Chronis-Tuscano, Andrea; Rooney, Mary; Seymour, Karen E.; Lavin, Heather Jones; Pian, Jessica; Robb, Adelaide; Efron, Lisa; Conlon, Charles; Stein, Mark A.

2010-01-01

292

Respiratory markers of conversational interaction.  

PubMed

Respiratory movements were recorded from 10 dyads (20 subjects) during quiet breathing, reading aloud, spontaneous monologue, scripted dialog, and spontaneous conversation. Timing measures of inspiratory, expiratory, and total cycle duration were used to compare respiratory function during quiet breathing, listening, and speech. Cross-correlation analyses of the respiratory movements of conversational partners provided an index of conversational synchrony. Inspiratory duration was found to be the most consistent and sensitive measure for discriminating quiet breathing from speech breathing. In the scripted dialog and spontaneous conversation conditions, respiratory kinematics changed during listening to more closely resemble speech, and systematic changes were observed in anticipation of turn-taking speech onset. For the breathing cycles immediately surrounding turn changes and simultaneously produced vocal events, the kinematic signals of conversational partners were strongly correlated. Results are discussed in the context of similar findings concerning conversational interactions and motor preparation for speech. PMID:11218097

McFarland, D H

2001-02-01

293

A characteristic destabilization profile in parent-child interactions associated with treatment efficacy for aggressive children.  

PubMed

This study examined profiles of change in repeated mother-child interactions over the course of a 12 week treatment period for childhood aggression. The aim of this study was to investigate whether it was possible to detect the characteristic profile of change, typical for phase transitions, over the course of treatment, and whether this profile was associated with positive treatment outcomes. Entropy values were computed for six repeated real-time observations of each mother-child dyad, using a novel application of recurrence quantification analysis for categorical time series. Subsequent latent class growth curve analysis on the sequences of entropy values revealed two distinct classes of dyads, with one class showing a clear peak in entropy over the six measurement points. The latent class membership variables showed a significant systematic relationship with observed dyad improvement (as rated by clinicians). The class with the peak in entropy over the sessions consisted largely of treatment improvers. Further analysis revealed that improvers and non-improvers could not be distinguished based on content-specific changes (e.g. more positivity or less negativity during the interaction). The present study revealed a treatment-related destabilization pattern in real-time behaviors that was related to better treatment outcomes, and underlines the value of dynamic nonlinear time-series analysis (especially RQA) in the study of dyadic interactions in clinical contexts. PMID:22695153

Lichtwarck-Aschoff, Anna; Hasselman, Fred; Cox, Ralf; Pepler, Debra; Granic, Isabela

2012-07-01

294

Chiroselective assembly of a chiral porphyrin-fullerene dyad: photoconductive nanofiber with a top-class ambipolar charge-carrier mobility.  

PubMed

Upon slow admission of MeOH, the enantiomerically pure form of chiral amphiphilic porphyrin-fullerene dyad 1 in CH(2)Cl(2) self-assembles at 25 degrees C into nanofibers with a built-in donor/acceptor heterojunction, while its racemic form, under identical conditions, self-assembles into submicrometer-sized spheres with a donor/acceptor arrangement essentially different from that in the nanofiber assembly. Although a cast film of the latter hardly shows a photoconducting profile on micrometer-gap electrodes, the former sample clearly displays photoconduction with an ambipolar charge-transporting character. The electron and hole mobilities under zero electric field, as estimated from time-of-flight profiles, are 0.14 and 0.10 cm(2) V(-1) s(-1), respectively, which are comparable to or even better than those reported for top-class organic materials with a donor/acceptor heterojunction. PMID:20423102

Hizume, Yumi; Tashiro, Kentaro; Charvet, Richard; Yamamoto, Yohei; Saeki, Akinori; Seki, Shu; Aida, Takuzo

2010-05-19

295

Effects of hydrogen bonding on metal ion-promoted intramolecular electron transfer and photoinduced electron transfer in a ferrocene-quinone dyad with a rigid amide spacer.  

PubMed

A ferrocene-quinone dyad (Fc-Q) with a rigid amide spacer and Fc-(Me)Q dyad, in which the amide proton acting as a hydrogen-bonding acceptor is replaced by the methyl group, are employed to examine the effects of hydrogen bonding on both the thermal and the photoinduced electron-transfer reactions. The hydrogen bonding of the semiquinone radical anion with the amide proton in Fc-Q(.-) produced by the electron-transfer reduction of Fc-Q is indicated by the significant positive shift of the one-electron reduction potential of Fc-Q. The hyperfine coupling constants of Fc-Q(.-) also indicate the existence of hydrogen bonding, agreeing with those predicted by the density functional calculation. The hydrogen-bonding dynamics in the photoinduced electron transfer from the ferrocene (Fc) to the quinone moiety (Q) in Fc-Q have been successfully detected in the femtosecond laser flash photolysis experiments. Thermal intramolecular electron transfer from Fc to Q in Fc-Q and Fc-(Me)Q also occurs efficiently in the presence of metal ions in acetonitrile at 298 K. The hydrogen bond formed between the semiquinone radical anion and the amide proton in Fc-Q results in remarkable acceleration of the rate of metal ion-promoted electron transfer as compared to the rate of Fc-(Me)Q in which hydrogen bonding is prohibited. The metal ion-promoted electron-transfer rates are well correlated with the binding energies of superoxide ion-metal ion complexes, which are derived from the g(zz) values of the ESR spectra. PMID:12537500

Fukuzumi, Shunichi; Okamoto, Ken; Yoshida, Yutaka; Imahori, Hiroshi; Araki, Yasuyuki; Ito, Osamu

2003-01-29

296

Effects of Maternal Stimulant Medication on Observed Parenting in Mother–Child Dyads With Attention-Deficit\\/Hyperactivity Disorder  

Microsoft Academic Search

This pilot study of 23 mothers with attention-deficit\\/hyperactivity disorder (ADHD) and their offspring with ADHD examined the effects of maternal stimulant medication on observed interactions. Parent–child interactions were observed using a structured protocol before and after mothers underwent a 5-week, double-blind stimulant titration. Despite dramatic effects of medication on adult ADHD symptoms, this small pilot and open label laboratory-based study

Andrea Chronis-Tuscano; Mary Rooney; Karen E. Seymour; Heather Jones Lavin; Jessica Pian; Adelaide Robb; Lisa Efron; Charles Conlon; Mark A. Stein

2010-01-01

297

Maternal postpartum depression and infant social withdrawal among human immunodeficiency virus (HIV) positive mother–infant dyads  

Microsoft Academic Search

Maternal postpartum depression poses significant risks for mother–child interaction and long-term infant outcomes. Human immunodeficiency virus (HIV) status has also been implicated in the development of postpartum depression, but the association between maternal depression and infant social behavior in the context of HIV infection has not been fully investigated. First, we examined the relationship between maternal postpartum depression and infant

C. Hartley; K. Pretorius; A. Mohamed; B. Laughton; S. Madhi; M. F. Cotton; B. Steyn; S. Seedat

2010-01-01

298

Identification of a novel BTB-zinc finger transcriptional repressor, CIBZ, that interacts with CtBP corepressor  

Microsoft Academic Search

The transcriptional corepressor C-terminal binding protein (CtBP) is thought to be involved in development and oncogenesis, but the regulation of its corepressor activity is largely unknown. We show here that a novel BTB-zinc finger protein, CIBZ (CtBP-interacting BTB zinc finger protein; a mouse ortholog of rat ZENON that was recently identified as an e-box\\/dyad binding protein), redistributes CtBP to pericentromeric

Nobuhiro Sasai; Eishou Matsuda; Emiko Sarashina; Yasumasa Ishida; Masashi Kawaichi

2005-01-01

299

Effects of Parent-Adolescent Interaction on the Continuity of Cognitive Development from Early Childhood to Early Adolescence  

Microsoft Academic Search

The continuity of cognitive development from early childhood to early adolescence is examined in light of mother-adolescent interaction and demographic measures. The sample was comprised of fifty-four mother-adolescent dyads, from a follow-up of an early-age antipoverty intervention. Middle class and lower class control groups and an experimental group were balanced by social class, ethnicity and gender. Measures used were the

Richard M. Dunham; Jeannie S. Kidwell; Pedro R. Portes

1988-01-01

300

The Effect of Personality on Collaborative Task Performance and Interaction  

NASA Astrophysics Data System (ADS)

Collocated, multi-user technologies, which support group-work are becoming increasingly popular. Examples include MERL’s Diamondtouch and Microsoft’s Surface, both of which have evolved from research prototypes to commercial products. Many applications have been developed for such technologies which support the work and entertainment needs of small groups of people. None of these applications however, have been studied in terms of the interactions and performances of their users with regards to their personality. In this paper, we address this research gap by conducting a series of user studies involving dyads working on a number of multi-user applications on the DiamondTouch tabletop device.

Givney, Sinéad Mc; Smeaton, Alan F.; Lee, Hyowon

301

The transcendent function, moments of meeting and dyadic consciousness: constructive and destructive co-creation in the analytic dyad.  

PubMed

In reading the work of Beebe (2002), Sander (Amadei & Bianchi 2008), Tronick (2007) and Stern and the Boston Change Process Study Group (1998), resonances to the transcendent function can be registered but these researchers seem to be more focused on the interpersonal domain. In particular Tronick's concept of 'dyadic expansion of consciousness' and 'moments of meeting' from the Boston Change Process Study Group describe external dyadic interactions between mothers and babies and therapists and patients while, in contrast, Jung's early focus was on the intrapsychic process of internal interaction between conscious and unconscious within an individual. From an overall perspective, the interpersonal process of change described by infant researchers, when held in conjunction with Jung's internal process of change, together form a transcendent whole that could also be called a complex adaptive system. Such new theoretical perspectives from other fields confirm and elaborate long held Jungian notions such as the transcendent function which is, in many ways, harmonious with a systems perspective. Throughout this paper, clinical vignettes of interactive moments along with sand play and dreams will be used to illustrate theoretical points regarding the healthy process of the transcendent function along with descriptions of failures of such conjunctive experiences. PMID:20518964

Carter, Linda

2010-04-01

302

Conflict in the Latino parent-youth dyad: the role of emotional support from the opposite parent.  

PubMed

In the present study, the author examined the independent and interactive effects of support and conflict within a triadic familial context (mother-father-youth). The sample consisted of 6th- and 7th-grade inner-city Latino youths (N = 329; 142 boys, 187 girls). Using multiple regression techniques, level of conflict with either mother or father was consistently related to higher levels of both boys' and girls' internalizing and externalizing symptoms. Interaction effects were significant in predicting boys' externalizing behavior problems--a supportive parental relationship significantly reduced the risk associated with high conflict with the opposite parent. For boys' internalizing problems, mother and father support served a protective function regardless of the level of conflict with the opposite parent. Conflict with the mother was especially detrimental for Latina girls--highly conflictive mother-daughter relationships were associated with increased internalizing and externalizing symptomatology, and father support added little in predicting symptomatology. The study adds to the understanding of risk and protection in Latino families and underscores the importance of examining the parent-youth relationship from a triadic perspective, noting similarities and differences in mother-son, mother-daughter, father-son, and father-daughter relations. PMID:18540777

Crean, Hugh F

2008-06-01

303

A panchromatic supramolecular fullerene-based donor-acceptor assembly derived from a peripherally substituted bodipy-zinc phthalocyanine dyad.  

PubMed

A panchromatic 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene-zinc phthalocyanine conjugate (Bodipy-ZnPc) 1 was synthesized starting from phthalocyanine aldehyde 4, via dipyrromethane 3 and dipyrromethene 2. Conjugate 1 represents the first example in which a Bodipy unit is tethered to the peripheral position of a phthalocyanine core. Electrochemical and optical measurements provided evidence for strong electronic interactions between the Bodipy and ZnPc constituents in the ground state of 1. When conjugate 1 is subjected to photoexcitation in the spectral region corresponding to the Bodipy absorption, the strong fluorescence characteristic of the latter subunit is effectively quenched (i.e., > or = 97%). Excitation spectral analysis confirmed that the photoexcited Bodipy and the tethered ZnPc subunits interact and that intraconjugate singlet energy transfer occurs with an efficiency of ca. 25%. Treatment of conjugate 1 with N-pyridylfulleropyrrolidine (8), an electron-acceptor system containing a nitrogen ligand, gives rise to the novel electron donor-acceptor hybrid 1<-->8 through ligation to the ZnPc center. Irradiation of the resulting supramolecular ensemble within the visible range leads to a charge-separated Bodipy-ZnPc(*+)-C(60)(*-) radical-ion-pair state, through a sequence of excited-state and charge transfers, characterized by a remarkably long lifetime of 39.9 ns in toluene. PMID:20039345

Rio, Yannick; Seitz, Wolfgang; Gouloumis, Andreas; Vázquez, Purificacion; Sessler, Jonathan L; Guldi, Dirk M; Torres, Tomás

2010-02-01

304

Inter-Brain Synchronization during Social Interaction  

PubMed Central

During social interaction, both participants are continuously active, each modifying their own actions in response to the continuously changing actions of the partner. This continuous mutual adaptation results in interactional synchrony to which both members contribute. Freely exchanging the role of imitator and model is a well-framed example of interactional synchrony resulting from a mutual behavioral negotiation. How the participants' brain activity underlies this process is currently a question that hyperscanning recordings allow us to explore. In particular, it remains largely unknown to what extent oscillatory synchronization could emerge between two brains during social interaction. To explore this issue, 18 participants paired as 9 dyads were recorded with dual-video and dual-EEG setups while they were engaged in spontaneous imitation of hand movements. We measured interactional synchrony and the turn-taking between model and imitator. We discovered by the use of nonlinear techniques that states of interactional synchrony correlate with the emergence of an interbrain synchronizing network in the alpha-mu band between the right centroparietal regions. These regions have been suggested to play a pivotal role in social interaction. Here, they acted symmetrically as key functional hubs in the interindividual brainweb. Additionally, neural synchronization became asymmetrical in the higher frequency bands possibly reflecting a top-down modulation of the roles of model and imitator in the ongoing interaction.

Dumas, Guillaume; Nadel, Jacqueline; Soussignan, Robert; Martinerie, Jacques

2010-01-01

305

Highly selective fluorescent OFF-ON thiol probes based on dyads of BODIPY and potent intramolecular electron sink 2,4-dinitrobenzenesulfonyl subunits.  

PubMed

Two highly selective OFF-ON green emitting fluorescent thiol probes (1 and 2) with intense absorption in the visible spectrum (molar extinction coefficient ? is up to 73?800 M(-1) cm(-1) at 509 nm) based on dyads of BODIPY (as electron donor of the photo-induced electron transfer, i.e.PET) and 2,4-dinitrobenzenesulfonyl (DNBS) (as electron acceptor of the PET process) were devised. The single crystal structures of the two probes were determined. The distance between the electron donor (BODIPY fluorophore) and the electron acceptor (DNBS) of probe 2 is larger than that of probe 1, as a result the contrast ratio (or the PET efficiency) of probe 2 is smaller than that of probe 1. However, fluorescence OFF-ON switching effects were observed for both probe 1 and probe 2 in the presence of cysteine (the emission enhancement is 300-fold for probe 1 and 54-fold for probe 2). The fluorescence OFF-ON sensing mechanism is rationalized by DFT/TDDFT calculations. We demonstrated with DFT calculations that DNBS is ca. 0.76 eV more potent to accept electrons than the maleimide moiety. The probes were used for fluorescent imaging of cellular thiols. PMID:21487590

Guo, Huimin; Jing, Yingying; Yuan, Xiaolin; Ji, Shaomin; Zhao, Jianzhang; Li, Xiaohuan; Kan, Yanyan

2011-04-12

306

Molecular motions of [Beta]-carotene and a carotenoporphyrin dyad in solution. A carbon-13 NMR spin-lattice relaxation time study  

SciTech Connect

Analysis of [sup 13]C NMR spin-lattice relaxation times (T[sub 1]) yields information concerning both overall tumbling of molecules in solution and internal rotations about single bonds. Relaxation time and nuclear Overhauser effect data have been obtained for [Beta]-carotene and two related molecules, squalane and squalene, for zinc meso-tetraphenylporphyrin, and for a dyad consisting of a porphyrin covalently linked to a carotenoid polyene through a trimethylene bridge. Squalane and squalene, which lack conjugated double bonds, behave essentially as limp string, with internal rotations at least as rapid as overall isotropic tumbling motions. In contrast, [Beta]-carotene reorients as a rigid rod, with internal motions which are too slow to affect relaxation times. Modeling it as an anisotropic rotor yields a rotational diffusion coefficient for motion about the major axis which is 14 times larger than that for rotation about axes perpendicular to that axis. The porphyrin reorients more nearly isotropically and features internal librational motions about the single bonds to the phenyl groups. The relaxation time data for the carotenoporphyrin are consistent with internal motions similar to those of a medieval military flail. 31 refs., 3 figs., 5 tabs.

Li, S.; Swindle, S.L.; Smith, S.K.; Nieman, R.A.; Moore, A.L.; Moore, T.A.; Gust, D. (Arizona State Univ., Tempe, AZ (United States))

1995-03-09

307

Perceived Spouse Responses to Pain: The Level of Agreement in Couple Dyads and the Role of Catastrophizing, Marital Satisfaction, and Depression  

PubMed Central

The primary objective of this study was to examine whether individuals with chronic pain (“participants”) and their spouses agree on perceptions of solicitous, distracting, and punishing spouse responses to pain. The second aim was to examine the role of participant catastrophizing (a negative mental set about pain), participant and spouse marital satisfaction, and participant and spouse depression in participant perceptions of spouse responses, spouse perceptions of their responses, and agreement between participants and spouses. Individuals with chronic musculoskeletal pain and their spouses (N=108 couples) completed questionnaire packets. Examination of overall group averages (participants vs. spouses) indicated little or no differences between participant and spouse ratings. Examination of individual agreement in participant and spouse ratings indicated substantial disagreement. The proposed moderators predicted both participant and spouse perceptions and jointly made minor contributions to dyad agreement. Although neither participant nor spouse perceptions of spouse responses are necessarily a reflection of actual behavior, the lack of agreement in this study suggests it may not be valid to use only patient perceptions in research related to spouse responses.

Pence, Laura; Cano, Annmarie; Thorn, Beverly; Ward, L. Charles

2007-01-01

308

A social interaction analysis of empathy and fairness.  

PubMed

This paper advances a social interaction analysis of altruism, as a likely result of empathy, and egalitarianism, as a key component of fairness. A social interaction analysis is unique in that it (a) focuses on the persons and the situation, (b) includes proximal and distal influences (such as personality and relational influences, as well as cognitive and emotional processes), (c) yields action-reaction patterns that are largely observable and therefore especially relevant to learning, and (d) helps conceptualize interpersonal orientations that affect behaviour and social interactions. The chapter discusses the ubiquity of altruism and egalitarianism in the context of social dilemmas and related situations, and concludes that these two orientations are important to theorizing and research in various disciplines that seek to understand the motivational underpinnings of social interactions in dyads and groups. PMID:17214312

Van Lange, Paul A M; Gallucci, Marcello; Karremans, Johan C; Klapwijk, Anthon; Folmer, Chris Reinders

2007-01-01

309

Dyadic interaction and adaptation to the stresses of college life  

Microsoft Academic Search

Conducted a 2 * 2 factorial design study in which 92 male undergraduates were assigned to mutual and nonmutual dyads with and without prior contact in an encounter group. Ss used a variety of psychological measures (e.g., the TAT, the Allport-Vernon Study of Values, and a scale of academic stress) to write biographies. Mutual dyads studied one another; nonmutual dyads

James C. Miller; Irving L. Janis

1973-01-01

310

The effectiveness of parent-child interaction therapy for victims of interparental violence.  

PubMed

This study compares the effectiveness of Parent-Child Interaction Therapy (PCIT) in reducing behavior problems (e.g., aggression, defiance, anxiety) of 62 clinic-referred, 2- to 7-year-old, maltreated children exposed to interparental violence (IPV) with a group of similar children with no exposure to IPV (N=67). Preliminary analyses showed that IPV-exposed dyads were no more likely to terminate treatment prematurely than non IPV-exposed dyads. Results of repeated-measures MANCOVAs showed significant decreases in child behavior problems and caregivers' psychological distress from pre- to posttreatment for IPV-exposed and IPV nonexposed groups, and no significant variation by exposure to IPV. Stress in the parent role related to children's difficult behaviors and the parent-child relationship decreased from pre- to posttreatment, but parental distress did not decrease significantly over the course of PCIT. Results of an analysis testing the benefits of a full course of treatment over the first phase of treatment showed that dyads completing the full course of treatment reported significantly greater improvements in children's behavior problems than those receiving only the first phase of treatment. PMID:20712147

Timmer, Susan G; Ware, Lisa M; Urquiza, Anthony J; Zebell, Nancy M

2010-01-01

311

Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.  

PubMed

The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo. PMID:7913462

Yoon, S O; Chikaraishi, D M

1994-07-15

312

Activation During Observed Parent–Child Interactions with Anxious Youths: A Pilot Study  

Microsoft Academic Search

Parent–child interaction paradigms are often used to observe dysfunctional family processes; however, the influence of such\\u000a tasks on a participant’s level of activation remain unclear. The aim of this pilot project is to explore the stimulus value\\u000a of interaction paradigms that have been commonly used in child anxiety research. Twenty-nine parent–child dyads with clinically\\u000a anxious (n?=?16) and non-anxious (n?=?13) youths

Araceli Gonzalez; Phoebe S. Moore; Abbe M. Garcia; Margo Thienemann; Lynne Huffman

2011-01-01

313

Electron transfer across modular oligo-p-phenylene bridges in Ru(bpy)2(bpy-ph(n)-DQ)4+ (n = 1-5) dyads. Unusual effects of bridge elongation.  

PubMed

A series of dyads of general formula Ru(bpy)(2)(bpy-ph(n)-DQ)(4+) (n = 1-5), based on a Ru(II) polypyridine unit as photoexcitable donor, a set of oligo-p-phenylene bridges with 1-5 modular units, and a cyclo-diquaternarized 2,2'-bipyridine (DQ(2+)) as electron acceptor unit, have been synthesized. Their spectroscopic and photophysical properties have been investigated in CH(3)CN and CH(2)Cl(2) by time-resolved emission and absorption spectroscopy in the nanosecond and picosecond time scale. The experimental study has also been complemented with a computational investigation carried out on the whole series of dyads. The absorption spectra of the dyads show new spectroscopic transitions, in addition to those characteristic of the donor, bridge, and acceptor fragments. DFT calculations suggest the assignment of such bands as bridge-to-acceptor (? ph(n)) ? (?* DQ) charge-transfer transitions. This assignment is consistent with the solvatochromic and spectroelectrochemical behavior of the new bands. For all the dyads at room temperature in fluid solution, the typical (3)MLCT luminescence of the Ru(II) polypyridine unit is strongly (>90%) quenched, supporting the occurrence of an efficient intramolecular photoinduced electron transfer. The study has revealed, however, that the photophysical mechanism is actually more complex than presumed on the basis of a simple photoinduced electron-transfer scheme. For n = 1, very fast (few picoseconds) photoinduced electron transfer from the MLCT state localized on the substituted bpy ligand to the DQ unit has been observed, followed by slower interligand hopping and charge recombination. For n = 2-5, MLCT excited-state quenching takes place without transient detection of charge-separated product, indicating that charge recombination is faster than charge separation. This behavior can be rationalized in terms of the superexchange couplings expected through this type of bridges for the two processes. The kinetics of MLCT quenching in the dyads with n = 1-5 does not follow the usual exponential falloff with bridge length: after a regular decrease for n = 1-3, the rate constants become almost insensitive to bridge length for n = 3-5. The rationale of this uncommon behavior, as suggested by DFT calculations, lies in a switch in the MLCT quenching mechanism with increasing bridge length, from oxidative quenching by the DQ acceptor to reductive quenching by the bridge. PMID:22103466

Indelli, Maria Teresa; Orlandi, Michele; Chiorboli, Claudio; Ravaglia, Marcella; Scandola, Franco; Lafolet, Frederic; Welter, Steve; De Cola, Luisa

2011-12-14

314

Training partnership dyads for community-based participatory research: strategies and lessons learned from the Community Engaged Scholars Program.  

PubMed

This article describes the development, implementation, evaluation framework, and initial outcomes of a unique campus-community training initiative for community-based participatory research (CBPR). The South Carolina Clinical & Translational Research Center for Community Health Partnerships, which functions as the institution's Clinical Translational and Science Award Community Engagement Program, leads the training initiative known as the Community Engaged Scholars Program (CES-P). The CES-P provides simultaneous training to CBPR teams, with each team consisting of at least one community partner and one academic partner. Program elements include 12 months of monthly interactive group sessions, mentorship with apprenticeship opportunities, and funding for a CBPR pilot project. A modified RE-AIM (Reach, Effectiveness, Adoption, Implementation, Maintenance) framework guides the process, impact, and outcome evaluation plan. Lessons learned include challenges of group instruction with varying levels of readiness among the CBPR partners, navigating the institutional review board process with community co-investigators, and finding appropriate academic investigators to match community research interests. Future directions are recommended for this promising and unique dyadic training of academic and community partners. PMID:23091303

Andrews, Jeannette O; Cox, Melissa J; Newman, Susan D; Gillenwater, Gwen; Warner, Gloria; Winkler, Joyce A; White, Brandi; Wolf, Sharon; Leite, Renata; Ford, Marvella E; Slaughter, Sabra

2012-10-22

315

Social coordination in toddler's word learning: interacting systems of perception and action  

NASA Astrophysics Data System (ADS)

We measured turn-taking in terms of hand and head movements and asked if the global rhythm of the participants' body activity relates to word learning. Six dyads composed of parents and toddlers (M=18 months) interacted in a tabletop task wearing motion-tracking sensors on their hands and head. Parents were instructed to teach the labels of 10 novel objects and the child was later tested on a name-comprehension task. Using dynamic time warping, we compared the motion data of all body-part pairs, within and between partners. For every dyad, we also computed an overall measure of the quality of the interaction, that takes into consideration the state of interaction when the parent uttered an object label and the overall smoothness of the turn-taking. The overall interaction quality measure was correlated with the total number of words learned. In particular, head movements were inversely related to other partner's hand movements, and the degree of bodily coupling of parent and toddler predicted the words that children learned during the interaction. The implications of joint body dynamics to understanding joint coordination of activity in a social interaction, its scaffolding effect on the child's learning and its use in the development of artificial systems are discussed.

Pereira, Alfredo; Smith, Linda; Yu, Chen

2008-06-01

316

Social coordination in toddler's word learning: interacting systems of perception and action  

PubMed Central

We measured turn-taking in terms of hand and head movements and asked if the global rhythm of the participants’ body activity relates to word learning. Six dyads composed of parents and toddlers (M = 18 months) interacted in a tabletop task wearing motion-tracking sensors on their hands and head. Parents were instructed to teach the labels of 10 novel objects and the child was later tested on a name-comprehension task. Using dynamic time warping, we compared the motion data of all body-part pairs, within and between partners. For every dyad, we also computed an overall measure of the quality of the interaction, that takes into consideration the state of interaction when the parent uttered an object label and the overall smoothness of the turn-taking. The overall interaction quality measure was correlated with the total number of words learned. In particular, head movements were inversely related to other partner’s hand movements, and the degree of bodily coupling of parent and toddler predicted the words that children learned during the interaction. The implications of joint body dynamics to understanding joint coordination of activity in a social interaction, its scaffolding effect on the child’s learning and its use in the development of artificial systems are discussed.

Pereira, Alfredo F.; Smith, Linda B.; Yu, Chen

2010-01-01

317

Brain-Mind Dyad, Human Experience, the Consciousness Tetrad and Lattice of Mental Operations: And Further, The Need to Integrate Knowledge from Diverse Disciplines  

PubMed Central

Brain, Mind and Consciousness are the research concerns of psychiatrists, psychologists, neurologists, cognitive neuroscientists and philosophers. All of them are working in different and important ways to understand the workings of the brain, the mysteries of the mind and to grasp that elusive concept called consciousness. Although they are all justified in forwarding their respective researches, it is also necessary to integrate these diverse appearing understandings and try and get a comprehensive perspective that is, hopefully, more than the sum of their parts. There is also the need to understand what each one is doing, and by the other, to understand each other’s basic and fundamental ideological and foundational underpinnings. This must be followed by a comprehensive and critical dialogue between the respective disciplines. Moreover, the concept of mind and consciousness in Indian thought needs careful delineation and critical/evidential enquiry to make it internationally relevant. The brain-mind dyad must be understood, with brain as the structural correlate of the mind, and mind as the functional correlate of the brain. To understand human experience, we need a triad of external environment, internal environment and a consciousness that makes sense of both. We need to evolve a consensus on the definition of consciousness, for which a working definition in the form of a Consciousness Tetrad of Default, Aware, Operational and Evolved Consciousness is presented. It is equally necessary to understand the connection between physical changes in the brain and mental operations, and thereby untangle and comprehend the lattice of mental operations. Interdisciplinary work and knowledge sharing, in an atmosphere of healthy give and take of ideas, and with a view to understand the significance of each other’s work, and also to critically evaluate the present corpus of knowledge from these diverse appearing fields, and then carry forward from there in a spirit of cooperative but evidential and critical enquiry – this is the goal for this monograph, and the work to follow.

Singh, Ajai R.; Singh, Shakuntala A.

2011-01-01

318

Parent-child interactions in autism: characteristics of play.  

PubMed

Although the literature on parent-child interactions in young children with autism has examined dyadic style, synchrony, and sustained engagement, the examination of parental skill in sustaining and developing play skills themselves has not been targeted. This study examined the extent to which parents of young children with autism match and scaffold their child's play. Sixteen dyads of parents and their children with autism participated in this study along with 16 matched dyads of typically developing children. Both groups were administered a structured play assessment and were observed during a 10-min free play situation. Strategies of play were examined and results revealed that parents of children with autism initiated more play schemes and suggested and commanded play acts more than parents of typical children. They also responded to their child's play acts more often with a higher level play act, while parents of typical children matched/expanded their responses to their child. Parent imitation was also related to longer sequences of play. The findings can guide further research and play intervention for parents. PMID:23382513

Freeman, Stephanny; Kasari, Connie

2013-02-04

319

Instructional interactions of students with cognitive disabilities: sequential analysis.  

PubMed

We studied instructional interactions through semi-structured observation of 13 student- teacher dyads involving elementary students with cognitive disabilities. Special educators' use of directions and responses of differing modes and types was analyzed. Student task-engagement behaviors (i.e., active engage, disruptive, passive on-task, off-task) provided a context for understanding differences in teacher styles. Results indicate that teacher directions were followed by student active engagement; and teacher responses, by student passive task-orientation. This higher quality feedback from students, together with outerdirectedness of students with cognitive disabilities, is postulated as a mechanism that maintains a high level of teacher directiveness. Sequential relationship patterns changed as student engagement levels varied, suggesting a child-driven model of teacher-child instructional interactions. PMID:17295557

Kim, Ockjean; Hupp, Susan C

2007-03-01

320

Rural low-income mothers' interactions with their young children.  

PubMed

Quality mother-child interaction is imperative for normal child growth and development. Early intervention programs may support mother-child interaction, particularly at-risk mother-child dyads. The purpose of this study was to describe mother-child dyadic interaction as they entered and exited a rural Early Head Start (EHS) program and compare their interaction with a normed national sample. Thirty mothers and their children participated in the study and agreed to allow trained data collectors to observe an in-home teaching situation using the Nursing Child Assessment Satellite Training (NCAST) Teaching Scale. At exit from the program, although no significant differences in mother-child interactions were found, more than half of the mothers maintained or improved their ability to read cues and respond to their child. However, over 40% of the mothers remained at risk for poor interaction. Differences in program outcomes may be a result of family participation and involvement levels. Poor maternal health may also adversely affect mother-child interaction. Program implications include resource allocation for those mothers with the greatest "worry" scores. Nurses and other professionals working with mothers and children need to be vigilant in their ongoing assessment of the mother's health and possible influence on the quality of the mother-child interaction. PMID:15511046

Horodynski, Mildred A; Gibbons, Cynthia

321

The Origins of 12-Month Attachment: A Microanalysis of 4-Month Mother-Infant Interaction  

PubMed Central

A detailed microanalysis of 4-month mother-infant face-to-face communication revealed a fine-grained specification of essential communication processes that predicted 12-month insecure attachment outcomes, particularly resistant and disorganized classifications. An urban community sample of 84 dyads were videotaped at 4 months during a face-to-face interaction, and at 12 months during the Ainsworth Strange Situation. Four-month mother and infant communication modalities of attention, affect, touch, and spatial orientation were coded from split-screen videotape on a 1s time base; mother and infant facial-visual “engagement” variables were constructed. We used contingency measures (multi-level time-series modeling) to examine the dyadic temporal process over time, and specific rates of qualitative features of behavior to examine the content of behavior. Self-contingency (auto-correlation) measured the degree of stability/lability within an individual’s own rhythms of behavior; interactive contingency (lagged cross-correlation) measured adjustments of the individual’s behavior that were correlated with the partner’s previous behavior. We documented that both self- and interactive contingency, as well as specific qualitative features, of mother and infant behavior were mechanisms of attachment formation by 4 months, distinguishing 12-month insecure, resistant, and disorganized attachment classifications from secure; avoidant were too few to test. All communication modalities made unique contributions. The separate analysis of different communication modalities identified intermodal discrepancies or conflict, both intrapersonal and interpersonal, that characterized insecure dyads. Contrary to dominant theories in the literature on face-to-face interaction, measures of maternal contingent coordination with infant yielded the fewest associations with 12-month attachment, whereas mother and infant self-contingency, and infant contingent coordination with mother, yielded comparable numbers of findings. Rather than the more usual hypothesis that more contingency is “better,” we partially supported our hypothesis that 12-month insecurity is associated with both higher and lower 4-month self- and interactive contingency values than secure, as a function of mother vs. infant and communication modality. Thus, in the origins of attachment security, more contingency is not necessarily better. A remarkable degree of differentiation was identified in the 4-month patterns of “future” C and D infants, classified as resistant and disorganized, respectively, at 12 months. Only future D infants were emotionally distressed, with simultaneous positive and negative discrepant affect; only their mothers showed difficulty in sharing infant affect, particularly distress, and lowered their contingent coordination with infant facial-visual engagement. This lowered contingent coordination makes it more difficult for infants to come to expect that their emotional/attentional states can influence mothers to coordinate with them and thus compromises the infant’s sense of interactive efficacy. Only future C dyads showed the spatial approach/avoid pattern of “chase and dodge;” only mothers of future D infants showed the spatial intrusion pattern of “looming” into the infant’s face. Both future C and D dyads showed patterns of touch dysregulation. Future C infants inhibited their emotional coordination with mothers’ less affectionate touch, as if tuning it out. Future D dyads showed a dyadic touch dysregulation, in which mothers lowered their coordination with infant touch, while infants had a lowered ability to use their own touch. Both mothers of future C and D infants disturbed the stability of the spatial “frame” of the encounter by transitioning among upward, forward and loom orientations in less predictable ways than mothers of future B infants. Only mothers of future D infants disturbed the attentional “frame” as

Beebe, Beatrice; Jaffe, Joseph; Markese, Sara; Buck, Karen; Chen, Henian; Cohen, Patricia; Bahrick, Lorraine; Andrews, Howard; Feldstein, Stanley

2013-01-01

322

Control of sarcoplasmic reticulum Ca2+ release by stochastic RyR gating within a 3D model of the cardiac dyad and importance of induction decay for CICR termination.  

PubMed

The factors responsible for the regulation of regenerative calcium-induced calcium release (CICR) during Ca(2+) spark evolution remain unclear. Cardiac ryanodine receptor (RyR) gating in rats and sheep was recorded at physiological Ca(2+), Mg(2+), and ATP levels and incorporated into a 3D model of the cardiac dyad, which reproduced the time course of Ca(2+) sparks, Ca(2+) blinks, and Ca(2+) spark restitution. The termination of CICR by induction decay in the model principally arose from the steep Ca(2+) dependence of RyR closed time, with the measured sarcoplasmic reticulum (SR) lumen Ca(2+) dependence of RyR gating making almost no contribution. The start of CICR termination was strongly dependent on the extent of local depletion of junctional SR Ca(2+), as well as the time course of local Ca(2+) gradients within the junctional space. Reducing the dimensions of the dyad junction reduced Ca(2+) spark amplitude by reducing the strength of regenerative feedback within CICR. A refractory period for Ca(2+) spark initiation and subsequent Ca(2+) spark amplitude restitution arose from 1), the extent to which the regenerative phase of CICR can be supported by the partially depleted junctional SR, and 2), the availability of releasable Ca(2+) in the junctional SR. The physical organization of RyRs within the junctional space had minimal effects on Ca(2+) spark amplitude when more than nine RyRs were present. Spark amplitude had a nonlinear dependence on RyR single-channel Ca(2+) flux, and was approximately halved by reducing the flux from 0.6 to 0.2 pA. Although rat and sheep RyRs had quite different Ca(2+) sensitivities, Ca(2+) spark amplitude was hardly affected. This suggests that moderate changes in RyR gating by second-messenger systems will principally alter the spatiotemporal properties of SR release, with smaller effects on the amount released. PMID:23708355

Cannell, M B; Kong, C H T; Imtiaz, M S; Laver, D R

2013-05-21

323

Interactions between Turkish mothers and preschool children with autism.  

PubMed

This study explored the relationship between Turkish mothers' style of interaction and the engagement of their preschool-aged children with autism. Data were collected from fifty mother-child dyads in which all children had diagnoses of autism. Video recordings of mother-child interaction were analyzed using the Turkish versions of the Maternal Behavior Rating Scale and the Child Behavior Rating Scale (O. Diken, 2009 ). Similar to mothers from Western countries, Turkish mothers tended to engage in highly directive interactions with their children. However, a cluster analysis revealed considerable variability in mothers' style of interaction. This included a directive nonengaged style, a directive/achievement-oriented style, and a responsive style of interaction. Children's level of engagement was associated with differences in mothers' style of interaction. Children were least engaged with directive/nonengaged mothers and most engaged with responsive mothers. However, children's engagement was only associated with their mothers' responsiveness, not with their directiveness. Results are discussed in terms of their implications for early intervention. PMID:23834215

Diken, Ozlem; Mahoney, Gerald

2013-06-01

324

Language skill and interactive patterns in prematurely born toddlers.  

PubMed

Developmental outcomes among preterm infants are highly variable. Research has shown that a potent factor in predicting outcome is some quality of the interactions between infants and caregivers. This study explores specific aspects of interaction that may, in part, account for its remedial influence on development. Videotaped interactions between 20 prematurely born toddlers and their mothers were described within a framework having theoretical relevance for language learning--dyadic joint attention to features of the environment. 3 major results are reported. First, the children could be divided into 2 linguistic groups. Children in the Hi group used word combinations productively and talked about relations between objects and events. Children in the Lo language group produced few word combinations and were limited in the relations they talked about. Second, the Lo language pairs did not share common topics as frequently as the Hi pairs. Finally, we found that no single style was used by Lo language dyads in breaking joint attention. Instead, this group was characterized by a broad range of interactive styles. These results are discussed in terms of the facilitating effect interaction may have for the acquisition of language. The findings underscore the need to recognize that poor outcomes can be brought about in many different ways, and that neither single outcomes nor unitary causes for poor outcomes should be expected in preterm populations. PMID:6354630

Rocissano, L; Yatchmink, Y

1983-10-01

325

A state space analysis of emotion and flexibility in parent-child interactions.  

PubMed

Negative emotion has been shown to reduce flexibility in cognition and behavior. We examined interpersonal flexibility during negative emotional episodes within parent-child interactions. Fifty-five mothers and early-adolescent daughters were observed during a positive discussion, a negative (conflict) discussion, and another positive discussion. Codes of moment-to-moment changes in emotion expression were used to create state space grids from which measures of emotional valence and flexibility were derived. As expected, mean flexibility was lowest during the conflict discussion when negative emotion peaked, suggesting that interpersonal flexibility decreases with increasing negative emotion. Sub-groups identified as low or high in stress were also compared. Dyads with girls reporting more stressful events showed lower flexibility during the first positive discussion. However, dyads expressing more negative emotion during the conflict discussion were also more flexible, suggesting that flexible dyadic styles permit more negative emotion. These individual difference findings are discussed in terms of the suppression versus expression of negative emotions. PMID:17144756

Hollenstein, Tom; Lewis, Marc D

2006-11-01

326

Equality versus differentiation: the effects of power dispersion on group interaction.  

PubMed

Power is an inherent characteristic of social interaction, yet research has yet to fully explain what power and power dispersion may mean for conflict resolution in work groups. We found in a field study of 42 organizational work groups and a laboratory study of 40 negotiating dyads that the effects of power dispersion on conflict resolution are contingent on the level of interactants' power, thereby explaining contradictory theory and findings on power dispersion. We found that when members have low power, power dispersion is positively related to conflict resolution, but when members have high power, power dispersion is negatively related to conflict resolution (i.e., power equality is better). These findings can be explained by the mediating role of intragroup power struggles. Together, these findings suggest that power hierarchies function as a heuristic solution for conflict and contribute to adaptive social dynamics in groups with low, but not high, levels of power. PMID:20822207

Greer, Lindred L; van Kleef, Gerben A

2010-11-01

327

The interactive roles of parenting, emotion regulation and executive functioning in moral reasoning during middle childhood.  

PubMed

We examined mother-child co-operative behaviour, children's emotion regulation and executive function, as well as combinations of these factors, as predictors of moral reasoning in 89 10-year-old children. Dyadic co-operation was coded from videotaped observations of laboratory puzzle and speech tasks. Emotion regulation was derived from maternal report, and executive functioning was assessed with the Tower of London task. Moral reasoning was coded during mother-child conversations about morally ambiguous, peer-conflict situations. Two significant interactions indicated that children from more co-operative dyads who also had higher executive function skills had higher moral reasoning scores than other children, and children lower in both emotion regulation and executive function had lower moral reasoning scores than other children. The results contribute to the literature on the multiple and interactive levels of influence on moral reasoning in childhood. PMID:23650955

Hinnant, J Benjamin; Nelson, Jackie A; O'Brien, Marion; Keane, Susan P; Calkins, Susan D

2013-05-01

328

High-Resolution Spectrum and Rovibrational Analysis of the nu(2)/nu(5) Dyad of D(3)SiF near 700 cm(-1).  

PubMed

The nu(2) (A(1), 710.157 cm(-1)) and nu(5) (E, 701.717 cm(-1)) fundamental bands of D(3)(28)SiF have been studied by FTIR spectroscopy with a resolution of 2.4 x 10(-3) cm(-1). We assigned 1648 lines for the parallel band (J(max) = 50, K(max) = 21), 4279 for the perpendicular band (J(max) = 52, K(max) = 27), and in addition 671 perturbation-allowed transitions (J(max) = 50, K(max) = 12). The nearly degenerate v(2) = 1 and v(5) = 1 states are linked by (DeltaK = +/-1, Deltal = +/-1) and (DeltaK = +/-2, Deltal = -/+1) interactions, while the l(5) = +/-1 levels of nu(5) interact also by l(2, -1), l(2, 2), and l(2, -4) interactions. The first model with 36 free parameters, taking into account all these resonances through a nonlinear least-squares program, gave standard deviations of 1.56 x 10(-4) cm(-1) for 5997 nonzero-weighted IR data and 138 kHz for 8 MW data from the literature. The second model, in which the main Coriolis term was constrained to a force field value, used 37 parameters and gave similar standard deviations. A new determination of the A(0) and D(0)(K) ground state parameters was performed by two methods: either using differences between "forbidden" transitions differing by 3 in K or letting A(0) and D(0)(K) free in the global fit. The values obtained are fully compatible with those obtained previously by the "loop method." Copyright 2000 Academic Press. PMID:10662578

Badaoui; Sari-Zizi; Graner; Mkadmi; Bürger; Pracna

2000-03-01

329

Parent-child interaction of mothers with depression and their children with ADHD.  

PubMed

Attention deficit/hyperactivity disorder (ADHD) is a developmental disorder that may have a chronic and pervasive impact on the child's function and cause long-term stress to parents. A higher rate of depression is associated with mothers of children with ADHD. This observational study aimed to investigate the effect of maternal depression and the child's ADHD on the quality of the parent-child interaction in children with ADHD and their mothers with depression. The study participants comprised 39 mother-son dyads including children with ADHD and mothers with depression, children with ADHD and mothers without depression, and children without ADHD and mothers without depression. The Specific Affect Coding System, 20-code version was used to code interactional affect, including positive engagement, negative engagement, negative disengagement, and neural affect. There were no statistically significant group-by-context interaction effects or group effects on all affective variables between the group of children with ADHD and mothers without depression and the group of children without ADHD and mothers without depression. Stimulant medication may account for these nonsignificant findings. No significant difference of positive affect between neutral and conflict-solving contexts was observed in depressed mothers whose children were diagnosed as ADHD. Children with ADHD whose mothers were depressed were less positive in their parent-child interaction compared with children in the other groups. Maternal depression may play an important role in the affective presentation of dyads of children with ADHD and mothers with depression. Implications for clinical practice and future research are provided. PMID:23123879

Lee, Pei-chin; Lin, Keh-chung; Robson, Deborah; Yang, Hao-jan; Chen, Vincent Chin-hung; Niew, Wern-ing

2012-11-01

330

Numerical simulations of ultrafast charge separation dynamics from second excited state of directly linked zinc-porphyrin-imide dyads and ensuing hot charge recombination into the first excited state.  

PubMed

A model of the intramolecular charge separation from the second singlet excited-state of directly linked Zn-porphyrin-imide dyads and following charge recombination into the first singlet excited-state has been constructed and investigated. The model incorporates three electronic states (the first and the second singlet excited and charge separated states) as well as their vibrational sublevels. Dynamics of the transitions between these states are described in the framework of the stochastic point-transition approach. The relaxation of the intramolecular high frequency vibrational mode is supposed to occur as a single-quantum transition between nearest states with a time constant depending on the number of the vibrational state. The medium relaxation is characterized by two timescales. A good fitting to experimentally observed population dynamics of both the first and the second singlet excited states has been obtained. The calculations show the charge recombination into the first excited-state to proceed in a hot stage in parallel with the relaxation of both the medium and the intramolecular high-frequency vibrational mode. PMID:19063611

Ionkin, Vladimir N; Ivanov, Anatoly I

2009-01-01

331

The recombinational enhancer for DNA inversion functions independent of its orientation as a consequence of dyad symmetry in the Fis-DNA complex.  

PubMed Central

The Escherichia coli Fis protein binds to specific DNA sequences whose base composition varies enormously. One known function of Fis is to stimulate site-specific DNA recombination. We used the Gin-mediated DNA inversion system of bacteriophage Mu to analyze Fis-DNA interaction. Efficient inversion requires an enhancer which consists of two Fis binding sites at a fixed distance from each other. Using mutant enhancers in which one of the Fis binding sites is replaced we show that Fis binds symmetrically to the DNA and we locate the center of symmetry. Furthermore, we show that one of the Fis binding sites can be replaced by a Fis binding site that normally functions in a process other than site-specific recombination. Images

Kanaar, R; van Hal, J P; van de Putte, P

1989-01-01

332

Competitive electron transfer and enhanced intersystem crossing in photoexcited covalent TEMPO-perylene-3,4:9,10-bis(dicarboximide) dyads: unusual spin polarization resulting from the radical-triplet interaction.  

PubMed

A stable 2,2,6,6-tetramethyl-1-piperidinyloxyl (TEMPO) radical was covalently attached at its 4-position to the imide nitrogen atom of a perylene-3,4:9,10-bis(dicarboximide) (PDI) to produce TEMPO-PDI, 1, having a well-defined distance and orientation between TEMPO and PDI. Transient optical absorption experiments in toluene following selective photoexcitation of the PDI chromophore in TEMPO-PDI show that enhanced intersystem crossing occurs with tau = 45 +/- 1 ps, resulting in formation of TEMPO-(3*)PDI, while the same experiment in THF shows that the electron-transfer reaction TEMPO-(1*)PDI --> TEMPO(+*)-PDI(-*) occurs with tau = 1.2 +/- 0.2 ps and thus competes effectively with enhanced intersystem crossing. Time-resolved EPR (TREPR) spectroscopy on the photogenerated three-spin system TEMPO-(3*)PDI in toluene at 295 K initially shows a broad signal assigned to spin-polarized (3*)PDI, which thermalizes at longer times and is accompanied by formation of an emissively polarized TEMPO radical. No signals are observed in THF at 295 K. The TREPR spectrum of TEMPO-(3*)PDI at 85 K in toluene shows an emissive/absorptive signal due to TEMPO and a broad triplet signal due to (3*)PDI having a spin polarization pattern characteristic of overpopulation of its T(0) sublevel. This unusual spin polarization pattern does not result from radical pair intersystem crossing because electron transfer does not occur at 85 K. The observed spin polarization of (3*)PDI cannot be readily explained by mechanisms discussed previously, leading us to propose a new spin polarization mechanism, which requires that the radical and attached triplet are in the weak exchange regime. PMID:20055506

Colvin, Michael T; Giacobbe, Emilie M; Cohen, Boiko; Miura, Tomoaki; Scott, Amy M; Wasielewski, Michael R

2010-02-01

333

d?f Energy Transfer in Ir(III)/Eu(III) Dyads: Use of a Naphthyl Spacer as a Spatial and Energetic "Stepping Stone".  

PubMed

A series of luminescent complexes based on {Ir(phpy)2} (phpy = cyclometallating anion of 2-phenylpyridine) or {Ir(F2phpy)2} [F2phpy = cyclometallating anion of 2-(2',4'-difluorophenyl)pyridine] units, with an additional 3-(2-pyridyl)-pyrazole (pypz) ligand, have been prepared; fluorination of the phenylpyridine ligands results in a blue-shift of the usual (3)MLCT/(3)LC luminescence of the Ir unit from 477 to 455 nm. These complexes have pendant from the coordinated pyrazolyl ring an additional chelating 3-(2-pyridyl)-pyrazole unit, separated via a flexible chain containing a naphthalene-1,4-diyl or naphthalene-1,5-diyl spacer. Crystal structures show that the flexibility of the pendant chain allows the naphthyl group to lie close to the Ir core and participate in a ?-stacking interaction with a coordinated phpy or F2phpy ligand. Luminescence spectra show that, whereas the {Ir(phpy)2(pypz)} complexes show typical Ir-based emission-albeit with lengthened lifetimes because of interaction with the stacked naphthyl group-the {Ir(F2phpy)2(pypz)} complexes are nearly quenched. This is because the higher energy of the Ir-based (3)MLCT/(3)LC excited state can now be quenched by the adjacent naphthyl group to form a long-lived naphthyl-centered triplet ((3)nap) state which is detectable by transient absorption. Coordination of an {Eu(hfac)3} unit (hfac = 1,1,1,5,5,5-hexafluoro-pentane-2,4-dionate) to the pendant pypz binding site affords Ir-naphthyl-Eu triads. For the triads containing a {Ir(phpy)2} core, the unavailability of the (3)nap state (not populated by the Ir-based excited state which is too low in energy) means that direct Ir?Eu energy-transfer occurs in the same way as in other flexible Ir/Eu complexes. However for the triads based on the{Ir(F2phpy)2} core, the initial Ir?(3)nap energy-transfer step is followed by a second, slower, (3)nap?Eu energy-transfer step: transient absorption measurements clearly show the (3)nap state being sensitized by the Ir center (synchronous Ir-based decay and (3)nap rise-time) and then transferring its energy to the Eu center (synchronous (3)nap decay and Eu-based emission rise time). Thus the (3)nap state, which is energetically intermediate in the {Ir(F2phpy)2}-naphthyl-Eu systems, can act as a "stepping stone" for two-step d?f energy-transfer. PMID:24007190

Sykes, Daniel; Parker, Simon C; Sazanovich, Igor V; Stephenson, Andrew; Weinstein, Julia A; Ward, Michael D

2013-09-05

334

Oxidative quenching within photosensitizer-acceptor dyads based on bis(bidentate) phosphine-connected osmium(II) bipyridyl light absorbers and reactive metal sites.  

PubMed

For the first time oxidative quenching of OsP2N4 chromophores by reactive Pt(II) or Pd(II) sites containing cis, trans, cis-1,2,3,4-tetrakis(diphenylphosphino)cyclobutane (dppcb) is directly observed despite the presence of a saturated cyclobutane backbone "bridge". This dramatic effect is measured as a sudden temperature-dependent onset of a reduction in phosphorescence lifetime in [Os(bpy)2(dppcb)MCl2](SbF6)2 (M = Pt, 1; Pd, 2). The appearance of this additional energy release is not detectable in [Os(bpy)2(dppcbO2)](PF6)2 (3), where dppcbO2 is cis, trans, cis-1,2-bis(diphenylphosphinoyl)-3,4-bis(diphenylphosphino)cyclobutane. Obviously, the square-planar metal centers in 1 and 2 are responsible for this effect. In line with these observations, the emission quantum yields at room temperature for 1 and 2 are drastically reduced compared with 3. Since this luminescence quenching implies strong intramolecular interaction between the Os(II) excited states and the acceptor sites and depends on the metal?metal distances, also the single crystal X-ray structures of 1-3 are given. PMID:23471298

Eller, Sylvia; Trettenbrein, Barbara; Oberhuber, Dennis; Strabler, Christof; Gutmann, Rene; van der Veer, Wytze E; Ruetz, Markus; Kopacka, Holger; Obendorf, Dagmar; Brüggeller, Peter

2012-09-01

335

Development of the Brief Romantic Relationship Interaction Coding Scheme (BRRICS)  

PubMed Central

Although observational studies of romantic relationships are common, many existing coding schemes require considerable amounts of time and resources to implement. The current study presents a new coding scheme, the Brief Romantic Relationship Interaction Coding Scheme (BRRICS), designed to assess various aspects of romantic relationship both quickly and efficiently. The BRRICS consists of four individual coding dimensions assessing positive and negative affect in each member of the dyad, as well as four codes assessing specific components of the dyadic interaction (i.e., positive reciprocity, demand-withdraw pattern, negative reciprocity, and overall satisfaction). Concurrent associations with measures of marital adjustment and conflict were evaluated in a sample of 118 married couples participating in the Michigan State University Twin Registry. Couples were asked to discuss common conflicts in their marriage while being videotaped. Undergraduate coders used the BRRICS to rate these interactions. The BRRICS scales were correlated in expected directions with self-reports of marital adjustment, as well as children’s perception of the severity and frequency of marital conflict. Based on these results, the BRRICS may be an efficient tool for researchers with large samples of observational data who are interested in coding global aspects of the relationship but do not have the resources to use labor intensive schemes.

Humbad, Mikhila N.; Donnellan, M. Brent; Klump, Kelly L.; Burt, S. Alexandra

2012-01-01

336

Colloid-wall interaction in a nematic liquid crystal: The mirror-image method of colloidal nematostatics  

NASA Astrophysics Data System (ADS)

The new area of nematic colloidal systems (or nematic emulsions) has been greatly guided by the fruitful analogy between the colloidal nematostatics and electrostatics. The elastic charge density representation of the colloidal nematostatics [V. M. Pergamenshchik and V. O. Uzunova, Eur. Phys. J. E 23, 161 (2007); Phys. Rev. E 76, 011707 (2007)] develops this analogy at the level of charge density and Coulomb interaction. It shows, however, that the colloidal nematostatics in three dimensions substantially differs from the electrostatics both in its mathematical structure and physical implications: the elastic charge and multipoles are dyads; similar charges attract while opposite charges repel each other, and so on. In this paper we consider the interaction between an elastic charge and elastic dipole with a nematic surface (wall) at which the director alignment is fixed. Using the mirror image method of electrostatics as a guiding idea, we develop the mirror image method in the nematostatics for arbitrary director tilt at the wall. A wall is shown to induce a repulsive 1/R4 force on the elastic dipole which, in general, is accompanied by its reorientation. External torque on the colloid induces an elastic charge therein and triggers switching to the 1/R2 repulsion. The dyadic nature of an elastic dipole is shown to be essential: a particle-wall interaction potential cannot be obtained in phenomenological theories with a single component dipole. In the introductory sections we discuss connection between the director-mediated interaction in two and three dimensions and the electrostatic interaction and consider different symmetries of elastic dipoles. Conservation of the torque components exerted upon colloids is shown to play the role of Gauss’ theorem and determines the elastic charge dyad.

Pergamenshchik, V. M.; Uzunova, V. A.

2009-02-01

337

Colloid-wall interaction in a nematic liquid crystal: the mirror-image method of colloidal nematostatics.  

PubMed

The new area of nematic colloidal systems (or nematic emulsions) has been greatly guided by the fruitful analogy between the colloidal nematostatics and electrostatics. The elastic charge density representation of the colloidal nematostatics [V. M. Pergamenshchik and V. O. Uzunova, Eur. Phys. J. E 23, 161 (2007); Phys. Rev. E 76, 011707 (2007)] develops this analogy at the level of charge density and Coulomb interaction. It shows, however, that the colloidal nematostatics in three dimensions substantially differs from the electrostatics both in its mathematical structure and physical implications: the elastic charge and multipoles are dyads; similar charges attract while opposite charges repel each other, and so on. In this paper we consider the interaction between an elastic charge and elastic dipole with a nematic surface (wall) at which the director alignment is fixed. Using the mirror image method of electrostatics as a guiding idea, we develop the mirror image method in the nematostatics for arbitrary director tilt at the wall. A wall is shown to induce a repulsive 1R{4} force on the elastic dipole which, in general, is accompanied by its reorientation. External torque on the colloid induces an elastic charge therein and triggers switching to the 1R{2} repulsion. The dyadic nature of an elastic dipole is shown to be essential: a particle-wall interaction potential cannot be obtained in phenomenological theories with a single component dipole. In the introductory sections we discuss connection between the director-mediated interaction in two and three dimensions and the electrostatic interaction and consider different symmetries of elastic dipoles. Conservation of the torque components exerted upon colloids is shown to play the role of Gauss' theorem and determines the elastic charge dyad. PMID:19391762

Pergamenshchik, V M; Uzunova, V A

2009-02-23

338

Species Interactions.  

National Technical Information Service (NTIS)

This paper illustrates and discusses the following conclusions: (1) species interactions have been studied in numerous laboratory systems that might be adapted for toxicity testing; (2) species interactions could significantly alter toxicant effects, and ...

G. W. Suter

1983-01-01

339

Playful Interaction  

Microsoft Academic Search

The video Playful Interaction describes a future architectural office, and envisions ideas and concepts for playful interactions between people, materials and appliances in a pervasive and aug- mented working environment. The video both describes existing developments, technologies and de- signs as well as ideas not yet implemented such as playful modes of interaction with an augmented ball.

METTE AGGER ERIKSEN; PETER GALL KROGH; MARTIN LUDVIGSEN

340

On the mechanism of d-f energy transfer in RuII/LnIII and OsII/LnIII dyads: Dexter-type energy transfer over a distance of 20 A.  

PubMed

We have used time-resolved luminescence methods to study rates of photoinduced energy transfer (PEnT) from [M(bipy)3]2+ (M=Ru, Os) chromophores to Ln(III) ions with low-energy f-f states (Ln=Yb, Nd, Er) in d-f dyads in which the metal fragments are separated by a saturated -CH2CH2- spacer, a p-C6H4 spacer, or a p-(C6H4)2 spacer. The finding that d-->f PEnT is much faster across a conjugated p-C6H4 spacer than it is across a shorter CH2CH2 spacer points unequivocally to a Dexter-type energy transfer, involving electronic coupling mediated by the bridging ligand orbitals (superexchange) as the dominant mechanism. Comparison of the distance dependence of the Ru-->Nd energy-transfer rate across different conjugated spacers [p-C6H4 or p-(C6H4)2 groups] is also consistent with this mechanism. Observation of Ru-->Nd PEnT (as demonstrated by partial quenching of the RuII-based 3MLCT emission (MLCT=metal-to-ligand charge transfer), and the growth of sensitised NdIII-based emission at 1050 nm) over approximately 20 A by an exchange mechanism is a departure from the normal situation with lanthanides, in which long-range energy transfer often involves through-space Coulombic mechanisms. PMID:18756566

Lazarides, Theodore; Sykes, Daniel; Faulkner, Stephen; Barbieri, Andrea; Ward, Michael D

2008-01-01

341

Client-identified important events in psychotherapy: interactional structures and practices.  

PubMed

This study describes interactional structures and practices in client-identified important events in psychotherapy sessions. Twelve of 16 events from seven client-therapist dyads were found to contain disagreement. A turn-by-turn investigation using conversation analysis displayed three different ways that therapists used to handle disagreement. The first was to orient to the client's disagreement cues by inviting the client to elaborate his or her point and to establish a shared understanding. The second was to orient to the client's disagreement cues but define the therapist's point of view as more relevant to the project at hand. The third was a single case where the therapist did not orient to the client's disagreement cues. The results suggest that disagreement patterns may be an interesting focus for further exploration of microprocesses within therapy sessions. PMID:19821183

Viklund, Erika; Holmqvist, Rolf; Zetterqvist Nelson, Karin

2010-03-01

342

Automated Measurement of Facial Expression in Infant-Mother Interaction: A Pilot Study  

PubMed Central

Automated facial measurement using computer vision has the potential to objectively document continuous changes in behavior. To examine emotional expression and communication, we used automated measurements to quantify smile strength, eye constriction, and mouth opening in two six-month-old/mother dyads who each engaged in a face-to-face interaction. Automated measurements showed high associations with anatomically based manual coding (concurrent validity); measurements of smiling showed high associations with mean ratings of positive emotion made by naive observers (construct validity). For both infants and mothers, smile strength and eye constriction (the Duchenne marker) were correlated over time, creating a continuous index of smile intensity. Infant and mother smile activity exhibited changing (nonstationary) local patterns of association, suggesting the dyadic repair and dissolution of states of affective synchrony. The study provides insights into the potential and limitations of automated measurement of facial action.

Messinger, Daniel S.; Mahoor, Mohammad H.; Chow, Sy-Miin; Cohn, Jeffrey F.

2009-01-01

343

A parent-child interactional model of social anxiety disorder in youth.  

PubMed

In this paper, one of the most common disorders of childhood and adolescence, social anxiety disorder (SAD), is examined to illustrate the complex and delicate interplay between parent and child factors that can result in normal development gone awry. Our parent-child model of SAD posits a host of variables that converge to occasion the onset and maintenance of this disorder. Specifically, five risk factors--temperamental characteristics of the child, parental anxiety, attachment processes in the parent-child dyad, information processing biases, and parenting practices--will be highlighted. While it is acknowledged that other factors including genetic influences and peer relationships may also be important, they are simply not the focus of this paper. Within these constraints, the implications of our parent-child interaction model for prevention, treatment, research, and practice will be explored. PMID:22116625

Ollendick, Thomas H; Benoit, Kristy E

2012-03-01

344

Attention bias in youth: Associations with youth and mother's depressive symptoms moderated by emotion regulation and affective dynamics during family interactions.  

PubMed

Recent research has highlighted the potential role of attention bias for emotional stimuli as a possible cognitive risk factor for depression in youth. However, differences in youth emotion regulation or maternal affect may moderate the association between maternal and youth depression and youth attention biases. The current study investigated the relationship between maternal and youth depressive symptoms and youth (aged 11-17 years) attention bias for sad and happy faces in 59 mother-youth dyads, examining whether positive and negative maternal affect observed during structured interaction tasks or youth emotion regulation tendencies moderated associations between maternal and youth depression and attention biases. Youth suppression interacted with maternal and youth depression to predict sad attentional biases in youth, while maternal positive affect interacted with maternal depression to predict happy attention biases in youth. PMID:23782292

Connell, Arin M; Patton, Emily; Klostermann, Susan; Hughes-Scalise, Abigail

2013-06-19

345

Hyperfine Interactions  

NASA Astrophysics Data System (ADS)

In Chap. 2, for the sake of simplicity, we dealt with transitions between unperturbed energy levels of “bare” nuclei with the mean transition energy E 0. In reality, however, nuclei are exposed to electric and magnetic fields created by the electrons of the Mössbauer atom itself and by other atoms in the neighborhood. These fields generally interact with the electric charge distribution and the magnetic dipole moment of the Mössbauer nucleus and perturb its nuclear energy states. The perturbation, called nuclear hyperfine interaction, may be such that it shifts the nuclear energy levels, as is the case in the electric monopole interaction (e0), or such that it splits degenerate states, as afforded by the electric quadrupole interaction (e2) and the magnetic dipole interaction (m1). Only these three kinds of interaction must be considered in practical Mössbauer spectroscopy.

Gütlich, Philipp; Bill, Eckhard; Trautwein, Alfred X.

346

Do Verbal Interactions with Infants During Electronic Media Exposure Mitigate Adverse Impacts on their Language Development as Toddlers?  

PubMed Central

The goal of this study was to determine whether verbal interactions between mothers and their 6-month-old infants during media exposure (‘media verbal interactions’) might have direct positive impacts, or mitigate any potential adverse impacts of media exposure, on language development at 14 months. For 253 low-income mother–infant dyads participating in a longitudinal study, media exposure and media verbal interactions were assessed using 24-hour recall diaries. Additionally, general level of cognitive stimulation in the home [StimQ] was assessed at 6 months and language development [Preschool Language Scale-4] was assessed at 14 months. Results suggest that media verbal interactions play a role in the language development of infants from low-income, immigrant families. Evidence showed that media verbal interactions moderated adverse impacts of media exposure found on 14-month language development, with adverse associations found only in the absence the these interactions. Findings also suggest that media verbal interactions may have some direct positive impacts on language development, in that media verbal interactions during the co-viewing of media with educational content (but not other content) were predictive of 14-month language independently of overall level of cognitive stimulation in the home.

Mendelsohn, Alan L.; Brockmeyer, Carolyn A.; Dreyer, Benard P.; Fierman, Arthur H.; Berkule-Silberman, Samantha B.; Tomopoulos, Suzy

2011-01-01

347

Do Verbal Interactions with Infants During Electronic Media Exposure Mitigate Adverse Impacts on their Language Development as Toddlers?  

PubMed

The goal of this study was to determine whether verbal interactions between mothers and their 6-month-old infants during media exposure ('media verbal interactions') might have direct positive impacts, or mitigate any potential adverse impacts of media exposure, on language development at 14 months. For 253 low-income mother-infant dyads participating in a longitudinal study, media exposure and media verbal interactions were assessed using 24-hour recall diaries. Additionally, general level of cognitive stimulation in the home [StimQ] was assessed at 6 months and language development [Preschool Language Scale-4] was assessed at 14 months. Results suggest that media verbal interactions play a role in the language development of infants from low-income, immigrant families. Evidence showed that media verbal interactions moderated adverse impacts of media exposure found on 14-month language development, with adverse associations found only in the absence the these interactions. Findings also suggest that media verbal interactions may have some direct positive impacts on language development, in that media verbal interactions during the co-viewing of media with educational content (but not other content) were predictive of 14-month language independently of overall level of cognitive stimulation in the home. PMID:21593996

Mendelsohn, Alan L; Brockmeyer, Carolyn A; Dreyer, Benard P; Fierman, Arthur H; Berkule-Silberman, Samantha B; Tomopoulos, Suzy

2010-11-01

348

Photoinduced processes in dyads and triads containing a ruthenium(II)-bis(terpyridine) photosensitizer covalently linked to electron donor and acceptor groups. [Ru(ttp) sub 2 sup 2+ where ttp=4 prime -p-tolyl-2,2 prime :6 prime ,2 double prime -terpyridine  

SciTech Connect

Five supramolecular systems containing the Ru(ttp){sub 2}{sup 2+} photosensitizer (P) covalently linked to an electron acceptor (A), MV{sup 2+}, and/or an electron donor (D), PTZ or DPAA, have been synthesized; ttp is 4{prime}-p-tolyl-2,2{prime}:6{prime},2{double prime}-terpyridine, MV{sup 2+} is methyl viologen, PTZ is phenotiazine, and DPAA is di-p-anisylamine. In the D-P-A triads the electron donor and acceptor groups are linked in opposite positions with respect to the photosensitizer. The spectroscopic properties (room-temperature absorption spectra, emission spectra and lifetimes in the 90-200 K temperature range, and transient absorption spectra and lifetimes at 150 K) and the (room-temperature) electrochemical behavior of the supramolecular systems and of their components have been investigated. At 90 K, where the solvent is frozen, no quenching of the photosensitizer luminescence is observed for all the supramolecular systems. At 150 K, where the solvent is fluid, the results obtained were as follows. In the PTZ-Ru(ttp){sub 2}{sup 2+} dyad, neither quenching of the photosensitizer luminescence nor formation of oxidized donor are observed. In the DPAA-Ru(ttp){sub 2}{sup 2+} dyad, luminescence quenching and transient formation of the oxidized donor take place. For the Ru(ttp){sub 2}{sup 2+}-MV{sup 2+} dyad, transient formation of the reduced acceptor is observed, but the lifetime of the photosensitizer luminescence increases, indicating that charge recombination leads back to the excited photosensitizer. The PTZ-Ru(ttp){sub 2}{sup 2+}-MV{sup 2+} triad behaves as the Ru(ttp){sub 2}{sup 2+}-MV{sup 2+} dyad. For the DPAA-Ru(ttp){sub 2}{sup 2+}-MV{sup 2+} triad, strong luminescence quenching is observed, and transient absorption spectroscopy shows that charge separation is followed by a very fast charge recombination reaction ({tau}<100 ns). Thermodynamic and kinetic aspects of the photoinduced electron-transfer processes are discussed.

Collin, J.P.; Guillerez, S.; Sauvage, J.P. (Univ. Louis Pasteur, Strasbourg (France)); Barigelletti, F.; Flamigni, L. (Inst. FRAE-CNR, Bologna (Italy)); De Cola, L.; Balzani, V. (Univ. di Bologna (Italy))

1991-10-30

349

Atomic Interactions  

NSDL National Science Digital Library

Explore the interactions between various combinations of two atoms. Turn on the force arrows to see either the total force acting on the atoms or the individual attractive and repulsive forces. Try the "Adjustable Attraction" atom to see how changing the parameters affects the interaction.

Simulations, Phet I.; Adams, Wendy; Blanco, John; Perkins, Kathy; Podolefsky, Noah; Wieman, Carl

2009-08-01

350

The triad of paragangliomas, gastric stromal tumours and pulmonary chondromas (Carney triad), and the dyad of paragangliomas and gastric stromal sarcomas (Carney-Stratakis syndrome): molecular genetics and clinical implications  

PubMed Central

Carney triad (CT) describes the association of paragangliomas (PGLs) with gastrointestinal stromal tumours (GISTs) and pulmonary chondromas (PCH). A number of other lesions have been described in the condition including pheochromocytomas, oesophageal leiomyomas and adrenocortical adenomas; CT is a novel form of multiple endocrine neoplasia (MEN), a genetic condition with a female predilection. Inactivating mutations of the mitochondrial complex II succinate dehydrogenase (SDH) enzyme subunits SDHB, SDHC and SDHD have been found in familial and sporadic PGLs, and gain-of-function mutations of the oncogenes c-kit (KIT) and platelet-derived growth factor receptor A (PDGFRA) cause sporadic and familial GISTs. We recently reported an international series of patients with CT, 34 females and three males (median age of presentation 21 years) who did not carry SDHA, SDHB, SDHC, SDHD, KIT or PDGFRA gene mutations. Comparative genomic hybridization revealed a number of DNA copy number changes. The most frequent and greatest contiguous change was a deletion within the 1pcen13-q21 region, which harbours the SDHC gene. Another frequent change was loss of 1p. Although GISTs showed more frequent losses of 1p than PGLs, the pattern of chromosomal changes was similar in the two tumours despite their different tissue origin and histology; the findings were consistent with a common genetic aetiology of these two tumours in CT. In a separate condition, in which the association (or dyad) of GISTs with PGLs is inherited in an autosomal dominant manner (Carney–Stratakis syndrome, CSS), germline mutations of the SDHB, SDHC and SDHD genes (but not KIT or PDFGRA) were found; GISTs in this condition were caused by SDH deficiency. We conclude that CT is a novel MEN syndrome whose genetic defect remains elusive. CSS is caused by SDH defects, suggesting that sarcomas (GISTs) can be caused by defective mitochondrial oxidation, consistent with recent data implicating this enzyme in a variety of endocrine and other tumours. The above have clinical implications (i) for patients with GISTs that are cKIT- and PDGFRA-mutation negative: these tumours are usually resistant to treatment with currently available tyrosine kinase inhibitors and may be part of a syndrome such as CT or CSS; and (ii) for patients with an inherited PGL syndrome, family history should be explored to identify any other tumours in the family, and in particular other endocrine lesions and GISTs.

Stratakis, C. A.; Carney, J. A.

2011-01-01

351

The triad of paragangliomas, gastric stromal tumours and pulmonary chondromas (Carney triad), and the dyad of paragangliomas and gastric stromal sarcomas (Carney-Stratakis syndrome): molecular genetics and clinical implications.  

PubMed

Carney triad (CT) describes the association of paragangliomas (PGLs) with gastrointestinal stromal tumours (GISTs) and pulmonary chondromas (PCH). A number of other lesions have been described in the condition including pheochromocytomas, oesophageal leiomyomas and adrenocortical adenomas; CT is a novel form of multiple endocrine neoplasia (MEN), a genetic condition with a female predilection. Inactivating mutations of the mitochondrial complex II succinate dehydrogenase (SDH) enzyme subunits SDHB, SDHC and SDHD have been found in familial and sporadic PGLs, and gain-of-function mutations of the oncogenes c-kit (KIT) and platelet-derived growth factor receptor A (PDGFRA) cause sporadic and familial GISTs. We recently reported an international series of patients with CT, 34 females and three males (median age of presentation 21 years) who did not carry SDHA, SDHB, SDHC, SDHD, KIT or PDGFRA gene mutations. Comparative genomic hybridization revealed a number of DNA copy number changes. The most frequent and greatest contiguous change was a deletion within the 1pcen13-q21 region, which harbours the SDHC gene. Another frequent change was loss of 1p. Although GISTs showed more frequent losses of 1p than PGLs, the pattern of chromosomal changes was similar in the two tumours despite their different tissue origin and histology; the findings were consistent with a common genetic aetiology of these two tumours in CT. In a separate condition, in which the association (or dyad) of GISTs with PGLs is inherited in an autosomal dominant manner (Carney-Stratakis syndrome, CSS), germline mutations of the SDHB, SDHC and SDHD genes (but not KIT or PDFGRA) were found; GISTs in this condition were caused by SDH deficiency. We conclude that CT is a novel MEN syndrome whose genetic defect remains elusive. CSS is caused by SDH defects, suggesting that sarcomas (GISTs) can be caused by defective mitochondrial oxidation, consistent with recent data implicating this enzyme in a variety of endocrine and other tumours. The above have clinical implications (i) for patients with GISTs that are cKIT- and PDGFRA-mutation negative: these tumours are usually resistant to treatment with currently available tyrosine kinase inhibitors and may be part of a syndrome such as CT or CSS; and (ii) for patients with an inherited PGL syndrome, family history should be explored to identify any other tumours in the family, and in particular other endocrine lesions and GISTs. PMID:19522824

Stratakis, C A; Carney, J A

2009-07-01

352

Nutritional management of the breastfeeding dyad.  

PubMed

Milk is successfully produced by mothers regardless of their nutritional status. Nevertheless, the concentrations of some nutrients, specifically vitamins A, D, B1, B2, B3, B6, and B12, fatty acids, and iodine, in human milk depend on or are influenced by maternal diet. A healthy and varied diet during lactation ensures adequate maternal nutrition and optimal concentration of some nutrients in human milk. Exclusive breastfeeding meets the nutritional needs of infants for 6 months of life with the exception of vitamins D and K, which should be given to breastfed infants as supplements. PMID:23178069

Valentine, Christina J; Wagner, Carol L

2013-02-01

353

Topical Concerns in the Poetry Coaching Dyad.  

ERIC Educational Resources Information Center

|Eight coaches of oral interpretation from colleges across the United States were asked to tape record the coaching sessions that brought eight novices to tournament readiness. All of the students used the same three-poem program on the general theme of animals and children, but each student was required to write the introduction and transitions.…

Keefe, Carolyn

354

Identifying Dyads and their conservation in Drosphila.  

NASA Astrophysics Data System (ADS)

Core promoter regions in Drosophila are enriched with binding sites like TATA, Inr, DPE, MTE, etc. They have very strict spacing between each other in promoters where they occur together. For example, in Drosophila melanogaster TATA-Inr has a spacing of 25-30 bp. Our aim in this work is to identify all such pair of motifs having strict positional constraint in the core promoters of all Drosophila species. We discover how these motifs and the spacing between them evolve within Drosophila species. For this we analyze 700 bp upstream and 300 bp downstream of TSS in D. melanogaster and the corresponding orthologous region in other Drosophila species. For each species, this 1000 bp region is searched for statistically over-represented compound words of the form W1NLW2, where L is the spacing between words W1 and W2. These compound words are systematically clustered for further analysis.

Dan, Debasis

2007-03-01

355

Effective Leadership in Superior-Subordinate Dyads  

Microsoft Academic Search

This paper describes and experimentally demonstrates the main tenets of an operant theory of leadership. Leadership is characterized in the current paper as involving problem solving operant behavior (Cerutti, 1989; Skinner, 1969) in a social context (Skinner, 1953). The theory was assessed under two experimental analogs modeled from generic formal organizational bureaucratic leader-follower role relations. Under a minimal leadership contingency

Thomas C. Mawhinney

2006-01-01

356

Positive maternal interaction behavior moderates the relation between maternal anxiety and infant regulatory problems.  

PubMed

Regulatory problems in infancy are determined by different risk factors. This study aims to examine how psychosocial risk factors are connected, and how they impact the early regulatory ability of 3-month-old infants. In a sample of 57 mother-infant dyads, maternal anxiety and infant crying, sleeping and feeding habits were assessed. As a possible moderator, the role of positive maternal behavior was analyzed by videotaping face-to-face interactions. During the interaction, interactive stress was provoked with the face-to-face still-face paradigm (FFSF). Thus, this study differentiated between the effects of maternal behavior in both an ordinary play context, as well as a stressful interaction context. Results revealed that the relation between maternal anxiety and infant regulatory problems in crying and sleeping varied as a function of positive maternal engagement in stressful situations. However, a significant moderation effect influencing infant feeding problems could not be demonstrated. These findings stress the importance of positive maternal interaction behavior in at least some parts of regulatory adjustment of at-risk infants. PMID:23728294

Richter, Nina; Reck, Corinna

2013-05-30

357

Interaction during intervention: conversations between professionals and children with cerebral palsy.  

PubMed

To develop interactional ability, conversation with both peers and adults is vital. However, for children with physical impairments, like cerebral palsy, interactions with adults often dominate. In this study, interaction between eight Swedish children with cerebral palsy, mean age 8.6 years, and their physiotherapists (PTs) and speech-language therapists (SLTs) was analysed during intervention across 16 dyads. The analysis of data focused on how quantitative, interactional and topical dominance was manifested by the PTs and the SLTs. In addition, mitigating strategies and use of feedback was investigated. Surprisingly, the only significant finding was in topic maintenance, where the PTs' conversations were more directed towards topics unrelated to the intervention context when compared to the conversations of the SLTs. Although not significant, the PTs tended to dominate by having a greater amount of talk, and the SLTs by asking many questions. It is discussed how the two professions may contribute to the development of interactional skills and pragmatic ability among children with cerebral palsy, given their professional training and focus of intervention. PMID:19798835

Holck, Pernille; Sandberg, Annika Dahlgren; Nettelbladt, Ulrika

2009-01-01

358

Interactive Whiteboards  

NSDL National Science Digital Library

This Wiki page provides a link to the recording of a webinar by Todd Williamson. Todd discusses Interactive Whiteboard in the classroom. As more and more schools purchase SmartBoards, Promethean Boards, Mimio systems, and a host of other Interactive Whiteboard solutions, the expectation often seems to be that they will just teach the kids themselves. Join us for this session to learn some of the challenges, strategies, and wonders of using an Interactive Whiteboard in your subject area. Other links to the resources discussed in this webinar are also provided.

2009-09-16

359

[Bacterial interactions].  

PubMed

The review deals with specific features of interactions in microbial biocenoses. The subdivision of the mechanisms of microbial interactions in associations into direct and indirect ones is proposed. The formation of intercellular contacts and matrix belongs to one group of mechanisms, the second group includes the products of metabolism (changes in the physical and chemical composition of the medium, specific growth regulators) and secreted factors (antibacterial substances, pheromones and signal molecules, vitamins, specific mediators). The applied aspects of the knowledge of microbial interactions in the human body are presented. PMID:12966867

Bukharin, O V; Usviatsov, B Ia; Khusnutdinova, L M

360

Interacting parasites  

USGS Publications Warehouse

Parasitism is the most popular life-style on Earth, and many vertebrates host more than one kind of parasite at a time. A common assumption is that parasite species rarely interact, because they often exploit different tissues in a host, and this use of discrete resources limits competition (1). On page 243 of this issue, however, Telfer et al. (2) provide a convincing case of a highly interactive parasite community in voles, and show how infection with one parasite can affect susceptibility to others. If some human parasites are equally interactive, our current, disease-by-disease approach to modeling and treating infectious diseases is inadequate (3).

Lafferty, Kevin D.

2010-01-01

361

An Observational Investigation of Sibling Interactions in Married and Divorced Families.  

ERIC Educational Resources Information Center

Results of this study of 96 sibling dyads demonstrated necessity of going beyond the examination of between-group differences in the study of divorce effects to look at the processes by which developmental outcomes for children are enhanced or undermined. Findings draw attention to the heightened vulnerability of dyads containing older boys in…

MacKinnon, Carol E.

1989-01-01

362

Mother-Infant Person- and Object-Directed Interactions in Latino Immigrant Families: A Comparative Approach  

ERIC Educational Resources Information Center

|Cultural variation in durations, relations, and contingencies of mother-infant person- and object-directed behaviors were examined for 121 nonmigrant Latino mother-infant dyads in South America, Latina immigrants from South America and their infants living in the United States, and European American mother-infant dyads. Nonmigrant Latina mothers…

Cote, Linda R.; Bornstein, Marc H.; Haynes, O. Maurice; Bakeman, Roger

2008-01-01

363

Interacting Sprays  

Microsoft Academic Search

\\u000a In many disparate engineering systems, ranging from cooling systems for microelectronics to jet engines, multiple sprays are\\u000a utilized and the way they interact with one another is the subject matter of this chapter. A general overview of published\\u000a research on interacting sprays is presented. Both experimental and theoretical or numerical investigations of combusting or\\u000a noncombusting systems are covered. The nature

J. B. Greenberg

364

Coulomb-like interaction in nematic emulsions induced by external torques exerted on the colloids  

NASA Astrophysics Data System (ADS)

An external mechanical torque on colloids immersed in a nematic liquid crystal can induce a Coulomb-like 1/r interaction between them [Lev and Tomchuk, Phys. Rev. E 59, 591 (1999); Lev , ibid. 65, 021709 (2002)]. In this paper we show that the director-mediated Coulomb-like interaction of two colloids is determined by the vectors ??(1) and ??(2) of the transverse external torques exerted upon these colloids. We derive the 1/r potential in which the scalar product -(??(1)•??(2)) of the two torques plays the role of the product of two electrostatic charges. The 1/r interaction is attractive for (??(1)•??(2))>0 and repulsive for (??(1)•??(2))<0 (“parallel torques” attract whereas “antiparallel torques” repel each other). The vector of transverse torque determines the two-component “elastic charge” (dyad), which is illustrated by the 1/r2 and 1/r3 terms in the elastic energy (the elastic analogs of the monopole-dipole and dipole-dipole interactions). The general status of the pairwise approach to nematic emulsions is considered in terms of the elastic charge density.

Pergamenshchik, V. M.; Uzunova, V. O.

2007-07-01

365

Coulomb-like interaction in nematic emulsions induced by external torques exerted on the colloids.  

PubMed

An external mechanical torque on colloids immersed in a nematic liquid crystal can induce a Coulomb-like 1/r interaction between them [Lev and Tomchuk, Phys. Rev. E 59, 591 (1999); Lev, ibid. 65, 021709 (2002)]. In this paper we show that the director-mediated Coulomb-like interaction of two colloids is determined by the vectors Gamma perpendicular (1) and Gamma perpendicular (2) of the transverse external torques exerted upon these colloids. We derive the 1/r potential in which the scalar product -(Gamma perpendicular (1) x Gamma perpendicular (2)) of the two torques plays the role of the product of two electrostatic charges. The 1/r interaction is attractive for (Gamma perpendicular (1) x Gamma perpendicular (2))>0 and repulsive for (Gamma perpendicular (1) x Gamma perpendicular (2))<0 ("parallel torques" attract whereas "antiparallel torques" repel each other). The vector of transverse torque determines the two-component "elastic charge" (dyad), which is illustrated by the 1/r2 and 1/r3 terms in the elastic energy (the elastic analogs of the monopole-dipole and dipole-dipole interactions). The general status of the pairwise approach to nematic emulsions is considered in terms of the elastic charge density. PMID:17677471

Pergamenshchik, V M; Uzunova, V O

2007-07-19

366

Couples' experiences of interacting with outside others in chronic fatigue syndrome: a qualitative study.  

PubMed

OBJECTIVES: Social isolation and stigma are frequently reported by patients with chronic fatigue syndrome/myalgic encephalomyelitis and relationships in the home environment with those close to the patients (their 'significant others') may thus be particularly important. Rather little attention has yet been paid to the beliefs and experiences of 'significant others' themselves in this context. This study sought to explore in-depth the beliefs and experiences of both patients and 'significant others' in relation to chronic fatigue syndrome/myalgic encephalomyelitis. METHODS: In-depth interviews using a semi-structured interview schedule designed around the core constructs of the Common-Sense Model of self-regulation were conducted with two patients with chronic fatigue syndrome/myalgic encephalomyelitis and their spouses. Interpretative Phenomenological Analysis was used to analyse interview data. RESULTS: Experiences of social interactions in relation to chronic fatigue syndrome/myalgic encephalomyelitis with others outside of the relationship dyad emerged as a key issue for all participants when reflecting on their experiences of living with the condition. These concerns are presented under two themes: interactions with healthcare professionals and interactions with the social world. CONCLUSIONS: It is evident that significant others play an important role in the lived experience of chronic fatigue syndrome/myalgic encephalomyelitis. For both patients and significant others, the wider social world and interactions with outside others may be important influences on dyadic coping in chronic fatigue syndrome/myalgic encephalomyelitis. Both future research and treatment interventions could usefully include a 'significant other' perspective. PMID:23585635

Brooks, Joanna; King, Nigel; Wearden, Alison

2013-04-12

367

Strong Interaction  

SciTech Connect

We will give here an overview of our theory of the strong interactions, Quantum Chromo Dynamics (QCD) and its properties. We will also briefly review the history of the study of the strong interactions, and the discoveries that ultimately led to the formulation of QCD. The strong force is one of the four known fundamental forces in nature, the others being the electromagnetic, the weak and the gravitational force. The strong force, usually referred to by scientists as the 'strong interaction', is relevant at the subatomic level, where it is responsible for the binding of protons and neutrons to atomic nuclei. To do this, it must overcome the electric repulsion between the protons in an atomic nucleus and be the most powerful force over distances of a few fm (1fm=1 femtometer=1 fermi=10{sup -15}m), the typical size of a nucleus. This property gave the strong force its name.

Karsch, F.; Vogelsang, V.

2009-09-29

368

Environmental Interactions  

NSDL National Science Digital Library

In this activity, students create a "web" to identify and demonstrate the interactions among the living and non-living parts of an environment. This information allows students to better understand what an environment is and to also consider how engineers use teamwork to solve problems.

Integrated Teaching And Learning Program

369

MATTER & INTERACTIONS  

Microsoft Academic Search

Matter & Interactions is a modern calculus-based introductory curriculum that em- phasizes the power of fundamental principles, and guides students through the proc- ess of starting from these principles in analyzing physical systems, on both the mac- roscopic and the microscopic level. The continual emphasis on the application of fundamental principles and on the atomic nature of matter makes possible

Ruth Chabay; Bruce Sherwood

370

Interactive semantics  

Microsoft Academic Search

Much research pursues machine intelligence through better representation of semantics. What is semantics? People in different areas view semantics from different facets although it accompanies interaction through civilization. Some researchers believe that humans have some innate structure in mind for processing semantics. Then, what the structure is like? Some argue that humans evolve a structure for processing semantics through constant

Hai Zhuge

2010-01-01

371

Dinosaur Interaction  

NSDL National Science Digital Library

In this activity, learners explore why animals, specifically dinosaurs, live in families. Learners examine Dinosphere scenes (drawing of dinosaurs in groups) and sort the scenes by reasons the animals are living in groups. Then, learners glue together geometric shapes to create dinosaurs interacting in groups and families. This activity is featured on page 26 of the "Dinosphere" unit of study for K-2 learners.

Crosslin, Rick; Fortney, Mary; Indianapolis, The C.

2004-01-01

372

Interactive Astronomy.  

ERIC Educational Resources Information Center

|Presents guiding principles for developing interactive lessons for the World Wide Web. Describes "Amazing Space: Education Online from the Hubble Space Telescope", a program where students study spectacular Hubble Space Telescope images of stars and star-forming regions to learn about the life cycle of stars and the creation of atoms. (JRH)|

Martin, Jean K.

1997-01-01

373

Interactive projection  

Microsoft Academic Search

Projectors are becoming very compact, and this is driving an evolution in their functionality. The handheld projector in this work is capable of stabilized projection under hand-jitter, and allows the user to interact with projected information. The ideas anticipate current handheld devices, such as cellphones and PDAs, being augmented with projectors to supplement or even replace the built-in screen with

Paul Beardsley; Clifton Forlines; Ramesh Raskar; Jeroen VanBaar; Chris Wren

2004-01-01

374

Mohr Interactive  

NSDL National Science Digital Library

Mohr's Circle is a graphical method that allows engineers to visualize and analyze internal stress (force per unit area) within engineering materials. The Mohrs applet is designed to interactively explore the relationship between a given stress state, the frame of reference and the graphical Mohr's Circle representation.

Love, Garrett R.; Feiner, Joel

375

Interactive Spreadsheets  

NSDL National Science Digital Library

Interactive Excel spreadsheets display hard-to-understand concepts in statistics, quantum mechanics, physics, and more. Parameters are adjusted by clicking on easy-to-use buttons or by using numeric input boxes. Graphs, tables, and/or figures are then created reflecting the change in parameters.

376

Psychophysical Interaction  

Microsoft Academic Search

IN relation to the letters on ``Psychophysical Interaction'' appearing in NATURE, the initial questioning the discussion works back to is whether we are to recognise in mind the mere knower, or manipulator, as well, of animal action. In relation to such a questioning it may be of use to consider that what is inferred concerning mind as existing anywhere outside

A. Bowman

1903-01-01

377

Interactive Television: How Interactive is It?  

ERIC Educational Resources Information Center

|Discusses how interaction occurs with interactive television in the classroom, examining the introduction of interactive television into Victoria, Australia's schools and investigating two types of interaction (overt and covert) between students and teachers. Notes that the types of interaction that occur with interactive television relate to the…

Barty, Karin

1998-01-01

378

Interactive Notebooks  

NSDL National Science Digital Library

This Wiki page provides a link to the recording of a webinar by Todd Williamson. He disscuses student organization (or lack thereof) and homework. Come join him for a discussion of one way to help combat both problems while also addressing multiple intelligences, differentiation, and student choice. Interactive Notebooks are a way to help facilitate all of these things by allowing your students to be creative and have a choice in the way they process information. This informal chat will address the beginning stages of starting to work with Interactive Notebooks, guide you through the process, and point you in the direction of more resources. Other links to the resources discussed in this webinar are also provided.

2009-07-29

379

Interactives: Garbage  

NSDL National Science Digital Library

With a heading that includes the phrase "How can my community reduce waste?", this educational site provided by the Annenberg Media group is one that's hard to ignore. This resource is one of their "Interactives", and educators can use these various tools to help students learn "how to improve next year's environmental record." Educators and students can choose between one of five topical areas, all of which include various interactive components and activities. These sections cover solid waste, hazardous waste, sewage, global efforts to reduce solid waste, and links to related resources. Along the way, users will get the opportunity to test their knowledge about hazardous waste in their home, and they can even step up to try their hand at shrinking a landfill.

2007-01-01

380

Physiological Interactions  

Microsoft Academic Search

\\u000a Improvement in both temporal and spatial resolution of MDCT has brought the ability to explore both the heart and lung within\\u000a a single examination and opened the field of functional evaluation. However, interactions between heart and lung have long\\u000a been identified as important physiological phenomena in pathology (Pinsky 2005). For the radiologist, they are involved in difficulties of interpretation in

Francois Laurent; Michel Montaudon

381

Interactive Television  

Microsoft Academic Search

\\u000a This paper presents recent experiments in interactive program development done at the BBC. Specific examples using combinations\\u000a of digital technology and requiring different amounts of bandwidth are reviewed. Lessons learned are shared and various design\\u000a solutions are presented. The emphasis is on the new thinking required of program developers who must accommodate both linear\\u000a and nonlinear story lines as well

Robin Mudge

382

Long-range nature of the interactions between titratable groups in Bacillus agaradhaerens family 11 xylanase: pH titration of B. agaradhaerens xylanase.  

PubMed

Xylanase from Bacillus agaradhaerens belongs to a large group of glycosyl hydrolases which catalyze the degradation of xylan. The protonation behavior of titratable groups of the uniformly (15)N- and (13)C-labeled xylanase was investigated by multinuclear NMR spectroscopy. A total of 224 chemical shift titration curves corresponding to (1)H, (13)C, and (15)N resonances revealed pK(a) values for all aspartic and glutamic acid residues, as well as for the C-terminal carboxylate and histidine residues. Most of the titratable groups exhibit a complex titration behavior, which is most likely due to the mutual interactions with other neighboring groups or due to an unusual local microenvironment. Subsite -1 containing the catalytic dyad shows a long-range interaction over 9 A with Asp21 via two hydrogen bonds with Asn45 as the mediator. This result illuminates the pivotal role of the conserved position 45 among family 11 endoxylanases, determining an alkaline pH optimum by asparagine residues or an acidic pH optimum by an aspartate. The asymmetric interactions of neighboring tryptophan side chains with respect to the catalytic dyad can be comprehended as a result of hydrogen bonding and aromatic stacking. Most of the chemical shift-pH profiles of the backbone amides exhibit biphasic behavior with two distinct inflection points, which correspond to the pK(a) values of the nearby acidic side chains. However, the alternation of both positive and negative slopes of individual amide titration curves is interpreted as a consequence of a simultaneous reorganization of side chain conformational space at pH approximately 6 and/or an overall change in the hydrogen network in the substrate binding cleft. PMID:15134456

Betz, Marco; Löhr, Frank; Wienk, Hans; Rüterjans, Heinz

2004-05-18

383

Interactive atmosphere  

NSDL National Science Digital Library

Where is ozone located in the atmosphere? This informational activity, part of an interactive laboratory series for grades 8-12, explores the changes in ozone concentration with altitude. Students are introduced to layers of the atmosphere and the amount of ozone found at each layer of the troposphere, stratosphere, mesosphere, thermosphere, and exosphere. The activity also discusses why the addition of ozone to the atmosphere at different levels determines the temperatures of those levels. Students can move up and down to different layers of the atmosphere. A temperature scale is shown that runs from the surface of the Earth to the outer most reaches of the atmosphere. Copyright 2005 Eisenhower National Clearinghouse

University of Utah. Astrophysics Science Project Integrating Research and Education (ASPIRE)

2003-01-01

384

Interactive Physlets  

NSDL National Science Digital Library

What, you may ask, is a physlet? It is a portmanteau combining the words "physics" and "applet" which can be used "to demonstrate a concept in physics through animation or interaction." Physlets are handy tools, especially for visual learners. These physlets were created by scholars at the Grenfell Campus of Memorial University in Corner Brook, Newfoundland. Designed to be used in several different introductory physics courses, the physlets cover a range of topics, including friction, conservation of energy, projectile motion, magnetism, and simple harmonic motion. Visitors will find that they can play each physlet, pause it along the way, or skip ahead to the next one as they see fit.

2012-02-10

385

Electroweak interactions  

SciTech Connect

A point of view of the electroweak interaction is presented. It begins phenomenologically and moves in stages toward the conventional gauge theory formalism containing elementary scalar Higgs-fields and then beyond. The purpose in so doing is that the success of the standard SU(2) x U(1) theory in accounting for low energy phenomena need not automatically imply success at high energies. It is deemed unlikely by most theorists that the predicted W/sup + -/ or Z/sup 0/ does not exist or does not have the mass and/or couplings anticipated in the standard model. However, the odds that the standard predictions will work are not 100%. Therefore there is some reason to look at the subject as one would were he forced by a wrong experimental outcome - to go back to fundamentals and ascertain what is the minimal amount of theory necessary to account for the data.

Bjorken, J.D.

1980-10-01

386

Single-base resolution mapping of H1-nucleosome interactions and 3D organization of the nucleosome  

PubMed Central

Despite the key role of the linker histone H1 in chromatin structure and dynamics, its location and interactions with nucleosomal DNA have not been elucidated. In this work we have used a combination of electron cryomicroscopy, hydroxyl radical footprinting, and nanoscale modeling to analyze the structure of precisely positioned mono-, di-, and trinucleosomes containing physiologically assembled full-length histone H1 or truncated mutants of this protein. Single-base resolution •OH footprinting shows that the globular domain of histone H1 (GH1) interacts with the DNA minor groove located at the center of the nucleosome and contacts a 10-bp region of DNA localized symmetrically with respect to the nucleosomal dyad. In addition, GH1 interacts with and organizes about one helical turn of DNA in each linker region of the nucleosome. We also find that a seven amino acid residue region (121–127) in the COOH terminus of histone H1 was required for the formation of the stem structure of the linker DNA. A molecular model on the basis of these data and coarse-grain DNA mechanics provides novel insights on how the different domains of H1 interact with the nucleosome and predicts a specific H1-mediated stem structure within linker DNA.

Syed, Sajad Hussain; Goutte-Gattat, Damien; Becker, Nils; Meyer, Sam; Shukla, Manu Shubhdarshan; Hayes, Jeffrey J.; Everaers, Ralf; Angelov, Dimitar; Bednar, Jan; Dimitrov, Stefan

2010-01-01

387

Behavior problems in middle childhood: the predictive role of maternal distress, child attachment, and mother-child interactions.  

PubMed

The objective of the study was to examine the longitudinal relation between early school-age measures of maternal psychosocial distress, quality of mother-child interactions, and child attachment behavior, and behavior problem profiles in middle childhood using a multi-informant design. Participants were 243 French-speaking mother-child dyads (122 girls) who were part of an ongoing longitudinal project. Maternal psychosocial distress was assessed when children were between 4 and 6 years of age. Mother-child interactive quality and attachment patterns were observed at age 6 during a laboratory visit. At age 8.5, externalizing and internalizing problems were assessed using mother and child reports. Results show that maternal psychosocial distress predicted later social adaptation reported by the child through the mediation of mother-child interactions. Analyses also revealed that higher maternal psychosocial distress and controlling attachment patterns, either of the punitive or caregiving type, significantly predicted membership in both child internalizing and externalizing clinical problem groups. Lower mother-child interactive quality, male gender, and child ambivalent attachment were also predictors of externalizing clinical problems. PMID:23748336

Dubois-Comtois, Karine; Moss, Ellen; Cyr, Chantal; Pascuzzo, Katherine

2013-11-01

388

Interactive dynamic simulation using haptic interaction  

Microsoft Academic Search

Describes an interactive dynamic simulator for virtual environments which allows user interaction via a haptic interface. The interactive simulation is performed in our testbed dynamic simulator I-GMS (Interactive Generalized Motion Simulator), which has been developed in an object-oriented framework for simulating motions of free bodies and complex linkages such as those needed for robotic systems or human body simulation. User

Wookho Son; Kyunghwan Kim; Nancy M. Amato; Jeffrey C. Trinkle

2000-01-01

389

Future TV Interaction: Augmenting Existing Interaction Techniques  

Microsoft Academic Search

The television concept is changing, while the remote control remains the same and tends to evolve more slowly interaction. The future TV is a complex device and viewers need support to interact with it without difficulty by creating easy to use yet advanced interaction tools. One approach to accomplish this is by augmenting exiting interaction tools, such as remote control

Aseel Berglund

390

Mother-infant interaction in mother and baby unit patients: before and after treatment.  

PubMed

Maternal severe mental illness (SMI) disrupts mother-infant interaction in the immediate postpartum and is associated with less than optimal offspring development. In-patient mother and baby units (MBUs) provide the opportunity of supporting mothers with SMI in developing their relationships with their infants in order to minimise this disruption. One way is through an individualised video feedback intervention, delivered as part of a multidisciplinary inpatient treatment package. The present study prospectively measured changes in mother-infant interaction following video feedback intervention, during admission to an MBU (N = 49). Comparisons were made with mother-infant interactions of (1) a community-based ill group of mothers (N = 67) with a mental health diagnosis of similar severity, living at home and without the intervention and (2) a group of healthy mothers (N = 22). Maternal sensitivity and unresponsiveness, and infant cooperativeness and passiveness, were measured from a 3-min videotaped play session, using the CARE-Index. Following admission and the video feedback intervention, the MBU mothers (irrespective of diagnosis) and their infants showed improvements in their interactions. Moreover, on discharge the MBU dyads were significantly more sensitive, cooperative and responsive than the community ill group, and as attuned as the healthy group. While the design of the study does not allow us to conclude unequivocally that the video feedback intervention has effects on the outcome for the mothers and babies independent from the whole inpatient therapeutic package, the results do show that the dyadic interaction of mothers with SMI and their infants improves following the focussed treatment package in a specialised MBU. PMID:23786913

Kenny, Maeve; Conroy, Susan; Pariante, Carmine M; Seneviratne, Gertrude; Pawlby, Susan

2013-06-17

391

Prenatal Ultrasound Screening: False Positive Soft Markers May Alter Maternal Representations and Mother-Infant Interaction  

PubMed Central

Background In up to 5% of pregnancies, ultrasound screening detects a “soft marker” (SM) that places the foetus at risk for a severe abnormality. In most cases, prenatal diagnostic work-up rules out a severe defect. We aimed to study the effects of false positive SM on maternal emotional status, maternal representations of the infant, and mother-infant interaction. Methodology and Principal Findings Utilizing an extreme-case prospective case control design, we selected from a group of 244 women undergoing ultrasound, 19 pregnant women whose foetus had a positive SM screening and a reassuring diagnostic work up, and 19 controls without SM matched for age and education. In the third trimester of pregnancy, within one week after delivery, and 2 months postpartum, we assessed anxiety, depression, and maternal representations. Mother-infant interactions were videotaped during feeding within one week after delivery and again at 2 months postpartum and coded blindly using the Coding Interactive Behavior (CIB) scales. Anxiety and depression scores were significantly higher at all assessment points in the SM group. Maternal representations were also different between SM and control groups at all study time. Perturbations to early mother-infant interactions were observed in the SM group. These dyads showed greater dysregulation, lower maternal sensitivity, higher maternal intrusive behaviour and higher infant avoidance. Multivariate analysis showed that maternal representation and depression at third trimester predicted mother-infant interaction. Conclusion False positive ultrasound screenings for SM are not benign and negatively affect the developing maternal-infant attachment. Medical efforts should be directed to minimize as much as possible such false diagnoses, and to limit their psychological adverse consequences.

Viaux-Savelon, Sylvie; Dommergues, Marc; Rosenblum, Ouriel; Bodeau, Nicolas; Aidane, Elizabeth; Philippon, Odile; Mazet, Philippe; Vibert-Guigue, Claude; Vauthier-Brouzes, Daniele; Feldman, Ruth; Cohen, David

2012-01-01

392

Developmental correlates and predictors of emotional availability in mother-child interaction: a longitudinal study from infancy to middle childhood.  

PubMed

In this investigation we examined the developmental correlates and predictors of maternal emotional availability in interactions with their 7-year-old children among a sample of families at psychosocial risk. We found developmental coherence in maternal interactive behavior, and in the relations between maternal emotional availability and children's functioning in middle childhood. Mothers and children were observed at home and in a laboratory playroom in infancy to assess maternal interactive behavior and child attachment security. When children were 7 years of age, dyads were observed in the lab; maternal emotional availability was coded using the Emotional Availability Scales, and children's disorganized and controlling attachment behavior was assessed. Classroom teachers reported on children's behavior problems; at age 8, children reported on their depressive symptoms. Results showed that aspects of maternal emotional availability (sensitivity, nonhostility, nonintrusiveness [passive/withdrawn behavior]) were associated with children's functioning in middle childhood: (a) controlling and disorganized attachment behavior, (b) behavior problems in school, and (c) self-reported depressive symptoms. Maternal emotional availability in childhood was predicted by early mother-infant relationship dysfunction (maternal hostility, disrupted communication, and infant attachment insecurity). PMID:22292994

Easterbrooks, M Ann; Bureau, Jean-Francois; Lyons-Ruth, Karlen

2012-02-01

393

Touching behaviors of infants of depressed mothers during normal and perturbed interactions  

Microsoft Academic Search

The present study investigated the touching behaviors of 4-month-old infants of depressed and non-depressed mothers during the still-face (SF; maternal emotional unavailability) and separation (SP; maternal physical unavailability) procedures. Forty-one dyads participated in the present study; dyads were from low SES backgrounds and they exhibited poor relationship qualities (e.g. poor maternal sensitivity, low infant responsiveness); thus, they were considered at-risk.

Robin J. Moszkowski; Dale M. Stack; Nadine Girouard; Tiffany M. Field; Maria Hernandez-Reif; Miguel Diego

2009-01-01

394

Looking over toxin-K(+) channel interactions. Clues from the structural and functional characterization of ?-KTx toxin Tc32, a Kv1.3 channel blocker.  

PubMed

?-KTx toxin Tc32, from the Amazonian scorpion Tityus cambridgei, lacks the dyad motif, including Lys27, characteristic of the family and generally associated with channel blockage. The toxin has been cloned and expressed for the first time. Electrophysiological experiments, by showing that the recombinant form blocks Kv1.3 channels of olfactory bulb periglomerular cells like the natural Tc32 toxin, when tested on the Kv1.3 channel of human T lymphocytes, confirmed it is in an active fold. The nuclear magnetic resonance-derived structure revealed it exhibits an ?/? scaffold typical of the members of the ?-KTx family. TdK2 and TdK3, all belonging to the same ?-KTx 18 subfamily, share significant sequence identity with Tc32 but diverse selectivity and affinity for Kv1.3 and Kv1.1 channels. To gain insight into the structural features that may justify those differences, we used the recombinant Tc32 nuclear magnetic resonance-derived structure to model the other two toxins, for which no experimental structure is available. Their interaction with Kv1.3 and Kv1.1 has been investigated by means of docking simulations. The results suggest that differences in the electrostatic features of the toxins and channels, in their contact surfaces, and in their total dipole moment orientations govern the affinity and selectivity of toxins. In addition, we found that, regardless of whether the dyad motif is present, it is always a Lys side chain that physically blocks the channels, irrespective of its position in the toxin sequence. PMID:22332965

Stehling, Eliana G; Sforça, Mauricio L; Zanchin, Nilson I T; Oyama, Sérgio; Pignatelli, Angela; Belluzzi, Ottorino; Polverini, Eugenia; Corsini, Romina; Spisni, Alberto; Pertinhez, Thelma A

2012-02-27

395

User-media interaction with interactive TV  

Microsoft Academic Search

Watching TV is a practice many people enjoy and feel comfortable with. We propose the capture of the user interaction while interacting with a remote control to watch TV: such detailed information is most valuable to many applications and services. We discuss our proposed approach in the context of the Brazilian Interactive Digital TV platform.

César A. C. Teixeira; Erick L. Melo; Renan G. Cattelan; Maria Da Graça Campos Pimentel

2009-01-01

396

Peer Interaction in the Presence and Absence of Observers.  

ERIC Educational Resources Information Center

Directives, social conversation, on-task play, and positive, negative, nonsense, and task-related verbalizations of preschool-aged and school-aged peer dyads were observed in a laboratory playroom in the presence or absence of observers. Results revealed that the frequency of all of the behaviors sampled, except positive verbalizations, decreased…

Brody, Gene H.; And Others

1984-01-01

397

Elastic charge density representation of the interaction via the nematic director field  

NASA Astrophysics Data System (ADS)

The interaction between particle-like sources of the nematic director distortions (e.g., colloids, point defects, macromolecules in nematic emulsions) allows for a useful analogy with the electrostatic multipole interaction between charged bodies. In this paper we develop this analogy to the level corresponding to the charge density and consider the general status of the pairwise approach to the nematic emulsions with finite-size colloids. It is shown that the elastic analog of the surface electric charge density is represented by the two transverse director components on the surface imposing the director distortions. The elastic multipoles of a particle are expressed as integrals over the charge density distribution on this surface. Because of the difference between the scalar electrostatics and vector nematostatics, the number of elastic multipoles of each order is doubled compared to that in the electrostatics: there are two elastic charges, two vectors of dipole moments, two quadrupolar tensors, and so on. The two-component elastic charge is expressed via the vector of external mechanical torque applied on the particle. As a result, the elastic Coulomb-like coupling between two particles is found to be proportional to the scalar product of the two external torques and does not directly depend on the particles' form and anchoring. The real-space Green function method is used to develop the pairwise approach to nematic emulsions and determine its form and restrictions. The pairwise potentials are obtained in the familiar form, but, in contrast to the electrostatics, they describe the interaction between pairs (dyads) of the elastic multipole moments. The multipole moments are shown to be uniquely determined by the single-particle director field, unperturbed by other particles. The pairwise approximation is applicable only in the leading order in the small ratio particle size-to-interparticle distance as the next order contains irreducible three-body terms.

Pergamenshchik, V. M.; Uzunova, V. O.

2007-06-01

398

Elastic charge density representation of the interaction via the nematic director field.  

PubMed

The interaction between particle-like sources of the nematic director distortions (e.g., colloids, point defects, macromolecules in nematic emulsions) allows for a useful analogy with the electrostatic multipole interaction between charged bodies. In this paper we develop this analogy to the level corresponding to the charge density and consider the general status of the pairwise approach to the nematic emulsions with finite-size colloids. It is shown that the elastic analog of the surface electric charge density is represented by the two transverse director components on the surface imposing the director distortions. The elastic multipoles of a particle are expressed as integrals over the charge density distribution on this surface. Because of the difference between the scalar electrostatics and vector nematostatics, the number of elastic multipoles of each order is doubled compared to that in the electrostatics: there are two elastic charges, two vectors of dipole moments, two quadrupolar tensors, and so on. The two-component elastic charge is expressed via the vector of external mechanical torque applied on the particle. As a result, the elastic Coulomb-like coupling between two particles is found to be proportional to the scalar product of the two external torques and does not directly depend on the particles' form and anchoring. The real-space Green function method is used to develop the pairwise approach to nematic emulsions and determine its form and restrictions. The pairwise potentials are obtained in the familiar form, but, in contrast to the electrostatics, they describe the interaction between pairs (dyads) of the elastic multipole moments. The multipole moments are shown to be uniquely determined by the single-particle director field, unperturbed by other particles. The pairwise approximation is applicable only in the leading order in the small ratio particle size-to-interparticle distance as the next order contains irreducible three-body terms. PMID:17619815

Pergamenshchik, V M; Uzunova, V O

2007-06-01

399

Interaction and Intervention Modeling  

Microsoft Academic Search

PURPOSE: Methods called interaction and intervention modeling are presented. Interaction modeling examines the interactions between variables as the basis for predicting the impact of multiple variables on a target population and on populations with difference distributions of risk factors. Intervention modeling incorporates these interactions and aims to extrapolate the impact of multiple interventions to new populations. The aim is to

Richard Riegelman; Dante Verme; James Rochon; Ayman El-Mohandes

2002-01-01

400

Task-Oriented and Bottle Feeding Adversely Affect the Quality of Mother-Infant Interactions Following Abnormal Newborn Screens  

PubMed Central

Objective Examine effects of newborn screening (NBS) and neonatal diagnosis on the quality of mother-infant interactions in the context of feeding. Methods Study compared the quality of mother-infant feeding interactions among four groups of infants classified by severity of NBS and diagnostic results: cystic fibrosis (CF), congenital hypothyroidism, heterozygote CF carrier, and healthy with normal NBS. The Parent-Child Early Relational Assessment and a task-oriented item measured the quality of feeding interactions for 130 dyads, infant ages 3–19 weeks (M=9.19, SD=3.28). The Center for Epidemiologic Studies Depression Scale and State-Trait Anxiety Inventory measured maternal depression and anxiety. Results Composite Indicator Structure Equation Modeling showed that infant diagnostic status and, to a lesser extent, maternal education predicted feeding method. Mothers of infants with CF were most likely to bottle feed, which was associated with more task-oriented maternal behavior than breastfeeding. Mothers with low task-oriented behavior showed more sensitivity and responsiveness to infant cues, as well as less negative affect and behavior in their interactions with their infants than mothers with high task-oriented scores. Mothers of infants with CF were significantly more likely to have clinically significant anxiety and depression than the other groups. However, maternal psychological profile did not predict feeding method or interaction quality. Conclusions Mothers in the CF group were the least likely to breastfeed. Research is needed to explicate long-term effects of feeding methods on quality of mother-child relationship and ways to promote continued breastfeeding following a neonatal CF diagnosis.

Tluczek, Audrey; Clark, Roseanne; McKechnie, Anne Chevalier; Orland, Kate Murphy; Brown, Roger L.

2010-01-01

401

Human-Computer Interaction INTERACT '03  

Microsoft Academic Search

Abstract: In this paper, we introduce the notion of a socially transforming interface, which is an interface that,when wielded, transforms its user into a more social character in a digital interactive experience than he or shewould be normally, one in which the user is more likely to interact and collaborate in an ad-hoc and constructiveway with other people as part

Matthias Rauterberg; Marino Menozzi

2003-01-01

402

"You Didn't Teach Me, You Showed Me": Variations in Sibling Teaching Strategies in Early and Middle Childhood  

ERIC Educational Resources Information Center

|This study examined siblings' teaching strategies in 72 dyads (firstborn and second born, M ages = 81.64 and 56.31 months) as a function of dyad age, age gap between siblings, and teacher birth order. One child per dyad was randomly assigned to teach her or his sibling to construct a tractor toy. Interactions were coded for the topic of…

Recchia, Holly E.; Howe, Nina; Alexander, Stephanie

2009-01-01

403

Early Participation in a Prenatal Food Supplementation Program Ameliorates the Negative Association of Food Insecurity with Quality of Maternal-Infant Interaction123  

PubMed Central

Food insecurity is detrimental to child development, yet little is known about the combined influence of food insecurity and nutritional interventions on child development in low-income countries. We proposed that women assigned to an early invitation time to start a prenatal food supplementation program could reduce the negative influence of food insecurity on maternal-infant interaction. A cohort of 180 mother-infant dyads were studied (born between May and October 2003) from among 3267 in the randomized controlled trial Maternal Infant Nutritional Interventions Matlab, which was conducted in Matlab, Bangladesh. At 8 wk gestation, women were randomly assigned an invitation time to start receiving food supplements (2.5 MJ/d; 6 d/wk) either early (~9 wk gestation; early-invitation group) or at the usual start time (~20 wk gestation; usual-invitation group) for the government program. Maternal-infant interaction was observed in homes with the use of the Nursing Child Assessment Satellite Training Feeding Scale, and food-insecurity status was obtained from questionnaires completed when infants were 3.4–4.0 mo old. By using a general linear model for maternal-infant interaction, we found a significant interaction (P = 0.012) between invitation time to start a prenatal food supplementation program and food insecurity. Those in the usual-invitation group with higher food insecurity scores (i.e., more food insecure) had a lower quality of maternal-infant interaction, but this relationship was ameliorated among those in the early-invitation group. Food insecurity limits the ability of mothers and infants to interact well, but an early invitation time to start a prenatal food supplementation program can support mother-infant interaction among those who are food insecure.

Frith, Amy L.; Naved, Ruchira T.; Persson, Lars Ake; Rasmussen, Kathleen M.; Frongillo, Edward A.

2012-01-01

404

Modeling Interactive Intelligences.  

National Technical Information Service (NTIS)

This paper explores modeling the adaptive mechanisms of autonomous agents. The focus is on reflexive interaction as a looping action that creates a 'self.' Imitation and play are adaptive components of reflexive interactions that can provide gradual modif...

L. O. Arata

2002-01-01

405

University-Industry Interaction.  

National Technical Information Service (NTIS)

It is posited that university industry interaction is highly desirable from the viewpoint of the long term economic development of the country as well as being desirable for the Space Grant Programs. The present and future possible interactions are review...

D. E. Hastings

1990-01-01

406

Cardiovascular Interactions CVI Project  

NSDL National Science Digital Library

The Cardiovascular Interactions Project is an electronic active learning tool that demonstrates the complex and intricate interactions between the functions of the heart and peripheral circulation to provide an adequate cardiac output during various stresses.

PhD Carl F. Rothe (Indiana University School of Medicine Department of Cellular and Integrative Physiology)

2005-06-22

407

Antiproton-Nucleus Interaction.  

National Technical Information Service (NTIS)

Several facets of antinucleon-nucleus interactions are explored. The topics treated are: coherent interactions, production of unusual states and particles in the nuclear medium, and the creation of extreme states of matter by antimatter annihilation. It i...

W. R. Gibbs

1984-01-01

408

Biological Interactions of Nanomaterials.  

National Technical Information Service (NTIS)

The Biological Interactions of Nanomaterials project focuses on biological characterization of nanomaterials of particular interest to the Air Force. This report describes the basic mechanism of biological interactions of engineered nanomaterials, and exp...

A. M. Schrand J. L. Speshock K. O. Yu L. K. Braydich-Stolle S. M. Hussain

2008-01-01

409

Implementing Interactive Multimedia Training.  

National Technical Information Service (NTIS)

This paper will provide a brief overview of the role of interactive multimedia in corporate training, and will discuss the relevant factors in making wise business decisions regarding the implementation of interactive multimedia (IM) within U.S. shipyards...

R. E. Matlack E. R. Matlack

1995-01-01

410

Interactions in the Serum  

Center for Drug Evaluation (CDER)

... Interactions in the Serum. Protein “bumping” interactions in the serum are a test-tube phenomenon without clinical relevance. ... More results from www.fda.gov/drugs/developmentapprovalprocess/developmentresources

411

Interacting with stories  

Microsoft Academic Search

In todays media-saturated world, students are consuming media both actively and passively. To facilitate active interaction with media, we address a specific kind of audiovisual media interaction in which we call a hyper-drama. We address hyper-drama interaction preferences across two age groups: grades one to five and grades 6 to 9. These hyper-drama interactions include a token on a horizontal

Ashley Robinson; Chao Peng; Francis Quek; Yong Cao

2009-01-01

412

Theorizing Interactivity's Effects  

Microsoft Academic Search

Noting that interactivity is often defined but seldom theorized in the literature, this article provides some pointers for developing theories about effects of interactivity, particularly as it applies to Web-based mass communication. It first makes the case that interactivity is an attribute of the technology and not that of the user. It exposes the tautology of studying the effects of

S. Shyam Sundar

2004-01-01

413

Seamless interaction in space  

Microsoft Academic Search

As more electronic devices enter the living room, there is a need to explore new ways to provide seamless interaction with them over a range of different distances. In this paper we describe a proximity-based interface that allows users to interact with screen content both within arm's length and at a distance. To support such a wide interaction range we

Adrian Clark; Andreas Dünser; Mark Billinghurst; Thammathip Piumsomboon; David Altimira

2011-01-01

414

Dynamic Interactive Learning Systems  

ERIC Educational Resources Information Center

This paper reviews and discusses the notions of interactivity and dynamicity of learning systems in relation to information technologies and design principles that can contribute to interactive and dynamic learning. It explores the concept of dynamic interactive learning systems based on the emerging generation of information as part of a…

Sabry, Khaled; Barker, Jeff

2009-01-01

415

Interactive graph layout  

Microsoft Academic Search

This paper presents a novel methodology for viewing large graphs. The basic concept is to allow the user to interactively navigate through large graphs learning about them in appropriately small and concise pieces. An architecture is present to support graph exploration. It contains methods for building custom layout algorithms hierarchically, interactively decomposing large graphs, and creating interactive parameterized layout algorithms.

Tyson R. Henry; Scott E. Hudson

1991-01-01

416

Interactive Learning and  

Microsoft Academic Search

A growing body of evidence demonstrates that student understanding and retention of key concepts in science can be dramatically improved by using ``Interactive Learning'' techniques. Interactive learning is a way to get students more actively involved in their own learning than by simple lecture alone. I will focus on one type of interactive learning activity, known as ``Think-Pair-Share''. After a

Alexander Rudolph

2006-01-01

417

Laser pointer interaction  

Microsoft Academic Search

Group meetings and other non-desk situations require that people be able to interact at a distance from a display surface. This paper describes a technique using a laser pointer and a camera to accomplish just such interactions. Calibration techniques are given to synchronize the display and camera coordinates. A series of interactive techniques are described for navigation and entry of

Dan R. Olsen Jr.; Travis Nielsen

2001-01-01

418

New insights into calicheamicin-DNA interactions derived from a model nucleosome system.  

PubMed

Using the Xenopus borealis 5S RNA gene, we have identified several new features of the interaction of calicheamicin (CAL), an enediyne antitumor agent, with nucleosomal and naked DNA targets. CAL-mediated DNA damage was generally reduced by incorporation of the DNA into a nucleosome. However, in one instance, the frequency of DNA damage was enhanced in the nucleosome compared to naked DNA. This increase in CAL damage may result from bending-induced changes in the target site, while the association of histone proteins with DNA in the nucleosome may generally reduce the affinity of CAL for its targets by imposing dynamic constraints on the DNA, by altering target structure, or by steric hindrance. One implication of these observations is that new structural features created by incorporation of DNA into chromatin may produce 'hot spots' for CAL-mediated DNA damage not apparent in naked DNA studies. In a second set of experiments, the orientation of CAL at damage sites in naked 5S rDNA was determined. The results suggest that minor groove width per se is not a major determinant of CAL target selection. Our studies support the generality of an oligopurine recognition element, with the additional requirement that the purine tract is interrupted at the 3'-end by a pyrimidine(s). To account for these observations, we propose a model in which CAL recognizes the unique structural and dynamic features associated with the 3'-end of an oligopurine tract. Finally, we conclude that the dyad axis of pseudosymmetry of the 5S rRNA gene nucleosome cannot be determined with any degree of certainty. This places significant limitations on the interpretation of results from the study of drug-DNA interactions with reconstituted nucleosomes. PMID:7582951

Yu, L; Salzberg, A A; Dedon, P C

1995-06-01

419

Development and assessment of an interactive web-based breastfeeding monitoring system (LACTOR).  

PubMed

The purpose of this study is to describe an interactive web-based breastfeeding monitoring system (LACTOR), illustrate its components, explain the theoretical framework, and discuss its assessment as a model for an innovative breastfeeding support intervention. Based on the self-regulation model from Bandura Social Cognitive Theory, we have developed an interactive web-based breastfeeding monitoring system using a breastfeeding diary. The system has two main components: the Mothers' Portal, where mothers can enter their breastfeeding data and receive notifications, and the Lactation Consultants' Portal, where mothers' data can be monitored. The system is designed to send notifications to mothers in case of breastfeeding problems using triggers such as inability to latch, sleepy infant, jaundice, and maternal sore nipples. A prospective, descriptive, mixed methods study was conducted to examine the feasibility, usability, and acceptability of LACTOR among breastfeeding mothers. Eligible mothers were asked to enter their breastfeeding data into the system daily for 30 days and then submit an online system evaluation survey. Twenty-six mother/infant dyads completed the study. Feasibility of the system was established by the mothers' compliance in entering breastfeeding data. The system proved to be user-friendly. The mothers said that the monitoring was beneficial and gave them an opportunity to track their children's feeding patterns and detect any problems early. Mothers also appreciated the notifications and interventions received through the system. We concluded that the system is feasible and acceptable among breastfeeding mothers and a promising tool for maintaining communication between mothers and lactation consultants. PMID:22791207

Ahmed, Azza; Ouzzani, Mourad

2013-07-01

420

Passive Interactivity, an Answer to Interactive Emotion  

Microsoft Academic Search

Sadness is a negative emotion, which aims at a deactivated physiological and behavioural state [21] and so this is easy to\\u000a develop in film experiencing, where the viewer is passively watching and feeling. Interactive storytelling supposes active\\u000a physiological behaviours and this raises the problematic – how to create sad deactivated moments during interactive sequences.\\u000a In this paper we intend to

Nelson Zagalo; Ana Torres; Vasco Branco

2006-01-01

421

Diffractive Interaction of Neutrinos  

NASA Astrophysics Data System (ADS)

Interactions of high-energy neutrinos expose hadronic properties, in particular, contain a strong diffractive channel. The Adler relation (AR) between soft interactions of neutrinos and pions, might look as a manifestation of pion dominance. However, neutrinos cannot fluctuate to pions because of conservation of the lepton current, and interact via much heavier hadronic components. This fact leads to nontrivial relations between interactions of different hadronic species, in particular, it links diagonal and off-diagonal diffractive interactions of pions. Absorptive corrections break these relations making the AR impossible to hold universally, for any target and at any energy.

Kopeliovich, B. Z.; Potashnikova, I. K.; Schmidt, Iván; Siddikov, M.

2013-06-01

422

Two-dimensional NMR study of a protein-DNA complex. lac repressor headpiece-operator interaction.  

PubMed

The interaction of the N-terminal DNA-binding domain (56 amino acid residues) of the lac repressor with lac operator DNA was analyzed using two-dimensional NMR spectroscopy. Both half-operators (11 and 14 bp) and a complete fully symmetric 22 bp operator were studied. Two-dimensional nuclear Overhauser effect (2D NOE) spectra of headpiece-operator complexes were taken in both D2O and H2O solutions. Special attention was given to the problem of 1H resonance assignments. Based on an analysis of the proton-proton NOEs, a model for the headpiece-operator complex could be derived. In this model, most of the protein-DNA contracts occur between amino acid residues in the second helix (recognition helix) of the lac headpiece and DNA bases in the major groove. The orientation of this helix with respect to the dyad axis of the operator is opposite to that found in the X-ray structures of several other repressor-operator complexes. PMID:2372315

Kaptein, R; Lamerichs, R M; Boelens, R; Rullmann, J A

1990-07-01

423

The interactive brain hypothesis  

PubMed Central

Enactive approaches foreground the role of interpersonal interaction in explanations of social understanding. This motivates, in combination with a recent interest in neuroscientific studies involving actual interactions, the question of how interactive processes relate to neural mechanisms involved in social understanding. We introduce the Interactive Brain Hypothesis (IBH) in order to help map the spectrum of possible relations between social interaction and neural processes. The hypothesis states that interactive experience and skills play enabling roles in both the development and current function of social brain mechanisms, even in cases where social understanding happens in the absence of immediate interaction. We examine the plausibility of this hypothesis against developmental and neurobiological evidence and contrast it with the widespread assumption that mindreading is crucial to all social cognition. We describe the elements of social interaction that bear most directly on this hypothesis and discuss the empirical possibilities open to social neuroscience. We propose that the link between coordination dynamics and social understanding can be best grasped by studying transitions between states of coordination. These transitions form part of the self-organization of interaction processes that characterize the dynamics of social engagement. The patterns and synergies of this self-organization help explain how individuals understand each other. Various possibilities for role-taking emerge during interaction, determining a spectrum of participation. This view contrasts sharply with the observational stance that has guided research in social neuroscience until recently. We also introduce the concept of readiness to interact to describe the practices and dispositions that are summoned in situations of social significance (even if not interactive). This latter idea links interactive factors to more classical observational scenarios.

Di Paolo, Ezequiel; De Jaegher, Hanne

2012-01-01

424

The interacting boson model  

SciTech Connect

This chapter examines the algebraic and geometric properties of the interacting boson model-1, and reviews the interacting boson model-2. Explains that the model was originally introduced with only one kind of collective boson variable with angular momentum J=O and J=2 (the interacting boson model-1), and subsequently, a more elaborate version was introduced with two kinds of collective variables, proton bosons and neutron bosons (the interacting boson model-2). Discusses analytic solutions, transitional classes, extensions of the models, coherent states, transitional classes and shape-phase transitions, energy levels, electromagnetic transition rates, other properties, a microscopic description of interacting bosons, generalized seniority, the single j-shell, several j-shells, and the Ginocchio model. Excludes odd-even nuclei and the corresponding interacting boson-fermion models 1 and 2 from the review.

Arima, A.; Iachello, F.

1984-01-01

425

Wave–Vortex Interactions  

Microsoft Academic Search

\\u000a This chapter presents a theoretical investigation of wave–vortex interactions in fluid systems of interest to atmosphere and\\u000a ocean dynamics. The focus is on strong interactions in the sense that the induced changes in the vortical flow should be significant. In essence, such strong wave–vortex\\u000a interactions require significant changes in the potential vorticity (PV) of the flow either by advection of

O. Bühler

2010-01-01

426

Beam-Bem interactions  

SciTech Connect

In high energy storage-ring colliders, the nonlinear effect arising from beam-beam interactions is a major source that leads to the emittance growth, the reduction of beam life time, and limits the collider luminosity. In this paper, two models of beam-beam interactions are introduced, which are weak-strong and strong-strong beam-beam interactions. In addition, space-charge model is introduced.

Kim, Hyung Jin; /Fermilab

2011-12-01

427

Structuring interactive TV documents  

Microsoft Academic Search

Interactive video technology is meant to support user-interaction with video in scene objects associated with navigation in video segments and access to text-based metadata. Interactive TV is one of the most important applications of this area, which has required the development of standards, techniques and tools, such as MPEG-4 and MPEG-7, to create, to describe, to deliver and to present

Rudinei Goularte; Edson dos Santos Moreira; Maria da Graça Campos Pimentel

2003-01-01

428

A monomer-dimer equilibrium modulates the interaction of the sunflower homeodomain leucine-zipper protein Hahb-4 with DNA.  

PubMed Central

We have analysed the interaction of the sunflower homeodomain leucine-zipper (Hd-Zip) protein Hahb-4 with DNA. The complete Hd-Zip domain from Hahb-4 was able to select specific sequences from a random oligonucleotide mixture that contained a 9-bp core with four fixed and five degenerate positions. Analysis of the binding of some of the selected sequences suggests that Hahb-4 preferentially binds the dyad-symmetrical sequence CAAT(A/T)ATTG. Single-nucleotide replacements at positions 1, 5 or 9 of this sequence produced a decrease in binding of 2-4-fold. DNA binding as a function of protein concentration was non-hyperbolic. This behaviour could be explained by an equation in which dimer formation is a pre-requisite for DNA binding. A global dissociation constant (Kd) of 1.31x10(-14) M2 could be calculated. The removal of the leucine zipper promoted a change in specificity and a decrease in binding affinity (Kd=5. 03x10(-5) M). Mutation of Phe-20 of the homeodomain into Leu completely abolished DNA binding. The mutant protein, however, was able to inhibit DNA binding by the non-mutant form, presumably through the formation of heterodimers. The analysis of this inhibitory effect at different mutant concentrations allowed the estimation of the Kd for the dimer-monomer equilibrium [about (2-4)x10(-6) M]; from this, a Kd of 3-6x10(-9) M for the dimer-DNA complex could be estimated. The results obtained indicate that the formation of dimers is the main factor influencing the interaction of Hahb-4 with DNA. It is proposed that shifts in a dimer-monomer equilibrium could be used within the cell to modulate the interaction of this protein with target genes.

Palena, C M; Gonzalez, D H; Chan, R L

1999-01-01

429

Cancer-stromal interactions  

PubMed Central

It has been known for a long time that the interaction between cancer cells and tissue microenvironment plays a major role in cancer development, progression and metastasis. The biochemical aspect of cancer-stromal interactions, however, is less appreciated. This short review article first provides a brief summary of the communications between cancer cells and the tissue microenvironment by direct cell-cell interactions and by soluble factors, and then describes several biochemical pathways that are important for the interaction between stromal and cancer cells with respect to energy metabolism, redox balance, cell survival and drug resistance. The potential therapeutic implications of abolishing stromal protective mechanisms to overcome drug resistance are also discussed.

Zhang, Wan

2011-01-01

430

Interactive brains, social minds  

PubMed Central

To reveal the neural and behavioral dynamics of social interaction, single-person studies are increasingly complemented by research designs that simultaneously assess two or more interacting individuals. In this article, we review studies on neural mechanisms and markers of social interactions that use multi-person functional magnetic resonance imaging and electrophysiological recordings. We propose a terminology for investigating social interaction dynamics, show how forward models of action regulation may serve as a framework for investigating interpersonal action coordination and discuss different methodological approaches to studying functional brain connectivity.

Lindenberger, Ulman

2011-01-01

431

Drug Interaction: Contact Information  

Center for Drug Evaluation (CDER)

... Development Resources. Section Contents Menu. Development & Approval Process (Drugs). ... Drug Interaction: Contact Information. ... More results from www.fda.gov/drugs/developmentapprovalprocess/developmentresources

432

Nerve-pulse interactions  

SciTech Connect

Some recent experimental and theoretical results on mechanisms through which individual nerve pulses can interact are reviewed. Three modes of interactions are considered: (1) interaction of pulses as they travel along a single fiber which leads to velocity dispersion; (2) propagation of pairs of pulses through a branching region leading to quantum pulse code transformations; and (3) interaction of pulses on parallel fibers through which they may form a pulse assembly. This notion is analogous to Hebb's concept of a cell assembly, but on a lower level of the neural hierarchy.

Scott, A.C.

1982-01-01

433

The Negotiation of Intelligibility in an Aphasic Dyad  

ERIC Educational Resources Information Center

|Employing conversation analysis as a research technique, this study investigates the ways that unintelligibility is accounted for and overcome within a therapeutic encounter between an individual with aphasia and dysarthria and his clinician. The results emphasize the collaborative nature of intelligibility negotiation and demonstrate how both…

Damico, Jack S.; Simmons-Mackie, Nina; Wilson, Brent

2006-01-01

434

Whose intentions predict? Power over condom use within heterosexual dyads.  

PubMed

According to major theories of behavioral prediction, the most proximal psychological predictor of an individual's behavior is that individual's intention. With respect to interdependent behaviors such as condom use, however, relationship dynamics influence individuals' power to make decisions and to act. Objective: The current study examines how relationship dynamics impact 3 condom use relevant outcomes: (a) the individual forming his or her own intention to use condoms, (b) the couple forming their joint intention to use condoms, and (c) actual condom use behavior. Method: We conducted a 2-wave longitudinal study of young heterosexual adult couples at high risk for HIV infection involving the collection of both individual- and couple-derived data. Results: Results demonstrate the importance of both person (e.g., biological sex and dispositional dominance) and relational (e.g., relational power and amount of interest in the relationship, operationalized as commitment and perceived alternatives to the relationship) factors in predicting condom use intentions and behavior. Individuals who are lower in dispositional dominance are likely to incorporate their partner's intentions into their own individual intentions; the intentions of individuals who have less interest in the relationship are more highly predictive of the couple's joint intention; and the intentions of men and individuals higher in relationship power are more likely to exert a direct influence on condom use. Conclusions: These findings have implications for improving the health of high-risk individuals, including suggesting situations in which individuals are highly influenced by their partners' intentions. (PsycINFO Database Record (c) 2013 APA, all rights reserved). PMID:23025301

Vanderdrift, Laura E; Agnew, Christopher R; Harvey, S Marie; Warren, Jocelyn T

2012-10-01

435

Beyond the dyad: Including the father in separation-individuation  

Microsoft Academic Search

As a result of changes in family role distribution generated by the Women's Movement, many fathers are participating more directly in the care of their infants and young children. To be responsive to this change in the ecology of parenting, clinicians must reconsider and update traditional formulations about fatherhood toward, an expanded theoretical perspective for learning about and helping families.

Jeffrey Scott Applegate

1987-01-01

436

Developmental trends in television coviewing of parent-child dyads  

Microsoft Academic Search

In this study, long-term trends in joint parent-child television viewing are taken as prototype for developmental changes of the parent-child relationship during adolescence. To describe and compare trends of television coviewing in different configurations of family members, trajectories of daily television viewing, tmeasured with Nielsen-type people meters over a time period of three years, were analyzed using time series methods.

Fritz Sang; Bernhard Schmitz; Karl Tasche

1993-01-01

437

The Atonement–Forgiveness Dyad: Identification With the Aggressed  

Microsoft Academic Search

In an effort to assuage the dystonicities of guilt and anxiety, the atoner forms an identification with his victim. Such an identification is, for the most part, unconscious and, to follow Racker's categorization, is either a concordant or a complementary one, with each pattern generating a distinct atonement narrative. Atonement is synonymous with neither reparation nor guilt, although each of

Irwin C. Rosen

2009-01-01

438

Affect and Dyads: Conflict Across Different Technological Media  

NASA Astrophysics Data System (ADS)

Communication is as, or more, important under conditions of conflict or disagreement as when agreement prevails. An experiment looked at couples engaged in discussing a topic that they disagreed about, either face-to-face, over the phone, or via instant messaging. At least one member of a couple was more likely to suffer an above-median decline in mood in the mediated condition as compared to the face-to-face condition. Couples in the face-to-face condition used the most words, while those in the instant messaging used the least. Couples in the phone condition nearly covered the spectrum. Current indications suggest that while the answer to the question, “Does arguing via mediated means have worse effects than all the other things in relationships, known and unknown, that contribute to the outcome of an argument?” is “No,” the answer to the question, “Does arguing via mediated means have bad effects compared to arguing face-to-face?” is “Quite likely.” At the minimum, the course of the argument and the facial expressions differ from medium to medium.

Burge, Jamika D.; Tatar, Deborah

439

Affect and Dyads: Conflict Across Different Technological Media  

Microsoft Academic Search

Communication is as, or more, important under conditions of conflict or disagreement as when agreement prevails. An experiment\\u000a looked at couples engaged in discussing a topic that they disagreed about, either face-to-face, over the phone, or via instant\\u000a messaging. At least one member of a couple was more likely to suffer an above-median decline in mood in the mediated condition

Jamika D. Burge; Deborah Tatar

2009-01-01

440

Work outcomes of relational demography in Chinese vertical dyads  

Microsoft Academic Search

Relational demography refers to the demographic differences (such as gender, age, race, and tenure) between supervisor and subordinate. This study examines its impact on employees' work outcomes in the setting of a foreign-invested enterprise in China. We hypothesize that dissimilarities on demographic attributes between supervisor and subordinate affect subordinate's leader–member exchange, trust in organization, in-role performance, and organizational citizenship behavior.

Raymond Loi; Hang-yue Ngo

2009-01-01

441

Effective Leadership in Superior-Subordinate Dyads: Theory and Data  

ERIC Educational Resources Information Center

|This paper describes and experimentally demonstrates the main tenets of an operant theory of leadership. Leadership is characterized in the current paper as involving problem solving operant behavior (Cerutti, 1989; Skinner, 1969) in a social context (Skinner, 1953). The theory was assessed under two experimental analogs modeled from generic…

Mawhinney, Thomas C.

2006-01-01

442

Venus: Interaction with Solar Wind  

NASA Astrophysics Data System (ADS)

The solar wind interaction with VENUS provides the archetypal interaction of a flowing magnetized PLASMA with a PLANETARY IONOSPHERE. Mars interacts with the solar wind in much the same way as does Venus, while the rotating plasma in the Saturnian magnetosphere is believed to interact similarly with its moon, Titan (see SATURN: MAGNETOSPHERE INTERACTION WITH TITAN). The interaction of the Jovian ...

Russell, C.; Luhmann, J.; Murdin, P.

2002-07-01

443

Interactive Particle Swarm Optimization  

Microsoft Academic Search

It is often desirable to simultaneously handle several objectives and constraints in practical optimization problems. In some cases, these objectives and constraints are non-commensurable and they are not explicitly\\/mathematically available. For this kind of problems, interactive optimization may be a good approach. Interactive optimization means that a human user evaluates the potential solutions in qualitative way. In recent years evolutionary

Janos Madar; János Abonyi; Ferenc Szeifert

2005-01-01

444

Solitary water wave interactions  

Microsoft Academic Search

This article concerns the pairwise nonlinear interaction of solitary waves in the free surface of a body of water lying over a horizontal bottom. Unlike solitary waves in many completely integrable model systems, solitary waves for the full Euler equations do not collide elastically; after interactions, there is a nonzero residual wave that trails the post-collision solitary waves. In this

Walter Craig; P. Guyenne; J. Hammack; D. Henderson; C. Sulem

2006-01-01

445

The Interaction Equivalency Theorem  

ERIC Educational Resources Information Center

|This paper examines the key issues regarding The Interaction Equivalency Theorem posited by Anderson (2003a), which consists of the three interaction elements found in formal education courses among teacher, student, and content. It first examines the core concepts of the theorem and argues that two theses of different dimensions can be…

Miyazoe, Terumi; Anderson, Terry

2010-01-01

446

Interactive Video Authoring Systems.  

ERIC Educational Resources Information Center

|Five articles describe the following microcomputer-based interactive video authoring aids: (1) IBM's Learning System/1; (2) Video Nova Authoring System; (3) IMSATT Corporation's expert-based authoring system; (4) the System for Authoring Microtraining (SAM); and (5) Omnicom's Content Expert Interviewer and Interactive Design and Authoring System.…

Taylor, Timothy D.; And Others

1987-01-01

447

An Interactive Multimedia Review.  

ERIC Educational Resources Information Center

|Presents a review of "Communism and the Cold War," an interactive multimedia videodisk designed for teaching about the post-World War II world. Concludes that, although the program is a first step in the use of interactive media in the classroom, it provides a vision of an exciting and dynamic social studies classroom in the future. (CFR)|

Benedicks, William, Jr.; Felton, Randall G.

1994-01-01

448

Media Embedded Interactions.  

ERIC Educational Resources Information Center

|A review of literature and two surveys, one of college students and one of a random sample of adults, were used to examine four aspects of media embedded interactions (social behavior in front of a TV or radio): their functions, their environment, their effects, and the reactions of the interactants to them. Television is seen as performing a…

Johnson, J. David

449

ISDB: Interaction Sentence Database  

Microsoft Academic Search

BACKGROUND: Rapid growth in the scientific literature available on-line continues to motivate shifting data analysis from humans to computers. For example, greater knowledge of sentence characteristics indicative of interaction between two biological entities is needed to aid in the creation of better-performing information extraction tools for effectively using this rich body of information. FINDINGS: The Interaction Sentence Database (ISDB) allows

Michael A Bauer; Robert E Belford; Jing Ding; Daniel Berleant

2010-01-01

450

Media Embedded Interactions.  

ERIC Educational Resources Information Center

A review of literature and two surveys, one of college students and one of a random sample of adults, were used to examine four aspects of media embedded interactions (social behavior in front of a TV or radio): their functions, their environment, their effects, and the reactions of the interactants to them. Television is seen as performing a…

Johnson, J. David

451

Antiproton-nucleus interaction  

SciTech Connect

Several facets of antinucleon-nucleus interactions are explored. The topics treated are: coherent interactions, production of unusual states and particles in the nuclear medium, and the creation of extreme states of matter by antimatter annihilation. It is found that temperatures of the magnitude necessary to achieve the predicted quark-gluon phase transition are obtained. 20 references.

Gibbs, W.R.

1984-01-01

452

Antiproton-nucleus interaction  

SciTech Connect

Several facets of antinucleon-nucleus interactions are explored. The topics treated are: coherent interactions, production of usual states and particles in the nuclear medium, and the creation of extreme states of matter by antimatter annihilation. It is found that temperatures of the magnitude necessary to achieve the predicted quark-gluon phase transition are obtained.

Gibbs, W.R.

1984-11-15

453

The Audio Interactive Tutor.  

ERIC Educational Resources Information Center

Describes The Audio Interactive Tutor (TAIT), an interactive audio/oral computer-assisted study device. TAIT's output consists of explanations and examples along with commands and questions requiring responses from the user. It uses speech recognition to determine the responses made by the user and constructs an evolving model of what the user…

Waters, Richard C.

1995-01-01

454

What Is Interactivity?  

ERIC Educational Resources Information Center

In this article, the author attempts to develop a definition of "interactivity" that meets two sometimes incompatible goals: the definition should be in accord with the best intuitions on how the term should be used, and it should usefully differentiate interactivity from related but incompatible concepts with which it is often confused. The…

Smuts, Aaron

2009-01-01

455

Phonon Interactions in Crystals.  

National Technical Information Service (NTIS)

The role of four-phonon processes in the decay of high energy phonons from the lowest (transverse) phonon branch is discussed. The effects of both the quartic anharmonic interaction, as well as the cubic anharmonic interaction calculated in the second Bor...

M. Pomerantz N. S. Shiren R. J. von Gutfeld P. B. Miller

1966-01-01

456

Environmental sustainability and interaction  

Microsoft Academic Search

By its nature, the discipline of human computer interaction must take into consideration the issues that are most pertinent to humans. We believe that the CHI community faces an unanswered challenge in the creation of interactive systems: sustainability. For example, climate scientists argue that the most serious consequences of climate change can be averted, but only if fundamental changes are

Jennifer C. Mankoff; Eli Blevis; Alan Borning; Batya Friedman; Susan R. Fussell; Jay Hasbrouck; Allison Woodruff; Phoebe Sengers

2007-01-01

457

Flow Interaction with Topography  

NSDL National Science Digital Library

This module explores the fundamental concepts used to determine how air flow interacts with topography. Using the simple analogy of a marble rolling over a hill, this module examines the relationship between wind speed and static stability of the atmosphere. These results are further extended to include three-dimensional terrain barriers as well as the evolution through time of the interaction.

Spangler, Tim

1999-05-01

458

The ADAMS interactive interpreter  

Microsoft Academic Search

The ADAMS (Advanced DAta Management System) project is exploring next generation database technology. Database management does not follow the usual programming paradigm. Instead, the database dictionary provides an additional name space environment that should be interactively created and tested before w