Note: This page contains sample records for the topic carbon fixation pathways from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: November 12, 2013.
1

Improving carbon fixation pathways.  

PubMed

A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that novel pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials. PMID:22647231

Ducat, Daniel C; Silver, Pamela A

2012-05-29

2

Improving Carbon Fixation Pathways  

PubMed Central

A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that alternative pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials.

Ducat, Daniel C.

2012-01-01

3

A survey of carbon fixation pathways through a quantitative lens.  

PubMed

While the reductive pentose phosphate cycle is responsible for the fixation of most of the carbon in the biosphere, it has several natural substitutes. In fact, due to the characterization of three new carbon fixation pathways in the last decade, the diversity of known metabolic solutions for autotrophic growth has doubled. In this review, the different pathways are analysed and compared according to various criteria, trying to connect each of the different metabolic alternatives to suitable environments or metabolic goals. The different roles of carbon fixation are discussed; in addition to sustaining autotrophic growth it can also be used for energy conservation and as an electron sink for the recycling of reduced electron carriers. Our main focus in this review is on thermodynamic and kinetic aspects, including thermodynamically challenging reactions, the ATP requirement of each pathway, energetic constraints on carbon fixation, and factors that are expected to limit the rate of the pathways. Finally, possible metabolic structures of yet unknown carbon fixation pathways are suggested and discussed. PMID:22200662

Bar-Even, Arren; Noor, Elad; Milo, Ron

2011-12-26

4

Thermodynamic constraints shape the structure of carbon fixation pathways.  

PubMed

Thermodynamics impose a major constraint on the structure of metabolic pathways. Here, we use carbon fixation pathways to demonstrate how thermodynamics shape the structure of pathways and determine the cellular resources they consume. We analyze the energetic profile of prototypical reactions and show that each reaction type displays a characteristic change in Gibbs energy. Specifically, although carbon fixation pathways display a considerable structural variability, they are all energetically constrained by two types of reactions: carboxylation and carboxyl reduction. In fact, all adenosine triphosphate (ATP) molecules consumed by carbon fixation pathways - with a single exception - are used, directly or indirectly, to power one of these unfavorable reactions. When an indirect coupling is employed, the energy released by ATP hydrolysis is used to establish another chemical bond with high energy of hydrolysis, e.g. a thioester. This bond is cleaved by a downstream enzyme to energize an unfavorable reaction. Notably, many pathways exhibit reduced ATP requirement as they couple unfavorable carboxylation or carboxyl reduction reactions to exergonic reactions other than ATP hydrolysis. In the most extreme example, the reductive acetyl coenzyme A (acetyl-CoA) pathway bypasses almost all ATP-consuming reactions. On the other hand, the reductive pentose phosphate pathway appears to be the least ATP-efficient because it is the only carbon fixation pathway that invests ATP in metabolic aims other than carboxylation and carboxyl reduction. Altogether, our analysis indicates that basic thermodynamic considerations accurately predict the resource investment required to support a metabolic pathway and further identifies biochemical mechanisms that can decrease this requirement. PMID:22609686

Bar-Even, Arren; Flamholz, Avi; Noor, Elad; Milo, Ron

2012-05-17

5

Design and analysis of synthetic carbon fixation pathways.  

PubMed

Carbon fixation is the process by which CO(2) is incorporated into organic compounds. In modern agriculture in which water, light, and nutrients can be abundant, carbon fixation could become a significant growth-limiting factor. Hence, increasing the fixation rate is of major importance in the road toward sustainability in food and energy production. There have been recent attempts to improve the rate and specificity of Rubisco, the carboxylating enzyme operating in the Calvin-Benson cycle; however, they have achieved only limited success. Nature employs several alternative carbon fixation pathways, which prompted us to ask whether more efficient novel synthetic cycles could be devised. Using the entire repertoire of approximately 5,000 metabolic enzymes known to occur in nature, we computationally identified alternative carbon fixation pathways that combine existing metabolic building blocks from various organisms. We compared the natural and synthetic pathways based on physicochemical criteria that include kinetics, energetics, and topology. Our study suggests that some of the proposed synthetic pathways could have significant quantitative advantages over their natural counterparts, such as the overall kinetic rate. One such cycle, which is predicted to be two to three times faster than the Calvin-Benson cycle, employs the most effective carboxylating enzyme, phosphoenolpyruvate carboxylase, using the core of the naturally evolved C4 cycle. Although implementing such alternative cycles presents daunting challenges related to expression levels, activity, stability, localization, and regulation, we believe our findings suggest exciting avenues of exploration in the grand challenge of enhancing food and renewable fuel production via metabolic engineering and synthetic biology. PMID:20410460

Bar-Even, Arren; Noor, Elad; Lewis, Nathan E; Milo, Ron

2010-04-21

6

The role of the C4 pathway in carbon accumulation and fixation in a marine diatom.  

PubMed

The role of a C(4) pathway in photosynthetic carbon fixation by marine diatoms is presently debated. Previous labeling studies have shown the transfer of photosynthetically fixed carbon through a C(4) pathway and recent genomic data provide evidence for the existence of key enzymes involved in C(4) metabolism. Nonetheless, the importance of the C(4) pathway in photosynthesis has been questioned and this pathway is seen as redundant to the known CO(2) concentrating mechanism of diatoms. Here we show that the inhibition of phosphoenolpyruvate carboxylase (PEPCase) by 3,3-dichloro-2-dihydroxyphosphinoylmethyl-2-propenoate resulted in a more than 90% decrease in whole cell photosynthesis in Thalassiosira weissflogii cells acclimated to low CO(2) (10 microm), but had little effect on photosynthesis in the C(3) marine Chlorophyte, Chlamydomonas sp. In 3,3-dichloro-2-dihydroxyphosphinoylmethyl-2-propenoate-treated T. weissflogii cells, elevated CO(2) (150 microm) or low O(2) (80-180 microm) restored photosynthesis to the control rate linking PEPCase inhibition with CO(2) supply in this diatom. In C(4) organic carbon-inorganic carbon competition experiments, the (12)C-labeled C(4) products of PEPCase, oxaloacetic acid and its reduced form malic acid suppressed the fixation of (14)C-labeled inorganic carbon by 40% to 50%, but had no effect on O(2) evolution in photosynthesizing diatoms. Oxaloacetic acid-dependent O(2) evolution in T. weissflogii was twice as high in cells acclimated to 10 microm rather than 22 microm CO(2), indicating that the use of C(4) compounds for photosynthesis is regulated over the range of CO(2) concentrations observed in marine surface waters. Short-term (14)C uptake (silicone oil centrifugation) and CO(2) release (membrane inlet mass spectrometry) experiments that employed a protein denaturing cell extraction solution containing the PEPCKase inhibitor mercaptopicolinic acid revealed that much of the carbon taken up by diatoms during photosynthesis is stored as organic carbon before being fixed in the Calvin cycle, as expected if the C(4) pathway functions as a CO(2) concentrating mechanism. Together these results demonstrate that the C(4) pathway is important in carbon accumulation and photosynthetic carbon fixation in diatoms at low (atmospheric) CO(2). PMID:15286292

Reinfelder, John R; Milligan, Allen J; Morel, François M M

2004-07-30

7

Carbon dioxide fixation in 'Archaeoglobus lithotrophicus': are there multiple autotrophic pathways?  

PubMed

Several representatives of the euryarchaeal class Archaeoglobi are able to grow facultative autotrophically using the reductive acetyl-CoA pathway, with 'Archaeoglobus lithotrophicus' being an obligate autotroph. However, genome sequencing revealed that some species harbor genes for key enzymes of other autotrophic pathways, i.e. 4-hydroxybutyryl-CoA dehydratase of the dicarboxylate/hydroxybutyrate cycle and the hydroxypropionate/hydroxybutyrate cycle and ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) of the Calvin-Benson cycle. This raised the question of whether only one or multiple autotrophic pathways are operating in these species. We searched for the presence of enzyme activities specific for the dicarboxylate/hydroxybutyrate or the hydroxypropionate/hydroxybutyrate cycles in 'A. lithotrophicus', but such enzymes could not be detected. Low Rubisco activity was detected that could not account for the carbon dioxide (CO(2)) fixation rate; in addition, phosphoribulokinase activity was not found. The generation of ribulose 1,5-bisphosphate from 5-phospho-D-ribose 1-pyrophosphate was observed, but not from AMP; these sources for ribulose 1,5-bisphosphate have been proposed before. Our data indicate that the reductive acetyl-CoA pathway is the only functioning CO(2) fixation pathway in 'A. lithotrophicus'. PMID:21410513

Estelmann, Sebastian; Ramos-Vera, Walter Hugo; Gad'on, Nasser; Huber, Harald; Berg, Ivan A; Fuchs, Georg

2011-04-04

8

An ancient pathway combining carbon dioxide fixation with the generation and utilization of a sodium ion gradient for ATP synthesis.  

PubMed

Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K; Gottschalk, Gerhard; Müller, Volker

2012-03-29

9

An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis  

PubMed Central

Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes.

Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thurmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Muller, Volker

2012-01-01

10

The Role of the C4 Pathway in Carbon Accumulation and Fixation in a Marine Diatom1  

PubMed Central

The role of a C4 pathway in photosynthetic carbon fixation by marine diatoms is presently debated. Previous labeling studies have shown the transfer of photosynthetically fixed carbon through a C4 pathway and recent genomic data provide evidence for the existence of key enzymes involved in C4 metabolism. Nonetheless, the importance of the C4 pathway in photosynthesis has been questioned and this pathway is seen as redundant to the known CO2 concentrating mechanism of diatoms. Here we show that the inhibition of phosphoenolpyruvate carboxylase (PEPCase) by 3,3-dichloro-2-dihydroxyphosphinoylmethyl-2-propenoate resulted in a more than 90% decrease in whole cell photosynthesis in Thalassiosira weissflogii cells acclimated to low CO2 (10 ?m), but had little effect on photosynthesis in the C3 marine Chlorophyte, Chlamydomonas sp. In 3,3-dichloro-2-dihydroxyphosphinoylmethyl-2-propenoate-treated T. weissflogii cells, elevated CO2 (150 ?m) or low O2 (80–180 ?m) restored photosynthesis to the control rate linking PEPCase inhibition with CO2 supply in this diatom. In C4 organic carbon-inorganic carbon competition experiments, the 12C-labeled C4 products of PEPCase, oxaloacetic acid and its reduced form malic acid suppressed the fixation of 14C-labeled inorganic carbon by 40% to 50%, but had no effect on O2 evolution in photosynthesizing diatoms. Oxaloacetic acid-dependent O2 evolution in T. weissflogii was twice as high in cells acclimated to 10 ?m rather than 22 ?m CO2, indicating that the use of C4 compounds for photosynthesis is regulated over the range of CO2 concentrations observed in marine surface waters. Short-term 14C uptake (silicone oil centrifugation) and CO2 release (membrane inlet mass spectrometry) experiments that employed a protein denaturing cell extraction solution containing the PEPCKase inhibitor mercaptopicolinic acid revealed that much of the carbon taken up by diatoms during photosynthesis is stored as organic carbon before being fixed in the Calvin cycle, as expected if the C4 pathway functions as a CO2 concentrating mechanism. Together these results demonstrate that the C4 pathway is important in carbon accumulation and photosynthetic carbon fixation in diatoms at low (atmospheric) CO2.

Reinfelder, John R.; Milligan, Allen J.; Morel, Francois M.M.

2004-01-01

11

Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans  

PubMed Central

Background Acidithiobacillus ferrooxidans is chemolithoautotrophic ?-proteobacterium that thrives at extremely low pH (pH 1-2). Although a substantial amount of information is available regarding CO2 uptake and fixation in a variety of facultative autotrophs, less is known about the processes in obligate autotrophs, especially those living in extremely acidic conditions, prompting the present study. Results Four gene clusters (termed cbb1-4) in the A. ferrooxidans genome are predicted to encode enzymes and structural proteins involved in carbon assimilation via the Calvin-Benson-Bassham (CBB) cycle including form I of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO, EC 4.1.1.39) and the CO2-concentrating carboxysomes. RT-PCR experiments demonstrated that each gene cluster is a single transcriptional unit and thus is an operon. Operon cbb1 is divergently transcribed from a gene, cbbR, encoding the LysR-type transcriptional regulator CbbR that has been shown in many organisms to regulate the expression of RubisCO genes. Sigma70-like -10 and -35 promoter boxes and potential CbbR-binding sites (T-N11-A/TNA-N7TNA) were predicted in the upstream regions of the four operons. Electrophoretic mobility shift assays (EMSAs) confirmed that purified CbbR is able to bind to the upstream regions of the cbb1, cbb2 and cbb3 operons, demonstrating that the predicted CbbR-binding sites are functional in vitro. However, CbbR failed to bind the upstream region of the cbb4 operon that contains cbbP, encoding phosphoribulokinase (EC 2.7.1.19). Thus, other factors not present in the assay may be required for binding or the region lacks a functional CbbR-binding site. The cbb3 operon contains genes predicted to encode anthranilate synthase components I and II, catalyzing the formation of anthranilate and pyruvate from chorismate. This suggests a novel regulatory connection between CO2 fixation and tryptophan biosynthesis. The presence of a form II RubisCO could promote the ability of A. ferrooxidans to fix CO2 at different concentrations of CO2. Conclusions A. ferrooxidans has features of cbb gene organization for CO2-assimilating functions that are characteristic of obligate chemolithoautotrophs and distinguish this group from facultative autotrophs. The most conspicuous difference is a separate operon for the cbbP gene. It is hypothesized that this organization may provide greater flexibility in the regulation of expression of genes involved in inorganic carbon assimilation.

2010-01-01

12

Carbon dioxide fixation.  

National Technical Information Service (NTIS)

Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO(sub 2) conv...

E. Fujita

2000-01-01

13

Widespread Occurrence of Two Carbon Fixation Pathways in Tubeworm Endosymbionts: Lessons from Hydrothermal Vent Associated Tubeworms from the Mediterranean Sea  

PubMed Central

Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL – the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat.

Thiel, Vera; Hugler, Michael; Blumel, Martina; Baumann, Heike I.; Gartner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schonberg, Dieter; Petersen, Sven; Cowart, Dominique A.; Fisher, Charles R.; Imhoff, Johannes F.

2012-01-01

14

Insights into the autotrophic CO2 fixation pathway of the archaeon Ignicoccus hospitalis: comprehensive analysis of the central carbon metabolism.  

PubMed

Ignicoccus hospitalis is an autotrophic hyperthermophilic archaeon that serves as a host for another parasitic/symbiotic archaeon, Nanoarchaeum equitans. In this study, the biosynthetic pathways of I. hospitalis were investigated by in vitro enzymatic analyses, in vivo (13)C-labeling experiments, and genomic analyses. Our results suggest the operation of a so far unknown pathway of autotrophic CO(2) fixation that starts from acetyl-coenzyme A (CoA). The cyclic regeneration of acetyl-CoA, the primary CO(2) acceptor molecule, has not been clarified yet. In essence, acetyl-CoA is converted into pyruvate via reductive carboxylation by pyruvate-ferredoxin oxidoreductase. Pyruvate-water dikinase converts pyruvate into phosphoenolpyruvate (PEP), which is carboxylated to oxaloacetate by PEP carboxylase. An incomplete citric acid cycle is operating: citrate is synthesized from oxaloacetate and acetyl-CoA by a (re)-specific citrate synthase, whereas a 2-oxoglutarate-oxidizing enzyme is lacking. Further investigations revealed that several special biosynthetic pathways that have recently been described for various archaea are operating. Isoleucine is synthesized via the uncommon citramalate pathway and lysine via the alpha-aminoadipate pathway. Gluconeogenesis is achieved via a reverse Embden-Meyerhof pathway using a novel type of fructose 1,6-bisphosphate aldolase. Pentosephosphates are formed from hexosephosphates via the suggested ribulose-monophosphate pathway, whereby formaldehyde is released from C-1 of hexose. The organism may not contain any sugar-metabolizing pathway. This comprehensive analysis of the central carbon metabolism of I. hospitalis revealed further evidence for the unexpected and unexplored diversity of metabolic pathways within the (hyperthermophilic) archaea. PMID:17400748

Jahn, Ulrike; Huber, Harald; Eisenreich, Wolfgang; Hügler, Michael; Fuchs, Georg

2007-03-30

15

Enzymes and coenzymes of the carbon monoxide dehydrogenase pathway for autotrophic CO 2 fixation in Archaeoglobus lithotrophicus and the lack of carbon monoxide dehydrogenase in the heterotrophic A. profundus  

Microsoft Academic Search

Archaeoglobus lithotrophicus is a hyperthermophilic Archaeon that grows on H2 and sulfate as energy sources and CO2 as sole carbon source. The autotrophic sulfate reducer was shown to contain all the enzyme activities and coenzymes of the reductive carbon monoxide dehydrogenase pathway for autotrophic CO2 fixation as operative in methanogenic Archaea. With the exception of carbon monoxide dehydrogenase these enzymes

Julia Vornolt; Jasper Kunow; Karl O. Stetter; Rudolf K. Thauer

1995-01-01

16

Enzymes and coenzymes of the carbon monoxide dehydrogenase pathway for autotrophic CO2 fixation in Archaeoglobus lithotrophicus and the lack of carbon monoxide dehydrogenase in the heterotrophic A. profundus  

Microsoft Academic Search

Archaeoglobus lithotrophicus is a hyperthermophilic Archaeon that grows on H 2 and sulfate as energy sources and CO 2 as sole carbon source. The autotrophic sulfate reducer was shown to contain all the enzyme activities and coenzymes of the reductive carbon monoxide dehydrogenase pathway for autotrophic CO 2 fixation as operative in methanogenic Archaea. With the exception of carbon monoxide

Julia Vorholt; Jasper Kunow; Karl O. Stetter; R. K. Thauer

1995-01-01

17

The Emergence and Early Evolution of Biological Carbon-Fixation  

Microsoft Academic Search

The fixation of into living matter sustains all life on Earth, and embeds the biosphere within geochemistry. The six known chemical pathways used by extant organisms for this function are recognized to have overlaps, but their evolution is incompletely understood. Here we reconstruct the complete early evolutionary history of biological carbon-fixation, relating all modern pathways to a single ancestral form.

Rogier Braakman; Eric Smith

2012-01-01

18

Beyond the Calvin Cycle: Autotrophic Carbon Fixation in the Ocean  

NASA Astrophysics Data System (ADS)

Organisms capable of autotrophic metabolism assimilate inorganic carbon into organic carbon. They form an integral part of ecosystems by making an otherwise unavailable form of carbon available to other organisms, a central component of the global carbon cycle. For many years, the doctrine prevailed that the Calvin-Benson-Bassham (CBB) cycle is the only biochemical autotrophic CO2 fixation pathway of significance in the ocean. However, ecological, biochemical, and genomic studies carried out over the last decade have not only elucidated new pathways but also shown that autotrophic carbon fixation via pathways other than the CBB cycle can be significant. This has ramifications for our understanding of the carbon cycle and energy flow in the ocean. Here, we review the recent discoveries in the field of autotrophic carbon fixation, including the biochemistry and evolution of the different pathways, as well as their ecological relevance in various oceanic ecosystems.

Hügler, Michael; Sievert, Stefan M.

2011-01-01

19

Computation of metabolic fluxes and efficiencies for biological carbon dioxide fixation.  

PubMed

With rising energy prices and concern over the environmental impact of fossil fuel consumption, the push to develop biomass derived fuels has increased significantly. Although most global carbon fixation occurs via the Calvin Benson Bassham cycle, there are currently five other known pathways for carbon fixation; the goal of this study was to determine the thermodynamic efficiencies of all six carbon fixation pathways for the production of biomass using flux balance analysis. The three chemotrophic pathways, the reductive acetyl-CoA pathway, the 3-hydroxypropionate/4-hydroxybutyrate cycle and the dicarboxylate/4-hydroxybutyrate cycle, were found to be more efficient than photoautotrophic carbon fixation pathways. However, as hydrogen is not freely available, the energetic cost of hydrogen production from sunlight was calculated and included in the overall energy demand, which results in a 5 fold increase in the energy demand of chemoautotrophic carbon fixation. Therefore, when the cost of hydrogen production is included, photoautotrophic pathways are more efficient. However, the energetic cost for the production of 12 metabolic precursors was found to vary widely across the different carbon fixation pathways; therefore, different pathways may be more efficient at producing products from a single precursor than others. The results of this study have significant impact on the selection or design of autotrophic organisms for biofuel or biochemical production. Overall biomass production from solar energy is most efficient in organisms using the reductive TCA cycle, however, products derived from one metabolic precursor may be more efficiently produced using other carbon fixation pathways. PMID:21276868

Boyle, Nanette R; Morgan, John A

2011-01-27

20

Current views on the regulation of autotrophic carbon dioxide fixation via the Calvin cycle in bacteria  

Microsoft Academic Search

The Calvin cycle of carbon dioxide fixation constitutes a biosynthetic pathway for the generation of (multi-carbon) intermediates\\u000a of central metabolism from the one-carbon compound carbon dioxide. The product of this cycle can be used as a precursor for\\u000a the synthesis of all components of cell material. Autotrophic carbon dioxide fixation is energetically expensive and it is\\u000a therefore not surprising that

L. Dijkhuizen; W. Harder

1984-01-01

21

Distribution of CO(2) fixation and acetate mineralization pathways in microorganisms from extremophilic anaerobic biotopes.  

PubMed

Extremophilic anaerobes are widespread in saline, acid, alkaline, and high or low temperature environments. Carbon is essential to living organisms and its fixation, degradation, or mineralization is driven by, up to now, six metabolic pathways. Organisms using these metabolisms are known as autotrophs, acetotrophs or carbon mineralizers, respectively. In anoxic and extreme environments, besides the well-studied Calvin-Benson-Bassham cycle, there are other five carbon fixation pathways responsible of autotrophy. Moreover, regarding carbon mineralization, two pathways perform this key process for carbon cycling. We might imagine that all the pathways can be found evenly distributed in microbial biotopes; however, in extreme environments, this does not occur. This manuscript reviews the most commonly reported anaerobic organisms that fix carbon and mineralize acetate in extreme anoxic habitats. Additionally, an inventory of autotrophic extremophiles by biotope is presented. PMID:23065059

Montoya, Lilia; Celis, Lourdes B; Razo-Flores, Elías; Alpuche-Solís, Angel G

2012-10-12

22

Efficient CO2 Fixation Pathways: Energy Plant: High Efficiency Photosynthetic Organisms  

SciTech Connect

PETRO Project: UCLA is redesigning the carbon fixation pathways of plants to make them more efficient at capturing the energy in sunlight. Carbon fixation is the key process that plants use to convert carbon dioxide (CO2) from the atmosphere into higher energy molecules (such as sugars) using energy from the sun. UCLA is addressing the inefficiency of the process through an alternative biochemical pathway that uses 50% less energy than the pathway used by all land plants. In addition, instead of producing sugars, UCLA’s designer pathway will produce pyruvate, the precursor of choice for a wide variety of liquid fuels. Theoretically, the new biochemical pathway will allow a plant to capture 200% as much CO2 using the same amount of light. The pathways will first be tested on model photosynthetic organisms and later incorporated into other plants, thus dramatically improving the productivity of both food and fuel crops.

None

2012-01-01

23

Dark fixation of carbon dioxide in an agricultural soil  

SciTech Connect

Dark fixation of carbon dioxide was monitored in an agricultural soil in northeast Georgia from December 1981 through December 1982. Carbon fixation, based on the rate of radiolabeled CO/sub 2/ incorporation, varied from 0.2 to 4.8 mg m/sup -2/ h/sup -1/. Stepwise regression analysis indicated that dark fixation was positively correlated with the rate of carbon dioxide evolution and soil temperature and was inversely correlated with irradiance. Total annual dark fixation of carbon was estimated to be 15 g m/sup -2/.

Shimmel, S.M.

1987-07-01

24

Carbon Fixation and Isotope Discrimination by a Crassulacean Plant: Dependence on the Photoperiod  

Microsoft Academic Search

Variations of more than 1 percent are observed in the carbon-13 to carbon-12 ratio of extracts of leaves of the succulent Kalanchoe blossfeldiana when the photoperiod is changed from long to short days. This indicates that the mechanism of carbon fixation switches from the Calvin (C3) pathway to the Hatch-Slack (C4) pathway of primary enzymic operation. The variations observed in

J. C. Lerman; O. Queiroz

1974-01-01

25

Acetogenesis and the Wood-Ljungdahl Pathway of CO2 Fixation  

PubMed Central

I. Summary Conceptually, the simplest way to synthesize an organic molecule is to construct it one carbon at a time. The Wood-Ljungdahl pathway of CO2 fixation involves this type of stepwise process. The biochemical events that underlie the condensation of two one-carbon units to form the two-carbon compound, acetate, have intrigued chemists, biochemists, and microbiologists for many decades. We begin this review with a description of the biology of acetogenesis. Then, we provide a short history of the important discoveries that have led to the identification of the key components and steps of this usual mechanism of CO and CO2 fixation. In this historical perspective, we have included reflections that hopefully will sketch the landscape of the controversies, hypotheses, and opinions that led to the key experiments and discoveries. We then describe the properties of the genes and enzymes involved in the pathway and conclude with a section describing some major questions that remain unanswered.

Ragsdale, Stephen W.; Pierce, Elizabeth

2008-01-01

26

Carbon fixation and carbonic anhydrase activity in Haslea ostrearia (Bacillariophyceae) in relation to growth irradiance  

Microsoft Academic Search

The metabolic pathway of primary carbon fixation was studied in a peculiar pennate marine diatom, Haslea ostrearia (Bory) Simonsen, which synthesizes and accumulates a blue pigment known as “marennine”. Cells were cultured in a semi-continuous\\u000a mode under saturating [350 µmol(photon) m?2 s?1] or non-saturating [25 µmol(photon) m?2 s?1] irradiance producing “blue” (BC) and “green” (GC) cells, characterized by high and

M. Rech; A. Morant-Manceau; G. Tremblin

2008-01-01

27

Uranous ion oxidation and carbon dioxide fixation by Thiobacillus ferrooxidans  

Microsoft Academic Search

The stoichiometric oxidation of uranous-to uranyl-uranium byThiobacllus ferrooxidans is demonstrated. Fixation of14CO2 and the effect of inhibitors demonstrate that energy is conserved during the oxidation and used for energy-dependent “reverse electron flow” and carbon dioxide fixation.

Alan A. DiSpirito; Olli H. Tuovinen

1982-01-01

28

Carbon Fixation by the Peculiar Marine Diatom Haslea Ostrearia  

Microsoft Academic Search

During batch culture of Haslea ostrearia the highest carbon (14C) fixation rate was found in vivo in cells that did not accumulate the blue pigment marennine (green form). This fixation rate decreased concomitantly with the accumulation of marennine. In vitro, no phosphoenolpyruvate carboxylase (PEPC) activity was detected, but nearly equivalent activities of ribulose-1,5-bisphosphate carboxylase (RuBPC) and phosphoenolpyruvate carboxykinase (PEPCK) were

G. Tremblin; J.-M. Robert

2001-01-01

29

Fixation of potassium aurocyanide on active carbons  

Microsoft Academic Search

Active carbons of different origins (ex-coconut shell, ex-coal, ex-peat and ex-wood) have been used as adsorbents of potassium aurocyanide. Various treatments were applied to the active carbons: heat treatment at 800 °C, heat treatment at 800 °C followed by HCl (11) washing, heat treatment at 650 °C, washing with HCl 10%, esterification with methanol, oxidation with nitric acid and extraction

Eugène Papirer; Anundo Polania-Leon; Jean-Baptiste Donnet; Philippe Montagnon

1995-01-01

30

Abundance and Distribution of Diagnostic Carbon Fixation Genes in a Deep-Sea Hydrothermal Gradient Ecosystem  

NASA Astrophysics Data System (ADS)

The walls of deep-sea hydrothermal vent chimneys sustain steep thermal and chemical gradients resulting from the mixing of hot (350°C+) hydrothermal fluids with cold, oxygenated seawater. The chemical disequilibrium generated from this process has the potential to drive numerous chemolithoautotrophic metabolisms, many of which have been demonstrated to be operative in microbial pure cultures. In addition to the well-known Calvin Cycle, at least five additional pathways have been discovered including the Reverse Tricarboxylic Acid Cycle (rTCA), the Reductive Acetyl-CoA pathway, and the 3-hydroxyproprionate pathway. Most of the newly discovered pathways have been found in thermophilic and hyperthermophilic Bacteria and Archaea, which are the well represented in microbial diversity studies of hydrothermal chimney walls. However, to date, little is known about the environmental controls that impact various carbon fixation pathways. The overlap of limited microbial diversity with distinct habitat conditions in hydrothermal chimney walls provides an ideal setting to explore these relationships. Hydrothermal chimney walls from multiple structures recovered from the Juan de Fuca Ridge in the northeastern Pacific were sub-sampled and analyzed using PCR-based assays. Earlier work showed elevated microbial abundances in the outer portions of mature chimney walls, with varying ratios of Archaea to Bacteria from the outer to inner portions of the chimneys. Common phylotypes identified in these regions included Epsilonproteobacteria, Gammaproteobacteria, and Desulfurococcales. Total genomic DNA was extracted from mineralogically distinct niches within these structures and queried for genes coding key regulatory enzymes for each of the well studied carbon fixation pathways. Preliminary results show the occurrence of genes representing rTCA cycle (aclB) and methyl coenzyme A reductase (mcrA) - a proxy for the Reductive Acetyl-CoA Pathway within interior portion of mature hydrothermal chimneys. Ongoing analyses are aimed at quantifying the abundances of these diagnostic carbon fixation genes within the hydrothermal chimney gradients. These data are being compared to a broad array of contextual data to provide insight into the environmental and biological controls that may impact the distribution of the various carbon fixation pathways. Application of genomic approaches to the hydrothermal chimney ecosystem will provide insight into the microbial ecology of such structures and refine our ability to measure autotrophy in hydrothermal habitats sustained by chemical energy.

Blumenfeld, H. N.; Kelley, D. S.; Girguis, P. R.; Schrenk, M. O.

2010-12-01

31

Mechanism of biological nitrogen fixation. VIII. Carbon monoxide as an inhibitor for nitrogen fixation by red clover  

Microsoft Academic Search

Evidence from experiments in which total nitrogen was estimated, as well as others in which the rate of fixation was measured, shows that the uptake of free nitrogen by inoculated red clover plants is inhibited by as little as 0.01% carbon monoxide. The fixation process is practically stopped by 0.05% carbon monoxide. In this range of pCO, no effect on

Charles J. Lind; P. W. Wilson

1941-01-01

32

Carbohydrate metabolism and carbon fixation in Roseobacter denitrificans OCh114.  

PubMed

The Roseobacter clade of aerobic marine proteobacteria, which compose 10-25% of the total marine bacterial community, has been reported to fix CO(2), although it has not been determined what pathway is involved. In this study, we report the first metabolic studies on carbohydrate utilization, CO(2) assimilation, and amino acid biosynthesis in the phototrophic Roseobacter clade bacterium Roseobacter denitrificans OCh114. We develop a new minimal medium containing defined carbon source(s), in which the requirements of yeast extract reported previously for the growth of R. denitrificans can be replaced by vitamin B(12) (cyanocobalamin). Tracer experiments were carried out in R. denitrificans grown in a newly developed minimal medium containing isotopically labeled pyruvate, glucose or bicarbonate as a single carbon source or in combination. Through measurements of (13)C-isotopomer labeling patterns in protein-derived amino acids, gene expression profiles, and enzymatic activity assays, we report that: (1) R. denitrificans uses the anaplerotic pathways mainly via the malic enzyme to fix 10-15% of protein carbon from CO(2); (2) R. denitrificans employs the Entner-Doudoroff (ED) pathway for carbohydrate metabolism and the non-oxidative pentose phosphate pathway for the biosynthesis of histidine, ATP, and coenzymes; (3) the Embden-Meyerhof-Parnas (EMP, glycolysis) pathway is not active and the enzymatic activity of 6-phosphofructokinase (PFK) cannot be detected in R. denitrificans; and (4) isoleucine can be synthesized from both threonine-dependent (20% total flux) and citramalate-dependent (80% total flux) pathways using pyruvate as the sole carbon source. PMID:19794911

Tang, Kuo-Hsiang; Feng, Xueyang; Tang, Yinjie J; Blankenship, Robert E

2009-10-01

33

Variations in short term products of inorganic carbon fixation in exponential and stationary phase cultures of Aphanocapsa 6308.  

PubMed

Aphanocapsa 6308 metabolizes both NaHCO3 and Na2CO3. The short term incorporation (5-s) metabolic pattern and the patterns of incorporation of bicarbonate for exponential versus stationary phase cultures differ, however. Cells were equilibrated for 10 min in air and distilled water prior to injection of either NaH14CO3 at pH 8.0, or Na214CO3 at pH 11.0. Hot ethanol extracts were analyzed via paper chromatography and autoradiography for products of CO2 fixation. At 5 s, malate (51.5%) predominates slightly as a primary bicarbonate fixation product over 3-phosphoglycerate (40.3%); 3-phosphoglycerate is the primary product of carbonate fixation. At 60 s, the carbonate and bicarbonate labelling patterns are similar. Cells in stationary phase fix in 5 s a greater proportion of bicarbonate into malate (36% vs. 14% for 3-phosphoglycerate) than do cells in exponential growth. Likewise, 60 s incorporations show a large amount of bicarbonate fixed into aspartate (30.9%) in stationary phase cells over that of exponential phase (11.6%). These data suggest an operative C4 pathway for purposes not related to carbohydrate synthesis but rather as compensation for the incomplete tricarboxylic acid cycle in cyanobacteria. The enhancement of both aspartate fixation and CO2 fixation into citrulline in stationary phase correlates with an increase in cyanophycin granule production which requires both aspartate and arginine. PMID:417691

Weathers, P J; Allen, M M

1978-03-01

34

Recovering of carbon fixation in a eucalyptus site after felling  

NASA Astrophysics Data System (ADS)

Espirra site (38°38'N,8°36'W) is located in a 300ha Eucalyptus globulus plantation, with a Mediterranean type climate with a mean annual precipitation of 709mm and a mean annual air temperature of 15.9°C. The plantation was established in 1986 with about 1100 trees ha-1. A 33m observation tower was installed in 2002, with an ultrasonic Gill anemometer R2, an open path analyzer IRGA LI-7500 and a microclimate unit at its top. A harvesting of trees was made at the end of the 2nd rotation period, from November to December 2006. During the last four years of the second rotation the coppice were 20m height. Harvesting was planned in order to initiate a new 12 year productive cycle. In October 2008 a first thinning was made in three fourths of emerging stems from stumps. At this stage the forest trees had a mean height of 6m. For the 2002-2006 period, mean annual values of carbon net ecosystem exchange (NEE), gross production(GPP) and ecosystem respiration(Reco) were -533.3 gCm-2, 1628.6 gCm-2 and 1095.2 gCm-2. Seasonal patterns of carbon fixation for the five years showed a decrease in July-August periods due to highest air temperatures, atmospheric water vapour deficits and stomata partial closure to prevent water transpiration losses. For the period 2002-2006, the dry year of 2005 with a precipitation of about 390 mm, corresponded to the smaller carbon fixation of 390 gCm-2. Similarly, values of Reco, GPP and estimated leaf area index (less than three) were also minimal in 2005. Water use efficiency, WUE (ratio GPP/precipitation) was maximum in summer periods and in driest years, reaching values of about 12g/L-1. Recovery of carbon sink capacity, after the felling, begun after August 2007. The 2007 and 2008 annual NEE values were respectively 105.8 gCm-2 and -35.78 gCm-2. This negative value of NEE for 2008 is indicative of a carbon sink recovery. Annual Reco values for 2007 and 2008 were respectively 1059.03 gCm-2 and 1148.21 gCm-2. For GPP the annual values of 2007 and 2008 were respectively 953.24 gCm-2 and 1148.10 gCm-2. After the felling, stems rapidly grew and monthly GPP increased from 32 gCm-2 to 114 gCm-2 from January to October 2007. In November and December 2007, GPP decreased as a consequence of less solar radiation and frost in the young plants. In 2008 monthly GPP increased again till September. In the last three months of 2008, GPP diminished as a consequence of lack of water loss by evapotranspiration and the thinning. The results showed a chronological tendency for carbon fixation of the eucalyptus site according to physiological status of plants, concerning age and physical environmental factors.

Rodrigues, A. M.; Pita, G. P. A.; Mateus, A.; Santos Pereira, J.

2009-04-01

35

A Simple Demonstration of Carbon Dioxide Fixation and Acid Production in CAM Plants  

ERIC Educational Resources Information Center

|Described is an experiment investigating carbon dioxide fixation in the dark and the diurnal rhythm of acid production in plants exhibiting Crassulacean Acid Metabolism. Included are suggestions for four further investigations. (SL)|

Walker, John R. L.; McWha, James A.

1976-01-01

36

Model of carbon fixation in microbial mats from 3,500 Myr ago to the present  

Microsoft Academic Search

BIOLOGICAL carbon fixation is an important part of global carbon cycling and ecology. Fixation that took place 3,500 million years ago is recorded in the laminated sedimentary rock structures known as stromatolites, which are fossilized remains of microbial mat communities1-4. Stromatolites are the most abundant type of fossil found in the Proterozoic (2,500 to 590 Myr ago), but they then

Lynn J. Rothschild; Rocco L. Mancinelli

1990-01-01

37

Model of carbon fixation in microbial mats from 3,500 Myr ago to the present.  

PubMed

Biological carbon fixation is an important part of global carbon cycling and ecology. Fixation that took place 3,500 million years ago is recorded in the laminated sedimentary rock structures known as stromatolites, which are fossilized remains of microbial mat communities. Stromatolites are the most abundant type of fossil found in the Proterozoic (2,500 to 590 Myr ago), but they then declined, possibly because of predation and competition. Using modern microbial mats as analogues for ancient stromatolites, we show that the rate of carbon fixation is higher at the greater levels of atmospheric CO2 that were probably present in the past. We suggest that carbon fixation in microbial mats was not carbon-limited during the early Precambrian, but became carbon-limited as the supply of inorganic carbon decreased. Carbon limitation led to a lower rate of carbon fixation, especially towards the end of the Precambrian. Thus, another reason for the decline of the stromatolites could have been a decrease in available CO2. PMID:11536465

Rothschild, L J; Mancinelli, R L

1990-06-21

38

Effects of Organic Carbon/Carbonate Burial Ratios and Biological Carbon Fixation on the Global Carbon Cycle Over the Past ~200 myr  

NASA Astrophysics Data System (ADS)

The isotopic composition of the global carbon reservoir integrates large kinetic fractionations from photosynthesis with small thermodynamic fractionations from carbonate precipitation. We present concordant ? 13C records of carbonates (? 13Ccarb) and organic matter (? 13Corg), along with new carbonate (Ccarb) and organic carbonate (Corg) fluxes for the past ˜205 myrs (Jurassic-Cenozoic) generated from bulk sediment samples from the Atlantic. The new ? 13Corg record greatly refines previous compilations (Hayes et al., 1999) by providing a sample resolution of ˜100-300 kyrs. Model simulations using these ? 13Ccarb and ? 13Corg data provide constraints on carbon sources (mantle and weathering) and sinks (carbonate and organic carbon sedimentation); comparisons with the flux records provide insight on the components of the geological carbon cycle. Stable isotope records indicate that long-term net depletion of 12C from mobile carbon reservoirs was a consequence of an organic carbon burial fraction increase of ˜0.05-0.1 that began in the Jurassic ( ˜200 Ma). Superimposed on the long-term trend are higher-order variations (5-10s of myrs) in ? 13Ccarb and ? 13Corg that show episodic intervals of elevated values. In contrast to paleoceanographic convention, organic carbon burial is often decoupled from global ? 13C variations on the 5-10s of myrs scale. Brief episodes of elevated Corg flux tend to occur near the onset and cessation of these intervals of elevated ? 13Ccarb and ? 13Corg values; prolonged episodes of elevated Ccarb flux tend to correspond to the cessation of extended intervals of elevated ? 13C values. In the latter part of the Cenozoic, the development of ? carboxylation and C4 photosynthetic pathways in phytoplankton and terrestrial plants increasingly influenced ? 13Corg, ultimately contributing to the reversal of the long-term trend in ? 13Ccarb. Thus, the geologic record of the global carbon cycle over the past 205 myr has been influenced by a combination of changes in carbonate burial, organic carbon burial, and biological fixation.

Katz, M. E.; Milligan, A. J.; Cramer, B. S.; Fennel, K.; Miller, K. G.; Wright, J. D.; Falkowski, P. G.

2004-12-01

39

Carbon monoxide inhibition of nitrogen fixation by Azotobacter  

Microsoft Academic Search

CO inhibition of nitrogen fixation by Azotobacter vinelandii has been established. Definite inhibition is observed when the CO concentration is 0.1-0.2%; it increases with the pCO until at 0.5-0.6% fixation is almost completely suppressed. This inhibition is comparable with that of inoculated red clover plants, but the quantity of CO required is about 10 times greater than for the symbiotic

C. J. Lind; P. W. Wilson

1942-01-01

40

The pattern of carbon fixation in the marine unicellular alga Phaeodactylum tricornutum  

Microsoft Academic Search

The short- and long-term fixation of 14CO2 by Phaeodactylum tricornutum was studied using methods of fractionation that allowed examination of all the products labelled with 14C. There was no doubt that the major pathway of CO2 fixation was into 3-phosphoglycerate, but there was also significant incorporation by ß-carboxylation by means of phosphoenol-pyruvate carboxylase and transamination into aspartate. At short time

E. S. Holdsworth; J. Colbeck

1976-01-01

41

Differences in the pH Optimum of the Photosynthetic Fixation of Carbon Dioxide in Isolated Whole and Broken Chloroplasts  

Microsoft Academic Search

RECENTLY, Gibbs et al.1-4 emphasized the differences between whole and broken chloroplasts regarding their sensitivity against inhibitors during fixation of carbon dioxide and the distribution of carbon-14 in the sugars so formed. In our experiments an additional difference, the markedly lower pH optimum of fixation of carbon dioxide in whole chloroplasts, as compared with broken chloroplasts, was observed.

Helmut Elbertzhagen; Otto Kandler

1962-01-01

42

Nitrate uptake in marine phytoplankton: Energy sources and the interaction with carbon fixation  

Microsoft Academic Search

Field studies of whole natural phytoplankton communities from Knight Inlet, B. C., Canada and laboratory cultures of the diatom Skeletonema costatum indicate inorganic carbon fixation may be temporarily suppressed following 10 to 15% enrichment with NO3-or NH4+. (This effect is suggested to be due to competition between inorganic carbon and nitrogen for adenosine triphosphate (ATP), and is reduced when chlorophyll

P. G. Falkowski; D. P. Stone

1975-01-01

43

Photochemical Reduction of Pyridine Nucleotides by Spinach Grana and Coupled Carbon Dioxide Fixation  

Microsoft Academic Search

HIGHLY purified `malic' enzyme from pigeon's liver1 mediates a fixation of carbon dioxide through catalysis of reaction (1). When, by coupling with a suitable dehydrogenase system, triphosphopyridine nucleotide is continuously reconverted to its reduced form, malate is readily synthesized from pyruvate and carbon dioxide2. Should illuminated chloroplast preparations be able to effect a reduction of pyridine nucleotides, then the photochemical

Wolf Vishniac; Severo Ochoa

1951-01-01

44

Transgenic approaches to manipulate the environmental responses of the C3 carbon fixation cycle.  

PubMed

The limitation to photosynthetic CO2 assimilation in C3 plants in hot, dry environments is dominated by ribulose 1.5-bisphosphate carboxylase/oxygenase (Rubisco) because CO2 availability is restricted and photorespiration is stimulated. Using a combination of genetic engineering and transgenic technology, three approaches to reduce photorespiration have been taken; two of these focused on increasing the carboxylation efficiency of Rubisco either by reducing the oxygenase reaction directly or by manipulating the Rubisco enzyme by concentrating CO2 in the region of Rubisco through the introduction of enzymes of the C4 pathway. The third approach attempted to reduce photorespiration directly by manipulation of enzymes in this pathway. The progress in each of these areas is discussed, and the most promising approaches are highlighted. Under saturating CO2 conditions, Rubisco did not limit photosynthesis, and limitation shifted to ribulose bisphosphate (RuBP) regeneration capacity of the C3 cycle. Transgenic analysis was used to identify the specific enzymes that may be targets for improving carbon fixation, and the way this may be exploited in the high CO2 future is considered. PMID:17080589

Raines, Christine A

2006-03-01

45

[Regulation of alternative CO[sub 2] fixation pathways in procaryotic and eucaryotic photosynthetic organisms  

SciTech Connect

The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.

Not Available

1992-01-01

46

Single cell protein production of Euglena gracilis and carbon dioxide fixation in an innovative photo-bioreactor  

Microsoft Academic Search

The biological fixation using microalgae has been known as an effective and economical carbon dioxide reduction technology. Carbon dioxide (CO2) fixation by microalgae has been shown to be effective and economical. Among various algae, a species Euglena gracilis was selected as it has advantages such as high protein content and high digestibility for animal feed. A kinetic model was studied

S. R. Chae; E. J. Hwang; H. S. Shin

2006-01-01

47

Photosynthesis, dark respiration and light independent carbon fixation of endemic Antarctic macroalgae  

Microsoft Academic Search

The light saturated photosynthesis, dark respiration and light independent carbon fixation of macroalgal species endemic to the Antarctic were measured. Five brown algae. Ascoseira mirabilis, Desmarestia anceps, D. antarctica, Phaeurus antarcticus, Himantothallus grandifolius and the red alga Palmaria decipiens were included. Rates of these three parameters at 0°C were very similar to those measured in other studies on temperate algae

D. N. Thomas; C. Wiencke

1991-01-01

48

Trinuclear zinc complexes for biologically relevant ?3-oxoanion binding and carbon dioxide fixation.  

PubMed

Tremendous efforts have been made to model multinuclear zinc enzymes. Despite such efforts, it remains a challenge to design single molecules that stabilize ?3-oxoanion-bridged trinuclear zinc cores as analogues of enzymatic active sites. The conversion of carbon dioxide to carbonates is a biological process mediated by carbonic anhydrases and a natural process for large-scale carbon dioxide fixation. Here we report a trinuclear zinc scaffold for capturing biologically relevant ?3-oxoanions, such as phosphate and carbonate, and its ability to catalytically convert carbon dioxide to carbonates. Structurally characterized {Zn3(?3-PO4)} and {Zn3(?3-CO3)} cores are observed in solution by nuclear magnetic resonance and high-resolution mass spectrometry. The activity of the ?3-carbonate unit can be sterically controlled, which makes the carbon dioxide fixation cycle feasible. Our results suggest that this trinuclear zinc scaffold catalytically converts carbon dioxide to carbonates under mild conditions and provides a good model for studying oxoanion-bridged zinc cores in solution. PMID:23982347

Liu, Xiao; Du, Pingwu; Cao, Rui

2013-08-28

49

Chemical fixation of carbon dioxide to cyclic carbonates under extremely mild conditions with highly active bifunctional catalysts  

Microsoft Academic Search

Chemical fixation of carbon dioxide to cyclic carbonates proceeds effectively under extremely mild temperature and pressure by using a bifunctional nucleophile–electrophile catalyst system of tetradentate Schiff-base aluminum complexes ((Salen)AlX) in conjunction with a quaternary ammonium salt (n-Bu4NY) in the absence of any organic solvent. Electrophilicity of central Al3+ ion and the steric factor of substituent groups on the aromatic rings

Xiao-Bing Lu; Ying-Ju Zhang; Bin Liang; Xiao Li; Hui Wang

2004-01-01

50

Carbon cost of plant nitrogen acquisition: A mechanistic, globally applicable model of plant nitrogen uptake, retranslocation, and fixation  

Microsoft Academic Search

Nitrogen (N) generally limits plant growth and controls biosphere responses to climate change. We introduce a new mathematical model of plant N acquisition, called Fixation and Uptake of Nitrogen (FUN), based on active and passive soil N uptake, leaf N retranslocation, and biological N fixation. This model is unified under the theoretical framework of carbon (C) cost economics, or resource

J. B. Fisher; S. Sitch; Y. Malhi; R. A. Fisher; C. Huntingford; S.-Y. Tan

2010-01-01

51

Carbon Dioxide Fixation by Detached Cereal Caryopses 1  

PubMed Central

Immature detached cereal caryopses from barley (Hordeum vulgare L. var distichum cv Midas) and wheat (Triticum aestivum L. cv Sicco) were shown to be capable of fixing externally supplied 14CO2 in the light or dark. Green cross cells and the testa contained the majority of the 14C-labeled material. Some 14C-labeled material was also found in the outer, or transparent, layer and in the endosperm/embryo fraction. More 14C was recovered from caryopses when they were incubated in 14CO2 without the transparent layer, thus suggesting that this layer is a barrier to the uptake of CO2. In all cases, significant amounts of 14C-labeled material were found in caryopses after dark incubation with 14CO2. Interestingly, CO2 fixation in the chlorophyll-less mutant Albino lemma was significantly greater in the light than in the dark. The results indicate that intact caryopses have the ability to translocate 14C-labeled assimilate derived from external CO2 to the endosperm/embryo. Carboxylating activity in the transparent layer appears to be confined to phosphoenolpyruvate carboxylase activity but that in the chloroplast-containing cross-cells may be accounted for by both ribulose-1,5-bisphosphate carboxylase-oxygenase and phosphoenolpyruvate carboxylase activity. Depending on a number of assumptions, the amount of CO2 fixed is sufficient to account for about 2% of the weight of starch found in the mature caryopsis.

Watson, Patricia A.; Duffus, Carol M.

1988-01-01

52

Carbon Dioxide Fixation in Malaria. Ii. Plasmodium Knowlesi (Monkey Malaria).  

National Technical Information Service (NTIS)

Plasmodium knowlesi-infected monkey erythrocytes fix more carbon dioxide than normal monkey red blood cells. Malaria-infected cells, incubated in the presence of NaHC14O3, show maximum amounts of radioactivity in aspartate, glutamate, lactate and citrate,...

I. W. Sherman I. P. Ting

1968-01-01

53

Carbohydrate Metabolism and Carbon Fixation in Roseobacter denitrificans OCh114  

Microsoft Academic Search

The Roseobacter clade of aerobic marine proteobacteria, which compose 10–25% of the total marine bacterial community, has been reported to fix CO2, although it has not been determined what pathway is involved. In this study, we report the first metabolic studies on carbohydrate utilization, CO2 assimilation, and amino acid biosynthesis in the phototrophic Roseobacter clade bacterium Roseobacter denitrificans OCh114. We

Kuo-Hsiang Tang; Xueyang Feng; Yinjie J. Tang; Robert E. Blankenship

2009-01-01

54

Carbon dioxide fixation by microalgae photosynthesis using actual flue gas discharged from a boiler  

Microsoft Academic Search

To mitigate the effects of carbon dioxide discharged from a boiler in a power plant, CO2 fixation by microalgae photosynthesis was studied. For the algae cultivation, actual flue gas from a boiler was used in two\\u000a sets of small-sized raceway-type cultivators installed at Tohoku Electric Power Company's Shin-Sendai power station. UsingNannochloropsis sp. NANNP-2 andPhaeodactylum sp. PHAEO-2 strains from the SERI

Masaaki Negoro; Akihiro Hamasaki; Yoshiaki Ikuta; Takenori Makita; Kohei Hirayama; Shinji Suzuki

1993-01-01

55

Carbon fixation and oxygen evolution by phytoplankton in the Canadian high arctic  

Microsoft Academic Search

In the Canadian high arctic, in summer, in situ profiles of oxygen evolution and carbon fixation by phytoplankton showed excellent qualitative and quantitative agreement with an apparent photosynthetic quotient in the range from 1.3 to 1.8. Water column photosynthesis was linear in the available light at the surface. Daily rates photosynthesis exceeded 1 mg C m-2 d-1, implying a minimal

Trevor Platt; William G. Harrison; Edward P. W. Horne; Brian Irwin

1987-01-01

56

Carbon dioxide fixation in the metabolism of propylene and propylene oxide by Xanthobacter strain Py2.  

PubMed Central

Evidence for a requirement for CO2 in the productive metabolism of aliphatic alkenes and epoxides by the propylene-oxidizing bacterium Xanthobacter strain Py2 is presented. In the absence of CO2, whole-cell suspensions of propylene-grown cells catalyzed the isomerization of propylene oxide (epoxypropane) to acetone. In the presence of CO2, no acetone was produced. Acetone was not metabolized by suspensions of propylene-grown cells, in either the absence or presence of CO2. The degradation of propylene and propylene oxide by propylene-grown cells supported the fixation of 14CO2 into cell material, and the time course of 14C fixation correlated with the time course of propylene and propylene oxide degradation. The degradation of glucose and propionaldehyde by propylene-grown or glucose-grown cells did not support significant 14CO2 fixation. With propylene oxide as the substrate, the concentration dependence of 14CO2 fixation exhibited saturation kinetics, and at saturation, 0.9 mol of CO2 was fixed per mol of propylene oxide consumed. Cultures grown with propylene in a nitrogen-deficient medium supplemented with NaH13CO3 specifically incorporated 13C label into the C-1 (major labeled position) and C-3 (minor labeled position) carbon atoms of the endogenous storage compound poly-beta-hydroxybutyrate. No specific label incorporation was observed when cells were cultured with glucose or n-propanol as a carbon source. The depletion of CO2 from cultures grown with propylene, but not glucose or n-propanol, inhibited bacterial growth. We propose that propylene oxide metabolism in Xanthobacter strain Py2 proceeds by terminal carboxylation of an isomerization intermediate, which, in the absence of CO2, is released as acetone.

Small, F J; Ensign, S A

1995-01-01

57

Kinetics and mechanistic analysis of an extremely rapid carbon dioxide fixation reaction  

PubMed Central

Carbon dioxide may react with free or metal-bound hydroxide to afford products containing bicarbonate or carbonate, often captured as ligands bridging two or three metal sites. We report the kinetics and probable mechanism of an extremely rapid fixation reaction mediated by a planar nickel complex [NiII(NNN)(OH)]1- containing a tridentate 2,6-pyridinedicarboxamidate pincer ligand and a terminal hydroxide ligand. The minimal generalized reaction is M-OH + CO2 ? M-OCO2H; with variant M, previous rate constants are ?103 M-1 s-1 in aqueous solution. For the present bimolecular reaction, the (extrapolated) rate constant is 9.5 × 105 M-1 s-1 in N,N?-dimethylformamide at 298 K, a value within the range of kcat/KM?105–108 M-1 s-1 for carbonic anhydrase, the most efficient catalyst of CO2 fixation reactions. The enthalpy profile of the fixation reaction was calculated by density functional theory. The initial event is the formation of a weak precursor complex between the Ni-OH group and CO2, followed by insertion of a CO2 oxygen atom into the Ni-OH bond to generate a four center Ni(?2-OCO2H) transition state similar to that at the zinc site in carbonic anhydrase. Thereafter, the Ni-OH bond detaches to afford the Ni(?1-OCO2H) fragment, after which the molecule passes through a second, lower energy transition state as the bicarbonate ligand rearranges to a conformation very similar to that in the crystalline product. Theoretical values of metric parameters and activation enthalpy are in good agreement with experimental values [?H‡ = 3.2(5) kcal/mol].

Huang, Deguang; Makhlynets, Olga V.; Tan, Lay Ling; Lee, Sonny C.; Rybak-Akimova, Elena V.; Holm, R. H.

2011-01-01

58

Assessment of carbon fibre composite fracture fixation plate using finite element analysis.  

PubMed

In the internal fixation of fractured bone by means of bone-plates fastened to the bone on its tensile surface, an on-going concern has been the excessive stress shielding of the bone by the excessively-stiff stainless-steel plate. The compressive stress shielding at the fracture-interface immediately after fracture-fixation delays callus formation and bone healing. Likewise, the tensile stress shielding in the layer of bone underneath the plate can cause osteoporosis and decrease in tensile strength of this layer. In this study a novel forearm internal fracture fixation plate made from short carbon fibre reinforced plastic (CFRP) was used in an attempt to address the problem. Accordingly, it has been possible to analyse the stress distribution in the composite plates using finite-element modelling. A three-dimensional, quarter-symmetric finite element model was generated for the plate system. The stress state in the underlying bone was examined for several loading conditions. Based on the analytical results the composite plate system is likely to reduce stress-shielding effects at the fracture site when subjected to bending and torsional loads. The design of the plate was further optimised by reducing the width around the innermost holes. PMID:16732432

Saidpour, Seyed H

2006-05-27

59

Study of Plant Bioelectric Potential Response due to Photochemical Reaction and Carbon-fixation Reaction in Photosynthetic Process  

NASA Astrophysics Data System (ADS)

We focused on measurement of the bioelectric potential as a method of evaluating plant activities and supporting effective cultivation. In this study, we researched on the bioelectric potential response due to photochemical reaction and carbon-fixation reaction in the process of photosynthesis. At first, we measured the bioelectric potential when illumination started and stopped, under N2 gas condition for suppressing carbon-fixation reaction and respiration. In the result, amplitude of the potential response related to illumination intensity and wave length. We considered that the amplitude of potential response in N2 condition indicated activity of photochemical reaction. Based on this result, we investigated the potential response in room air condition. If carbon-fixation reaction was deactivated by long dark period, significant potential decrease was observed when illumination started. In contrast, if carbon-fixation reaction kept active during short dark period, potential decrease was slight or none regardless of photosynthetic rate. Therefore, we considered that this potential decrease related to activation of carbon-fixation reaction. Next, we researched on relationship between plant activities and the potential response when illumination stopped. The result shows that amplitude of the response related to illumination intensity and respiration rate. We conclude that plant activities such as photosynthesis can be evaluated in more detail by measurement of the bioelectric potential with applying this study.

Ando, Ki; Hasegawa, Yuki; Yaji, Tamaki; Uchida, Hidekazu

60

Volatile organic compound emissions in relation to plant carbon fixation and the terrestrial carbon budget  

Microsoft Academic Search

A substantial amount of carbon is emitted by terrestrial vegetation as biogenic volatile organic compounds (VOC), which contributes to the oxidative capacity of the atmosphere, to particle production and to the carbon cycle. With regard to the carbon budget of the terrestrial biosphere, a release of these carbon compounds is regarded as a loss of photosynthetically fixed carbon. The significance

Jürgen Kesselmeier; Paolo Ciccioli; Uwe Kuhn; Paolo Stefani; Thomas Biesenthal; Stefanie Rottenberger; Annette Wolf; Marina Vitullo; Ricardo Valentini; Antonio Nobre; Pavel Kabat; Meinrat O. Andreae

2002-01-01

61

PH-NEUTRAL CONCRETE FOR ATTACHED MICROALGAE AND ENHANCED CARBON DIOXIDE FIXATION - PHASE I  

SciTech Connect

The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SC-CO {sub 2})-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resistance) cement-based products. SC-CO{sub 2} can rapidly convert the calcium hydroxide in cured cement to calcium carbonate, which increases the density and unconfined compressive strength in the treated region. In cured concrete, this treated region is typically a several-mm thick layer (generally <{approx}5mm, unless treatment time is excessive). However, we have found that by treating the entire cement matrix with SC-CO{sub 2} as part of the curing process, we can carbonate it rapidly, regardless of the thickness. By ''rapidly'' we mean simultaneous carbonation/curing in < 5 ks even for large cement forms, compared to typical carbonation times of several days or even years at low pressures. Carbonation changes the pH in the treated region from {approx}13 to {approx}8, almost exactly compatible with seawater. Therefore the leaching rates from these cements is reduced. These cement improvements are directed to the development of strong but thin artificial reefs, to which can be attached microalgae used for the enhanced fixation of CO{sub 2}. It is shown below that attached microalgae, as algal beds or reefs, are more efficient for CO{sub 2} fixation by a factor of 20, compared to the open ocean on an area basis. We have performed preliminary tests of the pH-neutral cements of our invention for attachment of microalgae populations. We have found pH-neutral materials which attach microalgae readily. These include silica-enriched (pozzolanic) cements, blast-furnace slags and fly ash, which are also silica-rich. We have already developed technology to simultaneously foam, carbonate and cure the cements; this foaming process further increases cement surface areas for microalgae attachment, in some cases to >10 m{sup 2}/g internal surface area. This project involves a team of researchers with backgrounds in cement technology, supercritical fluid technology, materials science, oceanography, and wetland biogeochemistry.

Kerry M. Dooley; F. Carl Knopf; Robert P. Gambrell

1999-05-31

62

[Regulation of alternative CO{sub 2} fixation pathways in procaryotic and eucaryotic photosynthetic organisms]. Progress report  

SciTech Connect

The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.

Not Available

1992-12-31

63

Ecological Aspects of the Distribution of Different Autotrophic CO2 Fixation Pathways?  

PubMed Central

Autotrophic CO2 fixation represents the most important biosynthetic process in biology. Besides the well-known Calvin-Benson cycle, five other totally different autotrophic mechanisms are known today. This minireview discusses the factors determining their distribution. As will be made clear, the observed diversity reflects the variety of the organisms and the ecological niches existing in nature.

Berg, Ivan A.

2011-01-01

64

Predicting the Electron Requirement for Carbon Fixation in Seas and Oceans  

PubMed Central

Marine phytoplankton account for about 50% of all global net primary productivity (NPP). Active fluorometry, mainly Fast Repetition Rate fluorometry (FRRf), has been advocated as means of providing high resolution estimates of NPP. However, not measuring CO2-fixation directly, FRRf instead provides photosynthetic quantum efficiency estimates from which electron transfer rates (ETR) and ultimately CO2-fixation rates can be derived. Consequently, conversions of ETRs to CO2-fixation requires knowledge of the electron requirement for carbon fixation (?e,C, ETR/CO2 uptake rate) and its dependence on environmental gradients. Such knowledge is critical for large scale implementation of active fluorescence to better characterise CO2-uptake. Here we examine the variability of experimentally determined ?e,C values in relation to key environmental variables with the aim of developing new working algorithms for the calculation of ?e,C from environmental variables. Coincident FRRf and 14C-uptake and environmental data from 14 studies covering 12 marine regions were analysed via a meta-analytical, non-parametric, multivariate approach. Combining all studies, ?e,C varied between 1.15 and 54.2 mol e? (mol C)?1 with a mean of 10.9±6.91 mol e? mol C)?1. Although variability of ?e,C was related to environmental gradients at global scales, region-specific analyses provided far improved predictive capability. However, use of regional ?e,C algorithms requires objective means of defining regions of interest, which remains challenging. Considering individual studies and specific small-scale regions, temperature, nutrient and light availability were correlated with ?e,C albeit to varying degrees and depending on the study/region and the composition of the extant phytoplankton community. At the level of large biogeographic regions and distinct water masses, ?e,C was related to nutrient availability, chlorophyll, as well as temperature and/or salinity in most regions, while light availability was also important in Baltic Sea and shelf waters. The novel ?e,C algorithms provide a major step forward for widespread fluorometry-based NPP estimates and highlight the need for further studying the natural variability of ?e,C to verify and develop algorithms with improved accuracy.

Lawrenz, Evelyn; Silsbe, Greg; Capuzzo, Elisa; Ylostalo, Pasi; Forster, Rodney M.; Simis, Stefan G. H.; Prasil, Ondrej; Kromkamp, Jacco C.; Hickman, Anna E.; Moore, C. Mark; Forget, Marie-Helen; Geider, Richard J.; Suggett, David J.

2013-01-01

65

Assaying the catalytic potential of transition metal sulfides for abiotic carbon fixation  

NASA Astrophysics Data System (ADS)

A suite of nickel, cobalt, iron, copper, and zinc containing sulfides are assayed for the promotion of a model carbon fixation reaction with relevance to local reducing environments of the early Earth. The assay tests the promotion of hydrocarboxylation (the Koch reaction) wherein a carboxylic acid is synthesized via carbonyl insertion at a metal-sulfide-bound alkyl group. The experimental conditions are chosen for optimal assay, i.e., high reactant concentrations and pressures (200 MPa) to enhance chemisorption, and high temperature (250°C) to enhance reaction kinetics. All of the metal sulfides studied, with the exception CuS, promote hydrocarboxylation. Two other significant reactions involve the catalytic reduction of CO to form a surface-bound methyl group, detected after nucleophilic attack by nonane thiol to form methyl nonyl sulfide, and the formation of dinonyl sulfide via a similar reaction. Estimation of the catalytic turnover frequencies for each of the metal sulfides with respect to each of the primary reactions reveals that NiS, Ni 3S 2, and CoS perform comparably to commonly employed industrial catalysts. A positive correlation between the yield of primary product to NiS and Ni 3S 2 surface areas provides strong evidence that the reactions are surface catalytic in these cases. The sulfides FeS and Fe (1-x)S are unique in that they exhibit evidence of extensive dissolution, thus, complicating interpretation regarding heterogeneous vs. homogeneous catalysis. With the exception of CuS, each of the metal sulfides promotes reactions that mimic key intermediate steps manifest in the mechanistic details of an important autotrophic enzyme, acetyl-CoA synthase. The relatively high temperatures chosen for assaying purposes, however, are incompatible with the accumulation of thioesters. The results of this study support the hypothesis that transition metal sulfides may have provided useful catalytic functionality for geochemical carbon fixation in a prebiotic world (at least intially) devoid of peptide-based enzymes.

Cody, G. D.; Boctor, N. Z.; Brandes, J. A.; Filley, T. R.; Hazen, R. M.; Yoder, H. S.

2004-05-01

66

The Majority of Free-Living Autotrophic Bacteria use the Reductive TCA Cycle for Carbon Fixation at Deep-Sea Hydrothermal Vents  

NASA Astrophysics Data System (ADS)

Deep-sea hydrothermal vents support large micro and macroscopic communities, without the input of photosynthesis. Autotrophic production at these vents is based on hydrothermal vent fluid chemistry. Primary production has been thought to occur mainly via hydrogen sulfide oxidation through the Calvin-Benson pathway, as measured by the presence of Rubisco in endosymbionts of several invertebrate hosts. Recently, we characterized two fosmids from a large insert library of the epsilon Proteobacterial episymbionts of Alvinella pompejana. Both contained sequences encoding ATP citrate lyase, a key enzyme in the reverse TCA cycle, an alternate carbon dioxide fixation pathway. Previous investigators have demonstrated the dominance of the epsilon subdivision in the free-living bacterial communities at hydrothermal vents. Based on these results, our working hypothesis is: The rTCA cycle is the dominant pathway for carbon fixation in the free-living bacterial communities at hydrothermal vents. A selection of free-living bacterial communities from various geographic locations (9N, East Pacific Rise and Guaymas Basin) were screened for the presence, diversity and expression (via RT-PCR) of Rubisco (forms I and II) and ATP citrate lyase. Our results indicate that the ATP citrate lyase gene is diverse and is consistently expressed in several types of vent communities. The two forms of Rubisco are not consistently present or expressed in the same environments. These results indicate that chemoautotrophic production in the free-living bacterial communities at deep-sea hydrothermal vents is dominated by bacteria that utilize the rTCA cycle, and parallels the phylogenetic dominance of members of the epsilon subdivision of Proteobacteria.

Campbell, B. J.; Cary, C.

2003-12-01

67

The relationship between carbon dioxide fixation and chlorophyll a fluorescence during induction of photosynthesis in maize leaves at different temperatures and carbon dioxide concentrations  

Microsoft Academic Search

The rate of CO2 fixation (Fc) and 680 nm chlorophyll fluorescence emission (F680) were measured simultaneously during induction of photosynthesis in Zea mays L. leaves under varying experimental conditions in order to assess the validity of fluorescence as an indicator of in vivo photosynthetic carbon assimilation. Z. mays leaves showed typical ‘Kautsky’ fluorescence induction curves consisting of a fast rise

C. R. Ireland; S. P. Long; N. R. Baker

1984-01-01

68

Establishment of microbial eukaryotic enrichment cultures from a chemically stratified antarctic lake and assessment of carbon fixation potential.  

PubMed

Lake Bonney is one of numerous permanently ice-covered lakes located in the McMurdo Dry Valleys, Antarctica. The perennial ice cover maintains a chemically stratified water column and unlike other inland bodies of water, largely prevents external input of carbon and nutrients from streams. Biota are exposed to numerous environmental stresses, including year-round severe nutrient deficiency, low temperatures, extreme shade, hypersalinity, and 24-hour darkness during the winter (1). These extreme environmental conditions limit the biota in Lake Bonney almost exclusively to microorganisms (2). Single-celled microbial eukaryotes (called "protists") are important players in global biogeochemical cycling (3) and play important ecological roles in the cycling of carbon in the dry valley lakes, occupying both primary and tertiary roles in the aquatic food web. In the dry valley aquatic food web, protists that fix inorganic carbon (autotrophy) are the major producers of organic carbon for organotrophic organisms (4, 2). Phagotrophic or heterotrophic protists capable of ingesting bacteria and smaller protists act as the top predators in the food web (5). Last, an unknown proportion of the protist population is capable of combined mixotrophic metabolism (6, 7). Mixotrophy in protists involves the ability to combine photosynthetic capability with phagotrophic ingestion of prey microorganisms. This form of mixotrophy differs from mixotrophic metabolism in bacterial species, which generally involves uptake dissolved carbon molecules. There are currently very few protist isolates from permanently ice-capped polar lakes, and studies of protist diversity and ecology in this extreme environment have been limited (8, 4, 9, 10, 5). A better understanding of protist metabolic versatility in the simple dry valley lake food web will aid in the development of models for the role of protists in the global carbon cycle. We employed an enrichment culture approach to isolate potentially phototrophic and mixotrophic protists from Lake Bonney. Sampling depths in the water column were chosen based on the location of primary production maxima and protist phylogenetic diversity (4, 11), as well as variability in major abiotic factors affecting protist trophic modes: shallow sampling depths are limited for major nutrients, while deeper sampling depths are limited by light availability. In addition, lake water samples were supplemented with multiple types of growth media to promote the growth of a variety of phototrophic organisms. RubisCO catalyzes the rate limiting step in the Calvin Benson Bassham (CBB) cycle, the major pathway by which autotrophic organisms fix inorganic carbon and provide organic carbon for higher trophic levels in aquatic and terrestrial food webs (12). In this study, we applied a radioisotope assay modified for filtered samples (13) to monitor maximum carboxylase activity as a proxy for carbon fixation potential and metabolic versatility in the Lake Bonney enrichment cultures. PMID:22546995

Dolhi, Jenna M; Ketchum, Nicholas; Morgan-Kiss, Rachael M

2012-04-20

69

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5?-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.  

PubMed Central

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5?- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

2013-01-01

70

Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.  

PubMed

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae. PMID:23585853

Kuo, Rita C; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

2013-04-09

71

Study of the carbon dioxide chemical fixation—activation by guanidines  

Microsoft Academic Search

Fixation of CO2 is one of the most important priorities of the scientific community dedicated to reduce global warming. In this work, we propose new methods for the fixation of CO2 using the guanidine bases tetramethylguanidine (TMG) and 1,3,4,6,7,8-hexahydro-2H-pyrimido[1,2-a]-pyrimidine (TBD). In order to understand the reactions occurring during the CO2 fixation and release processes, we employed several experimental methods, including

Fernanda Stuani Pereira; Eduardo Ribeiro deAzevedo; Eirik F. da Silva; Tito José Bonagamba; Deuber L. da Silva Agostíni; Alviclér Magalhães; Aldo Eloizo Job; Eduardo R. Pérez González

2008-01-01

72

A comparative study of the diurnal carbon fixation patterns of nannoplankton and net plankton  

Microsoft Academic Search

Autoradiographs of nannoplankton show high photosynthetic fixation rates relative to net plankton during early daylight hours. However, net plankton contribute increasingly to community fixation during the afternoon and early evening. During darkness nannoplank- ton show losses of fixed 14C greatly exceeding those from net plankton. This lack of uni- formity in (14C)C02 fixation and losses will affect the short term

HANS W. PAERL; LINCOLN A. MACKENZIE

1977-01-01

73

Carbon dioxide fixation by epidermal and mesophyll tissues of Tulipa and Commelina  

Microsoft Academic Search

Rates of 14CO2 fixation by epidermal tissue of Tulipa gesneriana (tulip) and Commelina diffusa are only slightly higher in the light than in the dark while in mesophyl tissues rates are much greater in the light. The first products of 14CO2 fixation by epidermal tissue of Tulipa gesneriana and C. diffusa in the light and dark are malate and aspartate.

C. M. Willmer; P. Dittrich

1974-01-01

74

Greater efficiency of photosynthetic carbon fixation due to single amino-acid substitution  

PubMed Central

The C4-photosynthetic carbon cycle is an elaborated addition to the classical C3-photosynthetic pathway, which improves solar conversion efficiency. The key enzyme in this pathway, phosphoenolpyruvate carboxylase, has evolved from an ancestral non-photosynthetic C3 phosphoenolpyruvate carboxylase. During evolution, C4 phosphoenolpyruvate carboxylase has increased its kinetic efficiency and reduced its sensitivity towards the feedback inhibitors malate and aspartate. An open question is the molecular basis of the shift in inhibitor tolerance. Here we show that a single-point mutation is sufficient to account for the drastic differences between the inhibitor tolerances of C3 and C4 phosphoenolpyruvate carboxylases. We solved high-resolution X-ray crystal structures of a C3 phosphoenolpyruvate carboxylase and a closely related C4 phosphoenolpyruvate carboxylase. The comparison of both structures revealed that Arg884 supports tight inhibitor binding in the C3-type enzyme. In the C4 phosphoenolpyruvate carboxylase isoform, this arginine is replaced by glycine. The substitution reduces inhibitor affinity and enables the enzyme to participate in the C4 photosynthesis pathway.

Paulus, Judith Katharina; Schlieper, Daniel; Groth, Georg

2013-01-01

75

Greater efficiency of photosynthetic carbon fixation due to single amino-acid substitution.  

PubMed

The C4-photosynthetic carbon cycle is an elaborated addition to the classical C3-photosynthetic pathway, which improves solar conversion efficiency. The key enzyme in this pathway, phosphoenolpyruvate carboxylase, has evolved from an ancestral non-photosynthetic C3 phosphoenolpyruvate carboxylase. During evolution, C4 phosphoenolpyruvate carboxylase has increased its kinetic efficiency and reduced its sensitivity towards the feedback inhibitors malate and aspartate. An open question is the molecular basis of the shift in inhibitor tolerance. Here we show that a single-point mutation is sufficient to account for the drastic differences between the inhibitor tolerances of C3 and C4 phosphoenolpyruvate carboxylases. We solved high-resolution X-ray crystal structures of a C3 phosphoenolpyruvate carboxylase and a closely related C4 phosphoenolpyruvate carboxylase. The comparison of both structures revealed that Arg884 supports tight inhibitor binding in the C3-type enzyme. In the C4 phosphoenolpyruvate carboxylase isoform, this arginine is replaced by glycine. The substitution reduces inhibitor affinity and enables the enzyme to participate in the C4 photosynthesis pathway. PMID:23443546

Paulus, Judith Katharina; Schlieper, Daniel; Groth, Georg

2013-01-01

76

Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L  

Microsoft Academic Search

Activities of key enzymes of the Calvin cycle and Câ metabolism, rates of COâ fixation, and the initial products of photosynthetic ¹⁴COâ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and

H. R. Singal; I. S. Sheoran; R. Singh

1987-01-01

77

Enhancing Carbon Fixation by Metabolic Engineering: A Model System of Complex Network Modulation  

SciTech Connect

In the first two years of this research we focused on the development of a DNA microarray for transcriptional studies in the photosynthetic organism Synechocystis and the elucidation of the metabolic pathway for biopolymer synthesis in this organism. In addition we also advanced the molecular biological tools for metabolic engineering of biopolymer synthesis in Synechocystis and initiated a series of physiological studies for the elucidation of the carbon fixing pathways and basic central carbon metabolism of these organisms. During the last two-year period we focused our attention on the continuation and completion of the last task, namely, the development of tools for basic investigations of the physiology of these cells through, primarily, the determination of their metabolic fluxes. The reason for this decision lies in the importance of fluxes as key indicators of physiology and the high level of information content they carry in terms of identifying rate limiting steps in a metabolic pathway. While flux determination is a well-advanced subject for heterotrophic organisms, for the case of autotrophic bacteria, like Synechocystis, some special challenges had to be overcome. These challenges stem mostly from the fact that if one uses {sup 13}C labeled CO{sub 2} for flux determination, the {sup 13}C label will mark, at steady state, all carbon atoms of all cellular metabolites, thus eliminating the necessary differentiation required for flux determination. This peculiarity of autotrophic organisms makes it imperative to carry out flux determination under transient conditions, something that had not been accomplished before. We are pleased to report that we have solved this problem and we are now able to determine fluxes in photosynthetic organisms from stable isotope labeling experiments followed by measurements of label enrichment in cellular metabolites using Gas Chromatography-Mass Spectrometry. We have conducted extensive simulations to test the method and also are presently validating it experimentally using data generated in collaboration with a research group at Purdue University. As result of these studies we can now determine, for the first time, fluxes in photosynthetic organisms and, eventually, in plants.

Dr. Gregory Stephanopoulos

2008-04-10

78

Oxygen-18 incorporation into malic acid during nocturnal carbon dioxide fixation in crassulacean acid metabolism plants. A new approach to estimating in vivo carbonic anhydrase activity.  

PubMed

Crassulacean acid metabolism (CAM) plants fix carbon dioxide at night by the carboxylation of phosphoenolpyruvate. If CO2 fixation is conducted with 13C18O2 , then in the absence of carbonic anhydrase, the malate formed by dark CO2 fixation should also contain high levels of carbon-13 and oxygen-18. Conversely, if carbonic anhydrase is present and highly active, oxygen exchange between CO2 and cellular H2O will occur more rapidly than carboxylation, and the [13C] malate formed will contain little or no oxygen-18 above the natural abundance level. The presence of oxygen-18 in these molecules can be detected either by nuclear magnetic resonance (using the oxygen-18 effect on the carbon-13 chemical shift of the carboxyl carbon) or by mass spectrometry (comparing the ions at three and five units above the molecular weight with that one unit above). Studies of phosphoenolpyruvate carboxylase in the presence and absence of carbonic anhydrase in vitro confirm the validity of the method. When CAM plants are studied by this method, we find that most species show incorporation of a significant amount of oxygen-18. Comparison of these results with results of isotope fractionation and gas exchange studies permits calculation of the in vivo activity of carbonic anhydrase toward HCO-3 compared with that of phosphoenolpyruvate carboxylase. The ratio (carbonic anhydrase activity/phosphoenolpyruvate carboxylase activity) is species dependent and varies from a low of about 7 for Ananas comosus to values near 20 for Hoya carnosa and Bryophyllum pinnatum , 40 for Kalancho ë daigremontiana , and 100 or greater for Bryophyllum tubiflorum , Kalancho ë serrata, and Kalancho ë tomentosa. Carbonic anhydrase activity increases relative to phosphoenolpyruvate carboxylase activity at higher temperature. PMID:6427227

Holtum, J A; Summons, R; Roeske, C A; Comins, H N; O'Leary, M H

1984-06-10

79

Carbon fixation prediction during a bloom of Emiliania huxleyi is highly sensitive to the assumed regulation mechanism  

NASA Astrophysics Data System (ADS)

Large scale precipitation of calcium carbonate in the oceans by coccolithophorids plays an important role in carbon sequestration. However, there is a controversy on the effect of an increase in atmospheric CO2 concentration on both calcification and photosynthesis of coccolithophorids. Indeed recent experiments, performed under nitrogen limitation, revealed that the associated fluxes may be slowed down, while other authors claim the reverse. We designed models to account for various scenarii of calcification and photosynthesis regulation in chemostat cultures of Emiliania huxleyi, based on different hypotheses on the regulation mechanism. These models consider that either carbon dioxide, bicarbonate, carbonate or calcite saturation state (?) is the regulating factor. All were calibrated to predict the same carbon fixation rate in nowadays pCO2, but they turn out to respond differently to an increase in CO2 concentration. Thus, using the four possible models, we simulated a large bloom of Emiliania huxleyi. It results that models assuming a regulation by CO32- or ? predicted much higher carbon fluxes. The response when considering a doubled pCO2 was different and models controlled by CO2 or HCO3 - led to increased carbon fluxes. In addition, the variability between the various scenarii proved to be in the same order of magnitude than the response to pCO2 increase. These sharp discrepancies reveal the consequences of model assumptions on the simulation outcome.

Bernard, O.; Sciandra, A.; Rabouille, S.

2009-05-01

80

A Synthetic Recursive "+1" Pathway for Carbon Chain Elongation  

PubMed Central

Nature uses four methods of carbon chain elongation for the production of 2-ketoacids, fatty acids, polyketides, and isoprenoids. Using a combination of quantum mechanical (QM) modeling, protein–substrate modeling, and protein and metabolic engineering, we have engineered the enzymes involved in leucine biosynthesis for use as a synthetic “+1” recursive metabolic pathway to extend the carbon chain of 2-ketoacids. This modified pathway preferentially selects longer-chain substrates for catalysis, as compared to the non-recursive natural pathway, and can recursively catalyze five elongation cycles to synthesize bulk chemicals, such as 1-heptanol, 1-octanol, and phenylpropanol directly from glucose. The “+1” chemistry is a valuable metabolic tool in addition to the “+5” chemistry and “+2” chemistry for the biosynthesis of isoprenoids, fatty acids, or polyketides.

Marcheschi, Ryan J.; Li, Han; Zhang, Kechun; Noey, Elizabeth L.; Kim, Seonah; Chaubey, Asha; Houk, K. N.; Liao, James C.

2013-01-01

81

SOS and UVM Pathways Have Lesion-Specific Additive and Competing Effects on Mutation Fixation at Replication-Blocking DNA Lesions  

PubMed Central

Escherichia coli cells have multiple mutagenic pathways that are induced in response to environmental and physiological stimuli. Unlike the well-investigated classical SOS response, little is known about newly recognized pathways such as the UVM (UV modulation of mutagenesis) response. In this study, we compared the contributions of the SOS and UVM pathways on mutation fixation at two representative noninstructive DNA lesions: 3,N4-ethenocytosine (?C) and abasic (AP) sites. Because both SOS and UVM responses are induced by DNA damage, and defined UVM-defective E. coli strains are not yet available, we first constructed strains in which expression of the SOS mutagenesis proteins UmuD? and UmuC (and also RecA in some cases) is uncoupled from DNA damage by being placed under the control of a heterologous lac-derived promoter. M13 single-stranded viral DNA bearing site-specific lesions was transfected into cells induced for the SOS or UVM pathway. Survival effects were determined from transfection efficiency, and mutation fixation at the lesion was analyzed by a quantitative multiplex sequence analysis procedure. Our results suggest that induction of the SOS pathway can independently elevate mutagenesis at both lesions, whereas the UVM pathway significantly elevates mutagenesis at ?C in an SOS-independent fashion and at AP sites in an SOS-dependent fashion. Although mutagenesis at ?C appears to be elevated by the induction of either the SOS or the UVM pathway, the mutational specificity profiles for ?C under SOS and UVM pathways are distinct. Interestingly, when both pathways are active, the UVM effect appears to predominate over the SOS effect on mutagenesis at ?C, but the total mutation frequency is significantly increased over that observed when each pathway is individually induced. These observations suggest that the UVM response affects mutagenesis not only at class 2 noninstructive lesions (?C) but also at classical SOS-dependent (class 1) lesions such as AP sites. Our results add new layers of complexity to inducible mutagenic phenomena: DNA damage activates multiple pathways that have lesion-specific additive as well as suppressive effects on mutation fixation, and some of these pathways are not directly regulated by the SOS genetic network.

Rahman, M. Sayeedur; Humayun, M. Zafri

1999-01-01

82

N, Fixation, Carbon Metabolism, and Oxidative Damage in Nodules of Dark-Stressed Common Bean Plants  

Microsoft Academic Search

~ ~ ~ ~ ~~~ Common beans (Phaseolus vulgaris 1.) were exposed to continuous darkness to induce nodule senescence, and severa1 nodule parame- ters were investigated to identify factors that may be involved in the initial loss of N, fixation. After only 1 d of darkness, total root respiration decreased by 76% and in vivo nitrogenase (N,ase) activ- ity decreased

Yolanda Cogorcena; Anthony J. Gordon; Pedro R. Escuredo; Frank R. Minchin; John F. Witty; Jose F. Moran; Manuel Becana

83

A gene homologous to chloroplast carbonic anhydrase (icfA) is essential to photosynthetic carbon dioxide fixation by Synechococcus PCC7942.  

PubMed Central

To understand the CO2-concentrating mechanism in cyanobacteria, a genomic DNA fragment that complements a temperature-sensitive high-CO2 (5%)-requiring mutant of Synechococcus PCC7942 has been isolated. An open reading frame (ORF272) encoding a polypeptide of 272 amino acids (Mr, 30,184) was found within the genomic region located 20 kilobases downstream from the genes for ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcLS). Insertion of a kanamycin-resistance gene cartridge within the ORF272 in wild-type cells led to a high-CO2-requiring phenotype. Strains carrying a gene disabled by insertional mutagenesis accumulated inorganic carbon in the cells, but they could not fix it efficiently, even though ribulose-1,5-bisphosphate carboxylase activity was comparable to that of the wild-type strain. Therefore, the ORF272 was designated as a gene icfA, which is essential to inorganic carbon fixation. Furthermore, the predicted icfA gene product shared significant sequence similarities with plant chloroplast carbonic anhydrases (CAs) from pea (22%) and spinach (22%) and also with the Escherichia coli cynT gene product (31%), which was recently identified to be E. coli CA. These results indicate that the putative CA encoded by icfA is essential to photosynthetic carbon dioxide fixation in cyanobacteria and that plant chloroplast CAs may have evolved from a common ancestor of the prokaryotic CAs, which are distinct from mammalian CAs and Chlamydomonas periplasmic CAs.

Fukuzawa, H; Suzuki, E; Komukai, Y; Miyachi, S

1992-01-01

84

Coordination of carbon fixation and nitrogen metabolism in Salicornia europaea under salinity: Comparative proteomic analysis on chloroplast proteins.  

PubMed

Halophyte, like Salicornia europaea, could make full use of marginal saline land for carbon fixation. How the photosynthesis of S. europaea is regulated under high salinity implicates a significant aspect to exploit this pioneer plant in future. Measurement of photosynthesis parameters demonstrated the reduction of photosynthesis for the 0 and 800?mM NaCl treated plants are more likely due to non-stomatal limitation, which might be caused by changes in the enzymes associated with photosynthesis. Different salinity induced ultrastructure changes other than photosynthetic apparatus damage, suggesting the photosynthesis of S. europaea might be affected via biochemical regulation. Comparative proteomics analysis of chloroplast proteins by 2-D gel electrophoresis reproducibly detected 90 differentially expressed proteins, among which 66 proteins were identified by nanoLC MS/MS. Further study of thylakoid membrane proteins by Blue-Native PAGE proved the increase in abundance of light reaction proteins under salinity. Analysis of gene expression patterns of 12 selected proteins provides evidence for the correlations between transcription and proteomics data. Based on our results, a putative model of photosynthesis regulatory network figured out proper coordination of carbon fixation and nitrogen metabolism in chloroplast of S. europaea under salinity, which provided subcellular level insight into salt tolerance mechanism in S. europaea. PMID:21905221

Fan, Pengxiang; Feng, Juanjuan; Jiang, Ping; Chen, Xianyang; Bao, Hexigeduleng; Nie, Lingling; Jiang, Dan; Lv, Sulian; Kuang, Tingyun; Li, Yinxin

2011-10-17

85

Pathways of human development and carbon emissions embodied in trade  

NASA Astrophysics Data System (ADS)

It has long been assumed that human development depends on economic growth, that national economic expansion in turn requires greater energy use and, therefore, increased greenhouse-gas emissions. These interdependences are the topic of current research. Scarcely explored, however, is the impact of international trade: although some nations develop socio-economically and import high-embodied-carbon products, it is likely that carbon-exporting countries gain significantly fewer benefits. Here, we use new consumption-based measures of national carbon emissions to explore how the relationship between human development and carbon changes when we adjust national emission rates for trade. Without such adjustment of emissions, some nations seem to be getting far better development `bang' for the carbon `buck' than others, who are showing scant gains for disproportionate shares of global emissions. Adjusting for the transfer of emissions through trade explains many of these outliers, but shows that further socio-economic benefits are accruing to carbon-importing rather than carbon-exporting countries. We also find that high life expectancies are compatible with low carbon emissions but high incomes are not. Finally, we see that, despite strong international trends, there is no deterministic industrial development trajectory: there is great diversity in pathways, and national histories do not necessarily follow the global trends.

Steinberger, Julia K.; Timmons Roberts, J.; Peters, Glen P.; Baiocchi, Giovanni

2012-02-01

86

Antioxidant pathways are up-regulated during biological nitrogen fixation to prevent ROS-induced nitrogenase inhibition in Gluconacetobacter diazotrophicus  

Microsoft Academic Search

Gluconacetobacter diazotrophicus, an endophyte isolated from sugarcane, is a strict aerobe that fixates N2. This process is catalyzed by nitrogenase and requires copious amounts of ATP. Nitrogenase activity is extremely sensitive\\u000a to inhibition by oxygen and reactive oxygen species (ROS). However, the elevated oxidative metabolic rates required to sustain\\u000a biological nitrogen fixation (BNF) may favor an increased production of ROS.

Sylvia M. C. Alquéres; Jose Henrique M. Oliveira; Eduardo M. Nogueira; Helma V. Guedes; Pedro L. Oliveira; Fernando Câmara; Jose I. Baldani; Orlando B. Martins

2010-01-01

87

Fixation of CO 2 by carbonating calcium derived from blast furnace slag  

Microsoft Academic Search

Industrial waste materials, such as steelmaking slags, appear to be potential raw materials for reducing CO2 emissions by carbonation. The suitability of applying a carbonation route based on acetic acid leaching to produce carbonates from blast furnace slag is presented in this study. The effect of solution pH, temperature, and CO2 pressure on the precipitation of carbonates was experimentally studied.

Sanni Eloneva; Sebastian Teir; Justin Salminen; Carl-Johan Fogelholm; Ron Zevenhoven

2008-01-01

88

[ 14 C]Carbon-dioxide fixation by isolated leaf epidermes with stomata closed or open  

Microsoft Academic Search

Isolated epidermes of Tulipa gesneriana L. and Commelian communis L. were exposed to 14CO2 in the light and in darkness, when stomata were either closed or open. The labelling patterns did not differ: the main products of CO2 fixation were malate and aspartate. Small amounts of radioactivity appeared also in acids of the tricarboxylic-acid cycle and their transamination products. Since

K. Raschke; P. Dittrich

1977-01-01

89

Rapid resonance Raman microspectroscopy to probe carbon dioxide fixation by single cells in microbial communities  

PubMed Central

Photosynthetic microorganisms play crucial roles in aquatic ecosystems and are the major primary producers in global marine ecosystems. The discovery of new bacteria and microalgae that play key roles in CO2 fixation is hampered by the lack of methods to identify hitherto-unculturable microorganisms. To overcome this problem we studied single microbial cells using stable-isotope probing (SIP) together with resonance Raman (RR) microspectroscopy of carotenoids, the light-absorbing pigments present in most photosynthetic microorganisms. We show that fixation of 13CO2 into carotenoids produces a red shift in single-cell RR (SCRR) spectra and that this SCRR–SIP technique is sufficiently sensitive to detect as little as 10% of 13C incorporation. Mass spectrometry (MS) analysis of labelled cellular proteins verifies that the red shift in carotenoid SCRR spectra acts as a reporter of the 13C content of single cells. Millisecond Raman imaging of cells in mixed cultures and natural seawater samples was used to identify cells actively fixing CO2, demonstrating that the SCRR–SIP is a noninvasive method for the rapid and quantitative detection of CO2 fixation at the single cell level in a microbial community. The SCRR–SIP technique may provide a direct method for screening environmental samples, and could help to reveal the ecophysiology of hitherto-unculturable microorganisms, linking microbial species to their ecological function in the natural environment.

Li, Mengqiu; Canniffe, Daniel P; Jackson, Philip J; Davison, Paul A; FitzGerald, Simon; Dickman, Mark J; Burgess, J Grant; Hunter, C Neil; Huang, Wei E

2012-01-01

90

The R3-carbon allotrope: a pathway towards glassy carbon under high pressure  

NASA Astrophysics Data System (ADS)

Pressure-induced bond type switching and phase transformation in glassy carbon (GC) has been simulated by means of Density Functional Theory (DFT) calculations and the Stochastic Quenching method (SQ) in a wide range of pressures (0-79 GPa). Under pressure, the GC experiences a hardening transition from sp- and sp2-type to sp3-type bonding, in agreement with previous experimental results. Moreover, a new crystalline carbon allotrope possessing R3 symmetry (R3-carbon) is predicted using the stochastic SQ method. The results indicate that R3-carbon can be regarded as an allotrope similar to that of amorphous GC. A very small difference in the heat of formation and the coherence of the radial and angular distribution functions of GC and the R3-carbon structure imply that small perturbations to this crystalline carbon allotrope may provide another possible amorphization pathway of carbon besides that of quenching the liquid melt or gas by ultra-fast cooling.

Jiang, Xue; Århammar, Cecilia; Liu, Peng; Zhao, Jijun; Ahuja, Rajeev

2013-05-01

91

Cra and the control of carbon flux via metabolic pathways  

Microsoft Academic Search

The catabolite repressor-activator (Cra) protein controls the direction of carbon flux through metabolic pathways in enteric bacteria. Cra binds to the control regions of target genes and exerts a negative effect on the expression of genes encoding glycolytic and Entner-Duodoroff enzymes, while exerting a positive effect on genes encoding Krebs cycle, glyoxylate shunt and gluconeogenic enzymes. Cra mediates cylic AMP-independent

T. M. Ramseier

1996-01-01

92

Photosynthetic Carbon Metabolism in Seagrasses 14C-Labeling Evidence for the C3 Pathway  

PubMed Central

The ?13C values of several seagrasses were considerably less negative than those of terrestrial C3 plants and tended toward those of terrestrial C4 plants. However, for Thalassia hemprichii (Ehrenb.) Aschers and Halophila spinulosa (R. Br.) Aschers, phosphoglycerate and other C3 cycle intermediates predominated among the early labeled products of photosynthesis in 14C-labeled seawater (more than 90% at the earliest times) and the labeling pattern at longer times was brought about by the operation of the C3 pathway. Malate and aspartate together accounted for only a minor fraction of the total fixed label at all times and the kinetic data of this labeling were not at all consistent with these compounds being early intermediates in seagrass photosynthesis. Pulse-chase 14C-labeling studies further substantiated these conclusions. Significant labeling of photorespiratory intermediates was observed in all experiments. The kinetics of total fixation of label during some steady-state and pulse-chase experiments suggested that there may be an intermediate pool of inorganic carbon of variable size closely associated with the leaves, either externally or internally. Such a pool may be one cause for the C4-like carbon isotope ratios of seagrasses. Images

Andrews, T. John; Abel, Kay M.

1979-01-01

93

Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use  

SciTech Connect

Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such as sulfide and CO2. Remarkably little is known about the physiological strategies that enable chemosynthetic symbioses to colonize oligotrophic environments. In this study, we used metaproteomics and metabolomics to investigate the intricate network of metabolic interactions in the chemosynthetic association between Olavius algarvensis, a gutless marine worm, and its bacterial symbionts. We propose novel pathways for coping with energy and nutrient limitation, some of which may be widespread in both free-living and symbiotic bacteria. These include (i) a pathway for symbiont assimilation of the host waste products acetate, propionate, succinate and malate, (ii) the potential use of carbon monoxide as an energy source, a substrate previously not known to play a role in marine invertebrate symbioses, (iii) the potential use of hydrogen as an energy source, (iv) the strong expression of high affinity uptake transporters, and (v) novel energy efficient steps in CO2 fixation and sulfate reduction. The high expression of proteins involved in pathways for energy and carbon uptake and conservation in the O. algarvensis symbiosis indicates that the oligotrophic nature of its environment exerted a strong selective pressure in shaping these associations.

Kleiner, Manuel [Max Planck Institute for Marine Microbiology; Wentrop, C. [Max Planck Institute for Marine Microbiology; Lott, C. [Max Planck Institute for Marine Microbiology; Teeling, Hanno [Max Planck Institute for Marine Microbiology; Wetzel, Silke [Max Planck Institute for Marine Microbiology; Young, Jacque C [ORNL; Chang, Y. [Oak Ridge National Laboratory (ORNL); Shah, Manesh B [ORNL; Verberkmoes, Nathan C [ORNL; Zarzycki, Jan [University of Freiburg, Germany; Fuchs, Georg [University of Freiburg, Germany; Markert, Stephanie [Institute of Marine Biotechnology, Germany; Hempel, Kristina [Institute for Microbiology, Germany

2012-01-01

94

Impact of ultraviolet-B radiation on photosystem II activity and its relationship to the inhibition of carbon fixation rates for antarctic ice algae communities  

SciTech Connect

One goal of the Icecolors 1993 study was to determine whether or not photosystem II (PSII) was a major target site for photoinhibition by ultraviolet-B radiation (Q{sub UVB}, 280-320 nm) in natural communities. Second, the degree to which Q{sub UVB} inhibition of PSII could account for Q{sub UVB} effects on whole cell rates of carbon fixation in phytoplankton was assessed. On 1 October, 1993, at Palmer Station (Antarctica), dense samples of a frazil ice algal community were collected and maintained outdoors in the presence or absence of Q{sub UVB} and/or ultraviolet-A (Q{sub UVA}, 320-400 nm) radiation. The time of day course of UV inhibition of primary production was tracted. Over the day, {phi}{sub IIe}{degrees} declined due to increasing time-integrated dose exposure of Q{sub UVB}. The Q{sub UVB}-driven inhibition of {phi}{sub IIe}{degrees} increased from 4% in the early morning hours to a maximum of 23% at the end of the day. The Q{sub UVB} photoinhibition of PSII quantum yield did not recover by 6 h after sunset. In contrast, photoinhibition by Q{sub UVA} and photosynthetically available radiation (Q{sub PAR}, 400-700 nm) recovered during the late afternoon. Fluorescence-based estimates of carbon fixation rates were linearly correlated with measured carbon fixation. Fluorescence overestimated the observed Q{sub UVB} inhibition in measured carbon fixation rates. Researchers should be cautious in using fluorescence measurements to infer ultraviolet inhibition for rates of carbon fixation until there is a greater understanding of the coupling of carbon metabolism to PSII activity for natural populations. Despite these current limitations, fluorescence-based technologies represent powerful tools for studying the impact of the ozone hole on natural populations on spatial/temporal scales not possible using conventional productivity techniques. 55 refs., 11 figs., 2 tabs.

Schofield, O.; Prezelin, B.B. [Univ. of California, Santa Barbara, CA (United States); Kroon, B.M.A. [Univ. of Amsterdam (Netherlands)

1995-10-01

95

Activity of carbon dioxide fixation by anthers and leaves of cereal grains  

SciTech Connect

This paper gives a comparative evaluation of the photosynthetic activity of anthers and flag leaves in winter wheat, rye, and triticale. The content of chlorophylls in anthers and leaves was determined. The activity of /sup 14/CO/sub 2/ fixation by anthers and leaf disks was determined by the radiometric method in a chamber floating on mercury under standard exposure conditions (0.1% concentration of /sup 14/CO/sub 2/, illumination of 15,000 1x, temperature of 23 C). Analyses were conducted in three replications and the results of typical biological experiments are cited. Data show that chlorophyll is actively synthesized in the anthers of cereal grains.

Kirichenko, E.B.; Chernyad'ev, I.I.; Doman, N.G.; Talibullina, K.K.; Voronkova, T.V.

1986-05-01

96

WAVELENGTH DEPENDENCY OF THE MAXIMUM QUANTUM YIELD OF CARBON FIXATION FOR TWO RED TIDE DINOFLAGELLATES, HETEROCAPSA PYGMAEA AND PROROCENTRUM MINIMUM (PYRROPHYTA): IMPLICATIONS FOR MEASURING PHOTOSYNTHETIC RATES1  

Microsoft Academic Search

The influence of photoadaptiue state on the spectral dependency of the maximum quantum yield for carbon fixation was determined for two red tide dinojagellates, Heterocapsa pygmaea Loeblich, Schmidt, et Sherley and Prorocentrum minimum Pauillard. Cultures were ac- climated to green, blue, red, and white light. The spectral dependency in the light-limited slope of the photosynthesis- irradiance curves (CY~ was measured

Oscar Schofield; Barbara Prezelin; Geir Johnsen

1996-01-01

97

RuBP limitation of photosynthetic carbon fixation during NH sub 3 assimilation: Interactions between photosynthesis, respiration, and ammonium assimilation in N-limited green algae  

SciTech Connect

The effects of ammonium assimilation on photosynthetic carbon fixation and O{sub 2} exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP) concentration and the RuBP binding site density of ribulose bisphosphate carboxylase/oxygenase (Rubisco). In both species, ammonium assimilation resulted in a decrease in RuBP concentration. In S. minutum the concentration fell below the RuBP binding site density of Rubisco, indicating RuBP limitation of carboxylation. In contrast, RuBP concentration remained above the binding site density in C. pyrenoidosa. Compromising RuBP regeneration in C. pyrenoidosa with low light resulted in an ammonium-induced decrease in RuBP concentration below the RuBP binding site density of Rubisco. This resulted in a decrease in photosynthetic carbon fixation. In both species, ammonium assimilation resulted in a larger decrease in net O{sub 2} evolution than in carbon fixation. Mass spectrometric analysis shows this to be a result of an increase in the rate of mitochondrial respiration in the light.

Elrifi, I.R.; Holmes, J.J.; Weger, H.G.; Mayo, W.P.; Turpin, D.H. (Queen's Univ., Kingston, Ontario (Canada))

1988-06-01

98

Nitrogen and irradiance-dependent variations of the maximum quantum yield of carbon fixation in eutrophic, mesotrophic and oligotrophic marine systems  

Microsoft Academic Search

Natural variability of the maximum quantum yield of carbon fixation (?C max), as determined from the initial slope of the photosynthesis-irradiance curve and from light absorption measurements, was studied at three sites in the northeast tropical Atlantic representing typical eutrophic, mesotrophic and oligotrophic regimes. At the eutrophic and mesotrophic sites, where the mixed layer extended deeper than the euphotic layer,

Marcel Babin; André Morel; Hervé Claustre; Annick Bricaud; Zbigniew Kolber; Paul G. Falkowski

1996-01-01

99

Ammonium enhancement of dark carbon fixation and nitrogen limitation in zooxanthellae symbiotic with the reef corals Madracis mirabilis and Montastrea annularis  

Microsoft Academic Search

The nutrient status (limitation vs sufficiency) of dinoflagellates (zooxanthellae) symbiotic with reef corals in Bermuda was assessed in 1989 and 1990 by measuring the enhancement of dark carbon fixation with 20 µM ammonium by isolated symbionts. A colony ofMadracis mirabilis was kept in the laboratory and fed daily or starved for one month. Symbionts from fed portions of the colony

C. B. Cook; G. Muller-Parker; Co D. Orlandini

1994-01-01

100

Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L  

SciTech Connect

Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwall and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.

Singal, H.R.; Sheoran, I.S.; Singh, R.

1987-04-01

101

Mineral Radioactivity in Sands as a Mechanism for Fixation of Organic Carbon on the Early Earth  

NASA Astrophysics Data System (ADS)

Irradiation of organic molecules by mineral radioactivity is a feasible alternative to cosmic irradiation to precipitate solid organic carbon-rich matter on the early Earth. Radioactive (uranium- and thorium-rich) minerals have been concentrated at the Earth's surface, and accumulated accretionary coatings of carbon due to irradiation, since early Archean times. The organic accretion process could have occurred at the surface or in the sub-surface, and is independent of a terrestrial or extraterrestrial source for the carbon.

Parnell, John

2004-12-01

102

Nitrogen fixation-enhanced carbon sequestration in low nitrate, low chlorophyll seascapes  

Microsoft Academic Search

The magnitude of fluxes in the carbon cycle of subtropical and tropical marine habitats is determined by the supply of inorganic nutrients. These habitats have low sea-surface concentra- tions of nitrate (NO3-) and chlorophyll (dubbed LNLC regions), sustain relatively low rates of organic matter production and export, and represent global ocean minima in carbon sequestration potential. The low NO3- resupply

David M. Karl; Ricardo M. Letelier

2008-01-01

103

C3 and C4 pathways of photosynthetic carbon assimilation in marine diatoms are under genetic, not environmental, control.  

PubMed

Marine diatoms are responsible for up to 20% of global CO(2) fixation. Their photosynthetic efficiency is enhanced by concentrating CO(2) around Rubisco, diminishing photorespiration, but the mechanism is yet to be resolved. Diatoms have been regarded as C(3) photosynthesizers, but recent metabolic labeling and genome sequencing data suggest that they perform C(4) photosynthesis. We studied the pathways of photosynthetic carbon assimilation in two diatoms by short-term metabolic (14)C labeling. In Thalassiosira weissflogii, both C3 (glycerate-P and triose-P) and C4 (mainly malate) compounds were major initial (2-5 s) products, whereas Thalassiosira pseudonana produced mainly C3 and C6 (hexose-P) compounds. The data provide evidence of C(3)-C(4) intermediate photosynthesis in T. weissflogii, but exclusively C(3) photosynthesis in T. pseudonana. The labeling patterns were the same for cells grown at near-ambient (380 microL L(-1)) and low (100 microL L(-1)) CO(2) concentrations. The lack of environmental modulation of carbon assimilatory pathways was supported in T. pseudonana by measurements of gene transcript and protein abundances of C(4)-metabolic enzymes (phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase) and Rubisco. This study suggests that the photosynthetic pathways of diatoms are diverse, and may involve combined CO(2)-concentrating mechanisms. Furthermore, it emphasizes the requirement for metabolic and functional genetic and enzymic analyses before accepting the presence of C(4)-metabolic enzymes as evidence for C(4) photosynthesis. PMID:17644625

Roberts, Karen; Granum, Espen; Leegood, Richard C; Raven, John A

2007-07-20

104

Nitrogen Fixation (Acetylene Reduction) in a Salt Marsh Amended with Sewage Sludge and Organic Carbon and Nitrogen Compounds 1  

PubMed Central

Seasonal distribution of nitrogen fixation by Spartina alterniflora epiphytes and in surface and soil samples was investigated in a Georgia salt marsh which was amended with sewage sludge or with glucose and/or ammonium nitrate. There was no significant difference between the rates of fixation in the unamended and sewage sludge plots. Additional perturbation experiments suggested that nitrogen addition indirectly stimulates nitrogen fixation by enhancing Spartina production and root exudation. Glucose additions, on the other hand, suppressed nitrogen fixation on a long-term basis. It is suggested that the microbial population in the soil out-competed the plants for the available nitrogen and in turn suppressed plant production and possibly root exudation. A comparison of nitrogen fixation in clipped and unclipped Spartina plots substantiated the suggestion that root exudation probably supports nitrogen fixation. Fixation in the clipped plots was significantly lower (P < 0.05) than the rates in the unclipped plots.

Hanson, Roger B.

1977-01-01

105

pH-Neutral Concrete for Attached Microalgae and Enhanced Carbon Dioxide Fixation. Phase I.  

National Technical Information Service (NTIS)

The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SCCO 2)-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resi...

K. M. Dooley F. C. Knopf R. P. Gambrell

1999-01-01

106

Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities.  

PubMed

The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope-probing experiments with and without methane. The relative incorporation of (13)C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both (13)C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs. PMID:23129626

Kellermann, Matthias Y; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe

2012-11-05

107

Antioxidant pathways are up-regulated during biological nitrogen fixation to prevent ROS-induced nitrogenase inhibition in Gluconacetobacter diazotrophicus  

PubMed Central

Gluconacetobacter diazotrophicus, an endophyte isolated from sugarcane, is a strict aerobe that fixates N2. This process is catalyzed by nitrogenase and requires copious amounts of ATP. Nitrogenase activity is extremely sensitive to inhibition by oxygen and reactive oxygen species (ROS). However, the elevated oxidative metabolic rates required to sustain biological nitrogen fixation (BNF) may favor an increased production of ROS. Here, we explored this paradox and observed that ROS levels are, in fact, decreased in nitrogen-fixing cells due to the up-regulation of transcript levels of six ROS-detoxifying genes. A cluster analyses based on common expression patterns revealed the existence of a stable cluster with 99.8% similarity made up of the genes encoding the ?-subunit of nitrogenase Mo–Fe protein (nifD), superoxide dismutase (sodA) and catalase type E (katE). Finally, nitrogenase activity was inhibited in a dose-dependent manner by paraquat, a redox cycler that increases cellular ROS levels. Our data revealed that ROS can strongly inhibit nitrogenase activity, and G. diazotrophicus alters its redox metabolism during BNF by increasing antioxidant transcript levels resulting in a lower ROS generation. We suggest that careful controlled ROS production during this critical phase is an adaptive mechanism to allow nitrogen fixation.

Oliveira, Jose Henrique M.; Nogueira, Eduardo M.; Guedes, Helma V.; Oliveira, Pedro L.; Camara, Fernando; Baldani, Jose I.; Martins, Orlando B.

2010-01-01

108

Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation.  

PubMed

The atmospheric and deep sea reservoirs of carbon dioxide are linked via physical, chemical, and biological processes. The last of these include photosynthesis, particle settling, and organic matter remineralization, and are collectively termed the "biological carbon pump." Herein, we present results from a 13-y (1992-2004) sediment trap experiment conducted in the permanently oligotrophic North Pacific Subtropical Gyre that document a large, rapid, and predictable summertime (July 15-August 15) pulse in particulate matter export to the deep sea (4,000 m). Peak daily fluxes of particulate matter during the summer export pulse (SEP) average 408, 283, 24.1, 1.1, and 67.5 ?mol·m(-2)·d(-1) for total carbon, organic carbon, nitrogen, phosphorus (PP), and biogenic silica, respectively. The SEP is approximately threefold greater than mean wintertime particle fluxes and fuels more efficient carbon sequestration because of low remineralization during downward transit that leads to elevated total carbon/PP and organic carbon/PP particle stoichiometry (371:1 and 250:1, respectively). Our long-term observations suggest that seasonal changes in the microbial assemblage, namely, summertime increases in the biomass and productivity of symbiotic nitrogen-fixing cyanobacteria in association with diatoms, are the main cause of the prominent SEP. The recurrent SEP is enigmatic because it is focused in time despite the absence of any obvious predictable stimulus or habitat condition. We hypothesize that changes in day length (photoperiodism) may be an important environmental cue to initiate aggregation and subsequent export of organic matter to the deep sea. PMID:22308450

Karl, David M; Church, Matthew J; Dore, John E; Letelier, Ricardo M; Mahaffey, Claire

2012-01-30

109

QUANTITATIVE STUDIES OF THE EFFECT OF ORGANIC SUBSTRATES AND 2,4-DINITROPHENOL ON HETEROTROPHIC CARBON DIOXIDE FIXATION IN HYDROGENOMONAS FACILIS  

PubMed Central

McFadden, Bruce A. (Washington State University, Pullman), and H. Robert Homann. Quantitative studies of the effect of organic substrates and 2,4-dinitrophenol on heterotrophic carbon dioxide fixation in Hydrogenomonas facilis. J. Bacteriol. 86:971–977. 1963.—Whole cells of Hydrogenomonas facilis under heterotrophic conditions fixed levels of C14O2 which depended upon the nature of the carbon source being oxidized. It was established that oxidative rates varied as a function of pCO2. Therefore, all studies were conducted in the presence of 1.5 mole% CO2 in the gas phase. With glucose-grown cells supplied with glucose as substrate, the heterotrophic fixation was curtailed 98% by the addition of 8.3 × 10?4m 2,4-dinitrophenol (DNP). A coupling between reductive fixation of CO2 and heterotrophic oxidation of substrate is consistent with the observed effect of DNP. The efficiency of coupling of fixation with oxidation was studied for acetate, d-glucose, l-glutamate, d,l-lactate, d-ribose, and succinate as substrates. Kinetic studies showed that the efficiency of coupling (expressed as disintegrations per minute of C14 per microliter of O2) was initially time-variable for all substrates; however, it approached a constant value after 30 to 45 min for acetate, glutamate, lactate, and succinate. The initial variation of the ratio with time was due primarily to C14O2 uptake, which was nonlinear with time. Control studies in the absence of exogenous substrate indicated that CO2 fixation may also be linked to oxidation of endogenous stores accumulated during heterotrophic growth. d-Ribose appears to be the most promising substrate for short-term fixation studies owing to the rapid incorporation of C14 and the unusually low endogenous fixation rate by cells grown on ribose. Calculations reveal that, after isotopic equilibrium has occurred, the amount of CO2 utilized during glucose oxidation is almost 50% of O2 uptake during the same interval. Even during succinate oxidation, which was shown to be coupled much less effectively with CO2 fixation, the CO2 utilized during the same interval is 8% of O2 uptake.

McFadden, Bruce A.; Homann, H. Robert

1963-01-01

110

Nitrogen fixation on early Mars and other terrestrial planets: experimental demonstration of abiotic fixation reactions to nitrite and nitrate.  

PubMed

Understanding the abiotic fixation of nitrogen is critical to understanding planetary evolution and the potential origin of life on terrestrial planets. Nitrogen, an essential biochemical element, is certainly necessary for life as we know it to arise. The loss of atmospheric nitrogen can result in an incapacity to sustain liquid water and impact planetary habitability and hydrological processes that shape the surface. However, our current understanding of how such fixation may occur is almost entirely theoretical. This work experimentally examines the chemistry, in both gas and aqueous phases, that would occur from the formation of NO and CO by the shock heating of a model carbon dioxide/nitrogen atmosphere such as is currently thought to exist on early terrestrial planets. The results show that two pathways exist for the abiotic fixation of nitrogen from the atmosphere into the crust: one via HNO and another via NO(2). Fixation via HNO, which requires liquid water, could represent fixation on a planet with liquid water (and hence would also be a source of nitrogen for the origin of life). The pathway via NO(2) does not require liquid water and shows that fixation could occur even when liquid water has been lost from a planet's surface (for example, continuing to remove nitrogen through NO(2) reaction with ice, adsorbed water, etc.). PMID:17480164

Summers, David P; Khare, Bishun

2007-04-01

111

Factors influencing carbon fixation and water use by mediterranean sclerophyll shrubs during summer drought  

Microsoft Academic Search

Mediterranean sclerophyll shrubs respond to seasonal drought by adjusting the amount of leaf area exposed and by reducing gas exchange via stomatal closure mechanisms. The degree to which each of these modifications can influence plant carbon and water balances under typical mediterranean-type climate conditions is examined. Leaf area changes are assessed in the context of a canopy structure and light

J. D. Tenhunen; A. Sala Serra; P. C. Harley; R. L. Dougherty; J. F. Reynolds

1990-01-01

112

Soybean Photosynthetic Rate and Carbon Fixation at Early and Late Planting Dates  

Technology Transfer Automated Retrieval System (TEKTRAN)

Early planting (late April to early May) is recommended for increasing soybean yield but a full understanding of the physiological response is lacking. This study was conducted to determine whether carbon dioxide exchange rate (CER) could explain this yield difference. A study with five (2007) and s...

113

Nitrogen fixation and CO/sub 2/ metabolism: proceedings  

SciTech Connect

Photosynthesis and nitrogen fixation are key metabolic processes which lead to the production of reduced carbon and nitrogen compounds. These compounds are essential for the maintenance and continuation of life on earth. In this volume many recent advances in the study of nitrogen fixation and photosynthetic carbon dioxide fixation are presented. The papers were presented in seven sessions. These sessions were the biochemistry of the legume nodule, genetics and molecular biology of nitrogen fixation, enzymes and cofactors involved in inorganic nitrogen reductions, aspects of nitrogen fixation by associations and symbioses, physiology of free-living nitrogen fixers, interactions between carbon metabolism and nitrogen fixation, photorespiration in plants, and photosynthetic carbon fixation. (DT)

Ludden, P.W.; Burris, J.E. (eds.)

1985-01-01

114

Carbon fixation and analysis of assimilates in a coral-dinoflagellate symbiosis  

Microsoft Academic Search

Freshly collected pieces of the hermatypic coral Acropora cf. scandens containing dinoflagellate endosymbionts (presumably Gymnodinium microadriaticum) were allowed to assimilated 14C from H14CO3-in the light and in the dark. Time-dependent carbon uptake resulted in intense 14C-labelling of ethanol-soluble as well as of insoluble assimilates. About forty 14C-labelled assimilates have been identified. Polymeric (ethanol-insoluble) compounds achieve about 30% of total radiocarbon

K. Schmitz; B. P. Kremer

1977-01-01

115

Effects of fixation on freshwater invertebrate carbon and nitrogen isotope composition and its arithmetic correction  

Microsoft Academic Search

Retrospective investigations using carbon and nitrogen stable isotope composition of archived material have a great potential\\u000a for describing past effects of anthropogenic ecosystem alterations or natural shifts in ecosystems. In this study, we examined\\u000a the effects of two commonly used preservation substances of freshwater invertebrates, ethanol and lugol, on ?13C and ?15N of various planktonic and benthic taxa. For both

M. Ventura; E. Jeppesen

2009-01-01

116

Investigation of metallic and carbon fibre PEEK fracture fixation devices for three-part proximal humeral fractures.  

PubMed

A computational investigation of proximal humeral fracture fixation has been conducted. Four devices were selected for the study; a locking plate, intramedullary nail (IM Nail), K-wires and a Bilboquet device. A 3D model of a humerus was created using a process of thresholding based on the grayscale values of a CT scan of an intact humerus. An idealised three part fracture was created in addition to removing a standard volume from the humeral head as a representation of bone voids that occur as a result of the injury. All finite element simulations conducted represent 90° arm abduction. Simulations were conducted to investigate the effect of filling this bone void with calcium phosphate cement for each device. The effect of constructing devices from carbon fibre polyetheretherketone (CFPEEK) was investigated. Simulations of cement reinforced devices predict greater stability for each device. The average unreinforced fracture line opening (FLO) is reduced by 48.5% for metallic devices with a lesser effect on composite devices with FLO reduced by 23.6%. Relative sliding (shear displacement) is also reduced between fracture fragments by an average of 58.34%. CFPEEK device simulations predict reduced stresses at the device-bone interface. PMID:22989528

Feerick, Emer M; Kennedy, Jim; Mullett, Hannan; FitzPatrick, David; McGarry, Patrick

2012-09-16

117

Influence of the CO2 absorbent monoethanolamine on growth and carbon fixation by the green alga Scenedesmus sp.  

PubMed

The influence of monoethanolamine (MEA) as a CO(2) absorbent on photoautotrophic culture of CO(2)-fixing microalgae was investigated. When 300 ppm MEA (4.92 mM) was added to blank culture medium, the dissolved inorganic carbon and the molar absorption ratio increased to 51.0mg/L and 0.34 mol CO2 = mol MEA, respectively, which was an almost 6-fold increase in CO(2) solubility. When free MEA up to 300 mg/L was added to a green alga Scenedesmus sp. culture that was supplied 5% (v/v) CO(2) at 0.1 vvm, both cell growth rate and final cell density were enhanced compared to when no MEA was added. The cell growth rate reached 288.6 mg/L/d, which was equivalent to 539.6 mg-CO(2)/L/d as a CO(2)-fixation rate and enhancement of about 63.0% compared to not adding MEA. Chlorophyll-a content and nitrate consumption rate increased correspondingly. MEA doses higher than 400mg/L inhibited cell growth, probably due to toxicity of the carbamate intermediate. PMID:22771020

Choi, Wookjin; Kim, Garam; Lee, Kisay

2012-06-16

118

Regulation, unique gene organization, and unusual primary structure of carbon fixation genes from a marine phycoerythrin-containing cyanobacterium.  

PubMed

Marine phycoerythrin-containing cyanobacteria are major contributors to the overall productivity of the oceans. The present study indicates that the structural genes of the carbon assimilatory system are unusually arranged and possess a unique primary structure compared to previously studied cyanobacteria. Southern blot analyses of Synechococcus sp. strain WH7803 chromosomal DNA digests, using the ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit gene from Synechococcus sp. strain PCC6301 as a heterologous probe, revealed the presence of a 6.4 kb HindIII fragment that was detectable at only low stringency. Three complete open reading frames (ORFs) were detected within this fragment. Two of these ORFs potentially encode the Synechococcus sp. strain WH7803 rbcL and rbcS genes. The third ORF, situated immediately upstream from rbcL, potentially encodes a homologue of the ccmK gene from Synechococcus sp. strain PCC7942. The deduced amino acid sequences of each of these ORFs are more similar to homologues among the beta/gamma purple bacteria than to existing cyanobacterial homologues and phylogenetic analysis of the Rubisco large and small subunit sequences confirmed an unexpected relationship to sequences from among the beta/gamma purple bacteria. This is the first instance in which the possibility has been considered that an operon encoding three genes involved in carbon fixation may have been laterally transferred from a purple bacterium. Analysis of mRNA extracted from cells grown under diel conditions indicated that rbcL, rbcS and ccmK were regulated at the transcriptional level; specifically Rubisco transcripts were highest during the midday period, decreased at later times during the light period and eventually reached a level where they were all but undetectable during the dark period. Primer extension analysis indicated that the ccmK, rbcL and rbcS genes were co-transcribed. PMID:9002609

Watson, G M; Tabita, F R

1996-12-01

119

Pathways of Carbon and Energy Metabolism of the Epibiotic Community Associated with the Deep-Sea Hydrothermal Vent Shrimp Rimicaris exoculata  

PubMed Central

Background The shrimp Rimicaris exoculata dominates the faunal biomass at many deep-sea hydrothermal vent sites at the Mid-Atlantic Ridge. In its enlarged gill chamber it harbors a specialized epibiotic bacterial community for which a nutritional role has been proposed. Methodology/Principal Findings We analyzed specimens from the Snake Pit hydrothermal vent field on the Mid-Atlantic Ridge by complementing a 16S rRNA gene survey with the analysis of genes involved in carbon, sulfur and hydrogen metabolism. In addition to Epsilon- and Gammaproteobacteria, the epibiotic community unexpectedly also consists of Deltaproteobacteria of a single phylotype, closely related to the genus Desulfocapsa. The association of these phylogenetic groups with the shrimp was confirmed by fluorescence in situ hybridization. Based on functional gene analyses, we hypothesize that the Gamma- and Epsilonproteobacteria are capable of autotrophic growth by oxidizing reduced sulfur compounds, and that the Deltaproteobacteria are also involved in sulfur metabolism. In addition, the detection of proteobacterial hydrogenases indicates the potential for hydrogen oxidation in these communities. Interestingly, the frequency of these phylotypes in 16S rRNA gene clone libraries from the mouthparts differ from that of the inner lining of the gill chamber, indicating potential functional compartmentalization. Conclusions Our data show the specific association of autotrophic bacteria with Rimicaris exoculata from the Snake Pit hydrothermal vent field, and suggest that autotrophic carbon fixation is contributing to the productivity of the epibiotic community with the reductive tricarboxylic acid cycle as one important carbon fixation pathway. This has not been considered in previous studies of carbon fixation and stable carbon isotope composition of the shrimp and its epibionts. Furthermore, the co-occurrence of sulfur-oxidizing and sulfur-reducing epibionts raises the possibility that both may be involved in the syntrophic exchange of sulfur compounds, which could increase the overall efficiency of this epibiotic community.

Hugler, Michael; Petersen, Jillian M.; Dubilier, Nicole; Imhoff, Johannes F.; Sievert, Stefan M.

2011-01-01

120

Pyrolysis pathways of sulfonated polyethylene, an alternative carbon fiber precursor.  

PubMed

Polyethylene is an emerging precursor material for the production of carbon fibers. Its sulfonated derivative yields ordered carbon when pyrolyzed under inert atmosphere. Here, we investigate its pyrolysis pathways by selecting n-heptane-4-sulfonic acid (H4S) as a model compound. Density functional theory and transition state theory were used to determine the rate constants of pyrolysis for H4S from 300 to 1000 K. Multiple reaction channels from two different mechanisms were explored: (1) internal five-centered elimination (Ei5) and (2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain thermogravimetric (TGA) plots that compared favorably to experiment. We observed that at temperatures <550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial ?H radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440 to 460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene (~31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOS?2 became competitive to ?-H abstraction by HOS?2, making ?H the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures >600 K. Low-scale carbonization utilizes temperatures <620 K; thus, internal elimination will not be competitive. E(i)5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. PMID:23560686

Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A; Naskar, Amit K; Beste, Ariana

2013-04-15

121

Carbon fixation in marine phytoplankton: carboxylase activities and stable carbon-isotope ratios; physiological and paleoclimatological aspects  

Microsoft Academic Search

We measured the activity of three carboxylases: RuBP carboxylase, PEP carboxylase and PEP carboxykinase of marine phytoplankton species in culture and in natural communities. Activities of the three carboxylases were measured simultaneously with stable carbon-isotope ratios. The enzymatic activities have been used to estimate the importance of ß carboxylation and its impact on the 13C:12C ratio (expressed as d13C). The

C. Descolas-Gros; M. R. Fontugne

1985-01-01

122

Will elevated carbon dioxide concentration amplify the benefits of nitrogen fixation in legumes?  

SciTech Connect

Growth at elevated [CO{sub 2}] stimulates photosynthesis and increases carbon (C) supply in all C3 species. A sustained and maximal stimulation in productivity at elevated [CO{sub 2}] requires an enhanced nutrient supply to match the increase in C acquisition. The ability of legumes to exchange C for nitrogen (N) with their N{sub 2}-fixing symbionts has led to the hypothesis that legumes will have a competitive advantage over nonleguminous species when grown at elevated [CO{sub 2}]. On balance, evidence suggests that in managed systems, legumes are more responsive to elevated [CO{sub 2}] than other plants (e.g. Ainsworth and Long, 2005); however, in natural ecosystems, nutrient availability can limit the response of legumes to elevated [CO{sub 2}] (Hungate et al., 2004; van Groenigen et al., 2006). Here, we consider these observations, outline the mechanisms that underlie them, and examine recent work that advances our understanding of how legumes respond to growth at elevated [CO{sub 2}]. First we highlight the global importance of legumes and provide a brief overview of the symbiotic relationship.

Rogers, A.; Ainsworth, E. A.; Leakey, A. D. B.

2009-11-01

123

Regulation of Multiple Carbon Monoxide Consumption Pathways in Anaerobic Bacteria  

PubMed Central

Carbon monoxide (CO), well known as a toxic gas, is increasingly recognized as a key metabolite and signaling molecule. Microbial utilization of CO is quite common, evidenced by the rapid escalation in description of new species of CO-utilizing bacteria and archaea. Carbon monoxide dehydrogenase (CODH), the protein complex that enables anaerobic CO-utilization, has been well-characterized from an increasing number of microorganisms, however the regulation of multiple CO-related gene clusters in single isolates remains unexplored. Many species are extraordinarily resistant to high CO concentrations, thriving under pure CO at more than one atmosphere. We hypothesized that, in strains that can grow exclusively on CO, both carbon acquisition via the CODH/acetyl CoA synthase complex and energy conservation via a CODH-linked hydrogenase must be differentially regulated in response to the availability of CO. The CO-sensing transcriptional activator, CooA is present in most CO-oxidizing bacteria. Here we present a genomic and phylogenetic survey of CODH operons and cooA genes found in CooA-containing bacteria. Two distinct groups of CooA homologs were found: one clade (CooA-1) is found in the majority of CooA-containing bacteria, whereas the other clade (CooA-2) is found only in genomes that encode multiple CODH clusters, suggesting that the CooA-2 might be important for cross-regulation of competing CODH operons. Recombinant CooA-1 and CooA-2 regulators from the prototypical CO-utilizing bacterium Carboxydothermus hydrogenoformans were purified, and promoter binding analyses revealed that CooA-1 specifically regulates the hydrogenase-linked CODH, whereas CooA-2 is able to regulate both the hydrogenase-linked CODH and the CODH/ACS operons. These studies point to the ability of dual CooA homologs to partition CO into divergent CO-utilizing pathways resulting in efficient consumption of a single limiting growth substrate available across a wide range of concentrations.

Techtmann, Stephen M.; Colman, Albert S.; Murphy, Michael B.; Schackwitz, Wendy S.; Goodwin, Lynne A.; Robb, Frank T.

2011-01-01

124

Acetyl CoA, a central intermediate of autotrophic CO 2 fixation in Methanobacterium thermoautotrophicum  

Microsoft Academic Search

The pathway of autotrophic CO2 fixation in Methanobacterium thermoautotrophicum has been investigated by long term labelling of the organism with isotopic acetate and pyruvate while exponentially growing on H2 plus CO2. Maximally 2% of the cell carbon were derived from exogeneous tracer, 98% were synthesized from CO2. Since growth was obviously autotrophic the labelled compounds functioned as tracers of the

Georg Fuchs; Erhard Stupperich

1980-01-01

125

14C Fixation by Leaves and Leaf Cell Protoplasts of the Submerged Aquatic Angiosperm Potamogeton lucens: Carbon Dioxide or Bicarbonate? 1  

PubMed Central

Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is, acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant.

Staal, Marten; Elzenga, J. Theo M.; Prins, Hidde B. A.

1989-01-01

126

sup 14 C fixation by leaves and leaf cell protoplasts of the submerged aquatic angiosperm Potamogeton lucens: Carbon dioxide or bicarbonate  

SciTech Connect

Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant.

Staal, M.; Elzenga, J.T.M.; Prins, H.B.A. (Univ. of Groningen, Haren (Netherlands))

1989-07-01

127

Carbon dioxide fixation in batch culture of Chlorella sp. using a photobioreactor with a sunlight-cellection device  

Microsoft Academic Search

In a batch culture of Chlorella sp. using sunlight as a light source, the cell concentration reached a maximum of 150 mg dry cells dm?3 at 200 h. The mean rate of CO2 fixation during the culture was 31.8 mg CO2 dm?3 d?1. The efficiency of conversion of energy to biomass was estimated as 4.3%.

Satoshi Hirata; Masao Hayashitani; Masahito Taya; Setsuji Tone

1996-01-01

128

The ORF encoding a putative ferredoxin-like protein downstream of the vnfH gene in Azotobacter vinelandii is involved in the vanadium-dependent alternative pathway of nitrogen fixation  

Microsoft Academic Search

An open reading frame (ORF) in the same operon as, but downstream of, vnfH in Azotobacter vinelandii can code for a ferredoxin-like protein. The role this ORF may play in the vnf (vanadium-dependent alternative) pathway of nitrogen fixation was investigated. Site-directed mutagenesis was used to alter one base in each of the codons specifying amino acids 18 and 19 generating

Ramesh Raina; Umesh K. Bageshwar; H. K. Das

1993-01-01

129

Germline polymorphisms in the one-carbon metabolism pathway and DNA methylation in colorectal cancer  

Microsoft Academic Search

Dietary intake of one-carbon nutrients (methyl donors) and germline variants in the one-carbon metabolism genes may influence\\u000a global DNA methylation level and methylation in promoter CpG islands. In this study, we evaluated the relationship between\\u000a single nucleotide polymorphisms (SNPs) in the one-carbon metabolism pathway and DNA methylation status in colorectal cancer.\\u000a Utilizing 182 colorectal cancers cases in two prospective cohort

Aditi HazraCharles; Charles S. Fuchs; Takako Kawasaki; Gregory J. Kirkner; David J. Hunter; Shuji Ogino

2010-01-01

130

Preparation of monodispersed aragonite microspheres via a carbonation crystallization pathway  

Microsoft Academic Search

Monodispersed calcium carbonate microspheres were prepared by carbonating a calcium acetate aqueous solution with CO2 gas at a high pressure of 40 bar and a high temperature of 80 °C after 60 minutes of reaction. The products were characterized by X-ray powder diffraction (XRD) and scanning electron microscopy (SEM), respectively. The XRD pattern showed that the crystal polymorph of the

Weijun Bao; Huiquan Li; Yi Zhang

2009-01-01

131

Carbon Assimilation Pathways, Water Relationships and Plant Ecology.  

ERIC Educational Resources Information Center

Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

Etherington, John R.

1988-01-01

132

Carbon Assimilation Pathways, Water Relationships and Plant Ecology.  

ERIC Educational Resources Information Center

|Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)|

Etherington, John R.

1988-01-01

133

Manipulation of Ralstonia eutropha Carbon Storage Pathways to Produce Useful Bio-Based Products.  

PubMed

Ralstonia eutrophais a Gram-negative betaproteobacterium found natively in soils that can utilize a wide array of carbon sources for growth, and can store carbon intracellularly in the form of polyhydroxyalkanoate. Many aspects of R. eutrophamake it a good candidate for use in biotechnological production of polyhydroxyalkanoate and other bio-based, value added compounds. Manipulation of the organism's carbon flux is a cornerstone to success in developing it as a biotechnologically relevant organism. Here, we examine the methods of controlling and adapting the flow of carbon in R. eutrophametabolism and the wide range of compounds that can be synthesized as a result. The presence of many different carbon utilization pathways and the custom genetic toolkit for manipulation of those pathways gives R. eutrophaa versatility that allows it to be a biotechnologically important organism. PMID:23080259

Brigham, Christopher J; Zhila, Natalia; Shishatskaya, Ekaterina; Volova, Tatiana G; Sinskey, Anthony J

2012-01-01

134

Modeling the optimal central carbon metabolic pathways under feedback inhibition using flux balance analysis.  

PubMed

Metabolism is a complex process for energy production for cellular activity. It consists of a cascade of reactions that form a highly branched network in which the product of one reaction is the reactant of the next reaction. Metabolic pathways efficiently produce maximal amount of biomass while maintaining a steady-state behavior. The steady-state activity of such biochemical pathways necessarily incorporates feedback inhibition of the enzymes. This observation motivates us to incorporate feedback inhibition for modeling the optimal activity of metabolic pathways using flux balance analysis (FBA). We demonstrate the effectiveness of the methodology on a synthetic pathway with and without feedback inhibition. Similarly, for the first time, the Central Carbon Metabolic (CCM) pathways of Saccharomyces cerevisiae and Homo sapiens have been modeled and compared based on the above understanding. The optimal pathway, which maximizes the amount of the target product(s), is selected from all those obtained by the proposed method. For this, we have observed the concentration of the product inhibited enzymes of CCM pathway and its influence on its corresponding metabolite/substrate. We have also studied the concentration of the enzymes which are responsible for the synthesis of target products. We further hypothesize that an optimal pathway would opt for higher flux rate reactions. In light of these observations, we can say that an optimal pathway should have lower enzyme concentration and higher flux rates. Finally, we demonstrate the superiority of the proposed method by comparing it with the extreme pathway analysis. PMID:22913632

De, Rajat K; Tomar, Namrata

2012-08-23

135

The importance of slope aspect and stand age on the photosynthetic carbon fixation capacity of forest: a case study with black locust ( Robinia pseudoacacia ) plantations on the Loess Plateau  

Microsoft Academic Search

The black locust (Robinia pseudoacacia L.) is an important tree species not only for the vegetation rehabilitation but also for the photosynthetic carbon dynamics\\u000a on the Loess Plateau. Slope aspect and stand age play important roles in the photosynthesis of the black locusts. To investigate\\u000a the photosynthetic carbon fixation capacity (PCFC) of the juvenile and mature black locusts located on

Yuan ZhengZhong; Zhong Zhao; Jing-Jing Zhou; Hui Zhou; Zong-Suo Liang; Zhi-Bin Luo

2011-01-01

136

Significance of non-sinking particulate organic carbon and dark CO2 fixation to heterotrophic carbon demand in the mesopelagic northeast Atlantic  

Microsoft Academic Search

It is generally assumed that sinking particulate organic carbon (POC) constitutes the main source of organic carbon supply to the deep ocean's food webs. However, a major discrepancy between the rates of sinking POC supply (collected with sediment traps) and the prokaryotic organic carbon demand (the total amount of carbon required to sustain the heterotrophic metabolism of the prokaryotes; i.e.,

Federico Baltar; Javier Arístegui; Eva Sintes; Josep M. Gasol; Thomas Reinthaler; Gerhard J. Herndl

2010-01-01

137

INCREASING CO2 FROM SUBAMBIENT TO ELEVATED CONCENTRATIONS INCREASES GRASSLAND RESPIRATION PER UNIT OF NET CARBON FIXATION  

Technology Transfer Automated Retrieval System (TEKTRAN)

Respiration (carbon efflux) by terrestrial ecosystems is a major component of the global carbon (C) cycle, but the response of C efflux to atmospheric CO2 enrichment remains uncertain. Respiration may respond directly to an increase in the availability of C substrates at high CO2, but also may be a...

138

Comparison of the Kinetics of Photosynthetic Carbon Dioxide Fixation in Maize, Sugar Cane and Tobacco, and its Relation to Photorespiration  

Microsoft Academic Search

MOST plants exhibit the phenomenon of photorespiration : that is to say they give out a certain amount of carbon dioxide in the light. This effect is usually masked by the occurrence of photosynthesis which takes up carbon dioxide at a greater rate than photorespiration releases it. Photorespiration can, however, usually be demonstrated by allowing leaves to photosynthesize in an

A. Goldsworthy

1968-01-01

139

Carbon isotopes and the oldest record of life: potential and limits  

Microsoft Academic Search

The currently available sedimentary carbon isotope record goes back to 3.85 Ga and conveys a remarkably consistent isotopic signal of biological carbon fixation based on the bias for light carbon ((superscript 12)C) exercised by common photosynthetic pathways. This holds particularly for the time segment < 3.5 Ga, whereas the older (Isua) record is blurred by a metamorphic overprint. In spite

Manfred Schidlowski

1997-01-01

140

Chemical mechanism of the high solubility pathway for the carbon dioxide free production of iron.  

PubMed

We determine the fundamental iron oxide high solubility mechanism that drives a new electrolytic pathway to iron production, and eliminates a major CO(2) emission source, for example it is produced using wind and solar energy, in a molten carbonate electrolyte, at a high rate and a low electrolysis energy. PMID:21301745

Licht, Stuart; Wu, Hongjun; Zhang, Zhonghai; Ayub, Hina

2011-02-08

141

Sources and Pathways of Particulate Organic Carbon in a Submarine Cave with Sulphur Water Springs  

Microsoft Academic Search

The origin, quality and pathways of particulate organic carbon (POC) were studied from May 1991 to May 1995 in a submarine cave (Grotta Azzurra, Tyrrhenian Sea, Italy) with warm sulphur springs that support dense mats of sulphur-oxidizing bacteria. Multifactorial sampling designs were used to specifically address: (1) differences in the quantity and quality of suspended and sedimenting particles in two

L. Airoldi; A. J. Southward; I. Niccolai; F. Cinelli

1997-01-01

142

Light- and Carbon-Signaling Pathways. Modeling Circuits of Interactions1  

PubMed Central

Here, we report the systematic exploration and modeling of interactions between light and sugar signaling. The data set analyzed explores the interactions of sugar (sucrose) with distinct light qualities (white, blue, red, and far-red) used at different fluence rates (low or high) in etiolated seedlings and mature green plants. Boolean logic was used to model the effect of these carbon/light interactions on three target genes involved in nitrogen assimilation: asparagine synthetase (ASN1 and ASN2) and glutamine synthetase (GLN2). This analysis enabled us to assess the effects of carbon on light-induced genes (GLN2/ASN2) versus light-repressed genes (ASN1) in this pathway. New interactions between carbon and blue-light signaling were discovered, and further connections between red/far-red light and carbon were modeled. Overall, light was able to override carbon as a major regulator of ASN1 and GLN2 in etiolated seedlings. By contrast, carbon overrides light as the major regulator of GLN2 and ASN2 in light-grown plants. Specific examples include the following: Carbon attenuated the blue-light induction of GLN2 in etiolated seedlings and also attenuated the white-, blue-, and red-light induction of GLN2 and ASN2 in light-grown plants. By contrast, carbon potentiated far-red-light induction of GLN2 and ASN2 in light-grown plants. Depending on the fluence rate of far-red light, carbon either attenuated or potentiated light repression of ASN1 in light-grown plants. These studies indicate the interaction of carbon with blue, red, and far-red-light signaling and set the stage for further investigation into modeling this complex web of interacting pathways using systems biology approaches.

Thum, Karen E.; Shasha, Dennis E.; Lejay, Laurence V.; Coruzzi, Gloria M.

2003-01-01

143

Pathways of carbon assimilation and ammonia oxidation suggested by environmental genomic analyses of marine Crenarchaeota.  

PubMed

Marine Crenarchaeota represent an abundant component of oceanic microbiota with potential to significantly influence biogeochemical cycling in marine ecosystems. Prior studies using specific archaeal lipid biomarkers and isotopic analyses indicated that planktonic Crenarchaeota have the capacity for autotrophic growth, and more recent cultivation studies support an ammonia-based chemolithoautotrophic energy metabolism. We report here analysis of fosmid sequences derived from the uncultivated marine crenarchaeote, Cenarchaeum symbiosum, focused on the reconstruction of carbon and energy metabolism. Genes predicted to encode multiple components of a modified 3-hydroxypropionate cycle of autotrophic carbon assimilation were identified, consistent with utilization of carbon dioxide as a carbon source. Additionally, genes predicted to encode a near complete oxidative tricarboxylic acid cycle were also identified, consistent with the consumption of organic carbon and in the production of intermediates for amino acid and cofactor biosynthesis. Therefore, C. symbiosum has the potential to function either as a strict autotroph, or as a mixotroph utilizing both carbon dioxide and organic material as carbon sources. From the standpoint of energy metabolism, genes predicted to encode ammonia monooxygenase subunits, ammonia permease, urease, and urea transporters were identified, consistent with the use of reduced nitrogen compounds as energy sources fueling autotrophic metabolism. Homologues of these genes, recovered from ocean waters worldwide, demonstrate the conservation and ubiquity of crenarchaeal pathways for carbon assimilation and ammonia oxidation. These findings further substantiate the likely global metabolic importance of Crenarchaeota with respect to key steps in the biogeochemical transformation of carbon and nitrogen in marine ecosystems. PMID:16533068

Hallam, Steven J; Mincer, Tracy J; Schleper, Christa; Preston, Christina M; Roberts, Katie; Richardson, Paul M; DeLong, Edward F

2006-03-21

144

Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor  

SciTech Connect

Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. We observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.

Younker, Jarod M [ORNL; Saito, Tomonori [ORNL; Hunt, Marcus A [ORNL; Beste, Ariana [ORNL; Naskar, Amit K [ORNL

2013-01-01

145

ENZYMOLOGY: A Trio of Transition Metals in Anaerobic CO2 Fixation  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Certain anaerobic microorganisms can gain energy and biomass using carbon monoxide or dioxide and dihydrogen as sole sources of carbon and energy. In his Perspective, Peters explains how new results by Doukov et al. illuminate the carbon dioxide fixation pathway. Doukov et al. report that the enzyme responsible for the process contains a highly unusual metal cluster, with three different transition metals including copper, in one of its active sites.

John W. Peters (Montana State University;Department of Chemistry and Biochemistry)

2002-10-18

146

A single leaf of Camellia oleifera has two types of carbon assimilation pathway, C(3) and crassulacean acid metabolism.  

PubMed

The C(4) plants, whose first product of photosynthetic CO(2) fixation is a four-carbon acid, have evolved independently many times. Crassulacean acid metabolism (CAM) is a biological mechanism known to exhibit some C(4) characteristics such as the C(3) cycle during daylight and demonstrates the C(4) cycle at night. There are also various C(3)-CAM intermediates, whose CAM pathway can be induced by environmental changes. However, neither fungus-induced CAM nor Theaceae CAM have been reported previously. Here, we show that CAM could be generated by fungus infection in Camellia oleifera Abel. young leaves, even at a location of a single leaf where the upper part had been transformed into a succulent one, while the lower part remained unchanged. The early photosynthetic products of dark-grown C. oleifera succulent leaves were malate, whereas C. oleifera normal leaves and light-grown succulent leaves incorporated most of (14)C into the primary photosynthetic product 3-phosphoglycerate. Camellia oleifera succulent leaves have a lower absolute ?(13)C value, much lower photorespiration rates and lower transpiration rates during the day than those of C. oleifera normal leaves. Like a typical CAM plant, stomata of C. oleifera succulent leaves closed during the daylight, but opened at night, and therefore had a detectable CO(2) compensation point in darkness. Net photosynthetic rates (P(n)) fluctuated diurnally and similarly with stomatal aperture. No light intensity saturation could be defined for C. oleifera succulent leaves. C(4) key enzymes in C. oleifera succulent leaves were increased at both the transcriptional/translational levels as well as at the enzyme activity level. PMID:22337600

Yuan, Ming; Xu, Fei; Wang, Shao-Dong; Zhang, Da-Wei; Zhang, Zhong-Wei; Cao, Yang; Xu, Xiao-Chao; Luo, Ming-Hua; Yuan, Shu

2012-02-14

147

A model of biogeochemical cycles of carbon, nitrogen, and phosphorus including symbiotic nitrogen fixation and phosphatase production  

Microsoft Academic Search

Global climate models have not yet considered the effects of nutrient cycles and limitation when forecasting carbon uptake by the terrestrial biosphere into the future. Using the principle of resource optimization, we here develop a new theory by which C, N, and P cycles interact. Our model is able to replicate the observed responses of net primary production to nutrient

Y.-P. Wang; B. Z. Houlton; C. B. Field

2007-01-01

148

Magnetic properties of hexanuclear lanthanide(III) clusters incorporating a central ?6-carbonate ligand derived from atmospheric CO2 fixation.  

PubMed

Three isostructural hexanuclear lanthanide(III) clusters are reported (Ln(III) = Gd, Tb, and Dy). The metallic core of each complex displays an unusual arrangement of ions, which is stabilized by a ?(6)-carbonate ligand. Magnetic studies show that the Ln(III) ions in each compound are weakly exchange coupled, with the Tb and Dy analogues displaying single-molecule-magnet behavior. PMID:22414239

Langley, Stuart K; Moubaraki, Boujemaa; Murray, Keith S

2012-03-13

149

Fixation of atmospheric CO2 by a dimeric lanthanum hydroxide complex; assembly of an unusual hexameric carbonate.  

PubMed

Exposure of the dinuclear hydroxo complex {[La(tpen)(mu-OH)]2(mu-eta1:eta1OTf)}OTf3 to air results in the immediate uptake of atmospheric CO2 affording an unusual hexanuclear lanthanum carbonato complex in which the carbonate anions are ligated in a mu3-eta1:eta1:eta2 and mu3-eta1:eta2:eta2 fashion. PMID:16474884

Natrajan, Louise; Pécaut, Jacques; Mazzanti, Marinella

2005-12-14

150

Regulation, unique gene organization, and unusual primary structure of carbon fixation genes from a marine phycoerythrin-containing cyanobacterium  

Microsoft Academic Search

Marine phycoerythrin-containing cyanobacteria are major contributors to the overall productivity of the oceans. The present study indicates that the structural genes of the carbon assimilatory system are unusually arranged and possess a unique primary structure compared to previously studied cyanobacteria. Southern blot analyses of Synechococcus sp. strain WH7803 chromosomal DNA digests, using the ribulose 1,5-bisphosphate carboxylase\\/oxygenase (Rubisco) large subunit gene

Gregory M. F. Watson; F. Robert Tabita

1996-01-01

151

Free atmospheric CO2 enrichment did not affect symbiotic N2-fixation and soil carbon dynamics in a mixed deciduous stand in Wales  

NASA Astrophysics Data System (ADS)

Through increases in net primary production (NPP), elevated CO2 is hypothesizes to increase the amount of plant litter entering the soil. The fate of this extra carbon on the forest floor or in mineral soil is currently not clear. Moreover, increased rates of NPP can be maintained only if forests can escape nitrogen limitation. In a Free atmospheric CO2 Enrichment (FACE) experiment near Bangor, Wales, 4 ambient CO2 and 4 FACE plots were planted with patches of Betula pendula, Alnus glutinosa and Fagus sylvatica on a former arable field. Four years after establishment, only a shallow L forest floor litter layer had formed due to intensive bioturbation. Total soil C and N contents increased irrespective of treatment and species as a result of afforestation. We could not detect an additional C sink in the soil, nor were soil C stabilization processes affected by FACE. We observed a decrease of leaf N content in Betula and Alnus under FACE, while the soil C/N ratio decreased regardless of CO2 treatment. The ratio of N taken up from the soil and by N2-fixation in Alnus was not affected by FACE. We infer that increased nitrogen use efficiency is the mechanism by which increased NPP is sustained under elevated CO2 at this site.

Hoosbeek, M. R.; Lukac, M.; Velthorst, E. J.; Godbold, D. L.

2010-06-01

152

Molecular comparison of carbonic anhydrase from Flaveria species demonstrating different photosynthetic pathways  

Microsoft Academic Search

During the evolution of C4 plants from C3 plants, both the function and intracellular location of carbonic anhydrase (CA) have changed. To determine whether these changes are due to changes at the molecular level, we have studied the cDNA sequences and the expression of CA from Flaveria species demonstrating different photosynthetic pathways. In leaf extracts from F. bidentis (C4), F.

Martha Ludwig; James N. Burnell

1995-01-01

153

Sources and pathways of particulate obanic carbon in a submarine cave with sulphur water springs  

Microsoft Academic Search

The origin, quality and pathways of particulate organic carbon (POC) were studied from May 1991 to May 1995 in a submarine\\u000a cave (Grotta Azzurra, Tyrrhenian Sea, Italy) with warm sulphur springs that support dense mats of sulphur-oxidizing bacteria.\\u000a Multifactorial sampling designs were used to specifically address: (1) differences in the quantity and quality of suspended\\u000a and sedimenting particles in two

L. Aairoldi; A. J. Southward; I. Niccolai; F. Cinelli

1997-01-01

154

Autotrophic Methanotrophy in Verrucomicrobia: Methylacidiphilum fumariolicumSolV Uses the Calvin-Benson-Bassham Cycle for Carbon Dioxide Fixation ? †  

PubMed Central

Genome data of the extreme acidophilic verrucomicrobial methanotroph Methylacidiphilum fumariolicumstrain SolV indicated the ability of autotrophic growth. This was further validated by transcriptome analysis, which showed that all genes required for a functional Calvin-Benson-Bassham (CBB) cycle were transcribed. Experiments with 13CH4or 13CO2in batch and chemostat cultures demonstrated that CO2is the sole carbon source for growth of strain SolV. In the presence of CH4, CO2concentrations in the headspace below 1% (vol/vol) were growth limiting, and no growth was observed when CO2concentrations were below 0.3% (vol/vol). The activity of the key enzyme of the CBB cycle, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), measured with a 13C stable-isotope method was about 70 nmol CO2fixed · min?1· mg of protein?1. An immune reaction with antibody against the large subunit of RuBisCO on Western blots was found only in the supernatant fractions of cell extracts. The apparent native mass of the RuBisCO complex in strain SolV was about 482 kDa, probably consisting of 8 large (53-kDa) and 8 small (16-kDa) subunits. Based on phylogenetic analysis of the corresponding RuBisCO gene, we postulate that RuBisCO of the verrucomicrobial methanotrophs represents a new type of form I RuBisCO.

Khadem, Ahmad F.; Pol, Arjan; Wieczorek, Adam; Mohammadi, Seyed S.; Francoijs, Kees-Jan; Stunnenberg, Henk G.; Jetten, Mike S. M.; Op den Camp, Huub J. M.

2011-01-01

155

Catalytic ozonation of sulphamethoxazole in the presence of carbon materials: catalytic performance and reaction pathways.  

PubMed

Two carbon materials (multi-walled carbon nanotubes, MWCNTs, and activated carbon) were investigated as ozonation catalysts for the mineralization of the antibiotic sulphamethoxazole (SMX). MWCNTs presented a higher catalytic performance than activated carbons, which was justified by their differences in surface chemistry and by the higher internal mass transfer resistances expected for activated carbons. 3-Amino-5-methylisoxazole and p-benzoquinone were detected as primary products of single and catalytic ozonation of SMX, whereas oxamic, oxalic, pyruvic and maleic acids were identified as refractory final oxidation products. The original sulphur of the SMX was almost completely converted to sulphate and part of the nitrogen was converted to NH4+ and NO3-. The presence of the radical scavenger tert-butanol during catalytic and single ozonation evidenced the participation of HO radicals in the oxidation mechanisms of SMX, especially in the mineralization of several intermediates. Microtox tests revealed that simultaneous use of ozone and MWCNTs originated lower acute toxicity. The time course of all detected compounds was studied and the transformation pathway for the complete mineralization of SMX by single and catalytic ozonation in the presence of the selected materials was elucidated. PMID:23009796

Gonçalves, Alexandra G; Órfão, José J M; Pereira, Manuel Fernando R

2012-09-01

156

Nitrogen- and irradiance-dependent variations of the maximum quantum yield of carbon fixation in eutrophic, mesotrophic and oligotrophic marine systems  

NASA Astrophysics Data System (ADS)

Natural variability of the maximum quantum yield of carbon fixation ( ?C max), as determined from the initial slope of the photosynthesis-irradiance curve and from light absorption measurements, was studied at three sites in the northeast tropical Atlantic representing typical eutrophic, mesotrophic and oligotrophic regimes. At the eutrophic and mesotrophic sites, where the mixed layer extended deeper than the euphotic layer, all photosynthetic parameters were nearly constant with depth, and ?C max averaged between 0.05 and 0.03 molC (mol quanta absorbed) -1, respectively. At the oligotrophic site, a deep chlorophyll maximum (DCM) existed and ?C max varied from ca 0.005 in the upper nutrient-depleted mixed layer to 0.063 below the DCM in stratified waters. firstly, ?C max was found roughly to covary with nitrate concentration between sites and with depth at the oligotrophic site, and secondly, it was found to decrease with increasing relative concentrations of non-photosynthetic pigments. The extent of ?C max variations directly related to nitrate concentration was inferred from variations in the fraction of functional PS2 reaction centers ( f), measured using fast repetition rate fluorometry. Covariations between f and nitrate concentration indicate that the latter factor may be responsible for a 2-fold variation in ?C max. Moreover, partitioning light absorption between photosynthetic and non-photosynthetic pigments suggests that the variable contribution of the non-photosynthetic absorption may explain a 3-fold variation in ?C max, as indicated by variations in the effective absorption cross-section of photosystem 2 ( ?PS2). Results confirm the role of nitrate in ?C max variation, and emphasize those of light and vertical mixing.

Babin, Marcel; Morel, André; Claustre, Hervé; Bricaud, Annick; Kolber, Zbigniew; Falkowski, Paul G.

1996-08-01

157

Free atmospheric CO2 enrichment increased above ground biomass but did not affect symbiotic N2-fixation and soil carbon dynamics in a mixed deciduous stand in Wales  

NASA Astrophysics Data System (ADS)

Through increases in net primary production (NPP), elevated CO2 is hypothesized to increase the amount of plant litter entering the soil. The fate of this extra carbon on the forest floor or in mineral soil is currently not clear. Moreover, increased rates of NPP can be maintained only if forests can escape nitrogen limitation. In a Free atmospheric CO2 Enrichment (FACE) experiment near Bangor, Wales, 4 ambient and 4 elevated [CO2] plots were planted with patches of Betula pendula, Alnus glutinosa and Fagus sylvatica on a former arable field. After 4 years, biomass averaged for the 3 species was 5497 (se 270) g m-2 in ambient and 6450 (se 130) g m-2 in elevated [CO2] plots, a significant increase of 17% (P = 0.018). During that time, only a shallow L forest floor litter layer had formed due to intensive bioturbation. Total soil C and N contents increased irrespective of treatment and species as a result of afforestation. We could not detect an additional C sink in the soil, nor were soil C stabilization processes affected by elevated [CO2]. We observed a decrease of leaf N content in Betula and Alnus under elevated [CO2], while the soil C/N ratio decreased regardless of CO2 treatment. The ratio of N taken up from the soil and by N2-fixation in Alnus was not affected by elevated [CO2]. We infer that increased nitrogen use efficiency is the mechanism by which increased NPP is sustained under elevated [CO2] at this site.

Hoosbeek, M. R.; Lukac, M.; Velthorst, E.; Smith, A. R.; Godbold, D. L.

2011-02-01

158

Carbon dioxide metabolism by Actinomyces viscosus: pathways for succinate and aspartate production.  

PubMed Central

14C-labeled bicarbonate was incorporated into trichloroacetic acid-insoluble material by cell suspensions of A. viscosus strain M100 and also into the four-carbon fermentation product, succinate, but not into the three-carbon fermentation product, lactate. The initial step in the conversion of 14C-labeled bicarbonate into both trichloroacetic acid-insoluble material and succinate was catalyzed by the enzyme phosphoenolypyruvate carboxylase, which served to convert the glycolytic intermediate, phosphoenolpyruvate, and bicarbonate to the four-carbon compound, oxalacetate. The metabolic fate of oxalacetate was its conversion to either trichloroacetic acid-insoluble material or succinate. One pathway by which oxalacetate may be metabolized into acid-insoluble material is via its conversion to the biosynthetic precursor aspartate by the action of glutamate aspartate aminotransferase. One source of the alpha-amino group of aspartate was the ammonium ion, which could be incorporated into glutamate, the substrate of the glutamate aspartate aminotransferase reaction, by the action of a reduced nicotinamide adenine dinucleotide phosphate-dependent glutamate dehydrogenase whose reducing equivalents could be derived from the nicotinamide adenine dinucleotide phosphate-dependent oxidative reactions of the hexose monophosphate pathway catalyzed by glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase. Alternatively, oxalacetate was converted to the fermentation product, succinate, through the sequential action of malate dehydrogenase, fumarase, and succinic dehydrogenase. The resolution and partial purification of phosphoenolpyruvate carboxylase, glutamate aspartate aminotransferase, glutamate dehydrogenase, malate dehydrogenase, fumarase, and succinic dehydrogenase are also reported.

Brown, A T; Breeding, L C

1980-01-01

159

Regulation of alternative CO2 fixation pathways in prokaryotic and eukaryotic photosynthetic organisms. Progress report, June 15, 1991--June 14, 1993.  

National Technical Information Service (NTIS)

The goal of this project to determine how photosynthetic microorganisms regulate the assimilation of CO(sub 2) via pathways alternative to the usual Calvin-Benson-Bassham reductive pentose phosphate scheme, particularly in the molecular basis for switches...

R. Tabita

1993-01-01

160

Central heme oxygenase-carbon monoxide pathway participates in the lipopolysaccharide-induced tolerance in rats.  

PubMed

Recently, heme oxygenase-carbon monoxide (HO-CO) pathway has been reported to be involved in the development of lipopolysaccharide (LPS) fever. However, no information exists about its participation in LPS tolerance, which is defined by an attenuation of the febrile response to repeated administrations of LPS. Thus, we tested the hypothesis that HO-CO pathway plays a role in endotoxin tolerance, which was induced by means of three consecutive LPS intraperitoneal injections (i.p.) at 24-h intervals. Body temperature (Tb) was measured by biotelemetry. Induction of the HO pathway using intracerebroventricular (i.c.v.) heme lysinate reversed tolerance, and this effect could be prevented by pretreatment with ODQ [a soluble guanylate cyclase (sGC) inhibitor; i.c.v.]. These results indicate that HO-CO pathway seems to be down-regulated during LPS tolerance, and that CO is the HO product that can prevent LPS tolerance, acting via cGMP. In further support, either biliverdine or iron (the others HO products; i.c.v.) had no effect in LPS-induced tolerance. PMID:16901472

Raffaini, Maria S; Dias, Mirela B; Branco, Luiz G S

2006-08-09

161

Enhancing Biological Nitrogen Fixation.  

National Technical Information Service (NTIS)

The report summarizes present understanding of the broad area of the chemical and biological aspects of nitrogen fixation. It suggests: (a) opportunities for increasing fixation by leguma-bacterial and other types of systems, (b) approaches toward extendi...

H. J. Evans

1975-01-01

162

Sulfide oxidation, nitrate respiration, carbon acquisition, and electron transport pathways suggested by the draft genome of a single orange Guaymas Basin Beggiatoa (Cand. Maribeggiatoa) sp. filament.  

PubMed

A near-complete draft genome has been obtained for a single vacuolated orange Beggiatoa (Cand. Maribeggiatoa) filament from a Guaymas Basin seafloor microbial mat, the third relatively complete sequence for the Beggiatoaceae. Possible pathways for sulfide oxidation; nitrate respiration; inorganic carbon fixation by both Type II RuBisCO and the reductive tricarboxylic acid cycle; acetate and possibly formate uptake; and energy-generating electron transport via both oxidative phosphorylation and the Rnf complex are discussed here. A role in nitrite reduction is suggested for an abundant orange cytochrome produced by the Guaymas strain; this has a possible homolog in Beggiatoa (Cand. Isobeggiatoa) sp. PS, isolated from marine harbor sediment, but not Beggiatoa alba B18LD, isolated from a freshwater rice field ditch. Inferred phylogenies for the Calvin-Benson-Bassham (CBB) cycle and the reductive (rTCA) and oxidative (TCA) tricarboxylic acid cycles suggest that genes encoding succinate dehydrogenase and enzymes for carboxylation and/or decarboxylation steps (including RuBisCO) may have been introduced to (or exported from) one or more of the three genomes by horizontal transfer, sometimes by different routes. Sequences from the two marine strains are generally more similar to each other than to sequences from the freshwater strain, except in the case of RuBisCO: only the Guaymas strain encodes a Type II enzyme, which (where studied) discriminates less against oxygen than do Type I RuBisCOs. Genes subject to horizontal transfer may represent key steps for adaptation to factors such as oxygen and carbon dioxide concentration, organic carbon availability, and environmental variability. PMID:24012537

Macgregor, Barbara J; Biddle, Jennifer F; Harbort, Christopher; Matthysse, Ann G; Teske, Andreas

2013-09-03

163

Mobilization pathways of organic carbon from permafrost to arctic rivers in a changing climate  

NASA Astrophysics Data System (ADS)

Arctic warming may cause the release of vast amounts of soil organic carbon (SOC) from permafrost, which will manifest itself in the fluxes and composition of organic carbon in northern rivers and Arctic coastal regions. To elucidate the transport pathways of SOC, radiocarbon composition was measured for dissolved organic carbon (DOC), particulate organic carbon (POC), sediments and SOC from the Mackenzie, Sagavanirktok, and Yukon river basins, and soil leaching experiments were conducted. The radiocarbon ages of riverine suspended POC and sediments ranged from 4430 to ~7970 yr BP, while DOC was much younger (390-1440 yr BP) except samples from the Sag River. Soil leaching experiments released <1% of SOC as DOC. The decoupling in age and partitioning between POC and DOC indicates that POC in these rivers is dominated by old SOC derived from permafrost thawing and river-bank erosion in contrast to DOC, which is more readily influenced by modern terrestrial biomass, especially in large river basins which also drain subarctic regions. These observations imply that melting of permafrost will be manifest in the age and amounts of POC in arctic rivers whereas change in DOC will reflect altered plant ecology.

Guo, Laodong; Ping, Chien-Lu; Macdonald, Robie W.

2007-07-01

164

The Influence of pCO2 and Temperature on Gene Expression of Carbon and Nitrogen Pathways in Trichodesmium IMS101  

PubMed Central

Growth, protein amount, and activity levels of metabolic pathways in Trichodesmium are influenced by environmental changes such as elevated pCO2 and temperature. This study examines changes in the expression of essential metabolic genes in Trichodesmium grown under a matrix of pCO2 (400 and 900 µatm) and temperature (25 and 31°C). Using RT-qPCR, we studied 21 genes related to four metabolic functional groups: CO2 concentrating mechanism (bicA1, bicA2, ccmM, ccmK2, ccmK3, ndhF4, ndhD4, ndhL, chpX), energy metabolism (atpB, sod, prx, glcD), nitrogen metabolism (glnA, hetR, nifH), and inorganic carbon fixation and photosynthesis (rbcL, rca, psaB, psaC, psbA). nifH and most photosynthetic genes exhibited relatively high abundance and their expression was influenced by both environmental parameters. A two to three orders of magnitude increase was observed for glnA and hetR only when both pCO2 and temperature were elevated. CO2 concentrating mechanism genes were not affected by pCO2 and temperature and their expression levels were markedly lower than that of the nitrogen metabolism and photosynthetic genes. Many of the CO2 concentrating mechanism genes were co-expressed throughout the day. Our results demonstrate that in Trichodesmium, CO2 concentrating mechanism genes are constitutively expressed. Co-expression of genes from different functional groups were frequently observed during the first half of the photoperiod when oxygenic photosynthesis and N2 fixation take place, pointing at the tight and complex regulation of gene expression in Trichodesmium. Here we provide new data linking environmental changes of pCO2 and temperature to gene expression in Trichodesmium. Although gene expression indicates an active metabolic pathway, there is often an uncoupling between transcription and enzyme activity, such that transcript level cannot usually be directly extrapolated to metabolic activity.

Levitan, Orly; Sudhaus, Stefanie; LaRoche, Julie; Berman-Frank, Ilana

2010-01-01

165

Carbon emission limits required to satisfy future representative concentration pathways of greenhouse gases  

NASA Astrophysics Data System (ADS)

The response of the second-generation Canadian earth system model (CanESM2) to historical (1850-2005) and future (2006-2100) natural and anthropogenic forcing is assessed using the newly-developed representative concentration pathways (RCPs) of greenhouse gases (GHGs) and aerosols. Allowable emissions required to achieve the future atmospheric CO2 concentration pathways, are reported for the RCP 2.6, 4.5 and 8.5 scenarios. For the historical 1850-2005 period, cumulative land plus ocean carbon uptake and, consequently, cumulative diagnosed emissions compare well with observation-based estimates. The simulated historical carbon uptake is somewhat weaker for the ocean and stronger for the land relative to their observation-based estimates. The simulated historical warming of 0.9°C compares well with the observation-based estimate of 0.76 ± 0.19°C. The RCP 2.6, 4.5 and 8.5 scenarios respectively yield warmings of 1.4, 2.3, and 4.9°C and cumulative diagnosed fossil fuel emissions of 182, 643 and 1617 Pg C over the 2006-2100 period. The simulated warming of 2.3°C over the 1850-2100 period in the RCP 2.6 scenario, with the lowest concentration of GHGs, is slightly larger than the 2°C warming target set to avoid dangerous climate change by the 2009 UN Copenhagen Accord. The results of this study suggest that limiting warming to roughly 2°C by the end of this century is unlikely since it requires an immediate ramp down of emissions followed by ongoing carbon sequestration in the second half of this century.

Arora, V. K.; Scinocca, J. F.; Boer, G. J.; Christian, J. R.; Denman, K. L.; Flato, G. M.; Kharin, V. V.; Lee, W. G.; Merryfield, W. J.

2011-03-01

166

Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria  

SciTech Connect

Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

Ferry, J.G.

1991-12-31

167

Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria  

SciTech Connect

Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

Ferry, J.G.

1991-01-01

168

13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose  

PubMed Central

Background The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions and the utilization of the respirative pathway has not been investigated on the level of in vivo fluxes. Results The biosynthetic pathways of amino acids in T. reesei supported by genome-level evidence were reconstructed with computational carbon path analysis. The pathway reconstructions were a prerequisite for analysis of in vivo fluxes. The distribution of in vivo fluxes in both wild type strain and cre1, a key regulator of carbon catabolite repression, deletion strain were quantitatively studied by performing 13C-labeling on both repressive carbon source glucose and non-repressive carbon source sorbitol. In addition, the 13C-labeling on sorbitol was performed both in the presence and absence of sophorose that induces the expression of cellulase genes. Carbon path analyses and the 13C-labeling patterns of proteinogenic amino acids indicated high similarity between biosynthetic pathways of amino acids in T. reesei and yeast Saccharomyces cerevisiae. In contrast to S. cerevisiae, however, mitochondrial rather than cytosolic biosynthesis of Asp was observed under all studied conditions. The relative anaplerotic flux to the TCA cycle was low and thus characteristic to respiratory metabolism in both strains and independent of the carbon source. Only minor differences were observed in the flux distributions of the wild type and cre1 deletion strain. Furthermore, the induction of the hydrolytic gene expression did not show altered flux distributions and did not affect the relative amino acid requirements or relative anabolic and respirative activities of the TCA cycle. Conclusion High similarity between the biosynthetic pathways of amino acids in T. reesei and yeast S. cerevisiae was concluded. In vivo flux distributions confirmed that T. reesei uses primarily the respirative pathway also when growing on the repressive carbon source glucose in contrast to Saccharomyces cerevisiae, which substantially diminishes the respirative pathway flux under glucose repression.

Jouhten, Paula; Pitkanen, Esa; Pakula, Tiina; Saloheimo, Markku; Penttila, Merja; Maaheimo, Hannu

2009-01-01

169

Using Phospholipids and Stable Carbon Isotopes to Assess Microbial Community Structures and Carbon Cycle Pathways in Kamchatka Hot Springs  

NASA Astrophysics Data System (ADS)

Phospholipid fatty acid (PLFA) and stable carbon isotopes were used to assess the microbial community structures in Kamchatka hot springs. Eighteen mats or surface sediments were collected from hot springs having temperatures of 31 to 91°C and pHs of 4.9 to 8.5. These samples were clearly separated into three groups according to the bacterial PLFA: 1) those dominated by terminally branched odd-numbered fatty acids, 2) those dominated by C18:1 and 3) those dominated by C20:1. With support from other minor PLFA components, group 2 may be used as biomarkers for Chloroflexales or other phototrophic bacteria and group 3 for Aquificales, respectively. Among the sampled hot springs, the Arkashin pool represents the simplest microbial structure with members of Aquificales being the dominant primary producers. On the other hand, the Zavarzin pool may represent the most heterogeneous pool that may include members of Chloroflexales and Aquificales as primary producers. Bacterial 16S rDNA clone libraries confirmed the presence of these microbial groups in the two pools. Results of stable carbon isotope fractionation between CO2 source, bulk biomass and total PLFA showed that primary producers in the Arkashin pool primarily used the reductive tricarboxylic acid (rTCA) cycle (e.g., members of Aquificales); whereas the Zavarzin pool may be a mixture of the 3-hydroxypropionate (3-HP) pathway (e.g. members of Chloroflexales) and the rTCA cycle. Bacterial contribution using the Calvin cycle was not significant and may be less important in Kamchatka hot springs.

Zhao, W.; Romanek, C. S.; Burgess, E. A.; Wiegel, J.; Mills, G.; Zhang, C. L.

2006-12-01

170

The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast  

SciTech Connect

The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates.

Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

2007-08-08

171

C1 Metabolism in Corynebacterium glutamicum: an Endogenous Pathway for Oxidation of Methanol to Carbon Dioxide.  

PubMed

Methanol is considered an interesting carbon source in "bio-based" microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert (13)C-labeled methanol to (13)CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

Witthoff, Sabrina; Mühlroth, Alice; Marienhagen, Jan; Bott, Michael

2013-09-06

172

Photographic fixative poisoning  

MedlinePLUS

Photographic developer poisoning; Hydroquinone poisoning; Quinone poisoning; Sulfite poisoning ... Hydroquinones Quinones Sodium thiosulfate Sodium sulfite/bisulfite Boric acid Photographic fixative can also break down (decompose) to ...

173

Constraining pathways of microbial mediation for carbonate concretions of the Miocene Monterey Formation using carbonate-associated sulfate  

NASA Astrophysics Data System (ADS)

Carbonate concretions can form as a result of organic matter degradation within sediments. However, the ability to determine specific processes and timing relationships to particular concretions has remained elusive. Previously employed proxies (e.g., carbon and oxygen isotopes) cannot uniquely distinguish among diagenetic alkalinity sources generated by microbial oxidation of organic matter using oxygen, nitrate, metal oxides, and sulfate as electron acceptors, in addition to degradation by thermal decarboxylation. Here, we employ concentrations of carbonate-associated sulfate (CAS) and ? 34S CAS (along with more traditional approaches) to determine the specific nature of concretion authigenesis within the Miocene Monterey Formation. Integrated geochemical analyses reveal that at least three specific organo-diagenetic reaction pathways can be tied to concretion formation and that these reactions are largely sample-site specific. One calcitic concretion from the Phosphatic Shale Member at Naples Beach yields ? 34S CAS values near Miocene seawater sulfate (˜+22‰ VCDT), abundant CAS (ca. 1000 ppm), depleted ? 13C carb (˜-11‰ VPDB), and very low concentrations of Fe (ca. 700 ppm) and Mn (ca. 15 ppm)—characteristics most consistent with shallow formation in association with organic matter degradation by nitrate, iron-oxides and/or minor sulfate reduction. Cemented concretionary layers of the Phosphatic Shale Member at Shell Beach display elevated ? 34S CAS (up to ˜+37‰), CAS concentrations of ˜600 ppm, mildly depleted ? 13C carb (˜-6‰), moderate amounts of Mn (ca. 250 ppm), and relatively low Fe (ca. 1700 ppm), indicative of formation in sediments dominated by sulfate reduction. Finally, concretions within a siliceous host at Montaña de Oro and Naples Beach show minimal CAS concentrations, positive ? 13C values, and the highest concentrations of Fe (ca. 11,300 ppm) and Mn (ca. 440 ppm), consistent with formation in sediments experiencing methanogenesis in a highly reducing environment. This study highlights the promise in combining CAS analysis with more traditional techniques to differentiate among diagenetic reactions as preserved in the geologic record and shows potential for unraveling subsurface biospheric processes in ancient samples with a high degree of specificity.

Loyd, Sean J.; Berelson, William M.; Lyons, Timothy W.; Hammond, Douglas E.; Corsetti, Frank A.

2012-02-01

174

Modulation of apoptotic pathways of macrophages by surface-functionalized multi-walled carbon nanotubes.  

PubMed

Biomedical applications of carbon nanotubes (CNTs) often involve improving their hydrophilicity and dispersion in biological media by modifying them through noncovalent or covalent functionalization. However, the potential adverse effects of surface-functionalized CNTs have not been well characterized. In this study, we functionalized multi-walled CNTs (MWCNTs) via carboxylation, to produce MWCNTs-COOH, and via poly (ethylene glycol) linking, to produce MWCNTs-PEG. We used these functionalized MWCNTs to study the effect of surface functionalization on MWCNTs-induced toxicity to macrophages, and elucidate the underlying mechanisms of action. Our results revealed that MWCNTs-PEG were less cytotoxic and were associated with less apoptotic cell death of macrophages than MWCNTs-COOH. Additionally, MWCNTs-PEG induced less generation of reactive oxygen species (ROS) involving less activation of NADPH oxidase compared with MWCNTs-COOH, as evidenced by membrane translocation of p47(phox) and p67(phox) in macrophages. The less cytotoxic and apoptotic effect of MWCNTs-PEG compared with MWCNTs-COOH resulted from the lower cellular uptake of MWCNTs-PEG, which resulted in less activation of oxidative stress-responsive pathways, such as p38 mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-?B. These results demonstrate that surface functionalization of CNTs may alter ROS-mediated cytotoxic and apoptotic response by modulating apoptotic signaling pathways. Our study thus provides new insights into the molecular basis for the surface properties affecting CNTs toxicity. PMID:23755279

Jiang, Yuanqin; Zhang, Honggang; Wang, Yange; Chen, Min; Ye, Shefang; Hou, Zhenqing; Ren, Lei

2013-06-06

175

Candidate pathway polymorphisms in one-carbon metabolism and risk of rectal tumor mutations  

PubMed Central

We examined candidate polymorphisms in genes involved in the folate-mediated, one-carbon metabolism pathway, DNMT1 1311V, MTHFD1 R134K and R653Q, MTHFR R594Q, MTR D919G, MTRR H595Y and I22M, SHMT1 L474F, SLC19A1 H27R, and TDG G199S, and associations with rectal tumor characteristics. We hypothesized that these candidate genes would influence CpG Island Methylator Phenotype and potentially KRAS2 or TP53 tumors. Data from a population-based study of 747 rectal cases (593 with tumor markers) and 956 controls were evaluated using generalized estimating equations. We observed an increased risk of TP53 tumor mutations in homozygous carriers of the MTHFD1 134K allele (0R=2.0, 95%CI 1.2-3.1, P- trend=0.02). In the presence of low folate intake, the R134K variant was associated with increased risk of CIMP+ tumors (OR=2.8, 95%CI 1.04-7.7). The MTRR I22M variant genotype was associated with a modest increased risk of TP53 mutations (OR=1.7, 95%CI 1.2-2.5, P-trend=0.001). Our findings offer limited support that polymorphisms in one-carbon metabolism genes influence rectal tumor phenotype, and that folate may interact with MTHFD1 to alter CIMP+ risk.

Curtin, Karen; Ulrich, Cornelia M; Samowitz, Wade S; Wolff, Roger K; Duggan, David J; Makar, Karen W; Caan, Bette J; Slattery, Martha L

2011-01-01

176

Tight coupling of root-associated nitrogen fixation and plant photosynthesis in the salt marsh grass Spartina alterniflora and carbon dioxide enhancement of nitrogenase activity.  

PubMed Central

The coupling of root-associated nitrogen fixation and plant photosynthesis was examined in the salt marsh grass Spartina alterniflora. In both field experiments and hydroponic assay chambers, nitrogen fixation associated with the roots was rapidly enhanced by stimulating plant photosynthesis. A kinetic analysis of acetylene reduction activity (ARA) showed that a five-to sixfold stimulation occurred within 10 to 60 min after the plant leaves were exposed to light or increased CO2 concentrations (with the light held constant). In field experiments, CO2 enrichment increased plant-associated ARA by 27%. Further evidence of the dependence of ARA on plant photosynthate was obtained when activity in excised roots was shown to decrease after young greenhouse plants were placed in the dark. Seasonal variation in the ARA of excised plant roots from field cores appears to be related to the annual cycle of net photosynthesis in S. alterniflora. Images

Whiting, G J; Gandy, E L; Yoch, D C

1986-01-01

177

The ? 8Desaturase of Euglena gracilis:An Alternate Pathway for Synthesis of 20Carbon Polyunsaturated Fatty Acids  

Microsoft Academic Search

Desaturation of fatty acids is an important metabolic process. In mammals, 20-carbon and longer polyunsaturated fatty acids are not only incorporated into cellular membranes in a tissue-specific manner, but also serve as the precursors to synthesis of eicosanoid metabolic regulators. The processes of desaturation and elongation in human liver are well characterized, but an alternate ?8desaturation pathway that may be

James G. Wallis; John Browse

1999-01-01

178

POLYMORPHISMS IN THE ONE-CARBON METABOLIC PATHWAY, PLASMA FOLATE LEVELS AND COLORECTAL CANCER IN A PROSPECTIVE STUDY  

Technology Transfer Automated Retrieval System (TEKTRAN)

One-carbon (e.g., folate) metabolism plays a pivotal role in the etiology of colorectal cancer (CRC). Cytosolic serine hydroxymethyltransferase (cSHMT), methylenetetrahydrofolate dehydrogenase (MTHFD1) and glutamate carboxypeptidase II (GCPII) are key genes involved in this pathway. Several new poly...

179

Guide to radiation fixatives  

SciTech Connect

This report identifies and then characterizes a variety of substances available in the market place for potential effectiveness as a fixative on radiologically contaminated surfaces. The substances include both generic chemicals and proprietary products. In selecting a fixative for a particular application, several attributes of the fixative may be relevant to the choice. These attributes include: toxicity, durability, and cleanliness and removability. In addition to the attributes of the fixative, one should also take into account certain characteristics of the site to be treated. These characteristics relate to climate, nature of the surface, use to which the treated surface will be put, subsequent cleanup operations, and type of neighboring surfaces. Finally, costs and potential environmental effects may influence the decision. A variety of fixatives are evaluated with respect to these various attributes and summarized in a reference table.

Tawil, J.J.; Bold, F.C.

1983-11-01

180

Effects of Carbon Dioxide and Oxygen on the Regulation of Photosynthetic Carbon Metabolism by Ammonia in Spinach Mesophyll Cells 1  

PubMed Central

Photosynthetic carbon metabolism of isolated spinach mesophyll cells was characterized under conditions favoring photorespiratory (PR; 0.04% CO2 and 20% O2) and nonphotorespiratory (NPR; 0.2% CO2 and 2% O2) metabolism, as well as intermediate conditions. Comparisons were made between the metabolic effects of extracellularly supplied NH4+ and intracellular NH4+, produced primarily via PR metabolism. The metabolic effects of 14CO2 fixation under PR conditions were similar to perturbations of photosynthetic metabolism brought about by externally supplied NH4+; both increased labeling and intracellular concentrations of glutamine at the expense of glutamate and increased anaplerotic synthesis through ?-ketoglutarate. The metabolic effects of added NH4+ during NPR fixation were greater than those during PR fixation, presumably due to lower initial NH4+ levels during NPR fixation. During PR fixation, addition of ammonia caused decreased pools and labeling of glutamate and serine and increased glycolate, glyoxylate, and glycine labeling. The glycolate pathway was thus affected by increased rates of carbon flow and decreased glutamate availability for glyoxylate transamination, resulting in increased usage of serine for transamination. Sucrose labeling decreased with NH4+ addition only during PR fixation, suggesting that higher photosynthetic rates under NPR conditions can accommodate the increased drain of carbon toward amino acid synthesis while maintaining sucrose synthesis.

Lawyer, Arthur L.; Cornwell, Karen L.; Larsen, Peder O.; Bassham, James A.

1981-01-01

181

Multiwall Carbon Nanotubes Mediate Macrophage Activation and Promote Pulmonary Fibrosis Through TGF-?/Smad Signaling Pathway.  

PubMed

Multiwall carbon nanotubes (MWCNTs) have been widely used in many disciplines due to their unique physical and chemical properties, but have also raised great concerns about their possible negative health impacts, especially through occupational exposure. Although recent studies have demonstrated that MWCNTs induce granuloma formation and/or fibrotic responses in the lungs of rats or mice, their cellular and molecular mechanisms remain largely unaddressed. Here, it is reported that the TGF-?/Smad signaling pathway can be activated by MWCNTs and play a critical role in MWCNT-induced pulmonary fibrosis. Firstly, in vivo data show that spontaneously hypertensive (SH) rats administered long MWCNTs (20-50 ?m) but not short MWCNTs (0.5-2 ?m) exhibit increased fibroblast proliferation, collagen deposition and granuloma formation in lung tissue. Secondly, the in vivo experiments also indicate that only long MWCNTs can significantly activate macrophages and increase the production of transforming growth factor (TGF)-?1, which induces the phosphorylation of Smad2 and then the expression of collagen I/III and extracellular matrix (ECM) protease inhibitors in lung tissues. Finally, the present in vitro studies further demonstrate that the TGF-?/Smad signaling pathway is indeed necessary for the expression of collagen III in fibroblast cells. Together, these data demonstrate that MWCNTs stimulate pulmonary fibrotic responses such as fibroblast proliferation and collagen deposition in a TGF-?/Smad-dependent manner. These observations also suggest that tube length acts as an important factor in MWCNT-induced macrophage activation and subsequent TGF-?1 secretion. These in vivo and in vitro studies further highlight the potential adverse health effects that may occur following MWCNT exposure and provide a better understanding of the cellular and molecular mechanisms by which MWCNTs induce pulmonary fibrotic reactions. PMID:23650105

Wang, Peng; Nie, Xin; Wang, Yue; Li, Yang; Ge, Cuicui; Zhang, Lili; Wang, Liming; Bai, Ru; Chen, Zhiyun; Zhao, Yuliang; Chen, Chunying

2013-05-01

182

Catabolite regulation of the pta gene as part of carbon flow pathways in Bacillus subtilis.  

PubMed

In Bacillus subtilis, the products of the pta and ackA genes, phosphotransacetylase and acetate kinase, play a crucial role in the production of acetate, one of the most abundant by-products of carbon metabolism in this gram-positive bacterium. Although these two enzymes are part of the same pathway, only mutants with inactivated ackA did not grow in the presence of glucose. Inactivation of pta had only a weak inhibitory effect on growth. In contrast to pta and ackA in Escherichia coli, the corresponding B. subtilis genes are not cotranscribed. Expression of the pta gene was increased in the presence of glucose, as has been reported for ackA. The effects of the predicted cis-acting catabolite response element (CRE) located upstream from the promoter and of the trans-acting proteins CcpA, HPr, Crh, and HPr kinase on the catabolite regulation of pta were investigated. As for ackA, glucose activation was abolished in ccpA and hprK mutants and in the ptsH1 crh double mutant. Footprinting experiments demonstrated an interaction between CcpA and the pta CRE sequence, which is almost identical to the proposed CRE consensus sequence. This interaction occurs only in the presence of Ser-46-phosphorylated HPr (HPrSer-P) or Ser-46-phosphorylated Crh (CrhSer-P) and fructose-1,6-bisphosphate (FBP). In addition to CcpA, carbon catabolite activation of the pta gene therefore requires at least two other cofactors, FBP and either HPr or Crh, phosphorylated at Ser-46 by the ATP-dependent Hpr kinase. PMID:10559153

Presecan-Siedel, E; Galinier, A; Longin, R; Deutscher, J; Danchin, A; Glaser, P; Martin-Verstraete, I

1999-11-01

183

Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway.  

PubMed

Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 ± 0.026 ng/mL for 1 mg/L, 0.21 ± 0.024 ng/mL for 5 mg/L, and 0.27 ± 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 ± 0.01 ng/mL for 1 mg/L, 0.12 ± 0.017 ng/mL for 5 mg/L, and 0.17 ± 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus. PMID:24039418

Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian

2013-08-30

184

Complementary pathways of dissolved organic carbon removal pathways in clear-water Amazonian ecosystems: photochemical degradation and bacterial uptake  

Microsoft Academic Search

Dissolved organic carbon (DOC) photochemical reactions establish important links between DOC and planktonic bacteria. We hypothesize that seasonal changes in DOC quality, related to the flood pulse, drive the effects of light-DOC interactions on uptake by planktonic bacteria uptake in clear-water Amazonian ecosystems. Water samples from two ecosystems (one lake and one stream) were incubated in sunlight during different hydrological

M. Amado; Vinicius F. Farjalla; Francisco de A. Esteves; Reinaldo L. Bozelli; F ´ abio Roland; Alex Enrich-Prast

185

Clinical significance of the pallidoreticular pathway in patients with carbon monoxide intoxication.  

PubMed

Whereas globus pallidus lesions resulting from carbon monoxide intoxication have been extensively described in the literature, the clinical significance of pallidoreticular lesions has rarely been mentioned. This study incorporated information from functional and structural imaging to explore the correlations of pallidoreticular lesions with parkinsonian features and neurobehavioural performance. Twenty-five patients (11 males) with globus pallidus lesions after carbon monoxide intoxication and 25 age- and sex-matched controls were enrolled for detailed neurological examinations, cognitive testing, susceptibility weighted imaging, diffusion tensor imaging and 99mTc-TRODAT-1 single photon emission computed tomography. The post-processing analysis of the neuroimaging included voxel-based morphometry to assess the regional atrophy, tract-based spatial statistics related to white matter involvement, tractography to investigate the rostral and caudal projections from the midbrain level and specific uptake ratios of 99mTc-TRODAT-1 for presynaptic dopaminergic transporter activity. In susceptibility weighted imaging, low-intensity pallidoreticular lesions were detected from the minimal-intensity projections, which were visible in only 7.7% of the T(1)-weighted images and 15.4% of the T(2)-weighted images, whereas inhomogeneous intensities were detected in the globus pallidus. The patients were further divided into two subgroups based on the presence (n = 13) or absence (n = 12) of pallidoreticular lesions. The patients with pallidoreticular lesions showed increased parkinsonian features, poorer performances on the neuropsychiatric tests, lower 99mTc-TRODAT-1 availability in both the caudate and the putamen and greater atrophy of the thalamus, posterior corpus callosum, cerebral peduncle and white matter surrounding the globus pallidus compared to those without pallidoreticular lesions. The tractography results obtained with seed regions of interest in the substantia nigra showed rostral projections to the supplementary motor cortex and anterior cingulate cortex via the globus pallidus; the two pathways were distinct but ran in parallel, caudal to the level of the globus pallidus. In conclusion, the presence of pallidoreticular lesions after carbon monoxide intoxication indicates a poorer cognitive state, which is associated with extensive grey and white matter damage in addition to the damage to the nigra-striatal neuronal networks. The presence of parkinsonian features may be related to pallidal and presynaptic dopaminergic dysfunction. The sensitivity for detecting pallidoreticular lesions can be greatly improved by using susceptibility weighted imaging compared with conventional imaging. PMID:22094539

Chang, Chiung-Chih; Chang, Wen-Neng; Lui, Chun-Chung; Huang, Shu-Hua; Lee, Chen-Chang; Chen, Ching; Wang, Jiun-Jie

2011-11-16

186

Internal Fixation for Fractures  

MedlinePLUS

... American Academy of Orthopaedic Surgeons Internal Fixation for Fractures When members of the American Academy of Orthopaedic ... bones together. Can be used alone to treat fractures of small bones, such as those found in ...

187

Heme oxygenase\\/carbon monoxide system participates in regulating wheat seed germination under osmotic stress involving the nitric oxide pathway  

Microsoft Academic Search

To investigate the mechanism and signaling pathway of carbon monoxide (CO) and hematin in alleviating seed germination inhibition and lipid peroxidation, polyethylene glycol-6000 (PEG) was used to mimic osmotic stress in a series of experiments. The results showed that wheat seeds pretreated with a lower dose of PEG (12.5%) showed higher tolerance against osmotic stress as well as the up-regulation

Yahui Liu; Sheng Xu; Tengfang Ling; Langlai Xu; Wenbiao Shen

2010-01-01

188

Dissolved CO2 in small catchment streams of eastern Amazonia: A minor pathway of terrestrial carbon loss  

Microsoft Academic Search

Production of carbon dioxide (CO2) in soils can lead to supersaturation of dissolved free CO2 (pCO2) in groundwater, which later evades to the atmosphere as groundwater enters streams and rivers. This process could be a significant pathway for return of terrestrially fixed C to the atmosphere. We measured pCO2 monthly over two years at multiple stations along three streams from

Eric A. Davidson; Ricardo O. Figueiredo; Daniel Markewitz; Anthony K. Aufdenkampe

2010-01-01

189

Multiwalled carbon nanotubes activate NF ? B and AP1 signaling pathways to induce apoptosis in rat lung epithelial cells  

Microsoft Academic Search

Our previous report on multiwall carbon nanotubes (MWCNT) has demonstrated the generation of reactive radicals and depletion\\u000a of intracellular antioxidants which in turn cause cell death through activation of caspases. The molecular mechanism of cellular\\u000a death due to MWCNT is not clear yet. In this study, we investigated the signaling pathways implicated in MWCNT-induced apoptosis\\u000a in rat lung epithelial cells.

Prabakaran Ravichandran; Sudhakar Baluchamy; Bindhu Sadanandan; Ramya Gopikrishnan; Santosh Biradar; Vani Ramesh; Joseph C. Hall; Govindarajan T. Ramesh

2010-01-01

190

Measurement of black carbon at Syowa station, Antarctica: seasonal variation, transport processes and pathways  

NASA Astrophysics Data System (ADS)

Measurement of black carbon (BC) was carried out at Syowa station Antarctica (69° S, 39° E) from February 2004 until January 2007. The BC concentration at Syowa ranged from below detection to 176 ng m-3 during the measurements. Higher BC concentrations were observed mostly under strong wind (blizzard) conditions due to the approach of a cyclone and blocking event. The BC-rich air masses traveled from the lower troposphere of the Atlantic and Indian Oceans to Syowa (Antarctic coast). During the summer (November-February), the BC concentration showed a diurnal variation together with surface wind speed and increased in the katabatic wind from the Antarctic continent. Considering the low BC source strength in the Antarctic continent, the higher BC concentration in the continental air (katabatic wind) might be caused by long range transport of BC via the free troposphere from mid- and low- latitudes. The seasonal variation of BC at Syowa had a maximum in August, while at the other coastal stations (Halley, Neumayer, and Ferraz) and the continental station (Amundsen-Scott), the maximum occurred in October. This difference may result from different transport pathways and scavenging of BC by precipitation during the transport from the source regions. During the austral summer, long-range transport of BC via the free troposphere is likely to make an important contribution to the ambient BC concentration. The BC transport flux indicated that BC injection into the Antarctic region strongly depended on the frequency of storm (blizzard) conditions. The seasonal variation of BC transport flux increased by 290 mg m-2 month-1 in winter-spring when blizzards frequently occurred, whereas the flux decreased to lower than 50 mg m-2 month-1 in the summer with infrequent blizzards.

Hara, K.; Osada, K.; Yabuki, M.; Hayashi, M.; Yamanouchi, T.; Shiobara, M.; Wada, M.

2008-05-01

191

Role of the haeme oxygenase/carbon monoxide pathway in mechanical nociceptor hypersensitivity  

PubMed Central

The cleavage of haeme by haeme oxygenase (HO) yields carbon monoxide (CO), a biologically active molecule which exerts most of its effects via activation of soluble guanylate cyclase (sGC). In the present study, we tested the hypothesis that endogenous CO could modulate inflammatory hyperalgesia. The intensity of hyperalgesia was investigated in a model of mechanical nociceptor hypersensitivity in rats.The intra-plantar (i.pl.) administration of the HO inhibitor, ZnDPBG (Zinc deuteroporphyrin 2,4-bis glycol), potentiated in a dose-dependent manner the mechanical nociceptor hypersensitivity evoked by i.pl. administration of carrageenan.The mechanical hypersensitivity evoked by i.pl. injection of interleukin-1? (IL-1?), tumour necrosis factor-? (TNF-?), but not interleukin-8 (IL-8), prostaglandin E2 (PGE2) or dopamine, was also enhanced by ZnDPBG.Moreover, the haeme (HO substrate) injection in the paws reduced the hypersensitivity evoked by IL-1?, but not PGE2. Furthermore, i.pl. administration of the gas CO reduced the hypersensitivity elicited by PGE2.The inhibitory effect of haeme and CO upon mechanical nociceptor hypersensitivity were counteracted by a soluble guanylate cyclase (sGC) inhibitor, ODQ (1H-[1,2,4]-oxadiazolo[4,3-a]quinoxalin-1-one), suggesting that this effect of CO is mediated via cyclic GMP.Finally, the inhibitory effect of CO upon mechanical nociceptor hypersensitivity was prevented by the NO synthase blocker, L-NMMA (NG-monomethyl L-arginine), suggesting that the impairment of mechanical hypersensitivity elicited by CO depends on the integrity of the NO pathway.In conclusion, the results presented in this paper imply that endogenously CO produced by HO plays an anti-hyperalgesic role in inflamed paws, probably by increasing the intracellular levels of cyclic GMP in the primary afferent neurone.

Steiner, A A; Branco, L G S; Cunha, F Q; Ferreira, S H

2001-01-01

192

Heme oxygenase/carbon monoxide pathway inhibition plays a role in ameliorating fibrosis following splenectomy.  

PubMed

Splenectomy is a recognized therapy for liver cirrhosis with splenomegaly, since it decreases free iron concentration that accompanies the destruction of red blood cells. Heme oxygenase (HO)-1 and its by-products, iron and carbon monoxide (CO), play crucial roles in hepatic fibrosis. The aim of the present study was to determine whether splenectomy in cirrhotic rats induced by bile duct ligation (BDL), through the HO/CO pathway, could slow down the development of liver fibrosis. Male Sprague-Dawley rats were divided randomly into the sham, BDL, splenectomy, Fe, zinc protoporphyrin (Znpp) and cobalt protoporphyrin (Copp) treatment groups, for inhibiting and inducing HO-1 expression. The level of HO-1 was detected by western blot analysis and reverse transcription-polymerase chain reaction. Serum carboxyhemoglobin (COHb), iron and portal vein pressure (PVP) were also quantified. Liver iron was measured by atomic absorption spectrometry with acetylene-air flame atomization. HO-1 and ?-smooth muscle actin (?-SMA) were localized by immunohistochemistry. Liver and spleen iron were visualized by Perls' Prussian blue staining. Hepatic fibrosis was assessed using hematoxylin and eosin (H&E) staining. Enzyme-linked immunosorbent assay (ELISA) was used to detect serum transforming growth factor-?1 (TGF-?1). The results showed that liver, spleen and serum levels of HO-1, COHb and iron were greatly enhanced in the BDL group compared with the sham group; they were reduced following splenectomy and Znpp treatment, but were elevated in the Copp and Fe groups. Hydroxyproline, TGF-?1, ?-SMA, PVP and malonaldehyde levels were lower in the splenectomy and Znpp groups compared to BDL, while higher levels were observed in the Copp and Fe-treated groups. Our study shows that splenectomy reduces iron and CO levels in part by reducing HO-1 expression, and it decreases portal pressure and slightly decreases hepatic fibroproliferation. PMID:23525258

Wang, Qiu-Ming; Duan, Zhi-Jun; Du, Jian-Ling; Guo, Shi-Bin; Sun, Xiao-Yu; Liu, Zhen

2013-03-20

193

Synthetic Pathway for Production of Five-Carbon Alcohols from Isopentenyl Diphosphate  

PubMed Central

Synthetic biological pathways could enhance the development of novel processes to produce chemicals from renewable resources. On the basis of models that describe the evolution of metabolic pathways and enzymes in nature, we developed a framework to rationally identify enzymes able to catalyze reactions on new substrates that overcomes one of the major bottlenecks in the assembly of a synthetic biological pathway. We verified the framework by implementing a pathway with two novel enzymatic reactions to convert isopentenyl diphosphate into 3-methyl-3-butenol, 3-methyl-2-butenol, and 3-methylbutanol. To overcome competition with native pathways that share the same substrate, we engineered two bifunctional enzymes that redirect metabolic flux toward the synthetic pathway. Taken together, our work demonstrates a new approach to the engineering of novel synthetic pathways in the cell.

Chou, Howard H.

2012-01-01

194

Enzymological and Genetic Studies of One-Carbon Reactions in the Pathway of Acetate Utilization by Methanogenic Bacteria. Annual Report February 1986-December 1986.  

National Technical Information Service (NTIS)

The project focused on determining the biochemical pathway and mechanisms of acetate conversion to methane in methanogenic bacteria. A corrinoid cofactor was discovered in the carbon monoxide dehydrogenase complex previously shown to be involved in the pa...

J. G. Ferry

1987-01-01

195

Carbon and nitrogen uptake in the South Pacific Ocean: evidence for efficient dinitrogen fixation and regenerated production leading to large accumulation of dissolved organic matter in nitrogen-depleted waters  

NASA Astrophysics Data System (ADS)

A major goal of the BIOSOPE cruise on the R/V Atalante to the South Pacific Ocean (conducted in October-November 2004) was to establish rate of productivity along a longitudinal section across the oligotrophic South Pacific Gyre (SPG), and compared these measurements with those obtained in nutrient-repleted waters from Chilean upwelling and around Marquesas Islands. A dual 13C/15N isotopic technique was used to estimate rates of carbon fixation, inorganic nitrogen uptake (including dinitrogen fixation), ammonium (NH4) and nitrate (NO3) regeneration, and dissolved organic nitrogen (DON) release resulting from both NH4 and NO3 uptake. The SPG had revealed the lowest rates of primary production (0.1 gC.m-2.d-1), while rates were 7 to 20 fold higher around the Marquesas Islands and in the Chilean upwelling, respectively. In this very low productive area, most of primary production was sustained by active regeneration processes which fuelled up to 95% of the biological nitrogen demand. Since nitrification was very active in the surface layer and often balanced the biological demand of nitrate, dinitrogen fixation, although acting at low daily rate (?1-2 nmoles l-1d-1), sustained the main part of new production. Then, new production in the SPG (0.008±0.007 gC m-2.d-1) was two orders of magnitude lower than this measured in the upwelling where it essentially sustained by nitrate (0.69±0.49 gC.m-2.d-1). In the whole investigated region, the percentage of nitrogen release as DON represented a large part of the inorganic nitrogen uptake (13-15% in average), and reaching 26-41% in the SPG where the production of DON appeared to be a major part of the nitrogen cycle. Due to the lack of annual vertical mixing and very low lateral advection, the high release rates could explain the large accumulation of dissolved organic matter observed in the nitrogen-depleted and low productive waters of the South Pacific Gyre.

Raimbault, P.; Garcia, N.

2007-10-01

196

French Guiana Fluidized Muds: Predominant Sulfur Transformation Pathways and Prokaryotic Players in a Coupled System of Carbon-Sulfur-Metal Biogeochemical Cycling.  

NASA Astrophysics Data System (ADS)

The fluidized mud ecosystem off French Guiana coast is a unique and globally important sedimentary environment characterized by intense physical reworking and rapid turnover of major biogeochemical elements. Here we assess the major pathways of carbon cycling focusing on the transformation of sulfur species and major prokaryotic participants. The depth distribution of organic carbon oxidation rates was determined for ~100 cm long cores collected off the French Guiana coast. Total organic carbon oxidation rates inferred from accumulation of inorganic carbon during a 3-6 month incubation series were elevated at the surface and decreased with depth. A similar incubation approach was applied for estimation of ferric reduction|oxidation rates. Short- chain fatty acid degradation rates and dark carbon dioxide rates were determined with 14C radiolabeled acetate and carbon dioxide, respectively, which both decreased with depth. The rates for sulfate and elemental sulfur transformation pathways were determined using 35S radiolabeled sulfur species with and without the presence of molybdate. Proposed microbially-mediated biogeochemical pathways were confirmed by MPN measurements of sulfate-, sulfur- and iron-reducing heterotrophic bacteria. Autotrophic bacteria were less numerous and their numbers did not directly correlate with rates of specific biogeochemical pathways. With most carbon oxidation accounted for by sulfur species - and ferric iron respiration, corresponding microbial groups may play a significant role in regulation of the net balance of organic carbon mineralization. Experimental results imply that auto- and heterotrophy likely coexist simultaneously and, thus participate in the internal carbon cycling in this environment.

Luzan, T.; Chistoserdov, A. Y.; Aller, J. Y.; Aller, R. C.

2008-12-01

197

Nitrogen fixation in peanut nodules during dark periods and detopped conditions with special reference to lipid bodies  

SciTech Connect

The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of {beta}-oxidation pathway and glyoxylate cycle is shown by the release of {sup 14}CO{sub 2} from {sup 14}C lineoleoyl coenzyme A by the nodule homogenate.

Siddique, A.M.; Bal, A.K. (Memorial Univ. of Newfoundland, St. John's (Canada))

1991-03-01

198

Transsacral fixation for failed posterior fixation of the pelvic ring  

Microsoft Academic Search

Introduction: In the treatment of certain pelvic ring pathologies (non-unions and failure of ilio-sacral screw fixation) trans-sacral\\u000a fixation (i.e. fixation from iliac wing to the other traversing the body of S1) may be necessary. The purpose of our study\\u000a was to describe our early experience and describe the surgical technique. Materials and methods: Seven cases of trans-sacral fixation were identified

Paul E. Beaulé; John Antoniades; Joel M. Matta

2006-01-01

199

Variable fixation of staphylococcal slime by different histochemical fixatives  

Microsoft Academic Search

A variety of histochemical fixatives were used to compare the fixation of bacterial films produced by a standard slime-producing strain ofStaphylococcus epidermidis on plastic tissue culture plates. Some reagents were completely ineffective in fixing the slime layer, whereas others gave variable results. The best alternative to the fixative of the reference method, the potentially explosive Bouin's reagent, was air drying.

L. Baldassarri; W. A. Simpson; G. Donelli; G. D. Christensen

1993-01-01

200

A batch study on the bio-fixation of carbon dioxide in the absorbed solution from a chemical wet scrubber by hot spring and marine algae.  

PubMed

Carbon dioxide mass transfer is a key factor in cultivating micro-algae except for the light limitation of photosynthesis. It is a novel idea to enhance mass transfer with the cyclic procedure of absorbing CO(2) with a high performance alkaline abosorber such as a packed tower and regenerating the alkaline solution with algal photosynthesis. Hence, the algae with high affinity for alkaline condition must be purified. In this study, a hot spring alga (HSA) was purified from an alkaline hot spring (pH 9.3, 62 degrees C) in Taiwan and grows well over pH 11.5 and 50 degrees C. For performance of HSA, CO(2) removal efficiencies in the packed tower increase about 5-fold in a suitable growth condition compared to that without adding any potassium hydroxide. But ammonia solution was not a good choice for this system with regard to carbon dioxide removal efficiency because of its toxicity on HSA. In addition, HSA also exhibits a high growth rate under the controlled pHs from 7 to 11. Besides, a well mass balance of carbon and nitrogen made sure that less other byproducts formed in the procedure of carboxylation. For analysis of some metals in HSA, such as Mg, Mn, Fe, Zn, related to the photosynthesis increased by a rising cultivated pH and revealed that those metals might be accumulated under alkaline conditions but the growth rate was still limited by the ratio of bicarbonate (useful carbon source) and carbonate. Meanwhile, Nannochlopsis oculta (NAO) was also tested under different additional carbon sources. The results revealed that solutions of sodium/potassium carbonate are better carbon sources than ammonia carbonate/bicarbonate for the growth of NAO. However, pH 9.6 of growth limitation based on sodium was lower than one of HSA. The integrated system is, therefore, more feasible to treat CO(2) in the flue gases using the algae with higher alkaline affinity such as HSA in small volume bioreactors. PMID:16860839

Hsueh, H T; Chu, H; Yu, S T

2006-07-24

201

Fixative for fixing biological materials  

US Patent & Trademark Office Database

A fixative for fixing biological materials contains a depot agent, preferably a polyamine and especially hexamethylenetetramine, which reacts chemically with positively charged ions, especially H+ from an acid, while forming a fixative, where the fixative is an aldehyde and especially formaldehyde, which in turn reacts chemically with the biological material to be fixed in order to fix it and is consumed in doing so. By adjusting the pH of a solution containing the depot agent, a chemical equilibrium reaction occurs between the depot agent, fixative and biological material, so that just as much fixative is continuously formed as can be immediately consumed by the biological material. With that, the fixative, and especially the hazardous formaldehyde, cannot escape. Thus, an externally formaldehyde-free fixative that at the same time has the excellent fixative properties of formaldehyde is created.

Szabados; Andreas (Grunwald, DE); Gerigk; Roberto (Muhldorf a. Inn, DE)

2011-03-29

202

Historical and future anthropogenic emission pathways derived from coupled climate–carbon cycle simulations  

Microsoft Academic Search

Using a coupled climate–carbon cycle model, fossil fuel carbon dioxide (CO2) emissions are derived through a reverse approach of prescribing atmospheric CO2 concentrations according to observations and future projections, respectively. In the second half of the twentieth century,\\u000a the implied fossil fuel emissions, and also the carbon uptake by land and ocean, are within the range of observational estimates.\\u000a Larger

Erich Roeckner; M. A. Giorgetta; T. Crueger; M. Esch; Julia Pongratz

2011-01-01

203

Re-engineering of carbon fixation in plants - challenges for plant biotechnology to improve yields in a high-CO2 world.  

PubMed

Source and sink strength control plant carbon gain and yield. Source strength was recently engineered by modifying the large subunit of Rubisco, replacing the small subunit, and creating improved thermostable Rubisco activases. This technological breakthrough makes Rubisco engineering feasible at last. Enhancement of leaf transitory starch synthesis or induction of artificial sinks in leaves increased biomass and yield. Importantly, such approaches also had a positive feedback on source strength. In addition, novel targets for the improvement of carbon gain in crops have been identified that are especially relevant in the light of climate change. PMID:22261558

Peterhansel, Christoph; Offermann, Sascha

2012-01-17

204

The Fixation of Nitrogen.  

ERIC Educational Resources Information Center

|Discusses the fixation of atmospheric nitrogen in the form of ammonia as one of the foundations of modern chemical industry. The article describes ammonia production and synthesis, purifying the hydrogen-nitrogen mix, nitric acid production, and its commericial plant. (HM)|

Andrew, S. P. S.

1978-01-01

205

Nitrogen Fixation by Gloeocapsa  

Microsoft Academic Search

The continuous growth in a medium free of combined nitrogen and the experimental production of ethylene via acetylene reduction indicate that nitrogen fixation by blue-green algae is not solely confined to filamentous genera with heterocysts. Axenic cultures of Gloeocapsa sp., adapted to nitrate-free medium, form ethylene at rates comparable to those of species known to fix nitrogen.

J. T. Wyatt; J. K. G. Silvey

1969-01-01

206

Translaminar Facet Screw Fixation  

Microsoft Academic Search

significantly longer than that used by both Boucher and King due to an entry point at the base of the contralateral spinous process. This improves the technique by increasing the ef- fective working length of the screw on both sides of the facet joint resulting in increased strength of the fixation. This review focuses on the advantages of translaminar facet

Rick C. Sasso; Natalie M. Best

207

Successional changes in soil nitrogen availability, non-symbiotic nitrogen fixation and carbon/nitrogen ratios in southern Chilean forest ecosystems.  

PubMed

Vast areas of southern Chile are now covered by second-growth forests because of fire and logging. To study successional patterns after moderate-intensity, anthropogenic fire disturbance, we assessed differences in soil properties and N fluxes across a chronosequence of seven successional stands (2-130 years old). We examined current predictions of successional theory concerning changes in the N cycle in forest ecosystems. Seasonal fluctuations of net N mineralization (N(min)) in surface soil and N availability (N(a); N(a)=NH4+-N+NO3--N) in upper and deep soil horizons were positively correlated with monthly precipitation. In accordance with theoretical predictions, stand age was positively, but weakly related to both N(a) ( r(2)=0.282, P<0.001) and total N (N(tot); r(2)=0.192, P<0.01), and negatively related to soil C/N ratios ( r(2)=0.187, P<0.01) in surface soils. A weak linear increase in soil N(min) (upper plus deep soil horizons) was found across the chronosequence ( r(2)=0.124, P<0.022). N(min) occurred at modest rates in early successional stands, suggesting that soil disturbance did not impair microbial processes. The relationship between N fixation (N(fix)) in the litter layer and stand age best fitted a quadratic model ( r(2)=0.228, P<0.01). In contrast to documented successional trends for most temperate, tropical and Mediterranean forests, non-symbiotic N(fix) in the litter layer is a steady N input to unpolluted southern temperate forests during mid and late succession, which may compensate for hydrological losses of organic N from old-growth ecosystems. PMID:15221437

Pérez, Cecilia A; Carmona, Martín R; Aravena, Juan C; Armesto, Juan J

2004-06-19

208

Abiotic Nitrogen Fixation on Terrestrial Planets  

NASA Astrophysics Data System (ADS)

The abiotic fixation of nitrogen is critical to planetary evolution and the potential for life on terrestrial planets. A non-biological source of nitrogen, in a biochemically accessible form, is necessary for the origin and early evolution of life. Loss of nitrogen can result in atmospheric pressures too low for liquid water and will impact planetary habitability and hydrological processes. Shock heating of a non-reducing atmosphere produces NO and this has been well studied. Our understanding of the subsequent reactions was, in the past, theoretical. It was postulated that NO was photochemically converted to HNO which then, in surface waters, reacts to form nitrate and nitrite. This chemistry, including reactions in both the gas phase and the liquid phase, has now been studied experimentally. Our work has observed that there are multiple pathways for the fixation. One pathway observed is consistent with the theoretically predicted route via the formation of HNO. Interestingly, this pathway is coupled to photochemical formation of formaldehyde from CO through the formation of HCO. In the presence of liquid water, this pathway leads to the formation of nitrate and nitrite. In the presence of water vapor, but no liquid water, HNO appears to mostly dimerize to form N2O. A second pathway involves the formation of NO2 from CO2 and NO. This pathway becomes more dominant without water, but the reaction of NO2 with even adsorbed water can lead to the formation of nitric acid. Finally, with FeS suspended in liquid water, the direct reduction of NO to ammonia is observed. This last pathway represents the most efficient way to reduced nitrogen, with product yields well above 20% (nitrite/nitrate, from the first two pathways can also be reduced to ammonia thought the overall efficiency suffers). We wish to thank the NASA Astrobiology Institute for support.

Summers, David P.; Khare, B.; Basa, R. C. B.; Rodoni, D.

2009-09-01

209

Climate induced shifts in hydrologic flow pathways and carbon mobilization for a high-latitude, high-altitude catchment  

NASA Astrophysics Data System (ADS)

High-latitude, high-altitude catchments are traditionally data-limited with respect to hydrological cycling and biogeochemical transport. This creates a knowledge gap about how climatic changes could manifest themselves in such systems. The presented study assesses signals of change in historical streamflow and climatic records (e.g., precipitation, temperature) and characterizes the present-day flow pathway distribution and total organic carbon export for the glaciated Tarfala catchment located in subarctic Sweden. This catchment offers one of the World's longest continuously-monitored, glacier-dominated systems. With regards to the historical data, there have been significant increases in the cold season air temperature (over 0.6 °C/decade) and a doubling of summer event precipitation over the past four decades. These changes resulted in consistently positive trends in both the mean summer discharge and peak flood timing along with a 100% increase in the annual maximum discharge of Tarfalajokken stream over the past 45 years. Isotopic hydrograph separation based on present-day samplings indicates that the mechanism responsible for these hydrological intensifications is a shift towards rainfall-dominated floods in connection with glacier melt. This shift in hydrological process has caused fundamental changes in the mobilization and flow pathways of terrestrial carbon, as indicated by observed differences in the total organic carbon content and the carbon quality. The results of this study indicate that the hydrologic response to climate change and the resulting shifts in the biogeochemical transport within the Tarfala catchment are largely coupled to the glacier-dominated storage-discharge relationship. By improving the understanding of such process interactions, we can better represent current and predicted future changes in such high-latitude, high-altitude regions.

Dahlke, H. E.; Lyon, S. W.; Laudon, H.

2011-12-01

210

THE FREE ENERGY OF NITROGEN FIXATION BY LIVING FORMS  

PubMed Central

Fixation of nitrogen even with liberation of energy or free energy, will take place if either oxygen gas or hydrogen gas, or other substances, especially gases, whose standard free energies are close to zero, are involved to form either nitrates, ammonia, or cyanide, not to speak of still other compounds. It has been pointed out that there are two and only two general conditions where nitrogen fixation can require energy. These are, first, if nitrogen reacts with some compound like water with an already high negative free energy of formation and where negligible oxidation of nitrogen would occur; second, if the plant does not take advantage of working at concentrations where the process would yield free energy. If nitrogen fixation is exothermic and free energy-yielding, how is the carbohydrate requirement of nitrogen-fixing organisms to be interpreted? Are the experimental determinations of the carbon to nitrogen ratio purely circumstantial? Is further hope given to those who may experimentally try to narrow this ratio to where the carbon used is only for the carbon requirements of general metabolism, exclusive of fixation? Do not hypotheses concerning the fixation of nitrogen in the evolutionary process, which are based on the conception that energy is required, lose some of their significance? Does it not suggest that perhaps fixation is far more universal than is supposed among living forms, particularly among the higher green plants, and thereby give encouragement to those who may wish to demonstrate this experimentally? Does it not indicate that perhaps the function of fixation is often to obtain energy for use in general metabolism? Is the general carbohydrate metabolism of the fixation forms to be regarded as being merely extremely inefficient? Or most suggestive of all, is the carbohydrate serving some unobserved function?

Burk, Dean

1927-01-01

211

Carbon Dioxide Disposal via Carbonation  

Microsoft Academic Search

Carbonation is a solidification\\/stabilization process. The availability of a carbon dioxide (CO2) fixation technology would serve as insurance in case global warming causes severe restrictions on CO2 emissions. In order to prevent rapid climate change, it will be necessary to stabilize CO2 as carbonate by the carbonation process. Carbonation of the widely occurring mineral olivine (Mg2SiO4) converts CO2 into an

A. Demirbas

2007-01-01

212

Synthetic non-oxidative glycolysis enables complete carbon conservation.  

PubMed

Glycolysis, or its variations, is a fundamental metabolic pathway in life that functions in almost all organisms to decompose external or intracellular sugars. The pathway involves the partial oxidation and splitting of sugars to pyruvate, which in turn is decarboxylated to produce acetyl-coenzyme A (CoA) for various biosynthetic purposes. The decarboxylation of pyruvate loses a carbon equivalent, and limits the theoretical carbon yield to only two moles of two-carbon (C2) metabolites per mole of hexose. This native route is a major source of carbon loss in biorefining and microbial carbon metabolism. Here we design and construct a non-oxidative, cyclic pathway that allows the production of stoichiometric amounts of C2 metabolites from hexose, pentose and triose phosphates without carbon loss. We tested this pathway, termed non-oxidative glycolysis (NOG), in vitro and in vivo in Escherichia coli. NOG enables complete carbon conservation in sugar catabolism to acetyl-CoA, and can be used in conjunction with CO2 fixation and other one-carbon (C1) assimilation pathways to achieve a 100% carbon yield to desirable fuels and chemicals. PMID:24077099

Bogorad, Igor W; Lin, Tzu-Shyang; Liao, James C

2013-09-29

213

Complement fixation by rheumatoid factor.  

PubMed Central

The capacity for fixation and activation of hemolytic complement by polyclonal IgM rheumatoid factors (RF) isolated from sera of patients with rheumatoid arthritis and monoclonal IgM-RF isolated from the cryoprecipitates of patients with IgM-IgG mixed cryoglobulinemia was examined. RF mixed with aggregated, reduced, and alkylated human IgG (Agg-R/A-IgG) in the fluid phase failed to significantly reduce the level of total hemolytic complement, CH50, or of individual complement components, C1, C2, C3, and C5. However, sheep erythrocytes (SRC) coated with Agg-R/A-IgG or with reduced and alkylated rabbit IgG anti-SRC antibody were hemolyzed by complement in the presence of polyclonal IgM-RF. Human and guinea pig complement worked equally well. The degree of hemolysis was in direct proportion to the hemagglutination titer of the RF against the same coated cells. Monoclonal IgM-RF, normal human IgM, and purified Waldenström macroglobulins without antiglobulin activity were all inert. Hemolysis of coated SRC by RF and complement was inhibited by prior treatment of the complement source with chelating agents, hydrazine, cobra venom factor, specific antisera to C1q, CR, C5, C6, or C8, or by heating at 56 degrees C for 30 min. Purified radiolabeled C4, C3, and C8 included in the complement source were bound to hemolysed SRC in direct proportion to the degree of hemolysis. These data indicate that polyclonal IgM-RF fix and activate complement via the classic pathway. The system described for assessing complement fixation by isolated RF is readily adaptable to use with whole human serum.

Tanimoto, K; Cooper, N R; Johnson, J S; Vaughan, J H

1975-01-01

214

The Mechanics of External Fixation  

PubMed Central

External fixation has evolved from being used primarily as a last resort fixation method to becoming a main stream technique used to treat a myriad of bone and soft tissue pathologies. Techniques in limb reconstruction continue to advance largely as a result of the use of these external devices. A thorough understanding of the biomechanical principles of external fixation is useful for all orthopedic surgeons as most will have to occasionally mount a fixator throughout their career. In this review, various types of external fixators and their common clinical applications are described with a focus on unilateral and circular frames. The biomechanical principles that govern bony and fixator stability are reviewed as well as the recommended techniques for applying external fixators to maximize stability. Additionally, we have illustrated methods for managing patients while they are in the external frames to facilitate function and shorten treatment duration.

Rozbruch, S. Robert

2006-01-01

215

[Effect of temperature on methanogenic pathway during household waste anaerobic digestion by stable carbon isotopic signature of CH4].  

PubMed

The methanogenic pathway during anaerobic digestion of household waste was investigated by stable carbon isotopic signature analysis, and testified by the analysis of gas production, leachate characteristics and microbial fluorescence in situ hybridization (FISH) methods. Furthemore, the difference of methanogenic pathway between mesophilic and thermophilic anaerobic digestion was also discussed. Results showed that under mesophilic conditions, the isotopic stable carbon signature of CH4 (delta13 CH4) initially decreased to -69.5 per thousand, indicating that CH4 was produced from CO2 and H2 by hydrogenotrophic methanogens. When active CH4 production phase started, the delta13 CH4 values quickly increased to -23.8 per thousand, which indicated more and more CH4 were formed by aceticlastic methanogens, dominantly the family of Methanosarcinaceae, shown by the FISH results. The delta13 CH4 values decreased successively and ultimately remained at -55 per thousand, indicating that the fraction of aceticlastic methanogenesis finally decreased to a steady level comparative with CO2-derived methanogenesis at the steady slow methane production phase. Under thermophilic conditions, the delta13 CH4 values remained at a level about -70 per thousand, showing that methane were solely produced from CO2 reduction, and acetate syntrophic oxidation happened during the active methane production phase. PMID:19186836

Qu, Xian; He, Pin-Jing; Mazéas, Laurent; Bouchez, Théodore

2008-11-01

216

A selection platform for carbon chain elongation using the CoA-dependent pathway to produce linear higher alcohols.  

PubMed

Production of green chemicals and fuels using metabolically engineered organisms has been a promising alternative to petroleum-based production. Higher chain alcohols (C4-C8) are of interest because they can be used as chemical feedstock as well as fuels. Recently, the feasibility of n-hexanol synthesis using Escherichia coli has been demonstrated by extending the modified Clostridium CoA-dependent n-butanol synthesis pathway, thereby elongating carbon chain length via reactions in reversed ?-oxidation, (or ?-reduction). Here, we developed an anaerobic growth selection platform that allows selection or enrichment of enzymes for increased synthesis of C6 and C8 linear alcohols. Using this selection, we were able to improve the carbon flux towards the synthesis of C6 and C8 acyl-CoA intermediates. Replacement of the original enzyme Clostridium acetobutylicum Hbd with Ralstonia eutropha homologue PaaH1 increased production of n-hexanol by 10-fold. Further directed evolution by random mutagenesis of PaaH1 improved n-hexanol and n-octanol production. This anaerobic growth selection platform may be useful for selecting enzymes for production of long-chain alcohols and acids using this CoA-dependent pathway. PMID:22819734

Machado, Hidevaldo B; Dekishima, Yasumasa; Luo, Hao; Lan, Ethan I; Liao, James C

2012-07-20

217

Gene Regulation of Carbon Fixation, Storage, and Utilization in the Diatom Phaeodactylum tricornutum Acclimated to Light/Dark Cycles1[C][W][OA  

PubMed Central

The regulation of carbon metabolism in the diatom Phaeodactylum tricornutum at the cell, metabolite, and gene expression levels in exponential fed-batch cultures is reported. Transcriptional profiles and cell chemistry sampled simultaneously at all time points provide a comprehensive data set on carbon incorporation, fate, and regulation. An increase in Nile Red fluorescence (a proxy for cellular neutral lipids) was observed throughout the light period, and water-soluble glucans increased rapidly in the light period. A near-linear decline in both glucans and lipids was observed during the dark period, and transcription profile data indicated that this decline was associated with the onset of mitosis. More than 4,500 transcripts that were differentially regulated during the light/dark cycle are identified, many of which were associated with carbohydrate and lipid metabolism. Genes not previously described in algae and their regulation in response to light were integrated in this analysis together with proposed roles in metabolic processes. Some very fast light-responding genes in, for example, fatty acid biosynthesis were identified and allocated to biosynthetic processes. Transcripts and cell chemistry data reflect the link between light energy availability and light energy-consuming metabolic processes. Our data confirm the spatial localization of processes in carbon metabolism to either plastids or mitochondria or to glycolysis/gluconeogenesis, which are localized to the cytosol, chloroplast, and mitochondria. Localization and diel expression pattern may be of help to determine the roles of different isoenzymes and the mining of genes involved in light responses and circadian rhythms.

Chauton, Matilde Skogen; Winge, Per; Brembu, Tore; Vadstein, Olav; Bones, Atle M.

2013-01-01

218

Understanding Nitrogen Fixation  

SciTech Connect

The purpose of our program is to explore fundamental chemistry relevant to the discovery of energy efficient methods for the conversion of atmospheric nitrogen (N{sub 2}) into more value-added nitrogen-containing organic molecules. Such transformations are key for domestic energy security and the reduction of fossil fuel dependencies. With DOE support, we have synthesized families of zirconium and hafnium dinitrogen complexes with elongated and activated N-N bonds that exhibit rich N{sub 2} functionalization chemistry. Having elucidated new methods for N-H bond formation from dihydrogen, C-H bonds and Broensted acids, we have since turned our attention to N-C bond construction. These reactions are particularly important for the synthesis of amines, heterocycles and hydrazines with a range of applications in the fine and commodity chemicals industries and as fuels. One recent highlight was the discovery of a new N{sub 2} cleavage reaction upon addition of carbon monoxide which resulted in the synthesis of an important fertilizer, oxamide, from the diatomics with the two strongest bonds in chemistry. Nitrogen-carbon bonds form the backbone of many important organic molecules, especially those used in the fertilizer and pharamaceutical industries. During the past year, we have continued our work in the synthesis of hydrazines of various substitution patterns, many of which are important precursors for heterocycles. In most instances, the direct functionalization of N{sub 2} offers a more efficient synthetic route than traditional organic methods. In addition, we have also discovered a unique CO-induced N{sub 2} bond cleavage reaction that simultaneously cleaves the N-N bond of the metal dinitrogen compound and assembles new C-C bond and two new N-C bonds. Treatment of the CO-functionalized core with weak Broensted acids liberated oxamide, H{sub 2}NC(O)C(O)NH{sub 2}, an important slow release fertilizer that is of interest to replace urea in many applications. The synthesis of ammonia, NH{sub 3}, from its elements, H{sub 2} and N{sub 2}, via the venerable Haber-Bosch process is one of the most significant technological achievements of the past century. Our research program seeks to discover new transition metal reagents and catalysts to disrupt the strong N {triple_bond} N bond in N{sub 2} and create new, fundamental chemical linkages for the construction of molecules with application as fuels, fertilizers and fine chemicals. With DOE support, our group has discovered a mild method for ammonia synthesis in solution as well as new methods for the construction of nitrogen-carbon bonds directly from N{sub 2}. Ideally these achievements will evolve into more efficient nitrogen fixation schemes that circumvent the high energy demands of industrial ammonia synthesis. Industrially, atmospheric nitrogen enters the synthetic cycle by the well-established Haber-Bosch process whereby N{sub 2} is hydrogenated to ammonia at high temperature and pressure. The commercialization of this reaction represents one of the greatest technological achievements of the 20th century as Haber-Bosch ammonia is responsible for supporting approximately 50% of the world's population and serves as the source of half of the nitrogen in the human body. The extreme reaction conditions required for an economical process have significant energy consequences, consuming 1% of the world's energy supply mostly in the form of pollution-intensive coal. Moreover, industrial H{sub 2} synthesis via the water gas shift reaction and the steam reforming of methane is fossil fuel intensive and produces CO{sub 2} as a byproduct. New synthetic methods that promote this thermodynamically favored transformation ({Delta}G{sup o} = -4.1 kcal/mol) under milder conditions or completely obviate it are therefore desirable. Most nitrogen-containing organic molecules are derived from ammonia (and hence rely on the Haber-Bosch and H{sub 2} synthesis processes) and direct synthesis from atmospheric nitrogen could, in principle, be more energy-efficient. This is particularly attractive giv

Paul J. Chirik

2012-05-25

219

Biology Nitrogen Fixation: Fundamentals  

Microsoft Academic Search

The enzyme responsible for N_2 fixation, nitrogenase, is only found in prokaryotes. It consists of two metalloproteins, both irreversibly destroyed by exposure to the O_2 of air. The MoFe-protein binds N_2 and the Fe-protein, after activation by MgATP, supplies electrons. H_2 is evolved during the reduction of N_2 to NH_3 and can become the sole reaction in the absence of

J. R. Postgate

1982-01-01

220

Degradation Pathway of Bisphenol A: Does ipso Substitution Apply to Phenols Containing a Quaternary ?-Carbon Structure in the para Position?? †  

PubMed Central

The degradation of bisphenol A and nonylphenol involves the unusual rearrangement of stable carbon-carbon bonds. Some nonylphenol isomers and bisphenol A possess a quaternary ?-carbon atom as a common structural feature. The degradation of nonylphenol in Sphingomonas sp. strain TTNP3 occurs via a type II ipso substitution with the presence of a quaternary ?-carbon as a prerequisite. We report here a new degradation pathway of bisphenol A. Consequent to the hydroxylation at position C-4, according to a type II ipso substitution mechanism, the C-C bond between the phenolic moiety and the isopropyl group of bisphenol A is broken. Besides the formation of hydroquinone and 4-(2-hydroxypropan-2-yl)phenol as the main metabolites, further compounds resulting from molecular rearrangements consistent with a carbocationic intermediate were identified. Assays with resting cells or cell extracts of Sphingomonas sp. strain TTNP3 under an 18O2 atmosphere were performed. One atom of 18O2 was present in hydroquinone, resulting from the monooxygenation of bisphenol A and nonylphenol. The monooxygenase activity was dependent on both NADPH and flavin adenine dinucleotide. Various cytochrome P450 inhibitors had identical inhibition effects on the conversion of both xenobiotics. Using a mutant of Sphingomonas sp. strain TTNP3, which is defective for growth on nonylphenol, we demonstrated that the reaction is catalyzed by the same enzymatic system. In conclusion, the degradation of bisphenol A and nonylphenol is initiated by the same monooxygenase, which may also lead to ipso substitution in other xenobiotics containing phenol with a quaternary ?-carbon.

Kolvenbach, B.; Schlaich, N.; Raoui, Z.; Prell, J.; Zuhlke, S.; Schaffer, A.; Guengerich, F. P.; Corvini, P. F. X.

2007-01-01

221

Carbon isotope-labelling experiments indicate that ladderane lipids of anammox bacteria are synthesized by a previously undescribed, novel pathway.  

PubMed

Ladderane lipids are unusual membrane lipids of bacteria that anaerobically oxidize ammonium to dinitrogen gas (anammox). Ladderane lipids contain linearly concatenated cyclobutane rings for which the pathway of biosynthesis is currently unknown. To investigate the possible biosynthetic routes of these lipids, 2-(13)C-labelled acetate was added to a culture of the anammox bacterium Candidatus Brocadia fulgida. Labelling patterns obtained by high-field (13)C nuclear magnetic resonance spectroscopy of isolated lipids indicated that C. Brocadia fulgida synthesizes C(16:0) and isoC(16:0) fatty acids according to the known pathway of type II fatty acid biosynthesis. The (13)C-labelling pattern of the C(8) alkyl chain of the C(20) [3] ladderane monoether also indicated the use of this route. However, carbon atoms in the cyclobutane rings and the cyclohexane ring were nonspecifically labelled and did not correspond to known patterns of fatty acid synthesis. Taken together, our results indicate that it is unlikely that ladderane lipids are formed from the cyclization of polyunsaturated fatty acids as hypothesized previously and suggest an alternative, although as yet unknown, pathway of biosynthesis. PMID:19175409

Rattray, Jayne E; Geenevasen, Jan A J; van Niftrik, Laura; Rijpstra, W Irene C; Hopmans, Ellen C; Strous, Marc; Schouten, Stefan; Jetten, Mike S M; Sinninghe Damsté, Jaap S

2009-01-17

222

Temporal and spatial deployment of carbon dioxide capture and storage technologies across the representative concentration pathways  

Microsoft Academic Search

The Intergovernmental Panel on Climate Change’s (IPCC) Fifth Assessment (to be published in 2013–2014) will to a significant degree be built around four Representative Concentration Pathways (RCPs) that are intended to represent four scenarios of future development of greenhouse gas emissions, land use, and concentrations that span the widest range of potential future atmospheric radiative forcing. Under the very stringent

James J. Dooley; Katherine V. Calvin

2011-01-01

223

North and south: Regional footprints on the transition pathway towards a low carbon, global economy  

Microsoft Academic Search

Environmental or ‘ecological’ footprints are indicators of resource consumption and waste absorption transformed on the basis of biologically productive land area required per capita with prevailing technology. They represent a partial measure of the extent to which the planet, its regions, or nations are moving along a sustainable development pathway. Such footprints vary between countries at different stages of economic

G. R. Cranston; G. P. Hammond

2010-01-01

224

Measurement of black carbon at Syowa station, Antarctica: seasonal variation, transport processes and pathways  

Microsoft Academic Search

Measurement of black carbon (BC) was carried out at Syowa station Antarctica (69° S, 39° E) from February 2004 until January 2007. The BC concentration at Syowa ranged from below detection to 176 ng m-3 during the measurements. Higher BC concentrations were observed mostly under strong wind (blizzard) conditions due to the approach of a cyclone and blocking event. The

K. Hara; K. Osada; M. Yabuki; M. Hayashi; T. Yamanouchi; M. Shiobara; M. Wada

2008-01-01

225

Carbonyl sulfide (OCS) and carbon monoxide (CO) in natural waters: evidence of a coupled production pathway  

Microsoft Academic Search

The mechanisms for the photoproduction of carbonyl sulfide (OCS) and carbon monoxide (CO) in natural waters were studied by evaluating experimental results from different aqueous systems. A coupled photoproduction mechanism was observed operating on CO and OCS. For CO photoproduction, the presence of a carbonyl group is necessary, while for OCS, a source of reduced sulfur in addition to the

Willer H. Pos; Daniel D. Riemer; Rod G. Zika

1998-01-01

226

Carbon monoxide ameliorates chronic murine colitis through a heme oxygenase 1- dependent pathway  

Microsoft Academic Search

Heme oxygenase (HO)-1 and its metabolic product carbon monoxide (CO) play regulatory roles in acute inflammatory states. In this study, we demonstrate that CO administration is effective as a therapeutic modality in mice with established chronic colitis. CO administration ameliorates chronic intestinal inflammation in a T helper (Th)1-mediated model of murine colitis, interleukin (IL)-10-deficient ( IL-10 ? \\/ ? )

Refaat A. F. Hegazi; Kavitha N. Rao; Aqila Mayle; Antonia R. Sepulveda; Leo E. Otterbein; Scott E. Plevy

2005-01-01

227

Forefoot applications of external fixation.  

PubMed

The use of external fixation in foot and ankle surgery has steadily increased with the advent of devices geared toward the foot and ankle that have evolved over the past decade, as well as a greater understanding of the indications and advantages of external fixation. The application of external fixators in the forefoot may at first glance seem both limited and possibly overkill, but once the basics of external fixation and the types of devices available are understood the options for use become numerous. PMID:12613075

DeHeer, Patrick A

2003-01-01

228

Role of the locus coeruleus carbon monoxide pathway in endotoxin fever in rats  

Microsoft Academic Search

Carbon monoxide (CO) has been identified as a diffusible signaling messenger in the brain, capable of altering body temperature\\u000a by stimulating soluble guanylate cyclase (sGC). However, its site of action remains unclear. Locus coeruleus (LC) is rich\\u000a not only in sGC but also in heme oxygenase (HO; the enzyme that catalyses the metabolism of heme to CO, along with biliverdin

Maria Ida Bonini Ravanelli; Maria C. Almeida; Luiz G. S. Branco

2007-01-01

229

Definitive Bone Fixation and Reconstruction: Conversion from Temporary External Fixation to Internal Fixation Methods  

Microsoft Academic Search

\\u000a Temporary external fixation is frequently employed in the military combat theater of operations to temporize devastating extremity\\u000a injuries and facilitate transport of the wounded soldier. Multiple civilian and a few military studies have provided helpful\\u000a insight into the staged treatment of these injuries including conversion of temporary external fixation to definitive stabilization\\u000a with internal fixation. Diaphyseal fractures of the long

Craig S. Bartlett; Benjamin Geer; David L. Helfet

230

METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS  

SciTech Connect

The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage pathway. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum.

John J. Kilbane III

2003-12-01

231

Regulation of Autotrophic CO2 Fixation in the Archaeon Thermoproteus neutrophilus? †  

PubMed Central

Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO2 fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes.

Ramos-Vera, W. Hugo; Labonte, Valerie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

2010-01-01

232

Regulation of autotrophic CO2 fixation in the archaeon Thermoproteus neutrophilus.  

PubMed

Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO(2) fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes. PMID:20693323

Ramos-Vera, W Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

2010-08-06

233

Complement activation by PEGylated single-walled carbon nanotubes is independent of C1q and alternative pathway turnover  

PubMed Central

We have investigated the interaction between long circulating poly(ethylene glycol)-stabilized single-walled carbon nanotubes (SWNTs) and the complement system. Aminopoly(ethylene glycol)5000–distearoylphosphatidylethanolamine (aminoPEG5000–DSPE) and methoxyPEG5000–DSPE coated as-grown HIPco SWNTs activated complement in undiluted normal human serum as reflected in significant rises in C4d and SC5b-9 levels, but not the alternative pathway split-product Bb, thus indicating activation exclusively through C4 cleavage. Studies in C2-depleted serum confirmed that PEGylated nanotube-mediated elevation of SC5b-9 was C4b2a convertase-dependent. With the aid of monoclonal antibodies against C1s and human serum depleted from C1q, nanotube-mediated complement activation in C1q-depleted serum was also shown to be independent of classical pathway. Nanotube-mediated C4d elevation in C1q-depleted serum, however, was inhibited by N-acetylglucosamine, Futhan (a broad-spectrum serine protease inhibitor capable of preventing complement activation through all three pathways) and anti-MASP-2 antibodies; this strongly suggests a role for activation of MASP-2 in subsequent C4 cleavage and assembly of C4b2a covertases. Intravenous injection of PEGylated nanotubes in some rats was associated with a significant rise in plasma thromboxane B2 levels, indicative of in vivo nanotube-mediated complement activation. The clinical implications of these observations are discussed.

Hamad, Islam; Hunter, A. Christy; Rutt, Kenneth J.; Liu, Zhuang; Dai, Hongjie; Moghimi, S. Moein

2010-01-01

234

Large-scale distribution of Atlantic nitrogen fixation controlled by iron availability  

NASA Astrophysics Data System (ADS)

Oceanic fixed-nitrogen concentrations are controlled by the balance between nitrogen fixation and denitrification. A number of factors, including iron limitation, can restrict nitrogen fixation, introducing the potential for decoupling of nitrogen inputs and losses. Such decoupling could significantly affect the oceanic fixed-nitrogen inventory and consequently the biological component of ocean carbon storage and hence air-sea partitioning of carbon dioxide. However, the extent to which nutrients limit nitrogen fixation in the global ocean is uncertain. Here, we examined rates of nitrogen fixation and nutrient concentrations in the surface waters of the Atlantic Ocean along a north-south 10,000km transect during October and November 2005. We show that rates of nitrogen fixation were markedly higher in the North Atlantic compared with the South Atlantic Ocean. Across the two basins, nitrogen fixation was positively correlated with dissolved iron and negatively correlated with dissolved phosphorus concentrations. We conclude that inter-basin differences in nitrogen fixation are controlled by iron supply rather than phosphorus availability. Analysis of the nutrient content of deep waters suggests that the fixed nitrogen enters North Atlantic Deep Water. Our study thus supports the suggestion that iron significantly influences nitrogen fixation, and that subsequent interactions with ocean circulation patterns contribute to the decoupling of nitrogen fixation and loss.

Mark Moore, C.; Mills, Matthew M.; Achterberg, Eric P.; Geider, Richard J.; Laroche, Julie; Lucas, Mike I.; McDonagh, Elaine L.; Pan, Xi; Poulton, Alex J.; Rijkenberg, Micha J. A.; Suggett, David J.; Ussher, Simon J.; Woodward, E. Malcolm S.

2009-12-01

235

Dark Fixation of CO2 by Crassulacean Plants  

PubMed Central

Malic acid isolated from Bryophyllum pinnatum (Lamk.) Oken (B. calycinum Salisb.), Bryophyllum tubiflorum Harv., Kalanchoë diagremontiana Hamet et Perrier and Sedum guatamalense Hemsl. after dark 14CO2 fixation was degraded by an in vitro NADP-malic enzyme technique. In the short term (5 to 30 seconds) the malic acid was almost exclusively labeled in the C-4 carboxyl carbon (greater than 90%). The percentage of 14C in the C-4 carboxyl of malic acid declined slowly with time, reaching 70% in B. tubiflorum and 54% in B. pinnatum after 14 hours of exposure to 14CO2. It was found that malic acid-adapted Lactobacillus arabinosus may seriously underestimate the C-4 carboxyl component of label in malic acid-14C. The amount of substrate which the bacteria can completely metabolize was easily exceeded; there was a significant level of randomization of label even when ?-decarboxylation proceeded to completion, and in extended incubation periods, more than 25% of label was removed from malic acid-U-14C. The significance of these findings in relation to pathways of carbohydrate metabolism and malic acid synthesis in Crassulacean acid metabolism is discussed.

Sutton, B. G.; Osmond, C. B.

1972-01-01

236

Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501  

PubMed Central

The capacity to fix nitrogen is widely distributed in phyla of Bacteria and Archaea but has long been considered to be absent from the Pseudomonas genus. We report here the complete genome sequencing of nitrogen-fixing root-associated Pseudomonas stutzeri A1501. The genome consists of a single circular chromosome with 4,567,418 bp. Comparative genomics revealed that, among 4,146 protein-encoding genes, 1,977 have orthologs in each of the five other Pseudomonas representative species sequenced to date. The genome contains genes involved in broad utilization of carbon sources, nitrogen fixation, denitrification, degradation of aromatic compounds, biosynthesis of polyhydroxybutyrate, multiple pathways of protection against environmental stress, and other functions that presumably give A1501 an advantage in root colonization. Genetic information on synthesis, maturation, and functioning of nitrogenase is clustered in a 49-kb island, suggesting that this property was acquired by lateral gene transfer. New genes required for the nitrogen fixation process have been identified within the nif island. The genome sequence offers the genetic basis for further study of the evolution of the nitrogen fixation property and identification of rhizosphere competence traits required in the interaction with host plants; moreover, it opens up new perspectives for wider application of root-associated diazotrophs in sustainable agriculture.

Yan, Yongliang; Yang, Jian; Dou, Yuetan; Chen, Ming; Ping, Shuzhen; Peng, Junping; Lu, Wei; Zhang, Wei; Yao, Ziying; Li, Hongquan; Liu, Wei; He, Sheng; Geng, Lizhao; Zhang, Xiaobing; Yang, Fan; Yu, Haiying; Zhan, Yuhua; Li, Danhua; Lin, Zhanglin; Wang, Yiping; Elmerich, Claudine; Lin, Min; Jin, Qi

2008-01-01

237

DINITROGEN FIXATION IN ILLINOIS BUNDLEFLOWER  

Technology Transfer Automated Retrieval System (TEKTRAN)

Illinois bundleflower [Desmanthus illinoensis (Michx.) MacMillan] is a warm-season perennial forage legume that may serve as a pulse crop. Its productivity is influenced by its N2 fixation capability. Our objective was to estimate symbiotic N2 fixation of three Illinois bundleflower accessions from ...

238

Proximal humeral fractures: internal fixation.  

PubMed

Fractures of the proximal humerus are common injuries that are increasing in incidence as the population ages. These fractures are often treated nonsurgically; however, surgery is indicated if displacement, concurrent dislocation, or unacceptable alignment is present. Knowledge of the anatomic and physiologic characteristics of the proximal humerus and shoulder joint and familiarity with the available fixation elements will help surgeons make informed and patient-specific decisions regarding treatment. Reduction and internal fixation of proximal humeral fractures has expanding indications in comparison with arthroplasty, in part because of improvements in fixation technology and a better understanding of anatomy and physiology. The outcomes of proximal humeral fractures managed with percutaneous pinning, open reduction and locked-plate fixation, and intramedullary fixation are being actively investigated. PMID:23395021

Aaron, Daniel; Shatsky, Joshua; Paredes, Juan Carlos S; Jiang, Chunyan; Parsons, Bradford O; Flatow, Evan L

2013-01-01

239

Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds  

SciTech Connect

The objective of the project was to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically, the development of a novel biochemical pathway for the selective cleavage of C-N bonds in carbazole was the focus of research in this project. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. Obtaining an enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl-2,3-diol was the focus of much of the research in this project, however; no suitable enzyme was found. Project accomplishments included expressing the genes for carbazole dioxygenase in Rhodococcus erythropolis and Escherichia coli, development of gene expression vectors for Rhodococcus, and isolation of a Pseudomonas sp. strain GTIN-G4 that has the novel biochemical ability to replace one of the nitrogen-associated hydrogen atoms in 2-aminobiphenyl with formaldehyde. Rhodococcus cultures are capable of metabolizing a wide range of substrates, including hydrophobic substrates like petroleum, and may find widespread use in the development of biotechnology processes in the future. The results of this project will directly benefit the development of future biotechnology processes/projects employing Rhodococcus hosts. Three manuscripts were prepared and submitted for publication based on the data obtained in this project: (1) ''Formylation of 2-aminobiphenyl by Pseudomonas sp. strain GTIN-G4''; (2) ''Screening and Analysis of DNA Fragments that Show Promoter Activities in Rhodococcus erythropolis''; and (3) ''Microbial Biocatalyst Developments to Upgrade Fossil Fuels''.

John J. Kilbane II

2006-04-01

240

Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways.  

National Technical Information Service (NTIS)

Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detect...

A. S. Burton D. P. Glavin J. E. Elsila J. P. Dworkin S. B. Charnley

2012-01-01

241

Carbon isotopic composition of individual Precambrian microfossils  

NASA Astrophysics Data System (ADS)

Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the ˜850 Ma Bitter Springs Formation, Australia, and the ˜2100 Ma Gunflint Formation, Canada. The ?13CPDB values from individual microfossils of the Bitter Springs Formation ranged from -21.3 ± 1.7‰ to -31.9 ± 1.2‰, and the ?13CPDB values from microfossils of the Gunflint Formation ranged from -32.4 ± 0.7‰ to -45.4 ± 1.2‰. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

House, Christopher H.; Schopf, J. William; McKeegan, Kevin D.; Coath, Christopher D.; Harrison, T. Mark; Stetter, Karl O.

2000-08-01

242

Autotrophic CO2 Fixation by Chloroflexus aurantiacus: Study of Glyoxylate Formation and Assimilation via the 3-Hydroxypropionate Cycle  

PubMed Central

In the facultative autotrophic organism Chloroflexus aurantiacus, a phototrophic green nonsulfur bacterium, the Calvin cycle does not appear to be operative in autotrophic carbon assimilation. An alternative cyclic pathway, the 3-hydroxypropionate cycle, has been proposed. In this pathway, acetyl coenzyme A (acetyl-CoA) is assumed to be converted to malate, and two CO2 molecules are thereby fixed. Malyl-CoA is supposed to be cleaved to acetyl-CoA, the starting molecule, and glyoxylate, the carbon fixation product. Malyl-CoA cleavage is shown here to be catalyzed by malyl-CoA lyase; this enzyme activity is induced severalfold in autotrophically grown cells. Malate is converted to malyl-CoA via an inducible CoA transferase with succinyl-CoA as a CoA donor. Some enzyme activities involved in the conversion of malonyl-CoA via 3-hydroxypropionate to propionyl-CoA are also induced under autotrophic growth conditions. So far, no clue as to the first step in glyoxylate assimilation has been obtained. One possibility for the assimilation of glyoxylate involves the conversion of glyoxylate to glycine and the subsequent assimilation of glycine. However, such a pathway does not occur, as shown by labeling of whole cells with [1,2-13C2]glycine. Glycine carbon was incorporated only into glycine, serine, and compounds that contained C1 units derived therefrom and not into other cell compounds.

Herter, Sylvia; Farfsing, Jan; Gad'On, Nasser; Rieder, Christoph; Eisenreich, Wolfgang; Bacher, Adelbert; Fuchs, Georg

2001-01-01

243

Lumped pathway metabolic model of organic carbon accumulation and mobilization by the alga Chlamydomonas reinhardtii.  

PubMed

Phototrophic microorganisms have significant potential as bioenergy feedstocks, but the sustainability of large-scale cultivation will require the use of wastewater as a renewable resource. A key barrier to this advancement is a lack of bioprocess understanding that would enable the design and implementation of efficient and resilient mixed community, naturally lit cultivation systems. In this study, a lumped pathway metabolic model (denoted the phototrophic process model or PPM) was developed for mixed phototrophic communities subjected to day/night cycling. State variables included functional biomass (XCPO), stored carbohydrates (XCH), stored lipids (XLI), nitrate (SNO), phosphate (SP), and others. PPM metabolic reactions and stoichiometry were based on Chlamydomonas reinhardtii , but experiments for model calibration and validation were performed in flat panel photobioreactors (PBRs) originally inoculated with biomass from a phototrophic system at a wastewater treatment plant. PBRs were operated continuously as cyclostats to poise cells for intrinsic kinetic parameter estimation in batch studies, which included nutrient-available conditions in light and dark as well as nitrogen-starved and phosphorus-starved conditions in light. The model was calibrated and validated and was shown to be a reasonable predictor of growth, lipid and carbohydrate storage, and lipid and carbohydrate mobilization by a mixed microbial community. PMID:23452258

Guest, Jeremy S; van Loosdrecht, Mark C M; Skerlos, Steven J; Love, Nancy G

2013-03-15

244

Fixation disparity in binocular stress.  

PubMed

Fixation disparity has been taken as a sign of stress on binocular vision because it is established that prism stress creates fixation disparity. This paper looks at the effect on fixation disparity of the stress caused by requiring subjects to read in inadequate illumination. It is found that the reduction in illumination does not in itself immediately change the magnitude of the fixation disparity. There is, however, an increase in the mean slope of the central part of the fixation disparity curve which suggests that when the effect of reduced illumination is added to prism stress, fixation disparity is increased. The stress created by asking subjects to read in reduced illumination for half an hour resulted in the mean associated heterophoria being increased, and over half the subjects reported symptoms of stress. It is concluded that fixation disparity is changed by this type of visual stress in some subjects, and in near vision is increased to a more marked degree of exo-disparity. Most of this increase occurs in the first ten minutes. PMID:3658422

Pickwell, L D; Jenkins, T C; Yetka, A A

1987-01-01

245

Tricarboxylic Acid Cycle and One-Carbon Metabolism Pathways Are Important in Edwardsiella ictaluri Virulence  

PubMed Central

Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of channel catfish (ESC). The disease causes considerable economic losses in the commercial catfish industry in the United States. Although antibiotics are used as feed additive, vaccination is a better alternative for prevention of the disease. Here we report the development and characterization of novel live attenuated E. ictaluri mutants. To accomplish this, several tricarboxylic acid cycle (sdhC, mdh, and frdA) and one-carbon metabolism genes (gcvP and glyA) were deleted in wild type E. ictaluri strain 93-146 by allelic exchange. Following bioluminescence tagging of the E. ictaluri ?sdhC, ?mdh, ?frdA, ?gcvP, and ?glyA mutants, their dissemination, attenuation, and vaccine efficacy were determined in catfish fingerlings by in vivo imaging technology. Immunogenicity of each mutant was also determined in catfish fingerlings. Results indicated that all of the E. ictaluri mutants were attenuated significantly in catfish compared to the parent strain as evidenced by 2,265-fold average reduction in bioluminescence signal from all the mutants at 144 h post-infection. Catfish immunized with the E. ictaluri ?sdhC, ?mdh, ?frdA, and ?glyA mutants had 100% relative percent survival (RPS), while E. ictaluri ?gcvP vaccinated catfish had 31.23% RPS after re-challenge with the wild type E. ictaluri.

Dahal, Neeti; Abdelhamed, Hossam; Lu, Jingjun; Karsi, Attila; Lawrence, Mark L.

2013-01-01

246

Carbon and nitrogen isotope studies in an arctic ecosystem. Final report.  

National Technical Information Service (NTIS)

The dynamics of carbon fixation and storage in tundra soils has received considerable attention with respect to global carbon cycling. Recent findings by investigators using chamber measurements of fixation/respiration rates in arctic tundra have led to t...

D. M. Schell

1994-01-01

247

Pharmacological activation of heme oxygenase (HO)-1/carbon monoxide pathway prevents the development of peripheral neuropathic pain in Wistar rats.  

PubMed

Recent studies have emphasized the contribution of neuroinflammation and oxido-nitrosative stress to neuropathic pain. Both, heme oxygenase (HO)-1 and carbon monoxide (CO) play an important role in regulating free radical generation and inflammation. Herein, we investigated the role of HO-1/CO pathway, by using hemin, a selective HO activator, and CO-releasing molecule (CORM)-2, a CO-releasing agent, in rat sciatic nerve chronic constriction injury (CCI)-induced neuropathic pain. CCI rats exhibited full development of behavioral hypersensitivity symptoms, including cold allodynia, mechanical and thermal hyperalgesia and also exhibit of a significant increase in spinal cord pro-inflammatory cytokines (TNF-? and IL-1?) and oxido-nitrosative stress markers, both in spinal cord and ipsilateral sciatic nerve homogenate. Spinal (10 and 30 ?g/rat, intrathecal (i.t.)), but not systemic (5 and 10 mg/kg, subcutaneous (s.c.)), administration of hemin for 14 days significantly prevented the development of behavioral hypersensitivity. Further, simultaneous administration of hemin via spinal (10 ?g/rat, i.t.) and systemic (5 mg/kg, s.c.) routes led to a more pronounced inhibition of the development of behavioral hypersensitivity. Further, administration of CORM-2 (1 and 5 mg/kg, s.c.), dose-dependently and most effectively, prevented the development of behavioral hypersensitivity. Both hemin and CORM-2 produced ameliorative beneficial effects that paralleled with the extent of reduction of oxido-nitrosative stress and pro-inflammatory cytokines. Also, hemin and CORM-2 significantly improved the levels of HO-1 and activity of anti-oxidant enzymes such as superoxide dismutase and catalase. Thus, it may be concluded that chronic pharmacological activation of HO-1/CO pathway may prevent the development of behavioral symptoms of neuropathic pain, through an activation of anti-inflammatory and anti-oxidant mechanisms. PMID:23224421

Bijjem, Krishna Reddy V; Padi, Satyanarayana S V; lal Sharma, Pyare

2012-12-09

248

System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses.  

PubMed

The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80?g MWCNT at 1, 7, 28, or 56days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. PMID:23845593

Snyder-Talkington, Brandi N; Dymacek, Julian; Porter, Dale W; Wolfarth, Michael G; Mercer, Robert R; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L

2013-07-08

249

Carbon fixation in eucalypts in the field  

Microsoft Academic Search

The rate of CO2 assimilation at light saturation and an intercellular CO2 concentration of 350 µl l-1 (photosynthetic capacity), measured in leaves of Eucalyptus pauciflora, E. behriana, E. delegatensis and Acacia melanoxylon, declined over the course of cloudless days under naturally varying environmental conditions as well as under constant optimal conditions for high CO2 uptake. Since the capacity did not

M. Küppers; A. M. Wheeler; B. I. L. Küppers; M. U. F. Kirschbaum; G. D. Farquhar

1986-01-01

250

Rigid skeletal fixation of fractures.  

PubMed

Rigid skeletal fixation of facial fractures has evolved from the principles established in orthopedics. It has taken a long time to develop rigid internal fixation devices that provide stability combined with safety. The application of rigid skeletal fixation to the facial skeleton requires the surgeon to pay strict attention to detail, which may add a small time increment to the procedure. However, the benefits to patients of having early use of the jaws and exact placement of bony segments seem to outweigh the disadvantages. The future of this constantly developing field will almost certainly center around technologic innovations that will make the application of fixation devices easier. It is likely that future research will provide devices that are more biocompatible, and perhaps just over the horizon, devices that are bioresorbable. PMID:8426256

Ellis, E

1993-02-01

251

Sternal fixation with nonspecific plate.  

PubMed

Purpose: The aim of the present study was to fixate displaced sternum fractures with a nonspecific plate, without a sternotomy procedure.Method: Between May 2010 and December 2011, 15 patients with sternal fractures were included in this study. We performed fixation for 8 of 15 sternal fracture patients.Posteroanterior and lateral chest x-rays and computed tomography were taken for diagnosis of sternal fractures. Our surgical indications were severe pain, dislocationoverlapping of sternal edges, and thoracic wall instability. Locked volar distal radius plates were used for the sternal fixation.Results: After fixation of sternum with plate, the sternum was stable in all 8 patients.There were no complications intra- or postoperatively. Sternal union was observed for all. Pain relief was determined dramatically.Conclusion: Locked volar distal radius plates can be used for displaced sternal fractures.It is an alternative and successful method for sternal fractures. PMID:23269267

Ergene, Gökhan; Tulay, Cumhur Murat; Anas?z, Hüseyin

2012-12-26

252

Carbon monoxide differentially inhibits TLR signaling pathways by regulating ROS-induced trafficking of TLRs to lipid rafts  

PubMed Central

Carbon monoxide (CO), a byproduct of heme catabolism by heme oxygenase (HO), confers potent antiinflammatory effects. Here we demonstrate that CO derived from HO-1 inhibited Toll-like receptor (TLR) 2, 4, 5, and 9 signaling, but not TLR3-dependent signaling, in macrophages. Ligand-mediated receptor trafficking to lipid rafts represents an early event in signal initiation of immune cells. Trafficking of TLR4 to lipid rafts in response to LPS was reactive oxygen species (ROS) dependent because it was inhibited by diphenylene iodonium, an inhibitor of NADPH oxidase, and in gp91phox-deficient macrophages. CO selectively inhibited ligand-induced recruitment of TLR4 to lipid rafts, which was also associated with the inhibition of ligand-induced ROS production in macrophages. TLR3 did not translocate to lipid rafts by polyinosine-polycytidylic acid (poly(I:C)). CO had no effect on poly(I:C)-induced ROS production and TLR3 signaling. The inhibitory effect of CO on TLR-induced cytokine production was abolished in gp91phox-deficient macrophages, also indicating a role for NADPH oxidase. CO attenuated LPS-induced NADPH oxidase activity in vitro, potentially by binding to gp91phox. Thus, CO negatively controlled TLR signaling pathways by inhibiting translocation of TLR to lipid rafts through suppression of NADPH oxidase–dependent ROS generation.

Nakahira, Kiichi; Kim, Hong Pyo; Geng, Xue Hui; Nakao, Atsunori; Wang, Xue; Murase, Noriko; Drain, Peter F.; Wang, Xiaomei; Sasidhar, Madhu; Nabel, Elizabeth G.; Takahashi, Toru; Lukacs, Nicholas W.; Ryter, Stefan W.; Morita, Kiyoshi; Choi, Augustine M.K.

2006-01-01

253

Biological fixation of endosseous implants  

Microsoft Academic Search

Primary implant stability is ensured by a mechanical fixation of implants. However, during implant healing a biological anchorage is necessary to achieve final osseointegration.Aim of this study was to investigate the histological aspects of biological fixation around titanium screws.Forty-eight titanium screws with different surfaces (smooth, plasma sprayed, sand blasted) were inserted in tibiae and femura of sheep and analyzed by

M. Franchi; M. Fini; D. Martini; E. Orsini; L. Leonardi; A. Ruggeri; G. Giavaresi; V. Ottani

2005-01-01

254

Biological conversion of carbon dioxide and hydrogen into liquid fuels and industrial chemicals.  

PubMed

Non-photosynthetic routes for biological fixation of carbon dioxide into valuable industrial chemical precursors and fuels are moving from concept to reality. The development of 'electrofuel'-producing microorganisms leverages techniques in synthetic biology, genetic and metabolic engineering, as well as systems-level multi-omic analysis, directed evolution, and in silico modeling. Electrofuel processes are being developed for a range of microorganisms and energy sources (e.g. hydrogen, formate, electricity) to produce a variety of target molecules (e.g. alcohols, terpenes, alkenes). This review examines the current landscape of electrofuel projects with a focus on hydrogen-utilizing organisms covering the biochemistry of hydrogenases and carbonic anhydrases, kinetic and energetic analyses of the known carbon fixation pathways, and the state of genetic systems for current and prospective electrofuel-producing microorganisms. PMID:23510698

Hawkins, Aaron S; McTernan, Patrick M; Lian, Hong; Kelly, Robert M; Adams, Michael W W

2013-03-16

255

Genetic regulation of nitrogen fixation in rhizobia.  

PubMed Central

This review presents a comparison between the complex genetic regulatory networks that control nitrogen fixation in three representative rhizobial species, Rhizobium meliloti, Bradyrhizobium japonicum, and Azorhizobium caulinodans. Transcription of nitrogen fixation genes (nif and fix genes) in these bacteria is induced primarily by low-oxygen conditions. Low-oxygen sensing and transmission of this signal to the level of nif and fix gene expression involve at least five regulatory proteins, FixL, FixJ, FixK, NifA, and RpoN (sigma 54). The characteristic features of these proteins and their functions within species-specific regulatory pathways are described. Oxygen interferes with the activities of two transcriptional activators, FixJ and NifA. FixJ activity is modulated via phosphorylation-dephosphorylation by the cognate sensor hemoprotein FixL. In addition to the oxygen responsiveness of the NifA protein, synthesis of NifA is oxygen regulated at the level of transcription. This type of control includes FixLJ in R. meliloti and FixLJ-FixK in A. caulinodans or is brought about by autoregulation in B. japonicum. NifA, in concert with sigma 54 RNA polymerase, activates transcription from -24/-12-type promoters associated with nif and fix genes and additional genes that are not directly involved in nitrogen fixation. The FixK proteins constitute a subgroup of the Crp-Fnr family of bacterial regulators. Although the involvement of FixLJ and FixK in nifA regulation is remarkably different in the three rhizobial species discussed here, they constitute a regulatory cascade that uniformly controls the expression of genes (fixNOQP) encoding a distinct cytochrome oxidase complex probably required for bacterial respiration under low-oxygen conditions. In B. japonicum, the FixLJ-FixK cascade also controls genes for nitrate respiration and for one of two sigma 54 proteins. Images

Fischer, H M

1994-01-01

256

Functional ecology of free-living nitrogen fixation: A contemporary perspective  

USGS Publications Warehouse

Nitrogen (N) availability is thought to frequently limit terrestrial ecosystem processes, and explicit consideration of N biogeochemistry, including biological N2 fixation, is central to understanding ecosystem responses to environmental change. Yet, the importance of free-living N2 fixation—a process that occurs on a wide variety of substrates, is nearly ubiquitous in terrestrial ecosystems, and may often represent the dominant pathway for acquiring newly available N—is often underappreciated. Here, we draw from studies that investigate free-living N2 fixation from functional, physiological, genetic, and ecological perspectives. We show that recent research and analytical advances have generated a wealth of new information that provides novel insight into the ecology of N2 fixation as well as raises new questions and priorities for future work. These priorities include a need to better integrate free-living N2 fixation into conceptual and analytical evaluations of the N cycle's role in a variety of global change scenarios.

Reed, Sasha C.; Cleveland, Cory C.; Townsend, Alan R.

2011-01-01

257

Labeling and Enzyme Studies of the Central Carbon Metabolism in Metallosphaera sedula ?  

PubMed Central

Metallosphaera sedula (Sulfolobales, Crenarchaeota) uses the 3-hydroxypropionate/4-hydroxybutyrate cycle for autotrophic carbon fixation. In this pathway, acetyl-coenzyme A (CoA) and succinyl-CoA are the only intermediates that can be considered common to the central carbon metabolism. We addressed the question of which intermediate of the cycle most biosynthetic routes branch off. We labeled autotrophically growing cells by using 4-hydroxy[1-14C]butyrate and [1,4-13C1]succinate, respectively, as precursors for biosynthesis. The labeling patterns of protein-derived amino acids verified the operation of the proposed carbon fixation cycle, in which 4-hydroxybutyrate is converted to two molecules of acetyl-CoA. The results also showed that major biosynthetic flux does not occur via acetyl-CoA, except for the formation of building blocks that are directly derived from acetyl-CoA. Notably, acetyl-CoA is not assimilated via reductive carboxylation to pyruvate. Rather, our data suggest that the majority of anabolic precursors are derived from succinyl-CoA, which is removed from the cycle via oxidation to malate and oxaloacetate. These C4 intermediates yield pyruvate and phosphoenolpyruvate (PEP). Enzyme activities that are required for forming intermediates from succinyl-CoA were detected, including enzymes catalyzing gluconeogenesis from PEP. This study completes the picture of the central carbon metabolism in autotrophic Sulfolobales by connecting the autotrophic carbon fixation cycle to the formation of central carbon precursor metabolites.

Estelmann, Sebastian; Hugler, Michael; Eisenreich, Wolfgang; Werner, Katharina; Berg, Ivan A.; Ramos-Vera, W. Hugo; Say, Rafael F.; Kockelkorn, Daniel; Gad?on, Nasser; Fuchs, Georg

2011-01-01

258

Metabolite profile analysis reveals functional effects of 28-day vitamin B-6 restriction on one-carbon metabolism and tryptophan catabolic pathways in healthy men and women.  

PubMed

Suboptimal vitamin B-6 status, as reflected by low plasma pyridoxal 5'-phosphate (PLP) concentration, is associated with increased risk of vascular disease. PLP plays many roles, including in one-carbon metabolism for the acquisition and transfer of carbon units and in the transsulfuration pathway. PLP also serves as a coenzyme in the catabolism of tryptophan. We hypothesize that the pattern of these metabolites can provide information reflecting the functional impact of marginal vitamin B-6 deficiency. We report here the concentration of major constituents of one-carbon metabolic processes and the tryptophan catabolic pathway in plasma from 23 healthy men and women before and after a 28-d controlled dietary vitamin B-6 restriction (<0.35 mg/d). liquid chromatography-tandem mass spectrometry analysis of the compounds relevant to one-carbon metabolism showed that vitamin B-6 restriction yielded increased cystathionine (53% pre- and 76% postprandial; P < 0.0001) and serine (12% preprandial; P < 0.05), and lower creatine (40% pre- and postprandial; P < 0.0001), creatinine (9% postprandial; P < 0.05), and dimethylglycine (16% postprandial; P < 0.05) relative to the vitamin B-6-adequate state. In the tryptophan pathway, vitamin B-6 restriction yielded lower kynurenic acid (22% pre- and 20% postprandial; P < 0.01) and higher 3-hydroxykynurenine (39% pre- and 34% postprandial; P < 0.01). Multivariate ANOVA analysis showed a significant global effect of vitamin B-6 restriction and multilevel partial least squares-discriminant analysis supported this conclusion. Thus, plasma concentrations of creatine, cystathionine, kynurenic acid, and 3-hydroxykynurenine jointly reveal effects of vitamin B-6 restriction on the profiles of one-carbon and tryptophan metabolites and serve as biomarkers of functional effects of marginal vitamin B-6 deficiency. PMID:23966327

da Silva, Vanessa R; Rios-Avila, Luisa; Lamers, Yvonne; Ralat, Maria A; Midttun, Oivind; Quinlivan, Eoin P; Garrett, Timothy J; Coats, Bonnie; Shankar, Meena N; Percival, Susan S; Chi, Yueh-Yun; Muller, Keith E; Ueland, Per Magne; Stacpoole, Peter W; Gregory, Jesse F

2013-08-21

259

Gene Variants in the Folate-mediated One-carbon Metabolism (FOCM) Pathway as Risk Factors for Conotruncal Heart Defects  

PubMed Central

We evaluated 35 variants among four folate-mediated one-carbon metabolism pathway genes, MTHFD1, SHMT1, MTHFR, and DHFR as risk factors for conotruncal heart defects. Cases with a diagnosis of single gene disorders or chromosomal aneusomies were excluded. Controls were randomly selected from area hospitals in proportion to their contribution to the total population of live-born infants. Odds Ratios (OR) and the 95% confidence intervals were computed for each genotype (homozygous variant or heterozygote, versus homozygous wildtype) and for increase of each less common allele (log-additive model). Interactions between each variant and three folate intake variables (maternal multivitamin use, maternal dietary folate intake, and combined maternal folate intake) were also evaluated under the log-additive model. In general, we did not identify notable associations. The A allele of MTHFD1 rs11627387 was associated with a 1.7-fold increase in conotruncal defects risk in both Hispanic mothers (OR=1.7, 95% CI=1.1?2.5) and Hispanic infants (OR=1.7, 95% CI=1.2?2.3). The T allele of MTHFR rs1801133 was associated with a 2.8-fold increase of risk among Hispanic women whose dietary folate intake was ? 25th centile. The C allele of MTHFR rs1801131 was associated with a two-fold increase of risk (OR=2.0, 95%CI=1.0?3.9) only among those whose dietary folate intake was >25th centile. Our study suggested that MTHFD1 rs11627387 may be associated with risk of conotruncal defects through both maternal and offspring genotype effect among the Hispanics. Maternal functional variants in MTHFR gene may interact with dietary folate intake and modify the conotruncal defects risk in the offspring.

Zhu, Huiping; Yang, Wei; Lu, Wei; Etheredge, Analee; Lammer, Edward J; Finnell, Richard; Carmichael, Suzan L.; Shaw, Gary

2012-01-01

260

Femoral Reconstruction Using External Fixation  

PubMed Central

Background. The use of an external fixator for the purpose of distraction osteogenesis has been applied to a wide range of orthopedic problems caused by such diverse etiologies as congenital disease, metabolic conditions, infections, traumatic injuries, and congenital short stature. The purpose of this study was to analyze our experience of utilizing this method in patients undergoing a variety of orthopedic procedures of the femur. Methods. We retrospectively reviewed our experience of using external fixation for femoral reconstruction. Three subgroups were defined based on the primary reconstruction goal lengthening, deformity correction, and repair of nonunion/bone defect. Factors such as leg length discrepancy (LLD), limb alignment, and external fixation time and complications were evaluated for the entire group and the 3 subgroups. Results. There was substantial improvement in the overall LLD, femoral length discrepancy, and limb alignment as measured by mechanical axis deviation (MAD) and lateral distal femoral angle (LDFA) for the entire group as well as the subgroups. Conclusions. The Ilizarov external fixator allows for decreased surgical exposure and preservation of blood supply to bone, avoidance of bone grafting and internal fixation, and simultaneous lengthening and deformity correction, making it a very useful technique for femoral reconstruction.

Palatnik, Yevgeniy; Rozbruch, S. Robert

2011-01-01

261

Carbon isotopic fractionations associated with thermophilic bacteria Thermotoga maritima and Persephonella marina.  

PubMed

Stable carbon isotopes can provide insight into carbon cycling pathways in natural environments. We examined carbon isotope fractionations associated with a hyperthermophilic fermentative bacterium, Thermotoga maritima, and a thermophilic chemolithoautotrophic bacterium Persephonella marina. In T. maritima, phospholipid fatty acids (PLFA) are slightly enriched in 13C relative to biomass (epsilon = 0.1-0.8 per thousand). However, PLFA and biomass are depleted in 13C relative to the substrate glucose by approximately 8 per thousand. In P. marina, PLFA are 1.8-14.5 per thousand enriched in 13C relative to biomass, which suggests that the reversed tricarboxylic acid (TCA) cycle or the 3-hydroxypropionate pathway may be used for CO2 fixation. This is supported by small fractionation between biomass and CO2 (epsilon = -3.8 per thousand to -5.0 per thousand), which is similar to fractionations reported for other organisms using similar CO2 fixation pathways. Identification of the exact pathway will require biochemical assay for specific enzymes associated with the reversed TCA cycle or the 3-hydroxypropionate pathway. PMID:11966826

Zhang, Chuanlun L; Ye, Qi; Reysenbach, Anna-Louise; Götz, Dorothee; Peacock, Aaron; White, David C; Horita, Juske; Cole, David R; Fong, Jon; Pratt, Lisa; Fang, Jiasong; Huang, Yongsong

2002-01-01

262

Determination of pathways of glycogen synthesis and the dilution of the three-carbon pool with (U- sup 13 C)glucose  

SciTech Connect

Rats were infused with glucose at 30 mg/min, containing 18% enriched (U-{sup 13}C)glucose and (1-{sup 14}C)- and (3-{sup 3}H)glucose and liver glycogen were determined by gas chromatography/mass spectroscopy. The contribution of the direct pathway to glycogen was calculated from the three tracers, and the values by all three were nearly identical, about 50%. The {sup 14}C specific activity in carbon 6 of glycogen glucose was about 6% that of carbon 1. The ({sup 3}H)glucose/(1-{sup 14}C)glucose ratio in glycogen was 80-90% that is blood glucose. The enrichment of {sup 13}C and the specific activity of {sup 14}C in glycogen formed by the indirect path were 20-25% of glycogen formed directly from glucose. The dilution is of two kinds: (1) an exchange of labeled carbon with unlabeled carbon in the tricarboxylic acid cycle and (2) dilution by unlabeled nonglucose carbon. Methods to calculate the two types of dilution are presented. In rate preinjected with glucagon, the dilution through the tricarboxylic acid cycle was unaffected but that by nonglucose carbon was decreased.

Katz, J.; Wals, P.A. (Cedars-Sinai Medical Center, Los Angeles, CA (United States)); Lee, W.N.P. (Los Angeles Research and Education Inst., Torrance, CA (United States))

1991-03-15

263

A case of needle fixation.  

PubMed

Needle fixation is frequently missed and dismissed by clinicians and patients. However, ignoring this condition can have severe consequences, such as septicaemia, thrombosis, blood borne viruses, and is associated with an overall poor prognosis of drug dependence.Here we describe a 37-year-old man who presented with 20-year history of polydrug dependence, drug-induced psychosis and antisocial personality disorder. He was found to also have a 5-year history of intermittent needle fixation. His injecting behaviour and drug use improved significantly with fluoxetine while being on methadone maintenance.At present there is little evidence for any effective treatment strategies for needle fixation. The current recommended treatment consists of cognitive behavioural therapy and cue exposure. Whether fluoxetine constitutes an effective management strategy remains to be seen. PMID:22479297

Treffurth, Yvonne; Pal, Hem Raj

2010-04-05

264

Life in hot acid: Pathway analyses in extremely thermoacidophilic archaea  

PubMed Central

SUMMARY The extremely thermoacidophilic archaea are a particularly intriguing group of microorganisms that must simultaneously cope with biologically extreme pHs (? 4) and temperatures (Topt ? 60°C) in their natural environments. Their expandi ng biotechnological significance relates to their role in biomining of base and precious metals and their unique mechanisms of survival in hot acid, at both the cellular and biomolecular levels. Recent developments, such as advances in understanding of heavy metal tolerance mechanisms, implementation of a genetic system, and discovery of a new carbon fixation pathway, have been facilitated by availability of genome sequence data and molecular genetic systems. As a result, new insights into the metabolic pathways and physiological features that define extreme thermoacidophily have been obtained, in some cases suggesting prospects for biotechnological opportunities.

Auernik, Kathryne S.; Cooper, Charlotte R.; Kelly, Robert M.

2013-01-01

265

13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose  

Microsoft Academic Search

BACKGROUND: The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions

Paula Jouhten; Esa Pitkänen; Tiina Pakula; Markku Saloheimo; Merja Penttilä; Hannu Maaheimo

2009-01-01

266

OVEREXPRESSION OF A NODULE-ENHANCED MALATE DEHYDROGENASE INCREASES NITROGEN FIXATION IN ALFALFA  

Technology Transfer Automated Retrieval System (TEKTRAN)

Malate is crucial for symbiotic dinitrogen (N2) fixation, occurring in high concentrations in N2-fixing nodules as the major carbon source for bacteroid respiration. Malate also provides carbon skeletons for the assimilation of fixed nitrogen from ammonia into amino acids and is proposed to be invol...

267

Changes in North Atlantic nitrogen fixation controlled by ocean circulation.  

PubMed

In the ocean, the chemical forms of nitrogen that are readily available for biological use (known collectively as 'fixed' nitrogen) fuel the global phytoplankton productivity that exports carbon to the deep ocean. Accordingly, variation in the oceanic fixed nitrogen reservoir has been proposed as a cause of glacial-interglacial changes in atmospheric carbon dioxide concentration. Marine nitrogen fixation, which produces most of the ocean's fixed nitrogen, is thought to be affected by multiple factors, including ocean temperature and the availability of iron and phosphorus. Here we reconstruct changes in North Atlantic nitrogen fixation over the past 160,000?years from the shell-bound nitrogen isotope ratio ((15)N/(14)N) of planktonic foraminifera in Caribbean Sea sediments. The observed changes cannot be explained by reconstructed changes in temperature, the supply of (iron-bearing) dust or water column denitrification. We identify a strong, roughly 23,000-year cycle in nitrogen fixation and suggest that it is a response to orbitally driven changes in equatorial Atlantic upwelling, which imports 'excess' phosphorus (phosphorus in stoichiometric excess of fixed nitrogen) into the tropical North Atlantic surface. In addition, we find that nitrogen fixation was reduced during glacial stages 6 and 4, when North Atlantic Deep Water had shoaled to become glacial North Atlantic intermediate water, which isolated the Atlantic thermocline from excess phosphorus-rich mid-depth waters that today enter from the Southern Ocean. Although modern studies have yielded diverse views of the controls on nitrogen fixation, our palaeobiogeochemical data suggest that excess phosphorus is the master variable in the North Atlantic Ocean and indicate that the variations in its supply over the most recent glacial cycle were dominated by the response of regional ocean circulation to the orbital cycles. PMID:23965620

Straub, Marietta; Sigman, Daniel M; Ren, Haojia; Martínez-García, Alfredo; Meckler, A Nele; Hain, Mathis P; Haug, Gerald H

2013-08-21

268

An inexpensive and available external fixator.  

PubMed

This article introduces a simple and inexpensive external fixator device which has been designed and manufactured from materials readily available in this country. It is called the Doxa Fixator. PMID:11391841

Dagbue, N A

269

Carbonates.  

National Technical Information Service (NTIS)

There are approximately 150 carbonate minerals that occur in nature; however, most of these carbonates are relatively rare. The most common rock-forming carbonates are calcite (CaC03) and dolomite (CaMg(C03)2), which account for over 90 % of natural carbo...

D. W. Ming

2001-01-01

270

Fixation biases affecting human SNPs  

Microsoft Academic Search

Under neutrality all classes of mutation have an equal probability of becoming fixed in a population. In this article, we describe our analysis of the frequency distributions of >5000 human SNPs and provide evidence of biases in the process of fixation of certain classes of point mutation that are most likely to be attributable to biased gene conversion. The results

Matthew T. Webster; Nick G. C. Smith

2004-01-01

271

Polymeric media for tritium fixation  

Microsoft Academic Search

The synthesis and leach testing of several polymeric media for tritium ; fixation are presented. Tritiated bakelite, poly(acrylonitrile) and polystyrene ; successfully fixed tritium. Tritium leach rates at the tracer level appear to be ; negligible. Advantages and disadvantages of the processes are discussed, and ; further bench-scale investigations underway are reported. Rough cost estimates ; are presented for the

J. A. Franz; L. L. Burger

1975-01-01

272

Quantitative Approach to Camera Fixation.  

National Technical Information Service (NTIS)

The paper deals with quantitative aspects of camera fixation for a static scene. In general, when the camera undergoes translation and rotation, there is an infinite number of points that produce equal optical flow for any instantaneous point in time. Usi...

D. Raviv

1990-01-01

273

Methacarn (methanol-Carnoy) fixation  

Microsoft Academic Search

According to chemical data, methanol raises the shrinkage temperature of collagen significantly more than ethanol (86° C versus 70° C). Since increase of shrinkage temperature appears desirable in tissues to be embedded in paraffin, methanol was substituted for ethanol in Carnoy's fluid. This methanol-Carnoy mixture is referred to as methacarn solution. The fixation-embedding procedure was similar to that described in

Holde Puchtler; Faye Sweat Waldrop; Susan N. Meloan; Mary S. Terry; H. M. Conner

1970-01-01

274

Fixation of microsporidian spores for electron microscopy.  

PubMed

Fresh and frozen spores of the microsporidia Nosema apis and Nosema bombi were fixed using various fixatives at different times and temperatures. Paraformaldehyde and technical formaldehyde gave results comparable to or better than glutaraldehyde. Increased fixation temperature improved the fixation of spores from terrestrial hosts. Freezing did not destroy the cytology of the spore. PMID:16112682

Larsson, J I Ronny

2005-08-19

275

Osmolarity of osmium tetroxide and glutaraldehyde fixatives  

Microsoft Academic Search

Synopsis  The evidence available to date for the importance of fixative osmolarity is considered together with some observations on the volume changes of crab axons after fixation by osmium tetroxide and glutaraldehyde. The results obtained are compared with those obtained from crab axons and from amphioxus skin cells which had been processed and examined with the electron microscope after initial fixation

Q. Bone; K. P. Ryan

1972-01-01

276

Allograft interference screw fixation in meniscus transplantation  

Microsoft Academic Search

Allograft meniscus transplantation is indicated to restore proper knee biomechanics and prevent subsequent articular degeneration in patients with a meniscus-deficient knee. A variety of techniques for fixation of meniscal transplants exist, with some techniques using soft-tissue fixation of the meniscal horns and others using bony fixation. The authors present a technique of meniscus transplantation using a tibial slot with allograft

Jack Farr; R. Michael Meneghini; Brian J. Cole

2004-01-01

277

Acetate Regulation of Spore Formation Is under the Control of the Ras/Cyclic AMP/Protein Kinase A Pathway and Carbon Dioxide in Saccharomyces cerevisiae  

PubMed Central

In Saccharomyces cerevisiae, the Ras/cyclic AMP (cAMP)/protein kinase A (PKA) pathway is a nutrient-sensitive signaling cascade that regulates vegetative growth, carbohydrate metabolism, and entry into meiosis. How this pathway controls later steps of meiotic development is largely unknown. Here, we have analyzed the role of the Ras/cAMP/PKA pathway in spore formation by the meiosis-specific manipulation of Ras and PKA or by the disturbance of cAMP production. We found that the regulation of spore formation by acetate takes place after commitment to meiosis and depends on PKA and appropriate A kinase activation by Ras/Cyr1 adenylyl cyclase but not by activation through the Gpa2/Gpr1 branch. We further discovered that spore formation is regulated by carbon dioxide/bicarbonate, and an analysis of mutants defective in acetate transport (ady2?) or carbonic anhydrase (nce103?) provided evidence that these metabolites are involved in connecting the nutritional state of the meiotic cell to spore number control. Finally, we observed that the potential PKA target Ady1 is required for the proper localization of the meiotic plaque proteins Mpc70 and Spo74 at spindle pole bodies and for the ability of these proteins to initiate spore formation. Overall, our investigation suggests that the Ras/cAMP/PKA pathway plays a crucial role in the regulation of spore formation by acetate and indicates that the control of meiotic development by this signaling cascade takes places at several steps and is more complex than previously anticipated.

Jungbluth, Marc; Mosch, Hans-Ulrich

2012-01-01

278

Iron controls chemical and mineralogical pathways in organic-rich mudstones: implications for carbon and phosphorus burial and source-rock evolution.  

NASA Astrophysics Data System (ADS)

Early diagenetic pathways in Recent mud and ancient mudstone successions are mediated by microbial respiratory processes. Inevitably, these reactions are dependent upon availability of bioavailable reductants and oxidants. In Recent sediments consortia of micro-organisms exist that efficiently utilise the available reductants and oxidants such that generally very little organic matter leaks out of the biosphere into the lithosphere. In the rock record there are numerous examples where organic matter flux from the biosphere to the lithosphere seems to have been significantly large, resulting in the burial of organic matter rich mudstone successions. These successions, however, display contrasting variability in organic matter composition and diagenetic pathways. This variability is partly the result of the possibility for the organic component to be rendered refractory by early sulfurization (natural vulcanizaton). The chemical pathways that lead to early and rapid sulfurization are poorly known. It is likely however, that they are controlled by the prolonged availability of sulfur in pre-compaction pore waters. This paper seeks to address some of the fundamental mechanisms that might control sulfur-distributions in the pore waters of organic-rich fine-grained sediments. In order to investigate this problem the diagenetic pathways in two contrasting organic-rich mudstone lithofacies are compared, the Miocene Monterey Formation, California, and the Jurassic Kimmeridge Clay Formation, U.K., to determine the role that initial mineralogy may play in controlling subsequent pore water chemistries and resulting microbially mediated diagenetic pathways. To investigate this problem whole rock geochemical data are compared with high-resolution images of the rocks collected using combined optical and electron-optical methods. These techniques demonstrate that these two mudstones, in spite superficial similarities in their macroscopic appearance are very different. Although both contain significant organic matter and other production-derived components (eg. Coccolithophores), the matrix of the Kimmeridge Clay Formation is dominated by clay minerals, and pyrite, along with carbonate cements. In contrast, the Monterey Formation contains abundant diatoms, only trace pyrite and abundant phosphate cement. We conclude that the presence of clastic input, specifically the availability of Fe(III) associated with this supply, has a dramatic effect on diagenetic pathways. In iron-rich mudstones, Fe(III) acts as a sink for reduced sulfur species as pyrite is buried, whereas in iron-poor mudstones organic matter acts as a sink for sulfur in the absence of iron, leading to the burial of sulfur-rich organic matter. The varying presence of detrital iron in these settings plays an important role in the subsequent diagenesis of these rocks and is likely one of the fundamental controls on both natural carbon sequestration efficiency and organic matter evolution and maturation during diagenesis.

Macquaker, J. H. S.; Taylor, K. G.; Keller, M.; Polya, D.

2009-04-01

279

11CO2 fixation: a renaissance in PET radiochemistry.  

PubMed

Carbon-11 labelled carbon dioxide is the cyclotron-generated feedstock reagent for most positron emission tomography (PET) tracers using this radionuclide. Most carbon-11 labels, however, are installed using derivative reagents generated from [(11)C]CO2. In recent years, [(11)C]CO2 has seen a revival in applications for the direct incorporation of carbon-11 into functional groups such as ureas, carbamates, oxazolidinones, carboxylic acids, esters, and amides. This review summarizes classical [(11)C]CO2 fixation strategies using organometallic reagents and then focuses on newly developed methods that employ strong organic bases to reversibly capture [(11)C]CO2 into solution, thereby enabling highly functionalized labelled compounds to be prepared. Labelled compounds and radiopharmaceuticals that have been translated to the clinic are highlighted. PMID:23673726

Rotstein, Benjamin H; Liang, Steven H; Holland, Jason P; Collier, Thomas Lee; Hooker, Jacob M; Wilson, Alan A; Vasdev, Neil

2013-05-14

280

Fixation of 18O2 during Photorespiration  

PubMed Central

Mass spectrometric techniques were used to trace the incorporation of [18O]oxygen into metabolites of the photorespiratory pathway. Glycolate, glycine, and serine extracted from leaves of the C3 plants, Spinacia oleracea L., Atriplex hastata, and Helianthus annuus which had been exposed to [18O]oxygen at the CO2 compensation point were heavily labeled with 18O. In each case one, and only one of the carboxyl oxygens was labeled. The abundance of 18O in this oxygen of glycolate reached 50 to 70% of that of the oxygen provided after only 5 to 10 seconds exposure to [18O]oxygen. Glycine and serine attained the same final enrichment after 40 and 180 seconds, respectively. This confirms that glycine and serine are synthesized from glycolate. The labeling of photorespiratory intermediates in intact leaves reached a mean of 59% of that of the oxygen provided in the feedings. This indicates that at least 59% of the glycolate photorespired is synthesized with the fixation of molecular oxygen. This estimate is certainly conservative owing to the dilution of labeled oxygen at the site of glycolate synthesis by photosynthetic oxygen. We examined the yield of 18O in glycolate synthesized in vitro by isolated intact spinach chloroplasts in a system which permitted direct sampling of the isotopic composition of the oxygen at the site of synthesis. The isotopic enrichment of glycolate from such experiments was 90 to 95% of that of the oxygen present during the incubation. The carboxyl oxygens of 3-phosphoglycerate also became labeled with 18O in 20- and 40-minute feedings with [18O]oxygen to intact leaves at the CO2 compensation point. Control experiments indicated that this label was probably due to direct synthesis of 3-phosphoglycerate from glycolate during photorespiration. The mean enrichment of 3-phosphoglycerate was 14 ± 4% of that of glycine or serine, its precursors of the photorespiratory pathway, in 10 separate feeding experiments. It is argued that this constant dilution of label indicates a constant stoichiometric balance between photorespiratory and photosynthetic sources of 3-phosphoglycerate at the CO2 compensation point. Oxygen uptake sufficient to account for about half of the rate of 18O fixation into glycine in the intact leaves was observed with intact spinach chloroplasts. Oxygen uptake and production by intact leaves at the CO2 compensation point indicate about 1.9 oxygen exchanged per glycolate photorespired. The fixation of molecular oxygen into glycolate plus the peroxisomal oxidation of glycolate to glyoxylate and the mitochondrial conversion of glycine to serine can account for up to 1.75 oxygen taken up per glycolate. These studies provide new evidence which supports the current formulation of the pathway of photorespiration and its relation to photosynthetic metabolism. The experiments described also suggest new approaches using stable isotope techniques to study the rate of photorespiration and the balance between photorespiration and photosynthesis in vivo.

Berry, Joseph A.; Osmond, C. Barry; Lorimer, George H.

1978-01-01

281

Carbon Monoxide from Composting due to Thermal Oxidation of Biomass: An Additional Pathway for CO in Agricultural and Forest Ecosystems  

Microsoft Academic Search

Carbon monoxide (CO) influences tropospheric chemistry and, in particular, tropospheric ozone (O3) concentration. The major sources of CO are incomplete combustion and photochemical oxidation of atmospheric hydrocarbons. Other sources include emissions from green plants, dry soils, and degrading plant matter. Studying trace gas releases from composting processes with a high-resolution FT-IR spectrometer, we observed emissions of carbon dioxide (CO2) and

H. J. Hellebrand

282

First direct measurements of N2 fixation during a Trichodesmium bloom in the eastern Arabian Sea  

NASA Astrophysics Data System (ADS)

We report the first direct estimates of N2 fixation rates measured during the spring, 2009 using the 15N2 gas tracer technique in the eastern Arabian Sea, which is well known for significant loss of nitrogen due to intense denitrification. Carbon uptake rates are also concurrently estimated using the 13C tracer technique. The N2 fixation rates vary from ˜0.1 to 34 mmol N m-2d-1 after correcting for the isotopic under-equilibrium with dissolved air in the samples. These higher N2 fixation rates are consistent with higher chlorophyll a and low ?15N of natural particulate organic nitrogen. Our estimates of N2 fixation is a useful step toward reducing the uncertainty in the nitrogen budget.

Gandhi, Naveen; Singh, Arvind; Prakash, S.; Ramesh, R.; Raman, Mini; Sheshshayee, M. S.; Shetye, Suhas

2011-12-01

283

An oculomotor continuum from exploration to fixation.  

PubMed

During visual exploration, saccadic eye movements scan the scene for objects of interest. During attempted fixation, the eyes are relatively still but often produce microsaccades. Saccadic rates during exploration are higher than those of microsaccades during fixation, reinforcing the classic view that exploration and fixation are two distinct oculomotor behaviors. An alternative model is that fixation and exploration are not dichotomous, but are instead two extremes of a functional continuum. Here, we measured the eye movements of human observers as they either fixed their gaze on a small spot or scanned natural scenes of varying sizes. As scene size diminished, so did saccade rates, until they were continuous with microsaccadic rates during fixation. Other saccadic properties varied as function of image size as well, forming a continuum with microsaccadic parameters during fixation. This saccadic continuum extended to nonrestrictive, ecological viewing conditions that allowed all types of saccades and fixation positions. Eye movement simulations moreover showed that a single model of oculomotor behavior can explain the saccadic continuum from exploration to fixation, for images of all sizes. These findings challenge the view that exploration and fixation are dichotomous, suggesting instead that visual fixation is functionally equivalent to visual exploration on a spatially focused scale. PMID:23533278

Otero-Millan, Jorge; Macknik, Stephen L; Langston, Rachel E; Martinez-Conde, Susana

2013-03-26

284

An oculomotor continuum from exploration to fixation  

PubMed Central

During visual exploration, saccadic eye movements scan the scene for objects of interest. During attempted fixation, the eyes are relatively still but often produce microsaccades. Saccadic rates during exploration are higher than those of microsaccades during fixation, reinforcing the classic view that exploration and fixation are two distinct oculomotor behaviors. An alternative model is that fixation and exploration are not dichotomous, but are instead two extremes of a functional continuum. Here, we measured the eye movements of human observers as they either fixed their gaze on a small spot or scanned natural scenes of varying sizes. As scene size diminished, so did saccade rates, until they were continuous with microsaccadic rates during fixation. Other saccadic properties varied as function of image size as well, forming a continuum with microsaccadic parameters during fixation. This saccadic continuum extended to nonrestrictive, ecological viewing conditions that allowed all types of saccades and fixation positions. Eye movement simulations moreover showed that a single model of oculomotor behavior can explain the saccadic continuum from exploration to fixation, for images of all sizes. These findings challenge the view that exploration and fixation are dichotomous, suggesting instead that visual fixation is functionally equivalent to visual exploration on a spatially focused scale.

Otero-Millan, Jorge; Macknik, Stephen L.; Langston, Rachel E.; Martinez-Conde, Susana

2013-01-01

285

Identification of glucose kinase-dependent and -independent pathways for carbon control of primary metabolism, development and antibiotic production in Streptomyces coelicolor by quantitative proteomics.  

PubMed

Members of the soil-dwelling prokaryotic genus Streptomyces are indispensable for the recycling of complex polysaccharides, and produce a wide range of natural products. Nutrient availability is a major determinant for the switch to development and antibiotic production in streptomycetes. Carbon catabolite repression (CCR), a main signalling pathway underlying this phenomenon, was so far considered fully dependent on the glycolytic enzyme glucose kinase (Glk). Here we provide evidence of a novel Glk-independent pathway in Streptomyces coelicolor, using advanced proteomics that allowed the comparison of the expression of some 2000 proteins, including virtually all enzymes for central metabolism. While CCR and inducer exclusion of enzymes for primary and secondary metabolism and precursor supply for natural products is mostly mediated via Glk, enzymes for the urea cycle, as well as for biosynthesis of the ?-butyrolactone Scb1 and the responsive cryptic polyketide Cpk are subject to Glk-independent CCR. Deletion of glkA led to strong downregulation of biosynthetic proteins for prodigionins and calcium-dependent antibiotic (CDA) in mannitol-grown cultures. Repression of bldB, bldN, and its target bldM may explain the poor development of S.?coelicolor on solid-grown cultures containing glucose. A new model for carbon catabolite repression in streptomycetes is presented. PMID:23078239

Gubbens, Jacob; Janus, Marleen; Florea, Bogdan I; Overkleeft, Herman S; van Wezel, Gilles P

2012-11-05

286

Appearance and accumulation of C/sub 4/ carbon pathway enzymes in developing maize leaves and differentiating maize A188 callus  

SciTech Connect

Regenerating maize A188 tissue cultures were examined for the presence of enzymes involved in C/sub 4/ photosynthesis, for cell morphology, and for /sup 14/C labeling kinetics to study the implementation of this pathway during plant development. For comparison, sections of maize seedling leaves were examined. Protein blot analysis using antibodies to leaf enzymes showed a different profile of these enzymes during the early stages of shoot regeneration from callus from the closely-coordinated profile observed in seedling leaves. Pyruvate orthophosphate dikinase (PPDK) (EC 2.7.9.1) and phosphoenolpyruvate carboxylase (PEPC) (EC 4.1.1.31) were found in nonchlorophyllous callus while ribulose 1,5-bisphosphate carboxylase (RuBPC, EC 4.1.1.39) and malic enzyme, NADP-specific (ME-NADP) (EC 1.3.1.37) were not detectable until later. Enzyme activity assays showed the presence of ME-NADP as well as PEPC and PPDK in nonchlorophyllous callus. However, the activities of ME-NADP and PEPC had properties similar to those of the enzymes from C/sub 3/ leaves and from etiolated C/sub 4/ leaf tissues, but differing from the corresponding enzymes in the mature leaf. Immunoprecipitation of in vitro translation products of poly(A)RNA extracted from embryoid-forming callus showed both the 110 kilodalton precursor to chloroplast PPDK and the 94 kilodalton polypeptide. Therefore, the chloroplast tye of PPDK mRNA is present prior to the appearance of leaf morphology. Analysis of the labeled products of /sup 14/CO/sub 2/ fixation by nonchlorophyllous calli indicated ..beta..-carboxylation to give acids of the tricarboxylic acid cycle, but no incorporation into phosphoglycerate. With greening of the callus, some incorporation into phosphoglycerate and sugar phosphates occurred, and this increased in shoots as they developed, although with older shoots the increase in ..beta..-carboxylation products was even greater.

Aoyagi, K.; Bassham, J.A.

1986-02-01

287

Degradation pathway of bisphenol A: does ipso substitution apply to phenols containing a quaternary alpha-carbon structure in the para position?  

PubMed

The degradation of bisphenol A and nonylphenol involves the unusual rearrangement of stable carbon-carbon bonds. Some nonylphenol isomers and bisphenol A possess a quaternary alpha-carbon atom as a common structural feature. The degradation of nonylphenol in Sphingomonas sp. strain TTNP3 occurs via a type II ipso substitution with the presence of a quaternary alpha-carbon as a prerequisite. We report here a new degradation pathway of bisphenol A. Consequent to the hydroxylation at position C-4, according to a type II ipso substitution mechanism, the C-C bond between the phenolic moiety and the isopropyl group of bisphenol A is broken. Besides the formation of hydroquinone and 4-(2-hydroxypropan-2-yl)phenol as the main metabolites, further compounds resulting from molecular rearrangements consistent with a carbocationic intermediate were identified. Assays with resting cells or cell extracts of Sphingomonas sp. strain TTNP3 under an (18)O(2) atmosphere were performed. One atom of (18)O(2) was present in hydroquinone, resulting from the monooxygenation of bisphenol A and nonylphenol. The monooxygenase activity was dependent on both NADPH and flavin adenine dinucleotide. Various cytochrome P450 inhibitors had identical inhibition effects on the conversion of both xenobiotics. Using a mutant of Sphingomonas sp. strain TTNP3, which is defective for growth on nonylphenol, we demonstrated that the reaction is catalyzed by the same enzymatic system. In conclusion, the degradation of bisphenol A and nonylphenol is initiated by the same monooxygenase, which may also lead to ipso substitution in other xenobiotics containing phenol with a quaternary alpha-carbon. PMID:17557840

Kolvenbach, B; Schlaich, N; Raoui, Z; Prell, J; Zühlke, S; Schäffer, A; Guengerich, F P; Corvini, P F X

2007-06-08

288

Appearance and accumulation of Câ carbon pathway enzymes in developing maize leaves and differentiating maize A188 callus  

Microsoft Academic Search

Regenerating maize A188 tissue cultures were examined for the presence of enzymes involved in Câ photosynthesis, for cell morphology, and for ¹⁴C labeling kinetics to study the implementation of this pathway during plant development. For comparison, sections of maize seedling leaves were examined. Protein blot analysis using antibodies to leaf enzymes showed a different profile of these enzymes during the

K. Aoyagi; J. A. Bassham

1986-01-01

289

Intramedullary foot fixation for midfoot Charcot neuroarthropathy.  

PubMed

Midfoot Charcot collapse commonly occurs through the tarsometatarsal and/or midtarsal joints, which creates the characteristic "rocker bottom" deformity. Intramedullary metatarsal fixation spanning the tarsus into the talus and/or calcaneus is a recently developed method for addressing unstable midfoot Charcot deformity. The intramedullary foot fixation technique has various advantages when addressing midfoot Charcot deformity in the neuropathic patient. These advantages include anatomical realignment, minimally invasive fixation technique, formal multiple joint fusion, adjacent joint fixation beyond the level of Charcot collapse, rigid interosseus fixation, and preservation of foot length. The goals of the intramedullary foot fixation procedure are to create a stable, plantigrade, and ulcer-free foot, which allows the patient to ambulate with custom-molded orthotics and shoes. PMID:22632840

Lamm, Bradley M; Siddiqui, Noman A; Nair, Ajitha K; LaPorta, Guido

2012-05-24

290

Carbon and nitrogen cycling in thermally heated sediments  

NASA Astrophysics Data System (ADS)

Hydrothermally heated sediment environments, such as are found in abundance throughout Yellowstone National Park, host fully functional microbial ecosystems. As with any ecosystem, both sources and sinks of carbon, nitrogen, and a myriad of other nutrients and energy-driving factors must be supplied. While we know microbial communities in hydrothermal environments can be surprisingly diverse, we know little about basic ecological functions such as carbon and nitrogen cycling. Previous work has shown that carbon cycling in one hot spring in Yellowstone National Park [“Bison Pool”] and its associated runoff channel functions as a complex system. Analysis of carbon and nitrogen isotopes in sediments and biofilms across a temperature and chemical gradient at this location revealed that the four best studied carbon fixation pathways [Calvin, reverse tricarboxylic acid, acetyl-CoA, 3-hydroxypropionate cycles] may all be functioning in this system, and nitrogen fixation varies across the chemosynthetic/photosynthetic ecotone [1]. Microcosm experiments using biofilms from this hot spring as inoculae with 13C labeled carbon substrates indicate heterotrophic growth [2]. In addition, metagenomic analysis of environmental DNA has indicated the presence of genes involved in carbon fixation [both phototrophic and autotrophic], and heterotrophy, as well as nitrogen fixation [3]. Studies from other Yellowstone locations have also found genetic evidence for carbon and nitrogen fixation [4, 5]. Of particular interest is the role of individuals in carbon and nitrogen cycling as environmental conditions suitable for chemosynthetic and photosynthetic growth vary. This study explores the diversity of cbbM/cbbL [Calvin cycle], aclB/oor/porA [rTCA cycle], nifH [nitrogen fixation], nirK [nitrite reduction] and amoA [ammonia oxidation] genes across a variety of Yellowstone environments. The transition of genetic diversity within sediments and biofilms is focused on the chemosynthetic/photosynthetic ecotone from a variety of hot springs spanning a range of pH and geochemical conditions. By sampling across this ecotone, changes in carbon and nitrogen fixation as a function of changing community structure become apparent. Environmental DNA was extracted from these samples, and the presence/absence of Bacteria and Archaea determined by PCR. In addition, PCR-directed screens reveal the presence or absence of the aforementioned functional genes. Further, comparison across a broad spectrum of environmental conditions supplies context for phylogenetic analysis of diversity. [1] Havig, J.R., 2009. Geochemistry of Hydrothermal Biofilms: Composition of Biofilms in Siliceous Sinter-Deposting Hot Springs. Doctoral Dissertation, Arizona State University. [2] Meyer-Dombard et al., 2007. Microbial Diversity and SIP Investigations of Streamer Biofilm Communities in Yellowstone. Goldschmidt Geochemical Conference. [3] Raymond et al., 2008. EOS Trans AGU. Abstract B14A-03. [4] Hall et al., 2008. AEM 74:4910-4922. [5] Steunou et al., 2006. PNAS 103:2398-2403.

Meyer-Dombard, D. R.; Burton, M.; Vennelakanti, S.; Havig, J. R.; Shock, E.

2009-12-01

291

Carbon-Isotope Fractionations of Autotrophic Bacteria: Relevance to Primary Production and Microbial Evolution in Hot Springs and Hydrothermal Vents  

NASA Astrophysics Data System (ADS)

Terrestrial hot springs and marine hydrothermal vents are often dominated by autotrophic microorganisms. Species of the Bacteria Domain in these environments are known to use different pathways for CO2 fixation. These may include the Calvin cycle, the Acetyl CoA pathway, the reverse TCA cycle, and the 3-HP pathway. Each cycle or pathway may be characterized by distinct patterns of carbon isotope fractionation. This presentation will summarize isotope fractionation patterns associated with known autotrophic bacteria and to use these patterns for interpreting natural isotopic variations. Examples will include hot springs from the Yellowstone National Park and Nevada desert, USA and Kamchatka, Russia, and hydrothermal vents from the East Pacific Rise. An attempt will be made to discuss isotopic variations within a particular pathway in the context of species evolution through horizontal gene transfer.

Zhang, C. L.; Romanek, C. S.; Mills, G.

2004-12-01

292

Strength of internal fixation for calcaneal fractures  

Microsoft Academic Search

Objective. To compare the strength of two types of fixation method for calcaneal fractures.Design. A biomechanical testing examined the stability of 12 fractured calcaneal specimens fixed with two different methods.Background. Though anatomic reduction and internal fixation for the treatment of intra-articular fractures of the calcaneus has become popular, biomechanical data on the fixation strength is lacking.Methods. Twenty fresh frozen specimens

Chung-Li Wang; Guan-Liang Chang; Wen-Chang Tseng; Chin-Yin Yu; Ruey-Mo Lin

1998-01-01

293

Karnovsky-osmium as a primary fixative for electron microscopy  

NASA Astrophysics Data System (ADS)

A combined Karnovsky-osmium tetroxide primary fixative is proposed for transmission electron microscopy. This fixative, hypothetically, seems to overcome the drawbacks of sequential fixation techniques. Evaluation of this combined fixative reveals very acceptable fixation of hepatocytes, lymphocytes, and fibroblasts, as well as various organelles within these cells.

Buchanan, G. M.

1983-09-01

294

Environmentally safe parasitology fixative and stain  

US Patent & Trademark Office Database

A fixative-stain system, which gives superior preservation of nuclear detail, is free from toxic mercury compounds, and which is simple and easy to use, includes a zinc salt and a cobalt salt, in combination, as a fixative, and at least one of Chlorazol Black E, Fast Green FCF and May-Grunwald stains, and preferably the three in admixture, as a staining composition. The fixative may also be used alone. The present fixative-stain system is suitable for fixing and staining all types of parasites such as enteric and other parasites which infect animals and humans.

1996-04-16

295

Modeling fixation locations using spatial point processes.  

PubMed

Whenever eye movements are measured, a central part of the analysis has to do with where subjects fixate and why they fixated where they fixated. To a first approximation, a set of fixations can be viewed as a set of points in space; this implies that fixations are spatial data and that the analysis of fixation locations can be beneficially thought of as a spatial statistics problem. We argue that thinking of fixation locations as arising from point processes is a very fruitful framework for eye-movement data, helping turn qualitative questions into quantitative ones. We provide a tutorial introduction to some of the main ideas of the field of spatial statistics, focusing especially on spatial Poisson processes. We show how point processes help relate image properties to fixation locations. In particular we show how point processes naturally express the idea that image features' predictability for fixations may vary from one image to another. We review other methods of analysis used in the literature, show how they relate to point process theory, and argue that thinking in terms of point processes substantially extends the range of analyses that can be performed and clarify their interpretation. PMID:24084942

Barthelmé, Simon; Trukenbrod, Hans; Engbert, Ralf; Wichmann, Felix

2013-10-01

296

Pathways of acetate, propionate, and butyrate formation by the human fecal microbial flora.  

PubMed

The pathways of short-chain fatty acid (SCFA; acetate, propionate, and butyrate) formation from glucose were determined for the human fecal microbial communities of two subjects. The pathways were identified by radioisotope analysis of the SCFA and CO2 obtained after incubation of fecal suspensions with glucose under 20% CO2 with [1-14C]glucose, [3,4-14C]glucose, or 14CO2. Acetate was chemically degraded to learn the labeling of the methyl and carboxyl carbons. The labeling of CO2 and acetate showed that the major route of glucose catabolism was the Embden-Meyerhof-Parnas pathway, with production of CO2 from pyruvate carboxyl carbon. Labeling of the methyl and carboxyl carbons of acetate by 14CO2 or [3,4-14C]glucose proved that acetate was formed from CO2 by the Wood-Ljungdahl pathway. CO2 reduction accounted for about one-third of the acetate formed by suspensions from subject 1 and about one-fourth of the acetate formed by suspensions from subject 2. Propionate was formed by a CO2 fixation pathway, and butyrate was formed by classical routes of acetyl-S coenzyme A condensation. The amount of CO2 formed from [1-14C] glucose and acetate labeling patterns obtained with the other 14C precursors indicated that the Entner-Doudoroff, transketolase-transaldolase, and heterolactic pathways were not significant. Fermentation of cabbage cellulose by subject 1 followed the same pathways as were used for glucose. The results with suspensions from subject 2 suggested that some radioactive acetate was formed from the C-3 of glucose by the Bifidobacterium pathway. PMID:8633856

Miller, T L; Wolin, M J

1996-05-01

297

Controls over pathways of carbon efflux from soils along climate and black spruce productivity gradients in interior Alaska  

Microsoft Academic Search

Small changes in C cycling in boreal forests can change the sign of their C balance, so it is important to gain an understanding of the factors controlling small exports like water-soluble organic carbon (WSOC) fluxes from the soils in these systems. To examine this, we estimated WSOC fluxes based on measured concentrations along four replicate gradients in upland black

E. S. Kane; D. W. Valentine; G. J. Michaelson; J. D. Fox; C. L. Ping

2006-01-01

298

Pyruvate overflow and carbon flux within the central metabolic pathways of Corynebacterium glutamicum during growth on lactate  

Microsoft Academic Search

Growth of Corynebacterium glutamicum was characterized kinetically for chemostat cultures using lactate as the sole carbon substrate, and the concentration profile of various enzymes of central metabolism was established over a range of growth rates. Pyruvate overflow, together with incomplete lactate consumption, was observed under conditions for which the specific activity of pyruvate dehydrogenase no longer increased as a function

Muriel Cocaign-Bousquet; Nicholas D. Lindley

1995-01-01

299

Coupled transport-reaction pathways and distribution patterns between siliciclastic-carbonate sediments at the Ria de Vigo  

NASA Astrophysics Data System (ADS)

This paper examines the linkages between the space-distribution of grain sizes and the relative percentage of the amount of mineral species that result from the mixing process of siliciclastic and carbonate sediments at the Ria de Vigo (NW of Spain). The space-distribution of minerals was initially determined, starting from a detailed mineralogical study based on XRD-Rietveld analysis of the superficial sediments. Correlations between the maps obtained for grain sizes, average fractions of either siliciclastic or carbonates, as well as for individual-minerals, were further stabilised. From this analysis, spatially organized patterns were found between carbonates and several minerals involved in the siliciclastic fraction. In particular, a coupled behaviour is observed between plagioclases and carbonates, in terms of their relative percentage amounts and the grain size distribution. In order to explain these results a conceptual model is proposed, based on the interplay between chemical processes at the seawater sediment interface and hydrodynamical factors. This model suggests the existence of chemical control mechanisms that, by selective processes of dissolution-crystallization, constrain the mixed environment's long-term evolution, inducing the formation of self-organized sedimentary patterns.

García, T.; Velo, A.; Fernandez-Bastero, S.; Gago-Duport, L.; Santos, A.; Alejo, I.; Vilas, F.

2005-02-01

300

Arthroscopy-assisted fracture fixation  

Microsoft Academic Search

Purpose  The purpose of this article was to systematically analyze the results of published studies in the literature which evaluated\\u000a the use of arthroscopically assisted techniques in intra-articular fracture fixation.\\u000a \\u000a \\u000a \\u000a \\u000a Methods  Published investigations to date were analyzed by classifying them according to joints that were involved with intra-articular\\u000a fractures including: knee, ankle, hip, shoulder, elbow, and wrist joints. The results were studied

Kivanc AtesokM; M. Nedim Doral; Terry Whipple; Gideon Mann; Omer Mei-Dan; O. Ahmet Atay; Yiftah Beer; Joseph Lowe; Michael Soudry; Emil H. Schemitsch

2011-01-01

301

Do Fixation Cues Ensure Fixation Accuracy in Split-Fovea Studies of Word Recognition?  

ERIC Educational Resources Information Center

Many studies have claimed that hemispheric processing is split precisely at the foveal midline and so place great emphasis on the precise location at which words are fixated. These claims are based on experiments in which a variety of fixation procedures were used to ensure fixation accuracy but the effectiveness of these procedures is unclear. We…

Jordan, Timothy R.; Paterson, Kevin B.; Kurtev, Stoyan; Xu, Mengyun

2009-01-01

302

Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}  

NASA Astrophysics Data System (ADS)

Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (?13C = {[13C/12Csample/13C/12Cstandard] - 1} × 1000). Five different forms of RubisCO (IA, IB, IC, ID, and II) are utilized by algae and autotrophic bacteria reliant on the Calvin-Benson cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs, and their ? values (={[12k/13k] - 1} × 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, explaining the variation in biomass ?13C values of autotrophs utilizing these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides and Ralstonia eutropha. The purpose of this work was to determine the ? values for form IC RubisCO enzymes from R. sphaeroides and R. eutropha. Recombinant form IC RubisCOs were purified by conventional column chromatography procedures. Assay conditions (pH, dissolved inorganic carbon concentration) were tested to determine which parameters were conducive to the high rates of carbon fixation necessary for ? determination. Under standard conditions (pH 8.5 and 5 mM DIC), form IC RubisCO activities were sufficient for ? determination. Experiments are currently being conducted to measure the ? values of these enzymes. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of ?13C values of organisms fixing carbon via the Calvin-Benson cycle. These results are critical for determining the degree to which Calvin cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.

Thomas, P. J.; Boller, A. J.; Zhao, Z.; Tabita, F. R.; Cavanaugh, C. M.; Scott, K. M.

2006-12-01

303

The CCAAT box-binding factor stimulates ammonium assimilation in Saccharomyces cerevisiae, defining a new cross-pathway regulation between nitrogen and carbon metabolisms.  

PubMed Central

In Saccharomyces cerevisiae, carbon and nitrogen metabolisms are connected via the incorporation of ammonia into glutamate; this reaction is catalyzed by the NADP-dependent glutamate dehydrogenase (NADP-GDH) encoded by the GDH1 gene. In this report, we show that the GDH1 gene requires the CCAAT box-binding activator (HAP complex) for optimal expression. This conclusion is based on several lines of evidence: (1) overexpression of GDH1 can correct the growth defect of hap2 and hap3 mutants on ammonium sulfate as a nitrogen source, (ii) Northern (RNA) blot analysis shows that the steady-state level of GDH1 mRNA is strongly lowered in a hap2 mutant, (iii) expression of a GDH1-lacZ fusion is drastically reduced in hap mutants, (iv) NADP-GDH activity is several times lower in the hap mutants compared with that in the isogenic wild-type strain, and finally, (v) site-directed mutagenesis of two consensual HAP binding sites in the GDH1 promoter strongly reduces expression of GDH1 and makes it HAP independent. Expression of GDH1 is also regulated by the carbon source, i.e., expression is higher on lactate than on ethanol, glycerol, or galactose, with the lowest expression being found on glucose. Finally, we show that a hap2 mutation does not affect expression of other genes involved in nitrogen metabolism (GDH2, GLN1, and GLN3 encoding, respectively, the NAD-GDH, glutamine synthetase, and a general activator of several nitrogen catabolic genes). The HAP complex is known to regulate expression of several genes involved in carbon metabolism; its role in the control of GDH1 gene expression, therefore, provides evidence for a cross-pathway regulation between carbon and nitrogen metabolisms.

Dang, V D; Bohn, C; Bolotin-Fukuhara, M; Daignan-Fornier, B

1996-01-01

304

Regulation of carbon and electron flow in Propionispira arboris: Relationship of catabolic enzyme levels to carbon substrates fermented during propionate formation via the methylmalony coenzyme a pathway  

SciTech Connect

A detailed study of the glucose fermentation pathway and the modulation of catabolic oxidoreductase activities by energy sources (i.e., glucose versus lactate of fumarate) in Propionispira arboris was performed. {sup 14}C radiotracer data show the CO{sub 2} produced from pyruvate oxidation comes exclusively from the C-3 and C-4 positions of glucose. Significant specific activities of glyceraldehyde-3-phosphate dehydrogenase and fructose-1,6-bisphosphate aldolase were detected, which substantiates the utilization of the Embden-Meyerhoff-Parnas path for glucose metabolism. The methylmalonyl coenzyme A pathway for pyruvate reduction to propionate was established by detection of significant activities of methylmalonyl coenzyme A transcarboxylase, malate dehydrogenase, and fumarate reductase in cell-free extracts and by {sup 13}C nuclear magnetic resonance spectroscpic demonstation of randomization of label from (2-{sup 13}C)pyruvate into positions 2 and 3 of propionate. The specific activity of pyruvate-ferredoxin oxidoreductase, malate dehydrogenase, fumarate reductase, and transcarboxylase varied significantly in cells grown on different energy sources. D-Lactate dehydrogenase (non-NADH linked) was present in cells of P. arboris grown on lactate but not in cells grown on glucose or fumarate. These results indicate that growth substrates regulate synthesis of enzymes specific for the methylmalonyl coenzyme A path initial substrate transformation.

Thompson, T.E. (Univ. of Wisconsin, Madison (USA)); Zeikus, J.G. (Michigan State Univ., East Lansing (USA))

1988-09-01

305

The central carbohydrate metabolism of the hyperthermophilic crenarchaeote Thermoproteus tenax: pathways and insights into their regulation.  

PubMed

Although the complexity and modifications of the archaeal central carbohydrate metabolism (CCM) are well established, the knowledge about its regulation is rather limited. The facultatively heterotrophic, hyperthermophilic crenarchaeote Thermoproteus tenax utilizes a modified version of the reversible Embden-Meyerhof-Parnas (EMP) and the catabolic, branched Entner-Doudoroff (ED) pathway for glucose metabolism. Glucose is completely oxidized to carbon dioxide via the oxidative tricarboxylic acid (TCA) cycle, which is supposedly used in the reductive direction for carbon dioxide fixation under autotrophic growth conditions. Elemental sulfur is used as final electron acceptor. The CCM of T. tenax has been well studied on protein level as well as on gene level by performing a focused transcriptional analysis (CCM DNA microarray). In contrast to the classical pathways found in Bacteria and Eucarya allosteric regulation seems to play a minor role, therefore emphasizing the important role of regulation on transcript level in T. tenax. Whereas the EMP pathway and the TCA cycle show a highly coordinated regulation on gene level, the catabolic, branched ED pathway reveals no strong regulation. The CCM pathways in T. tenax and the current understanding of their regulation are presented. PMID:18491075

Zaparty, Melanie; Tjaden, Britta; Hensel, Reinhard; Siebers, Bettina

2008-05-20

306

Carbon Nanotubes as Intracellular Transporters for Proteins and DNA: An Investigation of the Uptake Mechanism and Pathway  

Microsoft Academic Search

New materials for the intracellular transport of biological cargos such as DNA, proteins, and drug molecules have been actively sought to effectively breach the cell-membrane barriers for delivery and enabling functionality of extracel- lular agents. Single-walled carbon nanotubes (SWNT) have been recently shown to shuttle various molecular cargos inside living cells including proteins, short peptides, and nucleic acids.(1-8) The internalized

Nadine Wong; Shi Kam; Zhuang Liu

2006-01-01

307

21 CFR 872.4880 - Intraosseous fixation screw or wire.  

Code of Federal Regulations, 2010 CFR

...2010-04-01 false Intraosseous fixation screw or wire. 872.4880 Section 872... § 872.4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended...

2010-04-01

308

21 CFR 872.4880 - Intraosseous fixation screw or wire.  

Code of Federal Regulations, 2010 CFR

...2009-04-01 false Intraosseous fixation screw or wire. 872.4880 Section 872... § 872.4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended...

2009-04-01

309

Pyrogenic carbon loss pathways under natural and increased N deposition and its priming effect on soil organic matter  

NASA Astrophysics Data System (ADS)

Pyrogenic carbon (PyC) plays an important role in the terrestrial C cycle, in fact it can comprise up to 40% of soil organic carbon(1), but the relative importance of processes that lead to its disappearance from the soil remain a mystery (2). Most experiments on PyC mineralization have been laboratory incubations (3; 4); very few studies have been carried out in situ (5; 6). Several studies have found relevant quantities of PyC in marine (7) and riverine (8) dissolved organic carbon. However, since PyC is not thought to contain easily soluble compounds (9), it is still unknown how such large quantities of PyC can be transported from soil to water bodies. Moreover, some studies find that PyC can promote soil organic matter decomposition (10; 11), although other studies do not find this result (9; 4). Moreover, nitrogen deposition might affect PyC losses from the soil, as it has been shown to reduce the mineralization of old soil organic matter (12). We set up a field experiment to measure PyC decomposition and stabilization in soil using stable isotopes (13C/15N) as tracer. The experiment was conducted under ambient and added mineral nitrogen. The equivalent of 3.8 gC kg-1 of soil of 13C- labelled (840 per mil), powdered (

Maestrini, B.; Abiven, S.; Singh, N.; Bird, J.; Torn, M. S.; Schmidt, M. W. I.

2012-04-01

310

Dark Fixation of CO(2) by Crassulacean Plants: Evidence for a Single Carboxylation Step.  

PubMed

Malic acid isolated from Bryophyllum pinnatum (Lamk.) Oken (B. calycinum Salisb.), Bryophyllum tubiflorum Harv., Kalanchoë diagremontiana Hamet et Perrier and Sedum guatamalense Hemsl. after dark (14)CO(2) fixation was degraded by an in vitro NADP-malic enzyme technique. In the short term (5 to 30 seconds) the malic acid was almost exclusively labeled in the C-4 carboxyl carbon (greater than 90%). The percentage of (14)C in the C-4 carboxyl of malic acid declined slowly with time, reaching 70% in B. tubiflorum and 54% in B. pinnatum after 14 hours of exposure to (14)CO(2). It was found that malic acid-adapted Lactobacillus arabinosus may seriously underestimate the C-4 carboxyl component of label in malic acid-(14)C. The amount of substrate which the bacteria can completely metabolize was easily exceeded; there was a significant level of randomization of label even when beta-decarboxylation proceeded to completion, and in extended incubation periods, more than 25% of label was removed from malic acid-U-(14)C. The significance of these findings in relation to pathways of carbohydrate metabolism and malic acid synthesis in Crassulacean acid metabolism is discussed. PMID:16658174

Sutton, B G; Osmond, C B

1972-09-01

311

Chemical fixation of arsenic in contaminated soils  

Microsoft Academic Search

Arsenic-contaminated soils have been successfully treated using fixation methods whereby chemicals are added to prevent As mobilization. However, the chemistry of the fixation process used in the field is poorly understood. We have examined one process which succeeded in immobilizing 0. I to 0.2 weight % As in soil at a 69 a old dump site through the addition of

Remy J.-C. Hennet; S. L. Brantley

1996-01-01

312

Nitrogen Fixation in Denitrified Marine Waters  

Microsoft Academic Search

Nitrogen fixation is an essential process that biologically transforms atmospheric dinitrogen gas to ammonia, therefore compensating for nitrogen losses occurring via denitrification and anammox. Currently, inputs and losses of nitrogen to the ocean resulting from these processes are thought to be spatially separated: nitrogen fixation takes place primarily in open ocean environments (mainly through diazotrophic cyanobacteria), whereas nitrogen losses occur

Camila Fernandez; Laura Farías; Osvaldo Ulloa

2011-01-01

313

Fixation and the Road Not Taken  

Microsoft Academic Search

In this article, the psychic and existential impact that fixation has on an individual's life is addressed. A person may drift through years that are dictated by the circuitous path of a fixation and its vicissitude of the repetition compulsion. When such \\

Peter Shabad

1987-01-01

314

Direct needle fixation in endoscopic facial rejuvenation  

Microsoft Academic Search

Background: Several authors have described the application of video endoscopy to facial rejuvenation to minimize incisions. Methods of fixation used in this technique include miniplates, tunnels in the outer tissues, and tissue glues. Objective: In this study, we examined the efficacy of endoscopic facial rejuvenation with direct transcutaneous needle fixation. Methods: Detailed preoperative markings were placed to outline important anatomical

Carlos Casagrande; Renato Saltz; Roberto Chem; Rinaldo Pinto; Marcus Collares

2000-01-01

315

Two fixations suffice in face recognition.  

PubMed

It is well known that there exist preferred landing positions for eye fixations in visual word recognition. However, the existence of preferred landing positions in face recognition is less well established. It is also unknown how many fixations are required to recognize a face. To investigate these questions, we recorded eye movements during face recognition. During an otherwise standard face-recognition task, subjects were allowed a variable number of fixations before the stimulus was masked. We found that optimal recognition performance is achieved with two fixations; performance does not improve with additional fixations. The distribution of the first fixation is just to the left of the center of the nose, and that of the second fixation is around the center of the nose. Thus, these appear to be the preferred landing positions for face recognition. Furthermore, the fixations made during face learning differ in location from those made during face recognition and are also more variable in duration; this suggests that different strategies are used for face learning and face recognition. PMID:19000210

Hsiao, Janet Hui-wen; Cottrell, Garrison

2008-10-01

316

Spherical Retinal Flow for a Fixating Observer.  

National Technical Information Service (NTIS)

When a human observer moves, the eye continually fixates on targets in the world. Although fixation is a common process in human vision, its role has not yet been established for computational purposes. The main contribution of this paper is the formalize...

I. Thomas E. Simoncelli R. Bajcsy

1994-01-01

317

Biochemical Approaches to Improved Nitrogen Fixation  

Technology Transfer Automated Retrieval System (TEKTRAN)

Improving symbiotic nitrogen fixation by legumes has emerged again as an important topic on the world scene due to the energy crisis and lack of access to nitrogen fertilizer in developing countries. We have taken a biochemical genomics approach to improving symbiotic nitrogen fixation in legumes. L...

318

Driver Eye Fixations under Different Operating Conditions.  

National Technical Information Service (NTIS)

The eye fixations of six individuals were measured while driving on straight and curved sections of road, night and day, and with and without a car in front of them. Eye fixations on straight sections were distributed uniformly over the road, while on cur...

P. L. Olson D. S. Battle T. Aoki

1989-01-01

319

The osmotic effects of electron microscope fixatives.  

PubMed

The reflecting cells on the scales of sprat and herring contain ordered arrays of guanine crystals. The spacing of the crystals within these cells determines the wave bands of the light which they reflect, hence volume changes in the reflecting cells can be observed as color changes directly. This property of the scales is used to show that (a) fixation with osmium tetroxide solutions destroys osmotic activity; (b) fixation with aldehyde solutions does not destroy osmotic activity and does not cause volume changes if the aldehydes are made up in salt or sucrose solutions whose osmolarities, discounting the aldehyde, are about 60% of those to which the cells are in equilibrium in life, and (c) after aldehyde fixation the cells are osmotically active but come to a given volume in salt and sucrose solutions of concentrations only 60% of those which give their volume before fixation. Various possible mechanisms underlying the change of osmotic equilibrium caused by aldehyde fixation are discussed. PMID:4103952

Bone, Q; Denton, E J

1971-06-01

320

Oxygen-poor microzones as potential sites of microbial n(2) fixation in nitrogen-depleted aerobic marine waters.  

PubMed

The nitrogen-deficient coastal waters of North Carolina contain suspended bacteria potentially able to fix N(2). Bioassays aimed at identifying environmental factors controlling the development and proliferation of N(2) fixation showed that dissolved organic carbon (as simple sugars and sugar alcohols) and particulate organic carbon (derived from Spartina alterniflora) additions elicited and enhanced N(2) fixation (nitrogenase activity) in these waters. Nitrogenase activity occurred in samples containing flocculent, mucilage-covered bacterial aggregates. Cyanobacterium-bacterium aggregates also revealed N(2) fixation. In all cases bacterial N(2) fixation occurred in association with surficial microenvironments or microzones. Since nitrogenase is oxygen labile, we hypothesized that the aggregates themselves protected their constituent microbes from O(2). Microelectrode O(2) profiles revealed that aggregates had lower internal O(2) tensions than surrounding waters. Tetrazolium salt (2,3,5-triphenyl-3-tetrazolium chloride) reduction revealed that patchy zones existed both within microbes and extracellularly in the mucilage surrounding microbes where free O(2) was excluded. Triphenyltetrazolium chloride reduction also strongly inhibited nitrogenase activity. These findings suggest that N(2) fixation is mediated by the availability of the appropriate types of reduced microzones. Organic carbon enrichment appears to serve as an energy and structural source for aggregate formation, both of which were required for eliciting N(2) fixation responses of these waters. PMID:16347337

Paerl, H W; Prufert, L E

1987-05-01

321

Oxygen-Poor Microzones as Potential Sites of Microbial N2 Fixation in Nitrogen-Depleted Aerobic Marine Waters  

PubMed Central

The nitrogen-deficient coastal waters of North Carolina contain suspended bacteria potentially able to fix N2. Bioassays aimed at identifying environmental factors controlling the development and proliferation of N2 fixation showed that dissolved organic carbon (as simple sugars and sugar alcohols) and particulate organic carbon (derived from Spartina alterniflora) additions elicited and enhanced N2 fixation (nitrogenase activity) in these waters. Nitrogenase activity occurred in samples containing flocculent, mucilage-covered bacterial aggregates. Cyanobacterium-bacterium aggregates also revealed N2 fixation. In all cases bacterial N2 fixation occurred in association with surficial microenvironments or microzones. Since nitrogenase is oxygen labile, we hypothesized that the aggregates themselves protected their constituent microbes from O2. Microelectrode O2 profiles revealed that aggregates had lower internal O2 tensions than surrounding waters. Tetrazolium salt (2,3,5-triphenyl-3-tetrazolium chloride) reduction revealed that patchy zones existed both within microbes and extracellularly in the mucilage surrounding microbes where free O2 was excluded. Triphenyltetrazolium chloride reduction also strongly inhibited nitrogenase activity. These findings suggest that N2 fixation is mediated by the availability of the appropriate types of reduced microzones. Organic carbon enrichment appears to serve as an energy and structural source for aggregate formation, both of which were required for eliciting N2 fixation responses of these waters. Images

Paerl, Hans W.; Prufert, Leslie E.

1987-01-01

322

Carbon-oxygen bond cleavage reactions by electron transfer. 1. Electrochemical studies on the formation and subsequent reaction pathways of cyanoanisole radical anions  

SciTech Connect

The radical anions of three isomers of cyanoanisole have been electrochemically generated and subsequently shown to react by at least three different reaction pathways in dry N,N-dimethylformamide (DMF). The o-cyanoanisole radical anion (E/sub pc/ = -2.3 V vs. SCE) dimerizes (k/sub 2/ = 3.2 X 10/sup 2/ M/sup -1/s/sup -1/) to form an intermediate dimeric dianion. The dianion, which can be oxidized (E/sub pa = 1.1 V vs. SCE), undergoes a slow intramolecular disproportionation reaction to form o-cyanophenoxide ion, methide ion, and unreduced substrate (k/sub 3/ = 1.9 X 10/sup -2/s/sup -1/). Subsequent protonation results in the formation of methane and p-cyanophenol in an overall two-electron process. The m-cyanoanisole radical anion (E/sub pc/ = -2.3 V vs. SCE) is very stable (t/sub 1/2/ > 10/sup 3/ s) under anhydrous DMF conditions. Overall, slow carbon-carbon bond cleavage with loss of cyanide occurs competitively with ..beta.. carbon-oxygen bond cleavage to produce anisole and m-cyanophenol, respectively. The final products of the reduction of p-cyanoanisole are p-cyanophenol and methane; however, the radical anion of p-cyanoanisole (E/sub pc/ = -2.5 V vs. SCE) undergoes a relatively rapid unimolecular fragmentation reaction (k/sub 1/ = 7 s/sup -1/). The initial products of the fragmentation are p-cyanophenoxide ion and the methyl radical, which is reduced further to methide ion. Hydrogen atom abstraction reactions by the methyl radical can also occur in the bulk solution to produce methane.

Koppang, M.D.; Woolsey, N.F.; Bartak, D.E.

1984-05-16

323

Autotrophic Microbe Metagenomes and Metabolic Pathways Differentiate Adjacent Red Sea Brine Pools  

PubMed Central

In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens.

Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

2013-01-01

324

REMOTELY SENSED SOIL MOISTURE EFFECTS ON CARBON SEQUESTRATION SPATIAL PATTERNS  

Microsoft Academic Search

Carbon emission and fixation fluxes are key variables to guide climate change stakeholders on the use of remediation techniques. To develop Kyoto Protocol support tools, a sound application perspective is offered by expert systems based on earth observation (EO). This allows estimates of vegetation carbon fixation using a minimum of meteorological data. The core module of this type of expert

W. W. Verstraeten; F. Veroustraete; P. R. Coppin; J Feyen

325

Meniscal repair: the newest fixators.  

PubMed

The surgical techniques and associated devices for meniscus repair have improved over time, spurred in part by the clear recognition of the benefits of meniscal preservation and in part by the introduction of ultra-high-molecular weight polyethylene containing sutures. The desires for more minimally invasive techniques that decrease the risks of neurovascular injury and articular cartilage excoriation have seen 1 device generation after another introduced and improved upon. The current generation of meniscal repair all-inside devices are easier to use, limit the presence of material on the meniscal surface, and are self-adjusting and suture based. Although the speed of meniscus fixation device development places increasingly useful devices in surgeons' hands, clinical evidence of their effectiveness lag behind. PMID:22555206

Barber, F Alan; Bava, Eric D

2012-06-01

326

Hypoxic regulation of the cerebral microcirculation is mediated by a carbon monoxide-sensitive hydrogen sulfide pathway.  

PubMed

Enhancement of cerebral blood flow by hypoxia is critical for brain function, but signaling systems underlying its regulation have been unclear. We report a pathway mediating hypoxia-induced cerebral vasodilation in studies monitoring vascular disposition in cerebellar slices and in intact mouse brains using two-photon intravital laser scanning microscopy. In this cascade, hypoxia elicits cerebral vasodilation via the coordinate actions of H(2)S formed by cystathionine ?-synthase (CBS) and CO generated by heme oxygenase (HO)-2. Hypoxia diminishes CO generation by HO-2, an oxygen sensor. The constitutive CO physiologically inhibits CBS, and hypoxia leads to increased levels of H(2)S that mediate the vasodilation of precapillary arterioles. Mice with targeted deletion of HO-2 or CBS display impaired vascular responses to hypoxia. Thus, in intact adult brain cerebral cortex of HO-2-null mice, imaging mass spectrometry reveals an impaired ability to maintain ATP levels on hypoxia. PMID:22232681

Morikawa, Takayuki; Kajimura, Mayumi; Nakamura, Tomomi; Hishiki, Takako; Nakanishi, Tsuyoshi; Yukutake, Yoshinori; Nagahata, Yoshiko; Ishikawa, Mami; Hattori, Katsuji; Takenouchi, Toshiki; Takahashi, Takao; Ishii, Isao; Matsubara, Kazuko; Kabe, Yasuaki; Uchiyama, Shinichiro; Nagata, Eiichiro; Gadalla, Moataz M; Snyder, Solomon H; Suematsu, Makoto

2012-01-09

327

Hypoxic regulation of the cerebral microcirculation is mediated by a carbon monoxide-sensitive hydrogen sulfide pathway  

PubMed Central

Enhancement of cerebral blood flow by hypoxia is critical for brain function, but signaling systems underlying its regulation have been unclear. We report a pathway mediating hypoxia-induced cerebral vasodilation in studies monitoring vascular disposition in cerebellar slices and in intact mouse brains using two-photon intravital laser scanning microscopy. In this cascade, hypoxia elicits cerebral vasodilation via the coordinate actions of H2S formed by cystathionine ?-synthase (CBS) and CO generated by heme oxygenase (HO)-2. Hypoxia diminishes CO generation by HO-2, an oxygen sensor. The constitutive CO physiologically inhibits CBS, and hypoxia leads to increased levels of H2S that mediate the vasodilation of precapillary arterioles. Mice with targeted deletion of HO-2 or CBS display impaired vascular responses to hypoxia. Thus, in intact adult brain cerebral cortex of HO-2–null mice, imaging mass spectrometry reveals an impaired ability to maintain ATP levels on hypoxia.

Morikawa, Takayuki; Kajimura, Mayumi; Nakamura, Tomomi; Hishiki, Takako; Nakanishi, Tsuyoshi; Yukutake, Yoshinori; Nagahata, Yoshiko; Ishikawa, Mami; Hattori, Katsuji; Takenouchi, Toshiki; Takahashi, Takao; Ishii, Isao; Matsubara, Kazuko; Kabe, Yasuaki; Uchiyama, Shinichiro; Nagata, Eiichiro; Gadalla, Moataz M.; Snyder, Solomon H.; Suematsu, Makoto

2012-01-01

328

Direct and Indirect Costs of Dinitrogen Fixation in Crocosphaera watsonii WH8501 and Possible Implications for the Nitrogen Cycle  

PubMed Central

The recent detection of heterotrophic nitrogen (N2) fixation in deep waters of the southern Californian and Peruvian OMZ questions our current understanding of marine N2 fixation as a process confined to oligotrophic surface waters of the oceans. In experiments with Crocosphaera watsonii WH8501, a marine unicellular diazotrophic (N2 fixing) cyanobacterium, we demonstrated that the presence of high nitrate concentrations (up to 800??M) had no inhibitory effect on growth and N2 fixation over a period of 2?weeks. In contrast, the environmental oxygen concentration significantly influenced rates of N2 fixation and respiration, as well as carbon and nitrogen cellular content of C. watsonii over a 24-h period. Cells grown under lowered oxygen atmosphere (5%) had a higher nitrogenase activity and respired less carbon during the dark cycle than under normal oxygen atmosphere (20%). Respiratory oxygen drawdown during the dark period could be fully explained (104%) by energetic needs due to basal metabolism and N2 fixation at low oxygen, while at normal oxygen these two processes could only account for 40% of the measured respiration rate. Our results revealed that under normal oxygen concentration most of the energetic costs during N2 fixation (?60%) are not derived from the process of N2 fixation per se but rather from the indirect costs incurred for the removal of intracellular oxygen or by the reversal of oxidative damage (e.g., nitrogenase de novo synthesis). Theoretical calculations suggest a slight energetic advantage of N2 fixation relative to assimilatory nitrate uptake, when oxygen supply is in balance with the oxygen requirement for cellular respiration (i.e., energy generation for basal metabolism and N2 fixation). Taken together our results imply the existence of a niche for diazotrophic organisms inside oxygen minimum zones, which are predicted to further expand in the future ocean.

Grosskopf, Tobias; LaRoche, Julie

2012-01-01

329

Glycolate Pathway in Algae 1  

PubMed Central

No glycolate oxidase activity could be detected by manometric, isotopic, or spectrophotometric techniques in cell extracts from 5 strains of algae grown in the light with CO2. However, NADH:glyoxylate reductase, phosphoglycolate phosphatase and isocitrate dehydrogenase were detected in the cell extracts. The serine formed by Chlorella or Chlamydomonas after 12 seconds of photosynthetic 14CO2 fixation contained 70 to 80% of its 14C in the carboxyl carbon. This distribution of label in serine was similar to that in phosphoglycerate from the same experiment. Thus, in algae serine is probably formed directly from phosphoglycerate. These results differ from those of higher plants which form uniformly labeled serine from glycolate in short time periods when phosphoglycerate is still carboxyl labeled. In glycolate formed by algae in 5 and 10 seconds of 14CO2 fixation, C2 was at least twice as radioactive as C1. A similar skewed labeling in C2 and C3 of 3-phosphoglycerate and serine suggests a common precursor for glycolate and 3-phosphoglycerate. Glycine formed by the algae, however, from the same experiments was uniformly labeled. Manganese deficient Chlorella incorporated only 2% of the total 14CO2 fixed in 10 minutes into glycolate, while in normal Chlorella 30% of the total 14C was found in glycolate. Manganese deficient Chlorella also accumulated more 14C in glycine and serine. Glycolate excretion by Chlorella was maximal in 10 mm bicarbonate and occurred only in the light, and was not influenced by the addition of glycolate. No time dependent uptake of significant amounts of either glycolate or phosphoglycolate was observed. When small amounts of glycolate-2-14C were fed to Chlorella or Scenedesmus, only 2 to 3% was metabolized after 30 to 60 minutes. The algae were not capable of significant glycolate metabolism as is the higher plant. The failure to detect glycolate oxidase, the low level glycolate-14C metabolism, and the formation of serine from phosphoglycerate rather than from glycolate are consistent with the concept of an incomplete glycolate pathway in algae.

Hess, J. L.; Tolbert, N. E.

1967-01-01

330

High speed fracture fixation: assessing resulting fixation stability and fastener withdrawal strength.  

PubMed

A new method of bone fracture fixation has been developed in which fixation darts (small diameter nails/pins) are driven across a fracture site at high velocity with a pneumatically powered gun. When fixation darts are inserted oblique to one another, kinematic constraints prevent fragment motion and allow bone healing to progress. The primary aim of this study is to determine if fixation darts can provide reasonable fixation stability compared to bone screws, which were used as a benchmark since they represent a simple, yet well-established, surgical technique. The first objective was to evaluate macro-level stability using different numbers of darts inserted parallel and oblique to each other; experimental comparisons were undertaken in a bone analog model. Experimental results showed fixation darts could not be substituted for screws on a one-to-one basis, but that a plurality of fixation darts provided comparable fixation to two bone screws while allowing for faster insertion and damaging less bone. A second objective was to evaluate micro-level stability; a finite element model was created in order to provide a detailed look at the stress state surrounding the fixation darts and the evolution of the fracture gap. Even with relatively weak fixation dart configurations, the fracture gap was maintained below physiological thresholds for bone healing. Most failures of the fixed fractures were attributed to fixation dart pullout from the cancellous structure. The final objective of the study was to characterize this mode of failure with separate fixation dart and screw pullout tests conducted in Sawbones® cancellous foam and fresh porcine cancellous bone. The results showed that the cancellous foam was an acceptable substitute for real bone and provided a conservative estimate of the fixation darts' performance relative to bone screws. A final comparison between experimental and numerically predicted pullout strengths provided confirmation that the model and experiments were consistent. PMID:23722627

Prygoski, Matthew Philip; Sanchez Caballero, Samuel; Schmid, Steven R; Lozier, Antony J; Selles, Miguel Angel

2013-09-01

331

Following the path of carbon in photosynthesis: a personal story  

Microsoft Academic Search

Chronological recognition of the intermediates and mechanisms involved in photosynthetic carbon dioxide fixation is delineated.\\u000a Sam Ruben and Martin Kamen's development of application of radioactive carbon for the study of carbon dioxide fixation provided\\u000a impetus and techniques for following the path of carbon in photosynthesis. Discovery The identity of the primary carboxylation\\u000a enzyme and its identity with the major protein

Andrew A. Benson

2002-01-01

332

Key role of symbiotic dinitrogen fixation in tropical forest secondary succession.  

PubMed

Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000?kg carbon per hectare) in the first 12?years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2. PMID:24037375

Batterman, Sarah A; Hedin, Lars O; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J; Hall, Jefferson S

2013-09-15

333

Key role of symbiotic dinitrogen fixation in tropical forest secondary succession  

NASA Astrophysics Data System (ADS)

Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000kg carbon per hectare) in the first 12years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2.

Batterman, Sarah A.; Hedin, Lars O.; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J.; Hall, Jefferson S.

2013-10-01

334

Influence of amino acids on nitrogen fixation ability and growth of Azospirillum spp.  

PubMed Central

The utilization of amino acids for growth and their effects on nitrogen fixation differ greatly among the several strains of each species of Azospirillum spp. that were examined. A. brasiliense grew poorly or not at all on glutamate, aspartate, serine, or histidine as the sole nitrogen and carbon sources. Nitrogen fixation by most A. brasiliense strains was inhibited only slightly even by 10 mM concentrations of these amino acids. In contrast, A. lipoferum and A. amazonense grew very well on glutamate, aspartate, serine, or histidine as the sole nitrogen and carbon sources; nitrogen fixation, which was measured in the presence of malate or sucrose, was severely inhibited by these amino acids. It was concluded that growth on histidine as the sole source of nitrogen, carbon, and energy may be used for the taxonomic characterization of Azospirillum spp. and for the selective isolation of A. lipoferum. The different utilization of various amino acids by Azospirillum spp. may be important for their establishment in the rhizosphere and for their associative nitrogen fixation with plants. The physiological basis for the different utilization of glutamate by Azospirillum spp. was investigated further. A. brasiliense and A. lipoferum exhibited a high affinity for glutamate uptake (Km values for uptake were 8 and 40 microM, respectively); the Vmax was 6 times higher in A. lipoferum than in A. brasiliense. At high substrate concentrations (10 mM), the nonsaturable component of glutamate uptake was most active in A. lipoferum and A. amazonense.(ABSTRACT TRUNCATED AT 250 WORDS)

Hartmann, A; Fu, H A; Burris, R H

1988-01-01

335

Thermus oshimai JL-2 and T. thermophilus JL-18 genome analysis illuminates pathways for carbon, nitrogen, and sulfur cycling  

PubMed Central

The complete genomes of Thermus oshimai JL-2 and T. thermophilus JL-18 each consist of a circular chromosome, 2.07 Mb and 1.9 Mb, respectively, and two plasmids ranging from 0.27 Mb to 57.2 kb. Comparison of the T. thermophilus JL-18 chromosome with those from other strains of T. thermophilus revealed a high degree of synteny, whereas the megaplasmids from the same strains were highly plastic. The T. oshimai JL-2 chromosome and megaplasmids shared little or no synteny with other sequenced Thermus strains. Phylogenomic analyses using a concatenated set of conserved proteins confirmed the phylogenetic and taxonomic assignments based on 16S rRNA phylogenetics. Both chromosomes encode a complete glycolysis, tricarboxylic acid (TCA) cycle, and pentose phosphate pathway plus glucosidases, glycosidases, proteases, and peptidases, highlighting highly versatile heterotrophic capabilities. Megaplasmids of both strains contained a gene cluster encoding enzymes predicted to catalyze the sequential reduction of nitrate to nitrous oxide; however, the nitrous oxide reductase required for the terminal step in denitrification was absent, consistent with their incomplete denitrification phenotypes. A sox gene cluster was identified in both chromosomes, suggesting a mode of chemolithotrophy. In addition, nrf and psr gene clusters in T. oshmai JL-2 suggest respiratory nitrite ammonification and polysulfide reduction as possible modes of anaerobic respiration.

Murugapiran, Senthil K.; Huntemann, Marcel; Wei, Chia-Lin; Han, James; Detter, J. C.; Han, Cliff; Erkkila, Tracy H.; Teshima, Hazuki; Chen, Amy; Kyrpides, Nikos; Mavrommatis, Konstantinos; Markowitz, Victor; Szeto, Ernest; Ivanova, Natalia; Pagani, Ioanna; Pati, Amrita; Goodwin, Lynne; Peters, Lin; Pitluck, Sam; Lam, Jenny; McDonald, Austin I.; Dodsworth, Jeremy A.; Woyke, Tanja; Hedlund, Brian P.

2013-01-01

336

Thermus oshimai JL-2 and T. thermophilus JL-18 genome analysis illuminates pathways for carbon, nitrogen, and sulfur cycling.  

PubMed

The complete genomes of Thermus oshimai JL-2 and T. thermophilus JL-18 each consist of a circular chromosome, 2.07 Mb and 1.9 Mb, respectively, and two plasmids ranging from 0.27 Mb to 57.2 kb. Comparison of the T. thermophilus JL-18 chromosome with those from other strains of T. thermophilus revealed a high degree of synteny, whereas the megaplasmids from the same strains were highly plastic. The T. oshimai JL-2 chromosome and megaplasmids shared little or no synteny with other sequenced Thermus strains. Phylogenomic analyses using a concatenated set of conserved proteins confirmed the phylogenetic and taxonomic assignments based on 16S rRNA phylogenetics. Both chromosomes encode a complete glycolysis, tricarboxylic acid (TCA) cycle, and pentose phosphate pathway plus glucosidases, glycosidases, proteases, and peptidases, highlighting highly versatile heterotrophic capabilities. Megaplasmids of both strains contained a gene cluster encoding enzymes predicted to catalyze the sequential reduction of nitrate to nitrous oxide; however, the nitrous oxide reductase required for the terminal step in denitrification was absent, consistent with their incomplete denitrification phenotypes. A sox gene cluster was identified in both chromosomes, suggesting a mode of chemolithotrophy. In addition, nrf and psr gene clusters in T. oshmai JL-2 suggest respiratory nitrite ammonification and polysulfide reduction as possible modes of anaerobic respiration. PMID:24019992

Murugapiran, Senthil K; Huntemann, Marcel; Wei, Chia-Lin; Han, James; Detter, J C; Han, Cliff; Erkkila, Tracy H; Teshima, Hazuki; Chen, Amy; Kyrpides, Nikos; Mavrommatis, Konstantinos; Markowitz, Victor; Szeto, Ernest; Ivanova, Natalia; Pagani, Ioanna; Pati, Amrita; Goodwin, Lynne; Peters, Lin; Pitluck, Sam; Lam, Jenny; McDonald, Austin I; Dodsworth, Jeremy A; Woyke, Tanja; Hedlund, Brian P

2013-02-25

337

Carbon metabolism in legume nodules. Progress report, July 1982-July 1983  

SciTech Connect

The goal is to understand how the legume nodule metabolizes carbohydrate to provide energy and reductant for symbiotic fixation. The working hypothesis has been that the plant cytosol is microacrobic and that some carbon metabolism may be via anaerobic pathways similar to those in roots of flood tolerant plants. A method of analyzing redox changes in intact mitochondria, bacteroids or bacteria was adapted; a method of manipulating nitrogenase activity by oxygen inhibition was developed; the production of alcohol by soybean nodules was studied; and enzymes metabolizing alcohol/aldehyde were found in other nitrogen fixing systems. (ACR)

LaRue, T.A.

1983-01-01

338

Paths of Carbon and Their Regulation.  

National Technical Information Service (NTIS)

A comparison of the carbon pathways in photosynthetic, oxygenic bacteria, and chloroplasts from eukaryotic cells was made. The regulations of these pathways was compared. The evolution of the carbon pathways from the most primitive to more advanced forms ...

J. A. Bassham

1979-01-01

339

Heme oxygenase/carbon monoxide-biliverdin pathway down regulates neutrophil rolling, adhesion and migration in acute inflammation  

PubMed Central

Background and purpose: Heme oxygenase (HO) activity is known to down-regulate inflammatory events. Here, we address the role of HO and its metabolites, carbon monoxide (CO) and biliverdin (BVD), in leukocyte rolling, adhesion and neutrophil migration during inflammatory processes. Experimental approach: Intravital microscopy was used to evaluate leukocyte rolling and adhesion in the mesenteric microcirculation of mice. TNF? and IL-1? were determined by ELISA and HO-1 protein expression by Western blot. Key results: Intraperitoneal challenge with carrageenan enhanced HO-1 protein expression in mesentery and bilirubin concentration in peritoneal exudates. Pretreatment of mice with a non-specific inhibitor of HO (ZnDPBG) or with a HO-1 specific inhibitor (ZnPP IX) enhanced neutrophil migration, rolling and adhesion on endothelium induced by carrageenan. In contrast, HO substrate (hemin), CO donor (DMDC) or BVD reduced these parameters. The reduction of neutrophil recruitment promoted by HO metabolites was independent of the production of chemotactic cytokines. Inhibitory effects of CO, but not of BVD, were counteracted by treatment with a soluble guanylate cyclase (sGC) inhibitor, ODQ. Furthermore, inhibition of HO prevented the inhibitory effect of a nitric oxide (NO) donor (SNAP) upon neutrophil migration, while the blockade of NO synthase (NOS) activity by aminoguanidine did not affect the CO or BVD effects. Conclusions and Implications: Metabolites of HO decreased leukocyte rolling, adhesion and neutrophil migration to the inflammatory site by a mechanism partially dependent on sGC. Moreover, inhibition by NO of neutrophil migration was dependent on HO activity.

Freitas, A; Alves-Filho, J C; Secco, D D; Neto, A F; Ferreira, S H; Barja-Fidalgo, C; Cunha, F Q

2006-01-01

340

Polymorphisms in one-carbon metabolism pathway genes and risk for bladder cancer in a Tunisian population.  

PubMed

Cigarette smoking is the most important risk factor for bladder cancer. Moreover, epidemiologic studies have implicated several genetic variations interfering with methyl group metabolisms in susceptibility for a variety of cancers. Examples of these variations can be found in genes of the folate metabolic pathway, which is crucial in the provision of methyl groups for DNA, RNA, and protein methylation, as well as in purine and pyrimidine synthesis. We conducted a case-control study to examine the relationship between the methylenetetrahydrofolate reductase (MTHFR C677 T and MTHFR A1298C), methionine synthase (5-methyltetrahydrofolate-homocysteine methyltransferase, MTR A2756 G), methionine synthase reductase (5-methyltetrahydrofolate-homocysteine methyltransferase reductase, MTRR A66 G and MTRR C524 T), and thymidylate synthase (TYMS 2R-->3R and G/C) genotypes and the risk for bladder cancer in a Tunisian population. The isolated MTHFR 677 *T, MTRR 66 *G and MTRR 524 *T variants did not appear to influence bladder cancer susceptibility. The 3R *C/3R *C genotype for the TYMS gene appears to be a protective factor against bladder cancer development (P=0.0001; OR=0.12; 95% CI=0.03-0.40). However, patients heterozygous for MTHFR A1298C or MTR A2756 G genotypes have 1.62- and 2.13-fold higher risk, respectively, of developing bladder cancer. Moreover, the combined study of MTHFR 1298 *C and MTR 2756 *G variants with either or both MTRR 66GG and TYMS 3R *G/3R *G genotypes suggests a cumulative effect. Finally, this study evidenced that interaction between gene variations involved in folate metabolism and risk of bladder cancer increased dramatically among smokers. PMID:19837268

Rouissi, Kamel; Ouerhani, Slah; Oliveira, Elisabete; Marrakchi, Raja; Cherni, Lotfi; Ben Othman, Fethi; Ben Slama, Mohamed R; Sfaxi, Mohamed; Ayed, Mohsen; Chebil, Mohamed; Amorim, António; Prata, Maria João; Benammar Elgaaied, Amel

2009-11-01

341

EST-analysis of the thermo-acidophilic red microalga Galdieria sulphuraria reveals potential for lipid A biosynthesis and unveils the pathway of carbon export from rhodoplasts.  

PubMed

When we think of extremophiles, organisms adapted to extreme environments, prokaryotes come to mind first. However, the unicellular red micro-alga Galdieria sulphuraria (Cyanidiales) is a eukaryote that can represent up to 90% of the biomass in extreme habitats such as hot sulfur springs with pH values of 0-4 and temperatures of up to 56 degrees C. This red alga thrives autotrophically as well as heterotrophically on more than 50 different carbon sources, including a number of rare sugars and sugar alcohols. This biochemical versatility suggests a large repertoire of metabolic enzymes, rivaled by few organisms and a potentially rich source of thermo-stable enzymes for biotechnology. The temperatures under which this organism carries out photosynthesis are at the high end of the range for this process, making G. sulphuraria a valuable model for physical studies on the photosynthetic apparatus. In addition, the gene sequences of this living fossil reveal much about the evolution of modern eukaryotes. Finally, the alga tolerates high concentrations of toxic metal ions such as cadmium, mercury, aluminum, and nickel, suggesting potential application in bioremediation. To begin to explore the unique biology of G. sulphuraria , 5270 expressed sequence tags from two different cDNA libraries have been sequenced and annotated. Particular emphasis has been placed on the reconstruction of metabolic pathways present in this organism. For example, we provide evidence for (i) a complete pathway for lipid A biosynthesis; (ii) export of triose-phosphates from rhodoplasts; (iii) and absence of eukaryotic hexokinases. Sequence data and additional information are available at http://genomics.msu.edu/galdieria. PMID:15604662

Weber, Andreas P M; Oesterhelt, Christine; Gross, Wolfgang; Bräutigam, Andrea; Imboden, Lori A; Krassovskaya, Inga; Linka, Nicole; Truchina, Julia; Schneidereit, Jörg; Voll, Hildegard; Voll, Lars M; Zimmermann, Marc; Jamai, Aziz; Riekhof, Wayne R; Yu, Bin; Garavito, R Michael; Benning, Christoph

2004-05-01

342

Inhibition of proteolysis in histiotrophic nutrition pathways alters DNA methylation and one-carbon metabolism in the organogenesis-stage rat conceptus.  

PubMed

Epigenetic modifications, including DNA methylation, contribute to the transcriptional regulation of developmental genes that control growth and differentiation during embryogenesis. The methyl donor, S-adenosylmethionine (SAM), is biosynthesized from methionine and adenosine triphosphate by methionine adenosyltransferase 2a (Mat2a) in the one-carbon (C1) metabolism pathway. SAM biosynthesis requires a steady supply of nutrients, vitamins and cofactors obtained by the developing conceptus through histiotrophic nutrition pathways (HNPs). The visceral yolk sac (VYS) captures proteins and their substrate cargos by receptor-mediated endocytosis and degrades them using lysosomal proteases. We hypothesize that leupeptin, a protease inhibitor, reduces the availability of methionine and C1 substrates, restricting SAM biosynthesis and altering patterns of DNA methylation. Rat conceptuses were exposed to 50 and 100 ?M leupeptin in whole embryo culture for periods of 26 h from gestational day (GD) 10 or 6 h on GD11. After 6 h on GD11, the 100-?M leupeptin treatment significantly decreased methionine in embryo (EMB) and VYS, reduced Mat2a protein levels and inhibited Mat2a specific activity, all of which produced a significant 52% reduction of SAM in the VYS. The 50- and 100-?M leupeptin treatments significantly decreased global methylation levels by 6%-9% in EMB and by 11%-15% in VYS following both 6- and 26-h exposure periods. This study demonstrates that HNP disruption alters C1 activity and significantly reduces global DNA methylation during organogenesis. Because epigenetic reprogramming is crucial for normal differentiation and growth, these findings suggest a possible mechanism through which nutrients and environmental factors may alter early developmental regulation. PMID:23453262

Sant, Karilyn E; Dolinoy, Dana C; Nahar, Muna S; Harris, Craig

2013-02-28

343

[Remarks on biomechanics of external fixation.].  

PubMed

In our experimental study we report results of a measurement of the stiffness of different types of external fixators. In model of external fixation of the femur the mechanical properties of Hoffmann, Wagner, Ilizarov and Poldi 7 aparates were evaluated in model of external fixation of the tibia the properties of the different configurations of the unilateral frame and of the combined unilateral frame and bilateral frame were evaluated. Our results have shown the importance: - the stiffness of an applied frame, - the proper interconection of the used configura tion of the apparatus (frame), - the number and placement of an individual im plants screws, pins. Some of the obtained results were applied in our clinical practice. Key words: external fixation, biomechanics. PMID:20470527

Stehlík, J; Novotný, R; Klézl, Z; Cech, O

1995-01-01

344

Internal fixation in patients with multiple injuries.  

PubMed

The hypothesis is advanced that there are additional and exceptional indications for the use of internal fixation in the patient with multiple injuries. Eleven case studies of patients who sustained major injuries support this hypothesis. PMID:6629496

Merriam, W F; Mifsud, R P

1983-09-01

345

Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion  

NASA Astrophysics Data System (ADS)

Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C-C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion.

Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

2013-07-01

346

Arsenic fixation on iron-hydroxide-rich and plant litter-containing sediments in natural environments  

NASA Astrophysics Data System (ADS)

Iron-hydroxide-rich and plant litter-containing sediments from natural sites contaminated with uranium mine tailing leachates were examined for their ability to adsorb arsenic. The samples with high contents of iron hydroxides (Fetotal concentration, >300 g kg-1) exhibited remarkable fixation of arsenic (up to 40 g As kg-1). This value corresponded approximately to the supersaturation point for natural iron hydroxides under the present conditions, and it was significantly lower than the value found for synthetic iron hydroxides. There was a strong correlation ( R=0.8999) between the concentration of iron and that of arsenic at low arsenic contents, indicating adsorption on strong binding sites. Although all the samples had noticeable contents of organic carbon (plant litter), calcium, and manganese, no obvious effect of these elements on arsenic fixation could be detected. The amount of iron hydroxides was found the only fixation-controlling parameter immediately below a leaching water source.

Fritzsche, Andreas; Dienemann, Holger; Dudel, Ernst Gert

2006-10-01

347

New insights in the use of carbon isotopes as tracers of DOC sources and water pathways in headwater catchments  

NASA Astrophysics Data System (ADS)

Despite the significant importance of dissolved organic carbon (DOC) in aquatics ecosystems, the processes controlling DOC delivery to stream waters at the catchment scale are still poorly understood, in particular with regards to the relative importance of riparian versus upland soils as DOC sources. In this respect, the stable carbon isotopic composition of DOC (?13CDOC) appears to be a promising tool as different ?13CDOC values are anticipated between wetland and upland soil DOC, because of differences in soil oxygenation, soil humidity and soil organic matter degradation scheme However, care must be exercised because of the possible occurrence of seasonal variations in the ?13CDOC values of both riparian and upland DOC , and because also of the possible mixing of DOC coming from spatially distinct sources. The markedly different isotopic patterns obtained during high resolution monitoring ( 2 ? units), while others showed no, or much more restricted isotopic variations. A comparison of these results with previously published data revealed that this temporal variability of intra-storm ?13CDOC values is the exact transposition of the temporal variability of ?13CDOC values that was found in the riparian soil waters of this catchment during the same period. The latter variability has been shown to arise from the combined effect of changes in the production mechanisms and ultimate sources of riparian DOC and of the lateral input in the riparian domains of an isotopically heavier DOC component coming from more upland areas. Overall, results from this study confirm that upland domains may be significant contributors of stream DOC flux in headwater catchments. They also show that upland soils behave as a size-limited reservoir with respect to DOC production, whereas more highly productive soils in the wetland domains act as a near-infinite reservoir. Through this study, we show that the isotopic composition of DOC is an extremely powerful tool for tracing DOC sources and DOC transport mechanisms in headwater catchments, demonstrating in the meantime that the use of this tool requires that the temporal and spatial variability of the isotopic signatures of all potential DOC sources in the catchment is known accurately. Providing that this condition is fulfilled, the isotopic tool can allow up to quantify the proportions of DOC - and of corresponding water flows - coming from different contributing areas which may be of great importance for better understanding and better modeling of DOC transfer and water routing through the landscape.

Lambert, Thibault; Pierson-Wickmann, Anne-Catherine; Gruau, Gérard; Petitjean, Patrice; Thibault, Jean-Noël; Jeanneau, Laurent

2013-04-01

348

T tubules and surface membranes provide equally effective pathways of carbonic anhydrase-facilitated lactic acid transport in skeletal muscle.  

PubMed

We have studied lactic acid transport in the fast mouse extensor digitorum longus muscles (EDL) by intracellular and cell surface pH microelectrodes. The role of membrane-bound carbonic anhydrases (CA) of EDL in lactic acid transport was investigated by measuring lactate flux in muscles from wildtype, CAIV-, CAIX- and CAXIV-single ko, CAIV-CAXIV double ko and CAIV-CAIX-CAXIV-triple ko mice. This was complemented by immunocytochemical studies of the subcellular localization of CAIV, CAIX and CAXIV in mouse EDL. We find that CAXIV and CAIX single ko EDL exhibit markedly but not maximally reduced lactate fluxes, whereas triple ko and double ko EDL show maximal or near-maximal inhibition of CA-dependent lactate flux. Interpretation of the flux measurements in the light of the immunocytochemical results leads to the following conclusions. CAXIV, which is homogeneously distributed across the surface membrane of EDL fibers, facilitates lactic acid transport across this membrane. CAIX, which is associated only with T tubular membranes, facilitates lactic acid transport across the T tubule membrane. The removal of lactic acid from the lumen of T tubuli towards the interstitial space involves a CO2-HCO3- diffusional shuttle that is maintained cooperatively by CAIX within the T tubule and, besides CAXIV, by the CAIV, which is strategically located at the opening of the T tubules. The data suggest that about half the CA-dependent muscular lactate flux occurs across the surface membrane, while the other half occurs across the membranes of the T tubuli. PMID:21179203

Hallerdei, Janine; Scheibe, Renate J; Parkkila, Seppo; Waheed, Abdul; Sly, William S; Gros, Gerolf; Wetzel, Petra; Endeward, Volker

2010-12-13

349

Structure of PhnP, a Phosphodiesterase of the Carbon-Phosphorus Lyase Pathway for Phosphonate Degradation*  

PubMed Central

Carbon-phosphorus lyase is a multienzyme system encoded by the phn operon that enables bacteria to metabolize organophosphonates when the preferred nutrient, inorganic phosphate, is scarce. One of the enzymes encoded by this operon, PhnP, is predicted by sequence homology to be a metal-dependent hydrolase of the ?-lactamase superfamily. Screening with a wide array of hydrolytically sensitive substrates indicated that PhnP is an enzyme with phosphodiesterase activity, having the greatest specificity toward bis(p-nitrophenyl)phosphate and 2?,3?-cyclic nucleotides. No activity was observed toward RNA. The metal ion dependence of PhnP with bis(p-nitrophenyl)phosphate as substrate revealed a distinct preference for Mn2+ and Ni2+ for catalysis, whereas Zn2+ afforded poor activity. The three-dimensional structure of PhnP was solved by x-ray crystallography to 1.4 resolution. The overall fold of PhnP is very similar to that of the tRNase Z endonucleases but lacks the long exosite module used by these enzymes to bind their tRNA substrates. The active site of PhnP contains what are probably two Mn2+ ions surrounded by an array of active site residues that are identical to those observed in the tRNase Z enzymes. A second, remote Zn2+ binding site is also observed, composed of a set of cysteine and histidine residues that are strictly conserved in the PhnP family. This second metal ion site appears to stabilize a structural motif.

Podzelinska, Kateryna; He, Shu-Mei; Wathier, Matthew; Yakunin, Alexander; Proudfoot, Michael; Hove-Jensen, Bjarne; Zechel, David L.; Jia, Zongchao

2009-01-01

350

Carbon Isotope Discrimination Varies Genetically in C4 Species  

PubMed Central

Carbon-isotope discrimination (?) is used to distinguish between different photosynthetic pathways. It has also been shown that variation in ? occurs among varieties of C3 species, but not as yet, in C4 species. We now report that ? also varies among genotypes of sorghum (Sorghum bicolor Moench), a C4 species. The discrimination in leaves of field-grown plants of 12 diverse genotypes of sorghum was measured and compared with their grain yields. Discrimination varied significantly among genotypes, and there was a significant negative correlation between grain yield and ?. The variation in ? may be caused by genetic differences in either leakiness of the bundle-sheath cells or by differences in the ratio of assimilation rate to stomatal conductance. At the leaf level, the former should be related to light-use efficiency of carbon fixation and the latter should be related to transpiration efficiency. Both could relate to the yield of the crop.

Hubick, Kerry T.; Hammer, Graeme L.; Farquhar, Graham D.; Wade, Len J.; von Caemmerer, Susanne; Henderson, Sally A.

1990-01-01

351

Fixation of Ejaculated Spermatozoa for Electron Microscopy  

Microsoft Academic Search

EJACULATED spermatozoa cannot be preserved satisfactorily by conventional fixation procedures for electron microscopy. Osmium tetroxide (OsO4) fixation of crude ejaculate consistently produces a variety of artefacts such as separation of the plasma membrane from the acrosome, widening of nuclear vacuoles, erosion of the acrosome, and swelling of mitochondria1-3. These alterations could be the consequence of the rapid destruction of the

Mario Stefanini; Cesare De Martino; Luciano Zamboni

1967-01-01

352

Nonmetallic fixation in elective maxillofacial surgery.  

PubMed

Resorbable fixation technology offers several benefits, including easily cut and shaped plates, strong and predictable resorption qualities, and improved patient acceptance and expectations. Moreover, resorbable fixation implants can be completely reabsorbed into the body, eliminating the need for subsequent removal. This article describes the use of this innovative technology in orthognathic surgery, including preoperative and postoperative patient needs, intraoperative patient care, and potential complications. PMID:10686651

Abernathy, W; McDaniel, M; Edwards, R; Kiely, K; Frazier, D

2000-01-01

353

Dynesys fixation for lumbar spine degeneration  

Microsoft Academic Search

The dynamic fixation system Dynesys is utilized in the last 10 years for treatment of degenerative segmental disease of the\\u000a lumbar spine. Dynesys is a semi-rigid fixation system that allows minimal lengthening and shortening between two segmental\\u000a pedicle screws as opposed to a rigid metal bar. Thus, the system is regarded to maintain stability and near physiological\\u000a motion patterns of the

Matthias Bothmann; Erich Kast; Gerald Jens Boldt; Joachim Oberle

2008-01-01

354

Fixation of carbon dioxide by macrocyclic lanthanide(III) complexes under neutral conditions producing self-assembled trimeric carbonato-bridged compounds with ?3-?2:?2:?2 bonding.  

PubMed

A series of mononuclear lanthanide(III) complexes [Ln(LH(2))(H(2)O)(3)Cl](ClO(4))(2) (Ln = La, Nd, Sm, Eu, Gd, Tb, Lu) of the tetraiminodiphenolate macrocyclic ligand (LH(2)) in 95 : 5 (v/v) methanol-water solution fix atmospheric carbon dioxide to produce the carbonato-bridged trinuclear complexes [{Ln(LH(2))(H(2)O)Cl}(3)(?(3)-CO(3))](ClO(4))(4)·nH(2)O. Under similar conditions, the mononuclear Y(III) complex forms the dimeric compound [{Y(LH(2))(H(2)O)Cl}(?(2)-CO(3)){Y(LH(2))(H(2)O)(2)}](ClO(4))(3)·4H(2)O. These complexes have been characterized by their IR and NMR ((1)H, (13)C) spectra. The X-ray crystal structures have been determined for the trinuclear carbonato-bridged compounds of Nd(III), Gd(III) and Tb(III) and the dinuclear compound of Y(III). In all cases, each of the metal centers are 8-coordinate involving two imine nitrogens and two phenolate oxygens of the macrocyclic ligand (LH(2)) whose two other imines are protonated and intramolecularly hydrogen-bonded with the phenolate oxygens. The oxygen atoms of the carbonate anion in the trinuclear complexes are bonded to the metal ions in tris-bidentate ?(3)-?(2):?(2):?(2) fashion, while they are in bis-bidentate ?(2)-?(2):?(2) mode in the Y(III) complex. The magnetic properties of the Gd(III) complex have been studied over the temperature range 2 to 300 K and the magnetic susceptibility data indicate a very weak antiferromagnetic exchange interaction (J = -0.042 cm(-1)) between the Gd(III) centers (S = 7/2) in the metal triangle through the carbonate bridge. The luminescence spectral behaviors of the complexes of Sm(III), Eu(III), and Tb(III) have been studied. The ligand LH(2) acts as a sensitizer for the metal ions in an acetonitrile-toluene glassy matrix (at 77 K) and luminescence intensities of the complexes decrease in the order Eu(3+) > Sm(3+) > Tb(3+). PMID:22301883

Bag, Pradip; Dutta, Supriya; Biswas, Papu; Maji, Swarup Kumar; Flörke, Ulrich; Nag, Kamalaksha

2012-02-03

355

Microwave energy fixation for electron microscopy.  

PubMed Central

We have demonstrated that microwave energy (MW) can be used in conjunction with chemical cross-linking agents in order to rapidly fix cell suspensions and tissue blocks for electron microscopy in 7-9 seconds. The optimal MW fixation method involved immersing tissues up to 1 cu cm in dilute aldehyde fixation and immediately irradiating the specimens in a conventional microwave oven for 9 seconds to 50 C. Ultrastructural preservation of samples irradiated by MW energy was comparable to that of the control samples immersed in aldehyde fixative for 2 hours at 25 C. Stereologic analysis showed that tissue blocks fixed by the MW fixation method did not cause organelles such as liver mitochondria and salivary gland granules to shrink or to swell. Potential applications for this new fixation technology include the investigation of rapid intracellular processes (eg, vesicular transport) and preservation of proteins that are difficult to demonstrate with routine fixation methods (eg, antigens and enzymes). Images Figure 4 Figure 5 Figure 2 Figure 3 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11

Login, G. R.; Dvorak, A. M.

1985-01-01

356

Maxwellian Eye Fixation during Natural Scene Perception  

PubMed Central

When we explore a visual scene, our eyes make saccades to jump rapidly from one area to another and fixate regions of interest to extract useful information. While the role of fixation eye movements in vision has been widely studied, their random nature has been a hitherto neglected issue. Here we conducted two experiments to examine the Maxwellian nature of eye movements during fixation. In Experiment 1, eight participants were asked to perform free viewing of natural scenes displayed on a computer screen while their eye movements were recorded. For each participant, the probability density function (PDF) of eye movement amplitude during fixation obeyed the law established by Maxwell for describing molecule velocity in gas. Only the mean amplitude of eye movements varied with expertise, which was lower in experts than novice participants. In Experiment 2, two participants underwent fixed time, free viewing of natural scenes and of their scrambled version while their eye movements were recorded. Again, the PDF of eye movement amplitude during fixation obeyed Maxwell's law for each participant and for each scene condition (normal or scrambled). The results suggest that eye fixation during natural scene perception describes a random motion regardless of top-down or of bottom-up processes.

Duchesne, Jean; Bouvier, Vincent; Guilleme, Julien; Coubard, Olivier A.

2012-01-01

357

Genetic evidence of a major role for glucose-6-phosphate dehydrogenase in nitrogen fixation and dark growth of the cyanobacterium Nostoc sp. strain ATCC 29133.  

PubMed Central

Heterocysts, sites of nitrogen fixation in certain filamentous cyanobacteria, are limited to a heterotrophic metabolism, rather than the photoautotrophic metabolism characteristic of cyanobacterial vegetative cells. The metabolic route of carbon catabolism in the supply of reductant to nitrogenase and for respiratory electron transport in heterocysts is unresolved. The gene (zwf) encoding glucose-6-phosphate dehydrogenase (G6PD), the initial enzyme of the oxidative pentose phosphate pathway, was inactivated in the heterocyst-forming, facultatively heterotrophic cyanobacterium, Nostoc sp. strain ATCC 29133. The zwf mutant strain had less than 5% of the wild-type apparent G6PD activity, while retaining wild-type rates of photoautotrophic growth with NH4+ and of dark O2 uptake, but it failed to grow either under N2-fixing conditions or in the dark with organic carbon sources. A wild-type copy of zwf in trans in the zwf mutant strain restored only 25% of the G6PD specific activity, but the defective N2 fixation and dark growth phenotypes were nearly completely complemented. Transcript analysis established that zwf is in an operon also containing genes encoding two other enzymes of the oxidative pentose phosphate cycle, fructose-1,6-bisphosphatase and transaldolase, as well as a previously undescribed gene (designated opcA) that is cotranscribed with zwf. Inactivation of opcA yielded a growth phenotype identical to that of the zwf mutant, including a 98% decrease, relative to the wild type, in apparent G6PD specific activity. The growth phenotype and lesion of G6PD activity in the opcA mutant were complemented in trans with a wild-type copy of opcA. In addition, placement in trans of a multicopy plasmid containing the wild-type copies of both zwf and opcA in the zwf mutant resulted in an approximately 20-fold stimulation of G6PD activity, relative to the wild type, complete restoration of nitrogenase activity, and a slight stimulation of N2-dependent photoautotrophic growth and fructose-supported dark growth. These results unequivocally establish that G6PD, and most likely the oxidative pentose phosphate pathway, represents the essential catabolic route for providing reductant for nitrogen fixation and respiration in differentiated heterocysts and for dark growth of vegetative cells. Moreover, the opcA gene product is involved by an as yet unknown mechanism in G6PD synthesis or catalytic activity.

Summers, M L; Wallis, J G; Campbell, E L; Meeks, J C

1995-01-01

358

Deciphering diatom biochemical pathways via whole-cell proteomics  

PubMed Central

Diatoms play a critical role in the oceans’ carbon and silicon cycles; however, a mechanistic understanding of the biochemical processes that contribute to their ecological success remains elusive. Completion of the Thalassiosira pseudonana genome provided ‘blueprints’ for the potential biochemical machinery of diatoms, but offers only a limited insight into their biology under various environmental conditions. Using high-throughput shotgun proteomics, we identified a total of 1928 proteins expressed by T. pseudonana cultured under optimal growth conditions, enabling us to analyze this diatom’s primary metabolic and biosynthetic pathways. Of the proteins identified, 70% are involved in cellular metabolism, while 11% are involved in the transport of molecules. We identified all of the enzymes involved in the urea cycle, thereby describing the complete pathway to convert ammonia to urea, along with urea transporters, and the urea-degrading enzyme urease. Although metabolic exchange between these pathways remains ambiguous, their constitutive presence suggests complex intracellular nitrogen recycling. In addition, all C4 related enzymes for carbon fixation have been identified to be in abundance, with high protein sequence coverage. Quantification of mass spectra acquisitions demonstrated that the 20 most abundant proteins included an unexpectedly high expression of clathrin, which is the primary structural protein involved in endocytic transport. This result highlights a previously overlooked mechanism for the inter- and intra-cellular transport of nutrients and macromolecules in diatoms, potentially providing a missing link to organelle communication and metabolite exchange. Our results demonstrate the power of proteomics, and lay the groundwork for future comparative proteomic studies and directed analyses of specifically expressed proteins and biochemical pathways of oceanic diatoms.

Nunn, Brook L.; Aker, Jocelyn R.; Shaffer, Scott A.; Tsai, Shannon; Strzepek, Robert F.; Boyd, Philip W.; Freeman, Theodore Larson; Brittnacher, Mitchell; Malmstrom, Lars; Goodlett, David R.

2009-01-01

359

Surface circulation patterns and the pathways of sea surface carbon dioxide (CO2) off northern Chile (~27.5° S) between 30 and 10 kyr BP: global and/or local forcing?  

NASA Astrophysics Data System (ADS)

We present a reconstruction of past changes in partial pressure of CO2 (pCO2) from northern Chile (~27° S), between 10 and 30 kyr BP, based on carbon isotope composition of C37:2-alkenone. The high-pCO2 during the entire time series indicates that northern Chile upwelling system has been a permanent source of CO2 to the atmosphere. The multiproxy reconstruction suggests that the CO2 outgassing and sequestration pathways were modulated by local and global mechanisms. During global glacial conditions, an enhanced coastal upwelling forcing resulted in high-availability of deep water macronutrients and a CO2-supersaturated water column, which combined with high-inputs of iron from the continent, intensified the carbon sequestration pathway of the biological pump, through diatom biomass export. During the deglacial, a decrease in the upwelling forcing, an increment in water column stability and reduced continental inputs of iron are consistent with a larger role of calcifying organisms in the plankton assemblage in terms of carbon sequestration pathway through the carbonate system.

Placencia, J. A.; Harada, N.; Torres, R.; Lange, C. B.; Hebbeln, D.

2010-03-01

360

The threonine degradation pathway of the Trypanosoma brucei procyclic form: the main carbon source for lipid biosynthesis is under metabolic control.  

PubMed

The Trypanosoma brucei procyclic form resides within the digestive tract of its insect vector, where it exploits amino acids as carbon sources. Threonine is the amino acid most rapidly consumed by this parasite, however its role is poorly understood. Here, we show that the procyclic trypanosomes grown in rich medium only use glucose and threonine for lipid biosynthesis, with threonine's contribution being ??2.5 times higher than that of glucose. A combination of reverse genetics and NMR analysis of excreted end-products from threonine and glucose metabolism, shows that acetate, which feeds lipid biosynthesis, is also produced primarily from threonine. Interestingly, the first enzymatic step of the threonine degradation pathway, threonine dehydrogenase (TDH, EC 1.1.1.103), is under metabolic control and plays a key role in the rate of catabolism. Indeed, a trypanosome mutant deleted for the phosphoenolpyruvate decarboxylase gene (PEPCK, EC 4.1.1.49) shows a 1.7-fold and twofold decrease of TDH protein level and activity, respectively, associated with a 1.8-fold reduction in threonine-derived acetate production. We conclude that TDH expression is under control and can be downregulated in response to metabolic perturbations, such as in the PEPCK mutant in which the glycolytic metabolic flux was redirected towards acetate production. PMID:23899193

Millerioux, Yoann; Ebikeme, Charles; Biran, Marc; Morand, Pauline; Bouyssou, Guillaume; Vincent, Isabel M; Mazet, Muriel; Riviere, Loïc; Franconi, Jean-Michel; Burchmore, Richard J S; Moreau, Patrick; Barrett, Michael P; Bringaud, Frédéric

2013-08-25

361

Oral facial clefts and gene polymorphisms in metabolism of folate/one-carbon and vitamin A: a pathway-wide association study  

PubMed Central

An increased risk of facial clefts has been observed among mothers with lower intake of folic acid or vitamin A around conception. We hypothesized that the risk of clefts may be further moderated by genes involved in metabolizing folate or vitamin A. We included 425 case-parent triads in which the child had either cleft lip with or without cleft palate (CL/P) or cleft palate only (CPO), and no other major defects. We analyzed 108 SNPs and one insertion in 29 genes involved in folate/one-carbon metabolism and 68 SNPs from 16 genes involved in vitamin A metabolism. Using the Triad Multi Marker (TRIMM) approach we performed SNP, gene, chromosomal region, and pathway-wide association tests of child or maternal genetic effects for both CL/P and CPO. We stratified these analyses on maternal intake of folic acid or vitamin A during the periconceptional period. As expected with this high number of statistical tests, there were many associations with p-values < 0.05; although there were fewer than predicted by chance alone. The strongest association in our data (between fetal FOLH1 and CPO, p=0.0008) is not in agreement with epidemiologic evidence that folic acid reduces the risk of CL/P in these data, not CPO. Despite strong evidence for genetic causes of oral facial clefts and the protective effects of maternal vitamins, we found no convincing indication that polymorphisms in these vitamin metabolism genes play an etiologic role.

Boyles, Abee L.; Wilcox, Allen J.; Taylor, Jack A.; Shi, Min; Weinberg, Clarice R.; Meyer, Klaus; Fredriksen, Ase; Ueland, Per Magne; Johansen, Anne Marte W.; Drevon, Christian A.; Jugessur, Astanand; Trung, Truc Nguyen; Gjessing, Hakon K.; Vollset, Stein Emil; Murray, Jeffrey C.; Christensen, Kaare; Lie, Rolv T.

2009-01-01

362

Pathways and regulation of carbon, sulfur and energy transfer in marine sediments overlying methane gas hydrates on the Opouawe Bank (New Zealand)  

NASA Astrophysics Data System (ADS)

This study combines sediment geochemical analysis, in situ benthic lander deployments and numerical modeling to quantify the biogeochemical cycles of carbon and sulfur and the associated rates of Gibbs energy production at a novel methane seep. The benthic ecosystem is dominated by a dense population of tube-building ampharetid polychaetes and conspicuous microbial mats were unusually absent. A 1D numerical reaction-transport model, which allows for the explicit growth of sulfide and methane oxidizing microorganisms, was tuned to the geochemical data using a fluid advection velocity of 14 cm yr -1. The fluids provide a deep source of dissolved hydrogen sulfide and methane to the sediment with fluxes equal to 4.1 and 18.2 mmol m -2 d -1, respectively. Chemosynthetic biomass production in the subsurface sediment is estimated to be 2.8 mmol m -2 d -1 of C biomass. However, carbon and oxygen budgets indicate that chemosynthetic organisms living directly above or on the surface sediment have the potential to produce 12.3 mmol m -2 d -1 of C biomass. This autochthonous carbon source meets the ampharetid respiratory carbon demand of 23.2 mmol m -2 d -1 to within a factor of 2. By contrast, the contribution of photosynthetically-fixed carbon sources to ampharetid nutrition is minor (3.3 mmol m -2 d -1 of C). The data strongly suggest that mixing of labile autochthonous microbial detritus below the oxic layer sustains high measured rates of sulfate reduction in the uppermost 2 cm of the sulfidic sediment (100-200 nmol cm -3 d -1). Similar rates have been reported in the literature for other seeps, from which we conclude that autochthonous organic matter is an important substrate for sulfate reducing bacteria in these sediment layers. A system-scale energy budget based on the chemosynthetic reaction pathways reveals that up to 8.3 kJ m -2 d -1 or 96 mW m -2 of catabolic (Gibbs) energy is dissipated at the seep through oxidation reactions. The microorganisms mediating sulfide oxidation and anaerobic oxidation of methane (AOM) produce 95% and 2% of this energy flux, respectively. The low power output by AOM is due to strong bioenergetic constraints imposed on the reaction rate by the composition of the chemical environment. These constraints provide a high potential for dissolved methane efflux from the sediment (12.0 mmol m -2 d -1) and indicates a much lower efficiency of (dissolved) methane sequestration by AOM at seeps than considered previously. Nonetheless, AOM is able to consume a third of the ascending methane flux (5.9 mmol m -2 d -1 of CH 4) with a high efficiency of energy expenditure (35 mmol CH 4 kJ -1). It is further proposed that bioenergetic limitation of AOM provides an explanation for the non-zero sulfate concentrations below the AOM zone observed here and in other active and passive margin sediments.

Dale, A. W.; Sommer, S.; Haeckel, M.; Wallmann, K.; Linke, P.; Wegener, G.; Pfannkuche, O.

2010-10-01

363

Relationship between DNA Polymorphism and Fixation Time  

PubMed Central

When there is no recombination among nucleotide sites in DNA sequences, DNA polymorphism and fixation of mutants at nucleotide sites are mutually related. Using the method of gene genealogy, the relationship between the DNA polymorphism and the fixation of mutant nucleotide was quantitatively investigated under the assumption that mutants are selectively neutral, that there is no recombination among nucleotide sites, and that the population is a random mating population with N diploid individuals. The results obtained indicate that the expected number of nucleotide differences between two DNA sequences randomly sampled from the population is 42% less when a mutant at a particular nucleotide site reaches fixation than at a random time, and that heterozygosity is also expected to be less when fixation takes place than at a random time, but the amount of reduction depends on the value of 4Nv in this case, where v is the mutation rate per DNA sequence per generation. The formula for obtaining the expected number of nucleotide differences between the two DNA sequences for a given fixation time is also derived, and indicates that, even when it takes a large number of generations for a mutant to reach fixation, this number is 33% less than at a random time. The computer simulation conducted suggests that the expected number of nucleotide differences between the two DNA sequences at the time when an advantageous mutant becomes fixed is essentially the same as that of neutral mutant if the fixation time is the same. The effect of recombination on the amount of DNA polymorphism was also investigated by using computer simulation.

Tajima, F.

1990-01-01

364

Nitrogen fixation in denitrified marine waters.  

PubMed

Nitrogen fixation is an essential process that biologically transforms atmospheric dinitrogen gas to ammonia, therefore compensating for nitrogen losses occurring via denitrification and anammox. Currently, inputs and losses of nitrogen to the ocean resulting from these processes are thought to be spatially separated: nitrogen fixation takes place primarily in open ocean environments (mainly through diazotrophic cyanobacteria), whereas nitrogen losses occur in oxygen-depleted intermediate waters and sediments (mostly via denitrifying and anammox bacteria). Here we report on rates of nitrogen fixation obtained during two oceanographic cruises in 2005 and 2007 in the eastern tropical South Pacific (ETSP), a region characterized by the presence of coastal upwelling and a major permanent oxygen minimum zone (OMZ). Our results show significant rates of nitrogen fixation in the water column; however, integrated rates from the surface down to 120 m varied by ?30 fold between cruises (7.5±4.6 versus 190±82.3 µmol m(-2) d(-1)). Moreover, rates were measured down to 400 m depth in 2007, indicating that the contribution to the integrated rates of the subsurface oxygen-deficient layer was ?5 times higher (574±294 µmol m(-2) d(-1)) than the oxic euphotic layer (48±68 µmol m(-2) d(-1)). Concurrent molecular measurements detected the dinitrogenase reductase gene nifH in surface and subsurface waters. Phylogenetic analysis of the nifH sequences showed the presence of a diverse diazotrophic community at the time of the highest measured nitrogen fixation rates. Our results thus demonstrate the occurrence of nitrogen fixation in nutrient-rich coastal upwelling systems and, importantly, within the underlying OMZ. They also suggest that nitrogen fixation is a widespread process that can sporadically provide a supplementary source of fixed nitrogen in these regions. PMID:21687726

Fernandez, Camila; Farías, Laura; Ulloa, Osvaldo

2011-06-07

365

Nitrogen fixation and nitrogen fertilization of soybeans.  

PubMed

Abstract In pot experiments with (15)N labelled soil and mineral (15)N, the influence of Bradyrhizobium (Rhizobium japonicum) inoculation and N fertilization on the symbiotic N(2) fixation and yield of soybeans [Glycine max (L.) Merill., cv. 'Fiskeby V'] was investigated. Symbiotic N(2) fixation only occured after inoculation with Bradyrhizobium. Considerable differences in efficiency of the bacterial preparations were observed. Shortly after flowering, the symbiotic nitrogen fixation was finished and, subsequently, soybeans took up considerable N amounts from the soil. N fertilization at seeding suppressed N(2) fixation of soybeans. In this case, the dry matter and nitrogen yield increased, because the loss of fixed nitrogen was overcompensated by the mineral N uptake. During flowering of soybeans, the N(2) fixation was not affected by N supply, because this process was already terminated. The mineral N was additionally available to the plants and led to increased N amounts in plants. It was absorbed to a considerable degree by soybeans. The mineral N was translocated (partly, after intermediate storage in the vegetative organs) into the seeds thus increasing their yields. PMID:22088108

Merbach, W; Jacob, H J

1996-08-01

366

Hydrologic Control on Bacterial Nitrogen Fixation in the Holocene Black Sea  

NASA Astrophysics Data System (ADS)

Stratified oceans of the Phanerozoic Oceanic Anoxic Events apparently were dominated by bacterial nitrogen fixation. Decreased marine N:P nutrient ratios resulting from increased denitrification and decreased phosphate burial efficiency under anoxic waters drove this nutrient regime. This model is upheld by the presence of cyanobacterial hopanoid biomarkers in sedimentary records and ?15N values indicative of nitrogen fixation. However, in the largest modern redox-stratified marine basin, the Black Sea, bacterial nitrogen fixation seems to be only a minor contributor to the nitrogen cycle. In this study, we use geochemical proxies to evaluate the role of bacterial nitrogen fixation during the deposition of the Holocene Black Sea sapropel, starting 7.8 ka. We report compound-specific nitrogen and carbon stable isotope values of pyropheophytin a, a chlorophyll degradation product, and bacteriochlorophyll e produced by green sulfur bacteria. We also present the surprising finding of scytonemin, a pigment produced only by filamentous cyanobacteria exposed to ultraviolet radiation, in certain intervals in these sediments. In the Holocene, nitrogen fixation in the Black Sea is most prominent during times of reduced river water influx. This directly decreases the external flux of nitrate into the surface waters. Reduced freshwater influx also decreases the volume of low salinity water dispersed around the sea by the Rim Current, allowing the chemocline to shoal along the margins. Previous geochemical studies have described this changing chemocline geometry. The exposure of shallow water sediments to anoxic waters further stimulates nitrogen fixation by releasing more phosphorus to the system. Nitrogen fixation is recorded in the sediments as bulk and compound-specific pyropheophytin a ?15N values near 0 ‰ and -5 ‰, respectively. We have also detected scytonemin in two intervals characterized by especially low ?15N values. This compound suggests abundant filamentous cyanobacteria were living at the sea surface, a marked ecological shift from modern phytoplankton distributions. These data support the hypothesis that bacterial nitrogen fixation, at times, contributed significantly to the Black Sea nitrogen cycle. Interestingly, nitrogen fixation did not dominate the entire time period of sapropel sedimentation and stable stratification. Normal marine ?15N values coincide with periods of Black Sea level high stand and a deeper marginal chemocline.

Fulton, J. M.; Arthur, M. A.; Freeman, K. H.

2008-12-01

367

Chemical and physical basics of routine formaldehyde fixation  

PubMed Central

Formaldehyde is the widely employed fixative that has been studied for decades. The chemistry of fixation has been studied widely since the early 20th century. However, very few studies have been focused on the actual physics/chemistry aspect of process of this fixation. This article attempts to explain the chemistry of formaldehyde fixation and also to study the physical aspects involved in the fixation. The factors involved in the fixation process are discussed using well documented mathematical and physical formulae. The deeper understanding of these factors will enable pathologist to optimize the factors and use them in their favor.

Thavarajah, Rooban; Mudimbaimannar, Vidya Kazhiyur; Elizabeth, Joshua; Rao, Umadevi Krishnamohan; Ranganathan, Kannan

2012-01-01

368

The effects of light, macronutrients, trace metals and CO 2 on the production of calcium carbonate and organic carbon in coccolithophores—A review  

Microsoft Academic Search

The ratio of calcium carbonate to organic carbon (C) production in the surface ocean is thought to be one of the key marine biotic climate variables, through its effect on ocean C cycling. This ratio is significantly affected by calcification and photosynthetic C fixation in coccolithophores. The abundance of coccolithophores and their rates of calcification and organic C fixation are

Ingrid Zondervan

2007-01-01

369

Molecular Basis of Microbial One-Carbon Metabolism 2008 Gordon Research Conference (July 20-25, 2008)  

SciTech Connect

One-carbon (C-1) compounds play a central role in microbial metabolism. C-1 compounds include methane, carbon monoxide, CO2, and methanol as well as coenzyme-bound one-carbon compounds (methyl-B12, CH3-H4folate, etc). Such compounds are of broad global importance because several C-1 compounds (e.g., CH4) are important energy sources, some (e.g., CO2 and CH4) are potent greenhouse gases, and others (e.g., CH2Cl2) are xenobiotics. They are central in pathways of energy metabolism and carbon fixation by microbes and many are of industrial interest. Research on the pathways of one-carbon metabolism has added greatly to our understanding of evolution, structural biology, enzyme mechanisms, gene regulation, ecology, and applied biology. The 2008 meeting will include recent important findings in the following areas: (a) genomics, metagenomics, and proteomic studies that have expanded our understanding of autotrophy and C-1 metabolism and the evolution of these pathways; (b) redox regulation of carbon cycles and the interrelationship between the carbon cycle and other biogeochemical cycles (sulfur, nitrogen, oxygen); (c) novel pathways for carbon assimilation; (d) biotechnology related to C-1 metabolism; (e) novel enzyme mechanisms including channeling of C-1 intermediates during metabolism; and (f) the relationship between metal homeostasis and the global carbon cycle. The conference has a diverse and gender-balanced slate of speakers and session leaders. The wide variety of disciplines brought to the study of C-1 metabolism make the field an excellent one in which to train young researchers.

Stephen W. Ragsdale

2009-08-12

370

A global proteome study of Mycobacterium gilvum PYR-GCK grown on pyrene and glucose reveals the activation of glyoxylate, shikimate and gluconeogenetic pathways through the central carbon metabolism highway.  

PubMed

Various hydrocarbons have been released into the environment as a result of industrialization. An effective way of removing these materials without further environmental contamination is microbial bioremediation. Mycobacterium gilvum PYR-GCK, a bacteria isolated from a PAH polluted estuary, was studied using comparative shotgun proteomics to gain insight on its molecular activity while using pyrene and glucose as sole carbon and energy sources. Based on annotated genomic information, a confirmation analysis was first performed to confirm its pyrene degradation activity, using gas chromatography-mass spectrometry technology. One dimensional gel electrophoresis and liquid chromatography-mass spectrometry technologies employed in the proteomics analysis revealed the expression of pyrene degrading gene products along with upregulated expression of proteins functioning in the glyoxylate and shikimate pathways, in the pyrene-induced cells. The study also revealed the pathway of pyrene degraded intermediates, via partial gluconeogenesis, into the pentose phosphate pathway to produce precursors for nucleotides and amino acids biosynthesis. PMID:23361126

Badejo, Abimbola Comfort; Choi, Chi-Won; Badejo, Adegoke Olugboyega; Shin, Kyung-Hoon; Hyun, Jung-Ho; Lee, Yeol-Gyun; Kim, Seung-Il; Park, Kang-Sik; Kim, Sang Hoon; Jung, Kyoung Hwa; Chung, Young-Ho; Chai, Young Gyu

2013-01-30

371

Nitrogen Fixation in the Marine Environment  

NASA Astrophysics Data System (ADS)

Cyanobacteria of the genus Oscillatoria (Trichodesmium) account for annual inputs of nitrogen to the world's oceans of about 4.8 × 1012 grams while benthic environments contribute 15 × 1012 grams. The sum of these inputs is one-fifth of current estimates of nitrogen fixation in terrestrial environments and one-half of the present rate of industrial synthesis of ammonia. When the total of all nitrogen inputs to the sea is compared with estimated losses through denitrification, the marine nitrogen cycle approximates a steady state. Oceanic nitrogen fixation can supply less than 0.3 percent of the calculated demand of marine phytoplankton. The minor contribution by nitrogen fixation to the overall nitrogen economy of the sea is not consistent with the supposition that nitrogen is the primary limiting nutrient and suggests that factors other than nitrogen availability limit phytoplankton growth rates.

Capone, Douglas G.; Carpenter, Edward J.

1982-09-01

372

Rapid Two-Temperature Formalin Fixation  

PubMed Central

Formalin fixation is a mainstay of modern histopathologic analysis, yet the practice is poorly standardized and a significant potential source of preanalytical errors. Concerns of workflow and turnaround time drive interest in developing shorter fixation protocols, but rapid protocols can lead to poor histomorphology or inadequate downstream assay results. Additionally, assays such as immunohistochemistry for phosphorylated epitopes have historically been challenging in the context of formalin-fixed tissue, indicating that there may be room for improvement in this process that is fundamental to the practice of anatomic pathology. With these issues in mind, we studied basic formalin biochemistry to develop a novel formalin fixation protocol that involves a pre-incubation in subambient temperature formalin prior to a brief exposure to heated formalin. This new protocol is more rapid than standard protocols yet preserves histomorphology and yields tissue that is compatible with an expanded set of downstream clinical and research assays, including immunohistochemistry for phosphorylated epitopes.

Roberts, Esteban; Borlee, Grace; Otter, Michael; Baird, Geoffrey S.

2013-01-01

373

Rapid two-temperature formalin fixation.  

PubMed

Formalin fixation is a mainstay of modern histopathologic analysis, yet the practice is poorly standardized and a significant potential source of preanalytical errors. Concerns of workflow and turnaround time drive interest in developing shorter fixation protocols, but rapid protocols can lead to poor histomorphology or inadequate downstream assay results. Additionally, assays such as immunohistochemistry for phosphorylated epitopes have historically been challenging in the context of formalin-fixed tissue, indicating that there may be room for improvement in this process that is fundamental to the practice of anatomic pathology. With these issues in mind, we studied basic formalin biochemistry to develop a novel formalin fixation protocol that involves a pre-incubation in subambient temperature formalin prior to a brief exposure to heated formalin. This new protocol is more rapid than standard protocols yet preserves histomorphology and yields tissue that is compatible with an expanded set of downstream clinical and research assays, including immunohistochemistry for phosphorylated epitopes. PMID:23349806

Chafin, David; Theiss, Abbey; Roberts, Esteban; Borlee, Grace; Otter, Michael; Baird, Geoffrey S

2013-01-18

374

[External fixation at the wrist and hand].  

PubMed

Distraction radio-metacarpal external fixation is an excellent technique for the osteosynthesis of distal radius fractures, in particular of comminuted articular fractures. The alternative is the locked palmar plate, a more demanding technique. The published literature does not allow concluding if one method is better than the other. The other main possible indications of external fixation at the wrist are comminuted fractures of the base of the thumb metacarpal, distal radius osteotomies, and wrist arthrodeses. At the hand, external minifixation is an excellent technique of osteosynthesis. Stable bone fixation is obtained, allowing early active mobilization of the fingers. The technique is especially indicated to treat open lesions or to perform lengthening, but we use also external minifixation to treat closed fractures, to perform arthrodesis or to cure non-unions, and to maintain the length of the thumb after trapeziectomy for osteoarthrosis. PMID:22458061

Schuind, F; El Kazzi, W; Cermak, K; Donkerwolcke, M; Burny, F

2011-01-01

375

Transarticular screw fixation using neuronavigation: Technique  

PubMed Central

Background: Transarticular screw placement needs highly accurate imaging. We assess the efficacy and accuracy of C1-C2 transarticular screw fixation using neuronavigation and also cast a technical note on the procedure. Materials and Methods: This study included a total of nine patients who underwent transarticular screw fixation using the neuronavigation system. A total of 15 screws were placed. All patients underwent postoperative CT scan with 3-Dimensional (3-D) reconstruction to check for the accuracy of implantation. Results: One patient had encroachment of the transverse foramen but there was no vertebral artery injury. There were no clinical complications or adverse sequelae. Conclusion: Neuronavigation is extremely helpful in C1-C2 transarticular screw fixation and gives excellent accuracy.

Dwarakanath, Srinivas; Suri, Ashish; Sharma, Bhavani Shankar

2007-01-01

376

LCP external fixation - External application of an internal fixator: two cases and a review of the literature  

PubMed Central

The locking compression plate (LCP) is an angle-stable fixator intended for intracorporeal application. In selected cases, it can be applied externally in an extracorporeal location to function as a monolateral external fixator. We describe one patient with Schatzker V tibial plateau fracture and one patient with Gustillo IIIB open tibia shaft fracture treated initially with traditional external fixation for whom exchange fixation with externally applied LCPs was performed. The first case went on to bony union while the second case required bone grafting for delayed union. Both patients found that the LCP external fixators facilitated mobilization and were more manageable and aesthetically acceptable than traditional bar-Schanz pin fixators.

2010-01-01

377

STUDIES ON COMPLEMENT FIXATION IN TUBERCULOSIS. III  

PubMed Central

The prolonged extraction of the tubercle bacillus with boiling ethyl alcohol, followed by one or more reprecipitations by chilling the hot alcoholic solution, easily yields a preparation very active as antigen in the complement fixation reaction. This preparation gives a precipitation reaction with high dilution of the normal blood serum of a number of species. The precipitation reaction presents as a peculiar feature a very long pro-zone and is further dependent on a preceding heat treatment of the serum for its demonstration. Occurring as a reaction of normal serum, the reaction is apparently not influenced by immunization sufficient to develop moderate specific complement fixation reactions.

Lewis, Paul A.

1927-01-01

378

Nitrogen fixation in the activated sludge treatment of thermomechanical pulping wastewater: effect of dissolved oxygen  

Microsoft Academic Search

N-ViroTech, a novel technology which selects for nitrogen-fixing bacteria as the bacteria primarily responsible for carbon removal, has been developed to treat nutrient limited wastewaters to a high quality without the addition of nitrogen, and only minimal addition of phosphorus. Selection of the operating dissolved oxygen level to maximise nitrogen fixation forms a key component of the technology. Pilot scale

A. H. Slade; S. M. Anderson; B. G. Evans

379

Pod photosynthesis and seed dark CO 2 fixation support oil synthesis in developing Brassica seeds  

Microsoft Academic Search

Rate of photosynthesis and activities of photosynthetic carbon reduction cycle enzymes were determined in pods (siliqua),\\u000a whereas rate of dark CO2 fixation, oil content and activities of enzymes involved in dark CO2 metabolism were measured in seeds ofBrassica campestris L. cv. Toria at different stages of pod\\/seed development. The period between 14 and 35 days after anthesis corresponded to\\u000a active

H. R. Singal; Gurmeet Talwar; Anita Dua; Randhir Singh

1995-01-01

380

Radiation characteristics of Botryococcus braunii, Chlorococcum littorale, and Chlorella sp. used for CO 2 fixation and biofuel production  

Microsoft Academic Search

This paper reports experimental measurements of the radiation characteristics of green algae used for carbon dioxide fixation via photosynthesis. The generated biomass can be used to produce not only biofuels but also feed for animal and food supplements for human consumptions. Particular attention was paid to three widely used species namely Botryococcus braunii, Chlorella sp., and Chlorococcum littorale. Their extinction

Halil Berberoglu; Pedro S. Gomez; Laurent Pilon

2009-01-01

381

Nitrogen fixation and respiration by root nodules of Alnus rubra Bong.: Effects of temperature and oxygen concentration  

Microsoft Academic Search

Using a root nodule cuvette and a continuous flow gas exchange system, we simultaneously measured the rates of carbon dioxide evolution, oxygen uptake and acetylene reduction by nodules ofAlnus rubra. This system allowed us to measure the respiration rates of single nodules and to determine the effects of oxygen concentration and temperature on the energy cost of nitrogen fixation. Energy

Lawrence J. Winship; John D. Tjepkema

1985-01-01

382

An estimation of CO 2 fixation capacity in mangrove forest using two methods of CO 2 gas exchange and growth curve analysis  

Microsoft Academic Search

In many coastal areas of South-East Asia, attempts have been made to revive coastal ecosystem by initiating projects that\\u000a encourage planting of mangrove trees. Compared to the terrestrial trees, mangrove trees possess a higher carbon fixation capacity.\\u000a It becomes a very significant option for clean development mechanism (CDM) program. However, a reliable method to estimate\\u000a CO2 fixation capacity of mangrove

Yosuke Okimoto; Akihiro Nose; Keizo Ikeda; Sakae Agarie; Kenzo Oshima; Yutaka Tateda; Takashi Ishii; Dang D. Nhan

2008-01-01

383

21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.  

Code of Federal Regulations, 2013 CFR

...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

2013-04-01

384

Enhancement of Nitrogen Fixation with Bradyrhizobium japonicum Mutants.  

National Technical Information Service (NTIS)

The objects of the invention are: to provide improved bacterial strains for inoculating leguminous crops to increase symbiotic fixation of atmospheric nitrogen; to enhance the potential of soybeans and other leguminous plants for symbiotic fixation of atm...

L. D. Kuykendall W. J. Hunter

1989-01-01

385

Effects of Fixational Eye Movements on Retinal Ganglion Cell Responses: A Modelling Study  

PubMed Central

Visual response properties of retinal ganglion cells (GCs), the retinal output neurons, are shaped by numerous processes and interactions within the retina. In particular, amacrine cells are known to form microcircuits that affect GC responses in specific ways. So far, relatively little is known about the influence of retinal processing on GC responses under naturalistic viewing conditions, in particular in the presence of fixational eye movements. Here we used a detailed model of the mammalian retina to investigate possible effects of fixational eye movements on retinal GC activity. Populations of linear, sustained (parvocellular, PC) and nonlinear, transient (magnocellular, MC) GCs were simulated during fixation of a star-shaped stimulus, and two distinct effects were found: (1) a fading of complete wedges of the star and (2) an apparent splitting of stimulus lines. Both effects only occur in MC-cells, and an analysis shows that fading is caused by an expression of the aperture problem in retinal GCs, and the splitting effect by spatiotemporal nonlinearities in the MC-cell receptive field. These effects strongly resemble perceived instabilities during fixation of the same stimulus, and we propose that these illusions may have a retinal origin. We further suggest that in this case two parallel retinal streams send conflicting, rather than complementary, information to the higher visual system, which here leads to a dominant influence of the MC pathway. Similar situations may be common during natural vision, since retinal processing involves numerous nonlinearities.

Hennig, Matthias H.; Worgotter, Florentin

2007-01-01

386

Pelagic Nitrogen Fixation in Lake Victoria (East Africa)  

Microsoft Academic Search

Between 1994 and 1998 biological nitrogen fixation was measured using the acetylene reduction method at inshore and offshore sites on northern Lake Victoria. Rates of biological N-fixation were high and often exceeded 0.5 ?g N\\/L\\/h. Average rates of volumetric N-fixation at optimal irradiance were 8 times higher at inshore locations than in the offshore. Rates of annual areal N-fixation, modeled

Rose Mugidde; Robert E. Hecky; Len L. Hendzel; William D. Taylor

2003-01-01

387

Influence of light, temperature and salinity on dissolved organic carbon exudation rates in Zostera marina L.  

EPA Science Inventory

Seagrass carbon budgets provide valuable insight on the minimum requirements needed to maintain this valuable resource. Carbon budgets are a balance between C fixation, storage and loss rates, most of which are well characterized. However, relatively few measurements of dissolv...

388

Fixation with bioabsorbable pins in chevron bunionectomy.  

PubMed

Fixation with bioabsorbable pins in distal chevron bunionectomy reduces the inconvenience and the risk of infection associated with fixation with stainless-steel Kirschner wires, which leaves a portion of the wires protruding from the skin. However, use of bioabsorbable implants has been reported to be associated with osteolysis and formation of a sinus with a sterile discharge. We studied the outcome and complications seen with use of poly-p-dioxanone pins and those seen with use of stainless-steel Kirschner wires after chevron bunionectomy in 114 patients (144 feet). We found no difference between the treatment groups with regard to the prevalence of complications or the stability of fixation. Notably, the prevalence of osteolysis was quite similar between the treatment groups; none of the feet that had had fixation with bioabsorbable pins had formation of a sinus with a sterile discharge. We believe that bioabsorbable pins can be used reliably to fix the site of the osteotomy for a distal chevron bunionectomy without undue risk of osteolysis or other complications. PMID:9378737

Gill, L H; Martin, D F; Coumas, J M; Kiebzak, G M

1997-10-01

389

Binocular Fixation in the Newborn Baby  

ERIC Educational Resources Information Center

|Three experiments are reported in which 15 babies were presented with visual stimuli which varied in shape and distance from the eye. Results indicated that the majority of subjects binocularly fixated all three stimuli and it was concluded that the newborn baby has the basic requirements for binocular vision. (Author/GO)|

Slater, Alan M.; Findlay, John M.

1975-01-01

390

External fixation of pediatric femoral fractures.  

PubMed

Fifteen pediatric femoral fractures in 14 patients were treated with external fixation using the EBI Orthofix unilateral external fixator. The average patient age was 8.5 years (range, 3-13 years). There were 7 children with multiple injuries and 7 with isolated fractures. The average duration in the fixator was 63 days; average followup was 34 months. All 15 fractures healed without additional operative intervention. Average angulation at the fracture site was 4.4 degrees in the anteroposterior plane (range, 0 degrees-10 degrees) and 4.6 degrees in the lateral plane (range, 0 degrees-11 degrees). There were 5 pin tract infections, all of which resolved with systemic antibiotics. There was 1 case of refracture in a boy with muscular dystrophy. Ten patients had clinically equal leg lengths, 3 patients had < 1 cm of inequality, and 1 patient had a 1.5 cm discrepancy. External fixation is a well-proven technique for managing pediatric femoral fractures in the child with multiple injuries. It is also an effective means of treating isolated femoral fractures in the pediatric population. PMID:7671516

Davis, T J; Topping, R E; Blanco, J S

1995-09-01

391

Design and other types of fixation  

Microsoft Academic Search

Design educators often comment on the difficulties that result from a premature commitment by students to a solution to a design problem. Similarly practitioners can find it difficult to move away from an idea they have developed or precedents in a field. In the psychology of problem solving this effect is called functional fixedness or fixation. It is not surprising

A. Terry Purcell; John S. Gero

1996-01-01

392

Postmortem inflation and fixation of human lungs  

PubMed Central

Wright, B. M., Slavin, G., Kreel, L., Callan, K., and Sandin, Brenda (1974).Thorax, 29, 189-194. Postmortem inflation and fixation of human lungs. A method of fixing lungs by inflating them with heated formalin vapour is described. This method facilitates postmortem correlations between radiographic and histological appearances. Images

Wright, B. M.; Slavin, G.; Kreel, L.; Callan, K.; Sandin, Brenda

1974-01-01

393

Associative Nitrogen Fixation in Lowland Rice  

Microsoft Academic Search

Nitrogen (N), a most limiting nutrient, is the input required in the largest quantity for lowland rice production. The concerns on N economy and efficiency and its impact on environment have renewed interest in exploring alternative or supplementary N source for sustainable agriculture. Several studies have indicated the existence of significant rice genotypic differences in N2 fixation stimulating traits (NFS).

Raj K Shrestha; Surya L Maskey

2010-01-01

394

New means in spinal pedicle hook fixation  

Microsoft Academic Search

Pedicle hooks which are used as an anchorage for posterior spinal instrumentation may be subjected to considerable three-dimensional forces. In order to achieve stronger attachment to the implantation site, hooks using screws for additional fixation have been developed. The failure loads and mechanisms of three such devices have been experimentally determined on human thoracic vertebrae: the Universal Spine System (USS)

U. Berlemann; P. Cripton; L.-P. Nolte; K. Lippuner; F. Schläpfer

1995-01-01

395

Aerobic nitrogen fixation by Lyngbya sp., a marine tropical cyanobacterium  

Microsoft Academic Search

Lyngbya majuscula, a frond-forming, non-heterocystous cyanobacterium found in the sublittoral zone off Oahu, Hawaii, is capable of high rates of aerobic nitrogen fixation in the light but incapable of nitrogen fixation in the dark. L. majuscula differs therefore from heterocystous Calothrix spp., which are found in the same habitat and are capable of N2 fixation in the dark.

Keith Jones

1990-01-01

396

Breding common bean for improved biological nitrogen fixation  

Microsoft Academic Search

Common bean (Phaseolus vulgaris L.), which is an important food crop in the Americas, Africa and Asia, usually is thought to fix only small amounts of atmospheric nitrogen. However, field data indicate considerable genetic variability for total N2 fixation and traits associated with fixation. Studies have shown that selection to increase N2 fixation will be successful if: (1) discriminating traits

F. A. Bliss

1993-01-01

397

Measurement of asymbiotic N 2 fixation in Australian agriculture  

Microsoft Academic Search

A wide range of bacteria capable of nitrogen fixation (free-living and associative) can be found in all agricultural soils across Australia, however measurement of their effectiveness in N2 fixation has proved to be problematic because rates are low compared to symbiotic systems and quantitative methodologies barely adequate. It is generally believed that associative N2 fixation rates may be greater than

Murray Unkovich; Jeff Baldock

2008-01-01

398

The biomechanics of wire fixation in the Ilizarov system  

Microsoft Academic Search

The purpose of this study was to establish the optimal fixation of tensioned wires to the frame construct in the Ilizarov system. The usual torque to which the fixation bolts were tightened in clinical practice was established by serial testing of orthopaedic surgeons’ work in our unit.The force required to produce wire slippage from the different types of wire fixation

M. M. Mullins; A. W. Davidson; David Goodier; M. Barry

2003-01-01

399

Fixation stability and saccadic latency in e elite shooters  

Microsoft Academic Search

This study tested the hypothesis that elementary visuo-motor functions involved in visual scanning, as measured by fixation and saccadic tasks, are better in a group ofhigh-level clay target shooters ( N ¼ 7) than in a control group (N ¼ 8). In the fixation task, subject were told to keep fixation as still as possible on a target for 1

Francesco Di Russo; Sabrina Pitzalis; Donatella Spinelli

2003-01-01

400

Microarray and bioinformatic analyses suggest models for carbon metabolism in the autotroph Acidithiobacillus ferrooxidans  

SciTech Connect

Acidithiobacillus ferrooxidans is a chemolithoautotrophic bacterium that uses iron or sulfur as an energy and electron source. Bioinformatic analysis was used to identify putative genes and potential metabolic pathways involved in CO2 fixation, 2P-glycolate detoxification, carboxysome formation and glycogen utilization in At. ferrooxidans. Microarray transcript profiling was carried out to compare the relative expression of the predicted genes of these pathways when the microorganism was grown in the presence of iron versus sulfur. Several gene expression patterns were confirmed by real-time PCR. Genes for each of the above predicted pathways were found to be organized into discrete clusters. Clusters exhibited differential gene expression depending on the presence of iron or sulfur in the medium. Concordance of gene expression within each cluster, suggested that they are operons Most notably, clusters of genes predicted to be involved in CO2 fixation, carboxysome formation, 2P-glycolate detoxification and glycogen biosynthesis were up-regulated in sulfur medium, whereas genes involved in glycogen utilization were preferentially expressed in iron medium. These results can be explained in terms of models of gene regulation that suggest how A. ferrooxidans can adjust its central carbon management to respond to changing environmental conditions.

C. Appia-ayme; R. Quatrini; Y. Denis; F. Denizot; S. Silver; F. Roberto; F. Veloso; J. Valdes; J. P. Cardenas; M. Esparza; O. Orellana; E. Jedlicki; V. Bonnefoy; D. Holmes

2006-09-01