These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Improving Carbon Fixation Pathways  

PubMed Central

A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that alternative pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials. PMID:22647231

Ducat, Daniel C.

2012-01-01

2

MICROBIOLOGY: A Fifth Pathway of Carbon Fixation  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Genome sequence analyses and enzymatic studies reveal a novel CO2 fixation cycle in some autotrophic archaea. Autotrophs are organisms that can grow using carbon dioxide (CO2) as their sole source of carbon. Four mechanisms are known by which autotrophic organisms fix carbon. Berg et al. describe a fifth autotrophic CO2 fixation pathway in archaea that may have been used by some of the earliest organisms on Earth.

Rudolf K. Thauer (Max Planck Institute for Terrestrial Microbiology;)

2007-12-14

3

Widespread Occurrence of Two Carbon Fixation Pathways in Tubeworm Endosymbionts: Lessons from Hydrothermal Vent Associated Tubeworms from the Mediterranean Sea  

PubMed Central

Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL – the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat. PMID:23248622

Thiel, Vera; Hugler, Michael; Blumel, Martina; Baumann, Heike I.; Gartner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schonberg, Dieter; Petersen, Sven; Cowart, Dominique A.; Fisher, Charles R.; Imhoff, Johannes F.

2012-01-01

4

Potential role of multiple carbon fixation pathways during lipid accumulation in Phaeodactylum tricornutum  

PubMed Central

Background Phaeodactylum tricornutum is a unicellular diatom in the class Bacillariophyceae. The full genome has been sequenced (<30?Mb), and approximately 20 to 30% triacylglyceride (TAG) accumulation on a dry cell basis has been reported under different growth conditions. To elucidate P. tricornutum gene expression profiles during nutrient-deprivation and lipid-accumulation, cell cultures were grown with a nitrate to phosphate ratio of 20:1 (N:P) and whole-genome transcripts were monitored over time via RNA-sequence determination. Results The specific Nile Red (NR) fluorescence (NR fluorescence per cell) increased over time; however, the increase in NR fluorescence was initiated before external nitrate was completely exhausted. Exogenous phosphate was depleted before nitrate, and these results indicated that the depletion of exogenous phosphate might be an early trigger for lipid accumulation that is magnified upon nitrate depletion. As expected, many of the genes associated with nitrate and phosphate utilization were up-expressed. The diatom-specific cyclins cyc7 and cyc10 were down-expressed during the nutrient-deplete state, and cyclin B1 was up-expressed during lipid-accumulation after growth cessation. While many of the genes associated with the C3 pathway for photosynthetic carbon reduction were not significantly altered, genes involved in a putative C4 pathway for photosynthetic carbon assimilation were up-expressed as the cells depleted nitrate, phosphate, and exogenous dissolved inorganic carbon (DIC) levels. P. tricornutum has multiple, putative carbonic anhydrases, but only two were significantly up-expressed (2-fold and 4-fold) at the last time point when exogenous DIC levels had increased after the cessation of growth. Alternative pathways that could utilize HCO3- were also suggested by the gene expression profiles (e.g., putative propionyl-CoA and methylmalonyl-CoA decarboxylases). Conclusions The results indicate that P. tricornutum continued carbon dioxide reduction when population growth was arrested and different carbon-concentrating mechanisms were used dependent upon exogenous DIC levels. Based upon overall low gene expression levels for fatty acid synthesis, the results also suggest that the build-up of precursors to the acetyl-CoA carboxylases may play a more significant role in TAG synthesis rather than the actual enzyme levels of acetyl-CoA carboxylases per se. The presented insights into the types and timing of cellular responses to inorganic carbon will help maximize photoautotrophic carbon flow to lipid accumulation. PMID:22672912

2012-01-01

5

CARBON DIOXIDE FIXATION.  

SciTech Connect

Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO{sub 2} conversion. Recent achievements in the efficiency of solar energy conversion and in catalysis suggest that this approach holds a great deal of promise for contributing to future needs for fuels and chemicals.

FUJITA,E.

2000-01-12

6

Structural studies of metalloenzyme complexes in acetogenic carbon fixation  

E-print Network

Acetogenic bacteria use the Wood-Ljungdahl carbon fixation pathway to produce cellular carbon from CO?. This process requires several metalloenzymes that employ transition metals such as iron, nickel, and cobalt towards ...

Kung, Yan

2011-01-01

7

Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway  

PubMed Central

The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73°C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA ?-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula. PMID:24532060

Hawkins, Aaron B.; Adams, Michael W. W.

2014-01-01

8

Beyond the Calvin cycle: autotrophic carbon fixation in the ocean.  

PubMed

Organisms capable of autotrophic metabolism assimilate inorganic carbon into organic carbon. They form an integral part of ecosystems by making an otherwise unavailable form of carbon available to other organisms, a central component of the global carbon cycle. For many years, the doctrine prevailed that the Calvin-Benson-Bassham (CBB) cycle is the only biochemical autotrophic CO2 fixation pathway of significance in the ocean. However, ecological, biochemical, and genomic studies carried out over the last decade have not only elucidated new pathways but also shown that autotrophic carbon fixation via pathways other than the CBB cycle can be significant. This has ramifications for our understanding of the carbon cycle and energy flow in the ocean. Here, we review the recent discoveries in the field of autotrophic carbon fixation, including the biochemistry and evolution of the different pathways, as well as their ecological relevance in various oceanic ecosystems. PMID:21329206

Hügler, Michael; Sievert, Stefan M

2011-01-01

9

Evidence of Carbon Fixation Pathway in a Bacterium from Candidate Phylum SBR1093 Revealed with Genomic Analysis  

PubMed Central

Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30?50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30?80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere. PMID:25310003

Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

2014-01-01

10

The emergence and early evolution of biological carbon-fixation.  

PubMed

The fixation of CO? into living matter sustains all life on Earth, and embeds the biosphere within geochemistry. The six known chemical pathways used by extant organisms for this function are recognized to have overlaps, but their evolution is incompletely understood. Here we reconstruct the complete early evolutionary history of biological carbon-fixation, relating all modern pathways to a single ancestral form. We find that innovations in carbon-fixation were the foundation for most major early divergences in the tree of life. These findings are based on a novel method that fully integrates metabolic and phylogenetic constraints. Comparing gene-profiles across the metabolic cores of deep-branching organisms and requiring that they are capable of synthesizing all their biomass components leads to the surprising conclusion that the most common form for deep-branching autotrophic carbon-fixation combines two disconnected sub-networks, each supplying carbon to distinct biomass components. One of these is a linear folate-based pathway of CO? reduction previously only recognized as a fixation route in the complete Wood-Ljungdahl pathway, but which more generally may exclude the final step of synthesizing acetyl-CoA. Using metabolic constraints we then reconstruct a "phylometabolic" tree with a high degree of parsimony that traces the evolution of complete carbon-fixation pathways, and has a clear structure down to the root. This tree requires few instances of lateral gene transfer or convergence, and instead suggests a simple evolutionary dynamic in which all divergences have primary environmental causes. Energy optimization and oxygen toxicity are the two strongest forces of selection. The root of this tree combines the reductive citric acid cycle and the Wood-Ljungdahl pathway into a single connected network. This linked network lacks the selective optimization of modern fixation pathways but its redundancy leads to a more robust topology, making it more plausible than any modern pathway as a primitive universal ancestral form. PMID:22536150

Braakman, Rogier; Smith, Eric

2012-01-01

11

De Novo Transcriptome Analysis of an Aerial Microalga Trentepohlia jolithus: Pathway Description and Gene Discovery for Carbon Fixation and Carotenoid Biosynthesis  

PubMed Central

Background Algae in the order Trentepohliales have a broad geographic distribution and are generally characterized by the presence of abundant ?-carotene. The many monographs published to date have mainly focused on their morphology, taxonomy, phylogeny, distribution and reproduction; molecular studies of this order are still rare. High-throughput RNA sequencing (RNA-Seq) technology provides a powerful and efficient method for transcript analysis and gene discovery in Trentepohlia jolithus. Methods/Principal Findings Illumina HiSeq 2000 sequencing generated 55,007,830 Illumina PE raw reads, which were assembled into 41,328 assembled unigenes. Based on NR annotation, 53.28% of the unigenes (22,018) could be assigned to gene ontology classes with 54 subcategories and 161,451 functional terms. A total of 26,217 (63.44%) assembled unigenes were mapped to 128 KEGG pathways. Furthermore, a set of 5,798 SSRs in 5,206 unigenes and 131,478 putative SNPs were identified. Moreover, the fact that all of the C4 photosynthesis genes exist in T. jolithus suggests a complex carbon acquisition and fixation system. Similarities and differences between T. jolithus and other algae in carotenoid biosynthesis are also described in depth. Conclusions/Significance This is the first broad transcriptome survey for T. jolithus, increasing the amount of molecular data available for the class Ulvophyceae. As well as providing resources for functional genomics studies, the functional genes and putative pathways identified here will contribute to a better understanding of carbon fixation and fatty acid and carotenoid biosynthesis in T. jolithus. PMID:25254555

Li, Qianqian; Liu, Jianguo; Zhang, Litao; Liu, Qian

2014-01-01

12

ORIGINAL ARTICLE Sulfur oxidizers dominate carbon fixation  

E-print Network

ORIGINAL ARTICLE Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system

Hansell, Dennis

13

Carbon cycling: Molecular regulation of photosynthetic carbon fixation  

Microsoft Academic Search

Photosynthetic carbon fixation by phytoplankton is a key component of the global carbon cycle. Our understanding of the types of picoplankton and ultraphytoplankton involved in this process is evolving. However, mechanisms of regulation of photosynthetic carbon fixation in the oceans are poorly understood. All phytoplankton fix CO2 by reductive carboxylation employing the enzyme ribulose bisphosphate carboxylase (RuBPCase). The sequence of

J. H. Paul

1996-01-01

14

Efficient CO2 Fixation Pathways: Energy Plant: High Efficiency Photosynthetic Organisms  

SciTech Connect

PETRO Project: UCLA is redesigning the carbon fixation pathways of plants to make them more efficient at capturing the energy in sunlight. Carbon fixation is the key process that plants use to convert carbon dioxide (CO2) from the atmosphere into higher energy molecules (such as sugars) using energy from the sun. UCLA is addressing the inefficiency of the process through an alternative biochemical pathway that uses 50% less energy than the pathway used by all land plants. In addition, instead of producing sugars, UCLA’s designer pathway will produce pyruvate, the precursor of choice for a wide variety of liquid fuels. Theoretically, the new biochemical pathway will allow a plant to capture 200% as much CO2 using the same amount of light. The pathways will first be tested on model photosynthetic organisms and later incorporated into other plants, thus dramatically improving the productivity of both food and fuel crops.

None

2012-01-01

15

Expression of the sub-pathways of the Chloroflexus aurantiacus 3-hydroxypropionate carbon fixation bicycle in E. coli: Toward horizontal transfer of autotrophic growth.  

PubMed

The 3-hydroxypropionate (3-HPA) bicycle is unique among CO2-fixing systems in that none of its enzymes appear to be affected by oxygen. Moreover, the bicycle includes a number of enzymes that produce novel intermediates of biotechnological interest, and the CO2-fixing steps in this pathway are relatively rapid. We expressed portions of the 3-HPA bicycle in a heterologous organism, E. coli K12. We subdivided the 3-HPA bicycle into four sub-pathways: (1) synthesis of propionyl-CoA from acetyl-CoA, (2) synthesis of succinate from propionyl-CoA, (3) glyoxylate production and regeneration of acetyl-CoA, and (4) assimilation of glyoxylate and propionyl-CoA to form pyruvate and regenerate acetyl-CoA. We expressed the novel enzymes of the 3-HPA bicycle in operon form and used phenotypic tests for activity. Sub-pathway 1 activated a propionate-specific biosensor. Sub-pathway 2, found in non-CO2-fixing bacteria, was reassembled in E. coli using genes from diverse sources. Sub-pathway 3, operating in reverse, generated succinyl-CoA sufficient to rescue a sucAD(-) double mutant of its diaminopimelic acid (DAP) auxotrophy. Sub-pathway 4 was able to reduce the toxicity of propionate and allow propionate to contribute to cell biomass in a prpC(-)(2 methylcitrate synthase) mutant strain. These results indicate that all of the sub-pathways of the 3-HPA bicycle can function to some extent in vivo in a heterologous organism, as indicated by growth tests. Overexpression of certain enzymes was deleterious to cell growth, and, in particular, expression of MMC-CoA lyase caused a mucoid phenotype. These results have implications for metabolic engineering and for bacterial evolution through horizontal gene transfer. PMID:23376595

Mattozzi, Matthew d; Ziesack, Marika; Voges, Mathias J; Silver, Pamela A; Way, Jeffrey C

2013-03-01

16

Barley mutants with defects in photosynthetic carbon dioxide fixation  

Microsoft Academic Search

Carbon dioxide fixation by leaf pieces from 12 different chloroplast mutants and wild type barley has been analysed. In the\\u000a light leaf pieces from wild type seedlings fixed14CO2 at a rate of approximately 80 ?moles per gram fresh weight per hour, or 40 ?moles per mg chlorophyll per hour. Fixation of14CO2 in darkness occurred at one to four per cent

Bodil Carlsen

1977-01-01

17

Acetogenesis and the Wood-Ljungdahl Pathway of CO2 Fixation  

PubMed Central

I. Summary Conceptually, the simplest way to synthesize an organic molecule is to construct it one carbon at a time. The Wood-Ljungdahl pathway of CO2 fixation involves this type of stepwise process. The biochemical events that underlie the condensation of two one-carbon units to form the two-carbon compound, acetate, have intrigued chemists, biochemists, and microbiologists for many decades. We begin this review with a description of the biology of acetogenesis. Then, we provide a short history of the important discoveries that have led to the identification of the key components and steps of this usual mechanism of CO and CO2 fixation. In this historical perspective, we have included reflections that hopefully will sketch the landscape of the controversies, hypotheses, and opinions that led to the key experiments and discoveries. We then describe the properties of the genes and enzymes involved in the pathway and conclude with a section describing some major questions that remain unanswered. PMID:18801467

Ragsdale, Stephen W.; Pierce, Elizabeth

2008-01-01

18

Influence of nitrate feeding on carbon dioxide fixation by microalgae.  

PubMed

In this study, the effects of nitrate feeding on microalgal growth and associated CO2 fixation were evaluated, as a strategy to enhance carbon fixation by increasing the duration of the exponential phase of cell growth in the batch operation of a photobioreactor. Two species of green algae, Chlorella and Scenedesmus, and two species of cyanobacteria, Microcystis ichthyoblabe and Microcystis aeruginosa, were used after adaptation to a 15% (v/v) CO2 environment. In the absence of nitrate feeding, nitrate concentrations declined rapidly and soon became a limiting factor. Nitrate feeding, administered in fed-batch mode to maintain 15-20 ppm of NO3-N, allowed for an extension of the exponential growth phase by more than 3 days, as well as a higher cell density, which subsequently resulted in an increase in photoautotrophic carbon fixation. The increases in the carbon fixation rate were in the ranges of 56.1-56.6% for the green algae, and between 68.2-68.8% for the cyanobacteria. The results indicated that intermittent nitrate feeding was a viable strategy for the augmentation of fixation productivity, and may thus be effectively applied as a substitute for conventional medium change, which has traditionally been employed in order to prolong the active growth duration. PMID:17114109

Jin, Hai-Feng; Lim, Byung-Ran; Lee, Kisay

2006-01-01

19

Carbon Dioxide Fixation in Cultured Animal Cells  

E-print Network

H the activity of adenosine tri­ phosphatase was Increased by carbon dioxide. Also, the same investigators found that increasing the carbon dioxide concentration from 10 to 1*0 mM at constant pH stimulated the conversion of acetate into fatty acids four to six... and Cortisol were present to­ gether (I9li, 70 ) . Paradoxically, tryptophan and quinolinic acid increased the in vitro assayable activity of PEP-CK (259, 68). Upon extraction, the inhibition appears to dissociate from the enzyme, leaving it in a metal...

Kyner, David Smith

1969-01-01

20

Carbon dioxide fixation by detached cereal caryopses  

SciTech Connect

Immature detached cereal caryposes from barley (Hordeum vulgare L. var distichum cv Midas) and wheat (Triticum aestivum L. cv Sicco) were shown to be capable of fixing externally supplied {sup 14}CO{sub 2} in the light or dark. Green cross cells and the testa contained the majority of the {sup 14}C-labeled material. Some {sup 14}C-labeled material was also found in the outer, or transparent, layer and in the endosperm/embryo fraction. More {sup 14}C was recovered from caryopses when they were incubated in {sup 14}CO{sub 2} without the transparent layer, thus suggesting that this layer is a barrier to the uptake of CO{sub 2}. In all cases, significant amounts of {sup 14}C-labeled material were found in caryopses after dark incubation with {sup 14}CO{sub 2}. Interestingly, CO{sub 2} fixation in the chlorophyll-less mutant Albino lemma was significantly greater in the light than in the dark. The results indicate that intact caryopses have the ability to translocate {sup 14}C-labeled assimilate derived from external CO{sub 2} to the endosperm/embryo. Carboxylating activity in the transparent layer appears to be confined to phosphoenolpyruvate carboxylase activity but that in the chloroplast-containing cross-cells may be accounted for by both ribulose-1,5-bisphosphate carboxylase-oxygenase and phosphoenolpyruvate carboxylase activity. Depending on a number of assumptions, the amount of CO{sub 2} fixed is sufficient to account for about 2% of the weight of starch found in the mature caryposis.

Watson, P.A.; Duffus, C.M. (Univ. of Edinburgh (Scotland))

1988-06-01

21

Isocyanate- and phosgene-free routes to polyfunctional cyclic carbonates and green polyurethanes by fixation of carbon dioxide.  

PubMed

The catalytic chemical fixation of carbon dioxide by carbonation of oxiranes, oxetanes, and polyols represents a very versatile green chemistry route to environmentally benign di- and polyfunctional cyclic carbonates as intermediates for the formation of non-isocyanate poly-urethane (NIPU). Two synthetic pathways lead to NIPU thermoplastics and thermosets: i) polycondensation of diacarbamates or acyclic dicarbonates with diols or diamines, respectively, and ii) polyaddition by ring-opening polymerization of di- and polyfunctional cyclic carbonates with di- and polyamines. The absence of hazardous and highly moisture-sensitive isocyanates as intermediates eliminates the need for special safety precautions, drying and handling procedures. Incorporated into polymer backbones and side chains, carbonate groups enable facile tailoring of a great variety of urethane-functional polymers. As compared with conventional polyurethanes, ring-opening polymerization of polyfunctional cyclic carbonates affords polyhydroxyurethanes with unconventional architectures including NIPUs containing carbohydrate segments. NIPU/epoxy hybrid coatings can be applied on wet surfaces and exhibit improved adhesion, thermal stability and wear resistance. Combining chemical with biological carbon dioxide fixation affords 100% bio-based NIPUs derived from plant oils, terpenes, carbohydrates, and bio polyols. Biocompatible and biodegradable NIPU as well as NIPU biocomposites hold great promise for biomedical applications. PMID:24979310

Blattmann, Hannes; Fleischer, Maria; Bähr, Moritz; Mülhaupt, Rolf

2014-07-01

22

Pyruvate Is Synthesized by Two Pathways in Pea Bacteroids with Different Efficiencies for Nitrogen Fixation?  

PubMed Central

Nitrogen fixation in legume bacteroids is energized by the metabolism of dicarboxylic acids, which requires their oxidation to both oxaloacetate and pyruvate. In alfalfa bacteroids, production of pyruvate requires NAD+ malic enzyme (Dme) but not NADP+ malic enzyme (Tme). However, we show that Rhizobium leguminosarum has two pathways for pyruvate formation from dicarboxylates catalyzed by Dme and by the combined activities of phosphoenolpyruvate (PEP) carboxykinase (PckA) and pyruvate kinase (PykA). Both pathways enable N2 fixation, but the PckA/PykA pathway supports N2 fixation at only 60% of that for Dme. Double mutants of dme and pckA/pykA did not fix N2. Furthermore, dme pykA double mutants did not grow on dicarboxylates, showing that they are the only pathways for the production of pyruvate from dicarboxylates normally expressed. PckA is not expressed in alfalfa bacteroids, resulting in an obligate requirement for Dme for pyruvate formation and N2 fixation. When PckA was expressed from a constitutive nptII promoter in alfalfa dme bacteroids, acetylene was reduced at 30% of the wild-type rate, although this level was insufficient to prevent nitrogen starvation. Dme has N-terminal, malic enzyme (Me), and C-terminal phosphotransacetylase (Pta) domains. Deleting the Pta domain increased the peak acetylene reduction rate in 4-week-old pea plants to 140 to 150% of the wild-type rate, and this was accompanied by increased nodule mass. Plants infected with Pta deletion mutants did not have increased dry weight, demonstrating that there is not a sustained change in nitrogen fixation throughout growth. This indicates a complex relationship between pyruvate synthesis in bacteroids, nitrogen fixation, and plant growth. PMID:20675477

Mulley, Geraldine; Lopez-Gomez, Miguel; Zhang, Ye; Terpolilli, Jason; Prell, Jurgen; Finan, Turlough; Poole, Philip

2010-01-01

23

Bioengineering of carbon fixation, biofuels, and biochemicals in cyanobacteria and plants.  

PubMed

Development of sustainable energy is a pivotal step towards solutions for today's global challenges, including mitigating the progression of climate change and reducing dependence on fossil fuels. Biofuels derived from agricultural crops have already been commercialized. However the impacts on environmental sustainability and food supply have raised ethical questions about the current practices. Cyanobacteria have attracted interest as an alternative means for sustainable energy productions. Being aquatic photoautotrophs they can be cultivated in non-arable lands and do not compete for land for food production. Their rich genetic resources offer means to engineer metabolic pathways for synthesis of valuable bio-based products. Currently the major obstacle in industrial-scale exploitation of cyanobacteria as the economically sustainable production hosts is low yields. Much effort has been made to improve the carbon fixation and manipulating the carbon allocation in cyanobacteria and their evolutionary photosynthetic relatives, algae and plants. This review aims at providing an overview of the recent progress in the bioengineering of carbon fixation and allocation in cyanobacteria; wherever relevant, the progress made in plants and algae is also discussed as an inspiration for future application in cyanobacteria. PMID:22677697

Rosgaard, Lisa; de Porcellinis, Alice Jara; Jacobsen, Jacob H; Frigaard, Niels-Ulrik; Sakuragi, Yumiko

2012-11-30

24

Carbon Dioxide Fixation by Metallosphaera yellowstonensis and Acidothermophilic Iron-Oxidizing Microbial Communities from Yellowstone National Park  

PubMed Central

The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope (13CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ?2.5‰. Analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

Jennings, Ryan M.; Whitmore, Laura M.; Moran, James J.

2014-01-01

25

Carbon dioxide fixation and lipid storage by Scenedesmus obtusiusculus.  

PubMed

An indigenous microalga was isolated from the springs in Cuatro Ciénegas, México. It was morphologically identified as Scenedesmus obtusiusculus and cultivated in bubble-column photobioreactors in batch operation mode. This microalga grows at 10% of carbon dioxide (CO(2)) showing a maximum CO(2) fixation rate of 970gm(-3)d(-1). The microalga, without any nutrient limitation, contained 20% of nonpolar lipids with a biomass productivity of 500gm(-3)d(-1) and a maximum biomass concentration of around 6,000gm(-3) at 5% CO(2) and irradiance of 134?molm(-2)s(-1). Furthermore, it was observed that the microalga stored 55.7% of nonpolar lipids when 5% CO(2) was fed at 0.8vvm and 54.7?molm(-2)s(-1) under nitrogen starvation. The lipid profile included C16:0, C18:0, C18:1n9t, C18:1n9c, C18:3n6 with a productivity of 200g lipid m(-3)d(-1). Therefore, the microalga may have biotechnological potential producing lipids for biodiesel. PMID:23334023

Toledo-Cervantes, Alma; Morales, Marcia; Novelo, Eberto; Revah, Sergio

2013-02-01

26

Dark inorganic carbon fixation sustains the functioning of benthic deep-sea ecosystems  

NASA Astrophysics Data System (ADS)

studies have provided evidence that dark inorganic carbon fixation is an important process for the functioning of the ocean interior. However, its quantitative relevance and ecological significance in benthic deep-sea ecosystems remain unknown. We investigated the rates of inorganic carbon fixation together with prokaryotic abundance, biomass, assemblage composition, and heterotrophic carbon production in surface sediments of different benthic deep-sea systems along the Iberian margin (northeastern Atlantic Ocean) and in the Mediterranean Sea. Inorganic carbon fixation rates in these surface deep-sea sediments did not show clear depth-related patterns, and, on average, they accounted for 19% of the total heterotrophic biomass production. The incorporation rates of inorganic carbon were significantly related to the abundance of total Archaea (as determined by catalyzed reporter deposition fluorescence in situ hybridization) and completely inhibited using an inhibitor of archaeal metabolism, N1-guanyl-1,7-diaminoheptane. This suggests a major role of the archaeal assemblages in inorganic carbon fixation. We also show that benthic archaeal assemblages contribute approximately 25% of the total 3H-leucine incorporation. Inorganic carbon fixation in surface deep-sea sediments appears to be dependent not only upon chemosynthetic processes but also on heterotrophic/mixotrophic metabolism, as suggested by estimates of the chemolithotrophic energy requirements and the enhanced inorganic carbon fixation due to the increase in the availability of organic trophic resources. Overall, our data suggest that archaeal assemblages of surface deep-sea sediments are responsible for the high rates of inorganic carbon incorporation and thereby sustain the functioning of the food webs as well as influence the carbon cycling of benthic deep-sea ecosystems.

Molari, Massimiliano; Manini, Elena; Dell'Anno, Antonio

2013-01-01

27

[Regulation of alternative CO[sub 2] fixation pathways in procaryotic and eucaryotic photosynthetic organisms  

SciTech Connect

The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.

Not Available

1992-01-01

28

Carbon Fixation and Partitioning in Coffee Seedlings Infested with Pratylenchuscoffeae  

Microsoft Academic Search

The objective was to study CO2 fixation and photoassimilate partition in coffee (Coffea arabica) seedlings infested with the lesion nematode Pratylenchus coffeae. Seedlings infested with 0, 1000 and 8000 Pratylenchus coffeae nematodes were exposed to 14CO2 and the incorporation and distribution of radioactivity were followed in the roots, stems and leaves. Fresh mass, pigments, soluble sugars, sucrose and specific radioactivity

Paulo Mazzafera; Roberto K. Kubo; Mário M. Inomoto

2004-01-01

29

Earth Exploration Toolbook Chapter: Visualizing Carbon Pathways  

NSDL National Science Digital Library

DATA: NASA Satellite Images TOOLS: ImageJ and Image Composite Explorer (ICE) of NASA Earth Observations (NEO). SUMMARY: Build animations of satellite data to illustrate and explore carbon pathways through the Earth system.

Dahlman, Luann; Whitmer, Ali; Caron, Bruce; Herring, David; Tschillard, Ray

30

Microbial carbon and nitrogen fixation on the surface of glaciers and ice sheets  

NASA Astrophysics Data System (ADS)

Studying the microbial sequestration of atmospheric carbon dioxide (via net autochthonous production) and nitrogen (via nitrogen fixation) into organic matter on the surface of glaciers and ice sheets is important for three main reasons. First, they can provide essential nutrients for supporting microbial ecosystems in these cold, typically nutrient-poor environments. Second, nutrients formed in the supraglacial environment may be important for sustaining hydrologically connected subglacial and downstream (e.g. fjords, near-shore marine) ecosystems. Third, organic matter produced or transformed by microbial activity can alter the albedo of ice, either directly by the production of dark pigments, or indirectly through the trapping and agglutination of dark mineral via the production of exopolysaccharides. Here, we present recent results of microbial carbon and nitrogen fixation in surface sediment (cryoconite) on Arctic and Antarctic glaciers and the Greenland Ice Sheet ablation zone. Results suggest that the fixation and recycling of autochthonous carbon in cryoconite on glaciers and ice sheets can support a significant fraction of the total microbial activity in the supraglacial environment during the ablation season. Nitrogen fixation can be important as a nitrogen source for microbial communities on both Arctic and Antarctic glaciers during the main ablation season. Nitrogen fixation could feasibly exceed precipitation as a source of nitrogen to microbial communities in debris rich zones on the margins of the Greenland Ice Sheet, aiding the colonization and subsequent 'greening' of subglacial and moraine derived debris.

Telling, J.; Anesio, A. M.; Stibal, M.; Hawkings, J.; Bellas, C. M.; Tranter, M.; Wadham, J. L.; Cook, J.; Hodson, A. J.; Yallop, M.; Barker, G.; Butler, C. E.; Fountain, A. G.; Nylen, T.; Irvine-Fynn, T. D.; Sole, A. J.; Nienow, P. W.

2012-12-01

31

Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens  

PubMed Central

Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. PMID:24762737

Feist, Adam M.; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P.; Lovley, Derek R.; Zengler, Karsten

2014-01-01

32

Carbon dioxide fixation and respiration relationships observed during closure experiments in Biosphere 2  

NASA Astrophysics Data System (ADS)

Biosphere 2 enclosed several ecosystems - ones analogous to rainforest, tropical savannah, thornscrub, desert, marsh and coral reef - and a diverse agro-ecology, with dozens of food crops, in virtual material isolation from Earth's environment. This permits a detailed examination of fixation and respiration from the continuous record of carbon dioxide concentration from sensors inside the facility. Unlike the Earth, all the ecosystems were active during sunlight hours, while phyto and soil respiration dominated nighttime hours. This resulted in fluctuations of as much as 600-700 ppm CO2 daily during days of high sunlight input. We examine the relationships between daytime fixation as driven by photosynthesis to nighttime respiration and also fixation and respiration as related to carbon dioxide concentration. Since carbon dioxide concentrations varied from near Earth ambient levels to over 3000 ppm (during low-light winter months), the response of the plant communities and impact on phytorespiration and soil respiration may be of relevance to the global climate change research community. An investigation of these dynamics will also allow the testing of models predicting the response of community metabolism to variations in sunlight and degree of previous net carbon fixation.

Nelson, Mark; Dempster, William; Allen, John P.

33

Trinuclear zinc complexes for biologically relevant ?3-oxoanion binding and carbon dioxide fixation.  

PubMed

Tremendous efforts have been made to model multinuclear zinc enzymes. Despite such efforts, it remains a challenge to design single molecules that stabilize ?3-oxoanion-bridged trinuclear zinc cores as analogues of enzymatic active sites. The conversion of carbon dioxide to carbonates is a biological process mediated by carbonic anhydrases and a natural process for large-scale carbon dioxide fixation. Here we report a trinuclear zinc scaffold for capturing biologically relevant ?3-oxoanions, such as phosphate and carbonate, and its ability to catalytically convert carbon dioxide to carbonates. Structurally characterized {Zn3(?3-PO4)} and {Zn3(?3-CO3)} cores are observed in solution by nuclear magnetic resonance and high-resolution mass spectrometry. The activity of the ?3-carbonate unit can be sterically controlled, which makes the carbon dioxide fixation cycle feasible. Our results suggest that this trinuclear zinc scaffold catalytically converts carbon dioxide to carbonates under mild conditions and provides a good model for studying oxoanion-bridged zinc cores in solution. PMID:23982347

Liu, Xiao; Du, Pingwu; Cao, Rui

2013-01-01

34

Photosynthesis in Grass Species Differing in Carbon Dioxide Fixation Pathways  

PubMed Central

Thirty-three grass species were examined in two experiments in an attempt to locate plants with photosynthetic responses to O2, CO2 compensation concentrations, and leaf anatomy intermediate to those of C3 and C4 species. Species examined included seven from the Laxa group in the Panicum genus, one of which, P. milioides Nees ex Trin., has been reported earlier to have intermediate characteristics. The species with O2-sensitive photosynthesis typical of C3 plants showed more than 37% increase in apparent photosynthesis at 2% O2 compared to 21% O2 at 25 C and 335 microliters per liter CO2, whereas in Panicum milioides, P. schenckii Hack., and P. decipiens Nees ex Trin., members of the Laxa group of Panicum, increases ranged from 25 to 30%. The remainder of the species did not respond to O2. Species with O2 responses characteristic of C3 plants exhibited CO2 compensation concentrations of 44 microliters per liter or higher at 21% O2 and 25 to 27.5 C and species characterized as O2-insensitive had values of microliters per liter or less. The CO2 compensation concentration (?) values of P. milioides, P. schenckii, and P. decipiens ranged from 10.3 to 23.3 microliters per liter. Other species of the Laxa group of Panicum exhibited O2 response and ? values of either C3 (P. laxum Sw., P. hylaeicum Mez., and P. rivulare Trin.) or C4 (P. prionitis Griseb.) plants. Leaves of species with O2 response and CO2 compensation values typical of C3 plants had poorly developed or nearly empty bundle sheath cells, and much larger distances and mesophyll cell numbers between veins than did the O2-insensitive ones. Vein spacings in P. milioides, P. schenckii, and P. decipiens ranged from 0.18 to 0.28 millimeter and mesophyll cell number between veins from 5.2 to 7.8. While these vein spacings are closer than those of most C3 grasses, two O2-sensitive species of Dactylis had vein spacings similar to these Panicums and veins in Glyceria striata, another O2-sensitive plant, were separated by only four mesophyll cells and 0.12 millimeter. Bundle sheath cells of the three intermediate Panicums contained greater quantities of organelles than are typical for C3 grasses. Images PMID:16660944

Morgan, Jack A.; Brown, R. Harold

1979-01-01

35

Autotrophic Carbon Dioxide Fixation via the Calvin-Benson-Bassham Cycle by the Denitrifying Methanotroph "Candidatus Methylomirabilis oxyfera"  

PubMed Central

Methane is an important greenhouse gas and the most abundant hydrocarbon in the Earth's atmosphere. Methanotrophic microorganisms can use methane as their sole energy source and play a crucial role in the mitigation of methane emissions in the environment. “Candidatus Methylomirabilis oxyfera” is a recently described intra-aerobic methanotroph that is assumed to use nitric oxide to generate internal oxygen to oxidize methane via the conventional aerobic pathway, including the monooxygenase reaction. Previous genome analysis has suggested that, like the verrucomicrobial methanotrophs, “Ca. Methylomirabilis oxyfera” encodes and transcribes genes for the Calvin-Benson-Bassham (CBB) cycle for carbon assimilation. Here we provide multiple independent lines of evidence for autotrophic carbon dioxide fixation by “Ca. Methylomirabilis oxyfera” via the CBB cycle. The activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO), a key enzyme of the CBB cycle, in cell extracts from an “Ca. Methylomirabilis oxyfera” enrichment culture was shown to account for up to 10% of the total methane oxidation activity. Labeling studies with whole cells in batch incubations supplied with either 13CH4 or [13C]bicarbonate revealed that “Ca. Methylomirabilis oxyfera” biomass and lipids became significantly more enriched in 13C after incubation with 13C-labeled bicarbonate (and unlabeled methane) than after incubation with 13C-labeled methane (and unlabeled bicarbonate), providing evidence for autotrophic carbon dioxide fixation. Besides this experimental approach, detailed genomic and transcriptomic analysis demonstrated an operational CBB cycle in “Ca. Methylomirabilis oxyfera.” Altogether, these results show that the CBB cycle is active and plays a major role in carbon assimilation by “Ca. Methylomirabilis oxyfera” bacteria. Our results suggest that autotrophy might be more widespread among methanotrophs than was previously assumed and implies that a methanotrophic community in the environment is not necessarily revealed by 13C-depleted lipids. PMID:24509918

Kool, Dorien M.; Jetten, Mike S. M.; Sinninghe Damste, Jaap S.; Ettwig, Katharina F.

2014-01-01

36

Slow carboxylation of Rubisco constrains the rate of carbon fixation during Antarctic phytoplankton blooms.  

PubMed

High-latitude oceans are areas of high primary production despite temperatures that are often well below the thermal optima of enzymes, including the key Calvin Cycle enzyme, Ribulose 1,5 bisphosphate carboxylase oxygenase (Rubisco). We measured carbon fixation rates, protein content and Rubisco abundance and catalytic rates during an intense diatom bloom in the Western Antarctic Peninsula (WAP) and in laboratory cultures of a psychrophilic diatom (Fragilariopsis cylindrus). At -1°C, the Rubisco turnover rate, kcat (c) , was 0.4 C s(-1) per site and the half saturation constant for CO2 was 15 ?M (vs c. 3 C s(-1) per site and 50 ?M at 20°C). To achieve high carboxylation rates, psychrophilic diatoms increased Rubisco abundance to c. 8% of biomass (vs c. 0.6% at 20°C), along with their total protein content, resulting in a low carbon : nitrogen ratio of c. 5. In psychrophilic diatoms, Rubisco must be almost fully active and near CO2 saturation to achieve carbon fixation rates observed in the WAP. Correspondingly, total protein concentrations were close to the highest ever measured in phytoplankton and likely near the maximum possible. We hypothesize that this high protein concentration, like that of Rubisco, is necessitated by slow enzyme rates, and that carbon fixation rates in the WAP are near a theoretical maximum. PMID:25283055

Young, Jodi N; Goldman, Johanna A L; Kranz, Sven A; Tortell, Philippe D; Morel, Francois M M

2015-01-01

37

Tetraphenylethylene-based phosphine: tuneable emission and carbon dioxide fixation.  

PubMed

A tetraphenylethylene-based phosphine, 1,1,2,2-tetrakis((4-diphenylphosphino)phenyl)ethylene (TPE-P4), was synthesized and showed novel aggregation-induced and mechano-responsive emission. A mixture of TPE-P4 and Ag(+) could fix atmospheric CO2in situ as carbonate ions in neutral solution to yield a rare 3D metal-organic framework with zeolite-like SOD topology, [Ag2(TPE-P4)CO3]x?nH2O (Ag-TPE-P4). Ag-TPE-P4 showed turn-on luminescence of TPE-P4, emitting bright bluish green light in the solid state. PMID:25216390

Zhang, Jianyong; Yang, Qiuli; Zhu, Yixuan; Liu, Haoliang; Chi, Zhenguo; Su, Cheng-Yong

2014-10-01

38

Chemoautotrophic carbon fixation rates and active bacterial communities in intertidal marine sediments.  

PubMed

Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, The Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m(-2) d(-1). Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)(-1), which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

Boschker, Henricus T S; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W C; Moodley, Leon

2014-01-01

39

Chemoautotrophic Carbon Fixation Rates and Active Bacterial Communities in Intertidal Marine Sediments  

PubMed Central

Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, the Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m?2 d?1. Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)?1, which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

Boschker, Henricus T. S.; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W. C.; Moodley, Leon

2014-01-01

40

Kinetics and mechanistic analysis of an extremely rapid carbon dioxide fixation reaction  

PubMed Central

Carbon dioxide may react with free or metal-bound hydroxide to afford products containing bicarbonate or carbonate, often captured as ligands bridging two or three metal sites. We report the kinetics and probable mechanism of an extremely rapid fixation reaction mediated by a planar nickel complex [NiII(NNN)(OH)]1- containing a tridentate 2,6-pyridinedicarboxamidate pincer ligand and a terminal hydroxide ligand. The minimal generalized reaction is M-OH + CO2 ? M-OCO2H; with variant M, previous rate constants are ?103 M-1 s-1 in aqueous solution. For the present bimolecular reaction, the (extrapolated) rate constant is 9.5 × 105 M-1 s-1 in N,N?-dimethylformamide at 298 K, a value within the range of kcat/KM?105–108 M-1 s-1 for carbonic anhydrase, the most efficient catalyst of CO2 fixation reactions. The enthalpy profile of the fixation reaction was calculated by density functional theory. The initial event is the formation of a weak precursor complex between the Ni-OH group and CO2, followed by insertion of a CO2 oxygen atom into the Ni-OH bond to generate a four center Ni(?2-OCO2H) transition state similar to that at the zinc site in carbonic anhydrase. Thereafter, the Ni-OH bond detaches to afford the Ni(?1-OCO2H) fragment, after which the molecule passes through a second, lower energy transition state as the bicarbonate ligand rearranges to a conformation very similar to that in the crystalline product. Theoretical values of metric parameters and activation enthalpy are in good agreement with experimental values [?H‡ = 3.2(5) kcal/mol]. PMID:21220298

Huang, Deguang; Makhlynets, Olga V.; Tan, Lay Ling; Lee, Sonny C.; Rybak-Akimova, Elena V.; Holm, R. H.

2011-01-01

41

[Regulation of alternative CO{sub 2} fixation pathways in procaryotic and eucaryotic photosynthetic organisms]. Progress report  

SciTech Connect

The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.

Not Available

1992-12-31

42

Ecological Aspects of the Distribution of Different Autotrophic CO2 Fixation Pathways?  

PubMed Central

Autotrophic CO2 fixation represents the most important biosynthetic process in biology. Besides the well-known Calvin-Benson cycle, five other totally different autotrophic mechanisms are known today. This minireview discusses the factors determining their distribution. As will be made clear, the observed diversity reflects the variety of the organisms and the ecological niches existing in nature. PMID:21216907

Berg, Ivan A.

2011-01-01

43

PH-NEUTRAL CONCRETE FOR ATTACHED MICROALGAE AND ENHANCED CARBON DIOXIDE FIXATION - PHASE I  

SciTech Connect

The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SC-CO {sub 2})-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resistance) cement-based products. SC-CO{sub 2} can rapidly convert the calcium hydroxide in cured cement to calcium carbonate, which increases the density and unconfined compressive strength in the treated region. In cured concrete, this treated region is typically a several-mm thick layer (generally <{approx}5mm, unless treatment time is excessive). However, we have found that by treating the entire cement matrix with SC-CO{sub 2} as part of the curing process, we can carbonate it rapidly, regardless of the thickness. By ''rapidly'' we mean simultaneous carbonation/curing in < 5 ks even for large cement forms, compared to typical carbonation times of several days or even years at low pressures. Carbonation changes the pH in the treated region from {approx}13 to {approx}8, almost exactly compatible with seawater. Therefore the leaching rates from these cements is reduced. These cement improvements are directed to the development of strong but thin artificial reefs, to which can be attached microalgae used for the enhanced fixation of CO{sub 2}. It is shown below that attached microalgae, as algal beds or reefs, are more efficient for CO{sub 2} fixation by a factor of 20, compared to the open ocean on an area basis. We have performed preliminary tests of the pH-neutral cements of our invention for attachment of microalgae populations. We have found pH-neutral materials which attach microalgae readily. These include silica-enriched (pozzolanic) cements, blast-furnace slags and fly ash, which are also silica-rich. We have already developed technology to simultaneously foam, carbonate and cure the cements; this foaming process further increases cement surface areas for microalgae attachment, in some cases to >10 m{sup 2}/g internal surface area. This project involves a team of researchers with backgrounds in cement technology, supercritical fluid technology, materials science, oceanography, and wetland biogeochemistry.

Kerry M. Dooley; F. Carl Knopf; Robert P. Gambrell

1999-05-31

44

Genomic signatures of fifth autotrophic carbon assimilation pathway in bathypelagic Crenarchaeota.  

PubMed

Marine Crenarchaeota, ubiquitous and abundant organisms in the oceans worldwide, remain metabolically uncharacterized, largely due to their low cultivability. Identification of candidate genes for bicarbonate fixation pathway in the Cenarchaeum symbiosum A was an initial step in understanding the physiology and ecology of marine Crenarchaeota. Recent cultivation and genome sequencing of obligate chemoautotrophic Nitrosopumilus maritimus SCM1 were a major breakthrough towards understanding of their functioning and provide a valuable model for experimental validation of genomic data. Here we present the identification of multiple key components of 3-hydroxipropionate/4-hydroxybutyrate cycle, the fifth pathway in carbon fixation, found in data sets of environmental sequences representing uncultivated superficial and bathypelagic Crenarchaeota from Sargasso sea (GOS data set) and KM3 (Mediterranean Sea) and ALOHA (Atlantic ocean) stations. These organisms are likely to use acetyl-CoA/propionyl-CoA carboxylase(s) as CO?-fixing enzyme(s) to form succinyl-CoA, from which one molecule of acetyl-CoA is regenerated via 4-hydroxybutyrate cleavage and another acetyl-CoA to be the pathway product. The genetic distinctiveness and matching sympatric abundance imply that marine crenarchaeal genotypes from the three different geographic sites share similar ecophysiological properties, and therefore may represent fundamental units of marine ecosystem functioning. To couple results of sequence comparison with the dark ocean primary production, dissolved inorganic carbon fixation rates were measured at KM3 Station (3000 m depth, Eastern Mediterranean Sea), i.e. at the same site and depth used for metagenomic library construction. PMID:21255356

La Cono, Violetta; Smedile, Francesco; Ferrer, Manuel; Golyshin, Peter N; Giuliano, Laura; Yakimov, Michail M

2010-09-01

45

Hydrogen-based carbon fixation in the earliest known photosynthetic organisms  

NASA Astrophysics Data System (ADS)

Thin carbonaceous laminations preserved in shallow-water facies of the 3416 Ma Buck Reef Chert, South Africa, have been interpreted to represent some of the oldest-known mats constructed by photosynthetic microbes. Preservation of these mats within a unit containing facies deposited at water depths ranging from 0 m to >200 m provides an opportunity to explore the electron donors employed in early microbial photosynthesis. The presence of siderite (FeCO3) as a primary sediment, lack of hematite (Fe2O3), and lack of cerium anomalies throughout the Buck Reef Chert imply that the entire water column was anoxic despite the presence of photosynthetic organisms. Authigenic uranium (Ua = U Th/3) correlates inversely with siderite abundance, suggesting that variations in carbonate rather than oxygen activity controlled uranium mobility. The inferred lack of oxygen and ferric minerals and the presence of dissolved Fe2+ in the water column imply that H2O, Fe2+, and H2S could not have served as primary electron donors for carbon fixation. It is most likely that Buck Reef Chert bacteria utilized H2 as the primary reductant for photosynthesis.

Tice, Michael M.; Lowe, Donald R.

2006-01-01

46

Evolution and Adaptation of Phytoplankton Photosynthetic Pathways to perturbations of the geological carbon system  

NASA Astrophysics Data System (ADS)

The ocean and atmosphere carbon system has varied greatly over geological history both in response to initial evolutionary innovation, and as a driver of adaptive change. Here we establish that positive selection in Rubisco, the most abundant enzyme on the Earth responsible for all photosynthetic carbon fixation, occurred early in Earth's history, and basal to the radiation of the modern marine algal groups. Our signals of positive selection appear to be triggered by changing intracellular concentrations of carbon dioxide (CO2) due to the emergence of carbon concentrating mechanisms between 1.56 and 0.41 Ba in response to declining atmospheric CO2 . We contend that, at least in terms of carbon, phytoplankton generally were well poised to manage subsequent abrupt carbon cycle perturbations. The physiological pathways for optimising carbon acquisition across a wide range of ambient carbon dioxide concentrations had already been established and were genetically widespread across open ocean phytoplankton groups. We will further investigate some case studies from the Mesozoic and Cenozoic abrupt carbon cycle excursions using isotopic tools to probe the community photosynthetic response and demonstrate the flexibility of phytoplankton photosynthesis in the face of major perturbations. In particular, an unprecedented resolution record across the Toarcian (Early Jurassic) carbon isotope excursion in the Paris Basin reveals a selection and evolution towards a community reliant solely on diffusive carbon dioxide supply for photosynthesis at the height of the excursion at 1500-2500 ppm CO2. The continued flourishing of the phytoplankton biological pump throughout this excursion was able to remove the excess carbon injected into the water column in less than 45 kyrs.

Rickaby, R. E.; Young, J. N.; Hermoso, M.; Heureux, A.; McCLelland, H.; Lee, R.; Eason Hubbard, M.

2012-12-01

47

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5?-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.  

PubMed Central

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5?- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae. PMID:23585853

Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

2013-01-01

48

Establishment of Microbial Eukaryotic Enrichment Cultures from a Chemically Stratified Antarctic Lake and Assessment of Carbon Fixation Potential  

PubMed Central

Lake Bonney is one of numerous permanently ice-covered lakes located in the McMurdo Dry Valleys, Antarctica. The perennial ice cover maintains a chemically stratified water column and unlike other inland bodies of water, largely prevents external input of carbon and nutrients from streams. Biota are exposed to numerous environmental stresses, including year-round severe nutrient deficiency, low temperatures, extreme shade, hypersalinity, and 24-hour darkness during the winter 1. These extreme environmental conditions limit the biota in Lake Bonney almost exclusively to microorganisms 2. Single-celled microbial eukaryotes (called "protists") are important players in global biogeochemical cycling 3 and play important ecological roles in the cycling of carbon in the dry valley lakes, occupying both primary and tertiary roles in the aquatic food web. In the dry valley aquatic food web, protists that fix inorganic carbon (autotrophy) are the major producers of organic carbon for organotrophic organisms 4, 2. Phagotrophic or heterotrophic protists capable of ingesting bacteria and smaller protists act as the top predators in the food web 5. Last, an unknown proportion of the protist population is capable of combined mixotrophic metabolism 6, 7. Mixotrophy in protists involves the ability to combine photosynthetic capability with phagotrophic ingestion of prey microorganisms. This form of mixotrophy differs from mixotrophic metabolism in bacterial species, which generally involves uptake dissolved carbon molecules. There are currently very few protist isolates from permanently ice-capped polar lakes, and studies of protist diversity and ecology in this extreme environment have been limited 8, 4, 9, 10, 5. A better understanding of protist metabolic versatility in the simple dry valley lake food web will aid in the development of models for the role of protists in the global carbon cycle. We employed an enrichment culture approach to isolate potentially phototrophic and mixotrophic protists from Lake Bonney. Sampling depths in the water column were chosen based on the location of primary production maxima and protist phylogenetic diversity 4, 11, as well as variability in major abiotic factors affecting protist trophic modes: shallow sampling depths are limited for major nutrients, while deeper sampling depths are limited by light availability. In addition, lake water samples were supplemented with multiple types of growth media to promote the growth of a variety of phototrophic organisms. RubisCO catalyzes the rate limiting step in the Calvin Benson Bassham (CBB) cycle, the major pathway by which autotrophic organisms fix inorganic carbon and provide organic carbon for higher trophic levels in aquatic and terrestrial food webs 12. In this study, we applied a radioisotope assay modified for filtered samples 13 to monitor maximum carboxylase activity as a proxy for carbon fixation potential and metabolic versatility in the Lake Bonney enrichment cultures. PMID:22546995

Dolhi, Jenna M.; Ketchum, Nicholas; Morgan-Kiss, Rachael M.

2012-01-01

49

Microbial microstratification, inorganic carbon photoassimilation and dark carbon fixation at the chemocline of the meromictic Lake Cadagno (Switzerland) and its relevance to the food web  

Microsoft Academic Search

The microstratification of the microbial community at the chemocline of Lake Cadagno and the associated inorganic carbon fixation activity was studied by fine layer sampling. A deep chlorophyll maximum caused by diatoms overlying Cryptomonas was found at the upper edge of the chemocline. A high population density of phototrophic sulphur bacteria, mainly Amoebobacter cf. purpureus, occurred closely below the oxic-anoxic

Antonio Camacho; Jonathan Erez; Alvaro Chicote; Máximo Florín; Margaret M. Squires; Christine Lehmann; Reinhard Backofen

2001-01-01

50

The relationship between carbon dioxide fixation and chlorophyll a fluorescence during induction of photosynthesis in maize leaves at different temperatures and carbon dioxide concentrations  

Microsoft Academic Search

The rate of CO2 fixation (Fc) and 680 nm chlorophyll fluorescence emission (F680) were measured simultaneously during induction of photosynthesis in Zea mays L. leaves under varying experimental conditions in order to assess the validity of fluorescence as an indicator of in vivo photosynthetic carbon assimilation. Z. mays leaves showed typical ‘Kautsky’ fluorescence induction curves consisting of a fast rise

C. R. Ireland; S. P. Long; N. R. Baker

1984-01-01

51

RuBP limitation of photosynthetic carbon fixation during NH sub 3 assimilation: Interactions between photosynthesis, respiration, and ammonium assimilation in N-limited green algae  

Microsoft Academic Search

The effects of ammonium assimilation on photosynthetic carbon fixation and Oâ exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP)

I. R. Elrifi; J. J. Holmes; H. G. Weger; W. P. Mayo; D. H. Turpin

1988-01-01

52

The reallocation of carbon in P deficient lupins affects biological nitrogen fixation.  

PubMed

It is not known how phosphate (P) deficiency affects the allocation of carbon (C) to biological nitrogen fixation (BNF) in legumes. The alteration of the respiratory and photosynthetic C costs of BNF was investigated under P deficiency. Although BNF can impose considerable sink stimulation on host respiratory and photosynthetic C, it is not known how the change in the C and energy allocation during P deficiency may affect BNF. Nodulated Lupinus luteus plants were grown in sand culture, using a modified Long Ashton nutrient solution containing no nitrogen (N) for ca. four weeks, after which one set was exposed to a P-deficient nutrient medium, while the other set continued growing on a P-sufficient nutrient medium. Phosphorus stress was measured at 20 days after onset of P-starvation. During P stress the decline in nodular P levels was associated with lower BNF and nodule growth. There was also a shift in the balance of photosynthetic and respiratory C toward a loss of C during P stress. Below-ground respiration declined under limiting P conditions. However, during this decline there was also a shift in the proportion of respiratory energy from maintenance toward growth respiration. Under P stress, there was an increased allocation of C toward root growth, thereby decreasing the amount of C available for maintenance respiration. It is therefore possible that the decline in BNF under P deficiency may be due to this change in resource allocation away from respiration associated with direct nutrient uptake, but rather toward a long term nutrient acquisition strategy of increased root growth. PMID:25155758

Kleinert, Aleysia; Venter, Mauritz; Kossmann, Jens; Valentine, Alexander

2014-11-01

53

Effect of light and atmospheric carbon dioxide concentration on nitrogen fixation by herbage legumes  

Microsoft Academic Search

Summary  Lucerne, red clover and white clover were grown at two atmospheric concentrations of CO2 (300 and 1000 ?l l?1) and the effects on N2 fixation, nodule mass\\/number and root\\/shoot dry matter production determined. Pea plants were similarly evaluated as a comparison\\u000a with grain legumes. CO2 enrichment increased N2 fixation activity in all cases but activity\\/unit nodule mass was significantly increased

P. M. Murphy

1986-01-01

54

Simultaneous quantification of active carbon- and nitrogen-fixing communities and estimation of fixation rates using fluorescence in situ hybridization and flow cytometry.  

PubMed

Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and (14)C/(15)N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

McInnes, Allison S; Shepard, Alicia K; Raes, Eric J; Waite, Anya M; Quigg, Antonietta

2014-11-01

55

Transitions in pathways of human development and carbon emissions  

NASA Astrophysics Data System (ADS)

Countries are known to follow diverse pathways of life expectancy and carbon emissions, but little is known about factors driving these dynamics. In this letter we estimate the cross-sectional economic, demographic and geographic drivers of consumption-based carbon emissions. Using clustering techniques, countries are grouped according to their drivers, and analysed with respect to a criteria of one tonne of carbon emissions per capita and a life expectancy over 70 years (Goldemberg’s Corner). Five clusters of countries are identified with distinct drivers and highly differentiated outcomes of life expectancy and carbon emissions. Representatives from four clusters intersect within Goldemberg’s Corner, suggesting diverse combinations of drivers may still lead to sustainable outcomes, presenting many countries with an opportunity to follow a pathway towards low-carbon human development. By contrast, within Goldemberg’s Corner, there are no countries from the core, wealthy consuming nations. These results reaffirm the need to address economic inequalities within international agreements for climate mitigation, but acknowledge plausible and accessible examples of low-carbon human development for countries that share similar underlying drivers of carbon emissions. In addition, we note differences in drivers between models of territorial and consumption-based carbon emissions, and discuss interesting exceptions to the drivers-based cluster analysis.

Lamb, W. F.; Steinberger, J. K.; Bows-Larkin, A.; Peters, G. P.; Roberts, J. T.; Wood, F. R.

2014-01-01

56

Carbon dioxide fixation by epidermal and mesophyll tissues of Tulipa and Commelina.  

PubMed

Rates of (14)CO2 fixation by epidermal tissue of Tulipa gesneriana (tulip) and Commelina diffusa are only slightly higher in the light than in the dark while in mesophyl tissues rates are much greater in the light. The first products of (14)CO2 fixation by epidermal tissue of Tulipa gesneriana and C. diffusa in the light and dark are malate and aspartate. In addition to these dominating dicarboxylic acids, 3-phosphoglyceric acid and sugar phosphates appear in the light, while in the dark only the amino acids, glutamate and glutamine become labelled. Mesophyll tissue of tulip and C. diffusa, however, gives typical CO2 fixation patterns of the labelled products of C3 plants. Furthermore, a period of dark (14)CO2 fixation followed by a light (12)CO2 chase carried out with epidermal tissue suggested that malate can act has the precursor of phosphorylated compounds of the Calvin cycle and consequently of starch. The data are consistent with the view that guard cells are able to exhibit Crassulacean acid metabolism. PMID:24458325

Willmer, C M; Dittrich, P

1974-06-01

57

Ammonia fixation by humic substances: A nitrogen-15 and carbon-13 NMR study  

USGS Publications Warehouse

The process of ammonia fixation has been studied in three well characterized and structurally diverse fulvic and humic acid samples. The Suwannee River fulvic acid, and the IHSS peat and leonardite humic acids, were reacted with 15N-labelled ammonium hydroxide, and analyzed by liquid phase 15N NMR spectrometry. Elemental analyses and liquid phase 13C NMR spectra also were recorded on the samples before and after reaction with ammonium hydroxide. The largest increase in percent nitrogen occurred with the Suwannee River fulvic acid, which had a nitrogen content of 0.88% before fixation and 3.17% after fixation. The 15N NMR spectra revealed that ammonia reacted similarly with all three samples, indicating that the functional groups which react with ammonia exist in structural configurations common to all three samples. The majority of nitrogcn incorporated into the samples appears to be in the form of indole and pyrrole nitrogen, followed by pyridine, pyrazine, amide and aminohydroquinone nitrogen. Chemical changes in the individual samples upon fixation could not be discerned from the 13C NMR spectra.

Thorn, K. A.; Mikita, M. A.

1992-01-01

58

Glycolaldehyde Inhibits CO2 Fixation in the Cyanobacterium Synechococcus UTEX 625 without Inhibiting the Accumulation of Inorganic Carbon or the Associated Quenching of Chlorophyll a Fluorescence 1  

PubMed Central

When studying active CO2 and HCO3? transport by cyanobacteria, it is often useful to be able to inhibit concomitant CO2 fixation. We have found that glycolaldehyde was an efficient inhibitor of photosynthetic CO2 fixation in Synechococcus UTEX 625. Glycolaldehyde did not inhibit inorganic carbon accumulation due to either active CO2 or HCO3? transport. When glycolaldehyde (10 millimolar) was added to rapidly photosynthesizing cells, CO2 fixation was stopped within 15 seconds. The quenching of chlorophyll a fluorescence remained high (? 82% control) when CO2 fixation was completely blocked by glycolaldehyde. This quenching was relieved upon the addition of a glucose oxidase oxygentrap. This is consistent with our previous finding that q-quenching in the absence of CO2 fixation was due to O2 photoreduction. Photosynthetic CO2 fixation was also inhibited by d,l,-glyceraldehyde but a sixfold higher concentration was required. Glycolaldehyde acted much more rapidly than iodoacetamide (15 seconds versus 300 seconds) and did not cause the onset of net O2 evolution often observed with iodoacetamide. Glycolaldehyde will be a useful inhibitor when it is required to study CO2 and HCO3? transport without the complication of concomitant CO2 fixation. PMID:16667109

Miller, Anthony G.; Canvin, David T.

1989-01-01

59

Fixation of CO 2 by carbonating calcium derived from blast furnace slag  

Microsoft Academic Search

Industrial waste materials, such as steelmaking slags, appear to be potential raw materials for reducing CO2 emissions by carbonation. The suitability of applying a carbonation route based on acetic acid leaching to produce carbonates from blast furnace slag is presented in this study. The effect of solution pH, temperature, and CO2 pressure on the precipitation of carbonates was experimentally studied.

Sanni Eloneva; Sebastian Teir; Justin Salminen; Carl-Johan Fogelholm; Ron Zevenhoven

2008-01-01

60

Role of intracellular carbon metabolism pathways in Shigella flexneri virulence.  

PubMed

Shigella flexneri, which replicates in the cytoplasm of intestinal epithelial cells, can use the Embden-Meyerhof-Parnas, Entner-Doudoroff, or pentose phosphate pathway for glycolytic carbon metabolism. To determine which of these pathways is used by intracellular S. flexneri, mutants were constructed and tested in a plaque assay for the ability to invade, replicate intracellularly, and spread to adjacent epithelial cells. Mutants blocked in the Embden-Meyerhof-Parnas pathway (pfkAB and pykAF mutants) invaded the cells but formed very small plaques. Loss of the Entner-Doudoroff pathway gene eda resulted in small plaques, but the double eda edd mutant formed normal-size plaques. This suggested that the plaque defect of the eda mutant was due to buildup of the toxic intermediate 2-keto-3-deoxy-6-phosphogluconic acid rather than a specific requirement for this pathway. Loss of the pentose phosphate pathway had no effect on plaque formation, indicating that it is not critical for intracellular S. flexneri. Supplementation of the epithelial cell culture medium with pyruvate allowed the glycolysis mutants to form larger plaques than those observed with unsupplemented medium, consistent with data from phenotypic microarrays (Biolog) indicating that pyruvate metabolism was not disrupted in these mutants. Interestingly, the wild-type S. flexneri also formed larger plaques in the presence of supplemental pyruvate or glucose, with pyruvate yielding the largest plaques. Analysis of the metabolites in the cultured cells showed increased intracellular levels of the added compound. Pyruvate increased the growth rate of S. flexneri in vitro, suggesting that it may be a preferred carbon source inside host cells. PMID:24733092

Waligora, E A; Fisher, C R; Hanovice, N J; Rodou, A; Wyckoff, E E; Payne, S M

2014-07-01

61

The R3-carbon allotrope: a pathway towards glassy carbon under high pressure  

NASA Astrophysics Data System (ADS)

Pressure-induced bond type switching and phase transformation in glassy carbon (GC) has been simulated by means of Density Functional Theory (DFT) calculations and the Stochastic Quenching method (SQ) in a wide range of pressures (0-79 GPa). Under pressure, the GC experiences a hardening transition from sp- and sp2-type to sp3-type bonding, in agreement with previous experimental results. Moreover, a new crystalline carbon allotrope possessing R3 symmetry (R3-carbon) is predicted using the stochastic SQ method. The results indicate that R3-carbon can be regarded as an allotrope similar to that of amorphous GC. A very small difference in the heat of formation and the coherence of the radial and angular distribution functions of GC and the R3-carbon structure imply that small perturbations to this crystalline carbon allotrope may provide another possible amorphization pathway of carbon besides that of quenching the liquid melt or gas by ultra-fast cooling.

Jiang, Xue; Århammar, Cecilia; Liu, Peng; Zhao, Jijun; Ahuja, Rajeev

2013-05-01

62

Impact of ultraviolet-B radiation on photosystem II activity and its relationship to the inhibition of carbon fixation rates for antarctic ice algae communities  

SciTech Connect

One goal of the Icecolors 1993 study was to determine whether or not photosystem II (PSII) was a major target site for photoinhibition by ultraviolet-B radiation (Q{sub UVB}, 280-320 nm) in natural communities. Second, the degree to which Q{sub UVB} inhibition of PSII could account for Q{sub UVB} effects on whole cell rates of carbon fixation in phytoplankton was assessed. On 1 October, 1993, at Palmer Station (Antarctica), dense samples of a frazil ice algal community were collected and maintained outdoors in the presence or absence of Q{sub UVB} and/or ultraviolet-A (Q{sub UVA}, 320-400 nm) radiation. The time of day course of UV inhibition of primary production was tracted. Over the day, {phi}{sub IIe}{degrees} declined due to increasing time-integrated dose exposure of Q{sub UVB}. The Q{sub UVB}-driven inhibition of {phi}{sub IIe}{degrees} increased from 4% in the early morning hours to a maximum of 23% at the end of the day. The Q{sub UVB} photoinhibition of PSII quantum yield did not recover by 6 h after sunset. In contrast, photoinhibition by Q{sub UVA} and photosynthetically available radiation (Q{sub PAR}, 400-700 nm) recovered during the late afternoon. Fluorescence-based estimates of carbon fixation rates were linearly correlated with measured carbon fixation. Fluorescence overestimated the observed Q{sub UVB} inhibition in measured carbon fixation rates. Researchers should be cautious in using fluorescence measurements to infer ultraviolet inhibition for rates of carbon fixation until there is a greater understanding of the coupling of carbon metabolism to PSII activity for natural populations. Despite these current limitations, fluorescence-based technologies represent powerful tools for studying the impact of the ozone hole on natural populations on spatial/temporal scales not possible using conventional productivity techniques. 55 refs., 11 figs., 2 tabs.

Schofield, O.; Prezelin, B.B. [Univ. of California, Santa Barbara, CA (United States); Kroon, B.M.A. [Univ. of Amsterdam (Netherlands)

1995-10-01

63

RuBP limitation of photosynthetic carbon fixation during NH sub 3 assimilation: Interactions between photosynthesis, respiration, and ammonium assimilation in N-limited green algae  

SciTech Connect

The effects of ammonium assimilation on photosynthetic carbon fixation and O{sub 2} exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP) concentration and the RuBP binding site density of ribulose bisphosphate carboxylase/oxygenase (Rubisco). In both species, ammonium assimilation resulted in a decrease in RuBP concentration. In S. minutum the concentration fell below the RuBP binding site density of Rubisco, indicating RuBP limitation of carboxylation. In contrast, RuBP concentration remained above the binding site density in C. pyrenoidosa. Compromising RuBP regeneration in C. pyrenoidosa with low light resulted in an ammonium-induced decrease in RuBP concentration below the RuBP binding site density of Rubisco. This resulted in a decrease in photosynthetic carbon fixation. In both species, ammonium assimilation resulted in a larger decrease in net O{sub 2} evolution than in carbon fixation. Mass spectrometric analysis shows this to be a result of an increase in the rate of mitochondrial respiration in the light.

Elrifi, I.R.; Holmes, J.J.; Weger, H.G.; Mayo, W.P.; Turpin, D.H. (Queen's Univ., Kingston, Ontario (Canada))

1988-06-01

64

Assaying the catalytic potential of transition metal sulfides for abiotic carbon fixation 1 1 Associate editor: P. A. O’Day  

Microsoft Academic Search

A suite of nickel, cobalt, iron, copper, and zinc containing sulfides are assayed for the promotion of a model carbon fixation reaction with relevance to local reducing environments of the early Earth. The assay tests the promotion of hydrocarboxylation (the Koch reaction) wherein a carboxylic acid is synthesized via carbonyl insertion at a metal-sulfide-bound alkyl group. The experimental conditions are

G. D. CODY; N. Z. BOCTOR; J. A Brandes; T. R Filley; R. M Hazen; H. S. YODER

2004-01-01

65

Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L  

SciTech Connect

Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwall and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.

Singal, H.R.; Sheoran, I.S.; Singh, R.

1987-04-01

66

Antioxidant pathways are up-regulated during biological nitrogen fixation to prevent ROS-induced nitrogenase inhibition in Gluconacetobacter diazotrophicus  

PubMed Central

Gluconacetobacter diazotrophicus, an endophyte isolated from sugarcane, is a strict aerobe that fixates N2. This process is catalyzed by nitrogenase and requires copious amounts of ATP. Nitrogenase activity is extremely sensitive to inhibition by oxygen and reactive oxygen species (ROS). However, the elevated oxidative metabolic rates required to sustain biological nitrogen fixation (BNF) may favor an increased production of ROS. Here, we explored this paradox and observed that ROS levels are, in fact, decreased in nitrogen-fixing cells due to the up-regulation of transcript levels of six ROS-detoxifying genes. A cluster analyses based on common expression patterns revealed the existence of a stable cluster with 99.8% similarity made up of the genes encoding the ?-subunit of nitrogenase Mo–Fe protein (nifD), superoxide dismutase (sodA) and catalase type E (katE). Finally, nitrogenase activity was inhibited in a dose-dependent manner by paraquat, a redox cycler that increases cellular ROS levels. Our data revealed that ROS can strongly inhibit nitrogenase activity, and G. diazotrophicus alters its redox metabolism during BNF by increasing antioxidant transcript levels resulting in a lower ROS generation. We suggest that careful controlled ROS production during this critical phase is an adaptive mechanism to allow nitrogen fixation. PMID:20697694

Oliveira, Jose Henrique M.; Nogueira, Eduardo M.; Guedes, Helma V.; Oliveira, Pedro L.; Camara, Fernando; Baldani, Jose I.; Martins, Orlando B.

2010-01-01

67

Pathways of organic carbon oxidation in three continental margin sediments  

NASA Technical Reports Server (NTRS)

We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and Mn reduction) has probably been well underestimated.

Canfield, D. E.; Jorgensen, B. B.; Fossing, H.; Glud, R.; Gundersen, J.; Ramsing, N. B.; Thamdrup, B.; Hansen, J. W.; Nielsen, L. P.; Hall, P. O.

1993-01-01

68

Nitrogen Fixation on Early Mars and Other Terrestrial Planets: Experimental Demonstration of Abiotic Fixation Reactions to Nitrite and Nitrate  

NASA Astrophysics Data System (ADS)

Understanding the abiotic fixation of nitrogen is critical to understanding planetary evolution and the potential origin of life on terrestrial planets. Nitrogen, an essential biochemical element, is certainly necessary for life as we know it to arise. The loss of atmospheric nitrogen can result in an incapacity to sustain liquid water and impact planetary habitability and hydrological processes that shape the surface. However, our current understanding of how such fixation may occur is almost entirely theoretical. This work experimentally examines the chemistry, in both gas and aqueous phases, that would occur from the formation of NO and CO by the shock heating of a model carbon dioxide/nitrogen atmosphere such as is currently thought to exist on early terrestrial planets. The results show that two pathways exist for the abiotic fixation of nitrogen from the atmosphere into the crust: one via HNO and another via NO2. Fixation via HNO, which requires liquid water, could represent fixation on a planet with liquid water (and hence would also be a source of nitrogen for the origin of life). The pathway via NO2 does not require liquid water and shows that fixation could occur even when liquid water has been lost from a planet's surface (for example, continuing to remove nitrogen through NO2 reaction with ice, adsorbed water, etc.).

Summers, David P.; Khare, Bishun

2007-05-01

69

Nitrogen fixation (acetylene reduction) in a salt marsh amended with sewage sludge and organic carbon and nitrogen compounds.  

PubMed

Seasonal distribution of nitrogen fixation by Spartina alterniflora epiphytes and in surface and soil samples was investigated in a Georgia salt marsh which was amended with sewage sludge or with glucose and/or ammonium nitrate. There was no significant difference between the rates of fixation in the unamended and sewage sludge plots. Additional perturbation experiments suggested that nitrogen addition indirectly stimulates nitrogen fixation by enhancing Spartina production and root exudation. Glucose additions, on the other hand, suppressed nitrogen fixation on a long-term basis. It is suggested that the microbial population in the soil out-competed the plants for the available nitrogen and in turn suppressed plant production and possibly root exudation. A comparison of nitrogen fixation in clipped and unclipped Spartina plots substantiated the suggestion that root exudation probably supports nitrogen fixation. Fixation in the clipped plots was significantly lower (P < 0.05) than the rates in the unclipped plots. PMID:16345239

Hanson, R B

1977-04-01

70

De quelques paradoxes autour de la fixation d'une taxe internationale sur le carbone  

Microsoft Academic Search

[eng] Some paradoxical issues about negociating an international carbon tax. . To date, debates on economic incentives apt to coordonate Greenhouse Gases emissions abatement policies focused mainly on an international uniform carbon tax and this for two type of reasons : the classical result of the unicity of a Pigouvian tax, the simplicity of its implementation. This paper presents a

Jean-Charles Hourcade; Khalil Helioui

1997-01-01

71

Carbon nanopipettes characterize calcium release pathways in breast cancer cells  

NASA Astrophysics Data System (ADS)

Carbon-based nanoprobes are attractive for minimally invasive cell interrogation but their application in cell physiology has thus far been limited. We have developed carbon nanopipettes (CNPs) with nanoscopic tips and used them to inject calcium-mobilizing messengers into cells without compromising cell viability. We identify pathways sensitive to cyclic adenosine diphosphate ribose (cADPr) and nicotinic acid adenine dinucleotide phosphate (NAADP) in breast carcinoma cells. Our findings demonstrate the superior utility of CNPs for intracellular delivery of impermeant molecules and, more generally, for cell physiology studies. The CNPs do not appear to cause any lasting damage to cells. Their advantages over commonly used glass pipettes include smaller size, breakage and clogging resistance, and potential for multifunctionality such as in concurrent injection and electrical measurements.

Schrlau, Michael G.; Brailoiu, Eugen; Patel, Sandip; Gogotsi, Yury; Dun, Nae J.; Bau, Haim H.

2008-08-01

72

Pathways to Adoption of Carbon Capture and Sequestration in India: Technologies and Policies  

E-print Network

Pathways to Adoption of Carbon Capture and Sequestration in India: Technologies and Policies, Technology and Policy Program #12;2 #12;Pathways to Carbon Capture and Sequestration in India: Technologies to control India's emissions will have to be a global priority. Carbon capture and sequestration (CCS) can

73

Grazing affects carbon fixation pathways by phytoplankton in coastal marine ecosystems  

Microsoft Academic Search

During parallel sampling of seawater samples in bottles and in free water (1000–2000 m clay ponds), we have measured phytoplankton biomass, Ribulose biphosphate carboxylase (Rubisco), phosphoenol pyruvate carboxylase, and phosphoenol pyruvate carboxykinase activities and major nutrients (ammonium, nitrate, phosphate, silicate). This was done in two ecosystems: one with high grazing pressure due to the presence of oysters and another with low

Y. Collos; C. Descolas-Gros; F. Mornet

2005-01-01

74

Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities  

PubMed Central

The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope–probing experiments with and without methane. The relative incorporation of 13C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both 13C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs. PMID:23129626

Kellermann, Matthias Y.; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe

2012-01-01

75

Regulation of photosynthetic carbon fixation on the ocean margins. Final report  

SciTech Connect

The US Department of Energy is concerned with the fate of energy-related materials, including carbon dioxide, in the marine environment. Using laboratory studies, as well as field studies, an attempt was made to understand the molecular regulation of photosynthetic carbon reduction. The objectives were: to determine the mechanism of regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBPCase) in phytoplankton in response to changes in light fields; and to determine regulation of (RuBPCase) in response to light under nutrient deprivation.

Paul, J.H.

1997-06-01

76

The carbon assimilation pathways of Methylococcus capsulatus, Pseudomonas methanica and Methylosinus trichosporium (OB3B) during growth on methane  

PubMed Central

d-arabino-3-Hexulose 6-phosphate was prepared by condensation of formaldehyde with ribulose 5-phosphate in the presence of 3-hexulose phosphate synthase from methane-grown Methylococcus capsulatus. The 3-hexulose phosphate was unstable in solutions of pH greater than 3, giving a mixture of products in which, after dephosphorylation, allulose and fructose were detected. A complete conversion of d-ribulose 5-phosphate and formaldehyde into d-fructose 6-phosphate was demonstrated in the presence of 3-hexulose phosphate synthase and phospho-3-hexuloisomerase (prepared from methane-grown M. capsulatus). d-Allulose 6-phosphate was prepared from d-allose by way of d-allose 6-phosphate. No evidence was found for its metabolism by extracts of M. capsulatus, thus eliminating it as an intermediate in the carbon assimilation process of this organism. A survey was made of the enzymes involved in the regeneration of pentose phosphate during C1 assimilation via a modified pentose phosphate cycle. On the basis of the presence of the necessary enzymes, two alternative routes for cleavage of fructose 6-phosphate are suggested, one route involves fructose diphosphate aldolase and the other 6-phospho-2-keto-3-deoxygluconate aldolase. A detailed formulation of the complete ribulose monophosphate cycle of formaldehyde fixation is presented. The energy requirements for carbon assimilation by this cycle are compared with those for the serine pathway and the ribulose diphosphate cycle of carbon dioxide fixation. A cyclic scheme for oxidation of formaldehyde via 6-phosphogluconate is suggested. PMID:4377654

Str?m, Terje; Ferenci, Thomas; Quayle, J. Rodney

1974-01-01

77

Coupling of Carbon Dioxide Fixation to the Oxyhydrogen Reaction in the Isolated Chloroplast of Chlamydomonas reinhardtii1  

PubMed Central

The oxyhydrogen reaction (the reduction of O2 to water by H2) in the presence of CO2 was studied in the isolated Chlamydomonas reinhardtii chloroplast by monitoring the rate of 14CO2 incorporation into acid-stable products in the dark. The endogenous rate of CO2 uptake (50-125 nmol/mg chlorophyll per h) was increased about 3- to 4-fold by ATP and additionally when combined with glucose, ribose-5-phosphate, and glycerate-3-phosphate. The rate was diminished 50 to 75%, respectively, when H2 was replaced by N2 or by air. Decrease in CO2 uptake by dl-glyceraldehyde was taken to indicate that the regenerative phase and complete Calvin cycle turnover were involved. Diminution of CO2 incorporation by rotenone, antimycin A, and 2,5-dibromo-3-methyl-6-isopropanol-p-benzoquinone was attributed to an inhibition of the oxyhydrogen reaction, resulting in an elevated NADPH/NADP ratio. If so, then the diminished CO2 uptake could have been by “product inhibition” of the carbon metabolic network. Our data are consistent with the proposal (H. Gaffron [1942] J Gen Physiol 26: 241-267) that CO2 fixation coupled to the oxyhydrogen reaction is dependent to some extent on exchloroplastic metabolism. This support is primarily ATP provided by mitochondrial respiration. PMID:16653129

Chen, Changguo; Gibbs, Martin

1992-01-01

78

Biomass production and carbon dioxide fixation by Aphanothece microscopica Nägeli in a bubble column photobioreactor  

Microsoft Academic Search

The objective of the present study was to evaluate the growth kinetics of Aphanothece microscopica Nägeli under different conditions of temperature, light intensity and CO2 concentration. The growth kinetics of the microorganism and carbon biofixation were evaluated using a central composite design, considering five different temperature levels (21.5, 25, 30, 35 and 38.5°C), light intensities (0.96, 3, 6, 9 and

Eduardo Jacob-Lopes; Lucy Mara Cacia Ferreira Lacerda; Telma Teixeira Franco

2008-01-01

79

Direct assembly of 2-oxazolidinones by chemical fixation of carbon dioxide.  

PubMed

The reaction of ?- and ?-haloamines with carbon dioxide to give pharmaceutically relevant 2-oxazolidinones and 1,3-dioxazin-2-ones, was found to proceed efficiently in the presence of a base and in the absence of catalyst. After optimization of reaction conditions, the system was successfully expanded to a variety of haloamines, even at multigram scale. The reaction was further studied in silico by DFT calculations. PMID:24905029

Niemi, Teemu; Perea-Buceta, Jesus E; Fernández, Israel; Alakurtti, Sami; Rantala, Erika; Repo, Timo

2014-07-14

80

Trophic pathways and carbon flux patterns in the Laptev Sea  

NASA Astrophysics Data System (ADS)

The Laptev Sea is a high-Arctic epicontinental sea north of Siberia (Russia) that is one of the least understood regions of the world’s ocean. It is characterized by a shallow and broad shelf plateau, high influx of river water, sediments and nutrients during summer, long-lasting sea-ice cover from October to May, and the formation of a narrow flaw-lead polynya off the fast-ice edge during winter. Here, we describe results of a German-Russian research project (1993-present), presenting the distribution patterns and dynamics of its marine flora and fauna, as well as pathways and processes of coupling between sea-ice, water-column and sea-floor biota. Three ecological zones are distinguished along a combined east-west and Lena-impact gradient, differing in the composition of pelagic and benthic communities. In general, high Chl a concentrations in the sediments indicate a tight coupling between sympagic and pelagic primary production and nutrient supply to the benthos throughout the entire Laptev Sea. However, there were pronounced regional differences between the ecological zones in magnitude of primary production and trophic dynamics. Primary production during the ice-free summer was highest in the estuarine zone most strongly influenced by the Lena River (210 mg C m -2 day -1). The western and northeastern Laptev Sea yielded 55 and 95 mg C m -2 day -1, respectively. Moreover, the zones differed in the partitioning of carbon flux between zooplankton and benthic food webs. In the Lena zone zooplankton carbon demand was about 31 mg C m -2 day -1 whereas in the western zone it was 21 mg C m -2 day -1 and in the eastern zone 4 mg C m -2 day -1. Total benthic carbon demand was 32 mg C m -2 day -1 for the Lena zone, 56 mg C m -2 day -1 in the western zone and 100 mg C m -2 day -1 in the northeastern zone. A carbon budget constructed for the Laptev Sea indicates that (1) a high proportion of primary production is channelled through the benthic trophic web, bypassing the pelagic trophic web, and (2) autochthonous primary production in the northeastern and western Laptev Sea might not be sufficient to fuel both pelagic and benthic secondary production and, hence, input of allochthonous organic carbon is required to balance the overall carbon demand.

Schmid, Michael K.; Piepenburg, Dieter; Golikov, Alexander A.; Juterzenka, Karen von; Petryashov, Victor V.; Spindler, Michael

2006-10-01

81

The R3-carbon allotrope: a pathway towards glassy carbon under high pressure  

PubMed Central

Pressure-induced bond type switching and phase transformation in glassy carbon (GC) has been simulated by means of Density Functional Theory (DFT) calculations and the Stochastic Quenching method (SQ) in a wide range of pressures (0–79?GPa). Under pressure, the GC experiences a hardening transition from sp- and sp2-type to sp3-type bonding, in agreement with previous experimental results. Moreover, a new crystalline carbon allotrope possessing R3 symmetry (R3-carbon) is predicted using the stochastic SQ method. The results indicate that R3-carbon can be regarded as an allotrope similar to that of amorphous GC. A very small difference in the heat of formation and the coherence of the radial and angular distribution functions of GC and the R3-carbon structure imply that small perturbations to this crystalline carbon allotrope may provide another possible amorphization pathway of carbon besides that of quenching the liquid melt or gas by ultra-fast cooling. PMID:23698738

Jiang, Xue; Arhammar, Cecilia; Liu, Peng; Zhao, Jijun; Ahuja, Rajeev

2013-01-01

82

Urea Uptake and Carbon Fixation by Marine Pelagic Bacteria and Archaea during the Arctic Summer and Winter Seasons.  

PubMed

How Arctic climate change might translate into alterations of biogeochemical cycles of carbon (C) and nitrogen (N) with respect to inorganic and organic N utilization is not well understood. This study combined (15)N uptake rate measurements for ammonium, nitrate, and urea with (15)N- and (13)C-based DNA stable-isotope probing (SIP). The objective was to identify active bacterial and archeal plankton and their role in N and C uptake during the Arctic summer and winter seasons. We hypothesized that bacteria and archaea would successfully compete for nitrate and urea during the Arctic winter but not during the summer, when phytoplankton dominate the uptake of these nitrogen sources. Samples were collected at a coastal station near Barrow, AK, during August and January. During both seasons, ammonium uptake rates were greater than those for nitrate or urea, and nitrate uptake rates remained lower than those for ammonium or urea. SIP experiments indicated a strong seasonal shift of bacterial and archaeal N utilization from ammonium during the summer to urea during the winter but did not support a similar seasonal pattern of nitrate utilization. Analysis of 16S rRNA gene sequences obtained from each SIP fraction implicated marine group I Crenarchaeota (MGIC) as well as Betaproteobacteria, Firmicutes, SAR11, and SAR324 in N uptake from urea during the winter. Similarly, (13)C SIP data suggested dark carbon fixation for MGIC, as well as for several proteobacterial lineages and the Firmicutes. These data are consistent with urea-fueled nitrification by polar archaea and bacteria, which may be advantageous under dark conditions. PMID:25063662

Connelly, Tara L; Baer, Steven E; Cooper, Joshua T; Bronk, Deborah A; Wawrik, Boris

2014-10-01

83

Biochemistry and control of the reductive tricarboxylic acid pathway of CO2 fixation and physiological role of the RubisCO-like protein  

SciTech Connect

During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris. 1. Reductive TCA pathway of CO2 assimilation Many diverse microorganisms use the reductive TCA (RTCA) pathway for CO2 assimilation. Included are photoautotrophic and chemoautotrophic organisms that occupy important niches in various ecosystems. Inasmuch as the biochemistry and regulation of the RTCA pathway has been virtually neglected, especially in comparison to the Calvin-Benson-Bassham (CBB) reductive pentose pathway of CO2 fixation, we sought to develop a system that would allow for detailed biochemical analysis of the RTCA enzymes and associated proteins, along with the genes that encode these proteins. We have focused on the green sulfur photosynthetic bacterium Chlorobium tepidum, a fast growing moderate thermophile originally isolated by Professor Mike Madigan and colleagues. Because of its rapid growth and relative ease to produce massive cell amounts via high-density fermentator vessels, C. tepidum has become the organism of choice for investigators interested in studying all aspects of the physiology and biochemistry of green sulfur bacteria. Moreover, this organism possesses a very convenient natural transformation system that allows routine genetic transfer and the generation of knockout mutations via homologous recombination at specific genetic loci. The first such mutations were generated in our laboratory [Hanson & Tabita, PNAS USA, 98 (2001), 4397-4402], such that these protocols have now become relatively routine. Moreover, the genome of C. tepidum was recently sequenced. Thus, all the tools are in place for productive analysis of key processes catalyzed by this organism, in particular for analysis of the RTCA pathway and the rather unique RubisCO-like protein (RLP) that we first discovered during the last grant period of this project [Hanson & Tabita, 2001]. We have concentrated on the enzymology of the key proteins of this pathway, in particular pyruvate synthase (PS), ?-ketoglutarate synthase (KGS), and ATP-citrate lyase (ACL). In addition, we have also focused on key electron transfer proteins that must provide needed reducing equivalents to PS and KGS, including two separate ferredoxins that were shown to be abundantly produced by this organism. 2. Physiological/biochemical/genetic studies on the RubisCO-like Protein (RLP) During the prior grant period we identified what we believe is an evolutional precursor to bona fide RubisCO in C. tepidum, the RubisCO-like protein (RLP) [Hanson & Tabita, 2001]. Typical bioinformatics software incorrectly indicates that RLP is RubisCO, however our previous experience with RubisCO enabled us to establish that C. tepidum RLP has substitutions in 9 out of the 19 residues known to be important for RubisCO-catalyzed CO2 fixation. After purifying recombinant RLP, we showed that the RLP is not a bona fide RubisCO that catalyzes RuBP-dependent CO2 fixation, but appears to function in some aspect of the oxidation of reduced sulfur compounds by this organism. More recent studies [Hanson & Tabita, Photosynth. Res. 78 (2003) 231-248] during the past grant period have established that this effect is related to some aspect of thiosulfate oxidation in the reduced sulfur compound oxidation pathway, as sulfide oxidation was not affected. When we first discovered the RLP, we noted that RLP homologs were also found in other organisms, including heterotrophic bacteria and at least one archaeon [Hanson & Tabita, 2001, 2003]. Finally, as long-time Rubiscologists we have always been intrigued with how the active site of RubisCO might have evolved for its key functional role in metabolizing CO2 and O2 [Tabita, Photosynth. Res. 60 (1999) 1-

Tabita, F Robert

2008-12-04

84

Oxygen Pathways and Carbon Dioxide Utilization in Methane Partial Oxidation in Ambient Temperature  

E-print Network

Oxygen Pathways and Carbon Dioxide Utilization in Methane Partial Oxidation in Ambient Temperature and lower environmental impacts make this the carbon-based fuel of choice well into the twenty-first century into enhance- ment of the carbon balance of methane conversion by reforming with CO2 in order to "recycle

Mallinson, Richard

85

Regulation of Multiple Carbon Monoxide Consumption Pathways in Anaerobic Bacteria  

PubMed Central

Carbon monoxide (CO), well known as a toxic gas, is increasingly recognized as a key metabolite and signaling molecule. Microbial utilization of CO is quite common, evidenced by the rapid escalation in description of new species of CO-utilizing bacteria and archaea. Carbon monoxide dehydrogenase (CODH), the protein complex that enables anaerobic CO-utilization, has been well-characterized from an increasing number of microorganisms, however the regulation of multiple CO-related gene clusters in single isolates remains unexplored. Many species are extraordinarily resistant to high CO concentrations, thriving under pure CO at more than one atmosphere. We hypothesized that, in strains that can grow exclusively on CO, both carbon acquisition via the CODH/acetyl CoA synthase complex and energy conservation via a CODH-linked hydrogenase must be differentially regulated in response to the availability of CO. The CO-sensing transcriptional activator, CooA is present in most CO-oxidizing bacteria. Here we present a genomic and phylogenetic survey of CODH operons and cooA genes found in CooA-containing bacteria. Two distinct groups of CooA homologs were found: one clade (CooA-1) is found in the majority of CooA-containing bacteria, whereas the other clade (CooA-2) is found only in genomes that encode multiple CODH clusters, suggesting that the CooA-2 might be important for cross-regulation of competing CODH operons. Recombinant CooA-1 and CooA-2 regulators from the prototypical CO-utilizing bacterium Carboxydothermus hydrogenoformans were purified, and promoter binding analyses revealed that CooA-1 specifically regulates the hydrogenase-linked CODH, whereas CooA-2 is able to regulate both the hydrogenase-linked CODH and the CODH/ACS operons. These studies point to the ability of dual CooA homologs to partition CO into divergent CO-utilizing pathways resulting in efficient consumption of a single limiting growth substrate available across a wide range of concentrations. PMID:21808633

Techtmann, Stephen M.; Colman, Albert S.; Murphy, Michael B.; Schackwitz, Wendy S.; Goodwin, Lynne A.; Robb, Frank T.

2011-01-01

86

14C Fixation by Leaves and Leaf Cell Protoplasts of the Submerged Aquatic Angiosperm Potamogeton lucens: Carbon Dioxide or Bicarbonate? 1  

PubMed Central

Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is, acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant. PMID:16666848

Staal, Marten; Elzenga, J. Theo M.; Prins, Hidde B. A.

1989-01-01

87

Simulation of permeability evolution of leakage pathway in carbonate-rich caprocks in carbon sequestration  

NASA Astrophysics Data System (ADS)

Geologic carbon sequestration in deep saline aquifers is a promising strategy for mitigating climate change. A major concern is the possibility of brine and CO2 migration through the caprock such as through fractures and faults. In this work, we examine the extent to which mineral dissolution will substantially alter the porosity and permeability of caprock leakage pathways as CO2-acidified brine flows through them. Three models were developed. Firstly, a reactive transport model, Permeability Evolution of Leakage pathway (PEL), was developed to simulate permeability evolution of a leakage pathway during the injection period, and assumes calcite is the only reactive mineral. The system domain is a 100 m long by 0.2 m diameter cylindrical flow path with fixed boundaries containing a rock matrix with an initial porosity of 30% and initial permeability of 1×10-13 m2. One example result is for an initial calcite volume fraction (CVF) of 0.20, in which all the calcite is dissolved after 50 years and the permeability reaches 3.2×10-13 m2. For smaller values of CVF, the permeability reaches its final value earlier but the increase in permeability is minimal. For a large value of CVF such as 0.50, the permeability could eventually reach 1×10-12 m2, but the large amount of dissolved calcium buffers the solution and slows the reaction. After 50 years the permeability change is negligible. Thus, there is a non-monotonic relationship between the amount of calcite in the rock and the resulting permeability change because of the competing dynamics of calcite dissolution and alkalinity build-up. In the second model, PEL was coupled to an existing basin-scale multiphase flow model, Princeton's Estimating Leakage Semi-Analytical (ELSA) model. The new model, ELSA-PEL, estimates the brine and CO2 leakage rates during the injection period under conditions of permeability evolution. The scenario considered in this work is for 50 years of CO2 injection into the Mt. Simon formation in the Michigan basin at an injection rate of 1 Mt/y. As an example, for a CVF value of 5%, the brine leakage rate after fifty years for a leakage pathway 1,000 m distance from the injection well is 0.88 kg/s, which is 2.4% larger than if there were no geochemical evolution of the permeability. In a sensitivity analysis with regard to the distance between the leakage pathway and the injection well, it was found that the cumulative leakage first increases with the distance and the relationship reverses after a certain distance. When the leakage pathway is farther away, the pressure increment drops leading to less acid brine flow; meanwhile, the time before the CO2 plume reaches the pathway is longer and this lengthens the reaction time with brine. Thirdly, we explored the role that SO2 would play if it were present as a co-injectant in carbon sequestration. The reaction considered is SO2 hydrolysis to form sulfurous acid. We expect the sulfurous acid will erode the calcite faster than carbonic acid because it is a stronger acid. Contrary to intuition, the simulation results showed a decrease in permeability due to CaSO3 precipitation in replacement of CaCO3, as CaSO3 has a larger molar volume.

Guo, B.; Fitts, J. P.; Dobossy, M. E.; Peters, C. A.

2013-12-01

88

Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata  

PubMed Central

The shrimp Rimicaris exoculata dominates several hydrothermal vent ecosystems of the Mid-Atlantic Ridge and is thought to be a primary consumer harbouring a chemoautotrophic bacterial community in its gill chamber. The aim of the present study was to test current hypotheses concerning the epibiont's chemoautotrophy, and the mutualistic character of this association. In-vivo experiments were carried out in a pressurised aquarium with isotope-labelled inorganic carbon (NaH13CO3 and NaH14CO3) in the presence of two different electron donors (Na2S2O3 and Fe2+) and with radiolabelled organic compounds (14C-acetate and 3H-lysine) chosen as potential bacterial substrates and/or metabolic by-products in experiments mimicking transfer of small biomolecules from epibionts to host. The bacterial epibionts were found to assimilate inorganic carbon by chemoautotrophy, but many of them (thick filaments of epsilonproteobacteria) appeared versatile and able to switch between electron donors, including organic compounds (heterotrophic acetate and lysine uptake). At least some of them (thin filamentous gammaproteobacteria) also seem capable of internal energy storage that could supply chemosynthetic metabolism for hours under conditions of electron donor deprivation. As direct nutritional transfer from bacteria to host was detected, the association appears as true mutualism. Import of soluble bacterial products occurs by permeation across the gill chamber integument, rather than via the digestive tract. This first demonstration of such capabilities in a decapod crustacean supports the previously discarded hypothesis of transtegumental absorption of dissolved organic matter or carbon as a common nutritional pathway. PMID:22914596

Ponsard, Julie; Cambon-Bonavita, Marie-Anne; Zbinden, Magali; Lepoint, Gilles; Joassin, Andre; Corbari, Laure; Shillito, Bruce; Durand, Lucile; Cueff-Gauchard, Valerie; Compere, Philippe

2013-01-01

89

C3 and C4 pathways of photosynthetic carbon assimilation in marine diatoms are under genetic, not environmental, control1  

Microsoft Academic Search

Marine diatoms are responsible for up to 20% of global CO2 fixation. Their photosynthetic efficiency is enhanced by con- centrating CO2 around Rubisco, diminishing photorespiration, but the mechanism is yet to be resolved. Diatoms have been regarded as C3 photosynthesizers, but recent metabolic labeling and genome sequencing data suggest that they perform C4 photosynthesis. We studied the pathways of photosynthetic

Karen Roberts; Espen Granum; Richard C. Leegood; John A. Raven

90

Mobilization pathways of organic carbon from permafrost to arctic rivers in a changing climate  

E-print Network

Mobilization pathways of organic carbon from permafrost to arctic rivers in a changing climate) from permafrost, which will manifest itself in the fluxes and composition of organic carbon in northern is dominated by old SOC derived from permafrost thawing and river-bank erosion in contrast to DOC, which

Guo, Laodong

91

Carbon Assimilation Pathways, Water Relationships and Plant Ecology.  

ERIC Educational Resources Information Center

Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

Etherington, John R.

1988-01-01

92

Carbon partitioning to the terpenoid biosynthetic pathway enables heterologous ?-phellandrene production in Escherichia coli cultures.  

PubMed

Escherichia coli was used as a microbial system for the heterologous synthesis of ?-phellandrene, a monoterpene of plant origin with several potential commercial applications. Expression of Lavandula angustifolia ?-phellandrene synthase (PHLS), alone or in combination with Picea abies geranyl-diphosphate synthase in E. coli, resulted in no ?-phellandrene accumulation, in sharp contrast to observations with PHLS-transformed cyanobacteria. Lack of ?-phellandrene biosynthesis in E. coli was attributed to the limited endogenous carbon partitioning through the native 2-C-methylerythritol-4-phosphate (MEP) pathway. Heterologous co-expression of the mevalonic acid pathway, enhancing cellular carbon partitioning and flux toward the universal isoprenoid precursors, isopentenyl-diphosphate and dimethylallyl-diphosphate, was required to confer ?-phellandrene production. Differences in endogenous carbon flux toward the synthesis of isoprenoids between photosynthetic (Synechocystis) and non-photosynthetic bacteria (E. coli) are discussed in terms of differences in the regulation of carbon partitioning through the MEP biosynthetic pathway in the two systems. PMID:25116411

Formighieri, Cinzia; Melis, Anastasios

2014-12-01

93

Nitrogen and carbon fixation by Anabaena sp. isolated from a rice paddy and grown under P and light limitations  

Microsoft Academic Search

Anabaena sp., isolated from a rice paddy, was investigated for its nitrogen fixation as measured by acetylene reduction activity (ARA)\\u000a in P-limited continuous and light-limited semi-continuous cultures. Growth rate (?) under P limitation was a function of cell\\u000a P content (q\\u000a p). Both the photosynthetic capacity (Pmax) and photosynthetic efficiency (?) increased with ? when expressed per cell, but not

Hee-Mock Oh; J. Maeng; G-Yull Rhee

1991-01-01

94

Root Carbon Dioxide Fixation by Phosphorus-Deficient Lupinus albus (Contribution to Organic Acid Exudation by Proteoid Roots).  

PubMed Central

When white lupin (Lupinus albus L.) is subjected to P deficiency lateral root development is altered and densely clustered, tertiary lateral roots (proteoid roots) are initiated. These proteoid roots exude large amounts of citrate, which increases P solubilization. In the current study plants were grown with either 1 mM P (+P-treated) or without P (-P-treated). Shoots or roots of intact plants from both P treatments were labeled independently with 14CO2 to compare the relative contribution of C fixed in each with the C exuded from roots as citrate and other organic acids. About 25-fold more acid-stable 14C, primarily in citrate and malate, was recovered in exudates from the roots of -P-treated plants compared with +P-treated plants. The rate of in vivo C fixation in roots was about 4-fold higher in -P-treated plants than in +P-treated plants. Evidence from labeling intact shoots or roots indicates that synthesis of citrate exuded by -P-treated roots is directly related to nonphotosynthetic C fixation in roots. C fixed in roots of -P-treated plants contributed about 25 and 34% of the C exuded as citrate and malate, respectively. Nonphotosynthetic C fixation in white lupin roots is an integral component in the exudation of large amounts of citrate and malate, thus increasing the P available to the plant. PMID:12226371

Johnson, J. F.; Allan, D. L.; Vance, C. P.; Weiblen, G.

1996-01-01

95

Catalytic wet air oxidation of phenol with functionalized carbon materials as catalysts: reaction mechanism and pathway.  

PubMed

The development of highly active carbon material catalysts in catalytic wet air oxidation (CWAO) has attracted a great deal of attention. In this study different carbon material catalysts (multi-walled carbon nanotubes, carbon fibers and graphite) were developed to enhance the CWAO of phenol in aqueous solution. The functionalized carbon materials exhibited excellent catalytic activity in the CWAO of phenol. After 60 min reaction, the removal of phenol was nearly 100% over the functionalized multi-walled carbon, while it was only 14% over the purified multi-walled carbon under the same reaction conditions. Carboxylic acid groups introduced on the surface of the functionalized carbon materials play an important role in the catalytic activity in CWAO. They can promote the production of free radicals, which act as strong oxidants in CWAO. Based on the analysis of the intermediates produced in the CWAO reactions, a new reaction pathway for the CWAO of phenol was proposed in this study. There are some differences between the proposed reaction pathway and that reported in the literature. First, maleic acid is transformed directly into malonic acid. Second, acetic acid is oxidized into an unknown intermediate, which is then oxidized into CO2 and H2O. Finally, formic acid and oxalic acid can mutually interconvert when conditions are favorable. PMID:25108731

Wang, Jianbing; Fu, Wantao; He, Xuwen; Yang, Shaoxia; Zhu, Wanpeng

2014-08-01

96

ENZYMOLOGY: A Trio of Transition Metals in Anaerobic CO2 Fixation  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Certain anaerobic microorganisms can gain energy and biomass using carbon monoxide or dioxide and dihydrogen as sole sources of carbon and energy. In his Perspective, Peters explains how new results by Doukov et al. illuminate the carbon dioxide fixation pathway. Doukov et al. report that the enzyme responsible for the process contains a highly unusual metal cluster, with three different transition metals including copper, in one of its active sites.

John W. Peters (Montana State University;Department of Chemistry and Biochemistry)

2002-10-18

97

Comparison of the Kinetics of Photosynthetic Carbon Dioxide Fixation in Maize, Sugar Cane and Tobacco, and its Relation to Photorespiration  

Microsoft Academic Search

MOST plants exhibit the phenomenon of photorespiration : that is to say they give out a certain amount of carbon dioxide in the light. This effect is usually masked by the occurrence of photosynthesis which takes up carbon dioxide at a greater rate than photorespiration releases it. Photorespiration can, however, usually be demonstrated by allowing leaves to photosynthesize in an

A. Goldsworthy

1968-01-01

98

Mechanistic models of oceanic nitrogen fixation  

E-print Network

Oceanic nitrogen fixation and biogeochemical interactions between the nitrogen, phosphorus and iron cycles have important implications for the control of primary production and carbon storage in the ocean. The biological ...

Monteiro, Fanny

2009-01-01

99

Incomplete Wood-Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi  

PubMed Central

The acetyl-CoA “Wood–Ljungdahl” pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood–Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood–Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L.; Feng, Xueyang; Men, Yujie; Conrad, Mark E.; Tang, Yinjie J.; Alvarez-Cohen, Lisa

2014-01-01

100

Incomplete Wood-Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi.  

PubMed

The acetyl-CoA "Wood-Ljungdahl" pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood-Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood-Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L; Feng, Xueyang; Men, Yujie; Conrad, Mark E; Tang, Yinjie J; Alvarez-Cohen, Lisa

2014-04-29

101

Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor  

SciTech Connect

Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. We observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.

Younker, Jarod M [ORNL; Saito, Tomonori [ORNL; Hunt, Marcus A [ORNL; Beste, Ariana [ORNL; Naskar, Amit K [ORNL

2013-01-01

102

Membrane perturbation by carbon nanotube insertion: pathways to internalization.  

PubMed

Carbon nanotubes (CNTs) can penetrate the membranes of cells, offering prospects for nanomedicine but problems for nanotoxicity. Molecular simulations are used to provide a systematic analysis of the interactions of single-walled and multi-walled CNTs of different radii with a model lipid bilayer membrane. The simulations allow characterization of the mechanism of spontaneous exothermic insertion of CNTs into lipid bilayer membranes. The size and type of CNT determine the nature and extent of the local perturbation of the bilayer. Single-walled CNTs are shown to insert via a two-step mechanism with initial transient formation of a water filled pore followed by full insertion of the CNT into the bilayer. The latter stage is associated with formation of a persistent inverted micelle arrangement of lipid molecules trapped inside the CNT. This suggests a possible vehicle for nano-encapsulation of drugs, enabling their entry into and subsequent release within cells following endocytosis of CNT-containing membranes. PMID:23418066

Lelimousin, Mickaël; Sansom, Mark S P

2013-11-11

103

Quantifying carbon fixation in trace minerals from processed kimberlite: A comparative study of quantitative methods using X-ray powder diffraction data with applications to the Diavik Diamond Mine, Northwest Territories, Canada  

Microsoft Academic Search

The capacity of mine waste to trap CO2 is, in some cases, much larger than the greenhouse gas production of a mining operation. In mine tailings, the presence of secondary carbonate minerals that trap CO2 can therefore represent substantial fixation of this greenhouse gas. The abilities of three methods of quantitative phase analysis to measure trace nesquehonite (MgCO3·3H2O) in samples

Siobhan A. Wilson; Mati Raudsepp; Gregory M. Dipple

2009-01-01

104

Evidence for the adaptive evolution of the carbon fixation gene rbcL during diversification in temperature tolerance of a clade of hot spring cyanobacteria.  

PubMed

Determining the molecular basis of enzyme adaptation is central to understanding the evolution of environmental tolerance but is complicated by the fact that not all amino acid differences between ecologically divergent taxa are adaptive. Analysing patterns of nucleotide sequence evolution can potentially guide the investigation of protein adaptation by identifying candidate codon sites on which diversifying selection has been operating. Here, I test whether there is evidence for molecular adaptation of the carbon fixation gene rbcL for a clade of hot spring cyanobacteria in the genus Synechococcus that has diverged in thermotolerance. Amino acid replacements during Synechococcus radiation have resulted in an increase in the number of hydrophobic residues in the RbcLs of more thermotolerant strains. A similar increase in hydrophobicity has been observed for many thermostable proteins. Maximum likelihood models which allow for heterogeneity among codon sites in the ratio of nonsynonymous to synonymous nucleotide substitutions estimated a class of amino acid sites as a target of positive selection. Depending on the model, a single amino acid site that interacts with a flexible element involved in the opening and closing of the active site was estimated with either low or moderate support to be a member of this class. Site-directed mutagenesis approaches are being explored in order to directly test its adaptive significance. PMID:12694287

Miller, S R

2003-05-01

105

C(4) Photosynthesis: Light-dependent CO(2) Fixation by Mesophyll Cells, Protoplasts, and Protoplast Extracts of Digitaria sanguinalis.  

PubMed

Mesophyll cells, protoplasts, and protoplast extracts of Digitaria sanguinalis were used for comparative studies of light-dependent CO(2) fixation. CO(2) fixation was low without the addition of organic substrates. Pyruvate, oxaloacetate, and 3-phosphoglycerate induced relatively low rates (10 to 90 mumoles/mg chlorophyll.hr) of CO(2) fixation when added separately. However, a highly synergistic relationship was found between pyruvate + oxaloacetate and pyruvate + 3-phosphoglycerate for inducing light-dependent CO(2) fixation in the mesophyll preparations. Highest rates of CO(2) fixation were obtained with protoplast extracts. Pyruvate, in combination with oxaloacetate or 3-phosphoglycerate induced light-dependent rates from 150 to 380 mumoles of CO(2) fixed/mg chlorophyll.hr which are equivalent to or exceed reported rates of whole leaf photosynthesis in C(4) species. Concentrations of various substrates required to give half-maximum velocities of CO(2) fixation were determined, with the protoplast extracts generally saturating at the lowest substrate concentrations. Chloroplasts separated from protoplast extracts showed little capacity for CO(2) fixation. The results suggest that CO(2) fixation in C(4) mesophyll cells is dependent on chloroplasts and extrachloroplastic phosphoenolpyruvate carboxylase.The stimulation of pyruvate-induced CO(2) fixation by oxaloacetate and 3-phosphoglycerate is thought to be due to induction of noncyclic electron transport which generates ATP for the conversion of pyruvate to phosphoenolpyruvate by pyruvate Pi dikinase. The primary products of the substrate-induced CO(2) fixation were oxaloacetate and malate, which provides further evidence for carbon fixation through the beta-carboxylation pathway. High rates of light-dependent CO(2) fixation with a significant percentage of (14)C fixed into malate suggest an efficient operation of both photosystems I and II.The substrate inductions are discussed with respect to the proposed role of the mesophyll cell in C(4) photosynthesis, and schemes suggesting the stoichiometry of energy requirements for photosynthetic carbon metabolism in C(4) mesophyll cells are presented. PMID:16659177

Huber, S C; Edwards, G E

1975-05-01

106

Gene regulation of carbon fixation, storage, and utilization in the diatom Phaeodactylum tricornutum acclimated to light/dark cycles.  

PubMed

The regulation of carbon metabolism in the diatom Phaeodactylum tricornutum at the cell, metabolite, and gene expression levels in exponential fed-batch cultures is reported. Transcriptional profiles and cell chemistry sampled simultaneously at all time points provide a comprehensive data set on carbon incorporation, fate, and regulation. An increase in Nile Red fluorescence (a proxy for cellular neutral lipids) was observed throughout the light period, and water-soluble glucans increased rapidly in the light period. A near-linear decline in both glucans and lipids was observed during the dark period, and transcription profile data indicated that this decline was associated with the onset of mitosis. More than 4,500 transcripts that were differentially regulated during the light/dark cycle are identified, many of which were associated with carbohydrate and lipid metabolism. Genes not previously described in algae and their regulation in response to light were integrated in this analysis together with proposed roles in metabolic processes. Some very fast light-responding genes in, for example, fatty acid biosynthesis were identified and allocated to biosynthetic processes. Transcripts and cell chemistry data reflect the link between light energy availability and light energy-consuming metabolic processes. Our data confirm the spatial localization of processes in carbon metabolism to either plastids or mitochondria or to glycolysis/gluconeogenesis, which are localized to the cytosol, chloroplast, and mitochondria. Localization and diel expression pattern may be of help to determine the roles of different isoenzymes and the mining of genes involved in light responses and circadian rhythms. PMID:23209127

Chauton, Matilde Skogen; Winge, Per; Brembu, Tore; Vadstein, Olav; Bones, Atle M

2013-02-01

107

Aquatic carbon and GHG losses via the aquatic pathway in an arctic catchment  

NASA Astrophysics Data System (ADS)

Based in Northwest Canada, the HYDRA project ('Permafrost catchments in transition: hydrological controls on carbon cycling and greenhouse gas budgets') aims to understand the fundamental role that hydrological processes play in regulating landscape-scale carbon fluxes. The project aims to determine a) the role of vegetation functional type in carbon uptake, turnover and allocation, b) how the same functional types influence the delivery of soil-derived carbon to surface waters, and c) how important the aquatic carbon and greenhouse gas (GHG) losses are relative to catchment scale terrestrial fluxes. Here we focus on the magnitude of the aquatic concentrations and fluxes, presenting results from the first year of field sampling. Concentrations of the greenhouse gases CO2, CH4 and N2O, as well as dissolved organic and inorganic carbon (DOC and DIC), will be presented from a range of freshwater types within the tundra landscape; sites include lakes, polygons and the 'Siksik' stream which drains the primary study catchment. Eight sampling locations were selected along the approximately 2km long Siksik stream to allow carbon and GHG concentrations to be considered within a set of nested subcatchments. This synoptic sampling regime, in combination with stable isotopes and major ion concentrations also measured at each sampling point, will allow inputs of carbon and GHGs to be traced to source areas within the catchment. Evasion and downstream export will also be calculated and preliminary results presented in the context of quantifying the relative importance of the aquatic pathway to the full catchment carbon and greenhouse gas budgets. This analysis will also allow an initial comparison between the relative importance of different water bodies within the catchment, highlighting spatial hotspots to be prioritized in future campaigns.

Dinsmore, Kerry; Billett, Mike; Lessels, Jason; Street, Lorna; Wookey, Philip; Baxter, Robert; Subke, Jens-Arne; Tetzlaff, Doerthe

2014-05-01

108

Carbon Metabolic Pathways in Phototrophic Bacteria and Their Broader Evolutionary Implications  

PubMed Central

Photosynthesis is the biological process that converts solar energy to biomass, bio-products, and biofuel. It is the only major natural solar energy storage mechanism on Earth. To satisfy the increased demand for sustainable energy sources and identify the mechanism of photosynthetic carbon assimilation, which is one of the bottlenecks in photosynthesis, it is essential to understand the process of solar energy storage and associated carbon metabolism in photosynthetic organisms. Researchers have employed physiological studies, microbiological chemistry, enzyme assays, genome sequencing, transcriptomics, and 13C-based metabolomics/fluxomics to investigate central carbon metabolism and enzymes that operate in phototrophs. In this report, we review diverse CO2 assimilation pathways, acetate assimilation, carbohydrate catabolism, the tricarboxylic acid cycle and some key, and/or unconventional enzymes in central carbon metabolism of phototrophic microorganisms. We also discuss the reducing equivalent flow during photoautotrophic and photoheterotrophic growth, evolutionary links in the central carbon metabolic network, and correlations between photosynthetic and non-photosynthetic organisms. Considering the metabolic versatility in these fascinating and diverse photosynthetic bacteria, many essential questions in their central carbon metabolism still remain to be addressed. PMID:21866228

Tang, Kuo-Hsiang; Tang, Yinjie J.; Blankenship, Robert Eugene

2011-01-01

109

Review article Oak growth, development and carbon metabolism  

E-print Network

fixation such as photosystem II light energy conversion and the dark reactions of Rubisco carbon fixation / water-stress tolerance / photosynthesis / stomatal response / nonstomatal response / Rubisco / carbon

Paris-Sud XI, Université de

110

Autotrophic Methanotrophy in Verrucomicrobia: Methylacidiphilum fumariolicumSolV Uses the Calvin-Benson-Bassham Cycle for Carbon Dioxide Fixation ? †  

PubMed Central

Genome data of the extreme acidophilic verrucomicrobial methanotroph Methylacidiphilum fumariolicumstrain SolV indicated the ability of autotrophic growth. This was further validated by transcriptome analysis, which showed that all genes required for a functional Calvin-Benson-Bassham (CBB) cycle were transcribed. Experiments with 13CH4or 13CO2in batch and chemostat cultures demonstrated that CO2is the sole carbon source for growth of strain SolV. In the presence of CH4, CO2concentrations in the headspace below 1% (vol/vol) were growth limiting, and no growth was observed when CO2concentrations were below 0.3% (vol/vol). The activity of the key enzyme of the CBB cycle, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), measured with a 13C stable-isotope method was about 70 nmol CO2fixed · min?1· mg of protein?1. An immune reaction with antibody against the large subunit of RuBisCO on Western blots was found only in the supernatant fractions of cell extracts. The apparent native mass of the RuBisCO complex in strain SolV was about 482 kDa, probably consisting of 8 large (53-kDa) and 8 small (16-kDa) subunits. Based on phylogenetic analysis of the corresponding RuBisCO gene, we postulate that RuBisCO of the verrucomicrobial methanotrophs represents a new type of form I RuBisCO. PMID:21725016

Khadem, Ahmad F.; Pol, Arjan; Wieczorek, Adam; Mohammadi, Seyed S.; Francoijs, Kees-Jan; Stunnenberg, Henk G.; Jetten, Mike S. M.; Op den Camp, Huub J. M.

2011-01-01

111

Nitrogen- and irradiance-dependent variations of the maximum quantum yield of carbon fixation in eutrophic, mesotrophic and oligotrophic marine systems  

NASA Astrophysics Data System (ADS)

Natural variability of the maximum quantum yield of carbon fixation ( ?C max), as determined from the initial slope of the photosynthesis-irradiance curve and from light absorption measurements, was studied at three sites in the northeast tropical Atlantic representing typical eutrophic, mesotrophic and oligotrophic regimes. At the eutrophic and mesotrophic sites, where the mixed layer extended deeper than the euphotic layer, all photosynthetic parameters were nearly constant with depth, and ?C max averaged between 0.05 and 0.03 molC (mol quanta absorbed) -1, respectively. At the oligotrophic site, a deep chlorophyll maximum (DCM) existed and ?C max varied from ca 0.005 in the upper nutrient-depleted mixed layer to 0.063 below the DCM in stratified waters. firstly, ?C max was found roughly to covary with nitrate concentration between sites and with depth at the oligotrophic site, and secondly, it was found to decrease with increasing relative concentrations of non-photosynthetic pigments. The extent of ?C max variations directly related to nitrate concentration was inferred from variations in the fraction of functional PS2 reaction centers ( f), measured using fast repetition rate fluorometry. Covariations between f and nitrate concentration indicate that the latter factor may be responsible for a 2-fold variation in ?C max. Moreover, partitioning light absorption between photosynthetic and non-photosynthetic pigments suggests that the variable contribution of the non-photosynthetic absorption may explain a 3-fold variation in ?C max, as indicated by variations in the effective absorption cross-section of photosystem 2 ( ?PS2). Results confirm the role of nitrate in ?C max variation, and emphasize those of light and vertical mixing.

Babin, Marcel; Morel, André; Claustre, Hervé; Bricaud, Annick; Kolber, Zbigniew; Falkowski, Paul G.

1996-08-01

112

Dinitrogen fixation in aphotic oxygenated marine environments  

PubMed Central

We measured N2 fixation rates from oceanic zones that have traditionally been ignored as sources of biological N2 fixation; the aphotic, fully oxygenated, nitrate (NO?3)-rich, waters of the oligotrophic Levantine Basin (LB) and the Gulf of Aqaba (GA). N2 fixation rates measured from pelagic aphotic waters to depths up to 720 m, during the mixed and stratified periods, ranged from 0.01 nmol N L?1 d?1 to 0.38 nmol N L?1 d?1. N2 fixation rates correlated significantly with bacterial productivity and heterotrophic diazotrophs were identified from aphotic as well as photic depths. Dissolved free amino acid amendments to whole water from the GA enhanced bacterial productivity by 2–3.5 fold and N2 fixation rates by ~2-fold in samples collected from aphotic depths while in amendments to water from photic depths bacterial productivity increased 2–6 fold while N2 fixation rates increased by a factor of 2 to 4 illustrating that both BP and heterotrophic N2 fixation were carbon limited. Experimental manipulations of aphotic waters from the LB demonstrated a significant positive correlation between transparent exopolymeric particle (TEP) concentrations and N2 fixation rates. This suggests that sinking organic material and high carbon (C): nitrogen (N) micro-environments (such as TEP-based aggregates or marine snow) could support high heterotrophic N2 fixation rates in oxygenated surface waters and in the aphotic zones. Indeed, our calculations show that aphotic N2 fixation accounted for 37 to 75% of the total daily integrated N2 fixation rates at both locations in the Mediterranean and Red Seas with rates equal or greater to those measured from the photic layers. Moreover, our results indicate that that while N2 fixation may be limited in the surface waters, aphotic, pelagic N2 fixation may contribute significantly to new N inputs in other oligotrophic basins, yet it is currently not included in regional or global N budgets. PMID:23986748

Rahav, Eyal; Bar-Zeev, Edo; Ohayon, Sarah; Elifantz, Hila; Belkin, Natalia; Herut, Barak; Mulholland, Margaret R.; Berman-Frank, Ilana

2013-01-01

113

Nitrogen fixation by biological soil crusts and heterotrophic bacteria in an intact Mojave Desert ecosystem with elevated CO 2 and added soil carbon  

Microsoft Academic Search

Fixation of N by biological soil crusts and free-living heterotrophic soil microbes provides a significant proportion of ecosystem N in arid lands. To gain a better understanding of how elevated CO2 may affect N2-fixation in aridland ecosystems, we measured C2H2 reduction as a proxy for nitrogenase activity in biological soil crusts for 2yr, and in soils either with or without

S. A. Billings; S. M. Schaeffer; R. D. Evans

2003-01-01

114

Catalytic ozonation of sulphamethoxazole in the presence of carbon materials: catalytic performance and reaction pathways.  

PubMed

Two carbon materials (multi-walled carbon nanotubes, MWCNTs, and activated carbon) were investigated as ozonation catalysts for the mineralization of the antibiotic sulphamethoxazole (SMX). MWCNTs presented a higher catalytic performance than activated carbons, which was justified by their differences in surface chemistry and by the higher internal mass transfer resistances expected for activated carbons. 3-Amino-5-methylisoxazole and p-benzoquinone were detected as primary products of single and catalytic ozonation of SMX, whereas oxamic, oxalic, pyruvic and maleic acids were identified as refractory final oxidation products. The original sulphur of the SMX was almost completely converted to sulphate and part of the nitrogen was converted to NH4+ and NO3-. The presence of the radical scavenger tert-butanol during catalytic and single ozonation evidenced the participation of HO radicals in the oxidation mechanisms of SMX, especially in the mineralization of several intermediates. Microtox tests revealed that simultaneous use of ozone and MWCNTs originated lower acute toxicity. The time course of all detected compounds was studied and the transformation pathway for the complete mineralization of SMX by single and catalytic ozonation in the presence of the selected materials was elucidated. PMID:23009796

Gonçalves, Alexandra G; Órfão, José J M; Pereira, Manuel Fernando R

2012-11-15

115

Carbon dioxide metabolism by Actinomyces viscosus: pathways for succinate and aspartate production.  

PubMed Central

14C-labeled bicarbonate was incorporated into trichloroacetic acid-insoluble material by cell suspensions of A. viscosus strain M100 and also into the four-carbon fermentation product, succinate, but not into the three-carbon fermentation product, lactate. The initial step in the conversion of 14C-labeled bicarbonate into both trichloroacetic acid-insoluble material and succinate was catalyzed by the enzyme phosphoenolypyruvate carboxylase, which served to convert the glycolytic intermediate, phosphoenolpyruvate, and bicarbonate to the four-carbon compound, oxalacetate. The metabolic fate of oxalacetate was its conversion to either trichloroacetic acid-insoluble material or succinate. One pathway by which oxalacetate may be metabolized into acid-insoluble material is via its conversion to the biosynthetic precursor aspartate by the action of glutamate aspartate aminotransferase. One source of the alpha-amino group of aspartate was the ammonium ion, which could be incorporated into glutamate, the substrate of the glutamate aspartate aminotransferase reaction, by the action of a reduced nicotinamide adenine dinucleotide phosphate-dependent glutamate dehydrogenase whose reducing equivalents could be derived from the nicotinamide adenine dinucleotide phosphate-dependent oxidative reactions of the hexose monophosphate pathway catalyzed by glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase. Alternatively, oxalacetate was converted to the fermentation product, succinate, through the sequential action of malate dehydrogenase, fumarase, and succinic dehydrogenase. The resolution and partial purification of phosphoenolpyruvate carboxylase, glutamate aspartate aminotransferase, glutamate dehydrogenase, malate dehydrogenase, fumarase, and succinic dehydrogenase are also reported. PMID:6769822

Brown, A T; Breeding, L C

1980-01-01

116

Biomarker Evidence for a Major Preservation Pathway of Sedimentary Organic Carbon  

NASA Astrophysics Data System (ADS)

Hydrogenation processes leading from biomolecules to fossil biomarkers in anoxic sediments are crucial for the preservation of organic matter. However, these processes are still poorly understood. The present identification of several reduced carotenoids in recent sediments attests that these processes operate at the earliest stages of diagenesis without structural or stereochemical specificity, implying a nonbiological reduction pathway. Sulfur species (e.g., H2S) are the hydrogen donors involved in such reduction, as demonstrated with laboratory experiments. These reactions allow the preservation of abundant organic carbon in the rock record.

Hebting, Y.; Schaeffer, P.; Behrens, A.; Adam, P.; Schmitt, G.; Schneckenburger, P.; Bernasconi, S. M.; Albrecht, P.

2006-06-01

117

Methylamine Utilization via the N-Methylglutamate Pathway in Methylobacterium extorquens PA1 Involves a Novel Flow of Carbon through C1 Assimilation and Dissimilation Pathways.  

PubMed

Methylotrophs grow on reduced single-carbon compounds like methylamine as the sole source of carbon and energy. In Methylobacterium extorquens AM1, the best-studied aerobic methylotroph, a periplasmic methylamine dehydrogenase that catalyzes the primary oxidation of methylamine to formaldehyde has been examined in great detail. However, recent metagenomic data from natural ecosystems are revealing the abundance and importance of lesser-known routes, such as the N-methylglutamate pathway, for methylamine oxidation. In this study, we used M. extorquens PA1, a strain that is closely related to M. extorquens AM1 but is lacking methylamine dehydrogenase, to dissect the genetics and physiology of the ecologically relevant N-methylglutamate pathway for methylamine oxidation. Phenotypic analyses of mutants with null mutations in genes encoding enzymes of the N-methylglutamate pathway suggested that ?-glutamylmethylamide synthetase is essential for growth on methylamine as a carbon source but not as a nitrogen source. Furthermore, analysis of M. extorquens PA1 mutants with defects in methylotrophy-specific dissimilatory and assimilatory modules suggested that methylamine use via the N-methylglutamate pathway requires the tetrahydromethanopterin (H4MPT)-dependent formaldehyde oxidation pathway but not a complete tetrahydrofolate (H4F)-dependent formate assimilation pathway. Additionally, we present genetic evidence that formaldehyde-activating enzyme (FAE) homologs might be involved in methylotrophy. Null mutants of FAE and homologs revealed that FAE and FAE2 influence the growth rate and FAE3 influences the yield during the growth of M. extorquens PA1 on methylamine. PMID:25225269

Nayak, Dipti D; Marx, Christopher J

2014-12-01

118

Carbon emission limits required to satisfy future representative concentration pathways of greenhouse gases  

NASA Astrophysics Data System (ADS)

The response of the second-generation Canadian earth system model (CanESM2) to historical (1850-2005) and future (2006-2100) natural and anthropogenic forcing is assessed using the newly-developed representative concentration pathways (RCPs) of greenhouse gases (GHGs) and aerosols. Allowable emissions required to achieve the future atmospheric CO2 concentration pathways, are reported for the RCP 2.6, 4.5 and 8.5 scenarios. For the historical 1850-2005 period, cumulative land plus ocean carbon uptake and, consequently, cumulative diagnosed emissions compare well with observation-based estimates. The simulated historical carbon uptake is somewhat weaker for the ocean and stronger for the land relative to their observation-based estimates. The simulated historical warming of 0.9°C compares well with the observation-based estimate of 0.76 ± 0.19°C. The RCP 2.6, 4.5 and 8.5 scenarios respectively yield warmings of 1.4, 2.3, and 4.9°C and cumulative diagnosed fossil fuel emissions of 182, 643 and 1617 Pg C over the 2006-2100 period. The simulated warming of 2.3°C over the 1850-2100 period in the RCP 2.6 scenario, with the lowest concentration of GHGs, is slightly larger than the 2°C warming target set to avoid dangerous climate change by the 2009 UN Copenhagen Accord. The results of this study suggest that limiting warming to roughly 2°C by the end of this century is unlikely since it requires an immediate ramp down of emissions followed by ongoing carbon sequestration in the second half of this century.

Arora, V. K.; Scinocca, J. F.; Boer, G. J.; Christian, J. R.; Denman, K. L.; Flato, G. M.; Kharin, V. V.; Lee, W. G.; Merryfield, W. J.

2011-03-01

119

ORIGINAL PAPER Biological nitrogen fixation by common beans  

E-print Network

ORIGINAL PAPER Biological nitrogen fixation by common beans (Phaseolus vulgaris L.) increases biological N2 fixation (BNF) by common beans (Phaseolus vulgaris L.) through bio-char additions (charcoal, biomass-derived black carbon). Bio- char was added at 0, 30, 60, and 90 g kg-1 soil, and BNF

Lehmann, Johannes

120

3, 10491080, 2006 Fate of N2 fixation  

E-print Network

from N2 fixation M. R. Mulholland Department of Ocean, Earth and Atmospheric Sciences, Old Dominion and colonial morphologies, and in various defined physiological states. Ni-15 trogen and carbon fixation rates information. Tri- chodesmium spp. occur throughout the subtropical and tropical ocean where it can5 represent

Boyer, Edmond

121

Investigation of inter-individual variability of the one-carbon folate pathway: a bioinformatic and genetic review  

Microsoft Academic Search

Genetic polymorphisms in the one-carbon folate pathway have been widely studied in association with a number of conditions. Most of the research has focused on the 677C>T polymorphism in the coding region of the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene. However, there are a total of 25 genes in this pathway coding for enzymes, transporters and receptors, which can be investigated using

D F Carr; G Whiteley; A Alfirevic; M Pirmohamed

2009-01-01

122

Amino Acid Biosynthesis Pathways in Diatoms  

PubMed Central

Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

Bromke, Mariusz A.

2013-01-01

123

Genetic Evidence of a Major Role for Glucose6Phosphate Dehydrogenase in Nitrogen Fixation and Dark Growth of the CyanobacteriumNostocsp. Strain ATCC 29133  

Microsoft Academic Search

Heterocysts, sites of nitrogen fixation in certain filamentous cyanobacteria, are limited to a heterotrophic metabolism,ratherthanthephotoautotrophicmetabolismcharacteristicofcyanobacterialvegetativecells.The metabolic route of carbon catabolism in the supply of reductant to nitrogenase and for respiratory electron transport in heterocysts is unresolved. The gene (zwf) encoding glucose-6-phosphate dehydrogenase (G6PD), the initial enzyme of the oxidative pentose phosphate pathway, was inactivated in the heterocyst-forming, facultativelyheterotrophiccyanobacterium,Nostocsp.strainATCC29133.Thezwfmutantstrainhadlessthan 5% of

MICHAEL L. SUMMERS; JAMES G. WALLIS; ELSIE L. CAMPBELL; ANDJOHN C. MEEKS

124

The catalytic pathways of hydrohalogenation over metal-free nitrogen-doped carbon nanotubes.  

PubMed

Nitrogen-doped carbon nanotubes (N-CNTs) are found to be active as one novel heterogeneous catalyst for acetylene hydrochlorination reaction, possessing good activity (TOF=2.3×10(-3) ?s(-1) ) and high selectivity (>98?%). Compared to toxic and energy-consuming conventional catalysts, such as HgCl2 , N-CNTs are more favorable in terms of sustainability, because of their thermo-stability, metal-free make up, and the wide availability of bulk CNT. Coupling X-ray photoelectron spectroscopy and density functional theory computations (DFT), the main active source and reaction pathway are shown. Good linearity between the quaternary nitrogen content and conversion is revealed. DFT study shows that the nitrogen doping enhanced the formation of the covalent bond between C2 H2 and NCNT compared with the undoped CNT, and therefore promoted the addition reaction of the C2 H2 and HCl into C2 H3 Cl. PMID:24458768

Zhou, Kai; Li, Bo; Zhang, Qiang; Huang, Jia-Qi; Tian, Gui-Li; Jia, Jin-Chao; Zhao, Meng-Qiang; Luo, Guo-Hua; Su, Dang Sheng; Wei, Fei

2014-03-01

125

C1 Metabolism in Corynebacterium glutamicum: an Endogenous Pathway for Oxidation of Methanol to Carbon Dioxide  

PubMed Central

Methanol is considered an interesting carbon source in “bio-based” microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert 13C-labeled methanol to 13CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

Witthoff, Sabrina; Muhlroth, Alice

2013-01-01

126

Temporal and Spatial Deployment of Carbon Dioxide Capture and Storage Technologies across the Representative Concentration Pathways  

SciTech Connect

The Intergovernmental Panel on Climate Change’s (IPCC) Fifth Assessment (to be published in 2013-2014) will to a significant degree be built around four Representative Concentration Pathways (RCPs) that are intended to represent four scenarios of future development of greenhouse gas emissions, land use, and concentrations that span the widest range of potential future atmospheric radiative forcing. Under the very stringent climate policy implied by the 2.6 W/m2 overshoot scenario, all electricity is eventually generated from low carbon sources. However, carbon dioxide capture and storage (CCS) technologies never comprise more than 50% of total electricity generation in that very stringent scenario or in any of the other cases examined here. There are significant differences among the cases studied here in terms of how CCS technologies are used, with the most prominent being is the significant expansion of biomass+CCS as the stringency of the implied climate policy increases. Cumulative CO2 storage across the three cases that imply binding greenhouse gas constraints ranges by nearly an order of magnitude from 170GtCO2 (radiative forcing of 6.0W/m2 in 2100) to 1600GtCO2 (2.6W/m2 in 2100) over the course of this century. This potential demand for deep geologic CO2 storage is well within published estimates of total global CO2 storage capacity.

Dooley, James J.; Calvin, Katherine V.

2011-04-18

127

Genetic and transgenic perturbations of carbon reserve production in Arabidopsis seeds reveal metabolic interactions of biochemical pathways  

Microsoft Academic Search

The biosynthesis of seed oil and starch both depend on the supply of carbon from the maternal plant. The biochemical interactions between these two pathways are not fully understood. In the Arabidopsis mutant shrunken seed 1 (sse1)\\/pex16, a reduced rate of fatty acid synthesis leads to starch accumulation. To further understand the metabolic impact of the decrease in oil synthesis,

Yun Lin; Alexander V. Ulanov; Vera Lozovaya; Jack Widholm; Guirong Zhang; Jinhua Guo; Howard M. Goodman

2006-01-01

128

Constraining pathways of microbial mediation for carbonate concretions of the Miocene Monterey Formation using carbonate-associated sulfate  

NASA Astrophysics Data System (ADS)

Carbonate concretions can form as a result of organic matter degradation within sediments. However, the ability to determine specific processes and timing relationships to particular concretions has remained elusive. Previously employed proxies (e.g., carbon and oxygen isotopes) cannot uniquely distinguish among diagenetic alkalinity sources generated by microbial oxidation of organic matter using oxygen, nitrate, metal oxides, and sulfate as electron acceptors, in addition to degradation by thermal decarboxylation. Here, we employ concentrations of carbonate-associated sulfate (CAS) and ? 34S CAS (along with more traditional approaches) to determine the specific nature of concretion authigenesis within the Miocene Monterey Formation. Integrated geochemical analyses reveal that at least three specific organo-diagenetic reaction pathways can be tied to concretion formation and that these reactions are largely sample-site specific. One calcitic concretion from the Phosphatic Shale Member at Naples Beach yields ? 34S CAS values near Miocene seawater sulfate (˜+22‰ VCDT), abundant CAS (ca. 1000 ppm), depleted ? 13C carb (˜-11‰ VPDB), and very low concentrations of Fe (ca. 700 ppm) and Mn (ca. 15 ppm)—characteristics most consistent with shallow formation in association with organic matter degradation by nitrate, iron-oxides and/or minor sulfate reduction. Cemented concretionary layers of the Phosphatic Shale Member at Shell Beach display elevated ? 34S CAS (up to ˜+37‰), CAS concentrations of ˜600 ppm, mildly depleted ? 13C carb (˜-6‰), moderate amounts of Mn (ca. 250 ppm), and relatively low Fe (ca. 1700 ppm), indicative of formation in sediments dominated by sulfate reduction. Finally, concretions within a siliceous host at Montaña de Oro and Naples Beach show minimal CAS concentrations, positive ? 13C values, and the highest concentrations of Fe (ca. 11,300 ppm) and Mn (ca. 440 ppm), consistent with formation in sediments experiencing methanogenesis in a highly reducing environment. This study highlights the promise in combining CAS analysis with more traditional techniques to differentiate among diagenetic reactions as preserved in the geologic record and shows potential for unraveling subsurface biospheric processes in ancient samples with a high degree of specificity.

Loyd, Sean J.; Berelson, William M.; Lyons, Timothy W.; Hammond, Douglas E.; Corsetti, Frank A.

2012-02-01

129

Pathways of carbon oxidation in continental margin sediments off central Chile.  

PubMed

Rates and oxidative pathways of organic carbon mineralization were determined in sediments at six stations on the shelf and slope off Concepcion Bay at 36.5 degrees S. The depth distribution of C oxidation rates was determined to 10 cm from accumulation of dissolved inorganic C in 1-5-d incubations. Pathways of C oxidation were inferred from the depth distributions of the potential oxidants (O2, NO3-, and oxides of Mn and Fe) and from directly determined rates of SO4(2-) reduction. The study area is characterized by intense seasonal upwelling, and during sampling in late summer the bottom water over the shelf was rich in NO3- and depleted of O2. Sediments at the four shelf stations were covered by mats of filamentous bacteria of the genera Thioploca and Beggiatoa. Carbon oxidation rates at these sites were extremely high near the sediment surface (>3 micromol cm-3 d-1) and decreased exponentially with depth. The process was entirely coupled to SO4(2-) reduction. At the two slope stations where bottom-water O2 was > 100 microM, C oxidation rates were 10-fold lower and varied less with depth; C oxidation coupled to the reduction of O2, NO3-, and Mn oxides combined to yield an estimated 15% of the total C oxidation between 0 and 10 cm. Carbon oxidation through Fe reduction contributed a further 12-29% of the depth-integrated rate, while the remainder of C oxidation was through SO4(2-) reduction. The depth distribution of Fe reduction agreed well with the distribution of poorly crystalline Fe oxides, and as this pool decreased with depth, the importance of SO4(2-) reduction increased. The results point to a general importance of Fe reduction in C oxidation in continental margin sediments. At the shelf stations, Fe reduction was mainly coupled to oxidation of reduced S. These sediments were generally H2S-free despite high SO4(2-) reduction rates, and precipitation of Fe sulfides dominated H2S scavenging during the incubations. A large NO3- pool was associated with the Thioploca, and the shelf sediments were thus enriched in NO3- relative to the bottom water, with maximum concentrations of 3 micromol cm-3. The NO3- was consumed during our sediment incubations, but no effects on either C or S cycles could be discerned. PMID:11540503

Thamdrup, B; Canfield, D E

1996-12-01

130

Multiwall carbon nanotubes mediate macrophage activation and promote pulmonary fibrosis through TGF-?/Smad signaling pathway.  

PubMed

Multiwall carbon nanotubes (MWCNTs) have been widely used in many disciplines due to their unique physical and chemical properties, but have also raised great concerns about their possible negative health impacts, especially through occupational exposure. Although recent studies have demonstrated that MWCNTs induce granuloma formation and/or fibrotic responses in the lungs of rats or mice, their cellular and molecular mechanisms remain largely unaddressed. Here, it is reported that the TGF-?/Smad signaling pathway can be activated by MWCNTs and play a critical role in MWCNT-induced pulmonary fibrosis. Firstly, in vivo data show that spontaneously hypertensive (SH) rats administered long MWCNTs (20-50 ?m) but not short MWCNTs (0.5-2 ?m) exhibit increased fibroblast proliferation, collagen deposition and granuloma formation in lung tissue. Secondly, the in vivo experiments also indicate that only long MWCNTs can significantly activate macrophages and increase the production of transforming growth factor (TGF)-?1, which induces the phosphorylation of Smad2 and then the expression of collagen I/III and extracellular matrix (ECM) protease inhibitors in lung tissues. Finally, the present in vitro studies further demonstrate that the TGF-?/Smad signaling pathway is indeed necessary for the expression of collagen III in fibroblast cells. Together, these data demonstrate that MWCNTs stimulate pulmonary fibrotic responses such as fibroblast proliferation and collagen deposition in a TGF-?/Smad-dependent manner. These observations also suggest that tube length acts as an important factor in MWCNT-induced macrophage activation and subsequent TGF-?1 secretion. These in vivo and in vitro studies further highlight the potential adverse health effects that may occur following MWCNT exposure and provide a better understanding of the cellular and molecular mechanisms by which MWCNTs induce pulmonary fibrotic reactions. PMID:23650105

Wang, Peng; Nie, Xin; Wang, Yue; Li, Yang; Ge, Cuicui; Zhang, Lili; Wang, Liming; Bai, Ru; Chen, Zhiyun; Zhao, Yuliang; Chen, Chunying

2013-11-25

131

Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway  

PubMed Central

Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 ± 0.026 ng/mL for 1 mg/L, 0.21 ± 0.024 ng/mL for 5 mg/L, and 0.27 ± 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 ± 0.01 ng/mL for 1 mg/L, 0.12 ± 0.017 ng/mL for 5 mg/L, and 0.17 ± 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus. PMID:24039418

Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian

2013-01-01

132

Fixation of CO2 by chrysotile in low-pressure dry and moist carbonation: Ex-situ and in-situ characterizations  

E-print Network

. Emitted in large proportions, especially from (stationary) fossil-fuel based power plants, carbon dioxide, a multistep carbonation mechanism was elaborated to explain the role of water during chrysotile partial-ray photoelectron spectros- copy evidence. The highest carbon dioxide uptake occurred at 375 °C in moist atmospheres

Long, Bernard

133

Preindustrial, historical, and fertilization simulations using a global ocean carbon model with new parameterizations of iron limitation, calcification, and N 2 fixation  

Microsoft Academic Search

The Canadian Model of Ocean Carbon (CMOC) has been developed as part of a global coupled climate carbon model. In a stand-alone integration to preindustrial equilibrium, the model ecosystem and global ocean carbon cycle are in general agreement with estimates based on observations. CMOC reproduces global mean estimates and spatial distributions of various indicators of the strength of the biological

Konstantin Zahariev; James R. Christian; Kenneth L. Denman

2008-01-01

134

Serine Biosynthesis with One Carbon Catabolism and the Glycine Cleavage System Represents a Novel Pathway for ATP Generation  

PubMed Central

Previous experimental evidence indicates that some cancer cells have an alternative glycolysis pathway with net zero ATP production, implying that upregulation of glycolysis in these cells may not be related to the generation of ATP. Here we use a genome-scale model of human cell metabolism to investigate the potential metabolic alterations in cells using net zero ATP glycolysis. We uncover a novel pathway for ATP generation that involves reactions from serine biosynthesis, one-carbon metabolism and the glycine cleavage system, and show that the pathway is transcriptionally upregulated in an inducible murine model of Myc-driven liver tumorigenesis. This pathway has a predicted two-fold higher flux rate in cells using net zero ATP glycolysis than those using standard glycolysis and generates twice as much ATP with significantly lower rate of lactate - but higher rate of alanine secretion. Thus, in cells using the standard - or the net zero ATP glycolysis pathways a significant portion of the glycolysis flux is always associated with ATP generation, and the ratio between the flux rates of the two pathways determines the rate of ATP generation and lactate and alanine secretion during glycolysis. PMID:22073143

Vazquez, Alexei; Markert, Elke K.; Oltvai, Zoltan N.

2011-01-01

135

Heme oxygenase\\/carbon monoxide system participates in regulating wheat seed germination under osmotic stress involving the nitric oxide pathway  

Microsoft Academic Search

To investigate the mechanism and signaling pathway of carbon monoxide (CO) and hematin in alleviating seed germination inhibition and lipid peroxidation, polyethylene glycol-6000 (PEG) was used to mimic osmotic stress in a series of experiments. The results showed that wheat seeds pretreated with a lower dose of PEG (12.5%) showed higher tolerance against osmotic stress as well as the up-regulation

Yahui Liu; Sheng Xu; Tengfang Ling; Langlai Xu; Wenbiao Shen

2010-01-01

136

Soil Carbon Dynamics Along the Pathway From Diverse Microbial Carbon to Humus in a Temperate and Tropical Forest  

NASA Astrophysics Data System (ADS)

This research investigates the importance of microbial biochemistry to humification pathways in two climatically different forest ecosystems; Blodgett forest (BF), a temperate forest in the Sierra Nevada and Luquillo forest (LF), a tropical forest in Puerto Rico. Non-living 13C enriched temperate and tropical microorganisms from four biochemically contrasting microbial groups (fungi, actinomycetes, bacteria gram (+), and bacteria gram (-)) were separately added to soil at both sites in a reciprocal transplant experiment. Decomposition rates were substantially greater at LF than BF for all microbial inputs. Although there were initial differences in microbial C turnover and recovery within the soil microbial biomass and dissolved organic carbon pools for unique microbial C inputs at both sites, over time treatment differences converge within each site and the quality of input microbial C becomes less important to C remaining and maintained within these soil C pools. Physical soil fractionation revealed important trends which illustrate the role of the soil mineral matrix to protect and stabilize C in soil. Results indicate different C turnover rates associated with the light, aggregate- occluded, and mineral-associated soil fractions at both sites. At BF input C recovered within the light and mineral-associated fractions decreased substantially over time (1 to 13 months), while C occluded within aggregates only slightly decreased. Similarly, LF soils exhibit only a slight decrease in aggregate-occluded C over time (0.5 to 3.5 months), while C recovered within the light fraction decreased substantially; however, unlike BF, LF soils exhibited only a slight decrease in C recovered within the mineral fraction. The distribution of total C among these physical soil pools differs substantially for either site, suggesting differences in the relative importance of the mineral matrix to protect and stabilize C. Preliminary compound-specific isotope analyses employing pyrolysis gas chromatography mass spectrometry and isotope ratio spectrometry (Py-GC-MS/IRMS) for temperate BF soils treated with 13C enriched temperate fungal residues indicates a substantial enrichment of low molecular weight (MW) compounds from microbial additions after 1 month in the field; however, after 5 months in the field the 13C enrichment shifts to higher MW compounds. These trends suggest higher MW compounds are formed through humification as synthesis or condensation products, which highlights the importance of monitoring biogeochemical transformations of unique sources of C over time. Future and ongoing work examines specific compounds associated with these high 13C enrichment values in an effort to understand the link between microbial C quality and humification products.

Throckmorton, H. M.; Bird, J. A.; Firestone, M. K.; Horwath, W. R.

2008-12-01

137

Spiral Intermaxillary Fixation  

PubMed Central

Intermaxillary fixation (IMF) remains an important component in the management of many facial fractures. During IMF, dental occlusion plays an important role as a guide and therapeutic tool. Since time immemorial there is a constant quest of oral and maxillofacial surgeons to find a quick way for IMF. The desire to develop an alternate interdental fixation technique, which not only would decrease the risk to the operator and gingival trauma but also accurately satisfy dental occlusion, lead to the development of this novel technique of “spiral IMF.” PMID:23730425

Kumar, Yuvika Raj; Chaudhary, Zainab; Sharma, Pankaj

2012-01-01

138

Measurement of black carbon at Syowa station, Antarctica: seasonal variation, transport processes and pathways  

NASA Astrophysics Data System (ADS)

Measurement of black carbon (BC) was carried out at Syowa station Antarctica (69° S, 39° E) from February 2004 until January 2007. The BC concentration at Syowa ranged from below detection to 176 ng m-3 during the measurements. Higher BC concentrations were observed mostly under strong wind (blizzard) conditions due to the approach of a cyclone and blocking event. The BC-rich air masses traveled from the lower troposphere of the Atlantic and Indian Oceans to Syowa (Antarctic coast). During the summer (November-February), the BC concentration showed a diurnal variation together with surface wind speed and increased in the katabatic wind from the Antarctic continent. Considering the low BC source strength in the Antarctic continent, the higher BC concentration in the continental air (katabatic wind) might be caused by long range transport of BC via the free troposphere from mid- and low- latitudes. The seasonal variation of BC at Syowa had a maximum in August, while at the other coastal stations (Halley, Neumayer, and Ferraz) and the continental station (Amundsen-Scott), the maximum occurred in October. This difference may result from different transport pathways and scavenging of BC by precipitation during the transport from the source regions. During the austral summer, long-range transport of BC via the free troposphere is likely to make an important contribution to the ambient BC concentration. The BC transport flux indicated that BC injection into the Antarctic region strongly depended on the frequency of storm (blizzard) conditions. The seasonal variation of BC transport flux increased by 290 mg m-2 month-1 in winter-spring when blizzards frequently occurred, whereas the flux decreased to lower than 50 mg m-2 month-1 in the summer with infrequent blizzards.

Hara, K.; Osada, K.; Yabuki, M.; Hayashi, M.; Yamanouchi, T.; Shiobara, M.; Wada, M.

2008-05-01

139

Update: Biological Nitrogen Fixation.  

ERIC Educational Resources Information Center

Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,…

Wiseman, Alan; And Others

1985-01-01

140

A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime  

NASA Technical Reports Server (NTRS)

A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

Carr, Mary-Elena

1998-01-01

141

French Guiana Fluidized Muds: Predominant Sulfur Transformation Pathways and Prokaryotic Players in a Coupled System of Carbon-Sulfur-Metal Biogeochemical Cycling.  

NASA Astrophysics Data System (ADS)

The fluidized mud ecosystem off French Guiana coast is a unique and globally important sedimentary environment characterized by intense physical reworking and rapid turnover of major biogeochemical elements. Here we assess the major pathways of carbon cycling focusing on the transformation of sulfur species and major prokaryotic participants. The depth distribution of organic carbon oxidation rates was determined for ~100 cm long cores collected off the French Guiana coast. Total organic carbon oxidation rates inferred from accumulation of inorganic carbon during a 3-6 month incubation series were elevated at the surface and decreased with depth. A similar incubation approach was applied for estimation of ferric reduction|oxidation rates. Short- chain fatty acid degradation rates and dark carbon dioxide rates were determined with 14C radiolabeled acetate and carbon dioxide, respectively, which both decreased with depth. The rates for sulfate and elemental sulfur transformation pathways were determined using 35S radiolabeled sulfur species with and without the presence of molybdate. Proposed microbially-mediated biogeochemical pathways were confirmed by MPN measurements of sulfate-, sulfur- and iron-reducing heterotrophic bacteria. Autotrophic bacteria were less numerous and their numbers did not directly correlate with rates of specific biogeochemical pathways. With most carbon oxidation accounted for by sulfur species - and ferric iron respiration, corresponding microbial groups may play a significant role in regulation of the net balance of organic carbon mineralization. Experimental results imply that auto- and heterotrophy likely coexist simultaneously and, thus participate in the internal carbon cycling in this environment.

Luzan, T.; Chistoserdov, A. Y.; Aller, J. Y.; Aller, R. C.

2008-12-01

142

Posterior transodontoid fixation: A new fixation (Kotil) technique.  

PubMed

Anterior odontoid screw fixation or posterior C1-2 fusion techniques are routinely used in the treatment of Type II odontoid fractures, but these techniques may be inadequate in some types of odontoid fractures. In this new technique (Kotil technique), through a posterior bilateral approach, transarticular screw fixation was performed at the non-dominant vertebral artery (VA) side and posterior transodontoid fixation technique was performed at the dominant VA side. C1-2 complex fusion was aimed with unilateral transarticular fixation and odontoid fixation with posterior transodontoid screw fixation. Cervical spinal computed tomography (CT) of a 40-year-old male patient involved in a motor vehicle accident revealed an anteriorly dislocated Type II oblique dens fracture, not reducible by closed traction. Before the operation, the patient was found to have a dominant right VA with Doppler ultrasound. He was operated through a posterior approach. At first, transarticular screw fixation was performed at the non-dominant (left) side, and then fixation of the odontoid fracture was achieved by directing the contralateral screw (supplemental screw) medially and toward the apex. Cancellous autograft was scattered for fusion without the need for structural bone graft or wiring. Postoperative cervical spinal CT of the patient revealed that stabilization was maintained with transarticular screw fixation and reduction and fixation of the odontoid process was achieved completely by posterior transodontoid screw fixation. The patient is at the sixth month of follow-up and complete fusion has developed. With this new surgical technique, C1-2 fusion is maintained with transarticular screw fixation and odontoid process is fixed by concomitant contralateral posterior transodontoid screw (supplemental screw) fixation; thus, this technique both stabilizes the C1-2 complex and fixes the odontoid process and the corpus in atypical odontoid fractures, appearing as an alternative new technique among the previously defined C1-C2 fixation techniques in eligible cases. PMID:22013375

Kotil, Kad?r; Köksal, Neslihan Sütpideler; Kayac?, Selim

2011-01-01

143

Posterior transodontoid fixation: A new fixation (Kotil) technique  

PubMed Central

Anterior odontoid screw fixation or posterior C1-2 fusion techniques are routinely used in the treatment of Type II odontoid fractures, but these techniques may be inadequate in some types of odontoid fractures. In this new technique (Kotil technique), through a posterior bilateral approach, transarticular screw fixation was performed at the non-dominant vertebral artery (VA) side and posterior transodontoid fixation technique was performed at the dominant VA side. C1-2 complex fusion was aimed with unilateral transarticular fixation and odontoid fixation with posterior transodontoid screw fixation. Cervical spinal computed tomography (CT) of a 40-year-old male patient involved in a motor vehicle accident revealed an anteriorly dislocated Type II oblique dens fracture, not reducible by closed traction. Before the operation, the patient was found to have a dominant right VA with Doppler ultrasound. He was operated through a posterior approach. At first, transarticular screw fixation was performed at the non-dominant (left) side, and then fixation of the odontoid fracture was achieved by directing the contralateral screw (supplemental screw) medially and toward the apex. Cancellous autograft was scattered for fusion without the need for structural bone graft or wiring. Postoperative cervical spinal CT of the patient revealed that stabilization was maintained with transarticular screw fixation and reduction and fixation of the odontoid process was achieved completely by posterior transodontoid screw fixation. The patient is at the sixth month of follow-up and complete fusion has developed. With this new surgical technique, C1-2 fusion is maintained with transarticular screw fixation and odontoid process is fixed by concomitant contralateral posterior transodontoid screw (supplemental screw) fixation; thus, this technique both stabilizes the C1-2 complex and fixes the odontoid process and the corpus in atypical odontoid fractures, appearing as an alternative new technique among the previously defined C1-C2 fixation techniques in eligible cases. PMID:22013375

Kotil, Kad?r; Köksal, Neslihan sütpideler; Kayac?, Selim

2011-01-01

144

Experimental Fluid-Rock Reactions Along the CO2 Pathway in Carbonate Host Reservoir.  

NASA Astrophysics Data System (ADS)

CO2 sequestration in geologic formations is increasingly being studied as a workable way for limiting CO2 overload in the atmosphere. Here, we will focus on carbonate rock which represents the large properties the targeted sedimentary reservoirs. The aim of this study is to produce experimental data base for constraining the modelling of CO2 injection and sequestration. A set of reactive percolation experiments in in-situ-like pressure and temperature conditions (i.e. T=100°C, P=12MPa) are presented. Experiments were designed to quantify reactions occurring near the CO2 injection zone where the aquifer fluid is saturated with CO2 and at increasing distances from the injection where the fluid is expected to contain progressively less CO2 and more divalent cations resulting from the rock dissolution along the fluid pathway. The underlying idea is to obtain experimental control points in space and time corresponding to the transport of the CO2 in the reservoir during the injection phase, whereas a complete and continuous reproduction of the processes at laboratory scale is obviously unfeasible. The protocol allows measuring changes in porosity and permeability continuously, as well as rock structure using recurrent X-ray microtomography imaging and effluent composition repeatedly. Results show that reactions produce high permeability channels, concomitant loss of integrity of the system close to the injection well, whereas precipitation inducing permeability decrease takes place far from the well. Mass transfers distribution and rate can be associated with the value of the CO2 partial pressure (PCO2) and Calcium saturation index (ICa) only. Specifically, dissolution is increasingly homogeneous as PCO2 decreases. Conversely, porosity-permeability relation is well fitted by the simple law k = a ; ?n where n can be related to the pore scale effective Damköhler number (which depend on the inlet PCO2 and ICa) by a simple power law relation. Then, the permeability change can be expressed as a function of the porosity changes by the relation k = a ; ?bDa where a and b are constants that are probably fixed by the initial structure of the rock and the reaction type respectively.

Luquot, L.; Gouze, P.

2007-12-01

145

Novel posterior fixation keratoprosthesis  

NASA Astrophysics Data System (ADS)

The keratoprosthesis is the last solution for corneally blind patients that cannot benefit from corneal transplants. Keratoprostheses that have been designed to be affixed anteriorly usually necessitate multi-step surgical procedures and are continuously subjected to the extrusion forces generated by the positive intraocular pressure; therefore, clinical results in patients prove inconsistent. We proposed a novel keratoprosthesis concept that utilizes posterior corneal fixation which `a priori' minimizes the risk of aqueous leakage and expulsion. This prosthesis is implanted in a single procedure thereby reducing the number of surgical complications normally associated with anterior fixation devices. In addition, its novel design makes this keratoprosthesis implantable in phakic eyes. With an average follow-up of 13 months (range 3 to 25 months), our results on 21 cases are encouraging. Half of the keratoprostheses were implanted in severe burn cases, with the remainder in cases of pseudo- pemphigus. Good visual results and cosmetic appearance were obtained in 14 of 21 eyes.

Lacombe, Emmanuel

1992-08-01

146

Understanding Nitrogen Fixation  

SciTech Connect

The purpose of our program is to explore fundamental chemistry relevant to the discovery of energy efficient methods for the conversion of atmospheric nitrogen (N{sub 2}) into more value-added nitrogen-containing organic molecules. Such transformations are key for domestic energy security and the reduction of fossil fuel dependencies. With DOE support, we have synthesized families of zirconium and hafnium dinitrogen complexes with elongated and activated N-N bonds that exhibit rich N{sub 2} functionalization chemistry. Having elucidated new methods for N-H bond formation from dihydrogen, C-H bonds and Broensted acids, we have since turned our attention to N-C bond construction. These reactions are particularly important for the synthesis of amines, heterocycles and hydrazines with a range of applications in the fine and commodity chemicals industries and as fuels. One recent highlight was the discovery of a new N{sub 2} cleavage reaction upon addition of carbon monoxide which resulted in the synthesis of an important fertilizer, oxamide, from the diatomics with the two strongest bonds in chemistry. Nitrogen-carbon bonds form the backbone of many important organic molecules, especially those used in the fertilizer and pharamaceutical industries. During the past year, we have continued our work in the synthesis of hydrazines of various substitution patterns, many of which are important precursors for heterocycles. In most instances, the direct functionalization of N{sub 2} offers a more efficient synthetic route than traditional organic methods. In addition, we have also discovered a unique CO-induced N{sub 2} bond cleavage reaction that simultaneously cleaves the N-N bond of the metal dinitrogen compound and assembles new C-C bond and two new N-C bonds. Treatment of the CO-functionalized core with weak Broensted acids liberated oxamide, H{sub 2}NC(O)C(O)NH{sub 2}, an important slow release fertilizer that is of interest to replace urea in many applications. The synthesis of ammonia, NH{sub 3}, from its elements, H{sub 2} and N{sub 2}, via the venerable Haber-Bosch process is one of the most significant technological achievements of the past century. Our research program seeks to discover new transition metal reagents and catalysts to disrupt the strong N {triple_bond} N bond in N{sub 2} and create new, fundamental chemical linkages for the construction of molecules with application as fuels, fertilizers and fine chemicals. With DOE support, our group has discovered a mild method for ammonia synthesis in solution as well as new methods for the construction of nitrogen-carbon bonds directly from N{sub 2}. Ideally these achievements will evolve into more efficient nitrogen fixation schemes that circumvent the high energy demands of industrial ammonia synthesis. Industrially, atmospheric nitrogen enters the synthetic cycle by the well-established Haber-Bosch process whereby N{sub 2} is hydrogenated to ammonia at high temperature and pressure. The commercialization of this reaction represents one of the greatest technological achievements of the 20th century as Haber-Bosch ammonia is responsible for supporting approximately 50% of the world's population and serves as the source of half of the nitrogen in the human body. The extreme reaction conditions required for an economical process have significant energy consequences, consuming 1% of the world's energy supply mostly in the form of pollution-intensive coal. Moreover, industrial H{sub 2} synthesis via the water gas shift reaction and the steam reforming of methane is fossil fuel intensive and produces CO{sub 2} as a byproduct. New synthetic methods that promote this thermodynamically favored transformation ({Delta}G{sup o} = -4.1 kcal/mol) under milder conditions or completely obviate it are therefore desirable. Most nitrogen-containing organic molecules are derived from ammonia (and hence rely on the Haber-Bosch and H{sub 2} synthesis processes) and direct synthesis from atmospheric nitrogen could, in principle, be more energy-efficient. This is particularly attractive giv

Paul J. Chirik

2012-05-25

147

Pathways and Mechanisms of OceanTracer Transport: Implications for Carbon Sequestration  

SciTech Connect

This funding enabled the following published manuscripts in which we have developed models of direct relevance to ocean carbon sequestration and of the oceanic iron cycle, its connection to the global carbon cycle, and the sensitivity of atmospheric carbon dioxide to the external source of iron. As part of this process we have developed the adjoint of the MIT ocean biogeochemistry model which has enabled us to perform rigorous and efficient sensitivity studies.

Marshall, John; Follows, MIchael

2006-11-06

148

Complement activation by PEGylated single-walled carbon nanotubes is independent of C1q and alternative pathway turnover  

Microsoft Academic Search

We have investigated the interaction between long circulating poly(ethylene glycol)-stabilized single-walled carbon nanotubes (SWNTs) and the complement system. Aminopoly(ethylene glycol)5000–distearoylphosphatidylethanolamine (aminoPEG5000–DSPE) and methoxyPEG5000–DSPE coated as-grown HIPco SWNTs activated complement in undiluted normal human serum as reflected in significant rises in C4d and SC5b-9 levels, but not the alternative pathway split-product Bb, thus indicating activation exclusively through C4 cleavage. Studies in

Islam Hamad; A. Christy Hunter; Kenneth J. Rutt; Zhuang Liu; Hongjie Dai; S. Moein Moghimi

2008-01-01

149

Photosynthesis in Grass Species Differing in Carbon Dioxide Fixation Pathways: II. A Search for Species with Intermediate Gas Exchange and Anatomical Characteristics.  

PubMed

Thirty-three grass species were examined in two experiments in an attempt to locate plants with photosynthetic responses to O(2), CO(2) compensation concentrations, and leaf anatomy intermediate to those of C(3) and C(4) species. Species examined included seven from the Laxa group in the Panicum genus, one of which, P. milioides Nees ex Trin., has been reported earlier to have intermediate characteristics. The species with O(2)-sensitive photosynthesis typical of C(3) plants showed more than 37% increase in apparent photosynthesis at 2% O(2) compared to 21% O(2) at 25 C and 335 microliters per liter CO(2), whereas in Panicum milioides, P. schenckii Hack., and P. decipiens Nees ex Trin., members of the Laxa group of Panicum, increases ranged from 25 to 30%. The remainder of the species did not respond to O(2). Species with O(2) responses characteristic of C(3) plants exhibited CO(2) compensation concentrations of 44 microliters per liter or higher at 21% O(2) and 25 to 27.5 C and species characterized as O(2)-insensitive had values of microliters per liter or less. The CO(2) compensation concentration (capital GHE, Cyrillic) values of P. milioides, P. schenckii, and P. decipiens ranged from 10.3 to 23.3 microliters per liter. Other species of the Laxa group of Panicum exhibited O(2) response and capital GHE, Cyrillic values of either C(3) (P. laxum Sw., P. hylaeicum Mez., and P. rivulare Trin.) or C(4) (P. prionitis Griseb.) plants. Leaves of species with O(2) response and CO(2) compensation values typical of C(3) plants had poorly developed or nearly empty bundle sheath cells, and much larger distances and mesophyll cell numbers between veins than did the O(2)-insensitive ones. Vein spacings in P. milioides, P. schenckii, and P. decipiens ranged from 0.18 to 0.28 millimeter and mesophyll cell number between veins from 5.2 to 7.8. While these vein spacings are closer than those of most C(3) grasses, two O(2)-sensitive species of Dactylis had vein spacings similar to these Panicums and veins in Glyceria striata, another O(2)-sensitive plant, were separated by only four mesophyll cells and 0.12 millimeter. Bundle sheath cells of the three intermediate Panicums contained greater quantities of organelles than are typical for C(3) grasses. PMID:16660944

Morgan, J A; Brown, R H

1979-08-01

150

Photosynthesis in Ceratophyllum demersum . Carbon fixation rates in relation to the plants' physiological stage, and the contents of chlorophylland non-structural carbohydrates  

Microsoft Academic Search

Summary  Since the role of the submerged aquatic macrophytes in the carbon cycle of lake Vechten (the Netherlands) is in study, attention is paid to several aspects of their productivity.Ceratophyllum demersum is a predominant macrophytic species in the littoral zone of this lake, occurring mainly from three to five metres depth.\\u000aIn situ measurements of its photosynthetic rate demonstrated a maximum

Elly P. H. Best

1979-01-01

151

The Mechanics of External Fixation  

Microsoft Academic Search

External fixation has evolved from being used primarily as a last resort fixation method to becoming a main stream technique\\u000a used to treat a myriad of bone and soft tissue pathologies. Techniques in limb reconstruction continue to advance largely\\u000a as a result of the use of these external devices. A thorough understanding of the biomechanical principles of external fixation\\u000a is

Austin T. Fragomen; S. Robert Rozbruch

2007-01-01

152

A selection platform for carbon chain elongation using the CoA-dependent pathway to produce linear higher alcohols.  

PubMed

Production of green chemicals and fuels using metabolically engineered organisms has been a promising alternative to petroleum-based production. Higher chain alcohols (C4-C8) are of interest because they can be used as chemical feedstock as well as fuels. Recently, the feasibility of n-hexanol synthesis using Escherichia coli has been demonstrated by extending the modified Clostridium CoA-dependent n-butanol synthesis pathway, thereby elongating carbon chain length via reactions in reversed ?-oxidation, (or ?-reduction). Here, we developed an anaerobic growth selection platform that allows selection or enrichment of enzymes for increased synthesis of C6 and C8 linear alcohols. Using this selection, we were able to improve the carbon flux towards the synthesis of C6 and C8 acyl-CoA intermediates. Replacement of the original enzyme Clostridium acetobutylicum Hbd with Ralstonia eutropha homologue PaaH1 increased production of n-hexanol by 10-fold. Further directed evolution by random mutagenesis of PaaH1 improved n-hexanol and n-octanol production. This anaerobic growth selection platform may be useful for selecting enzymes for production of long-chain alcohols and acids using this CoA-dependent pathway. PMID:22819734

Machado, Hidevaldo B; Dekishima, Yasumasa; Luo, Hao; Lan, Ethan I; Liao, James C

2012-09-01

153

Microbial fixation of CO2 in water bodies and in drylands to combat climate change, soil loss and desertification.  

PubMed

The growing concern for the increase of the global warming effects due to anthropogenic activities raises the challenge of finding novel technological approaches to stabilize CO2 emissions in the atmosphere and counteract impinging interconnected issues such as desertification and loss of biodiversity. Biological-CO2 mitigation, triggered through biological fixation, is considered a promising and eco-sustainable method, mostly owing to its downstream benefits that can be exploited. Microorganisms such as cyanobacteria, green algae and some autotrophic bacteria could potentially fix CO2 more efficiently than higher plants, due to their faster growth. Some examples of the potential of biological-CO2 mitigation are reported and discussed in this paper. In arid and semiarid environments, soil carbon sequestration (CO2 fixation) by cyanobacteria and biological soil crusts is considered an eco-friendly and natural process to increase soil C content and a viable pathway to soil restoration after one disturbance event. Another way for biological-CO2 mitigation intensively studied in the last few years is related to the possibility to perform carbon dioxide sequestration using microalgae, obtaining at the same time bioproducts of industrial interest. Another possibility under study is the exploitation of specific chemotrophic bacteria, such as Ralstonia eutropha (or picketii) and related organisms, for CO2 fixation coupled with the production chemicals such as polyhydroxyalkanoates (PHAs). In spite of the potential of these processes, multiple factors still have to be optimized for maximum rate of CO2 fixation by these microorganisms. The optimization of culture conditions, including the optimal concentration of CO2 in the provided gas, the use of metabolic engineering and of dual purpose systems for the treatment of wastewater and production of biofuels and high value products within a biorefinery concept, the design of photobioreactors in the case of phototrophs are some of the issues that, among others, have to be addressed and tested for cost-effective CO2 sequestration. PMID:24355428

Rossi, Federico; Olguín, Eugenia J; Diels, Ludo; De Philippis, Roberto

2015-01-25

154

Effect of multiple mutations in tricarboxylic acid cycle and one-carbon metabolism pathways on Edwardsiella ictaluri pathogenesis.  

PubMed

Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of catfish (ESC). We have shown recently that tricarboxylic acid cycle (TCA) and one-carbon (C1) metabolism are involved in E. ictaluri pathogenesis. However, the effect of multiple mutations in these pathways is unknown. Here, we report four novel E. ictaluri mutants carrying double gene mutations in TCA cycle (Ei?mdh?sdhC, Ei?frdA?sdhC), C1 metabolism (Ei?glyA?gcvP), and both TCA and C1 metabolism pathways (Ei?gcvP?sdhC). In-frame gene deletions were constructed by allelic exchange and mutants' virulence and vaccine efficacy were evaluated using in vivo bioluminescence imaging (BLI) as well as end point mortality counts in catfish fingerlings. Results indicated that all the double gene mutants were attenuated compared to wild-type (wt) E. ictaluri. There was a 1.39-fold average reduction in bioluminescence, and hence bacterial numbers, from all the mutants except for Ei?frdA?sdhC at 144 h post-infection. Vaccination with mutants was very effective in protecting channel catfish against subsequent infection with virulent E. ictaluri 93-146 strain. In particular, immersion vaccination resulted in complete protection. Our results provide further evidence on the importance of TCA and C1 metabolism pathways in bacterial pathogenesis. PMID:24418045

Dahal, N; Abdelhamed, H; Lu, J; Karsi, A; Lawrence, M L

2014-02-21

155

Gene Regulation of Carbon Fixation, Storage, and Utilization in the Diatom Phaeodactylum tricornutum Acclimated to Light/Dark Cycles1[C][W][OA  

PubMed Central

The regulation of carbon metabolism in the diatom Phaeodactylum tricornutum at the cell, metabolite, and gene expression levels in exponential fed-batch cultures is reported. Transcriptional profiles and cell chemistry sampled simultaneously at all time points provide a comprehensive data set on carbon incorporation, fate, and regulation. An increase in Nile Red fluorescence (a proxy for cellular neutral lipids) was observed throughout the light period, and water-soluble glucans increased rapidly in the light period. A near-linear decline in both glucans and lipids was observed during the dark period, and transcription profile data indicated that this decline was associated with the onset of mitosis. More than 4,500 transcripts that were differentially regulated during the light/dark cycle are identified, many of which were associated with carbohydrate and lipid metabolism. Genes not previously described in algae and their regulation in response to light were integrated in this analysis together with proposed roles in metabolic processes. Some very fast light-responding genes in, for example, fatty acid biosynthesis were identified and allocated to biosynthetic processes. Transcripts and cell chemistry data reflect the link between light energy availability and light energy-consuming metabolic processes. Our data confirm the spatial localization of processes in carbon metabolism to either plastids or mitochondria or to glycolysis/gluconeogenesis, which are localized to the cytosol, chloroplast, and mitochondria. Localization and diel expression pattern may be of help to determine the roles of different isoenzymes and the mining of genes involved in light responses and circadian rhythms. PMID:23209127

Chauton, Matilde Skogen; Winge, Per; Brembu, Tore; Vadstein, Olav; Bones, Atle M.

2013-01-01

156

Cathode deposits in fullerene formation — microstructural evidence for independent pathways of pyrolytic carbon and nanobody formation  

NASA Astrophysics Data System (ADS)

Microstructures in cathode deposits formed during fullerene production by electrical arcing in helium have been examined in detail. This has provided new information about the mechanisms by which nanobodies (nanotubes and nanoparticles) and pyrolytic carbon are deposited. Nanobodies and pyrolytic carbon form independently; the former probably grow in the plasma then deposit on the electrode but much of the latter deposits directly on the electrode surface.

Taylor, G. H.; Gerald, J. D. Fitz; Pang, L.; Wilson, M. A.

1994-01-01

157

Understanding the Kinetics and Dynamics of Radiation-induced Reaction Pathways in Carbon Monoxide Ice at 10 K  

NASA Astrophysics Data System (ADS)

Carbon monoxide is the second most abundant molecule on icy grains in the interstellar medium. It also exists on Pluto, Triton, comets, and possibly in other icy bodies of the outer solar system like Kuiper Belt objects. With the intense radiation fields that permeate virtually all unprotected regions of space, carbon monoxide ices can be processed through energetic particle bombardment (planetary magnetospheric particles, solar wind, Galactic cosmic ray particles, and UV photons). In the present study we have investigated the effects by condensing a 1 ?m layer of carbon monoxide ice on a substrate at 10 K and irradiated the sample with energetic (keV) electrons. These simulate the energetic electrons trapped in magnetospheres of planets and reproduce the irradiation effects of typical Galactic cosmic ray particles. A series of new carbon-chain (C3, C6) and carbon oxide species were observed including the linear isomers of C2O, C3O, C4O, C5O, C6/7O, CO2, C3O2, C4O2, and C5O2. A reaction model was proposed that outlines different reaction pathways to each of these products. Using this model, the kinetics of each route of reaction was quantified, and from this, the mechanisms and dynamics of the reactions can be understood. This work should aid in the astronomical detection of new molecular species in solar system ices as well as building up a comprehensive reaction model to describe the chemical inventory of ices on interstellar dust grains.

Jamieson, Corey S.; Mebel, Alexander M.; Kaiser, Ralf I.

2006-03-01

158

Definitive Bone Fixation and Reconstruction: Conversion from Temporary External Fixation to Internal Fixation Methods  

Microsoft Academic Search

\\u000a Temporary external fixation is frequently employed in the military combat theater of operations to temporize devastating extremity\\u000a injuries and facilitate transport of the wounded soldier. Multiple civilian and a few military studies have provided helpful\\u000a insight into the staged treatment of these injuries including conversion of temporary external fixation to definitive stabilization\\u000a with internal fixation. Diaphyseal fractures of the long

Craig S. Bartlett; Benjamin Geer; David L. Helfet

159

A hypersaline microbial mat from the Pacific Atoll Kiritimati: insights into composition and carbon fixation using biomarker analyses and a 13C-labeling approach.  

PubMed

Modern microbial mats are widely recognized as useful analogs for the study of biogeochemical processes relevant to paleoenvironmental reconstruction in the Precambrian. We combined microscopic observations and investigations of biomarker composition to investigate community structure and function in the upper layers of a thick phototrophic microbial mat system from a hypersaline lake on Kiritimati (Christmas Island) in the Northern Line Islands, Republic of Kiribati. In particular, an exploratory incubation experiment with (13)C-labeled bicarbonate was conducted to pinpoint biomarkers from organisms actively fixing carbon. A high relative abundance of the cyanobacterial taxa Aphanocapsa and Aphanothece was revealed by microscopic observation, and cyanobacterial fatty acids and hydrocarbons showed (13)C-uptake in the labeling experiment. Microscopic observations also revealed purple sulfur bacteria (PSB) in the deeper layers. A cyclic C(19:0) fatty acid and farnesol were attributed to this group that was also actively fixing carbon. Background isotopic values indicate Calvin-Benson cycle-based autotrophy for cycC(19:0) and farnesol-producing PSBs. Biomarkers from sulfate-reducing bacteria (SRB) in the top layer of the mat and their (13)C-uptake patterns indicated a close coupling between SRBs and cyanobacteria. Archaeol, possibly from methanogens, was detected in all layers and was especially abundant near the surface where it contained substantial amounts of (13)C-label. Intact glycosidic tetraether lipids detected in the deepest layer indicated other archaea. Large amounts of ornithine and betaine bearing intact polar lipids could be an indicator of a phosphate-limited ecosystem, where organisms that are able to substitute these for phospholipids may have a competitive advantage. PMID:19476506

Bühring, S I; Smittenberg, R H; Sachse, D; Lipp, J S; Golubic, S; Sachs, J P; Hinrichs, K-U; Summons, R E

2009-06-01

160

Regulation of Autotrophic CO2 Fixation in the Archaeon Thermoproteus neutrophilus? †  

PubMed Central

Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO2 fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes. PMID:20693323

Ramos-Vera, W. Hugo; Labonte, Valerie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

2010-01-01

161

Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501.  

PubMed

The capacity to fix nitrogen is widely distributed in phyla of Bacteria and Archaea but has long been considered to be absent from the Pseudomonas genus. We report here the complete genome sequencing of nitrogen-fixing root-associated Pseudomonas stutzeri A1501. The genome consists of a single circular chromosome with 4,567,418 bp. Comparative genomics revealed that, among 4,146 protein-encoding genes, 1,977 have orthologs in each of the five other Pseudomonas representative species sequenced to date. The genome contains genes involved in broad utilization of carbon sources, nitrogen fixation, denitrification, degradation of aromatic compounds, biosynthesis of polyhydroxybutyrate, multiple pathways of protection against environmental stress, and other functions that presumably give A1501 an advantage in root colonization. Genetic information on synthesis, maturation, and functioning of nitrogenase is clustered in a 49-kb island, suggesting that this property was acquired by lateral gene transfer. New genes required for the nitrogen fixation process have been identified within the nif island. The genome sequence offers the genetic basis for further study of the evolution of the nitrogen fixation property and identification of rhizosphere competence traits required in the interaction with host plants; moreover, it opens up new perspectives for wider application of root-associated diazotrophs in sustainable agriculture. PMID:18495935

Yan, Yongliang; Yang, Jian; Dou, Yuetan; Chen, Ming; Ping, Shuzhen; Peng, Junping; Lu, Wei; Zhang, Wei; Yao, Ziying; Li, Hongquan; Liu, Wei; He, Sheng; Geng, Lizhao; Zhang, Xiaobing; Yang, Fan; Yu, Haiying; Zhan, Yuhua; Li, Danhua; Lin, Zhanglin; Wang, Yiping; Elmerich, Claudine; Lin, Min; Jin, Qi

2008-05-27

162

Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501  

PubMed Central

The capacity to fix nitrogen is widely distributed in phyla of Bacteria and Archaea but has long been considered to be absent from the Pseudomonas genus. We report here the complete genome sequencing of nitrogen-fixing root-associated Pseudomonas stutzeri A1501. The genome consists of a single circular chromosome with 4,567,418 bp. Comparative genomics revealed that, among 4,146 protein-encoding genes, 1,977 have orthologs in each of the five other Pseudomonas representative species sequenced to date. The genome contains genes involved in broad utilization of carbon sources, nitrogen fixation, denitrification, degradation of aromatic compounds, biosynthesis of polyhydroxybutyrate, multiple pathways of protection against environmental stress, and other functions that presumably give A1501 an advantage in root colonization. Genetic information on synthesis, maturation, and functioning of nitrogenase is clustered in a 49-kb island, suggesting that this property was acquired by lateral gene transfer. New genes required for the nitrogen fixation process have been identified within the nif island. The genome sequence offers the genetic basis for further study of the evolution of the nitrogen fixation property and identification of rhizosphere competence traits required in the interaction with host plants; moreover, it opens up new perspectives for wider application of root-associated diazotrophs in sustainable agriculture. PMID:18495935

Yan, Yongliang; Yang, Jian; Dou, Yuetan; Chen, Ming; Ping, Shuzhen; Peng, Junping; Lu, Wei; Zhang, Wei; Yao, Ziying; Li, Hongquan; Liu, Wei; He, Sheng; Geng, Lizhao; Zhang, Xiaobing; Yang, Fan; Yu, Haiying; Zhan, Yuhua; Li, Danhua; Lin, Zhanglin; Wang, Yiping; Elmerich, Claudine; Lin, Min; Jin, Qi

2008-01-01

163

Fixation Time for Evolutionary Graphs  

NASA Astrophysics Data System (ADS)

Evolutionary graph theory (EGT) is recently proposed by Lieberman et al. in 2005. EGT is successful for explaining biological evolution and some social phenomena. It is extremely important to consider the time of fixation for EGT in many practical problems, including evolutionary theory and the evolution of cooperation. This study characterizes the time to asymptotically reach fixation.

Nie, Pu-Yan; Zhang, Pei-Ai

164

Eighth international congress on nitrogen fixation  

SciTech Connect

This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

Not Available

1990-01-01

165

Trophic structure and pathways of biogenic carbon flow in the eastern North Water Polynya  

NASA Astrophysics Data System (ADS)

In the eastern North Water, most of the estimated annual new and net production of carbon (C) occurred during the main diatom bloom in 1998. During the bloom, at least 30% of total and new phytoplankton production occurred as dissolved organic carbon (DOC) and was unavailable for short-term assimilation into the herbivorous food web or sinking export. Based on particle interceptor traps and 234Th deficits, 27% of the particulate primary production (PP) sank out of the upper 50 m, with only 7% and 1% of PP reaching the benthos at shallow (?200 m) and deep (?500 m) sites, respectively. Mass balance calculations and grazing estimates agree that ?79% of PP was ingested by pelagic consumers between April and July. During this period, the vertical flux of biogenic silica (BioSi) at 50 m was equivalent to the total BioSi produced, indicating that all of the diatom production was removed from the euphotic zone as intact cells (direct sinking) or empty frustules (grazing or lysis). The estimated flux of empty frustules was consistent with rates of herbivory by the large, dominant copepods and appendicularians during incubations. Since the carbon demand of the dominant planktivorous bird, Alle alle, amounted to ?2% of the biomass synthesized by its main prey, the large copepod Calanus hyperboreus, most of the secondary carbon production was available to pelagic carnivores. Stable isotopes indicated that the biomass of predatory amphipods, polar cod and marine mammals was derived from these herbivores, but corresponding carbon fluxes were not quantified. Our analysis shows that a large fraction of PP in the eastern North Water was ingested by consumers in the upper 50 m, leading to substantial carbon respiration and DOC accumulation in surface waters. An increasingly early and prolonged opening of the Artic Ocean is likely to promote the productivity of the herbivorous food web, but not the short-term efficiency of the particulate, biological CO 2 pump.

Tremblay, Jean-Éric; Hattori, Hiroshi; Michel, Christine; Ringuette, Marc; Mei, Zhi-Ping; Lovejoy, Connie; Fortier, Louis; Hobson, Keith A.; Amiel, David; Cochran, Kirk

2006-10-01

166

Molybdenum limitation of asymbiotic nitrogen fixation in tropical forest soils  

NASA Astrophysics Data System (ADS)

Nitrogen fixation, the biological conversion of di-nitrogen to plant-available ammonium, is the primary natural input of nitrogen to ecosystems, and influences plant growth and carbon exchange at local to global scales. The role of this process in tropical forests is of particular concern, as these ecosystems harbour abundant nitrogen-fixing organisms and represent one third of terrestrial primary production. Here we show that the micronutrient molybdenum, a cofactor in the nitrogen-fixing enzyme nitrogenase, limits nitrogen fixation by free-living heterotrophic bacteria in soils of lowland Panamanian forests. We measured the fixation response to long-term nutrient manipulations in intact forests, and to short-term manipulations in soil microcosms. Nitrogen fixation increased sharply in treatments of molybdenum alone, in micronutrient treatments that included molybdenum by design and in treatments with commercial phosphorus fertilizer, in which molybdenum was a `hidden' contaminant. Fixation did not respond to additions of phosphorus that were not contaminated by molybdenum. Our findings show that molybdenum alone can limit asymbiotic nitrogen fixation in tropical forests and raise new questions about the role of molybdenum and phosphorus in the tropical nitrogen cycle. We suggest that molybdenum limitation may be common in highly weathered acidic soils, and may constrain the ability of some forests to acquire new nitrogen in response to CO2 fertilization.

Barron, Alexander R.; Wurzburger, Nina; Bellenger, Jean Phillipe; Wright, S. Joseph; Kraepiel, Anne M. L.; Hedin, Lars O.

2009-01-01

167

Large-scale distribution of Atlantic nitrogen fixation controlled by iron availability  

NASA Astrophysics Data System (ADS)

Oceanic fixed-nitrogen concentrations are controlled by the balance between nitrogen fixation and denitrification. A number of factors, including iron limitation, can restrict nitrogen fixation, introducing the potential for decoupling of nitrogen inputs and losses. Such decoupling could significantly affect the oceanic fixed-nitrogen inventory and consequently the biological component of ocean carbon storage and hence air-sea partitioning of carbon dioxide. However, the extent to which nutrients limit nitrogen fixation in the global ocean is uncertain. Here, we examined rates of nitrogen fixation and nutrient concentrations in the surface waters of the Atlantic Ocean along a north-south 10,000km transect during October and November 2005. We show that rates of nitrogen fixation were markedly higher in the North Atlantic compared with the South Atlantic Ocean. Across the two basins, nitrogen fixation was positively correlated with dissolved iron and negatively correlated with dissolved phosphorus concentrations. We conclude that inter-basin differences in nitrogen fixation are controlled by iron supply rather than phosphorus availability. Analysis of the nutrient content of deep waters suggests that the fixed nitrogen enters North Atlantic Deep Water. Our study thus supports the suggestion that iron significantly influences nitrogen fixation, and that subsequent interactions with ocean circulation patterns contribute to the decoupling of nitrogen fixation and loss.

Mark Moore, C.; Mills, Matthew M.; Achterberg, Eric P.; Geider, Richard J.; Laroche, Julie; Lucas, Mike I.; McDonagh, Elaine L.; Pan, Xi; Poulton, Alex J.; Rijkenberg, Micha J. A.; Suggett, David J.; Ussher, Simon J.; Woodward, E. Malcolm S.

2009-12-01

168

Biosynthetic pathways of Vibrio succinogenes growing with fumarate as terminal electron acceptor and sole carbon source  

Microsoft Academic Search

1.With fumarate as the terminal electron acceptor and either H2 or formate as donor, Vibrio succinogenes could grow anaerobically in a mineral medium using fumarate as the sole carbon source. Both the growth rate and the cell yield were increased when glutamate was also present in the medium.2.Glutamate was incorporated only into the amino acids of the glutamate family (glutamate,

Margret Bronder; Hildegard Mell; Erhard Stupperich; Achim Kröger

1982-01-01

169

METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS  

SciTech Connect

The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage pathway. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum.

John J. Kilbane III

2003-12-01

170

Using C and S isotopes to elucidate carbonic versus sulfuric acid reaction pathways during shale weathering in the Susquehanna Shale Hills Critical Zone Observatory  

NASA Astrophysics Data System (ADS)

Chemical weathering of silicate minerals via the carbonic acid reaction pathway regulates global climate on geological timescales. However, strong acids are also key dissolution agents that drive silicate and carbonate weathering. In order to assess the potentials of silicate weathering on CO2 consumption, it is crucial to separate carbonic acid versus sulfuric acid reaction pathways, and also to separate the contribution of stream-dissolved inorganic carbon (DIC) from silicate versus carbonate dissoution. Here we address these two questions using C and S isotopes at the well-studied Susquehanna Shale Hills Critical Zone Observatory (SSHO). In shallow soils of SSHO, clay dissolution dominates. Here soil waters are charaterized by low [DIC], which is controlled by equilibrium with soil pCO2. Carbonate minerals, in this Rose Hill Shale formation, are depleted in soils and have only been observed in few bedrock boreholes, i.e. at > 23m depth at ridges and > 2m depth under the valley. Indeed, some groundwaters have much higher [DIC], [Mg] and [Ca], presumably due to ankerite dissolution. Accompanied by the transition from silicate weathering in shallow soils to carbonate weathering below the water table, the source of sulfate shifts with depth from atmospheric deposition to pyrite dissolution. Apparently, the weathering fronts of ankerite and pyrite are at almost the same depth. The ?13CDIC values of these groundwaters indicate C mixing equally from ankerite and soil CO2, with only slight modification by the sulfuric acid pathway. Groundwater chemistry evolves to different extents with respect to ankerite saturation because the depths to ankerite weathering fronts vary due to heterogeneity of the Rose Hill shales and landscape position. Interestingly, groundwaters along the valley floor at the outlet of the first-order catchment are influenced by carbonate dissolution but also show S isotope signatures indicative of anthropogenic sulfate in wet precipitation. This provides another line of evidence that at least some of the carbonate we observe at shallow depths in the valley floor may be secondary. Indeed, C isotopes of some of the shallow carbonates differ from those in Rose Hill bedrock. Comparison between groundwater and soil water chemistry shows that at SSHO most DIC derives from the dissolution of carbonate minerals, i.e., primary ankerite or secondary carbonate. Sulfate derives almost entirely from atmospheric deposition in soil waters and some groundwater near the outlet; however, its source shifts to pyrite dissolution in groundwaters from ridges and headwater areas. Overall, in this catchment underlain by grey shale, the sulfuric acid pathway is insignicant due to the low pyrite content in comparison to ankerite or secondary carbonate.

Jin, L.; Ogrinc, N.; Yesavage, T.; Hasenmueller, E. A.; Ma, L.; Kaye, J. P.; Brantley, S. L.

2013-12-01

171

Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds  

SciTech Connect

The objective of the project is to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. The selective cleavage of the second C-N bond has been challenging, and efforts to overcome that challenge have been the focus of recent research in this project. Enrichment culture experiments succeeded in isolating bacterial cultures that can metabolize 2-aminobiphenyl, but no enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl has been identified. Aniline is very similar to the structure of 2-aminobiphenyl and aniline dioxygenase catalyzes the conversion of aniline to catechol and ammonia. For the remainder of the project the emphasis of research will be to simultaneously express the genes for carbazole dioxygenase and for aniline dioxygenase in the same bacterial host and then to select for derivative cultures capable of using carbazole as the sole source of nitrogen.

John J. Kilbane II

2005-10-01

172

METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS  

SciTech Connect

The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project was focused on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate deaminase. The objective of the final phase of the project will be to develop derivative C-N bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments resulted in the isolation of microbial cultures that utilize aromatic amides as sole nitrogen sources, several amidase genes were cloned and were included in directed evolution experiments to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. During the second year of the project (October, 2003-September, 2004) enrichment culture experiments succeeded in isolating a mixed bacterial culture that can utilize 2-aminobiphenyl as a sole nitrogen source, directed evolution experiments were focused on the aniline dioxygenase enzyme that is capable of deaminating aniline, and expression vectors were constructed to enable the expression of genes encoding C-N bond cleaving enzymes in Rhodococcus hosts. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum. Aromatic compounds such as carbazole are representative of the difficult-to-treat organonitrogen compounds most commonly encountered in petroleum. There are two C-N bonds in carbazole and the construction of a metabolic pathway for the removal of nitrogen from carbazole will require enzymes capable cleaving both C-N bonds. A multi-component enzyme, carbazole dioxygenase, which can selectively cleave the first C-N bond has been identified and the genes that encode this enzyme have been cloned, sequenced, and are being expressed in Rhodococcus erythropolis, a bacterial culture that tolerates exposure to petroleum. An enzyme capable of selectively cleaving the second C-N bond in carbazole has not yet been identified, but enrichment culture experiments have recently succeeded in isolating a bacterial culture that is a likely candidate and may possess a suitable enzyme. Research in the near future will verify if a suitable enzyme for the cleavage of the second C-N bond in carbazole has indeed been found, then the genes encoding a suitable enzyme will be identified, cloned, and sequenced. Ultimately genes encoding enzymes for selective cleavage of both C-N bonds in carbazole will be assembled into a new metabolic pathway and the ability of the resulting bacterial culture to remove nitrogen from petroleum will be determined.

John J. Kilbane II

2004-10-01

173

Specific inhibitors for identifying pathways for methane production from carbon monoxide by a nonadapted anaerobic mixed culture.  

PubMed

Specific inhibitors such as 2-bromoethanesulfonate (BES) and vancomycin were employed in activity batch tests to decipher metabolic pathways that are preferentially used by a mixed anaerobic consortium (sludge from an anaerobic digester) to transform carbon monoxide (CO) into methane (CH4). We first evaluated the inhibitory effect of both BES and vancomycin on the microbial community, as well as the efficiency and stability of vancomycin at 35 °C, over time. The activity tests with CO2-H2, CO, glucose, acetate, formate, propionate, butyrate, methanol, and ethanol showed that vancomycin does not inhibit some Gram-negative bacteria, and 50 mmol/L BES effectively blocks CH4 production in the sludge. However, when sludge was incubated with propionate, butyrate, methanol, or ethanol as the sole energy and carbon source, methanogenesis was only partially inhibited by BES. Separate tests showed that 0.07 mmol/L vancomycin is enough to maintain its inhibitory efficiency and stability in the population for at least 32 days at 35 °C. Using the inhibitors above, it was demonstrated that CO conversion to CH4 is an indirect, 2-step process, in which the CO is converted first to acetate and subsequently to CH4. PMID:24896194

Navarro, Silvia Sancho; Cimpoia, Ruxandra; Bruant, Guillaume; Guiot, Serge R

2014-06-01

174

Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds  

SciTech Connect

The objective of the project was to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically, the development of a novel biochemical pathway for the selective cleavage of C-N bonds in carbazole was the focus of research in this project. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. Obtaining an enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl-2,3-diol was the focus of much of the research in this project, however; no suitable enzyme was found. Project accomplishments included expressing the genes for carbazole dioxygenase in Rhodococcus erythropolis and Escherichia coli, development of gene expression vectors for Rhodococcus, and isolation of a Pseudomonas sp. strain GTIN-G4 that has the novel biochemical ability to replace one of the nitrogen-associated hydrogen atoms in 2-aminobiphenyl with formaldehyde. Rhodococcus cultures are capable of metabolizing a wide range of substrates, including hydrophobic substrates like petroleum, and may find widespread use in the development of biotechnology processes in the future. The results of this project will directly benefit the development of future biotechnology processes/projects employing Rhodococcus hosts. Three manuscripts were prepared and submitted for publication based on the data obtained in this project: (1) ''Formylation of 2-aminobiphenyl by Pseudomonas sp. strain GTIN-G4''; (2) ''Screening and Analysis of DNA Fragments that Show Promoter Activities in Rhodococcus erythropolis''; and (3) ''Microbial Biocatalyst Developments to Upgrade Fossil Fuels''.

John J. Kilbane II

2006-04-01

175

Evaluation of Bone Fixation Implants  

E-print Network

This research investigates the effects of the human body on the mechanical, chemical, and morphological properties of the surface of internal fixation devices. Stainless steel and titanium devices that had failed were provided from the Shandong...

Perkins, Luke 1990-

2012-12-10

176

Carbon isotopic composition of individual Precambrian microfossils  

NASA Technical Reports Server (NTRS)

Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

House, C. H.; Schopf, J. W.; McKeegan, K. D.; Coath, C. D.; Harrison, T. M.; Stetter, K. O.

2000-01-01

177

Functional ecology of free-living nitrogen fixation: A contemporary perspective  

USGS Publications Warehouse

Nitrogen (N) availability is thought to frequently limit terrestrial ecosystem processes, and explicit consideration of N biogeochemistry, including biological N2 fixation, is central to understanding ecosystem responses to environmental change. Yet, the importance of free-living N2 fixation—a process that occurs on a wide variety of substrates, is nearly ubiquitous in terrestrial ecosystems, and may often represent the dominant pathway for acquiring newly available N—is often underappreciated. Here, we draw from studies that investigate free-living N2 fixation from functional, physiological, genetic, and ecological perspectives. We show that recent research and analytical advances have generated a wealth of new information that provides novel insight into the ecology of N2 fixation as well as raises new questions and priorities for future work. These priorities include a need to better integrate free-living N2 fixation into conceptual and analytical evaluations of the N cycle's role in a variety of global change scenarios.

Reed, Sasha C.; Cleveland, Cory C.; Townsend, Alan R.

2011-01-01

178

Mineral-assisted pathways in prebiotic synthesis: photoelectrochemical reduction of carbon(+IV) by manganese sulfide.  

PubMed

Photoelectrochemistry on mineral surfaces has the potential to play a central role in the prebiotic syntheses of building blocks for biomolecules. In this study, photoreduction of C(+IV) as bicarbonate is used as a probe to investigate the photoelectrochemical properties of alabandite (MnS) colloidal particles. Our experimental results show that photoreduction occurs and that formate is the initial photoproduct. A quantum efficiency of 4.2% is obtained (pH = 7.5). The quantum efficiency is temperature-independent from 298 to 328 K. In addition to formate, longer chain carbon products are also produced. Ion chromatography shows the presence of acetate and propionate. Infrared spectroscopy and mass spectrometry indicate the formation of longer chain organic molecules that contain oxygenated functional groups. Our results suggest that some prebiotic syntheses could have occurred via photoelectrochemical reactions on semiconducting minerals. PMID:15355106

Zhang, Xiang V; Martin, Scot T; Friend, Cynthia M; Schoonen, Martin A A; Holland, Heinrich D

2004-09-15

179

System-based Identification of Toxicity Pathways Associated With Multi-Walled Carbon Nanotube-Induced Pathological Responses  

PubMed Central

The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 µg MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and were used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. PMID:23845593

Snyder-Talkington, Brandi N.; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R.; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L.

2014-01-01

180

System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses.  

PubMed

The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 ?g MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. PMID:23845593

Snyder-Talkington, Brandi N; Dymacek, Julian; Porter, Dale W; Wolfarth, Michael G; Mercer, Robert R; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L

2013-10-15

181

Carbon dioxide fixation by artificial photosynthesis  

SciTech Connect

Green plants can absorb atmospheric CO{sub 2} and transform it to sugars, carbohydrates through their photosynthetic systems, but they become the source of CO{sub 2} when they are dead. This is the reason why artificial leaves which can be alive forever should be developed to meet with global warming due to the increase of CO{sub 2} concentration. The goal of artificial photosynthesis is not to construct the same system as the photosynthetic one, but to mimic the ability of green plants to utilize solar energy to make high energy chemicals. Needless to say, the artificial photosynthetic system is desired to be as simple as possible and to be as efficient as possible. From the knowledge on photosynthesis and the results of previous investigations, the critical components of artificial photosynthetic system are understood as follows: (1) light harvesting chromophore, (2) a center for electron transfer and charge separation, (3) catalytic sites for converting small molecules like water and CO{sub 2} (mutilelectron reactions) which are schematically described.

Ibusuki, Takashi; Koike, Kazuhide; Ishitani, Osamu [National Inst. for Resources and Environment, AIST, MITI, Tsukuba, Ibaraki (Japan)

1993-12-31

182

Tricarboxylic Acid Cycle and One-Carbon Metabolism Pathways Are Important in Edwardsiella ictaluri Virulence  

PubMed Central

Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of channel catfish (ESC). The disease causes considerable economic losses in the commercial catfish industry in the United States. Although antibiotics are used as feed additive, vaccination is a better alternative for prevention of the disease. Here we report the development and characterization of novel live attenuated E. ictaluri mutants. To accomplish this, several tricarboxylic acid cycle (sdhC, mdh, and frdA) and one-carbon metabolism genes (gcvP and glyA) were deleted in wild type E. ictaluri strain 93-146 by allelic exchange. Following bioluminescence tagging of the E. ictaluri ?sdhC, ?mdh, ?frdA, ?gcvP, and ?glyA mutants, their dissemination, attenuation, and vaccine efficacy were determined in catfish fingerlings by in vivo imaging technology. Immunogenicity of each mutant was also determined in catfish fingerlings. Results indicated that all of the E. ictaluri mutants were attenuated significantly in catfish compared to the parent strain as evidenced by 2,265-fold average reduction in bioluminescence signal from all the mutants at 144 h post-infection. Catfish immunized with the E. ictaluri ?sdhC, ?mdh, ?frdA, and ?glyA mutants had 100% relative percent survival (RPS), while E. ictaluri ?gcvP vaccinated catfish had 31.23% RPS after re-challenge with the wild type E. ictaluri. PMID:23762452

Dahal, Neeti; Abdelhamed, Hossam; Lu, Jingjun; Karsi, Attila; Lawrence, Mark L.

2013-01-01

183

Nitrogen fixation in boreal peatlands: the effects of increased N deposition on N2-fixation  

NASA Astrophysics Data System (ADS)

Boreal peatlands are of great importance to global carbon and nitrogen cycling. While covering only 3-4 % of the terrestrial surface, they account for 25-30 % of the world's soil C and 9-15 % of the world's soil N. In Western Canada atmospheric dry deposition rates are extremely low: approximately 1 kg N ha-1 yr-1. Though these systems have been functioning as net sinks over the past 11,000 years, natural and anthropogenic disturbances might compromise the historical balance of C and N. Biological N2-fixation has recently been shown to represent a very significant input of N into these systems, contributing to 62% of total N in Western Canada. Interactions between N deposition and biological N2-fixation are as yet, unknown, but the impact of elevated deposition of N-compounds from increased industrial expansion of oil sands mining to peatlands, is concerning. Given that nitrogenase, the enzyme responsible for catalyzing N2-fixation, is energetically costly when active, enhanced inputs of atmospheric N deposition could be a major determinant for enzyme activity and rates of biological N input to these bogs. Understanding interactions between N deposition and N2 fixation in boreal peatlands can aid in predicting the consequences of increased N deposition and setting critical loads. We conducted a field-fertilization experiment in a poor fen in Alberta, Canada, to determine the effects of enhanced N deposition on a dominant fen species Sphagnum angustifolium. The experiment consisted of seven N treatments: Control, 0, 5, 10, 15, 20 and 25 kg N ha-1 y1, n=3. N2-fixation was measured during summer 2012 and 2013 using the acetylene reduction assay (ARA). ARA rates were converted to rates of N2-fixation by calibrating ARA with paired 15N2-incubations. In both 2012 and 2013, with increasing N deposition from 0 kg N ha-1 yr-1 to 25 kg N ha-1 yr-1, rates of N2 fixation decreased, with highest rates in the 0 kg N ha-1 yr-1 treatment mosses (54.2 × 1.40; 48.58 × 7.12 kg N ha-1 yr-1, mean × std err for 2012 and 2013, respectively) followed by progressively lower rates with a low of 5.02 × 0.87 in 2012 and 8.94 × 3.09 in 2013 (mean × std err). As biological N2-fixation is an energetically costly process, up-regulating enzyme activity when N availability is low and down-regulating activity when N deposition is enhanced makes thermodynamic and evolutionary sense. N2-fixation shows to be one of the most early-warning indicators to the early response of boreal peatlands to increased N deposition, and can aid in setting critical loads to protect these historically pristine ecosystems.

Popma, J. M.; Wieder, R.; Lamers, L.; Vile, M. A.

2013-12-01

184

Characterization of the oxygen tolerance of a hydrogenase linked to a carbon monoxide oxidation pathway in Rubrivivax gelatinosus.  

PubMed

A hydrogenase linked to the carbon monoxide oxidation pathway in Rubrivivax gelatinosus displays tolerance to O2. When either whole-cell or membrane-free partially purified hydrogenase was stirred in full air (21% O2, 79% N2), its H2 evolution activity exhibited a half-life of 20 or 6 h, respectively, as determined by an anaerobic assay using reduced methyl viologen. When the partially purified hydrogenase was stirred in an atmosphere containing either 3.3 or 13% O2 for 15 min and evaluated by a hydrogen-deuterium (H-D) exchange assay, nearly 80 or 60% of its isotopic exchange rate was retained, respectively. When this enzyme suspension was subsequently returned to an anaerobic atmosphere, more than 90% of the H-D exchange activity was recovered, reflecting the reversibility of this hydrogenase toward O2 inactivation. Like most hydrogenases, the CO-linked hydrogenase was extremely sensitive to CO, with 50% inhibition occurring at 3.9 microM dissolved CO. Hydrogen production from the CO-linked hydrogenase was detected when ferredoxins of a prokaryotic source were the immediate electron mediator, provided they were photoreduced by spinach thylakoid membranes containing active water-splitting activity. Based on its appreciable tolerance to O2, potential applications of this hydrogenase are discussed. PMID:12039713

Maness, Pin-Ching; Smolinski, Sharon; Dillon, Anne C; Heben, Michael J; Weaver, Paul F

2002-06-01

185

Carbon Monoxide Signaling in Human Red Blood Cells: Evidence for Pentose Phosphate Pathway Activation and Protein Deglutathionylation  

PubMed Central

Abstract Aims: The biochemistry underlying the physiological, adaptive, and toxic effects of carbon monoxide (CO) is linked to its affinity for reduced transition metals. We investigated CO signaling in the vasculature, where hemoglobin (Hb), the CO most important metal-containing carrier is highly concentrated inside red blood cells (RBCs). Results: By combining NMR, MS, and spectrophotometric techniques, we found that CO treatment of whole blood increases the concentration of reduced glutathione (GSH) in RBC cytosol, which is linked to a significant Hb deglutathionylation. In addition, this process (i) does not activate glycolytic metabolism, (ii) boosts the pentose phosphate pathway (PPP), (iii) increases glutathione reductase activity, and (iv) decreases oxidized glutathione concentration. Moreover, GSH concentration was partially decreased in the presence of 2-deoxyglucose and the PPP antagonist dehydroepiandrosterone. Our MS results show for the first time that, besides Cys93, Hb glutathionylation occurs also at Cys112 of the ?-chain, providing a new potential GSH source hitherto unknown. Innovation: This work provides new insights on the signaling and antioxidant-boosting properties of CO in human blood, identifying Hb as a major source of GSH release and the PPP as a metabolic mechanism supporting Hb deglutathionylation. Conclusions: CO-dependent GSH increase is a new RBC process linking a redox-inactive molecule, CO, to GSH redox signaling. This mechanism may be involved in the adaptive responses aimed to counteract stress conditions in mammalian tissues. Antioxid. Redox Signal. 20, 403–416. PMID:23815439

Metere, Alessio; Iorio, Egidio; Scorza, Giuseppe; Camerini, Serena; Casella, Marialuisa; Crescenzi, Marco; Minetti, Maurizio

2014-01-01

186

The importance of nodule CO2 fixation for the efficiency of symbiotic nitrogen fixation in pea at vegetative growth and during pod formation  

PubMed Central

Nodule CO2 fixation is of pivotal importance for N2 fixation. The process provides malate for bacteroids and oxaloacetate for nitrogen assimilation. The hypothesis of the present paper was that grain legume nodules would adapt to higher plant N demand and more restricted carbon availability at pod formation through increased nodule CO2 fixation and a more efficient N2 fixation. Growth, N2 fixation, and nodule composition during vegetative growth and at pod formation were studied in pea plants (Pisum sativum L.). In parallel experiments, 15N2 and 13CO2 uptake, as well as nodule hydrogen and CO2 release, was measured. Plants at pod formation showed higher growth rates and N2 fixation per plant when compared with vegetative growth. The specific activity of active nodules was about 25% higher at pod formation. The higher nodule activity was accompanied by higher amino acid concentration in nodules and xylem sap with a higher share of asparagine. Nodule 13CO2 fixation was increased at pod formation, both per plant and per 15N2 fixed unit. However, malate concentration in nodules was only 40% of that during vegetative growth and succinate was no longer detectable. The data indicate that increased N2 fixation at pod formation is connected with strongly increased nodule CO2 fixation. While the sugar concentration in nodules at pod formation was not altered, the concentration of organic acids, namely malate and succinate, was significantly lower. It is concluded that strategies to improve the capability of nodules to fix CO2 and form organic acids might prolong intensive N2 fixation into the later stages of pod formation and pod filling in grain legumes. PMID:20363863

Fischinger, Stephanie Anastasia; Schulze, Joachim

2010-01-01

187

Hydrogen coupled CO2 fixation in legume cropping systems  

NASA Astrophysics Data System (ADS)

Electron flow from oxidation of excess H2 released by root nodules was shown to contribute to microbial CO2 fixation in soybean crops. This discovery has important implications for carbon storage in soils used to grow legumes; however, further research is needed to understand the fate and turnover time of this H2-coupled CO2 fixation. Isotopic labeling of soil through incubation with 13CO2 was used to elucidate movement of sequestered carbon into soil carbon pools. Measurement of isotopic shifts was determined using Isotope Ratio Mass Spectrometry. Preliminary experiments have confirmed CO2 uptake through an isotopic shift (?13C -20.4 to -14.5 ‰) in 24 hour incubated soils labeled with 13CO2 (1% v/v, 99.5 Atom%) under elevated H2 concentration (6000 ppm). Other incubation experiments have confirmed the biotic nature of observed CO2 uptake by comparing isotopic shifts in oven dried and autoclaved soils to moist soil. Under an elevated H2 atmosphere, no significant isotopic shift was observed in dry and autoclaved soils whereas moist soil showed an isotopic shift of ?13C -21.9 to 11.4 ‰ over 48 hours. Future experiments will involve longer incubations (7 days) and will be aimed at determining isotopic shifts within soil carbon pools. Samples will be incubated and fractionated into microbial biomass, light fraction carbon, and acid stable carbon and subsequent isotopic analysis will be carried out. This will help determine the distribution of H2- coupled fixed CO2 within soil carbon pools and the turnover time of sequestered carbon. This and further research may lead to modification of greenhouse gas coefficients for leguminous crops that includes a CO2 fixation component.

Philpott, T.; Cen, Y.; Layzell, D. B.; Kyser, K.; Scott, N. A.

2009-05-01

188

NCI-Frederick PHL - Fixatives and Solutions  

Cancer.gov

Services Price List Courier Services & Shipment Procedures Scheduling Contact Information Related Links Establishing an Account PHL Forms PHL Portal Fixatives and Solutions Routine fixatives: 10% Neutral Buffered Formalin (NBF) 37 - 40% Formaldehyde………………………………………1000mL distilled

189

Hinged external fixation of the elbow.  

PubMed

Hinged external fixation of the elbow provides the advantages of static fixation with the benefits of continued motion through the joint. Indications for the use of this method of fixation include traumatic instability, distraction interposition arthroplasty, instability after contracture release, and instability after excision of heterotopic ossification. Orthopedic surgeons should be familiar with hinged fixators and their application when faced with an unstable ulnohumeral joint. PMID:20670807

Chen, Neal C; Julka, Abhishek

2010-08-01

190

Evolution of fracture and fault-controlled fluid pathways in carbonates of the Albanides fold-thrust belt  

USGS Publications Warehouse

The process of fracture and fault formation in carbonates of the Albanides fold-thrust belt has been systematically documented using hierarchical development of structural elements from hand sample, outcrop, and geologic-map scales. The function of fractures and faults in fluid migration was elucidated using calcite cement and bitumen in these structures as a paleoflow indicator. Two prefolding pressure-solution and vein assemblages were identified: an overburden assemblage and a remote tectonic stress assemblage. Sheared layer-parallel pressure-solution surfaces of the overburden assemblage define mechanical layers. Shearing of mechanical layers associated with folding resulted in the formation of a series of folding assemblage fractures at different orientations, depending on the slip direction of individual mechanical layers. Prefolding- and folding-related fracture assemblages together formed fragmentation zones in mechanical layers and are the sites of incipient fault localization. Further deformation along these sites was accommodated by rotation and translation of fragmented rock, which formed breccia and facilitated fault offset across multiple mechanical layers. Strike-slip faults formed by this process are organized in two sets in an apparent conjugate pattern. Calcite cement and bitumen that accumulated along fractures and faults are evidence of localized fluid flow along fault zones. By systematic identification of fractures and faults, their evolution, and their fluid and bitumen contents, along with subsurface core and well-log data, we identify northeast-southwest-trending strike-slip faults and the associated structures as dominant fluid pathways in the Albanides fold-thrust belt. Copyright ?? 2006. The American Association of Petroleum Geologists. All rights reserved.

Graham, Wall, B. R.; Girbacea, R.; Mesonjesi, A.; Aydin, A.

2006-01-01

191

Gene Variants in the Folate-mediated One-carbon Metabolism (FOCM) Pathway as Risk Factors for Conotruncal Heart Defects  

PubMed Central

We evaluated 35 variants among four folate-mediated one-carbon metabolism pathway genes, MTHFD1, SHMT1, MTHFR, and DHFR as risk factors for conotruncal heart defects. Cases with a diagnosis of single gene disorders or chromosomal aneusomies were excluded. Controls were randomly selected from area hospitals in proportion to their contribution to the total population of live-born infants. Odds Ratios (OR) and the 95% confidence intervals were computed for each genotype (homozygous variant or heterozygote, versus homozygous wildtype) and for increase of each less common allele (log-additive model). Interactions between each variant and three folate intake variables (maternal multivitamin use, maternal dietary folate intake, and combined maternal folate intake) were also evaluated under the log-additive model. In general, we did not identify notable associations. The A allele of MTHFD1 rs11627387 was associated with a 1.7-fold increase in conotruncal defects risk in both Hispanic mothers (OR=1.7, 95% CI=1.1?2.5) and Hispanic infants (OR=1.7, 95% CI=1.2?2.3). The T allele of MTHFR rs1801133 was associated with a 2.8-fold increase of risk among Hispanic women whose dietary folate intake was ? 25th centile. The C allele of MTHFR rs1801131 was associated with a two-fold increase of risk (OR=2.0, 95%CI=1.0?3.9) only among those whose dietary folate intake was >25th centile. Our study suggested that MTHFD1 rs11627387 may be associated with risk of conotruncal defects through both maternal and offspring genotype effect among the Hispanics. Maternal functional variants in MTHFR gene may interact with dietary folate intake and modify the conotruncal defects risk in the offspring. PMID:22495907

Zhu, Huiping; Yang, Wei; Lu, Wei; Etheredge, Analee; Lammer, Edward J; Finnell, Richard; Carmichael, Suzan L.; Shaw, Gary

2012-01-01

192

Dissolved CO2 in small catchment streams of eastern Amazonia: A minor pathway of terrestrial carbon loss  

NASA Astrophysics Data System (ADS)

Production of carbon dioxide (CO2) in soils can lead to supersaturation of dissolved free CO2 (pCO2) in groundwater, which later evades to the atmosphere as groundwater enters streams and rivers. This process could be a significant pathway for return of terrestrially fixed C to the atmosphere. We measured pCO2 monthly over two years at multiple stations along three streams from their headwaters in remnant mature forests through multiple land covers in Pará, Brazil. The pCO2 averaged 19,000 ?atm in headwaters and decreased to about 4,500 ?atm downstream. Similar values were measured in headwaters of two small pristine mature forest catchments. Two approaches were used to estimate groundwater pCO2 evasion: assuming that headwater pCO2 measurements reflected incoming groundwater pCO2 or that all entering stream water was in equilibrium with previously measured deep soil CO2. With these assumptions, losses from the terrestrial environment through aquatic evasion of pCO2 would be 0.02-0.15 Mg C ha-1 of land area yr-1, which is about 2-3 orders of magnitude lower than annual estimates of soil respiration and net primary productivity. However, downstream pCO2 values that appear to be in quasi-steady state indicate contributions from other C sources, such as aquatic primary production, soil erosion, dissolved organic matter, or litter inputs from streamside vegetation. Hence, lateral pCO2 loss from groundwater to streams is minor for most of the terrestrial ecosystems of this region, although C loss to streams could be significant for net terrestrial budgets in riparian ecosystems or areas experiencing erosion.

Davidson, Eric A.; Figueiredo, Ricardo O.; Markewitz, Daniel; Aufdenkampe, Anthony K.

2010-12-01

193

Polysaccharide addition effects on rhizosphere nitrogen fixation rates of the California cordgrass, Spartina foliosa  

Microsoft Academic Search

Low nutrient availability in salt marsh ecosystems can potentially limit primary productivity and subsequent carbon export\\u000a to coastal waters. In temperate marshes with low external nitrogen inputs, nitrogen (N2) fixation may enhance availability of usable nitrogen to marsh plant communities and increase their growth. The effects of\\u000a sub-surface soil amendment of polysaccharides on rhizosphere N2 fixation, and on plant growth

Risa A. Cohen; Katelyn Walker; Edward J. Carpenter

2009-01-01

194

Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre  

PubMed Central

Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N2-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N2-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200?m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of 15N-labeled ammonium and leucine in our incubation experiments. N2-fixation was detectable throughout the upper 200?m at most stations, with rates ranging from 0.001 to 0.19?nM?N?h?1. N2-fixation in the SPG may account for the production of 8–20% of global oceanic new nitrogen. Interestingly, comparable 15N2-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel MM

2012-01-01

195

Tissue fixation and the effect of molecular fixatives on downstream staining procedures  

PubMed Central

It is impossible to underplay the importance of fixation in histopathology. Whether the scientist is interested in the extraction of information on lipids, proteins, RNA or DNA, fixation is critical to this extraction. This review aims to give a brief overview of the current “state of play” in fixation and focus on the effect fixation, and particularly the effect of the newer brand of “molecular fixatives” have on morphology, histochemistry, immunohistochemistry and RNA/DNA analysis. A methodology incorporating the creation of a fixation tissue microarray for the study of the effect of fixation on histochemistry is detailed. PMID:24561827

Howat, William J.; Wilson, Beverley A.

2014-01-01

196

Osmolarity of osmium tetroxide and glutaraldehyde fixatives  

Microsoft Academic Search

Synopsis  The evidence available to date for the importance of fixative osmolarity is considered together with some observations on the volume changes of crab axons after fixation by osmium tetroxide and glutaraldehyde. The results obtained are compared with those obtained from crab axons and from amphioxus skin cells which had been processed and examined with the electron microscope after initial fixation

Q. Bone; K. P. Ryan

1972-01-01

197

Options for acetabular fixation surfaces.  

PubMed

Aseptic loosening is the most common cause for revision total hip arthroplasty (THA). Due to poor long-term results with cemented acetabular components, cementless implants that rely on biologic fixation became popular in the United States for both primary and revision procedures in the early 1980s. Cementless acetabular components used in THA have been reported to have superior radiographic performance compared with cemented fixation, although the optimal method of acetabular fixation remains controversial. Cementless acetabular components require initial implant stability to allow for bone ingrowth and remodeling into the acetabular shell, providing long-term durability of the prosthesis. Many improved implant materials are available to facilitate bone growth and remodeling, including the 3 most common surface treatments; fibermesh, sintered beads, and plasma spray coatings. Recently added to these are porous metal surfaces, which have increased porosity and optimal pore sizes when compared with titanium fibermesh. The most studied of these materials is the titanium fibermesh fixation surface, which has demonstrated a mechanical failure rate of 1% at 10 to 15 years. This technology utilizes the diffusion bonding process to attach fiber metal pads to a titanium substrate using heat and pressure. The sintered bead fixation surface offers a porous coating of various sizes of spherical beads, achieved by the sintering process, and has been shown to provide long-term fixation. While there are less long-term published data regarding the titanium plasma spray surface, its early results have provided evidence of its durability, even in the face of significant osteolysis. The most recently added alternative fixation surface is porous tantalum metal, which offers potentially greater bone ingrowth and bone graft incorporation due to its high porosity (80%) and low modulus of elasticity (3 MPa). Porous tantalum implants have shown early favorable clinical results and have been reported to have excellent bone graft incorporation of the acetabular component based on serial radiograph data at a minimum 1-year follow-up. Tritanium is a porous metal, which has emerged as a promising new surface technology for acetabular shells. While no clinical data are yet available, basic science research has demonstrated enhanced bone ingrowth and mechanical strength. PMID:19023943

Klika, Alison K; Murray, Trevor G; Darwiche, Hussein; Barsoum, Wael K

2007-01-01

198

N? fixation by subsurface populations of Trichodesmium : an important source of new nitrogen to the North Atlantic Ocean  

E-print Network

Trichodesmium, a genus of diazotrophic cyanobacteria, is an important contributor to the marine nitrogen (N) and carbon (C) cycles. The extent to which Trichodesmium dinitrogen (N2) fixation contributes to the marine N ...

Heithoff, Abigail

2011-01-01

199

Determination of pathways of glycogen synthesis and the dilution of the three-carbon pool with (U- sup 13 C)glucose  

SciTech Connect

Rats were infused with glucose at 30 mg/min, containing 18% enriched (U-{sup 13}C)glucose and (1-{sup 14}C)- and (3-{sup 3}H)glucose and liver glycogen were determined by gas chromatography/mass spectroscopy. The contribution of the direct pathway to glycogen was calculated from the three tracers, and the values by all three were nearly identical, about 50%. The {sup 14}C specific activity in carbon 6 of glycogen glucose was about 6% that of carbon 1. The ({sup 3}H)glucose/(1-{sup 14}C)glucose ratio in glycogen was 80-90% that is blood glucose. The enrichment of {sup 13}C and the specific activity of {sup 14}C in glycogen formed by the indirect path were 20-25% of glycogen formed directly from glucose. The dilution is of two kinds: (1) an exchange of labeled carbon with unlabeled carbon in the tricarboxylic acid cycle and (2) dilution by unlabeled nonglucose carbon. Methods to calculate the two types of dilution are presented. In rate preinjected with glucagon, the dilution through the tricarboxylic acid cycle was unaffected but that by nonglucose carbon was decreased.

Katz, J.; Wals, P.A. (Cedars-Sinai Medical Center, Los Angeles, CA (United States)); Lee, W.N.P. (Los Angeles Research and Education Inst., Torrance, CA (United States))

1991-03-15

200

The supply of excess phosphate across the Gulf Stream and the maintenance of subtropical nitrogen fixation  

NASA Astrophysics Data System (ADS)

The subtropical North Atlantic is considered a hot spot for biological nitrogen fixation, with estimated rates between 1 and 20 × 1011 mol nitrogen fixed annually. However, the region's nutrient reservoir beneath the euphotic zone is so enriched in nitrate relative to phosphate that it is perplexing how fixation might be sustained there. Here, we investigate whether the physical transport of excess phosphate into the subtropical gyre is sufficient to sustain nitrogen fixation in the gyre. Specifically, we assess the Ekman advection and isopycnal mixing of excess phosphate to the subtropical North Atlantic, using detailed hydrographic and nutrient sections occupied across the Gulf Stream combined with satellite wind data. Ekman advection and along-isopycnal mixing provide a source of approximately 2 × 1010 mol yr-1 of excess phosphate in the northwestern subtropics, a physical mechanism that has the potential to support more than 3 × 1011 mol yr-1 of biological nitrogen fixation, after accounting for alternative sinks of excess phosphate. This excess phosphate supply across the gyre's northern boundary and high nitrogen fixation there offers a mechanism that can explain both the maintenance of subtropical North Atlantic nitrogen fixation in a phosphate-poor environment and help account for the weak gradients in the proxies of fixation observed along interior circulation pathways of the gyre.

Palter, Jaime B.; Lozier, M. Susan; Sarmiento, Jorge L.; Williams, Richard G.

2011-12-01

201

Analysis of gene expression profiles in healing rat fractures treated with nail and plate fixation.  

PubMed

To compare fracture healing therapies, the gene expression profiles of rat fracture samples treated with nail and plate fixation were analyzed at 1 day, 3 days, 1 week, 2 weeks, 4 weeks, and 6 weeks after surgery. The gene expression profiles GSE1685, which include 19 samples, were downloaded from the Gene Expression Omnibus database. After preprocessing, the gene expression profiles were subjected to time series analysis using the Short Time-series Expression Miner software, and the significantly differentially expressed gene (DEG) sets were selected. Further, the distributions of those DEG sets on the corresponding chromosomes were identified using the functional classification tool. Finally, the DEGs were subjected to function and pathway enrichment analysis. DEG analysis indicated that the number of DEGs (854 genes) from nail fixation was significantly lower than that of DEGs (1029 genes) from plate fixation. The DEGs were mainly enriched in cell proliferation, cellular localization, and response to wounding functions. Several critical DEGs expressed during the fracture healing process were screened, and 2 common pathways were enriched for the DEGs in the nail fixation and plate fixation. These DEGs and pathways may be potential targets or predictive markers during fracture healing. PMID:25366739

Wang, S D; Li, X L; Liu, H P

2014-01-01

202

Investigations of potential microbial methanogenic and carbon monoxide utilization pathways in ultra-basic reducing springs associated with present-day continental serpentinization: the Tablelands, NL, CAN  

PubMed Central

Ultra-basic reducing springs at continental sites of serpentinization act as portals into the biogeochemistry of a subsurface environment with H2 and CH4 present. Very little, however, is known about the carbon substrate utilization, energy sources, and metabolic pathways of the microorganisms that live in this ultra-basic environment. The potential for microbial methanogenesis with bicarbonate, formate, acetate, and propionate precursors and carbon monoxide (CO) utilization pathways were tested in laboratory experiments by adding substrates to water and sediment from the Tablelands, NL, CAD, a site of present-day continental serpentinization. Microbial methanogenesis was not observed after bicarbonate, formate, acetate, or propionate addition. CO was consumed in the live experiments but not in the killed controls and the residual CO in the live experiments became enriched in 13C. The average isotopic enrichment factor resulting from this microbial utilization of CO was estimated to be 11.2 ± 0.2‰. Phospholipid fatty acid concentrations and ?13C values suggest limited incorporation of carbon from CO into microbial lipids. This indicates that in our experiments, CO was used primarily as an energy source, but not for biomass growth. Environmental DNA sequencing of spring fluids collected at the same time as the addition experiments yielded a large proportion of Hydrogenophaga-related sequences, which is consistent with previous metagenomic data indicating the potential for these taxa to utilize CO.

Morrill, Penny L.; Brazelton, William J.; Kohl, Lukas; Rietze, Amanda; Miles, Sarah M.; Kavanagh, Heidi; Schrenk, Matthew O.; Ziegler, Susan E.; Lang, Susan Q.

2014-01-01

203

Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways  

NASA Technical Reports Server (NTRS)

Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

2012-01-01

204

11CO2 fixation: a renaissance in PET radiochemistry.  

PubMed

Carbon-11 labelled carbon dioxide is the cyclotron-generated feedstock reagent for most positron emission tomography (PET) tracers using this radionuclide. Most carbon-11 labels, however, are installed using derivative reagents generated from [(11)C]CO2. In recent years, [(11)C]CO2 has seen a revival in applications for the direct incorporation of carbon-11 into functional groups such as ureas, carbamates, oxazolidinones, carboxylic acids, esters, and amides. This review summarizes classical [(11)C]CO2 fixation strategies using organometallic reagents and then focuses on newly developed methods that employ strong organic bases to reversibly capture [(11)C]CO2 into solution, thereby enabling highly functionalized labelled compounds to be prepared. Labelled compounds and radiopharmaceuticals that have been translated to the clinic are highlighted. PMID:23673726

Rotstein, Benjamin H; Liang, Steven H; Holland, Jason P; Collier, Thomas Lee; Hooker, Jacob M; Wilson, Alan A; Vasdev, Neil

2013-06-25

205

Symbiotic nitrogen fixation in legume nodules: metabolism and regulatory mechanisms.  

PubMed

The special issue "Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms" aims to investigate the physiological and biochemical advances in the symbiotic process with an emphasis on nodule establishment, development and functioning. The original research articles included in this issue provide important information regarding novel aspects of nodule metabolism and various regulatory pathways, which could have important future implications. This issue also included one review article that highlights the importance of using legume trees in the production of renewable biofuels. PMID:25347276

Sulieman, Saad; Tran, Lam-Son Phan

2014-01-01

206

Fixational eye movements and binocular vision  

PubMed Central

During attempted visual fixation, small involuntary eye movements–called fixational eye movements–continuously change of our gaze’s position. Disagreement between the left and right eye positions during such motions can produce diplopia (double vision). Thus, the ability to properly coordinate the two eyes during gaze fixation is critical for stable perception. For the last 50 years, researchers have studied the binocular characteristics of fixational eye movements. Here we review classical and recent studies on the binocular coordination (i.e., degree of conjugacy) of each fixational eye movement type: microsaccades, drift and tremor, and its perceptual contribution to increasing or reducing binocular disparity. We also discuss how amblyopia and other visual pathologies affect the binocular coordination of fixational eye movements. PMID:25071480

Otero-Millan, Jorge; Macknik, Stephen L.; Martinez-Conde, Susana

2014-01-01

207

Carbon-Isotope Fractionations of Autotrophic Bacteria: Relevance to Primary Production and Microbial Evolution in Hot Springs and Hydrothermal Vents  

NASA Astrophysics Data System (ADS)

Terrestrial hot springs and marine hydrothermal vents are often dominated by autotrophic microorganisms. Species of the Bacteria Domain in these environments are known to use different pathways for CO2 fixation. These may include the Calvin cycle, the Acetyl CoA pathway, the reverse TCA cycle, and the 3-HP pathway. Each cycle or pathway may be characterized by distinct patterns of carbon isotope fractionation. This presentation will summarize isotope fractionation patterns associated with known autotrophic bacteria and to use these patterns for interpreting natural isotopic variations. Examples will include hot springs from the Yellowstone National Park and Nevada desert, USA and Kamchatka, Russia, and hydrothermal vents from the East Pacific Rise. An attempt will be made to discuss isotopic variations within a particular pathway in the context of species evolution through horizontal gene transfer.

Zhang, C. L.; Romanek, C. S.; Mills, G.

2004-12-01

208

Intermaxillary fixation screw for endotracheal tube fixation in the edentulous patient with facial burns.  

PubMed

Endotracheal tube fixation in patients with severe facial burns and edentulism is a challenge. We describe a simple and elegant method to secure the endotracheal tube in such patients by means of an intermaxillary fixation screw. PMID:24948409

Fleissig, Y; Rushinek, H; Regev, E

2014-10-01

209

Modeling fixation locations using spatial point processes.  

PubMed

Whenever eye movements are measured, a central part of the analysis has to do with where subjects fixate and why they fixated where they fixated. To a first approximation, a set of fixations can be viewed as a set of points in space; this implies that fixations are spatial data and that the analysis of fixation locations can be beneficially thought of as a spatial statistics problem. We argue that thinking of fixation locations as arising from point processes is a very fruitful framework for eye-movement data, helping turn qualitative questions into quantitative ones. We provide a tutorial introduction to some of the main ideas of the field of spatial statistics, focusing especially on spatial Poisson processes. We show how point processes help relate image properties to fixation locations. In particular we show how point processes naturally express the idea that image features' predictability for fixations may vary from one image to another. We review other methods of analysis used in the literature, show how they relate to point process theory, and argue that thinking in terms of point processes substantially extends the range of analyses that can be performed and clarify their interpretation. PMID:24084942

Barthelmé, Simon; Trukenbrod, Hans; Engbert, Ralf; Wichmann, Felix

2013-01-01

210

Image recorder with microwave fixation  

SciTech Connect

The present invention is directed to improvement in an image recorder for recording developed images or toner images by microwave fixation. According to the invention there is used a novel thermoplastic developer comprising of two components. The first component contains a dielectric material which is able to absorb microwave and generate heat by dielectric loss. The second component contains magnetic loss exothermic material. The microwave absorbing power of the first component is improved by heating the first component with heat generated from the second component.

Hosono, N.; Isaka, K.

1984-11-13

211

Symbiotic N 2 -fixation in alpine tundra: ecosystem input and variation in fixation rates among communities  

Microsoft Academic Search

Annual inputs of symbiotic N2-fixation associated with 3 species of alpine Trifolium were estimated in four alpine communities differing in resource supplies. We hypothesized that fixation rates would vary according to the degree of N, P, and water limitation of production, with the higher rates of fixation in N limited communities (dry meadow, moist meadow) and lower rates in P

William D. Bowman; James C. Schardt; Steven K. Schmidt

1996-01-01

212

UNDERSTANDING THE KINETICS AND DYNAMICS OF RADIATION-INDUCED REACTION PATHWAYS IN CARBON MONOXIDE ICE AT 10 K  

E-print Network

solar system like Kuiper Belt objects. With the intense radiation fields that permeate virtually all with its gas phase detection by Wilson et al. (1970) in the Orion Nebula, the carbon monoxide molecule has

Kaiser, Ralf I.

213

Comment: Critical examination of stable isotope analysis as a means for tracing carbon pathways in stream ecosystems  

Microsoft Academic Search

On the basis of a review of current literature, France (1995) questioned the utility of stable isotope analysis (SIA) in de- scribing food webs and understanding the effects of human perturbation in lotic ecosystems. His three main conclusions were (i) ìautotrophic pathways within forested headwaters are much more important to lotic food webs than would be sug- gested by their

Richard R. Doucett; Dave R. Barton; Karin R. A. Guiguer; G. Power; R. J. Drimmie

1996-01-01

214

21 CFR 888.3010 - Bone fixation cerclage.  

Code of Federal Regulations, 2011 CFR

... 2011-04-01 false Bone fixation cerclage. 888...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...Prosthetic Devices § 888.3010 Bone fixation cerclage. (a) Identification. A bone fixation cerclage...

2011-04-01

215

21 CFR 888.3010 - Bone fixation cerclage.  

Code of Federal Regulations, 2010 CFR

... 2010-04-01 false Bone fixation cerclage. 888...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...Prosthetic Devices § 888.3010 Bone fixation cerclage. (a) Identification. A bone fixation cerclage...

2010-04-01

216

21 CFR 888.3010 - Bone fixation cerclage.  

Code of Federal Regulations, 2012 CFR

... 2012-04-01 false Bone fixation cerclage. 888...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...Prosthetic Devices § 888.3010 Bone fixation cerclage. (a) Identification. A bone fixation cerclage...

2012-04-01

217

21 CFR 888.3010 - Bone fixation cerclage.  

Code of Federal Regulations, 2013 CFR

... 2013-04-01 false Bone fixation cerclage. 888...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...Prosthetic Devices § 888.3010 Bone fixation cerclage. (a) Identification. A bone fixation cerclage...

2013-04-01

218

SUSTAINABLE TRANSPORTATION ENERGY PATHWAYS  

E-print Network

and Sustainable Transportation 249 11: Toward a Universal Low-Carbon Fuel Standard 251 Daniel Sperling and SoniaSUSTAINABLE TRANSPORTATION ENERGY PATHWAYS A Research Summary for Decision Makers Edited by Joan Ogden and Lorraine Anderson #12;SUSTAINABLE TRANSPORTATION ENERGY PATHWAYS #12;SUSTAINABLE

California at Davis, University of

219

Nitrogen fixation in Lake Mendota, Madison, Wisconsin  

Microsoft Academic Search

The cffccts of various environmental conditions, and of ccl1 composition, heterocyst con- tent, and nitrogen content of algal s'amples, on fixation of N, by colonial and filamentous algae in Lake Mendota were investigated. IIctcrocyst content and temperature were significantly and positively related to accty- lcnc recluction activity ( NB fixation); depth of sample collection was negatively related. Rvailablc data do

MARGUERITE SHERMAN TORREY; G. F. LEE

1976-01-01

220

Original article The economics of nitrogen fixation  

E-print Network

. Of course, soil type and climate also affect the value of nitrogen, but so do fertiliser and crop and animalOriginal article The economics of nitrogen fixation Steven SCHILIZZI*, David J. PANNELL Agriculture the economic value of nitrogen fixation in a Mediterranean-type farming system in Western Australia, as well

Paris-Sud XI, Université de

221

Fixation and the Road Not Taken  

Microsoft Academic Search

In this article, the psychic and existential impact that fixation has on an individual's life is addressed. A person may drift through years that are dictated by the circuitous path of a fixation and its vicissitude of the repetition compulsion. When such \\

Peter Shabad

1987-01-01

222

Bioabsorbable fixation in orthopaedic surgery and traumatology  

Microsoft Academic Search

Bioabsorbable internal fixation devices were introduced clinically in the treatment of fractures and osteotomies of the extremities at the Department of Orthopaedics and Traumatology, Helsinki University, in 1984. Since November 5, 1984, a total of 3200 patients were managed using bone or ligament fixation devices made of self-reinforced (matrix and fibres of the same polymer) bioabsorbable alpha-hydroxy polyesters. The devices

Pentti U Rokkanen; Ole Böstman; Eero Hirvensalo; E. Antero Mäkelä; Esa K Partio; Hannu Pätiälä; Seppo Vainionpää; Kimmo Vihtonen; Pertti Törmälä

2000-01-01

223

The ecology and genomics of C02 fixation in oceanic river plumes  

SciTech Connect

The ocean/atmosphere interface is the major conduit for the entry of atmospheric CO2 into oceanic carbon pools that can lead to sequestration or recycled release. The surface layers of the temperate and tropical oceans are often too oligotrophic to result in significant primary production that might lead to carbon sequestration. However, nutrient-rich river plumes can alter the primary production schemes of oligotrophic ocean basins, resulting in increased phytoplankton biomass and carbon fixation. The ultimate goal of this proposal is to understand these carbon cycling processes in major river plumes from the molecular processes involved in biological DIC uptake to contribution to basin-wide production and potential sequestration. Our research efforts include a field component to answer the questions raised concerning DIC in plumes entering ocean basins and an intensive genomics approach to understanding these processes on the cellular level using genomic fragments obtained from plume biota. This project is actually composed of 3 separate PI-initiated projects, including projects at the University of South Florida (USF) College of Marine Science, the University of Puerto Rico, and The Ohio State University. This report concerns research conducted at The Ohio State University and studies performed in collaboration with USF. In order to understand what might occur in the field, two model sysytems were studied in the laboratory. Carbon fixation in the unicellular cyanobacterium Synechococcus sp Strain PCC 7002 took place mainly through the CBB pathway. Nitrogen nutrition in cyanobacteria is regulated by NtcA, a transcriptional regulatory protein. We show that the rubisco activity and gene (rbcL) expression were not affected when cells were exposed to prolonged periods of nitrogen stress, however cells appear to use intracellular nitrogen reserves during nitrogen starvation. Transcripts of the global transcriptional regulator NtcA are expressed under nitrogen starved and nitrogen replete (nitrate or ammonia) growth conditions, with slight decrease in transcription in the presence of ammonia. These results suggest that intracellular levels of NtcA do not directly affect carbon metabolism. Gene expression of the other nitrogen regulatory signal transducer, encoded by glnB was also studied. The glnB gene was highly transcribed in nitrogen-limited cells compared to nitrogen depleted growth conditions. Therefore in the cyanobacterium Synechococcus sp PCC 7002, nitrogen does not affect the metabolic potential and carbon fixation. The NtcA regulator behaved differently and studies indicate that the product of the ntcA gene (NtcA) has an indirect effect on ca rbon assimilation and the genes involved in the carbon concentrating mechanism of strain 7002. The product of the ccmM gene plays an important role in carboxysome assembly and inorganic carbon transport within the cell. We hypothesized that under nitrogen limiting conditions the transcriptional regulator NtcA binds at the region upstream of ccmM, near the transcription start site, and blocks the transcription of ccmM. This hypothesis was experimentally proven. In another study, with USF researchers, we performed experiments in situ on RubisCO espression. To determine the relationship between expression of the major gene in carbon fixation, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO2 in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30–32) stations were dominated by rbcL mRNA concentrations from heterokonts; i.e., diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, a-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34–36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO2. While Prochlorococcus cells did not exhibit a large difference between low and high pCO2

F. Robert Tabita

2008-09-12

224

Eighth international congress on nitrogen fixation. Final program  

SciTech Connect

This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

Not Available

1990-12-31

225

A re-investigation of the path of carbon in photosynthesis utilizing GC/MS methodology. Unequivocal verification of the participation of octulose phosphates in the pathway.  

PubMed

A GC/EIMS/SIM methodology has been developed to re-examine the path of carbon in photosynthesis. Exposing isolated spinach chloroplasts to 13CO2 on a solid support for a defined period followed by quenching and work-up provided a mixture of labelled sugar phosphates. After enzymatic dephosphorylation and derivatization, the Mox-TMS sugars were analysed using the above method. The purpose of the study was to try to calculate the atom% enrichment of 13C in as many of the individual carbons in each of the derivatized sugars as was practical using diagnostic fragment ions. In the event, only one 45 s experiment provided sufficient data to enable a range of enrichment values to be calculated. This confirmed that D-glycero-D-altro-octulose phosphate was present in the chloroplasts and was heavily labelled in the C4, C5 and C6 positions, in keeping with the hypothesis that it had an inclusive role and a labelling pattern consistent with a new modified pathway of carbon in photosynthesis. PMID:17149533

Flanigan, Ian L; MacLeod, John K; Williams, John F

2006-11-01

226

Fixation of CO2 in Clostridium cellulovorans analyzed by 13C-isotopomer-based target metabolomics  

PubMed Central

Clostridium cellulovorans has been one of promising microorganisms to use biomass efficiently; however the basic metabolic pathways have not been completely known. We carried out 13C-isotopomer-based target metabolome analysis, or carbohydrate conversion process analysis, for more profound understanding of metabolic pathways of the bacterium. Our findings that pyruvate?+?oxaloacetate, fumarate, and malate inside and outside cells exhibited 13C incorporation suggest that C. cellulovorans exactly fixed CO2 and partly operated the TCA cycle in a reductive manner. Accompanied with CO2 fixation, the microorganism was also found to produce and secrete lactate. Overall, our study demonstrates that a part of C. cellulovorans metabolic pathways related to glycolysis and the TCA cycle are involved in CO2 fixation. PMID:24103325

2013-01-01

227

Carbon and nitrogen cycling in thermally heated sediments  

NASA Astrophysics Data System (ADS)

Hydrothermally heated sediment environments, such as are found in abundance throughout Yellowstone National Park, host fully functional microbial ecosystems. As with any ecosystem, both sources and sinks of carbon, nitrogen, and a myriad of other nutrients and energy-driving factors must be supplied. While we know microbial communities in hydrothermal environments can be surprisingly diverse, we know little about basic ecological functions such as carbon and nitrogen cycling. Previous work has shown that carbon cycling in one hot spring in Yellowstone National Park [“Bison Pool”] and its associated runoff channel functions as a complex system. Analysis of carbon and nitrogen isotopes in sediments and biofilms across a temperature and chemical gradient at this location revealed that the four best studied carbon fixation pathways [Calvin, reverse tricarboxylic acid, acetyl-CoA, 3-hydroxypropionate cycles] may all be functioning in this system, and nitrogen fixation varies across the chemosynthetic/photosynthetic ecotone [1]. Microcosm experiments using biofilms from this hot spring as inoculae with 13C labeled carbon substrates indicate heterotrophic growth [2]. In addition, metagenomic analysis of environmental DNA has indicated the presence of genes involved in carbon fixation [both phototrophic and autotrophic], and heterotrophy, as well as nitrogen fixation [3]. Studies from other Yellowstone locations have also found genetic evidence for carbon and nitrogen fixation [4, 5]. Of particular interest is the role of individuals in carbon and nitrogen cycling as environmental conditions suitable for chemosynthetic and photosynthetic growth vary. This study explores the diversity of cbbM/cbbL [Calvin cycle], aclB/oor/porA [rTCA cycle], nifH [nitrogen fixation], nirK [nitrite reduction] and amoA [ammonia oxidation] genes across a variety of Yellowstone environments. The transition of genetic diversity within sediments and biofilms is focused on the chemosynthetic/photosynthetic ecotone from a variety of hot springs spanning a range of pH and geochemical conditions. By sampling across this ecotone, changes in carbon and nitrogen fixation as a function of changing community structure become apparent. Environmental DNA was extracted from these samples, and the presence/absence of Bacteria and Archaea determined by PCR. In addition, PCR-directed screens reveal the presence or absence of the aforementioned functional genes. Further, comparison across a broad spectrum of environmental conditions supplies context for phylogenetic analysis of diversity. [1] Havig, J.R., 2009. Geochemistry of Hydrothermal Biofilms: Composition of Biofilms in Siliceous Sinter-Deposting Hot Springs. Doctoral Dissertation, Arizona State University. [2] Meyer-Dombard et al., 2007. Microbial Diversity and SIP Investigations of Streamer Biofilm Communities in Yellowstone. Goldschmidt Geochemical Conference. [3] Raymond et al., 2008. EOS Trans AGU. Abstract B14A-03. [4] Hall et al., 2008. AEM 74:4910-4922. [5] Steunou et al., 2006. PNAS 103:2398-2403.

Meyer-Dombard, D. R.; Burton, M.; Vennelakanti, S.; Havig, J. R.; Shock, E.

2009-12-01

228

Autotrophic Microbe Metagenomes and Metabolic Pathways Differentiate Adjacent Red Sea Brine Pools  

PubMed Central

In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens. PMID:23624511

Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

2013-01-01

229

Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}  

NASA Astrophysics Data System (ADS)

Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (?13C = {[13C/12Csample/13C/12Cstandard] - 1} × 1000). Five different forms of RubisCO (IA, IB, IC, ID, and II) are utilized by algae and autotrophic bacteria reliant on the Calvin-Benson cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs, and their ? values (={[12k/13k] - 1} × 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, explaining the variation in biomass ?13C values of autotrophs utilizing these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides and Ralstonia eutropha. The purpose of this work was to determine the ? values for form IC RubisCO enzymes from R. sphaeroides and R. eutropha. Recombinant form IC RubisCOs were purified by conventional column chromatography procedures. Assay conditions (pH, dissolved inorganic carbon concentration) were tested to determine which parameters were conducive to the high rates of carbon fixation necessary for ? determination. Under standard conditions (pH 8.5 and 5 mM DIC), form IC RubisCO activities were sufficient for ? determination. Experiments are currently being conducted to measure the ? values of these enzymes. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of ?13C values of organisms fixing carbon via the Calvin-Benson cycle. These results are critical for determining the degree to which Calvin cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.

Thomas, P. J.; Boller, A. J.; Zhao, Z.; Tabita, F. R.; Cavanaugh, C. M.; Scott, K. M.

2006-12-01

230

Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria.  

PubMed

Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light-but only in Ala-contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy. PMID:25136122

Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M; Pinhassi, Jarone

2014-09-01

231

Biological nitrogen fixation in sugar cane: A key to energetically viable biofuel production  

Microsoft Academic Search

The advantages of producing biofuels to replace fossil energy sources are derived from the fact that the energy accumulated in the biomass in captured directly from photosynthesis and is thus renewable, and that the cycle of carbon dioxide fixation by the crop, followed by burning of the fuel makes no overall contribution to atmospheric COâ or, consequently, to global warming.

R. M. Boddey

1995-01-01

232

Coupled transport-reaction pathways and distribution patterns between siliciclastic-carbonate sediments at the Ria de Vigo  

NASA Astrophysics Data System (ADS)

This paper examines the linkages between the space-distribution of grain sizes and the relative percentage of the amount of mineral species that result from the mixing process of siliciclastic and carbonate sediments at the Ria de Vigo (NW of Spain). The space-distribution of minerals was initially determined, starting from a detailed mineralogical study based on XRD-Rietveld analysis of the superficial sediments. Correlations between the maps obtained for grain sizes, average fractions of either siliciclastic or carbonates, as well as for individual-minerals, were further stabilised. From this analysis, spatially organized patterns were found between carbonates and several minerals involved in the siliciclastic fraction. In particular, a coupled behaviour is observed between plagioclases and carbonates, in terms of their relative percentage amounts and the grain size distribution. In order to explain these results a conceptual model is proposed, based on the interplay between chemical processes at the seawater-sediment interface and hydrodynamical factors. This model suggests the existence of chemical control mechanisms that, by selective processes of dissolution-crystallization, constrain the mixed environment's long-term evolution, inducing the formation of self-organized sedimentary patterns.

García, T.; Velo, A.; Fernandez-Bastero, S.; Gago-Duport, L.; Santos, A.; Alejo, I.; Vilas, F.

2005-02-01

233

Oxygen-poor microzones as potential sites of microbial n(2) fixation in nitrogen-depleted aerobic marine waters.  

PubMed

The nitrogen-deficient coastal waters of North Carolina contain suspended bacteria potentially able to fix N(2). Bioassays aimed at identifying environmental factors controlling the development and proliferation of N(2) fixation showed that dissolved organic carbon (as simple sugars and sugar alcohols) and particulate organic carbon (derived from Spartina alterniflora) additions elicited and enhanced N(2) fixation (nitrogenase activity) in these waters. Nitrogenase activity occurred in samples containing flocculent, mucilage-covered bacterial aggregates. Cyanobacterium-bacterium aggregates also revealed N(2) fixation. In all cases bacterial N(2) fixation occurred in association with surficial microenvironments or microzones. Since nitrogenase is oxygen labile, we hypothesized that the aggregates themselves protected their constituent microbes from O(2). Microelectrode O(2) profiles revealed that aggregates had lower internal O(2) tensions than surrounding waters. Tetrazolium salt (2,3,5-triphenyl-3-tetrazolium chloride) reduction revealed that patchy zones existed both within microbes and extracellularly in the mucilage surrounding microbes where free O(2) was excluded. Triphenyltetrazolium chloride reduction also strongly inhibited nitrogenase activity. These findings suggest that N(2) fixation is mediated by the availability of the appropriate types of reduced microzones. Organic carbon enrichment appears to serve as an energy and structural source for aggregate formation, both of which were required for eliciting N(2) fixation responses of these waters. PMID:16347337

Paerl, H W; Prufert, L E

1987-05-01

234

Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes  

NASA Astrophysics Data System (ADS)

Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multi-year mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) build-up and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

2014-08-01

235

Intramedullary screw fixation of lateral malleolus fractures.  

PubMed

A biomechanical evaluation of intramedullary versus buttress plate and lag screw fixation of lateral malleolus fractures is combined with a clinical evaluation of 44 patients with lateral malleolus fractures who underwent intramedullary screw fixation. The biomechanical study was performed in experimentally produced, Weber B, supination-eversion ankle fractures. The fractures were fixed with one of the two above fixation methods and then placed under a torsional load to failure. Sixteen cadaver ankles were tested as compared with native bone. The intramedullary screw provided 66.5% the resistance of torsion, and the buttress plate and lag screw provided 61.5% the resistance to torsion. There was no statistical difference between these two groups. The 44 fractures treated with an intramedullary screw were reviewed retrospectively. There was one failure of fixation, and one prominent hardware problem. Time to full weightbearing averaged 7.2 weeks. These results suggest that intramedullary screw fixation of noncomminuted lateral malleolus fractures provides stable fixation with good clinical results. This technique has the advantages of providing dynamic intramedullary fixation with limited surgical dissection and no subcutaneous hardware. PMID:7849975

Bankston, A B; Anderson, L D; Nimityongskul, P

1994-11-01

236

Subduction-Zone Metamorphic Pathway for Deep Carbon Cycling: Evidence from the Italian Alps and the Tianshan  

NASA Astrophysics Data System (ADS)

Depending on the magnitude of the poorly constrained C flux in ultramafic rocks, on a global basis, sediments and altered oceanic crust (AOC) together deliver 70-95% of the C currently entering subduction zones. We are investigating extents of retention and metamorphic release of C in deeply subducted AOC and carbonate-rich sediment represented by HP/UHP meta-ophiolitic and metasedimentary rocks in the Italian Alps and in the Tianshan. Study of metapelite devolatilization in the same W. Alps suite (Bebout et al., 2013, Chem. Geol.) provides a geochemical framework for study of C behavior along prograde P-T paths similar to those experienced in forearcs of most modern subduction margins. Study of veins in the Tianshan affords examination of C mobility in UHP fluids, in later stages as metabasaltic rocks were fragmented in the subduction channel. Our results for sediments and AOC indicate impressive retention of oxidized C (carbonate) and reduced C (variably metamorphosed organic matter) to depths approaching those beneath arc volcanic fronts. In metasedimentary rocks, extensive isotopic exchange between the oxidized and reduced C resulted in shifts in both reservoirs toward upper mantle compositions. Much of the carbonate in metabasalts has C and O isotopic compositions overlapping with those for carbonate in AOC, with some HP/UHP metamorphic veins showing greater influence of organic C signatures from metasedimentary rocks. Calculations of prograde devolatilization histories using Perple-X demonstrate that, in most forearcs, very little decarbonation occurs in the more carbonate-rich rocks unless they are flushed by H2O-rich fluids from an external source, for example, from the hydrated ultramafic section of subducting slabs (cf. Gorman et al., 2006; G3) or from more nearby rocks experiencing dehydration (e.g., metapelites). A comparison of the most recently published thermal models for modern subduction zones (van Keken et al., 2011, JGR) with calculated and experimentally determined phase relations indicates that significant C loss during devolatilization (and partial melting) should occur as subducting sections traverse depths beneath arcs. The extent of C mobility due to carbonate dissolution remains uncertain. On a global basis, imbalance between subducted C input and C return flux by magmatism (excluding ultramafic inputs, ~40×20% of subducted C return via arcs and ~80×20% by all magmatism; Bebout, 2013, Treat. Geochem.) indicates net modern C return to the mantle, perhaps a reversal of Archean net outgassing (despite more rapid subduction). Global C cycle models predict that relatively small (and geologically plausible) change in the subduction/volcanic C flux could significantly affect atmospheric CO2 levels and thus global climate.

Bebout, G. E.; Collins, N.; Cook-Kollars, J.; Angiboust, S.; Agard, P.; Scambelluri, M.; John, T.; Kump, L. R.

2013-12-01

237

Single-walled carbon nanotube exposure induces membrane rearrangement and suppression of receptor-mediated signalling pathways in model mast cells.  

PubMed

Carbon nanotubes (CNT) are environmental challenges to the respiratory and gastrointestinal mucosa, and to the dermal immune system. Mast cells (MC) are pro-inflammatory immunocytes that reside at these interfaces with the environment. Mast cells are sources of pro-inflammatory mediators (histamine, serotonin, matrix-active proteases, eicosanoids, prostanoids, cytokines and chemokines), which are released in a calcium-dependent manner following immunological challenge or physico-chemical stimulation. Since C-60 fullerenes, which share geometry with CNT, are suppressive of mast cell-driven inflammatory responses, we explored the effects of unmodified SWCNT aggregates on mast cell signaling pathways, phenotype and pro-inflammatory function. We noted SWCNT suppression of antigen-induced signalling pathways and pro-inflammatory degranulation responses. Mast cells recognize unmodified SWCNT by remodeling the plasma membrane, disaggregating the cortical actin cytoskeleton and relocalizing clathrin. Clathrin was also identified as a component of an affinity-purified 'interactome' isolated from MC using an SWCNT affinity matrix for mast cell lysates. Together, these data are consistent with the ability of SWCNT to suppress mast cell pro-inflammatory function via a novel recognition mechanism. PMID:24910985

Umemoto, Eric Y; Speck, Mark; Shimoda, Lori M N; Kahue, Kara; Sung, Carl; Stokes, Alexander J; Turner, Helen

2014-08-17

238

Pyrogenic carbon loss pathways under natural and increased N deposition and its priming effect on soil organic matter  

NASA Astrophysics Data System (ADS)

Pyrogenic carbon (PyC) plays an important role in the terrestrial C cycle, in fact it can comprise up to 40% of soil organic carbon(1), but the relative importance of processes that lead to its disappearance from the soil remain a mystery (2). Most experiments on PyC mineralization have been laboratory incubations (3; 4); very few studies have been carried out in situ (5; 6). Several studies have found relevant quantities of PyC in marine (7) and riverine (8) dissolved organic carbon. However, since PyC is not thought to contain easily soluble compounds (9), it is still unknown how such large quantities of PyC can be transported from soil to water bodies. Moreover, some studies find that PyC can promote soil organic matter decomposition (10; 11), although other studies do not find this result (9; 4). Moreover, nitrogen deposition might affect PyC losses from the soil, as it has been shown to reduce the mineralization of old soil organic matter (12). We set up a field experiment to measure PyC decomposition and stabilization in soil using stable isotopes (13C/15N) as tracer. The experiment was conducted under ambient and added mineral nitrogen. The equivalent of 3.8 gC kg-1 of soil of 13C- labelled (840 per mil), powdered (

Maestrini, B.; Abiven, S.; Singh, N.; Bird, J.; Torn, M. S.; Schmidt, M. W. I.

2012-04-01

239

Effects of soil structure destruction on methane production and carbon partitioning between methanogenic pathways in tropical rain forest soils  

NASA Astrophysics Data System (ADS)

Controls on methanogenesis are often determined from laboratory incubations of soils converted to slurries. Destruction of soil structure during slurry conversion may disrupt syntrophic associations, kill methanogens, and/or alter the microsite distribution of methanogenic activity, suppressing CH4 production. The effects of slurry conversion on methanogenesis were investigated to determine if disruption of aggregate structure impacted methanogenesis, substrate utilization, and C partitioning between methanogenic pathways. Soils were collected from the tropical rain forest life zone of the Luquillo Experimental Forest, Puerto Rico, and exposed to different physical disturbances, including flooding and physical homogenization. Slurry conversion negatively impacted methanogenesis. Rates of CH4 production declined by a factor of 17 after well-aggregated soils were converted to slurries. Significantly more 13C-acetate was recovered in CO2 compared to CH4 after slurry conversion, suggesting that methanogens consumed less acetate after slurry conversion and may have competed less effectively with other anaerobes for acetate. Isotopic data indicate that the relative partitioning of C between aceticlastic and hydrogenotrophic pathways was unchanged after slurry conversion. These data suggest that experiments which destroy soil structure may significantly underestimate methanogenesis and overestimate the potential for other microorganisms to compete with methanogens for organic substrates. Current knowledge of the factors that regulate methanogenesis in soil may be biased by the findings of slurry-based experiments, that do not accurately represent the complex, spatially heterogeneous conditions found in well-aggregated soils.

Teh, Yit Arn; Silver, Whendee L.

2006-03-01

240

[Influence of different ecological groups of earthworms on the intensity of nitrogen fixation].  

PubMed

The results of studying nitrogen fixation in organic substrates processed by different ecological groups of earthworms suggest that the earthworms Aporrectoidea caliginosa actively stimulate nonsymbiotic nitrogen fixation. In this respect, they exceed the manure worms Eizenia foetida tens of times due to the formation in the organic substrate of conditions favorable for the nitrogen fixing bacteria, and namely: low content of nitrogen easily accessible for microorganisms, changes in the structure of the microbial community of the substrate in favor of non-spore forms of bacteria, and suppression of the growth of saprophyte bacilli, the main competitors of nitrogen fixing bacteria for carbon nourishment sources. PMID:12561340

Tereshchenko, N N; Naplekova, N N

2002-01-01

241

Monocular fixation with the optic nerve head: a case report  

E-print Network

was an 80-year-old male with left ET from early childhood. Retinal tracking monocular fixation measurements the fixation. This patient does not have the blind spot syndrome (Swan, 1948). We propose the use of a retinal perimeter for documentation of eccentric fixation in strabismus. Keywords: blind spot, eccentric fixation

Peli, Eli

242

Key role of symbiotic dinitrogen fixation in tropical forest secondary succession  

NASA Astrophysics Data System (ADS)

Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000kg carbon per hectare) in the first 12years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2.

Batterman, Sarah A.; Hedin, Lars O.; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J.; Hall, Jefferson S.

2013-10-01

243

Triple fixation of Bacillus subtilis dormant spores.  

PubMed Central

A triple-fixation method with a sequential application of 5% glutaraldehyde, 1% osmium tetroxide, and 2% potassium permanganate gave superior preservation of the ultrastructure of Bacillus subtilis dormant spores with a thick spore coat. Images PMID:6413496

Kozuka, S; Tochikubo, K

1983-01-01

244

Quantum Chemistry Study of Cycloaddition Pathways for the Reaction of o-Benzyne with Fullerenes and Carbon Nanotubes  

NASA Technical Reports Server (NTRS)

Functionalization of fullerenes via the [2+2] cycloaddition reaction with o-benzyne has been demonstrated in the laboratory. In contrast, [2+4) cycloaddition products are formed when benzyne reacts with planar polycyclic aromatic hydrocarbons. Using density functional theory (DFT) calculations with Becke's hybrid functional and small contracted gaussian basis sets, we are able to reproduce these product preferences. The objective of this work is to explore the functionalization of carbon nanotubes. We have studied o-benzyne cycloaddition products with a [14,0] single-walled nanotube. We find both the [2+2] and [2+4] adducts to be stable, with the latter product being somewhat favored.

Jaffe, Richard; Han, Jie; Langhoff, Stephen R. (Technical Monitor)

1997-01-01

245

Fixation of Ejaculated Spermatozoa for Electron Microscopy  

Microsoft Academic Search

EJACULATED spermatozoa cannot be preserved satisfactorily by conventional fixation procedures for electron microscopy. Osmium tetroxide (OsO4) fixation of crude ejaculate consistently produces a variety of artefacts such as separation of the plasma membrane from the acrosome, widening of nuclear vacuoles, erosion of the acrosome, and swelling of mitochondria1-3. These alterations could be the consequence of the rapid destruction of the

Mario Stefanini; Cesare De Martino; Luciano Zamboni

1967-01-01

246

Gaze shifts and fixations dominate gaze behavior of walking cats.  

PubMed

Vision is important for locomotion in complex environments. How it is used to guide stepping is not well understood. We used an eye search coil technique combined with an active marker-based head recording system to characterize the gaze patterns of cats walking over terrains of different complexity: (1) on a flat surface in the dark when no visual information was available, (2) on the flat surface in light when visual information was available but not required for successful walking, (3) along the highly structured but regular and familiar surface of a horizontal ladder, a task for which visual guidance of stepping was required, and (4) along a pathway cluttered with many small stones, an irregularly structured surface that was new each day. Three cats walked in a 2.5-m corridor, and 958 passages were analyzed. Gaze activity during the time when the gaze was directed at the walking surface was subdivided into four behaviors based on speed of gaze movement along the surface: gaze shift (fast movement), gaze fixation (no movement), constant gaze (movement at the body's speed), and slow gaze (the remainder). We found that gaze shifts and fixations dominated the cats' gaze behavior during all locomotor tasks, jointly occupying 62-84% of the time when the gaze was directed at the surface. As visual complexity of the surface and demand on visual guidance of stepping increased, cats spent more time looking at the surface, looked closer to them, and switched between gaze behaviors more often. During both visually guided locomotor tasks, gaze behaviors predominantly followed a repeated cycle of forward gaze shift followed by fixation. We call this behavior "gaze stepping". Each gaze shift took gaze to a site approximately 75-80cm in front of the cat, which the cat reached in 0.7-1.2s and 1.1-1.6 strides. Constant gaze occupied only 5-21% of the time cats spent looking at the walking surface. PMID:24973656

Rivers, T J; Sirota, M G; Guttentag, A I; Ogorodnikov, D A; Shah, N A; Beloozerova, I N

2014-09-01

247

Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion  

NASA Astrophysics Data System (ADS)

Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C-C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion.

Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

2013-07-01

248

Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion.  

PubMed

Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N?) does not easily react with other chemicals. By dry ball-milling graphite with N?, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N? at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C--C bonds generated active carbon species that react directly with N? to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

2013-01-01

249

Carbon metabolism in legume nodules. Progress report, July 1982-July 1983  

SciTech Connect

The goal is to understand how the legume nodule metabolizes carbohydrate to provide energy and reductant for symbiotic fixation. The working hypothesis has been that the plant cytosol is microacrobic and that some carbon metabolism may be via anaerobic pathways similar to those in roots of flood tolerant plants. A method of analyzing redox changes in intact mitochondria, bacteroids or bacteria was adapted; a method of manipulating nitrogenase activity by oxygen inhibition was developed; the production of alcohol by soybean nodules was studied; and enzymes metabolizing alcohol/aldehyde were found in other nitrogen fixing systems. (ACR)

LaRue, T.A.

1983-01-01

250

Seasonal variations in nitrogen-fixation (acetylene reduction) and sulphate-reduction rates in the rhizosphere of Zostera noltii : nitrogen fixation by sulphate-reducing bacteria  

Microsoft Academic Search

Nitrogen-fixation (acetylene reduction) rates were measured over an annual cycle in meadows of the seagrass Zostera noltii Hornem in the Bassin d'Arcachon, south-west France, between March 1994 and February 1995, using both slurry and whole-core techniques. Measured rates using the slurry technique consistently overestimated those determined on whole cores, probably due to the release of labile organic carbon sources as

D. T. Welsh; S. Bourgués; R. Wit; R. A. Herbert

1996-01-01

251

Biological construction of single-walled carbon nanotube electron transfer pathways in dye-sensitized solar cells.  

PubMed

We designed and mass-produced a versatile protein supramolecule that can be used to manufacture a highly efficient dye-sensitized solar cell (DSSC). Twelve single-walled carbon-nanotube (SWNT)-binding and titanium-mineralizing peptides were genetically integrated on a cage-shaped dodecamer protein (CDT1). A process involving simple mixing of highly conductive SWNTs with CDT1 followed by TiO2 biomineralization produces a high surface-area/weight TiO2 -(anatase)-coated intact SWNT nanocomposite under environmentally friendly conditions. A DSSC with a TiO2 photoelectrode containing 0.2?wt?% of the SWNT-TiO2 nanocomposite shows a current density improvement by 80?% and a doubling of the photoelectric conversion efficiency. The SWNT-TiO2 nanocomposite transfers photon-generated electrons from dye molecules adsorbed on the TiO2 to the anode electrode swiftly. PMID:25111295

Inoue, Ippei; Watanabe, Kiyoshi; Yamauchi, Hirofumi; Ishikawa, Yasuaki; Yasueda, Hisashi; Uraoka, Yukiharu; Yamashita, Ichiro

2014-10-01

252

Contribution of dinitrogen fixation to bacterial and primary productivity in the Gulf of Aqaba (Red Sea)  

NASA Astrophysics Data System (ADS)

We evaluated the seasonal contribution of heterotrophic and autotrophic diazotrophy to the total dinitrogen (N2) fixation in a representative pelagic station in the northern Gulf of Aqaba in early spring when the water column was mixed and during summer under full thermal stratification. N2 fixation rates were low during the mixed period (˜ 0.1 nmol N L-1 d-1) and were significantly coupled with both primary and bacterial productivity. During the stratified period N2 fixation rates were four-fold higher (˜ 0.4 nmol N L-1 d-1) and were significantly correlated solely with bacterial productivity. Furthermore, while experimental enrichment of seawater by phosphorus (P) enhanced bacterial productivity and N2 fixation rates during both seasons primary productivity was stimulated by P only in the early spring. Metatranscriptomic analyses from the stratified period identified the major diazotrophic contributors as related to heterotrophic prokaryotes from the Euryarchaeota and Desulfobacterales (Deltaproteobacteria) or Chlorobiales (Chlorobia). Moreover, during this season, experimental amendments to seawater applying a combination of the photosynthetic inhibitor 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and a mixture of amino acids increased both bacterial productivity and N2 fixation rates. Our findings from the northern Gulf of Aqaba indicate a~shift in the diazotrophic community from phototrophic and heterotrophic populations, including small blooms of the cyanobacterium Trichodesmium, in winter/early spring, to predominantly heterotrophic diazotrophs in summer that may be both P and carbon limited as the additions of P and amino acids illustrated.

Rahav, E.; Herut, B.; Mulholland, M. R.; Voß, B.; Stazic, D.; Steglich, C.; Hess, W. R.; Berman-Frank, I.

2013-06-01

253

EST-analysis of the thermo-acidophilic red microalga Galdieria sulphuraria reveals potential for lipid A biosynthesis and unveils the pathway of carbon export from rhodoplasts.  

PubMed

When we think of extremophiles, organisms adapted to extreme environments, prokaryotes come to mind first. However, the unicellular red micro-alga Galdieria sulphuraria (Cyanidiales) is a eukaryote that can represent up to 90% of the biomass in extreme habitats such as hot sulfur springs with pH values of 0-4 and temperatures of up to 56 degrees C. This red alga thrives autotrophically as well as heterotrophically on more than 50 different carbon sources, including a number of rare sugars and sugar alcohols. This biochemical versatility suggests a large repertoire of metabolic enzymes, rivaled by few organisms and a potentially rich source of thermo-stable enzymes for biotechnology. The temperatures under which this organism carries out photosynthesis are at the high end of the range for this process, making G. sulphuraria a valuable model for physical studies on the photosynthetic apparatus. In addition, the gene sequences of this living fossil reveal much about the evolution of modern eukaryotes. Finally, the alga tolerates high concentrations of toxic metal ions such as cadmium, mercury, aluminum, and nickel, suggesting potential application in bioremediation. To begin to explore the unique biology of G. sulphuraria , 5270 expressed sequence tags from two different cDNA libraries have been sequenced and annotated. Particular emphasis has been placed on the reconstruction of metabolic pathways present in this organism. For example, we provide evidence for (i) a complete pathway for lipid A biosynthesis; (ii) export of triose-phosphates from rhodoplasts; (iii) and absence of eukaryotic hexokinases. Sequence data and additional information are available at http://genomics.msu.edu/galdieria. PMID:15604662

Weber, Andreas P M; Oesterhelt, Christine; Gross, Wolfgang; Bräutigam, Andrea; Imboden, Lori A; Krassovskaya, Inga; Linka, Nicole; Truchina, Julia; Schneidereit, Jörg; Voll, Hildegard; Voll, Lars M; Zimmermann, Marc; Jamai, Aziz; Riekhof, Wayne R; Yu, Bin; Garavito, R Michael; Benning, Christoph

2004-05-01

254

Increase in cell motility by carbon ion irradiation via the Rho signaling pathway and its inhibition by the ROCK inhibitor Y-27632 in lung adenocarcinoma A549 cells.  

PubMed

This study aimed to investigate the effect of carbon ion (C-ion) irradiation on cell motility through the ras homolog gene family member (Rho) signaling pathway in the human lung adenocarcinoma cell line A549. Cell motility was assessed by a wound-healing assay, and the formation of cell protrusions was evaluated by F-actin staining. Cell viability was examined by the WST-1 assay. The expression of myosin light chain 2 (MLC2) and the phosphorylation of MLC2 at Ser19 (P-MLC2-S19) were analyzed by Western blot. At 48 h after irradiation, the wound-healing assay demonstrated that migration was significantly greater in cells irradiated with C-ion (2 or 8 Gy) than in unirradiated cells. Similarly, F-actin staining showed that the formation of protrusions was significantly increased in cells irradiated with C-ion (2 or 8 Gy) compared with unirradiated cells. The observed increase in cell motility due to C-ion irradiation was similar to that observed due to X-ray irradiation. Western-blot analysis showed that C-ion irradiation (8 Gy) increased P-MLC2-S19 expression compared with in unirradiated controls, while total MLC2 expression was unchanged. Exposure to a non-toxic concentration of Y-27632, a specific inhibitor of Rho-associated coiled-coil-forming protein kinase (ROCK), reduced the expression of P-MLC2-S19 after C-ion irradiation (8 Gy), resulting in a significant reduction in migration. These data suggest that C-ion irradiation increases cell motility in A549 cells via the Rho signaling pathway and that ROCK inhibition reduces that effect. PMID:24659807

Murata, Kazutoshi; Noda, Shin-ei; Oike, Takahiro; Takahashi, Akihisa; Yoshida, Yukari; Suzuki, Yoshiyuki; Ohno, Tatsuya; Funayama, Tomoo; Kobayashi, Yasuhiko; Takahashi, Takeo; Nakano, Takashi

2014-07-01

255

Inhibition of proteolysis in histiotrophic nutrition pathways alters DNA methylation and one-carbon metabolism in the organogenesis-stage rat conceptus  

PubMed Central

Epigenetic modifications, including DNA methylation, contribute to the transcriptional regulation of developmental genes that control growth and differentiation during embryogenesis. The methyl donor, S-adenosylmethionine (SAM) is biosynthesized from methionine and ATP by methionine adenosyltransferase 2a (Mat2a) in the one-carbon (C1) metabolism pathway. SAM biosynthesis requires a steady supply of nutrients, vitamins, and cofactors obtained by the developing conceptus through histiotrophic nutrition pathways (HNPs). The visceral yolk sac (VYS) captures proteins and their substrate cargos by receptor-mediated endocytosis (RME) and degrades them using lysosomal proteases. We hypothesize that leupeptin, a protease inhibitor, reduces the availability of methionine and C1 substrates, restricting SAM biosynthesis, and altering patterns of DNA methylation. Rat conceptuses were exposed to 50 and 100 ?M leupeptin in whole embryo culture (WEC) for periods of 26 h from gestational day (GD) 10 or 6 h on GD11. after 6 h on GD11, the 100 ?M leupeptin treatment significantly decreased methionine in embryo (EMB) and VYS, reduced Mat2a protein levels, and inhibited Mat2a specific activity; all of which produced a significant 52% reduction of SAM in the VYS. The 50 and 100 ?M leupeptin treatments significantly decreased global methylation levels by 6–9% in EMB and 11–15% in VYS following both 6 and 26 h exposure periods. This study demonstrates that HNP disruption alters C1 activity and significantly reduces global DNA methylation during organogenesis. Because epigenetic reprogramming is crucial for normal differentiation and growth, these findings suggest a possible mechanism through which nutrients and environmental factors may alter early developmental regulation. PMID:23453262

Sant, Karilyn E.; Dolinoy, Dana C.; Nahar, Muna S.; Harris, Craig

2014-01-01

256

Epithelial-mesenchymal transition involved in pulmonary fibrosis induced by multi-walled carbon nanotubes via TGF-beta/Smad signaling pathway.  

PubMed

Multi-walled carbon nanotubes (MWCNT) are a typical nanomaterial with a wide spectrum of commercial applications. Inhalation exposure to MWCNT has been linked with lung fibrosis and mesothelioma-like lesions commonly seen with asbestos. In this study, we examined the pulmonary fibrosis response to different length of MWCNT including short MWCNT (S-MWCNT, length=350-700nm) and long MWCNT (L-MWCNT, length=5-15?m) and investigated whether the epithelial-mesenchymal transition (EMT) occurred during MWCNT-induced pulmonary fibrosis. C57Bl/6J male mice were intratracheally instilled with S-MWCNT or L-WCNT by a single dose of 60?g per mouse, and the progress of pulmonary fibrosis was evaluated at 7, 28 and 56 days post-exposure. The in vivo data showed that only L-MWCNT increased collagen deposition and pulmonary fibrosis significantly, and approximately 20% of pro-surfactant protein-C positive epithelial cells transdifferentiated to fibroblasts at 56 days, suggesting the occurrence of EMT. In order to understand the mechanism, we used human pulmonary epithelial cell line A549 to investigate the role of TGF-?/p-Smad2 signaling pathway in EMT. Our results showed that L-MWCNT downregulated E-cadherin and upregulated ?-smooth muscle actin (?-SMA) protein expression in A549 cells. Taken together, both in vivo and in vitro study demonstrated that respiratory exposure to MWCNT induced length dependent pulmonary fibrosis and epithelial-derived fibroblasts via TGF-?/Smad pathway. PMID:24530353

Chen, Tian; Nie, Haiyu; Gao, Xin; Yang, Jinglin; Pu, Ji; Chen, Zhangjian; Cui, Xiaoxing; Wang, Yun; Wang, Haifang; Jia, Guang

2014-04-21

257

Design Fixation in the Wild: Design Environments and Their Influence on Fixation  

ERIC Educational Resources Information Center

Many studies of design fixation ask designers to work in controlled laboratory or classroom environments, but innovative design work frequently occurs in dynamic, social environments. The two studies reviewed in this paper investigated how three independent variables likely to be present in many design environments affect design fixation. The…

Youmans, Robert J.

2011-01-01

258

Diazotrophy in the Deep: Measuring Rates and Identifying Biological Mediators of N2 fixation in Deep-Sea Sediments  

NASA Astrophysics Data System (ADS)

Biological N2 fixation (the conversion of N2 to NH3) is the largest natural source of bioavailable nitrogen to the biosphere, and dictates the rate of community productivity in many nitrogen-limited environments. Deep-sea sediments are traditionally not thought to host N2 fixation, however evidence from a metagenomics dataset targeting deep-sea methanotrophic archaea (ANME) suggested their ability to fix N2 (Pernthaler, et al., PNAS 2008). Using stable isotope labeling experiments and FISH-NanoSIMS, a technique which allows the visualization of isotopic composition within phylogenetically identified cells on the nanometer scale, we demonstrated that the ANME are capable of N2 fixation (Dekas et al., Science 2009). In the present work, we use FISH-NanoSIMS and bulk Isotope Ratio Mass Spectrometry (IRMS) to show that the ANME are the most significant source of new nitrogen at a Costa Rican methane seep. This suggests that the ANME may play a significant role in N2 fixation in methane seeps worldwide. We expand our investigation of deep-sea diazotrophy to include diverse habitats, including sulfide- and carbon-rich whalefalls, and observe that N2 fixation is widespread in sediments on the seafloor. Outside of methane seeps, N2 fixation appears to be mediated by a diversity of anaerobic microbes potentially including methanogens and sulfate reducing bacteria. Interestingly, deep-sea N2 fixation often occurs in the presence of high levels of NH4+. Our observations challenge long-held hypotheses about where and when N2 fixation occurs, and suggest a bigger role for N2 fixation on the seafloor - and potentially the deep-biosphere - than previously realized.

Dekas, A. E.; Fike, D. A.; Chadwick, G.; Connon, S. A.; Orphan, V. J.

2013-12-01

259

Influence of carbon dioxide abatement and recreational services on optimal forest rotation  

Microsoft Academic Search

This paper presents and applies a theoretical framework to integrate the influence of carbon dioxide abatement as well as recreational services on the optimal bio-economic determination of forest rotation. Recreational services are included in the standard way proposed by Hartman, but carbon fixation benefits are introduced in a different manner to previous studies, concentrating on total permanent carbon fixation produced

Alejandro Caparros; Pablo Campos; David Martin

2003-01-01

260

Fixational saccades reflect volitional action preparation.  

PubMed

Human volitional actions are preceded by preparatory processes, a critical mental process of cognitive control for future behavior. Volitional action preparation is regulated by large-scale neural circuits including the cerebral cortex and the basal ganglia. Because volitional action preparation is a covert process, the network dynamics of such neural circuits have been examined by neuroimaging and recording event-related potentials. Here, we examined whether such covert processes can be measured by the overt responses of fixational saccades (including microsaccades), the largest miniature eye movements that occur during eye fixation. We analyzed fixational saccades while adult humans maintained fixation on a central visual stimulus as they prepared to generate a volitional saccade in response to peripheral stimulus appearance. We used the antisaccade paradigm, in which subjects generate a saccade toward the opposite direction of a peripheral stimulus. Appropriate antisaccade performance requires the following two aspects of volitional control: 1) facilitation of saccades away from the stimulus and 2) suppression of inappropriate saccades toward the stimulus. We found that fixational saccades that occurred before stimulus appearance reflected the dual preparatory states of saccade facilitation and suppression and correlated with behavioral outcome (i.e., whether subjects succeeded or failed to cancel inappropriate saccades toward the stimulus). Moreover, fixational saccades explained a large proportion of individual differences in behavioral performance (poor/excellent) across subjects. These results suggest that fixational saccades predict the outcome of future volitional actions and may be used as a potential biomarker to detect people with difficulties in volitional action preparation. PMID:23636719

Watanabe, Masayuki; Matsuo, Yuka; Zha, Ling; Munoz, Douglas P; Kobayashi, Yasushi

2013-07-01

261

Following the path of carbon in photosynthesis: a personal story  

Microsoft Academic Search

Chronological recognition of the intermediates and mechanisms involved in photosynthetic carbon dioxide fixation is delineated.\\u000a Sam Ruben and Martin Kamen's development of application of radioactive carbon for the study of carbon dioxide fixation provided\\u000a impetus and techniques for following the path of carbon in photosynthesis. Discovery The identity of the primary carboxylation\\u000a enzyme and its identity with the major protein

Andrew A. Benson

2002-01-01

262

Nitrogen fixation and nitrogen fertilization of soybeans.  

PubMed

Abstract In pot experiments with (15)N labelled soil and mineral (15)N, the influence of Bradyrhizobium (Rhizobium japonicum) inoculation and N fertilization on the symbiotic N(2) fixation and yield of soybeans [Glycine max (L.) Merill., cv. 'Fiskeby V'] was investigated. Symbiotic N(2) fixation only occured after inoculation with Bradyrhizobium. Considerable differences in efficiency of the bacterial preparations were observed. Shortly after flowering, the symbiotic nitrogen fixation was finished and, subsequently, soybeans took up considerable N amounts from the soil. N fertilization at seeding suppressed N(2) fixation of soybeans. In this case, the dry matter and nitrogen yield increased, because the loss of fixed nitrogen was overcompensated by the mineral N uptake. During flowering of soybeans, the N(2) fixation was not affected by N supply, because this process was already terminated. The mineral N was additionally available to the plants and led to increased N amounts in plants. It was absorbed to a considerable degree by soybeans. The mineral N was translocated (partly, after intermediate storage in the vegetative organs) into the seeds thus increasing their yields. PMID:22088108

Merbach, W; Jacob, H J

1996-08-01

263

New insights in the use of carbon isotopes as tracers of DOC sources and water pathways in headwater catchments  

NASA Astrophysics Data System (ADS)

Despite the significant importance of dissolved organic carbon (DOC) in aquatics ecosystems, the processes controlling DOC delivery to stream waters at the catchment scale are still poorly understood, in particular with regards to the relative importance of riparian versus upland soils as DOC sources. In this respect, the stable carbon isotopic composition of DOC (?13CDOC) appears to be a promising tool as different ?13CDOC values are anticipated between wetland and upland soil DOC, because of differences in soil oxygenation, soil humidity and soil organic matter degradation scheme However, care must be exercised because of the possible occurrence of seasonal variations in the ?13CDOC values of both riparian and upland DOC , and because also of the possible mixing of DOC coming from spatially distinct sources. The markedly different isotopic patterns obtained during high resolution monitoring ( 2 ? units), while others showed no, or much more restricted isotopic variations. A comparison of these results with previously published data revealed that this temporal variability of intra-storm ?13CDOC values is the exact transposition of the temporal variability of ?13CDOC values that was found in the riparian soil waters of this catchment during the same period. The latter variability has been shown to arise from the combined effect of changes in the production mechanisms and ultimate sources of riparian DOC and of the lateral input in the riparian domains of an isotopically heavier DOC component coming from more upland areas. Overall, results from this study confirm that upland domains may be significant contributors of stream DOC flux in headwater catchments. They also show that upland soils behave as a size-limited reservoir with respect to DOC production, whereas more highly productive soils in the wetland domains act as a near-infinite reservoir. Through this study, we show that the isotopic composition of DOC is an extremely powerful tool for tracing DOC sources and DOC transport mechanisms in headwater catchments, demonstrating in the meantime that the use of this tool requires that the temporal and spatial variability of the isotopic signatures of all potential DOC sources in the catchment is known accurately. Providing that this condition is fulfilled, the isotopic tool can allow up to quantify the proportions of DOC - and of corresponding water flows - coming from different contributing areas which may be of great importance for better understanding and better modeling of DOC transfer and water routing through the landscape.

Lambert, Thibault; Pierson-Wickmann, Anne-Catherine; Gruau, Gérard; Petitjean, Patrice; Thibault, Jean-Noël; Jeanneau, Laurent

2013-04-01

264

DOC sources and DOC transport pathways in a small headwater catchment as revealed by carbon isotope fluctuation during storm events  

NASA Astrophysics Data System (ADS)

Monitoring the isotopic composition (?13CDOC) of dissolved organic carbon (DOC) during flood events can be helpful for locating DOC sources in catchments and quantifying their relative contribution to stream DOC flux. High-resolution (< hourly basis) ?13CDOC data were obtained during six successive storm events occurring during the high-flow period in a small headwater catchment in western France. Intra-storm ?13CDOC values exhibit a marked temporal variability, with some storms showing large variations (> 2 ‰), and others yielding a very restricted range of values (< 1 ‰). Comparison of these results with previously published data shows that the range of intra-storm ?13CDOC values closely reflects the temporal and spatial variation in ?13CDOC observed in the riparian soils of this catchment during the same period. Using ?13CDOC data in conjunction with hydrometric monitoring and an end-member mixing approach (EMMA), we show that (i) > 80% of the stream DOC flux flows through the most superficial soil horizons of the riparian domain and (ii) the riparian soil DOC flux is comprised of DOC coming ultimately from both riparian and upland domains. Based on its ?13C fingerprint, we find that the upland DOC contribution decreases from ca.~30% of the stream DOC flux at the beginning of the high-flow period to < 10% later in this period. Overall, upland domains contribute significantly to stream DOC export, but act as a size-limited reservoir, whereas soils in the wetland domains act as a near-infinite reservoir. Through this study, we show that ?13CDOC provides a powerful tool for tracing DOC sources and DOC transport mechanisms in headwater catchments, having a high-resolution assessment of temporal and spatial variability.

Lambert, T.; Pierson-Wickmann, A.-C.; Gruau, G.; Jaffrezic, A.; Petitjean, P.; Thibault, J. N.; Jeanneau, L.

2014-06-01

265

The threonine degradation pathway of the Trypanosoma brucei procyclic form: the main carbon source for lipid biosynthesis is under metabolic control  

PubMed Central

The Trypanosoma brucei procyclic form resides within the digestive tract of its insect vector, where it exploits amino acids as carbon sources. Threonine is the amino acid most rapidly consumed by this parasite, however its role is poorly understood. Here, we show that the procyclic trypanosomes grown in rich medium only use glucose and threonine for lipid biosynthesis, with threonine's contribution being ??2.5 times higher than that of glucose. A combination of reverse genetics and NMR analysis of excreted end-products from threonine and glucose metabolism, shows that acetate, which feeds lipid biosynthesis, is also produced primarily from threonine. Interestingly, the first enzymatic step of the threonine degradation pathway, threonine dehydrogenase (TDH, EC 1.1.1.103), is under metabolic control and plays a key role in the rate of catabolism. Indeed, a trypanosome mutant deleted for the phosphoenolpyruvate decarboxylase gene (PEPCK, EC 4.1.1.49) shows a 1.7-fold and twofold decrease of TDH protein level and activity, respectively, associated with a 1.8-fold reduction in threonine-derived acetate production. We conclude that TDH expression is under control and can be downregulated in response to metabolic perturbations, such as in the PEPCK mutant in which the glycolytic metabolic flux was redirected towards acetate production. PMID:23899193

Millerioux, Yoann; Ebikeme, Charles; Biran, Marc; Morand, Pauline; Bouyssou, Guillaume; Vincent, Isabel M; Mazet, Muriel; Riviere, Loic; Franconi, Jean-Michel; Burchmore, Richard J S; Moreau, Patrick; Barrett, Michael P; Bringaud, Frederic

2013-01-01

266

Nitrite fixation by humic substances: Nitrogen-15 nuclear magnetic resonance evidence for potential intermediates in chemodenitrification  

USGS Publications Warehouse

Studies have suggested that NO2/-, produced during nitrification and denitrification, can become incorporated into soil organic matter and, in one of the processes associated with chemodenitrification, react with organic matter to form trace N gases, including N2O. To gain an understanding of the nitrosation chemistry on a molecular level, soil and aquatic humic substances were reacted with 15N-labeled NaNO2, and analyzed by liquid phase 15N and 13C nuclear magnetic resonance (NMR). The International Humic Substances Society (IHSS) Pahokee peat and peat humic acid were also reacted with Na15NO2 and analyzed by solid-state 15N NMR. In Suwannee River, Armadale, and Laurentian fulvic acids, phenolic rings and activated methylene groups underwent nitrosation to form nitrosophenols (quinone monoximes) and ketoximes, respectively. The oximes underwent Beckmann rearrangements to 2??amides, and Beckmann fragmentations to nitriles. The nitriles in turn underwent hydrolysis to 1??amides. Peaks tentatively identified as imine, indophenol, or azoxybenzene nitrogens were clearly present in spectra of samples nitrosated at pH 6 but diminished at pH 3. The 15N NMR spectrum of the peat humic acid exhibited peaks corresponding with N-nitroso groups in addition to nitrosophenols, ketoximes, and secondary Beckmann reaction products. Formation of N-nitroso groups was more significant in the whole peat compared with the peat humic acid. Carbon-13 NMR analyses also indicated the occurrence of nitrosative demethoxylation in peat and soil humic acids. Reaction of 15N-NH3 fixated fulvic acid with unlabeled NO2/- resulted in nitrosative deamination of aminohydroquinone N, suggesting a previously unrecognized pathway for production of N2 gas in soils fertilized with NH3.Studies have suggested that NO2-, produced during nitrification and denitrification, can become incorporated into soil organic matter and, in one of the processes associated with chemodenitrification, react with organic matter to form trace N gases, including N2O. To gain an understanding of the nitrosation chemistry on a molecular level, soil and aquatic humic substances were reacted with 15N-labeled NaNO2, and analyzed by liquid phase 15N and 13C nuclear magnetic resonance (NMR). The International Humic Substances Society (IHSS) Pahokee peat and peat humic acid were also reacted with Na15NO2 and analyzed by solid-state 15N NMR. In Suwannee River, Armadale, and Laurentian fulvic acids, phenolic rings and activated methylene groups underwent nitrosation to form nitrosophenols (quinone monoximes) and ketoximes, respectively. The oximes underwent Beckmann rearrangements to 2?? amides, and Beckmann fragmentations to nitriles. The nitriles in turn underwent hydrolysis to 1?? amides. Peaks tentatively identified as imine, indophenol, or azoxybenzene nitrogens were dearly present in spectra of samples nitrosated at pH 6 but diminished at pH 3. The 15N NMR spectrum of the peat humic acid exhibited peaks corresponding with N-nitroso groups in addition to nitrosophenols, ketoximes, and secondary Beckmann reaction products. Formation of N-nitroso groups was more significant in the whole peat compared with the peat humic acid. Carbon-13 NMR analyses also indicated the occurrence of nitrosative demethoxylation in peat and soil humic acids. Reaction of 15N-NH3 fixated fulvic acids with unlabeled NO2- resulted in nitrosative deamination of aminohydroquinone N, suggesting a previously unrecognized pathway for production of N2 gas in soils fertilized with NH3.

Thorn, K. A.; Mikita, M. A.

2000-01-01

267

Intracellular distribution of the reductive and oxidative pentose phosphate pathways in two diatoms.  

PubMed

Diatoms contribute a large proportion to the worldwide primary production and are particularly effective in fixing carbon dioxide. Possibly because diatom plastids originate from a secondary endocytobiosis, their cellular structure is more complex and metabolic pathways are rearranged within diatom cells compared to cells containing primary plastids. We annotated genes encoding isozymes of the reductive and oxidative pentose phosphate pathways in the genomes of the centric diatom Thalassiosira pseudonana and the pennate diatom Phaeodactylum tricornutum and bioinformatically inferred their intracellular distribution. Prediction results were confirmed by fusion of selected presequences to Green Fluorescent Protein and expression of these constructs in P. tricornutum. Calvin cycle enzymes for the carbon fixation and reduction of 3-phosphoglycerate are present in single isoforms, while we found multiple isoenzymes involved in the regeneration of ribulose-1,5-bisphosphate. We only identified one cytosolic sedoheptulose-1,7-bisphosphatase in both investigated diatoms. The oxidative pentose phosphate pathway seems to be restricted to the cytosol in diatoms, since we did not find stromal glucose-6-phosphate dehydrogenase and 6-phosphogluconolactone dehydrogenase isoforms. However, the two species apparently possess a plastidic phosphogluconolactonase. A 6-phosphogluconolactone dehydrogenase is apparently plastid associated in P. tricornutum and might be active in the periplastidic compartment, suggesting that this compartment might be involved in metabolic processes in diatoms. PMID:19206144

Gruber, Ansgar; Weber, Till; Bártulos, Carolina Río; Vugrinec, Sascha; Kroth, Peter G

2009-02-01

268

Pathways and regulation of carbon, sulfur and energy transfer in marine sediments overlying methane gas hydrates on the Opouawe Bank (New Zealand)  

NASA Astrophysics Data System (ADS)

This study combines sediment geochemical analysis, in situ benthic lander deployments and numerical modeling to quantify the biogeochemical cycles of carbon and sulfur and the associated rates of Gibbs energy production at a novel methane seep. The benthic ecosystem is dominated by a dense population of tube-building ampharetid polychaetes and conspicuous microbial mats were unusually absent. A 1D numerical reaction-transport model, which allows for the explicit growth of sulfide and methane oxidizing microorganisms, was tuned to the geochemical data using a fluid advection velocity of 14 cm yr -1. The fluids provide a deep source of dissolved hydrogen sulfide and methane to the sediment with fluxes equal to 4.1 and 18.2 mmol m -2 d -1, respectively. Chemosynthetic biomass production in the subsurface sediment is estimated to be 2.8 mmol m -2 d -1 of C biomass. However, carbon and oxygen budgets indicate that chemosynthetic organisms living directly above or on the surface sediment have the potential to produce 12.3 mmol m -2 d -1 of C biomass. This autochthonous carbon source meets the ampharetid respiratory carbon demand of 23.2 mmol m -2 d -1 to within a factor of 2. By contrast, the contribution of photosynthetically-fixed carbon sources to ampharetid nutrition is minor (3.3 mmol m -2 d -1 of C). The data strongly suggest that mixing of labile autochthonous microbial detritus below the oxic layer sustains high measured rates of sulfate reduction in the uppermost 2 cm of the sulfidic sediment (100-200 nmol cm -3 d -1). Similar rates have been reported in the literature for other seeps, from which we conclude that autochthonous organic matter is an important substrate for sulfate reducing bacteria in these sediment layers. A system-scale energy budget based on the chemosynthetic reaction pathways reveals that up to 8.3 kJ m -2 d -1 or 96 mW m -2 of catabolic (Gibbs) energy is dissipated at the seep through oxidation reactions. The microorganisms mediating sulfide oxidation and anaerobic oxidation of methane (AOM) produce 95% and 2% of this energy flux, respectively. The low power output by AOM is due to strong bioenergetic constraints imposed on the reaction rate by the composition of the chemical environment. These constraints provide a high potential for dissolved methane efflux from the sediment (12.0 mmol m -2 d -1) and indicates a much lower efficiency of (dissolved) methane sequestration by AOM at seeps than considered previously. Nonetheless, AOM is able to consume a third of the ascending methane flux (5.9 mmol m -2 d -1 of CH 4) with a high efficiency of energy expenditure (35 mmol CH 4 kJ -1). It is further proposed that bioenergetic limitation of AOM provides an explanation for the non-zero sulfate concentrations below the AOM zone observed here and in other active and passive margin sediments.

Dale, A. W.; Sommer, S.; Haeckel, M.; Wallmann, K.; Linke, P.; Wegener, G.; Pfannkuche, O.

2010-10-01

269

Water flow pathway and the organic carbon discharge during rain storm events in a coniferous forested head watershed, Tokyo, central Japan  

NASA Astrophysics Data System (ADS)

The current intense discussion of the green house effect, that has been one of the main focuses on the carbon cycle in environmental systems of the earth, seems to be weakened the importance related to the effect of carbonic materials on substance movement in the aquatic environments; though it has just begun to be referred recently. Because dissolved organic carbon (DOC) in stream flows believes to play a main role of the carbon cycle in the fresh water environment, seasonal changes in DOC discharge were investigated in catchments with various scale and land use, especially in forested catchments which are one of the important sources of DOC. In order to understand the fundamental characteristics of the discharge of dissolved organic materials, stream flows, DOC, and fulvic acid like materials (FA) included in stream flows were measured in a coniferous forested head watershed. The watershed is located at the southeast edge of the Kanto mountain and is 40 km west of Tokyo with the elevation from 720 to 820 m and mean slope gradient of 38 degrees. Geology of the watershed is underlain by the sequence of mud and sand stones in Jurassic and the soil in the watershed is Cambisol (Inceptisols). The watershed composes of a dense cypress and cedar forest of 45 years old with poor understory vegetation. Observations were carried out for 6 rain storms of which the total precipitations ranged between 16.2 and 117.4 mm. The magnitude of the storms was classified into small, middle, and big events on the basis of the total precipitation of around 20, 40, and more than 70 mm. Stream flows were collected during the storm events by 1 hour interval and were passed through the 0.45 ?m filters, and then the DOC concentrations in the flows were measured with a total organic carbon analyzer. The relative concentrations of fulvic acid (FA) in the flows were monitored with three dimensional excitations emission matrix fluorescence spectroscopy, because fulvic acid shows distinctive fluorescence peaks at around the excitation wave length of 340 nm and emission wave length of 440 nm. The timing of the peaks in DOC and FA occurred simultaneously or within 30 minutes prior to those in the stream flows. The relationship between DOC and stream flow showed linear correlations with various gradients in each event. However, the relationship between FA and stream flow showed the linear correlations only for the small and middle events and clockwise hysteresis relations occurred in the big storm events. The relationship between DOC and FA showed the linear correlations both for the extracted water of the shallow soil and for stream base flow composed mostly of groundwater discharge. However, the relationship in the storm flow closely distributed at that in the extracted water of the shallow soil. This thing reveals that DOC and FA were mainly flashed out from the shallow soil during the rain storm events. The quick rising and recession of the fulvic acid was likely provided by quick rain water discharge through the surface or near surface of the slope. However, the overland flow were rare in the watershed during the rain storms. This indicates that the rapid shallow subsurface flow, passed mainly through preferential flow pathways at the slope surface within the loose litter and root-permeated zone, was the main cause of the difference in discharge regimes between DOC and FA. The shallow subsurface flow may have flushed the FA in the near-surface of the soil, and then the relatively predominant discharge of DOC must have been caused during the big rain storm event.

Moriizumi, Mihoko; Terajima, Tomomi

2010-05-01

270

Evolution of mesh fixation for hernia repair.  

PubMed

Hernia repair remains one of the most common surgical procedures performed around the world. Over the past several decades, in response to various mesh-related complications and coinciding with the influx of laparoscopy into the field of general surgery, numerous advancements have been made in regards to the technology of mesh products being used in hernia repair today. Along these same lines, devices used for mesh fixation have evolved at a similar pace. The goal of this chapter is to review the various materials and methods of mesh fixation being utilized in both ventral and inguinal hernia repair today. PMID:25398127

Webb, David; Stoikes, Nathaniel; Voeller, Guy

2014-11-01

271

[Iris-fixated intraocular lenses: reinforced monitoring].  

PubMed

In 1986, the concept of the claw lens was applied to correct myopia in phakic patients. Since then, progress has made iris-fixated phakic intraocular lenses (IOL) relatively safe, predictable, and effective for the correction of myopia, hyperopia, and astigmatism. All these models have undergone a series of design improvements to prevent complications. Despite having excellent refractive results, the principal risk is a potential progressive endothelial cell loss. Many authors have presented encouraging results. Phakic iris-fixated IOL surgery is a potentially reversible procedure, but the surgeon cannot rule out the possibility of complications. Therefore, long-term follow-up is mandatory. PMID:19520458

Fournié, P; Malecaze, F

2009-11-01

272

Photosynthetic carbon metabolism in photoautotrophic cell suspension cultures grown at low and high CO sub 2  

SciTech Connect

Photosynthetic carbon metabolism was characterized in four photoautotrophic cell suspension cultures. There was no apparent difference between two soybeans (Glycine max) and one cotton (Gossypium hirsutum) cell line which required 5% CO{sub 2} for growth, and a unique cotton cell line that grows at ambient CO{sub 2} (660 microliters per liter). Photosynthetic characteristics in all four lines were more like C{sub 3} mesophyll leaf cells than the cell suspension cultures previously studied. The pattern of {sup 14}C-labeling reflected the high ratio of ribulosebisphosphate carboxylase to phosphoenolpyruvate carboxylase activity and showed that CO{sub 2} fixation occurred primarily by the C{sub 3} pathway. Photorespiration occurred at 330 microliters per liter CO{sub 2}, 21% O{sub 2} as indicated by the synthesis of high levels of {sup 14}C-labeled glycine and serine in a pulse-chase experiment and by oxygen inhibition of CO{sub 2} fixation. Short-term CO{sub 2} fixation in the presence and absence of carbonic anhydrase showed CO{sub 2}, not HCO{sub 3}{sup {minus}}, to be the main source of inorganic carbon taken up by the low CO{sub 2}-requiring cotton cells. The cells did not have a CO{sub 2}-concentrating mechanism as indicated by silicone oil centrifugation experiments. Carbonic anhydrase was absent in the low CO{sub 2}-requiring cotton cells, present in the high CO{sub 2}-requiring soybean cell lines, and absent in other high CO{sub 2} cell lines examined. Thus, the presence of carbonic anhydrase is not an essential requirement for photoautotrophy in cell suspension cultures which grow at either high or low CO{sub 2} concentrations.

Roeske, C.A.; Widholm, J.M. (Univ. of Illinois at Urbana-Champaign (USA)); Ogren, W.L. (Department of Agriculture, Urbana, IL (USA))

1989-12-01

273

Physical forcing of nitrogen fixation and diazotroph community structure in the North Pacific subtropical gyre  

NASA Astrophysics Data System (ADS)

Dinitrogen (N2) fixing microorganisms (termed diazotrophs) exert important control on the ocean carbon cycle. However, despite increased awareness on the roles of these microorganisms in ocean biogeochemistry and ecology, the processes controlling variability in diazotroph distributions, abundances, and activities remain largely unknown. In this study, we examine 3 years (2004-2007) of approximately monthly measurements of upper ocean diazotroph community structure and rates of N2 fixation at Station ALOHA (22°45'N, 158°W), the field site for the Hawaii Ocean Time-series program in the central North Pacific subtropical gyre (NPSG). The structure of the N2-fixing microorganism assemblage varied widely in time with unicellular N2-fixing microorganisms frequently dominating diazotroph abundances in the late winter and early spring, while filamentous microorganisms (specifically various heterocyst-forming cyanobacteria and Trichodesmium spp.) fluctuated episodically during the summer. On average, a large fraction (˜80%) of the daily N2 fixation was partitioned into the biomass of <10 ?m microorganisms. Rates of N2 fixation were variable in time, with peak N2 fixation frequently coinciding with periods when heterocystous N2-fixing cyanobacteria were abundant. During the summer months when sea surface temperatures exceeded 25.2°C and concentrations of nitrate plus nitrite were at their annual minimum, rates of N2 fixation often increased during periods of positive sea surface height anomalies, as reflected in satellite altimetry. Our results suggest mesoscale physical forcing may comprise an important control on variability in N2 fixation and diazotroph community structure in the NPSG.

Church, Matthew J.; Mahaffey, Claire; Letelier, Ricardo M.; Lukas, Roger; Zehr, Jonathan P.; Karl, David M.

2009-06-01

274

A global proteome study of Mycobacterium gilvum PYR-GCK grown on pyrene and glucose reveals the activation of glyoxylate, shikimate and gluconeogenetic pathways through the central carbon metabolism highway.  

PubMed

Various hydrocarbons have been released into the environment as a result of industrialization. An effective way of removing these materials without further environmental contamination is microbial bioremediation. Mycobacterium gilvum PYR-GCK, a bacteria isolated from a PAH polluted estuary, was studied using comparative shotgun proteomics to gain insight on its molecular activity while using pyrene and glucose as sole carbon and energy sources. Based on annotated genomic information, a confirmation analysis was first performed to confirm its pyrene degradation activity, using gas chromatography-mass spectrometry technology. One dimensional gel electrophoresis and liquid chromatography-mass spectrometry technologies employed in the proteomics analysis revealed the expression of pyrene degrading gene products along with upregulated expression of proteins functioning in the glyoxylate and shikimate pathways, in the pyrene-induced cells. The study also revealed the pathway of pyrene degraded intermediates, via partial gluconeogenesis, into the pentose phosphate pathway to produce precursors for nucleotides and amino acids biosynthesis. PMID:23361126

Badejo, Abimbola Comfort; Choi, Chi-Won; Badejo, Adegoke Olugboyega; Shin, Kyung-Hoon; Hyun, Jung-Ho; Lee, Yeol-Gyun; Kim, Seung-Il; Park, Kang-Sik; Kim, Sang Hoon; Jung, Kyoung Hwa; Chung, Young-Ho; Chai, Young Gyu

2013-11-01

275

Investigation of the medical applications of the unique biocarbons developed by NASA. [compatibility of percutaneous prosthetic carbon devices  

NASA Technical Reports Server (NTRS)

The biocompatibility of percutaneous endoskeletal fixation devices made from carbon compounds, and their applications are considered. The clinical application of these carbons to solve human problems is demonstrated and the nature of myoelectric simulation by carbon implants is studied.

Mooney, V.

1973-01-01

276

Simultaneous glutaraldehyde-osmium tetroxide fixation with postosmication  

Microsoft Academic Search

A fixation procedure for electron microscopy is described which includes a simultaneous glutaraldehyde-OsO4 fixation followed by postosmication. This procedure was found to have considerable advantages in preserving structures of plant and animal cells.

Werner W. Franke; Sigrid Krien; R. Malcolm Brown

1969-01-01

277

Large D/H variations in bacterial lipids reflect central metabolic pathways  

PubMed Central

Large hydrogen-isotopic (D/H) fractionations between lipids and growth water have been observed in most organisms studied to date. These fractionations are generally attributed to isotope effects in the biosynthesis of lipids, and are frequently assumed to be approximately constant for the purpose of reconstructing climatic variables. Here, we report D/H fractionations between lipids and water in 4 cultured members of the phylum Proteobacteria, and show that they can vary by up to 500‰ in a single organism. The variation cannot be attributed to lipid biosynthesis as there is no significant change in these pathways between cultures, nor can it be attributed to changing substrate D/H ratios. More importantly, lipid/water D/H fractionations vary systematically with metabolism: chemoautotrophic growth (approximately ?200 to ?400‰), photoautotrophic growth (?150 to ?250‰), heterotrophic growth on sugars (0 to ?150‰), and heterotrophic growth on TCA-cycle precursors and intermediates (?50 to +200‰) all yield different fractionations. We hypothesize that the D/H ratios of lipids are controlled largely by those of NADPH used for biosynthesis, rather than by isotope effects within the lipid biosynthetic pathway itself. Our results suggest that different central metabolic pathways yield NADPH—and indirectly lipids—with characteristic isotopic compositions. If so, lipid ?D values could become an important biogeochemical tool for linking lipids to energy metabolism, and would yield information that is highly complementary to that provided by 13C about pathways of carbon fixation. PMID:19617564

Zhang, Xinning; Gillespie, Aimee L.; Sessions, Alex L.

2009-01-01

278

A mechanistic, globally-applicable model of plant nitrogen uptake, retranslocation and fixation  

NASA Astrophysics Data System (ADS)

Nitrogen is one of the nutrients that can most limit plant growth, and nitrogen availability may be a controlling factor on biosphere responses to climate change. We developed a plant nitrogen assimilation model based on a) advective transport through the transpiration stream, b) retranslocation whereby carbon is expended to resorb nitrogen from leaves, c) active uptake whereby carbon is expended to acquire soil nitrogen, and d) biological nitrogen fixation whereby carbon is expended for symbiotic nitrogen fixers. The model relies on 9 inputs: 1) net primary productivity (NPP), 2) plant C:N ratio, 3) available soil nitrogen, 4) root biomass, 5) transpiration rate, 6) saturated soil depth,7) leaf nitrogen before senescence, 8) soil temperature, and 9) ability to fix nitrogen. A carbon cost of retranslocation is estimated based on leaf nitrogen and compared to an active uptake carbon cost based on root biomass and available soil nitrogen; for nitrogen fixers both costs are compared to a carbon cost of fixation dependent on soil temperature. The NPP is then allocated to optimize growth while maintaining the C:N ratio. The model outputs are total plant nitrogen uptake, remaining NPP available for growth, carbon respired to the soil and updated available soil nitrogen content. We test and validate the model (called FUN: Fixation and Uptake of Nitrogen) against data from the UK, Germany and Peru, and run the model under simplified scenarios of primary succession and climate change. FUN is suitable for incorporation into a land surface scheme of a General Circulation Model and will be coupled with a soil model and dynamic global vegetation model as part of a land surface model (JULES).

Fisher, J. B.; Tan, S.; Malhi, Y.; Fisher, R. A.; Sitch, S.; Huntingford, C.

2008-12-01

279

Molecular Basis of Microbial One-Carbon Metabolism 2008 Gordon Research Conference (July 20-25, 2008)  

SciTech Connect

One-carbon (C-1) compounds play a central role in microbial metabolism. C-1 compounds include methane, carbon monoxide, CO2, and methanol as well as coenzyme-bound one-carbon compounds (methyl-B12, CH3-H4folate, etc). Such compounds are of broad global importance because several C-1 compounds (e.g., CH4) are important energy sources, some (e.g., CO2 and CH4) are potent greenhouse gases, and others (e.g., CH2Cl2) are xenobiotics. They are central in pathways of energy metabolism and carbon fixation by microbes and many are of industrial interest. Research on the pathways of one-carbon metabolism has added greatly to our understanding of evolution, structural biology, enzyme mechanisms, gene regulation, ecology, and applied biology. The 2008 meeting will include recent important findings in the following areas: (a) genomics, metagenomics, and proteomic studies that have expanded our understanding of autotrophy and C-1 metabolism and the evolution of these pathways; (b) redox regulation of carbon cycles and the interrelationship between the carbon cycle and other biogeochemical cycles (sulfur, nitrogen, oxygen); (c) novel pathways for carbon assimilation; (d) biotechnology related to C-1 metabolism; (e) novel enzyme mechanisms including channeling of C-1 intermediates during metabolism; and (f) the relationship between metal homeostasis and the global carbon cycle. The conference has a diverse and gender-balanced slate of speakers and session leaders. The wide variety of disciplines brought to the study of C-1 metabolism make the field an excellent one in which to train young researchers.

Stephen W. Ragsdale

2009-08-12

280

Skin damage probabilities using fixation materials in high-energy photon beams  

Microsoft Academic Search

Introduction: Patient fixation, such as thermoplastic masks, carbon-fibre support plates and polystyrene bead vacuum cradles, is used to reproduce patient positioning in radiotherapy. Consequently low-density materials may be introduced in high-energy photon beams. The aim of the this study was to measure the increase in skin dose when low-density materials are present and calculate the radiobiological consequences in terms of

Jesper Carl; Anne Vestergaard

2000-01-01

281

Suture Bridge Fixation of a Femoral Condyle Traumatic Osteochondral Defect  

Microsoft Academic Search

Internal fixation of a traumatic osteochondral defect presents a challenge in terms of obtaining anatomic reduction, fixation,\\u000a and adequate compression for healing. Fixation with countersunk intraarticular screws, Herbert screws, bioabsorbable screws\\u000a and pins, mini-cancellous screws, and glue tissue adhesive have been reported with varying results. We present an alternative\\u000a fixation method used in two patients for femoral condylar defects that

Andrea L. Bowers; G. Russell Huffman

2008-01-01

282

Stability with unilateral external fixation in the tibia  

Microsoft Academic Search

\\u000a Abstract\\u000a   Unilateral external fixation can be used in the provisional or definitive treatment of tibial fractures. A properly applied\\u000a fixator allows bony and soft tissue stability, whereas an improperly applied fixator achieves neither and can be a hindrance.\\u000a The principles for the successful application of monolateral external fixation, including the rationale for choosing this\\u000a type of device, the assembly of

N. Giotakis; B. Narayan

2007-01-01

283

Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change  

PubMed Central

Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of “new” nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review. PMID:24967086

Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

2014-01-01

284

Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change.  

PubMed

Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of "new" nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review. PMID:24967086

Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

2014-05-01

285

Nitrogen fixation and respiration by root nodules of Alnus rubra Bong.: Effects of temperature and oxygen concentration  

Microsoft Academic Search

Using a root nodule cuvette and a continuous flow gas exchange system, we simultaneously measured the rates of carbon dioxide evolution, oxygen uptake and acetylene reduction by nodules ofAlnus rubra. This system allowed us to measure the respiration rates of single nodules and to determine the effects of oxygen concentration and temperature on the energy cost of nitrogen fixation. Energy

Lawrence J. Winship; John D. Tjepkema

1985-01-01

286

Augmentation of implant fixation in osteoporotic bone.  

PubMed

Osteoporosis presents a dilemma for the orthopedic surgeon. Screw fixation within the bone is crucial for mechanical stabilization, maintenance of reduction, and ultimately, fracture healing. For the patient, soft bones and physiological fragility usually benefit from immediate weight bearing and mobility to avoid further disuse osteoporosis, deconditioning, and immobility. For implant companies, traditional screws, plates, and nails function for simple fractures and compliant patients. Locked plating has improved screw purchase in osteoporotic bone and has expanded fracture fixation capabilities but is not the panacea for all fractures. For orthopedic surgeons, traditional surgical augmentation for osteoporosis consisting of dual plating, augmentation with polymethyl methacrylate, joint replacement, and now locked plating are beneficial. In order to advance orthopedic care in the expanding population of elderly osteoporotic patients, modern solutions utilizing the dual properties of secure fixation and relatively flexible implants are required. Endosteal substitution, extraosteal substitution, and combined nail/plate combinations are methods of utilizing traditional implants in a nontraditional way. Nonsurgical augmentation of fracture fixation is also paramount. PMID:23054960

Jones, Clifford B

2012-12-01

287

Postmortem inflation and fixation of human lungs  

PubMed Central

Wright, B. M., Slavin, G., Kreel, L., Callan, K., and Sandin, Brenda (1974).Thorax, 29, 189-194. Postmortem inflation and fixation of human lungs. A method of fixing lungs by inflating them with heated formalin vapour is described. This method facilitates postmortem correlations between radiographic and histological appearances. Images PMID:4598582

Wright, B. M.; Slavin, G.; Kreel, L.; Callan, K.; Sandin, Brenda

1974-01-01

288

Unfixing Design Fixation: From Cause to Computer Simulation  

ERIC Educational Resources Information Center

This paper argues that design fixation, in part, entails fixation at the level of meta-representation, the representation of the relation between a representation and its reference. In this paper, we present a mathematical model that mimics the idea of how fixation can occur at the meta-representation level. In this model, new abstract concepts…

Dong, Andy; Sarkar, Somwrita

2011-01-01

289

Three-dimensional load measurements in an external fixator  

Microsoft Academic Search

On the basis of a six-degree-of-freedom adjustable fracture reduction hexapod external fixator, a system which can be used for measuring axial and shear forces as well as torsion and bending moments in the fixator in vivo was developed. In a pilot study on 9 patients (7 fresh fractures and 2 osteotomies of the tibia), the load in the fixator during

K Seide; N Weinrich; M. E Wenzl; D Wolter; C Jürgens

2004-01-01

290

Sliding performance of unilateral external fixators for tibia  

Microsoft Academic Search

Some unilateral external fixators have a sliding mechanism to achieve dynamic axial fixation. However, it has been reported that binding of this mechanism occurs during routine ambulation. The Hifixator, a unilateral external fixator, has been developed which has a new type of sliding mechanism. The mechanism of the Hifixator was tested by connecting it to a fractured bone model with

Takashi Matsushita; Kozo Nakamura; Isao Ohnishi; Takahide Kurokawa

1998-01-01

291

Nonunion after primary treatment of tibia fractures with external fixation  

Microsoft Academic Search

The authors retrospectively reviewed 207 fractures of tibial diaphysis, treated primarily with external fixation without bone grafting. Forty-two fractures (20.3%) resulted in nonunion and required reoperation. Parameters analyzed for their significance for nonunion included, soft tissue damage, energy of injury, method of fracture reduction, type of external fixation frame, supplemental interfragmentary screw fixation, dynamization at the fracture site, and postoperative

N. Papaioannou; D. Mastrokalos; P. J. Papagelopoulos; M. Tyllianakis; J. Athanassopoulos; P. A. Nikiforidis

2001-01-01

292

The Two Phases of the Coalescent and Fixation Processes Introduction  

E-print Network

the stasis phase. Because the expected fixation and coalescent times are equal, and those processes share the transition phase, the expected lengths of the stasis phase are the same for the coalescent and fixation shall denote as T and t, contain the stasis phases for coalescence and fixation, respectively. Hence I

Campbell, Russell Bruce

293

Systematic comparison of tissue fixation with alternative fixatives to conventional tissue fixation with buffered formalin in a xenograft-based model.  

PubMed

In our study we systematically compared the alternative fixatives acidified formal alcohol (AFA), PAXgene®, HOPE®, and combinations of AFA or formalin with ultrasound treatment to standard (buffered) formalin fixation. We examined general morphology and detectability of protein structures by immunohistochemistry of the membrane receptors epidermal growth factor receptor (EGFR), insulin-like growth factor 1 receptor (IGF-1R), and phosphorylated human epidermal growth factor receptor 2 (phospho-HER2). In order to allow for stringent comparability of different fixation techniques, we used matched mouse xenograft tumor samples from three different human cancer cell lines (colon, ovarian, and non-small cell lung cancer), either fixed conventionally with formalin or an alternative fixative. Tissue morphology after fixation with AFA and PAXgene® was comparable to formalin-fixed paraffin-embedded tissue (FFPET) morphology. Ultrasound fixations resulted in slightly inferior morphology and HOPE® fixation preserved morphology only poorly compared to FFPET in this system. None of the tested alternative fixatives enabled immunohistochemical detectability of all three targets in the same manner as FFPET. Pronounced staining was possible for EGFR and IGF-1R with all alternative fixatives but HOPE®, and phospho-HER2 staining was only noteworthy with formalin-ultrasound-fixed tissue. Therefore, the use of alternative fixatives comes with the need for careful validation of obtained IHC results individually for each target. PMID:22814649

Nietner, Thorben; Jarutat, Tiantom; Mertens, Alfred

2012-09-01

294

Adult tibial eminence fracture fixation: arthroscopic procedure using K-wire folded fixation  

Microsoft Academic Search

The purpose of this article is to describe a new and simple technique for arthroscopic fixation of tibial intercondylar eminence\\u000a avulsion fractures using folded surgical pin. This technique allows reduction and fixation of the bone fragment without using\\u000a special equipment. After standard arthroscopic procedure to explore the knee and to remove fracture debris and blood clot,\\u000a the bone block is

Nicolas Bonin; Laurent Jeunet; Laurent Obert; David Dejour

2007-01-01

295

Environmental Forcing of Nitrogen Fixation in the Eastern Tropical and Sub-Tropical North Atlantic Ocean  

PubMed Central

During the winter of 2006 we measured nifH gene abundances, dinitrogen (N2) fixation rates and carbon fixation rates in the eastern tropical and sub-tropical North Atlantic Ocean. The dominant diazotrophic phylotypes were filamentous cyanobacteria, which may include Trichodesmium and Katagnymene, with up to 106 L?1 nifH gene copies, unicellular group A cyanobacteria with up to 105 L?1 nifH gene copies and gamma A proteobacteria with up to 104 L?1 nifH gene copies. N2 fixation rates were low and ranged between 0.032–1.28 nmol N L?1 d?1 with a mean of 0.30±0.29 nmol N L?1 d?1 (1?, n?=?65). CO2-fixation rates, representing primary production, appeared to be nitrogen limited as suggested by low dissolved inorganic nitrogen to phosphate ratios (DIN:DIP) of about 2±3.2 in surface waters. Nevertheless, N2 fixation rates contributed only 0.55±0.87% (range 0.03–5.24%) of the N required for primary production. Boosted regression trees analysis (BRT) showed that the distribution of the gamma A proteobacteria and filamentous cyanobacteria nifH genes was mainly predicted by the distribution of Prochlorococcus, Synechococcus, picoeukaryotes and heterotrophic bacteria. In addition, BRT indicated that multiple a-biotic environmental variables including nutrients DIN, dissolved organic nitrogen (DON) and DIP, trace metals like dissolved aluminum (DAl), as a proxy of dust inputs, dissolved iron (DFe) and Fe-binding ligands as well as oxygen and temperature influenced N2 fixation rates and the distribution of the dominant diazotrophic phylotypes. Our results suggest that lower predicted oxygen concentrations and higher temperatures due to climate warming may increase N2 fixation rates. However, the balance between a decreased supply of DIP and DFe from deep waters as a result of more pronounced stratification and an enhanced supply of these nutrients with a predicted increase in deposition of Saharan dust may ultimately determine the consequences of climate warming for N2 fixation in the North Atlantic. PMID:22174940

Rijkenberg, Micha J. A.; Langlois, Rebecca J.; Mills, Matthew M.; Patey, Matthew D.; Hill, Polly G.; Nielsdottir, Maria C.; Compton, Tanya J.; LaRoche, Julie; Achterberg, Eric P.

2011-01-01

296

Environmental forcing of nitrogen fixation in the eastern tropical and sub-tropical North Atlantic Ocean.  

PubMed

During the winter of 2006 we measured nifH gene abundances, dinitrogen (N(2)) fixation rates and carbon fixation rates in the eastern tropical and sub-tropical North Atlantic Ocean. The dominant diazotrophic phylotypes were filamentous cyanobacteria, which may include Trichodesmium and Katagnymene, with up to 10(6) L(-1)nifH gene copies, unicellular group A cyanobacteria with up to 10(5) L(-1)nifH gene copies and gamma A proteobacteria with up to 10(4) L(-1)nifH gene copies. N(2) fixation rates were low and ranged between 0.032-1.28 nmol N L(-1) d(-1) with a mean of 0.30 ± 0.29 nmol N L(-1) d(-1) (1?, n = 65). CO(2)-fixation rates, representing primary production, appeared to be nitrogen limited as suggested by low dissolved inorganic nitrogen to phosphate ratios (DIN:DIP) of about 2 ± 3.2 in surface waters. Nevertheless, N(2) fixation rates contributed only 0.55 ± 0.87% (range 0.03-5.24%) of the N required for primary production. Boosted regression trees analysis (BRT) showed that the distribution of the gamma A proteobacteria and filamentous cyanobacteria nifH genes was mainly predicted by the distribution of Prochlorococcus, Synechococcus, picoeukaryotes and heterotrophic bacteria. In addition, BRT indicated that multiple a-biotic environmental variables including nutrients DIN, dissolved organic nitrogen (DON) and DIP, trace metals like dissolved aluminum (DAl), as a proxy of dust inputs, dissolved iron (DFe) and Fe-binding ligands as well as oxygen and temperature influenced N(2) fixation rates and the distribution of the dominant diazotrophic phylotypes. Our results suggest that lower predicted oxygen concentrations and higher temperatures due to climate warming may increase N(2) fixation rates. However, the balance between a decreased supply of DIP and DFe from deep waters as a result of more pronounced stratification and an enhanced supply of these nutrients with a predicted increase in deposition of Saharan dust may ultimately determine the consequences of climate warming for N(2) fixation in the North Atlantic. PMID:22174940

Rijkenberg, Micha J A; Langlois, Rebecca J; Mills, Matthew M; Patey, Matthew D; Hill, Polly G; Nielsdóttir, Maria C; Compton, Tanya J; Laroche, Julie; Achterberg, Eric P

2011-01-01

297

Renewable Hydrogen Carrier Carbohydrate: Constructing the Carbon-Neutral Carbohydrate Economy  

SciTech Connect

Abstract The hydrogen economy presents an appealing energy future but its implementation must solve numerous problems ranging from low-cost sustainable production, high-density storage, costly infrastructure, to eliminating safety concern. The use of renewable carbohydrate as a high-density hydrogen carrier and energy source for hydrogen production is possible due to emerging cell-free synthetic biology technology called cell-free synthetic pathway biotransformation (SyPaB). Assembly of numerous enzymes and co-enzymes in vitro can create complicated set of biological reactions or pathways that microorganisms cannot complete, for example, C6H10O5 (aq) + 7 H2O (l) 12 H2 (g) + 6 CO2 (g) (PLoS One 2007, 2:e456). Thanks to 100% selectivity of enzymes, modest reaction conditions, and high-purity of generated hydrogen, carbohydrate is a promising hydrogen carrier for end users. Gravimetric density of carbohydrate is 14.8 H2 mass% if water can be recycled from PEM fuel cells or 8.33% H2 mass% without water recycling. Renewable carbohydrate can be isolated from plant biomass or would be produced from a combination of solar electricity/hydrogen and carbon dioxide fixation mediated by high-efficiency artificial photosynthesis mediated by SyPaB. The construction of this carbon-neutral carbohydrate economy would address numerous sustainability challenges, such as electricity and hydrogen storage, CO2 fixation and long-term storage, water conservation, transportation fuel production, plus feed and food production.

Zhang, Y.-H. Percival [Virginia Polytechnic Institute and State University (Virginia Tech); Mielenz, Jonathan R [ORNL

2011-01-01

298

LCP external fixation - External application of an internal fixator: two cases and a review of the literature  

Microsoft Academic Search

The locking compression plate (LCP) is an angle-stable fixator intended for intracorporeal application. In selected cases, it can be applied externally in an extracorporeal location to function as a monolateral external fixator. We describe one patient with Schatzker V tibial plateau fracture and one patient with Gustillo IIIB open tibia shaft fracture treated initially with traditional external fixation for whom

Colin Yi-Loong Woon; Merng-Koon Wong; Tet-Sen Howe

2010-01-01

299

Nitrogen Fixation By Sulfate-Reducing Bacteria in Coastal and Deep-Sea Sediments  

NASA Astrophysics Data System (ADS)

Sulfate-reducing bacteria (SRB) can greatly impact benthic nitrogen (N) cycling, by for instance inhibiting coupled denitrification-nitrification through the production of sulfide or by increasing the availability of fixed N in the sediment via dinitrogen (N2)-fixation. Here, we explored several coastal and deep-sea benthic habitats within the Atlantic Ocean and Baltic Sea, for the occurrence of N2-fixation mediated by SRB. A combination of different methods including microbial rate measurements of N2-fixation and sulfate reduction, geochemical analyses (porewater nutrient profiles, mass spectrometry), and molecular analyses (CARD-FISH, HISH-SIMS, "nested" PCR, and QPCR) were applied to quantify and identify the responsible processes and organisms, respectively. Furthermore, we looked deeper into the question of whether the observed nitrogenase activity was associated with the final incorporation of N into microbial biomass or whether the enzyme activity served another purpose. At the AGU Fall Meeting, we will present and compare data from numerous stations with different water depths, temperatures, and latitudes, as well as differences in key geochemical parameters, such as organic carbon content and oxygen availability. Current metabolic and molecular data indicate that N2-fixation is occurring in many of these benthic environments and that a large part of this activity may linked to SRB.

Bertics, V. J.; Löscher, C.; Salonen, I.; Schmitz-Streit, R.; Lavik, G.; Kuypers, M. M.; Treude, T.

2011-12-01

300

A possible nitrogen crisis for Archaean life due to reduced nitrogen fixation by lightning.  

PubMed

Nitrogen is an essential element for life and is often the limiting nutrient for terrestrial ecosystems. As most nitrogen is locked in the kinetically stable form, N2, in the Earth's atmosphere, processes that can fix N2 into biologically available forms-such as nitrate and ammonia-control the supply of nitrogen for organisms. On the early Earth, nitrogen is thought to have been fixed abiotically, as nitric oxide formed during lightning discharge. The advent of biological nitrogen fixation suggests that at some point the demand for fixed nitrogen exceeded the supply from abiotic sources, but the timing and causes of the onset of biological nitrogen fixation remain unclear. Here we report an experimental simulation of nitrogen fixation by lightning over a range of Hadean (4.5-3.8 Gyr ago) and Archaean (3.8-2.5 Gyr ago) atmospheric compositions, from predominantly carbon dioxide to predominantly dinitrogen (but always without oxygen). We infer that, as atmospheric CO2 decreased over the Archaean period, the production of nitric oxide from lightning discharge decreased by two orders of magnitude until about 2.2 Gyr. After this time, the rise in oxygen (or methane) concentrations probably initiated other abiotic sources of nitrogen. Although the temporary reduction in nitric oxide production may have lasted for only 100 Myr or less, this was potentially long enough to cause an ecological crisis that triggered the development of biological nitrogen fixation. PMID:11452304

Navarro-González, R; McKay, C P; Mvondo, D N

2001-07-01

301

Microarray and bioinformatic analyses suggest models for carbon metabolism in the autotroph Acidithiobacillus ferrooxidans  

SciTech Connect

Acidithiobacillus ferrooxidans is a chemolithoautotrophic bacterium that uses iron or sulfur as an energy and electron source. Bioinformatic analysis was used to identify putative genes and potential metabolic pathways involved in CO2 fixation, 2P-glycolate detoxification, carboxysome formation and glycogen utilization in At. ferrooxidans. Microarray transcript profiling was carried out to compare the relative expression of the predicted genes of these pathways when the microorganism was grown in the presence of iron versus sulfur. Several gene expression patterns were confirmed by real-time PCR. Genes for each of the above predicted pathways were found to be organized into discrete clusters. Clusters exhibited differential gene expression depending on the presence of iron or sulfur in the medium. Concordance of gene expression within each cluster, suggested that they are operons Most notably, clusters of genes predicted to be involved in CO2 fixation, carboxysome formation, 2P-glycolate detoxification and glycogen biosynthesis were up-regulated in sulfur medium, whereas genes involved in glycogen utilization were preferentially expressed in iron medium. These results can be explained in terms of models of gene regulation that suggest how A. ferrooxidans can adjust its central carbon management to respond to changing environmental conditions.

C. Appia-ayme; R. Quatrini; Y. Denis; F. Denizot; S. Silver; F. Roberto; F. Veloso; J. Valdes; J. P. Cardenas; M. Esparza; O. Orellana; E. Jedlicki; V. Bonnefoy; D. Holmes

2006-09-01

302

Molecular basis of a microbe-mediated enhancement of symbiotic N/sub 2/-fixation. [Rhizobium meliloti; Pseudomonas syringae pv. tabaci  

SciTech Connect

Improvement of biological nitrogen fixation represents a potential source of both increased food production and decreased dependence on costly chemical fertilizer. They report the results of an investigation of the molecular basis of a unique, microbial-mediated mechanism for increased growth and nitrogen fixation rates in alfalfa. Inoculation of alfalfa plants with both Rhizobium meliloti and Pseudomonas syringae pv tabaci provides increased growth and N/sub 2/-fixation rates of alfalfa. Tabaci produces tabtoxinine-..beta..-lactam (T..beta..L), an exocellular product and glutamine synthetase (GS) inhibitor. The association of this pathogen with nodulating alfalfa plants appears to alter the normal regulation of nitrogen fixation such that nitrogenase activity is stimulated and GS activity is inhibited. Studies of the soluble amino acids in these nodules and the activities of the ammonia assimilatory enzymes indicate alternative pathways of ammonia assimilation are being employed.

Unkefer, P.J.; Knight, T.J.

1987-04-01

303

Assessment of visual fixation in vegetative and minimally conscious states  

PubMed Central

Background Visual fixation plays a key role in the differentiation between vegetative state/unresponsive wakefulness (VS/UWS) syndrome and minimally conscious state (MCS). However, the use of different stimuli changes the frequency of visual fixation occured in patients, thereby possibly affecting the accuracy of the diagnosis. In order to establish a standardized assessment of visual fixation in patients in disorders of consciousness (DOC), we compared the frequency of visual fixation elicited by mirror,a ball and a light. Method Visual fixation was assessed in eighty-one post-comatose patients diagnosed with a MCS or VS/UWS. Occurrence of fixation to different stimuli was analysis used Chi-square testing. Result 40 (49%) out of the 81 patients showed fixation to visual stimuli. Among those, significantly more patients (39, 48%) had visual fixation elicited by mirror compared to a ball (23, 28%) and mirror compared to a light (20, 25%). Conclusion The use of a mirror during the assessment of visual fixation showed higher positive response rate, compared to other stimuli in eliciting a visual fixating response. Therefore, fixation elicited by a mirror can be a very sensitive and accurate test to differentiate the two disorders of consciousness. PMID:25027769

2014-01-01

304

MRI analysis of the ISOBAR TTL internal fixation system for the dynamic fixation of intervertebral discs: a comparison with rigid internal fixation  

PubMed Central

Objectives Using magnetic resonance imaging (MRI), we analyzed the efficacy of the posterior approach lumbar ISOBAR TTL internal fixation system for the dynamic fixation of intervertebral discs, with particular emphasis on its effects on degenerative intervertebral disc disease. Methods We retrospectively compared the MRIs of 54 patients who had previously undergone either rigid internal fixation of the lumbar spine or ISOBAR TTL dynamic fixation for the treatment of lumbar spondylolisthesis. All patients had received preoperative and 6-, 12-, and 24-month postoperative MRI scans of the lumbar spine with acquisition of both routine and diffusion-weighted images (DWI). The upper-segment discs of the fusion were subjected to Pfirrmann grading, and the lumbar intervertebral discs in the DWI sagittal plane were manually drawn; the apparent diffusion coefficient (ADC) value was measured. Results ADC values in the ISOBAR TTL dynamic fixation group measured at the 6-, 12-, and 24-month postoperative MRI studies were increased compared to the preoperative ADC values. The ADC values in the ISOBAR TTL dynamic fixation group at 24 months postoperatively were significantly different from the preoperative values (P?fixation group and the ISOBAR TTL dynamic fixation group (P?fixation system can prevent or delay the degeneration of intervertebral discs. PMID:24898377

2014-01-01

305

Application of alternative fixatives to formalin in diagnostic pathology.  

PubMed

Fixation is a critical step in the preparation of tissues for histopathology. The objective of this study was to investigate the effects of different fixatives vs formalin on proteins and DNA, and to evaluate alternative fixation for morphological diagnosis and nucleic acid preservation for molecular methods. Forty tissues were fixed for 24 h with six different fixatives: the gold standard fixative formalin, the historical fixatives Bouin and Hollande, and the alternative fixatives Greenfix, UPM and CyMol. Tissues were stained (Haematoxylin-Eosin, Periodic Acid Schiff, Trichromic, Alcian-blue, High Iron Diamine), and their antigenicity was determined by immunohistochemistry (performed with PAN-CK, CD31, Ki-67, S100, CD68, AML antibodies). DNA extraction, KRAS sequencing, FISH for CEP-17, and flow cytometry analysis of nuclear DNA content were applied. For cell morphology the alternative fixatives (Greenfix, UPM, CyMol) were equivalent to formalin. As expected, Hollande proved the best fixative for morphology. The morphology obtained with Bouin was comparable to that with formalin. Hollande was the best fixative for histochemistry. Bouin proved equivalent to formalin. The alternative fixatives were equivalent to formalin, although with greater variability in haematoxylin-eosin staining. It proved possible to obtain immunohistochemical staining largely equivalent to that following formalin-fixation with the following fixatives: Greenfix, Hollande, UPM and CyMol. The tissues fixed in Bouin did not provide results comparable to those obtained with formalin. The DNA extracted from samples fixed with alternative fixatives was found to be suitable for molecular analysis. PMID:22688293

Benerini Gatta, L; Cadei, M; Balzarini, P; Castriciano, S; Paroni, R; Verzeletti, A; Cortellini, V; De Ferrari, F; Grigolato, P

2012-01-01

306

Water flow pathway and the organic carbon discharge during rain storm events in a coniferous forested head watershed, Tokyo, central Japan  

Microsoft Academic Search

The current intense discussion of the green house effect, that has been one of the main focuses on the carbon cycle in environmental systems of the earth, seems to be weakened the importance related to the effect of carbonic materials on substance movement in the aquatic environments; though it has just begun to be referred recently. Because dissolved organic carbon

Mihoko Moriizumi; Tomomi Terajima

2010-01-01

307

Extra Corporeal Fixation of Fractured Mandibular Condyle  

PubMed Central

Condylar fracture is the second most common site in the mandibular fractures. Motor vehicle accident and fall are the major causes of such fractures. Because of the anatomical weakness of the condyle and the shape of the condylar head the antero-medial dislocation of the condyle is common. Open reduction and closed reduction is always debatable. The open reduction will bring back the normal function much earlier than closed reduction. Medially dislocated condylar fracture fragments are always managed with open method. In superior or high condylar fractures,exact reduction with conventional open reduction can be difficult due to the limited surgical and visual fields. In such cases extracorporeal fixation of condyle using vertical ramus osteotomy may be better choice to achieve perfect alignment and absolute maintaince of vertical height of the ramus and facial symmetry. We here present a case of extracorporeal fixation of unilateral left high condylar fracture. PMID:25386546

Shenoy K, Vandana; Kengagsubbiah, Srivatsa; V, Sathyabhama; Priya, Vishnu

2014-01-01

308

Nitrogen fixation in endophytic and associative symbiosis  

Microsoft Academic Search

N-balance, 15N isotope dilution and 15N natural abundance studies provide strong evidence that some tropical grasses, especially sugar cane (Saccharum spp.), wetland rice (Oryza sativa) and kallar grass (Leptochloa fusca) can obtain at least part of their N-needs from biological nitrogen (N2) fixation. However, these studies have not provided conclusive evidence that these plants are engaged in symbiotic partnerships with

E. K. James

2000-01-01

309

Pin loosening in external skeletal fixation  

E-print Network

healing and return of normal locomotor function depend upon counteracting the forces, moments, and shear stresses acting at the fracture site. Functionally the most important mechanical properties of a fixator-bone composite are strength and stiffness... should maximize the axial pull out strength, or holding power, once inserted. Threaded pins dramatically improve holding power over nonthreaded pins. This is particularly true after the pins are subjected to 8 weeks of fracture/osteotomy stabilization...

Vittal, Bamini

2012-06-07

310

Stability of external skeletal fixation clamps  

E-print Network

26 27 29 30 31 INTRODUCTION The first external skeleton fixation device was used by Malgaigne in 1843, twelve years before the plaster cast [1]. It was comprised of a clamp and four transcutaneous metal prongs and was used for reduction... popularity in the veterinary community, complications remain a significant problem. The most common complications are loosening of the flxator pins and pin tract sepsis. Knowledge gained through bioinechanical studies can minimize complications...

Sandel, Mark Eugene

2012-06-07

311

Distinguishing between target and nontarget fixations in a visual search task using fixation-related potentials.  

PubMed

The P300 event-related potential (ERP) can be used to infer whether an observer is looking at a target or not. Common practice in P300 experiments and applications is that observers are asked to fixate their eyes while stimuli are presented. We investigated the possibility to differentiate between single target and nontarget fixations in a target search task involving eye movements by using EEG epochs synchronized to fixation onset (fixation-related potentials: FRPs). Participants systematically scanned search displays consisting of six small Landolt Cs in search of Cs with a particular orientation. After each search display, they indicated whether and where target Cs had been presented. As expected, an FRP component consistent with the P300 reliably distinguished between target and nontarget fixations. It was possible to classify single FRPs into target and nontarget FRPs above chance (on average 62% correct, where 50% would be chance). These results are the first step to practical applications such as covertly monitoring observers' interests and supporting search tasks. PMID:23863335

Brouwer, Anne-Marie; Reuderink, Boris; Vincent, Joris; van Gerven, Marcel A J; van Erp, Jan B F

2013-01-01

312

Influence of light, temperature and salinity on dissolved organic carbon exudation rates in Zostera marina L.  

EPA Science Inventory

Seagrass carbon budgets provide valuable insight on the minimum requirements needed to maintain this valuable resource. Carbon budgets are a balance between C fixation, storage and loss rates, most of which are well characterized. However, relatively few measurements of dissolv...

313

Anoxygenic Photosynthesis and Nitrogen Fixation by a Microbial Mat Community in a Bahamian Hypersaline Lagoon  

PubMed Central

Simultaneous measurements of photosynthesis (both oxygenic and anoxygenic) and N(inf2) fixation were conducted to discern the relationships between photosynthesis, N(inf2) fixation, and environmental factors potentially regulating these processes in microbial mats in a tropical hypersaline lagoon (Salt Pond, San Salvador Island, Bahamas). Major photoautotrophs included cyanobacteria, purple phototrophic bacteria, and diatoms. Chemosystematic photopigments were used as indicators of the relative abundance of mat phototrophs. Experimental manipulations consisted of light and dark incubations of intact mat samples exposed to the photosystem II inhibitor DCMU [3-(3,4-dichlorophenyl)-1,1-dimethylurea], a dissolved organic carbon source (D-glucose), and normal seawater (37(permil)). Photosynthetic rates were measured by both O(inf2) and (sup14)C methods, and nitrogenase activity (NA) was estimated by the acetylene reduction assay. Moderate reductions in salinity (from 74 to 37(permil)) had no measurable effect on photosynthesis, O(inf2) consumption, or NA. CO(inf2) fixation in DCMU-amended samples was (symbl)25% of that in the control (nonamended) samples and demonstrated photosynthetic activity by anoxygenic phototrophs. NA in DCMU-amended samples, which was consistently higher (by a factor of 2 to 3) than the other (light and dark) treatments, was also attributed to purple phototrophic bacteria. The ecological implication is that N(inf2) fixation by anoxygenic phototrophs (purple phototrophic bacteria and possibly cyanobacteria) may be regulated by the activity of oxygenic phototrophs (cyanobacteria and diatoms). Consortial interactions that enhance the physiological plasticity of the mat community may be a key for optimizing production, N(inf2) fixation, and persistence in these extreme environments. PMID:16535506

Pinckney, J. L.; Paerl, H. W.

1997-01-01

314

Energetic factors affecting carbon dioxide fixation in isolated chloroplasts  

SciTech Connect

Light- and HCO/sub 3/-saturated (10 millimolar) rates of O/sub 2/ evolution (120 to 220 micromoles O/sub 2/ per milligram chlorophyll per hour), obtained with intact spinach chloroplasts, are decreased up to 3-fold by changes in assay conditions such as omission of catalase from the medium, the use of high (greater than or equal to 1 millimolar) inorganic phosphate, inclusion of NO/sub 2/- as an electron acceptor, or bright illumination at low partial pressures of O/sub 2/. These inhibitions may be reversed by addition of uncoupling levels of NH/sub 4/Cl or of antimycin concentrations that partially block cyclic electron transfer between cytochrome b/sub 6/ and cytochrome f. Measurements of the pH gradient across the thylakoid membrane with the fluorescent probe, 9-aminoacridine, indicate that changes in ..delta..pH are sufficient to account for both the inhibited and restored rates of electron transport. It follows that the rate of HCO/sub 3/-saturated photosynthesis may be restricted by a proton gradient back pressure under these conditions. The rate of O/sub 2/ evolution is also decreased 3-fold when ambient CO/sub 2/ (0.63 millimolar HCO/sub 3/- at pH 8.1) is used in place of saturating HCO/sub 3/- and chloroplasts are illuminated aerobically with catalase and a low level (0.25 millimolar) of K/sub 2/HPO/sub 4/. Only inhibitory effects are observed with additions of antimycin or NH/sub 4/Cl. Under these conditions, excessive photophosphorylation or a large pH gradient does not limit the rate of photosynthesis.

Slovacek, R.E.; Hind, G.

1980-03-01

315

Carbon Cycle Diagram  

NSDL National Science Digital Library

This diagram illustrates some of the most abundant stores of carbon and identifies some of the pathways in the carbon cycle along which carbon is transferred from one form to another. Long-term sinks of carbon are labelled in black; shorter-term fluxes are labelled in purple. Amounts are in billions of tons.

2011-07-12

316

Evidence of Coexistence of C3 and C4 Photosynthetic Pathways in a Green-Tide-Forming Alga, Ulva prolifera  

PubMed Central

Ulva prolifera, a typical green-tide-forming alga, can accumulate a large biomass in a relatively short time period, suggesting that photosynthesis in this organism, particularly its carbon fixation pathway, must be very efficient. Green algae are known to generally perform C3 photosynthesis, but recent metabolic labeling and genome sequencing data suggest that they may also perform C4 photosynthesis, so C4 photosynthesis might be more wide-spread than previously anticipated. Both C3 and C4 photosynthesis genes were found in U. prolifera by transcriptome sequencing. We also discovered the key enzymes of C4 metabolism based on functional analysis, such as pyruvate orthophosphate dikinase (PPDK), phosphoenolpyruvate carboxylase (PEPC), and phosphoenolpyruvate carboxykinase (PCK). To investigate whether the alga operates a C4-like pathway, the expression of rbcL and PPDK and their enzyme activities were measured under various forms and intensities of stress (differing levels of salinity, light intensity, and temperature). The expression of rbcL and PPDK and their enzyme activities were higher under adverse circumstances. However, under conditions of desiccation, the expression of rbcL and ribulose-1, 5-biphosphate carboxylase (RuBPCase) activity was lower, whereas that of PPDK was higher. These results suggest that elevated PPDK activity may alter carbon metabolism and lead to a partial operation of C4-type carbon metabolism in U. prolifera, probably contributing to its wide distribution and massive, repeated blooms in the Yellow Sea. PMID:22616009

Zhang, Xiaowen; Xu, Dong; Mou, Shanli; Cao, Shaona; Zheng, Zhou; Miao, Jinlai; Ye, Naihao

2012-01-01

317

Mathematical modeling of fixation of a bone fragment in a new Double-needle external Fixator compared to hoffmann ii fixator  

Microsoft Academic Search

The outcome of rehabilitation after multiple bone fractures can be improved, and the reduction of the rate of amputation due to severe trauma can be achieved with the early use of external fixators (1, 2). Effectiveness of the fixator depends on the stability of the bone fragments during the evacuation of a patient to specialized facilities (3, 4). The paper

Y. Shukeylo

318

Closed reduction and fixation of locked symphysis pubis using tubular external fixator: a case report.  

PubMed

Locked symphysis pubis is a kind of pelvic injury in which one pubic bone is jammed in the back of the other or opposite the obturator foramen following lateral compression forces. In this article, we present a 31-year-old female case of locked symphysis pubis which was treated by closed reduction using tubular external fixator. We believe that tubular external fixators are useful devices to perform closed reduction maneuvers for locked pelvic injuries and also help to reduce the need for open reduction and internal implant usage. PMID:23692202

Hal?c?, Mehmet; Karaman, ?brahim; Kafadar, ?brahim Halil; Argün, Ali Saltuk

2013-01-01

319

Four-Screw Plate Fixation vs Conventional Fixation for Diaphyseal Fractures of the Forearm  

PubMed Central

Background: Standard treatment of diaphyseal fractures of the forearm is open reduction and fixation using dynamic compression plates (DCP) and screws. This technique uses screw placement in all 6 or more of the plate holes except the hole over the fracture line. We hypothesized that DCP with selective 4-screw bicortical placement can provide adequate fixation for these fractures. Objectives: The aim of this study was to evaluate the results of conventional 6 or more screw fixation versus 4 screw fixation for adults with diaphyseal fractures of the forearm. Patients and Methods: In this prospective study, 128 fractures of the ulna, radius or both bones of the forearm in 87 patients were treated in either one of these two groups: Open reduction and internal fixation (ORIF) with conventional DCP and screws or ORIF using DCP and selective 4- screw placement. Fractures were transverse or oblique in pattern without gross comminution. In a total of 41 patients with fractures, 28 single ulnar and 18 single radius fractures were included. Follow-up visits were done at 3-6 and 12-16 weeks and at 6 months. Outcome with respect to union an nonunion rates, union time, infection, and device failure was noted. Results: No change in alignment was noted in any patient. Union time in conventional and selective bicortical 4-screw fixation was 74.8 days and 73.6 days respectively which showed no significant difference (P = 0.064). Union rate and infection was 92.1% and 3.2% in conventional and 95.3% and 0% in the selective group respectively. Non-union was observed in 5 and 3 cases of fractures in conventional and the selective group respectively. Conclusions: For treatment of the transverse or oblique diaphyseal fractures of the forearm, fixation by a same length 3.5 mm DCP with selective 4-screw cortical fixation (2 screws on each side of the fracture site) had similar results in comparison with conventional 6 or more DCP screws. Because of lesser impact on host bone and smaller incision, the selective 4-screw insertion can be an alternative technique for treatment of these fractures. PMID:24829892

Mehdi Nasab, Seyed Abdolhossein; Sarrafan, Nasser; Sabahi, Saeed

2012-01-01

320

Autotrophy of green non-sulphur bacteria in hot spring microbial mats: biological explanations for isotopically heavy organic carbon in the geological record  

NASA Technical Reports Server (NTRS)

Inferences about the evidence of life recorded in organic compounds within the Earth's ancient rocks have depended on 13C contents low enough to be characteristic of biological debris produced by the well-known CO2 fixation pathway, the Calvin cycle. 'Atypically' high values have been attributed to isotopic alteration of sedimentary organic carbon by thermal metamorphism. We examined the possibility that organic carbon characterized by a relatively high 13C content could have arisen biologically from recently discovered autotrophic pathways. We focused on the green non-sulphur bacterium Chloroflexus aurantiacus that uses the 3-hydroxypropionate pathway for inorganic carbon fixation and is geologically significant as it forms modern mat communities analogous to stromatolites. Organic matter in mats constructed by Chloroflexus spp. alone had relatively high 13C contents (-14.9%) and lipids diagnostic of Chloroflexus that were also isotopically heavy (-8.9% to -18.5%). Organic matter in mats constructed by Chloroflexus in conjunction with cyanobacteria had a more typical Calvin cycle signature (-23.5%). However, lipids diagnostic of Chloroflexus were isotopically enriched (-15.1% to -24.1%) relative to lipids typical of cyanobacteria (-33.9% to -36.3%). This suggests that, in mats formed by both cyanobacteria and Chloroflexus, autotrophy must have a greater effect on Chloroflexus carbon metabolism than the photoheterotrophic consumption of cyanobacterial photosynthate. Chloroflexus cell components were also selectively preserved. Hence, Chloroflexus autotrophy and selective preservation of its products constitute one purely biological mechanism by which isotopically heavy organic carbon could have been introduced into important Precambrian geological features.

van der Meer, M. T.; Schouten, S.; de Leeuw, J. W.; Ward, D. M.

2000-01-01

321

External fixation for open fractures of the upper extremity.  

PubMed

Recent advances in external fixation hardware, frame application, and pin-site care have resulted in the evolution of external fixation as a safe and versatile technique. It provides skeletal stability, access to the site of injury, and allows early mobilization. It avoids the disadvantages of additional soft-tissue stripping and the foreign body introduction associated with internal fixation of open fractures. The utility of external fixation principles in open hand and wrist fractures is well established. Indications for external fixation in open fractures of the forearm, elbow, and arm are more restricted. External fixation in these locations should probably be limited to situations of marked fracture comminution, bone loss, or extensive soft-tissue damage. PMID:8300731

Putnam, M D; Walsh, T M

1993-11-01

322

Photosynthetic carbon metabolism in Panicum milioides, a C3-C4 intermediate species: evidence for a limited C4 dicarboxylic acid pathway of photosynthesis.  

PubMed

Panicum milioides, a naturally occurring species with C4-like Kranz leaf anatomy, is intermediate between C3 and C4 plants with respect to photo-respiration and the associated oxygen inhibition of photosynthesis. This paper presents direct evidence for a limited degree of C4 photosynthesis in this C3-C4 intermediate species based on: (a) the appearance of 24% of the total 14C fixed following 4 s photosynthesis in 14CO2-air by excised leaves in malate and aspartate and the complete transfer of label from the C4 acids to Calvin cycle intermediates within a 15 s chase in 12CO2-air; (b) pyruvate- or alanine-enhanced light-dependent CO2 fixation and pyruvate stimulation ote- or alanine-enhanced light-dependent CO2 fixation and pyruvate stimulation of oxaloacetate- or 3-phosphoglycerate-dependent O2 evolution by illuminated mesophyll protoplasts, but not bundle sheath strands; and (c) NAD-malic enzyme-dependent decarboxylation of C4 acids at the C-4 carboxyl position, C4 acid-dependent O2 evolution, and 14CO2 donation from (4-14C)C4 acids to Calvin cycle intermediates during photosynthesis by bundle sheath strands, but not mesophyll protoplasts. However, P. milloides differs from C4 plants in that the activity of the C4 cycle enzymes is only 15 to 30% of a C4 Panicum species and the Calvin cycle and phosphoenolpyruvate carboxylase are present in both cell types. From these and related studies (Rathnam, C.K.M. and Chollet, R. (1979) Arch. Biochem. Biophys. 193, 346-354; (1978) Biochem. Biophys. Res. Commun. 85, 801-808) we conclude that reduced photorespiration in P. milioides is due to a limited degree of NAD-malic enzyme-type C4 photosynthesis permitting an increase in pCO2 at the site of bundle sheath, but not mesophyll, ribulose-bisphosphate carboxylase-oxygenase. PMID:508736

Rathnam, C K; Chollet, R

1979-12-01

323

Processing and evaluation of long fiber thermoplastic composite plates for internal fixation  

NASA Astrophysics Data System (ADS)

The metallic plates used in internal fracture fixation may have up to ten times the elastic modulus of normal bone tissue, causing stress shielding-induced osteopenia in healed bone that can lead to re-fracture after plate removal and prolonged and painful recovery. Thermoplastic polymer matrix composites reinforced with long carbon fiber are promising alternative materials for internal fixation plates because they may be produced with relative ease and be tailored to have specific mechanical properties, alleviating the stress shielding problem. Long carbon fiber-reinforced polyetheretherketone (LCF PEEK) plates were produced using the extrusion / compression molding process. Static flexural testing determined that LCF PEEK plates with rectangular cross-section had an average flexural modulus of 12 GPa, or 23% of the flexural modulus of a stainless steel plate. The LCF PEEK plates also experienced negligible (14.7%, 14.5%, and 16.7%) reductions in modulus after fatigue testing at applied moments of 2.5, 3.0, and 3.5 N•m, respectively, over 106 load cycles. Aging the plates in 0.9% NaCl solution for four and eight weeks caused 0.34% and 0.28% increases in plate mass, respectively. No significant decrease of flexural properties due to aging was detected. Differential scanning calorimetry (DSC) revealed the PEEK matrix of the plates to be 24.5% crystalline, which is lower than typical PEEK crystallinity values of 30-35%. Scanning electron microscopy (SEM) revealed three times as many fiber pullout areas in LCF PEEK fracture surfaces as in fracture surfaces of long carbon fiber-reinforced polyphenylenesulfide (LCF PPS), another plate material tested. DSC and SEM data suggest that improvements in processing conditions and fiber/matrix bonding, along with higher carbon fiber fractions, would enhance LCF PEEK plate performance. LCF PEEK remains a promising alternative to stainless steel for internal fixation plates.

Warren, Paul B.

324

Arthroscopic Bony Bankart Fixation Using a Modified Sugaya Technique  

PubMed Central

Arthroscopic fixation of bony Bankart lesions in the setting of anterior shoulder instability has had successful long-term results. Key factors such as patient positioning, portal placement, visualization, mobilization of bony/soft tissues, and anatomic reduction and fixation are crucial to yield such results. We present a modified Sugaya technique that is reproducible and based on such key principles. This technique facilitates ease of anchor and suture placement to allow for anatomic reduction and fixation. PMID:24265994

Gupta, Anil K.; McCormick, Frank M.; Abrams, Geoffrey D.; Harris, Joshua D.; Bach, Bernard R.; Romeo, Anthony A.; Verma, Nikhil N.

2013-01-01

325

Monitoring In Vivo Load Transmission Through an External Fixator  

Microsoft Academic Search

This work presents a portable non-invasive external fixator to assess and monitor fracture healing in real time. To evaluate\\u000a the potential of this fixator, a transverse osteotomy was performed in the tibia of six adult sheep (mean age 3 ± 0.5 years\\u000a and weight 63 ± 5 kg). The fractures were stabilized by a specially designed unilateral external fixator, which was instrumented

J. Grasa; M. J. Gómez-Benito; L. A. González-Torres; D. Asiaín; F. Quero; J. M. García-Aznar

2010-01-01

326

Microwave processing and ethanol-based fixation in forensic pathology.  

PubMed

An ethanol-based fixative (FineFIX) has been used, together with rapid microwave-stimulated processing, in postmortem material, resulting in a rapid fixation and processing of the tissues with morphology, histochemical stains, and immunocytochemistry comparable to formalin-fixed material. Furthermore, this alternative fixation gives better DNA recovery in higher amounts if compared with DNA extracted from formalin-fixed tissue, particularly advantageous in forensic pathology. PMID:16738442

Iesurum, Antonio; Balbi, Tiziana; Vasapollo, Domenico; Cicognani, Alberto; Ghimenton, Claudio

2006-06-01

327

Assessment of biological nitrogen fixation in grassland and associated sites  

Microsoft Academic Search

Summary  The extent of nitrogen fixation in native grassland on clay soil was measured using the C2H2 reduction assay. Undisturbed soil cores incubated in microcanopies in the field indicated fixation rates of 2 kg N\\/ha per\\u000a season. Less nitrogen fixation activity was found in associated cultivated soils. Other sites on different soil associations\\u000a were found capable of fixing 1 kgN\\/ha or

K. Vlassak; E. A. Paul; R. E. Harris

1973-01-01

328

Planktonic nitrogen fixation in Lake Malawi\\/Nyasa  

Microsoft Academic Search

Nitrogen (N2) fixation has been identified as possibly an important source of “new” nitrogen (N) to the epilimnion of Lake Malawi but\\u000a studies in 1999–2000 and 2002 (September–December) estimated that the contribution of N2-fixation by heterocystous Anabaena filaments to the N budget of the lake’s epilimnion is only 3–4% of total N input. N2-fixation rates in Lake Malawi, as estimated

Mangaliso J. Gondwe; Stephanie J. Guildford; Robert E. Hecky

2008-01-01

329

Nitrogen fixation in subarctic streams influenced by beaver (Castor canadensis)  

Microsoft Academic Search

Nitrogen fixation was measured in four subarctic streams substantially modified by beaver (Castor canadensis) in Quebec. Acetylene-ethylene (C2H2 ? C2H4) reduction techniques were used during the 1982 ice-free period (May–October) to estimate nitrogen fixation by microorganisms colonizing wood and sediment. Mean seasonal fixation rates were low and patchy, ranging from zero to 2.3 × 10-3 µmol C2H4 · cm-2 ·

Margaret M. Francis; Robert J. Naimant; Jerry M. Melillo

1985-01-01

330

Principles of tibial fracture management with circular external fixation.  

PubMed

There is a growing mass of literature to suggest that circular external fixation for high-energy tibial fractures has advantages over traditional internal fixation, with potential improved rates of union, decreased incidence of posttraumatic osteomyelitis, and decreased soft tissue problems. To further advance our understanding of the role of circular external fixation in the management of these tibial fractures, randomized controlled trials should be implemented. In addition to complication rates and radiographic outcomes, validated functional outcome tools and cost analysis of this method should be compared with open reduction with internal fixation. PMID:24684913

Lowenberg, David W; Githens, Michael; Boone, Christopher

2014-04-01

331

Decreased Fronto-Temporal Interaction during Fixation after Memory Retrieval  

PubMed Central

Previous studies have revealed top-down control during memory retrieval from the prefrontal cortex to the temporal cortex. In the present functional MRI study, we investigated whether the fronto-temporal functional interaction occurs even during fixation periods after memory retrieval trials. During recency judgments, subjects judged the temporal order of two items in a study list. The task used in the present study consisted of memory trials of recency judgments and non-memory trials of counting dots, and post-trial fixation periods. By comparing the brain activity during the fixation periods after the memory trials with that during the fixation periods after the non-memory trials, we detected heightened brain activity in the lateral prefrontal cortex, the lateral temporal cortex and the hippocampus. Functional interactions during the fixation periods after the memory vs. non-memory trials as examined using a psychophysiological interaction revealed a decreased interaction from the lateral prefrontal cortex to the lateral temporal cortex, but not to the hippocampus. The functional interaction between the same frontal and temporal regions was also present during the memory trials. A trial-based functional connectivity analysis further revealed that the fronto-temporal interaction was positive and decreased during the fixation periods after the memory trials, relative to the fixation periods after the non-memory trials. These results suggest that the fronto-temporal interaction existed during the post-trial fixation periods, which had been present during the memory trials and temporally extended into the fixation periods. PMID:25340398

Sasaki, Hiroki; Mori, Harushi; Kunimatsu, Akira; Ohtomo, Kuni; Jimura, Koji; Konishi, Seiki

2014-01-01

332

Bioabsorbable Tricalcium Phosphate Bone Cement Strengthens Fixation of Suture Anchors  

Microsoft Academic Search

Background  Failure of suture anchor fixation in rotator cuff repair can occur at different interfaces. Prior studies show fixation at\\u000a the bone-anchor interface can be augmented using polymethylmethacrylate (PMMA) cement, and screw fixation into bone can be\\u000a strengthened using bioabsorbable tricalcium phosphate cement.\\u000a \\u000a \\u000a \\u000a \\u000a Questions\\/purposes  We wished to determine whether augmentation of suture anchor fixation using bioabsorbable tricalcium phosphate cement would\\u000a increase pullout

Rayshad Oshtory; Derek P. Lindsey; Nicholas J. Giori; Faisal M. Mirza

2010-01-01

333

TAM: Explaining off-object fixations and central fixation tendencies as effects of population averaging during search  

PubMed Central

Understanding how patterns are selected for both recognition and action, in the form of an eye movement, is essential to understanding the mechanisms of visual search. It is argued that selecting a pattern for fixation is time consuming—requiring the pruning of a population of possible saccade vectors to isolate the specific movement to the potential target. To support this position, two experiments are reported showing evidence for off-object fixations, where fixations land between objects rather than directly on objects, and central fixations, where initial saccades land near the center of scenes. Both behaviors were modeled successfully using TAM (Target Acquisition Model; Zelinsky, 2008). TAM interprets these behaviors as expressions of population averaging occurring at different times during saccade target selection. A large population early during search results in the averaging of the entire scene and a central fixation; a smaller population later during search results in averaging between groups of objects and off-object fixations. PMID:22711998

Zelinsky, Gregory J.

2012-01-01

334

Will rising CO2 influence how nutrients interact to control tropical N2-fixation?  

NASA Astrophysics Data System (ADS)

The response of terrestrial tropical carbon sinks to increasing CO2 is a pressing question in biogeochemistry. Limitation of nutrients such as N may constrain these sinks. Biological N2-fixation, an important biogeochemical process that provides new nitrogen to ecosystems, potentially plays an important role in supporting tropical carbon sinks. Despite the importance of N2-fixation to the linked nitrogen and carbon cycles, we know little about how nutrient limitation of the process of biological N2-fixation, itself, will affect tropical fixation and N2-fixing plants. While rising CO2 levels may increase tree growth and N2-fixation when nutrients are abundant, at the same time, the increased growth may force N2-fixing plants into phosphorus (P) and molybdenum (Mo) limitation, both elements that are scarce in tropical forests and critical to N2-fixers. This study improves our understanding on what controls fixation through a series of greenhouse and in situ field experiments. First, we used a greenhouse experiment where we manipulated CO2 levels combined with a field study in forest gaps. In the greenhouse study we grew a N2-fixing seedling and a non-fixing seedling at pre-industrial (280 ppm), current (400 ppm), and double (800 ppm) CO2 concentrations with and without P, Mo, or both. In the year-long field study, we applied the same nutrient treatments to seedlings planting in natural light gaps and ambient CO2. To supplement our year-long seedling experiment, we also examined 11 years of growth data from a long-term N x P x K factorial fertilization experiment also on the Gigante Peninsula. In the greenhouse study, we found nutrient limitation was minimal at pre-industrial CO2 levels, but that limitation appeared with increasing CO2. Phosphorus limitation of tree growth and N2-fixation significantly increased with higher CO2. The additions of Mo and P together allowed for even greater growth and fixation, suggesting Mo-P co-limitation at elevated CO2. Compared to the control, the phosphorus addition treatment grew ~50% faster and fixed 10-15x more N2 at the present day and doubled CO2 levels. When plants received both P and Mo, they grew 66- 200% more, and fixed up to 25 times more N2. In the year-long field study, we did not find significant differences between nutrient treatments, but there was a correlation with canopy openness. In the long-term fertilization study, we found N2-fixing trees to be marginally limited by P. These experiments illustrate both hypothetical limitations at future higher global CO2 levels as well as the difficulty in scaling up to natural forests where herbivory and competition for light and nutrients confound clear treatment effects.

Trierweiler, A.; Winter, K.; Wright, S. J.; Wurzburger, N.; Hedin, L.

2013-12-01

335

Pathway Analysis  

Cancer.gov

Surprising failures of new cancer treatments have made it clear that we do not know enough about how molecules in RAS signaling pathways interact with each other. For example, in the context of mutant KRAS, inhibitors of BRAF increase signaling through ERK. RAS Program scientists at the FNLCR are expanding our knowledge of signaling through RAS pathways using in silico and wet lab methods.

336

Carbon sequestration in Synechococcus Sp.: from molecular machines to hierarchical modeling.  

SciTech Connect

The U.S. Department of Energy recently announced the first five grants for the Genomes to Life (GTL) Program. The goal of this program is to ''achieve the most far-reaching of all biological goals: a fundamental, comprehensive, and systematic understanding of life.'' While more information about the program can be found at the GTL website (www.doegenomestolife.org), this paper provides an overview of one of the five GTL projects funded, ''Carbon Sequestration in Synechococcus Sp.: From Molecular Machines to Hierarchical Modeling.'' This project is a combined experimental and computational effort emphasizing developing, prototyping, and applying new computational tools and methods to elucidate the biochemical mechanisms of the carbon sequestration of Synechococcus Sp., an abundant marine cyanobacteria known to play an important role in the global carbon cycle. Understanding, predicting, and perhaps manipulating carbon fixation in the oceans has long been a major focus of biological oceanography and has more recently been of interest to a broader audience of scientists and policy makers. It is clear that the oceanic sinks and sources of CO(2) are important terms in the global environmental response to anthropogenic atmospheric inputs of CO(2) and that oceanic microorganisms play a key role in this response. However, the relationship between this global phenomenon and the biochemical mechanisms of carbon fixation in these microorganisms is poorly understood. The project includes five subprojects: an experimental investigation, three computational biology efforts, and a fifth which deals with addressing computational infrastructure challenges of relevance to this project and the Genomes to Life program as a whole. Our experimental effort is designed to provide biology and data to drive the computational efforts and includes significant investment in developing new experimental methods for uncovering protein partners, characterizing protein complexes, identifying new binding domains. We will also develop and apply new data measurement and statistical methods for analyzing microarray experiments. Our computational efforts include coupling molecular simulation methods with knowledge discovery from diverse biological data sets for high-throughput discovery and characterization of protein-protein complexes and developing a set of novel capabilities for inference of regulatory pathways in microbial genomes across multiple sources of information through the integration of computational and experimental technologies. These capabilities will be applied to Synechococcus regulatory pathways to characterize their interaction map and identify component proteins in these pathways. We will also investigate methods for combining experimental and computational results with visualization and natural language tools to accelerate discovery of regulatory pathways. Furthermore, given that the ultimate goal of this effort is to develop a systems-level of understanding of how the Synechococcus genome affects carbon fixation at the global scale, we will develop and apply a set of tools for capturing the carbon fixation behavior of complex of Synechococcus at different levels of resolution. Finally, because the explosion of data being produced by high-throughput experiments requires data analysis and models which are more computationally complex, more heterogeneous, and require coupling to ever increasing amounts of experimentally obtained data in varying formats, we have also established a companion computational infrastructure to support this effort as well as the Genomes to Life program as a whole.

Martino, Anthony A. (Sandia National Laboratories, Livermore, CA); Heffelfinger, Grant S.; Frink, Laura J. Douglas; Davidson, George S.; Haaland, David Michael; Timlin, Jerilyn Ann; Plimpton, Steven James; Lane, Todd W. (Sandia National Laboratories, Livermore, CA); Thomas, Edward Victor; Rintoul, Mark Daniel; Roe, Diana C. (Sandia National Laboratories, Livermore, CA); Faulon, Jean-Loup Michel; Hart, William Eugene

2003-02-01

337

Randomized Prospective Study of Totally Extraperitoneal Inguinal Hernia Repair: Fixation Versus No Fixation of Mesh  

PubMed Central

Background: Fixation of the mesh during laparoscopic totally extraperitoneal (TEP) inguinal hernia repair is thought to be necessary to prevent recurrence. However, mesh fixation may increase postoperative pain and lead to an increased risk of complications. We questioned whether elimination of fixation of the mesh during TEP inguinal hernia repair leads to decreased postoperative pain or complications, or both, without an increased rate of recurrence. Methods: A randomized prospective single-blinded study was carried out in 40 patients who underwent laparoscopic TEP inguinal hernia repair with (Group A=20) or without (Group B=20) fixation of the mesh. Results: Patients in whom the mesh was not fixed had shorter hospital length of stay (8.3 vs 16.0 hours, P=0.01), were less likely to be admitted to the hospital (P=0.001), used less postoperative narcotic analgesia in the PACU (P=0.01), and were less likely to develop urinary retention (P=0.04). No significant differences occurred in the level of pain, time to return to normal activity, or the difficulty of the operation between the 2 groups. No hernia recurrences were observed in either group (follow-up range, 6 to 30 months, median=19). Conclusions: Elimination of tack fixation of mesh during laparoscopic TEP inguinal hernia repair significantly reduces the use of postoperative narcotic analgesia, hospital length of stay, and the development of postoperative urinary retention but does not lead to a significant reduction in postoperative pain. Eliminating tacks does not lead to an increased rate of recurrence. PMID:17575757

Koch, Cody A.; Greenlee, Susan M.; Larson, Dirk R.; Harrington, Jeffrey R.

2006-01-01

338

A steady-state tracing kinetic analysis of oxidative coupling of methane over Li[sup +]-doped TiO[sub 2]: Mechanistic aspects of the carbon and oxygen reaction pathways to form CO[sub 2  

SciTech Connect

A steady-state tracing kinetic study of the oxidative coupling of methane reaction at 800[degrees]C over Li[sup +]-doped TiO[sub 2] catalyst was performed. In particular, the carbon and oxygen reaction pathways which lead to the formation of CO[sub 2] have been probed using [sup 13]CH[sub 4] and [sup 18]O[sub 2] isotope gases under reaction conditions. The results obtained indicate that there is practically no reversibly adsorbed CH[sub 4] on the catalyst surface, while there is a very small reservoir of carbon-containing intermediate species which eventually lead to CO[sub 2](0.1 [mu]mol/g). A large reservoir of oxygen species, participating in the formation of CO[sub 2] (at least 12.0 [mu]mol/g), was detected, while subsurface lattice oxygen species also participate in the oxygen reaction pathway to form CO[sub 2]. In addition, large amounts of inactive carbonaceous species (17.0 [mu]mol/g) accumulate on the catalyst surface after 1 h on stream. These species do not participate in the reaction route to form CO[sub 2] (spectator species). 23 refs., 7 figs.

Efstathiou, A.M.; Verykios, X.E. (Univ. of Patras (Greece)); Lacombe, S.; Mirodatos, C. (Institut de Recherches sur la Catalyse, Villeurbanne (France))

1994-08-01

339

Dynesys fixation for lumbar spine degeneration.  

PubMed

The dynamic fixation system Dynesys is utilized in the last 10 years for treatment of degenerative segmental disease of the lumbar spine. Dynesys is a semi-rigid fixation system that allows minimal lengthening and shortening between two segmental pedicle screws as opposed to a rigid metal bar. Thus, the system is regarded to maintain stability and near physiological motion patterns of the lumbar spine. The theoretical advantage of this system is to stabilize the treated segment and to prevent adjacent segment degeneration. The goal of this prospective trial was to evaluate clinical, radiographic, and computed tomography (CT) scan outcomes in 54 consecutive cases. Postoperative complications are discussed in detail. Forty cases were recruited with a mean follow-up of 16 months (range, 12 to 37). Postoperative pain scores (Hannover Activities of Daily Living Questionnaire and VAS for back and leg pain) improved in 29 cases (73%) and was best when dynamic fusion was combined with nerve root decompression. Outcome data were not superior to conventional rigid fusion systems and had a considerable number of complications requiring revision surgery in 27.5% of cases. PMID:17906883

Bothmann, Matthias; Kast, Erich; Boldt, Gerald Jens; Oberle, Joachim

2008-04-01

340

Tibiocalcaneal arthrodesis using a simple external fixator.  

PubMed

Tibiocalcaneal arthrodesis has been a salvage option for conditions with extensive loss of the talar body. In conditions that preclude the use of internal fixation, external compression arthrodesis has been the preferred technique to achieve fusion about the hindfoot. Since Sir John Charnley elucidated the technique of compression arthrodesis using compression clamps, various modifications and techniques of external compression arthrodesis have been described. Various clinical and biomechanical studies have established the superiority of triangular transfixation in external compression arthrodesis. We have described a simple technique of compression arthrodesis after the principle of triangular transfixation using easily available hardware from Ilizarov instrumentation. This technique is relatively inexpensive in terms of the cost of the materials, uses a modular construct, and allows multiplanar correction of the hindfoot. It can be used intraoperatively to distract the hindfoot joints, especially in the presence of fibrosis and poor skin conditions. We believe this device can be a reasonable alternative to the conventional external fixation techniques for tibiocalcaneal arthrodesis. PMID:24717519

Ismavel, Ravichand; Azad, Sait S; Viju, Daniel V; Daniel, Alfred J

2014-01-01

341

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.  

Code of Federal Regulations, 2011 CFR

...2011-04-01 false Smooth or threaded metallic bone fixation fastener. 888.3040 Section...888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener is a device...

2011-04-01

342

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.  

...2014-04-01 false Smooth or threaded metallic bone fixation fastener. 888.3040 Section...888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener is a device...

2014-04-01

343

21 CFR 888.3030 - Single/multiple component metallic bone fixation appliances and accessories.  

... Single/multiple component metallic bone fixation appliances and accessories... Single/multiple component metallic bone fixation appliances and accessories... Single/multiple component metallic bone fixation appliances and...

2014-04-01

344

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.  

Code of Federal Regulations, 2013 CFR

...2013-04-01 false Smooth or threaded metallic bone fixation fastener. 888.3040 Section...888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener is a device...

2013-04-01

345

21 CFR 888.3030 - Single/multiple component metallic bone fixation appliances and accessories.  

Code of Federal Regulations, 2013 CFR

... Single/multiple component metallic bone fixation appliances and accessories... Single/multiple component metallic bone fixation appliances and accessories... Single/multiple component metallic bone fixation appliances and...

2013-04-01

346

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.  

Code of Federal Regulations, 2012 CFR

...2012-04-01 false Smooth or threaded metallic bone fixation fastener. 888.3040 Section...888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener is a device...

2012-04-01

347

21 CFR 888.3030 - Single/multiple component metallic bone fixation appliances and accessories.  

Code of Federal Regulations, 2011 CFR

... Single/multiple component metallic bone fixation appliances and accessories... Single/multiple component metallic bone fixation appliances and accessories... Single/multiple component metallic bone fixation appliances and...

2011-04-01

348

21 CFR 888.3030 - Single/multiple component metallic bone fixation appliances and accessories.  

Code of Federal Regulations, 2012 CFR

... Single/multiple component metallic bone fixation appliances and accessories... Single/multiple component metallic bone fixation appliances and accessories... Single/multiple component metallic bone fixation appliances and...

2012-04-01

349

A Novel Role of Exogenous Carbon Monoxide on Protecting Cardiac Function and Improving Survival against Sepsis via Mitochondrial Energetic Metabolism Pathway  

PubMed Central

Septic cardiac dysfunction is the main cause of death in septic patients. Here we investigate whether exogenous carbon monoxide can protect cardiac function and improve survival against sepsis by interfering with mitochondrial energetic metabolism. Male C57BL/6 mice were subjected to cecal ligation and puncture to induce sepsis. Exogenous carbon monoxide delivered from Tricarbonyldichlororuthenium (II) dimer (carbon monoxide releasing molecule II, 8mg/kg) was used intravenously as intervention. We found that carbon monoxide significantly improved cardiac function (LVEF 80.26 ± 2.37% vs. 71.21 ± 1.37%, P < 0.001; LVFS 43.52 ± 1.92% vs. 34.93 ± 1.28%, P < 0.001) and increased survival rate of septic mice (63% vs. 25%, P < 0.01). This phenomenon might be owing to the beneficial effect of carbon monoxide on abolishing the elevation of cardiac enzyme activity, cytokines levels and apoptosis rate, then attenuating cardiac injury in septic mice. Meanwhile, carbon monoxide significantly reversed the loss of mitochondrial number, effectively inhibited cardiac mitochondrial damage in septic mice by modulating glucose uptake, adenosine triphosphate and lactate content. Furthermore upregulation of peroxisome proliferator-activated receptor-? coactivator-1?, nuclear respiratory factor 1 and mitochondrial transcription factor A genes in cardiac tissue were revealed in septic mice treated with carbon monoxide. Taken together, the results indicate that exogenous carbon monoxide effectively modulated mitochondrial energetic metabolisms by interfering with expression of peroxisome proliferator-activated receptor-? coactivator-1?, nuclear respiratory factor 1 and mitochondrial transcription factor A genes, consequently exerted an important improvement in sepsis-induced cardiac dysfunction. PMID:25076854

Wang, Xu; Qin, Weiting; Qiu, Xuefeng; Cao, Jie; Liu, Dadong; Sun, Bingwei

2014-01-01

350

Systemic nickel allergy after internal fixation of a bunionectomy.  

PubMed

Allergic reactions to implanted metals have been estimated to occur in 1% to 5% of orthopedic cases. Stainless steel screws, which contain 14% nickel, are commonly used for internal fixation in an array of podiatric procedures. We present a rare case of a systemic allergic reaction to nickel secondary to stainless steel screw fixation in a bunionectomy procedure. PMID:24774988

Zhubrak, Michelle; Bar-David, Tzvi

2014-01-01

351

Compression plating of tibial fractures following primary external fixation  

Microsoft Academic Search

During the time period from May 1990 to December 1992, a total of 75 tibia fractures were treated in the Department of Traumatology at the University of Bonn. Thirtyeight patients with 40 tibial fractures were managed according to a regimen including primary stabilization, usually using external fixation, soft tissue reconstruction and delayed open reduction and internal fixation using an AO

C. H. Siebert; K.-P. Lehrbaß-Sökeland; F. Rinke; M. Hansis

1997-01-01

352

Treatment of Open Tibial Fractures: Converting or Continuing External Fixation?  

Microsoft Academic Search

Background: The treatment of open tibial fractures is still an orthopaedic challenge and full of complications . In many cases the use of external fixator that has been known as a non- union machine is obligatory with a high incidence of pin track infection and other complications. The aim of this study was to compare the use of external fixation

S. Tabatabai; E. Hosseini

2008-01-01

353

CRISP: A Computational Model of Fixation Durations in Scene Viewing  

ERIC Educational Resources Information Center

Eye-movement control during scene viewing can be represented as a series of individual decisions about where and when to move the eyes. While substantial behavioral and computational research has been devoted to investigating the placement of fixations in scenes, relatively little is known about the mechanisms that control fixation durations.…

Nuthmann, Antje; Smith, Tim J.; Engbert, Ralf; Henderson, John M.

2010-01-01

354

Overcoming Organizational Fixation: Creating and Sustaining an Innovation Culture  

ERIC Educational Resources Information Center

Fixation on established paradigms and practices can severely limit the capability of organizations to change, thereby jeopardizing the ability of organizations to keep up with changes in their environment and new technological developments. Overcoming organizational fixation is therefore a requirement for any organization that strives to achieve…

Stempfle, Joachim

2011-01-01

355

21 CFR 888.3020 - Intramedullary fixation rod.  

...intramedullary fixation rod is a device intended to be implanted that consists of a rod made of alloys such as cobalt-chromium-molybdenum and stainless steel. It is inserted into the medullary (bone marrow) canal of long bones for the fixation of...

2014-04-01

356

21 CFR 888.3020 - Intramedullary fixation rod.  

Code of Federal Regulations, 2010 CFR

...intramedullary fixation rod is a device intended to be implanted that consists of a rod made of alloys such as cobalt-chromium-molybdenum and stainless steel. It is inserted into the medullary (bone marrow) canal of long bones for the fixation of...

2010-04-01

357

Soil fixative study progress report aerial application test:  

SciTech Connect

A soil fixative has been developed (a simple wheat flour paste mixture) and tested in the laboratory that appears suitable for the temporary fixation of radioactive dusts in case of an accidental spill. A limited field test was made and the feasibility of aircraft delivery examined. A videotape was made of the operations. 3 figs.

Teter, A.C.

1988-03-01

358

Glycosaminoglycan-targeted fixation for improved bioprosthetic heart valve stabilization  

Microsoft Academic Search

Numerous crosslinking chemistries and methodologies have been investigated as alternative fixatives to glutaraldehyde (GLUT) for the stabilization of bioprosthetic heart valves (BHVs). Particular attention has been paid to valve leaflet collagen and elastin stability following fixation. However, the stability of glycosaminoglycans (GAGs), the primary component of the spongiosa layer of the BHV, has been largely overlooked despite recent evidence provided

Jeremy J. Mercuri; Joshua J. Lovekamp; Dan T. Simionescu; Narendra R. Vyavahare

2007-01-01

359

(iii) External fixation of diaphyseal fractures of the tibia  

Microsoft Academic Search

External fixation of fractures of the tibial shaft is an old and well-established method of treatment, but was not widely used because of the relatively unsophisticated nature of the devices, the problems of pin track infection and the perception that there was a high incidence of non-union. The development of modern fixation devices and improved techniques of pin site care

R. G Checketts; C. F Young

2003-01-01

360

External fixation in fractured patients aged more than 60 years  

Microsoft Academic Search

Fractures account for significant morbidity and mortality among the elderly. Commonly, surgical procedures like internal fixation are not exempt of complications (infection, soft-tissue problems). In this study, we examined the use of external fixation (EF) in 28 patients aged more than 60 years with a total of 30 fractures. There were 16 men and 12 women with a mean age

L. Galois; L. Darbelley; R. Traversari; D. Girard; D. Mainard; J. P. Delagoutte

2003-01-01

361

Sacroiliac screw fixation: A mini review of surgical technique  

PubMed Central

The sacral percutaneous fixation has many advantages but can be associated with a significant exposure to X-ray radiation. Currently, sacroiliac screw fixation represents the only minimally invasive technique to stabilize the posterior pelvic ring. It is a technique that should be used by experienced surgeons. We present a practical review of important aspects of this technique. PMID:25336831

Alvis-Miranda, Hernando Raphael; Farid-Escorcia, Hector; Alcala-Cerra, Gabriel; Castellar-Leones, Sandra Milena; Moscote-Salazar, Luis Rafael

2014-01-01

362

Testicular fixation in adult retractile testis: technical notes.  

PubMed

A variety of techniques for scrotal orchiopexy have been described in the literature, including those without suture fixation, such as the scrotal pouch. We perform a simple modified technique for bilateral testicular fixation in patients with bilateral and/or unilateral adult retractile testis and with symptoms characterised by chronic orchialgia due to testicular hypermobility or repeated funicular subtorsion. PMID:12633055

Forte, Flavio; Bitelli, Marco; Sorrenti, Salvatore; Spinelli, Giovanni Luigi; Foti, Nicola; Ciotola, Oscar; Pietrantuono, Francesco; Catania, Antonio; Micali, Francesco

2003-01-01

363

Biometric recognition via fixation density maps Ioannis Rigas*a  

E-print Network

biometrics, behavioral characteristics, fixation density maps 1. INTRODUCTION The research of eye movements behavioral approaches in biometrics, as for example the fundamental resistance in replicationBiometric recognition via fixation density maps Ioannis Rigas*a , Oleg V. Komogortseva a Texas

Oleg, Komogortsev - Department of Computer Science, Texas State University

364

A new adhesive technique for internal fixation in midfacial surgery  

Microsoft Academic Search

BACKGROUND: The current surgical therapy of midfacial fractures involves internal fixation in which bone fragments are fixed in their anatomical positions with osteosynthesis plates and corresponding screws until bone healing is complete. This often causes new fractures to fragile bones while drilling pilot holes or trying to insert screws. The adhesive fixation of osteosynthesis plates using PMMA bone cement could

Kira Endres; Rudolf Marx; Joachim Tinschert; Dieter Christian Wirtz; Christian Stoll; Dieter Riediger; Ralf Smeets

2008-01-01

365

FIXATION OF FISH TISSUES. IN: THE LABORATORY FISH.  

EPA Science Inventory

This chapter deals with the fixation of fish tissues and whole fish. Traditionally, fixation has been applied to animal tissues mainly for histological or pathological studies. Development of new molecular and immunologic tools now allows tissue and cellular localization of nucle...

366

Growth condition study of algae function in ecosystem for CO2 bio-fixation.  

PubMed

Algae niche play a crucial role on carbon cycle and have great potential for CO(2) sequestration. This study was to investigate the CO(2) bio-fixation by the high rate pond (HRP) to mimic the algae function of nature. All the reactors can keep CO(2) consumption efficiencies over 100%. The statistical analyses proved HRPs were close to the natural system from all the growth conditions. The HRP could show the "natural optimization as nature" to perform as well as the artificial reactor of continuously stirred tank reactor (CSTR). In the nutrition study, the carbon mass balance indicated CO(2) was the main carbon source. Accordingly, the HRPs can keep a neutral pH range to provide dissolved oxygen (DO), to promote total nitrogen (TN)/total phosphorous (TP) removal efficiencies and to demonstrate self-purification process. Furthermore, the observations of different nitrogen species in the reactors demonstrated that the major nitrogen source was decided by pH. This finding logically explained the complex nitrogen uptake by algae in nature. Consequently, this study took advantage of HRP to explore the processes of efficient CO(2) uptake with the corresponding growth condition in the ecosystem. Those results contributed the further understanding of the role of CO(2) bio-fixation in nature and demonstrated HRP could be a potential ecological engineering alternative. PMID:22196805

Tsai, David Dah-Wei; Ramaraj, Rameshprabu; Chen, Paris Honglay

2012-02-01

367

ICT Pathways  

NSDL National Science Digital Library

This page, from the Mid-Pacific Information and Communications Technology Center, provides a useful diagram for ICT educators that highlights employment pathways for students pursuing this career track. Users may click on the diagram to view a larger version.

2011-07-28

368

A New TechniqueIn Vitro Suture Anchor Fixation Has Superior Yield Strength to Bone Tunnel Fixation for Distal Biceps Tendon Repair  

Microsoft Academic Search

Background:Suture anchor and bone tunnel fixations are used for distal biceps tendon repairs and have not been compared.Hypothesis:Suture anchor fixation is equal or superior to bone tunnel fixation.Study Design:Randomized controlled in vitro study.Methods:A new fixation technique was compared to traditional bone tunnel fixation of distal biceps tendon ruptures between randomly selected sides of nine matched-pair, fresh-frozen elbow specimens from cadaveric

Stephen E. Lemos; Edward Ebramzedeh; Ronald S. Kvitne

2004-01-01

369

Multifunctional MOFs through CO2 fixation: a metamagnetic kagome lattice with uniaxial zero thermal expansion and reversible guest sorption.  

PubMed

The properties of atmospheric CO2 fixation, metamagnetism, reversible guest adsorption and zero thermal expansion have been combined in a single robust MOF, [Cu3(bpac)3(CO3)2](ClO4)2·H2O (·H2O). This compound is a ditopically-bridged copper carbonate kagome lattice where desolvation of the MOF allows subtle tuning of the metamagnetic and uniaxial ZTE behaviour. PMID:25157602

Keene, Tony D; Murphy, Michael J; Price, Jason R; Sciortino, Natasha F; Southon, Peter D; Kepert, Cameron J

2014-10-21

370

Increasing subtropical North Pacific Ocean nitrogen fixation since the Little Ice Age  

NASA Astrophysics Data System (ADS)

The North Pacific subtropical gyre (NPSG) plays a major part in the export of carbon and other nutrients to the deep ocean. Primary production in the NPSG has increased in recent decades despite a reduction in nutrient supply to surface waters. It is thought that this apparent paradox can be explained by a shift in plankton community structure from mostly eukaryotes to mostly nitrogen-fixing prokaryotes. It remains uncertain, however, whether the plankton community domain shift can be linked to cyclical climate variability or a long-term global warming trend. Here we analyse records of bulk and amino-acid-specific 15N/14N isotopic ratios (?15N) preserved in the skeletons of long-lived deep-sea proteinaceous corals collected from the Hawaiian archipelago; these isotopic records serve as a proxy for the source of nitrogen-supported export production through time. We find that the recent increase in nitrogen fixation is the continuation of a much larger, centennial-scale trend. After a millennium of relatively minor fluctuation, ?15N decreases between 1850 and the present. The total shift in ?15N of -2 per mil over this period is comparable to the total change in global mean sedimentary ?15N across the Pleistocene-Holocene transition, but it is happening an order of magnitude faster. We use a steady-state model and find that the isotopic mass balance between nitrate and nitrogen fixation implies a 17 to 27 per cent increase in nitrogen fixation over this time period. A comparison with independent records suggests that the increase in nitrogen fixation might be linked to Northern Hemisphere climate change since the end of the Little Ice Age.

Sherwood, Owen A.; Guilderson, Thomas P.; Batista, Fabian C.; Schiff, John T.; McCarthy, Matthew D.

2014-01-01

371

Increasing subtropical North Pacific Ocean nitrogen fixation since the Little Ice Age.  

PubMed

The North Pacific subtropical gyre (NPSG) plays a major part in the export of carbon and other nutrients to the deep ocean. Primary production in the NPSG has increased in recent decades despite a reduction in nutrient supply to surface waters. It is thought that this apparent paradox can be explained by a shift in plankton community structure from mostly eukaryotes to mostly nitrogen-fixing prokaryotes. It remains uncertain, however, whether the plankton community domain shift can be linked to cyclical climate variability or a long-term global warming trend. Here we analyse records of bulk and amino-acid-specific (15)N/(14)N isotopic ratios (?(15)N) preserved in the skeletons of long-lived deep-sea proteinaceous corals collected from the Hawaiian archipelago; these isotopic records serve as a proxy for the source of nitrogen-supported export production through time. We find that the recent increase in nitrogen fixation is the continuation of a much larger, centennial-scale trend. After a millennium of relatively minor fluctuation, ?(15)N decreases between 1850 and the present. The total shift in ?(15)N of -2 per mil over this period is comparable to the total change in global mean sedimentary ?(15)N across the Pleistocene-Holocene transition, but it is happening an order of magnitude faster. We use a steady-state model and find that the isotopic mass balance between nitrate and nitrogen fixation implies a 17 to 27 per cent increase in nitrogen fixation over this time period. A comparison with independent records suggests that the increase in nitrogen fixation might be linked to Northern Hemisphere climate change since the end of the Little Ice Age. PMID:24336216

Sherwood, Owen A; Guilderson, Thomas P; Batista, Fabian C; Schiff, John T; McCarthy, Matthew D

2014-01-01

372

[War injuries of the extremities. Use of the CMC fixator].  

PubMed

The injuries of the extremities in the military setting, during hostilities, are classified to be the most frequent in general. Among them there are those caused by the missiles from rifles and automatic and semiautomatic weapons and those due to mine and shell fragments. The characteristics of modern array of weapons are missiles of high kinetic energy provoking extensive tissue injuries, often together with fractures of the long bones. When taking care of such fractures, in addition to surgical treatment of the wounds, the administration of medicine and prevention, the immobilization of the fragments is of fundamental significance. All modern armies in the world use external fixators for the immobilization of the fragments, those fixators being the most reliable and the most uncomplicated means of immobilization. The paper presents a new type of the external fixator to be used in war surgery. It is called the CMC fixator (Croatian Medical Corps). The fixator is made according to the original designs in the factory (Instrumentarija) at Zagreb. Following its biomechanic characteristics the fixator is classified into the group of unilateral or joining external fixators. It is designed for fixation of the long bone fractures in the war setting and disaster conditions. It may be used for two purposes: 1. for the transport immobilization to a medical facility where the problem is to be finally solved, 2. as the means of an external immobilization until the final secondary bone-healing. The fixator has only three elements and the universal kee. It is easily applied. The way how to apply this fixator is described in details. The first experiences in the field have given satisfactory results. PMID:1762488

Korzinek, K; Smerdelj, M; Tripkovi?, B

1991-01-01

373

Spatial Patterns of Fixation-Switch Behavior in Strabismic Monkeys  

PubMed Central

Purpose. Patients with strabismus perceptually suppress information from one eye to avoid double vision. Mechanisms of visual suppression likely lead to fixation-switch behavior wherein the subject acquires targets with a specific eye depending on target location in space. The purpose of this study was to investigate spatial patterns of fixation-switch behavior in strabismic monkeys. Methods. Eye movements were acquired in three exotropic and one esotropic monkey in a binocular viewing saccade task. Spatial patterns of fixation were analyzed by calculating incidence of using either eye to fixate targets presented at various gaze locations. Results. Broadly, spatial fixation patterns and fixation-switch behavior followed expectations if a portion of the temporal retina was suppressed in exotropia and a portion of the nasal retina was suppressed in esotropia. Fixation-switch occurred for horizontal target locations that were approximately greater than halfway between the lines of sight of the foveating and strabismic eyes. Surprisingly, the border between right eye and left eye fixation zones was not sharply defined and there was a significant extent (>10°) over which the monkeys could acquire a target with either eye. Conclusions. We propose that spatial fixation patterns in strabismus can be accounted for in a decision framework wherein the oculomotor system has access to retinal error information from each eye and the brain chooses between them to prepare a saccade. For target locations approximately midway between the two foveae, strength of retinal error representations from each eye is almost equal, leading to trial-to-trial variability in choice of fixating eye. PMID:24508786

Agaoglu, Mehmet N.; LeSage, Stephanie K.; Joshi, Anand C.; Das, Vallabh E.

2014-01-01

374

Metabolic Activities in Extracts of Mesophyll and Bundle Sheath Cells of Panicum miliaceum (L.) in Relation to the C(4) Dicarboxylic Acid Pathway of Photosynthesis.  

PubMed

The activities of certain enzymes related to the carbon assimilation pathway in whole leaves, mesophyll cell extracts, and bundle sheath extracts of the C(4) plant Panicum miliaceum have been measured and compared on a chlorophyll basis. Enzymes of the C(4) dicarboxylic acid pathway-phosphoenolpyruvate carboxylase and NADP-malic dehydrogenase-were localized in mesophyll cells. Carbonic anhydrase was also localized in mesophyll cell extracts. Ribose 5-phosphate isomerase, ribulose 5-phosphate kinase, and ribulose diphosphate carboxylase-enzymes of the reductive pentose phosphate pathway-were predominantly localized in bundle sheath extracts. High activities of aspartate and alanine transaminases and glyceraldehyde-3-P dehydrogenase were found about equally distributed between the photosynthetic cell types. P. miliaceum had low malic enzyme activity in both mesophyll and bundle sheath extracts.Isolated bundle sheath cells were capable of converting aspartate to oxalacetate at rates approaching the aspartate transaminase activity of bundle sheath extracts. The bundle sheath cells had a light induced CO(2) fixation of 23 mumoles of CO(2)/mg chl.hr in the absence of exogenous substrates.The photorespiratory enzymes, hydroxypyruvate reductase and glycolic oxidase, were about 3 fold higher in bundle sheath extracts than in mesophyll extracts when compared on a chlorophyll basis. PMID:16658252

Edwards, G E; Gutierrez, M

1972-12-01

375

2.9 % (w/v) PARAFORMALDEHYDE FIXATIVE (SOP-26) An excellent all around fixative for normal histology, immunochemistry and  

E-print Network

2.9 % (w/v) PARAFORMALDEHYDE FIXATIVE (SOP-26) An excellent all around fixative for normal histology, immunochemistry and autoradiology. Useful variations include addition of 0.1 - 0.25% (w ml sodium phosphate monobasic 3.17 g 12.68 g (NaH2PO4*H20, FW 137.99) sodium phosphate dibasic 10

Kleinfeld, David

376

Nitrogen Fixation on Early Mars and Other Terrestrial Planets. Experimental Demonstration of Abiotic Fixation Reactions to Nitrite and Nitrate  

Microsoft Academic Search

The abiotic fixation of nitrogen on early terrestrial planets, such as Mars and the Earth, is important for number of reasons. Nitrogen is an essential biochemical element and the prebiotic fixation of nitrogen into a form suitable for the formation of nitrogen containing prebiotic organic compounds is important for the origin of life. Since loss of nitrogen can result in

D. P. Summers; B. Khare

2005-01-01

377

Endoscopic ACL reconstruction using stryker biosteon cross-pin femoral fixation and interlock cross-pin tibial fixation.  

PubMed

Hamstring tendon autografts have, over the past decade, increasingly become the graft of choice for anterior cruciate ligament (ACL) reconstructions. Studies have shown that multiply stranded hamstring grafts have superior biomechanical characteristics when compared to patellar tendon autografts. Harvests of hamstring tendons have been shown to cause less donor-site morbidity than the harvest of patellar bone-tendon-bone grafts. Historically, however, fixation methods for hamstring grafts have limited their successful use. Fixation for both the tibia and femur distant from the intra-articular portions of the graft decreased the stiffness of the construct. The fixation also contributed to tunnel widening and ganglion formation. New methods have been developed to maximize the mechanical strengths of hamstring grafts and optimize biological factors in healing of the graft to the bone tunnels. Femoral cross-pin fixation provides secure fixation close to the knee joint, while also allowing for placement of the graft in the native ACL footprint at the far posterior aspect of the intercondylar notch. Tibial interference screw fixation allows fixation close to the joint as well. Addition of the interlock pin through the interference screw increases pullout strength significantly. Recent advances in material science have led to the development of bioabsorbable implants that afford high initial fixation strengths while limiting subsequent complications from permanent hardware. PMID:15455332

Berg, Troy L; Paulos, Lonnie E

2004-01-01

378

Legumes, N2 fixation and the H2 cycle  

NASA Astrophysics Data System (ADS)

Legume plants such as soybean or pea can form symbiotic, N2 fixing associations with bacteria that exist in root nodules. For every N2 fixed, 1 to 3 H2 are produced as a by-product of the nitrogenase reaction. Therefore, a typical N2 fixing legume crop produces about 200,000 L H2 gas (at STP) per hectare per crop season. This paper will summarize our current understanding of the processes leading to H2 production in legumes, the magnitude of H2 production associated with global cropping systems, and the implications for its production and oxidation on both the legumes and the soils in which they grow. Specific points may include: ˜ In symbioses lacking uptake hydrogenase (HUP) activity (thought to be the majority of crop legumes), the H2 diffuses into the soil where it is oxidized by soil microbes that grow up around the legume nodules. The kinetic properties of these microbes are very different (higher Km and Vmax) from that of microbes in soils exposed to normal air (ca. 0.5 ppm H2); ˜ Laboratory studies indicate that 60% of the reducing power from H2 is coupled to O2 uptake, whereas 40% is coupled to autotrophic CO2 fixation. The latter process should increase soil carbon stocks by about 25 kg C/ha/yr; ˜ At the site of the nitrogenase enzyme, H2 production is autocatalytic such that the higher the H2 concentration, the more H2 is produced and the less N2 fixed. The variable O2 diffusion barrier in legumes can act to restrict H2 diffusion from the nodule, thereby increasing the relative magnitude of H2 production versus N2 fixation; ˜ Studies to understand why legume symbioses make such an energy investment in H2 production have led to the discovery that H2 treated soils have improved fertility, supporting the growth and yield of legume and non-legume crops. This observation may account for the benefits of legumes when used in rotation with cereal crops, a phenomenon that has been used by farmers for over 2000 years, but which has remained unexplained. An attempt will be made to position these results and insights in the context of the impact that a future H2 economy will have on the H2 cycle.

Layzell, D. B.

2004-12-01

379

Monitoring CO[subscript 2] Fixation Using GC-MS Detection of a [superscript 13]C-Label  

ERIC Educational Resources Information Center

Much of our understanding of metabolic pathways has resulted from the use of chemical and isotopic labels. In this experiment, a heavy isotope of carbon, [superscript 13]C, is used to label the product of the well-known RuBisCO enzymatic reaction. This is a key reaction in photosynthesis that converts inorganic carbon to organic carbon; a process…

Hammond, Daniel G.; Bridgham, April; Reichert, Kara; Magers, Martin

2010-01-01

380

Immobilized ionic liquid\\/zinc chloride: Heterogeneous catalyst for synthesis of cyclic carbonates from carbon dioxide and epoxides  

Microsoft Academic Search

Chemical fixation of carbon dioxide with epoxides to form cyclic carbonates proceeds very effectively under mild conditions by using immobilized ionic liquid catalyst in conjunction with zinc chloride without any organic solvents. The reaction temperature, carbon dioxide pressure, effects of different metallic complexes and the amount of immobilized ionic liquid were investigated. The optimum reaction conditions were 110°C and 1.5MPa,

Lin-Fei Xiao; Fu-Wei Li; Jia-Jian Peng; Chun-Gu Xia

2006-01-01

381

Oxygen relations of nitrogen fixation in cyanobacteria.  

PubMed Central

The enigmatic coexistence of O2-sensitive nitrogenase and O2-evolving photosynthesis in diazotrophic cyanobacteria has fascinated researchers for over two decades. Research efforts in the past 10 years have revealed a range of O2 sensitivity of nitrogenase in different strains of cyanobacteria and a variety of adaptations for the protection of nitrogenase from damage by both atmospheric and photosynthetic sources of O2. The most complex and apparently most efficient mechanisms for the protection of nitrogenase are incorporated in the heterocysts, the N2-fixing cells of cyanobacteria. Genetic studies indicate that the controls of heterocyst development and nitrogenase synthesis are closely interrelated and that the expression of N2 fixation (nif) genes is regulated by pO2. Images PMID:1620069

Fay, P

1992-01-01

382

[Results of 30 keratoprostheses with retrocorneal fixation].  

PubMed

Keratoprosthesis is the last solution for corneally blind patients who cannot benefit from corneal grafts. The indications are limited to blind patients with monophthalmia and bilateral problems that are otherwise untreatable. After implanting the Choyce and Strampelli's devices for more than 10 years, we abandoned these anterior fixation techniques and now use a keratoprosthesis in which the sole mechanical fixation consists of a posterior support which is subsequently sealed by the fibrosis produced by the endothelial-Descement tissues. This new prosthesis is made of two pieces, an optic and an haptic fashioned out of CQ-PMMA. To minimize expulsion, the haptic outer diameter is greater than the central corneal orifice through which the optic is inserted and screwed into the haptic. The keratoprosthesis refractive power can be easily adjusted after lensectomy by changing the 40 D for a 63 D optic. The prosthesis is implanted in a single step surgical procedure, and can be implanted in phakic eyes while respecting the physiology and anatomy of these fragile eyes. This single step procedure reduces the usual repeated operations required when using, other techniques. We operated 12 cases of pseudopemphigus, 9 cases of burns, 7 cases of trachoma, and 2 cases of pseudophakic oedema with good cosmetic and visual results with a follow-up ranging from several months to more than 3 years. The results obtained with this new keratoprosthesis are encouraging. The results have been analysed and classified into: anatomic and functional success 20 cases, anatomic success and functional failures 4 cases, anatomic failures 6 cases. PMID:8282949

Lacombe, E

1993-01-01

383

Design of a Geospatial Systems Model Integrating Power Generation, Transmission and Distribution for Use in Evaluating Low-Carbon Energy Pathways  

NASA Astrophysics Data System (ADS)

The transition to a low-carbon economy requires the coordination of research, and implementation efforts in basic energy and systems science, energy infrastructure, and efficient, low-carbon end-use technologies, practices and polices. While the evolution of specific supply-side and end-use technologies are vital to this process, too little attention has been given to the dramatic opportunities for energy systems science, specifically the use of the transmission, storage, and distribution system, to decarbonize the energy economy. We present results from a model, Switch, that uses historic data for wind, photovoltaic and solar thermal resources and electricity loads, as well as minimum, maximum and average flows for hydroelectric facilities and detailed performance characteristics for all existing conventional generators in its region of analysis. We utilize this model to consider the potential benefits of coordinated energy supply, transmission and distribution, and end-use technology deployment and planning decisions, and to explore opportunities to minimize cost and carbon emissions over the coming decades. We present results from the Switch model for western North America under a range of carbon prices and other policy scenarios, and discuss planned expansions of the model to all of North America and China.

Kammen, D. M.; Nelson, J.; Petros-Good, A.; Johnston, J.; Fripp, M.; Hoffman, I.; Blanco, C.

2009-12-01

384

Fixation Times in Deme Structured, Finite Populations with Rare Migration  

NASA Astrophysics Data System (ADS)

Population structure affects both the outcome and the speed of evolutionary dynamics. Here we consider a finite population that is divided into subpopulations called demes. The dynamics within the demes are stochastic and frequency-dependent. Individuals can adopt one of two strategic types, or . The fitness of each individual is determined by interactions with other individuals in the same deme. With small probability, proportional to fitness, individuals migrate to other demes. The outcome of these dynamics has been studied earlier by analyzing the fixation probability of a single mutant in an otherwise homogeneous population. These results give only a partial picture of the dynamics, because the time when fixation occurs can be exceedingly large. In this paper, we study the impact of deme structures on the speed of evolution. We derive analytical approximations of fixation times in the limit of rare migration and rare mutation. In this limit, the conditional fixation time of a single mutant in a population is the same as that of a single in an population. For the prisoner's dilemma game, simulation results fit very well with our analytical predictions and demonstrate that fixation takes place in a moderate amount of time as compared to the expected waiting time until a mutant successfully invades and fixates. The simulations also confirm that the conditional fixation time of a single cooperator is indeed the same as that of a single defector.

Hauert, Christoph; Chen, Yu-Ting; Imhof, Lorens A.

2014-08-01

385

Outcome of rail fixator system in reconstructing bone gap  

PubMed Central

Background: Bone loss following open fracture or infected gap nonunion is a difficult situation to manage. There are many modes of treatment such as bone grafting, vascularized bone grafting and bone transport by illizarov and monolateral fixator. We evaluated the outcome of rail fixator treatment in reconstructing bone and limb function. We felt that due to problems such as heavy apparatus, persistent pain, deformity of joints and discomfort caused by an Ilizarov ring fixator, rail fixator is a good alternative to treat bone gaps. Materials and Methods: 20 patients (17 males and 3 females with mean age 30.5 years) who suffered bone loss due to open fracture and chronic osteomyelitis leading to infected gap nonunion. Ten patients suffered an open fracture (Gustilo type II and type III) and 10 patients suffered bone gap following excision of necrotic bone after infected nonunion. There were 19 cases of tibia and one case of humerus. All patients were treated with debridement and stabilization of fracture with a rail fixator. Further treatment involved reconstructing bone defect by corticotomy at an appropriate level and distraction by rail fixator. Result: We achieved union in all cases. The average bone gap reconstructed was 7.72 cm (range 3.5-15.5 cm) in 9 months (range 6-14 months). Normal range of motion in nearby joint was achieved in 80% cases. We had excellent to good limb function in 85% of cases as per the association for the study and application of the method of ilizarov scoring system[ASAMI] score. Conclusion: All patients well tolerated rail fixator with good functional results and gap reconstruction. Easy application of rail fixator and comfortable distraction procedure suggest rail fixator a good alternative for gap reconstruction of limbs.

Lakhani, Amit; Singh, Deepinderjit; Singh, Randhir

2014-01-01

386

Cell fixation in zinc salt solution is compatible with DNA damage response detection by phospho-specific antibodies.  

PubMed

By virtue of superior preservation of proteins and nucleic acids the zinc salt-based fixatives (ZBF) has been proposed as an alternative to precipitants and cross-linking fixatives in histopathology. It was recently reported that ZBF is compatible with analysis of cell surface immunophenotype and detection of intracellular epitopes by flow cytometry. The aim of this study was to explore whether ZBF is also compatible with the detection of DNA damage response assessed by phospho-specific antibodies (Abs) detecting phosphorylation of the key proteins of that pathway. DNA damage in human pulmonary adenocarcinoma A549 cells was induced by treatment with the DNA topoisomerase I inhibitor camptothecin and phosphorylation of histone H2AX on Ser139 (?H2AX) and of ATM on Ser1981 was detected with phospho-specific Abs; cellular fluorescence was measured by laser scanning cytometry (LSC). The sensitivity and accuracy of detection of H2AX and ATM phosphorylation concurrent with the detection of DNA replication by EdU incorporation and "click chemistry" was found in ZBF fixed cells to be comparable to that of cell fixed in formaldehyde. The accuracy of DNA content measurement as evident from the resolution of DNA content frequency histograms of cells stained with DAPI was somewhat better in ZBF- than in formaldehyde-fixed cells. The pattern of chromatin condensation revealed by the intensity of maximal pixel of DAPI that allows one to identify mitotic and immediately post-mitotic cells by LSC was preserved after ZBF fixation. ZBF fixation was also compatible with the detection of ?H2AX foci considered to be the hallmarks of induction of DNA double-strand breaks. Analysis of cells by flow cytometry revealed that ZBF fixation of lymphoblastoid TK6 cells led to about 60 and 33% higher intensity of the side and forward light scatter, respectively, compared to formaldehyde fixed cells. PMID:21595014

Zhao, Hong; Li, Jiangwei; Traganos, Frank; Halicka, H Dorota; Zarebski, Miros?aw; Dobrucki, Jurek; Darzynkiewicz, Zbigniew

2011-06-01

387

Metal Transport, Heavy Metal Speciation and Microbial Fixation Through Fluvial Subenvironments, Lower Coeur D'Alene River Valley, Idaho  

NASA Astrophysics Data System (ADS)

The lower Coeur d'Alene River Valley of northern Idaho is the site of extensive lead and zinc contamination resulting from both direct riverine tailings disposal and flood remobilization of contaminated sediments derived from the Coeur d'Alene mining district upstream. Variations in the hydrologic regime, redox conditions, porosity/permeability, organic content and microbial activity results in complicated metal transport pathways. Documentation of these pathways is a prerequisite to effective remediation, and requires accurate analysis of lateral and vertical variations. An analytical approach combining sequential extraction, electron microscopy, and microanalysis provides a comprehensive assessment of particulate speciation in this complex hydrologic system. Rigorously controlled sample preparation and a new sequential extraction protocol provide unprecedented insight into the role of metal sequestration in fluvial subenvironments. Four subenvironments were investigated: bedload, overbank (levee), marsh, and lacustrine. Periodic floods remobilize primary ore minerals and secondary minerals from upstream tailings (primarily oxyhydroxides, sulfides and carbonates). The bedload in the lower valley is a reducing environment and acts as a sink for detrital carbonates and sulfides moving downstream. In addition, authigenic/biogenic Fe, Pb and Zn sulfides and phosphates are common in bedload sediments near the sediment/water interface. Flood redistribution of oxide, sulfide and carbonate phases results in periodic contaminant recharge generating a complex system of metal dissolution, mobilization, migration and precipitation. In levee environments, authigenic sulfides from flood scouring are quickly oxidized resulting in development of oxide coated grain surfaces. Stability of detrital minerals on the levee is variable depending on sediment permeability, grain size and mineralogy resulting in a complex stratigraphy of oxide zones mottled with zones dominated by detrital and authigenic carbonate and sulfide phases. Marshes subjected to periodic subaerial exposure/flooding are even more complex and dominated by authigenic and biogenic mineralization. Lacustrine environments are dominated by nanocrystalline inorganic and biogenic sulfide minerals in the upper third of the contaminated sediment column with increasing amounts of silt sized detrital sulfides (especially sphalerite) closer to the premining surface. In pH-neutral subenvironments within the wetlands and lateral lakes of the lower Coeur d'Alene River Valley, microbial fixation plays a critical role in sequestering metals. Complex metal oxyhydroxide phases provided via flood recharge to river edge, marsh and lacustrine environments rapidly dissolve upon encountering anoxic conditions. Microbial activity is extremely effective in removing heavy metals from the water column, producing a nanocrystalline biofilm substrate characterized by ZnS (sphalerite) and non-stoichiometric PbS, FeS, and mixed metal sulfides. These solid phases are inherently unstable, and the sequestered metals become readily available through changes in redox or pH conditions, particularly dam-controlled annual fluctuations in base level, or during removal by bottom-feeding aquatic water fowl. The recognition of the inherent complexity and instability of microbially produced sulfidic material in a pH-neutral environment has important implications for remediation efforts utilizing wetland filtration methods.

Hooper, R. L.; Mahoney, J. B.

2001-12-01

388

Biomechanical stability of a supra-acetabular pedicle screw Internal Fixation device (INFIX) vs External Fixation and plates for vertically unstable pelvic fractures  

PubMed Central

Background We have recently developed a subcutaneous anterior pelvic fixation technique (INFIX). This internal fixator permits patients to sit, roll over in bed and lie on their sides without the cumbersome external appliances or their complications. The purpose of this study was to evaluate the biomechanical stability of this novel supraacetabular pedicle screw internal fixation construct (INFIX) and compare it to standard internal fixation and external fixation techniques in a single stance pelvic fracture model. Methods Nine synthetic pelves with a simulated anterior posterior compression type III injury were placed into three groups (External Fixator, INFIX and Internal Fixation). Displacement, total axial stiffness, and the stiffness at the pubic symphysis and SI joint were calculated. Displacement and stiffness were compared by ANOVA with a Bonferroni adjustment for multiple comparisons Results The mean displacement at the pubic symphysis was 20, 9 and 0.8?mm for external fixation, INFIX and internal fixation, respectively. Plate fixation was significantly stiffer than the INFIX and external Fixator (P?=?0.01) at the symphysis pubis. The INFIX device was significantly stiffer than external fixation (P?=?0.017) at the symphysis pubis. There was no significant difference in SI joint displacement between any of the groups. Conclusions Anterior plate fixation is stiffer than both the INFIX and external fixation in single stance pelvic fracture model. The INFIX was stiffer than external fixation for both overall axial stiffness, and stiffness at the pubic symphysis. Combined with the presumed benefit of minimizing the complications associated with external fixation, the INFIX may be a more preferable option for temporary anterior pelvic fixation in situations where external fixation may have otherwise been used. PMID:23017093

2012-01-01

389

Size changes in single muscle fibers during fixation and embedding.  

PubMed

During fixation of single muscles fibers with glutaraldehyde, the volume of the fiber shrinks 20%, recovers in rinse and osmium tetroxide to near normal volume and shrinks 20% again when staining with uranyl acetate. This suggest that osmotic properties of membranes may not have been completely lost during fixation, post-fixation and en bloc staining. Dehydration in ethanol and propylene oxide produces a further 10% shrinkage in volume. Infiltration and embedding with Epon causes an additional 15% change in volume. This gives a total shrinkage in volume of 45% which is nearly twice that of the apparent shrinkage in the volume of the myosin lattice as determined by electron microscopy. PMID:49940

Eisenberg, B R; Mobley, B A

1975-01-01

390

Nitrogen fixation in the Gulf of California and the Eastern Tropical North Pacific  

NASA Astrophysics Data System (ADS)

Di-nitrogen (N2) fixation plays a well-recognized role in the enhancement of primary production and arguably particle export in oligotrophic regions of the subtropical and tropical oceans. However, recent evidence suggests that N2 fixation may also be significant in regions of the surface ocean proximate to or overlying zones of intense subsurface denitrification. In this study, we present results from a series of research cruises in the Gulf of California (GoCal) and adjacent waters of the Eastern Tropical North Pacific (ETNP). Measurements include microscopy, genomic analyses, incubations, stable isotopic measurements, and sediment traps coupled with 238U:234Th disequilibria. Combined, these results suggest that N2 fixing microorganisms are present and active throughout the region, with larger sized Richelia and Trichodesmium spp. recorded within the warmer waters at the entrance to and within the GoCal, and smaller, unicellular diazotrophs observed in the cooler waters of the northern ETNP. N2 fixation rates in the summer varied from 15-70 ?mol N m-2 d-1, with episodic blooms contributing as much as 795 ?mol N m-2 d-1. While the estimated contribution of N2 fixation to particle export was highly variable, blooms of diatom-Richelia symbioses accounted for as much as ?44% of the measured summer carbon flux at 100 m. Alternately, evaluation of the N isotopic composition of sinking material and the magnitude of measured N2 fixation rates indicate negligible to small enhancements of new production when blooms of either colonial Trichodesmium spp. or unicellular diazotrophs were encountered. Consistent with previous research, we also found that while fluxes of C to sediment traps are similar in winter and summer months, the efficiency of C export (export/surface productivity) in the GoCal region is elevated during summer relative to the more productive diatom-dominated winter phase of the seasonal cycle. The episodic and variable nature of N2 fixation recorded in this region make it unlikely that new production via diazotrophic activity is solely responsible for the observed patterns of C transport efficiency; rather, we hypothesize that eolian inputs and/or efficient transport of picocyanobacterial biomass via grazing or aggregation may further explain the enhanced export efficiency observed in the GoCal summer. In sum, diazotrophy typically supports <10%, but as much as 44% of export production. The high variability of direct measurements of N2 fixation implies that other mechanisms contribute to the seasonal invariance of C flux in this region. If this region is indicative of other oxygen minima zones with active diazotrophs, our results indicate that export-mediated feedback mechanisms between N2 fixation and denitrification are not as strong as previously hypothesized.

White, Angelicque E.; Foster, Rachel A.; Benitez-Nelson, Claudia R.; Masqué, Pere; Verdeny, Elisabet; Popp, Brian N.; Arthur, Karen E.; Prahl, Fredrick G.

2013-02-01

391

Nitrogen and Carbon Cycling in Deforested and Pristine Upland (2400m) Forest Catchments in the Peruvian Andes  

NASA Astrophysics Data System (ADS)

Nitrogen and carbon cycling were examined within two upland (2400m) forest catchments in the Peruvian Andes. One catchment was partially deforested within the last 3 years, while the other has remained untouched. Tracer amended samples were analyzed to determine the pathways and rates of nitrogen cycling in streams draining each catchment. Both streams exhibited very low inorganic nitrogen levels, on the order of 1 to 2 uM. A large percentage (>1/3) of the total fixed nitrogen flux from these systems was in the form of particulates. Preliminary results suggest a very high rate of nitrogen cycling in these systems. Isotopic measurements of plant samples from both catchments also suggest that these forests are highly efficient in trapping and using atmospheric nitrogen sources. The partially deforested catchment had significantly more species using C4 and CAM carbon fixation pathways. Leaf litter from both streams and leaves from trees in the area were also analyzed for carbon and nitrogen isotopes to compare and contrast nitrogen and carbon cycling between the two sites. This and other data to be presented suggest that deforestation has subtle but significant effects upon the ability of tropical upland forests to retain and use nutrients.

Townsend-Small, A.; Haberer, J.; McClain, M.; Ramos, O.; Gardner, W.; McCarthy, M.; Brandes, J.

2001-12-01

392

Amazon River enhances diazotrophy and carbon sequestration in the tropical North Atlantic Ocean  

E-print Network

#12;Amazon River enhances diazotrophy and carbon sequestration in the tropical North Atlantic Ocean in carbon sequestration. Here, we report that the Amazon River plume supports N2 fixation far from the mouth of atmospheric carbon to the deep ocean (3), or ``carbon sequestration'' (4). The Amazon River has the largest

Subramaniam, Ajit

393

CO2 Uptake and Fixation by a Thermoacidophilic Microbial Community Attached to Precipitated Sulfur in a Geothermal Spring? †  

PubMed Central

Carbon fixation at temperatures above 73°C, the upper limit for photosynthesis, is carried out by chemosynthetic thermophiles. Yellowstone National Park (YNP), Wyoming possesses many thermal features that, while too hot for photosynthesis, presumably support chemosynthetic-based carbon fixation. To our knowledge, in situ rates of chemosynthetic reactions at these high temperatures in YNP or other high-temperature terrestrial geothermal springs have not yet been reported. A microbial community attached to precipitated elemental sulfur (So floc) at the source of Dragon Spring (73°C, pH 3.1) in Norris Geyser Basin, YNP, exhibited a maximum rate of CO2 uptake of 21.3 ± 11.9 ?g of C 107 cells?1 h?1. When extrapolated over the estimated total quantity of So floc at the spring's source, the So floc-associated microbial community accounted for the uptake of 121 mg of C h?1 at this site. On a per-cell basis, the rate was higher than that calculated for a photosynthetic mat microbial community dominated by Synechococcus spp. in alkaline springs at comparable temperatures. A portion of the carbon taken up as CO2 by the So floc-associated biomass was recovered in the cellular nucleic acid pool, demonstrating that uptake was coupled to fixation. The most abundant sequences in a 16S rRNA clone library of the So floc-associated community were related to chemolithoautotrophic Hydrogenobaculum strains previously isolated from springs in the Norris Geyser Basin. These microorganisms likely contributed to the uptake and fixation of CO2 in this geothermal habitat. PMID:19429558

Boyd, Eric S.; Leavitt, William D.; Geesey, Gill G.

2009-01-01

394

CO(2) uptake and fixation by a thermoacidophilic microbial community attached to precipitated sulfur in a geothermal spring.  

PubMed

Carbon fixation at temperatures above 73 degrees C, the upper limit for photosynthesis, is carried out by chemosynthetic thermophiles. Yellowstone National Park (YNP), Wyoming possesses many thermal features that, while too hot for photosynthesis, presumably support chemosynthetic-based carbon fixation. To our knowledge, in situ rates of chemosynthetic reactions at these high temperatures in YNP or other high-temperature terrestrial geothermal springs have not yet been reported. A microbial community attached to precipitated elemental sulfur (S(o) floc) at the source of Dragon Spring (73 degrees C, pH 3.1) in Norris Geyser Basin, YNP, exhibited a maximum rate of CO(2) uptake of 21.3 +/- 11.9 microg of C 10(7) cells(-1) h(-1). When extrapolated over the estimated total quantity of S(o) floc at the spring's source, the S(o) floc-associated microbial community accounted for the uptake of 121 mg of C h(-1) at this site. On a per-cell basis, the rate was higher than that calculated for a photosynthetic mat microbial community dominated by Synechococcus spp. in alkaline springs at comparable temperatures. A portion of the carbon taken up as CO(2) by the S(o) floc-associated biomass was recovered in the cellular nucleic acid pool, demonstrating that uptake was coupled to fixation. The most abundant sequences in a 16S rRNA clone library of the S(o) floc-associated community were related to chemolithoautotrophic Hydrogenobaculum strains previously isolated from springs in the Norris Geyser Basin. These microorganisms likely contributed to the uptake and fixation of CO(2) in this geothermal habitat. PMID:19429558

Boyd, Eric S; Leavitt, William D; Geesey, Gill G

2009-07-01

395

Mechanical testing of a device for subcutaneous internal anterior pelvic ring fixation versus external pelvic ring fixation  

PubMed Central

Background Although useful in the emergency treatment of pelvic ring injuries, external fixation is associated with pin tract infections, the patient’s limited mobility and a restricted surgical accessibility to the lower abdomen. In this study, the mechanical stability of a subcutaneous internal anterior fixation (SIAF) system is investigated. Methods A standard external fixation and a SIAF system were tested on pairs of Polyoxymethylene testing cylinders using a universal testing machine. Each specimen was subjected to a total of 2000 consecutive cyclic loadings at 1 Hz with sinusoidal lateral compression/distraction (+/?50 N) and torque (+/? 0.5 Nm) loading alternating every 200 cycles. Translational and rotational stiffness were determined at 100, 300, 500, 700 and 900 cycles. Results There was no significant difference in translational stiffness between the SIAF and the standard external fixation when compared at 500 (p?=?.089), 700 (p?=?.081), and 900 (p?=?.266) cycles. Rotational stiffness observed for the SIAF was about 50 percent higher than the standard external fixation at 300 (p?=?.005), 500 (p?=?.020), and 900 (p?=?.005) cycles. No loosening or failure of the rod-pin/rod-screw interfaces was seen. Conclusions In comparison with the standard external fixation system, the tested device for subcutaneous internal anterior fixation (SIAF) in vitro has similar translational and superior rotational stiffness. PMID:24684828

2014-01-01

396

Randomised study of non-bridging external fixation compared with intramedullary fixation of unstable distal radial fractures.  

PubMed

This is a randomised study to compare two types of osteosynthesis to mobilise wrists after distal fractures of the radius. Inclusion criteria were Older type 2 and 3 fractures. External fixation was managed with Hoffmann II compact non-bridging. Internal fixation was managed with Micronail. Patients were followed up for 12 weeks. The primary outcome was the results of the disabilities of arm, shoulder and hand (DASH) questionnaire. The secondary outcomes were answers to the patient-rated wrist evaluation (PRWE), grip strength, satisfaction, radial length, and volar tilt. Thirty patients were randomised to have external fixation and 31 to have internal fixation.There were no significant differences in DASH score. Internal fixation gave significantly better grip strength at five (p = 0.00) and 12 weeks (p = 0.03). The operating time was significantly shorter (p = 0.00) when non-bridging external fixation was used, and there were minor radiological differences. An activity-based costing analysis showed that external fixation cost three times more overall. PMID:22150146

Schønnemann, Jesper O; Hansen, Torben B; Søballe, Kjeld

2011-09-01

397

Nitrogen fixation in freshwater, estuarine, and marine ecosystems. 1. Rates and importance  

Microsoft Academic Search

Nitrogen fixation is mediated by a variety of autotrophic and heterotrophic bacteria. Cyano- bacteria appear responsible for most planktonic fixation in aquatic ecosystems, and rates of fixation are high only when thcsc organisms make up a major percentage of the planktonic biomass, Planktonic nitrogen fixation tends to be low in oligotrophic and mesotrophic lakes (generally

ROBERT W. HOWARTH; ROXANNE MARINO; JONATHAN J. COLE

1988-01-01

398

21 CFR 888.3020 - Intramedullary fixation rod.  

Code of Federal Regulations, 2012 CFR

...made of alloys such as cobalt-chromium-molybdenum and stainless steel. It is inserted into the medullary (bone marrow) canal of long bones for the fixation of fractures. (b) Classification. Class...

2012-04-01

399

21 CFR 878.3250 - External facial fracture fixation appliance.  

Code of Federal Regulations, 2011 CFR

...fracture fixation appliance is a metal apparatus intended to be used during surgical reconstruction and repair to immobilize maxillofacial bone fragments in their proper facial relationship. (b) Classification. Class I (general controls). The...

2011-04-01

400

21 CFR 878.3250 - External facial fracture fixation appliance.  

Code of Federal Regulations, 2013 CFR

...fracture fixation appliance is a metal apparatus intended to be used during surgical reconstruction and repair to immobilize maxillofacial bone fragments in their proper facial relationship. (b) Classification. Class I (general controls). The...

2013-04-01