These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

MICROBIOLOGY: A Fifth Pathway of Carbon Fixation  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Genome sequence analyses and enzymatic studies reveal a novel CO2 fixation cycle in some autotrophic archaea. Autotrophs are organisms that can grow using carbon dioxide (CO2) as their sole source of carbon. Four mechanisms are known by which autotrophic organisms fix carbon. Berg et al. describe a fifth autotrophic CO2 fixation pathway in archaea that may have been used by some of the earliest organisms on Earth.

Rudolf K. Thauer (Max Planck Institute for Terrestrial Microbiology;)

2007-12-14

2

Design and analysis of synthetic carbon fixation pathways  

PubMed Central

Carbon fixation is the process by which CO2 is incorporated into organic compounds. In modern agriculture in which water, light, and nutrients can be abundant, carbon fixation could become a significant growth-limiting factor. Hence, increasing the fixation rate is of major importance in the road toward sustainability in food and energy production. There have been recent attempts to improve the rate and specificity of Rubisco, the carboxylating enzyme operating in the Calvin–Benson cycle; however, they have achieved only limited success. Nature employs several alternative carbon fixation pathways, which prompted us to ask whether more efficient novel synthetic cycles could be devised. Using the entire repertoire of approximately 5,000 metabolic enzymes known to occur in nature, we computationally identified alternative carbon fixation pathways that combine existing metabolic building blocks from various organisms. We compared the natural and synthetic pathways based on physicochemical criteria that include kinetics, energetics, and topology. Our study suggests that some of the proposed synthetic pathways could have significant quantitative advantages over their natural counterparts, such as the overall kinetic rate. One such cycle, which is predicted to be two to three times faster than the Calvin–Benson cycle, employs the most effective carboxylating enzyme, phosphoenolpyruvate carboxylase, using the core of the naturally evolved C4 cycle. Although implementing such alternative cycles presents daunting challenges related to expression levels, activity, stability, localization, and regulation, we believe our findings suggest exciting avenues of exploration in the grand challenge of enhancing food and renewable fuel production via metabolic engineering and synthetic biology. PMID:20410460

Bar-Even, Arren; Noor, Elad; Lewis, Nathan E.; Milo, Ron

2010-01-01

3

Potential role of multiple carbon fixation pathways during lipid accumulation in Phaeodactylum tricornutum  

PubMed Central

Background Phaeodactylum tricornutum is a unicellular diatom in the class Bacillariophyceae. The full genome has been sequenced (<30?Mb), and approximately 20 to 30% triacylglyceride (TAG) accumulation on a dry cell basis has been reported under different growth conditions. To elucidate P. tricornutum gene expression profiles during nutrient-deprivation and lipid-accumulation, cell cultures were grown with a nitrate to phosphate ratio of 20:1 (N:P) and whole-genome transcripts were monitored over time via RNA-sequence determination. Results The specific Nile Red (NR) fluorescence (NR fluorescence per cell) increased over time; however, the increase in NR fluorescence was initiated before external nitrate was completely exhausted. Exogenous phosphate was depleted before nitrate, and these results indicated that the depletion of exogenous phosphate might be an early trigger for lipid accumulation that is magnified upon nitrate depletion. As expected, many of the genes associated with nitrate and phosphate utilization were up-expressed. The diatom-specific cyclins cyc7 and cyc10 were down-expressed during the nutrient-deplete state, and cyclin B1 was up-expressed during lipid-accumulation after growth cessation. While many of the genes associated with the C3 pathway for photosynthetic carbon reduction were not significantly altered, genes involved in a putative C4 pathway for photosynthetic carbon assimilation were up-expressed as the cells depleted nitrate, phosphate, and exogenous dissolved inorganic carbon (DIC) levels. P. tricornutum has multiple, putative carbonic anhydrases, but only two were significantly up-expressed (2-fold and 4-fold) at the last time point when exogenous DIC levels had increased after the cessation of growth. Alternative pathways that could utilize HCO3- were also suggested by the gene expression profiles (e.g., putative propionyl-CoA and methylmalonyl-CoA decarboxylases). Conclusions The results indicate that P. tricornutum continued carbon dioxide reduction when population growth was arrested and different carbon-concentrating mechanisms were used dependent upon exogenous DIC levels. Based upon overall low gene expression levels for fatty acid synthesis, the results also suggest that the build-up of precursors to the acetyl-CoA carboxylases may play a more significant role in TAG synthesis rather than the actual enzyme levels of acetyl-CoA carboxylases per se. The presented insights into the types and timing of cellular responses to inorganic carbon will help maximize photoautotrophic carbon flow to lipid accumulation. PMID:22672912

2012-01-01

4

CARBON DIOXIDE FIXATION.  

SciTech Connect

Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO{sub 2} conversion. Recent achievements in the efficiency of solar energy conversion and in catalysis suggest that this approach holds a great deal of promise for contributing to future needs for fuels and chemicals.

FUJITA,E.

2000-01-12

5

Structural studies of metalloenzyme complexes in acetogenic carbon fixation  

E-print Network

Acetogenic bacteria use the Wood-Ljungdahl carbon fixation pathway to produce cellular carbon from CO?. This process requires several metalloenzymes that employ transition metals such as iron, nickel, and cobalt towards ...

Kung, Yan

2011-01-01

6

Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway  

PubMed Central

The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73°C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA ?-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula. PMID:24532060

Hawkins, Aaron B.; Adams, Michael W. W.

2014-01-01

7

De Novo Transcriptome Analysis of an Aerial Microalga Trentepohlia jolithus: Pathway Description and Gene Discovery for Carbon Fixation and Carotenoid Biosynthesis  

PubMed Central

Background Algae in the order Trentepohliales have a broad geographic distribution and are generally characterized by the presence of abundant ?-carotene. The many monographs published to date have mainly focused on their morphology, taxonomy, phylogeny, distribution and reproduction; molecular studies of this order are still rare. High-throughput RNA sequencing (RNA-Seq) technology provides a powerful and efficient method for transcript analysis and gene discovery in Trentepohlia jolithus. Methods/Principal Findings Illumina HiSeq 2000 sequencing generated 55,007,830 Illumina PE raw reads, which were assembled into 41,328 assembled unigenes. Based on NR annotation, 53.28% of the unigenes (22,018) could be assigned to gene ontology classes with 54 subcategories and 161,451 functional terms. A total of 26,217 (63.44%) assembled unigenes were mapped to 128 KEGG pathways. Furthermore, a set of 5,798 SSRs in 5,206 unigenes and 131,478 putative SNPs were identified. Moreover, the fact that all of the C4 photosynthesis genes exist in T. jolithus suggests a complex carbon acquisition and fixation system. Similarities and differences between T. jolithus and other algae in carotenoid biosynthesis are also described in depth. Conclusions/Significance This is the first broad transcriptome survey for T. jolithus, increasing the amount of molecular data available for the class Ulvophyceae. As well as providing resources for functional genomics studies, the functional genes and putative pathways identified here will contribute to a better understanding of carbon fixation and fatty acid and carotenoid biosynthesis in T. jolithus. PMID:25254555

Li, Qianqian; Liu, Jianguo; Zhang, Litao; Liu, Qian

2014-01-01

8

Carbon Dioxide Fixation by Lupin Root Nodules  

PubMed Central

Labeling studies using detached lupin (Lupinus angustifolius) nodules showed that over times of less than 3 minutes, label from [3,4-14C]glucose was incorporated into amino acids, predominantly aspartic acid, to a much greater extent than into organic acids. Only a slight preferential incorporation was observed with [1-14C]- and [6-14C]glucose, while with [U-14C]-glucose more label was incorporated into organic acids than into amino acids at all labeling times. These results are consistent with a scheme whereby the “carbon skeletons” for amino acid synthesis are provided by the phosphoenolpyruvate carboxylase reaction. A comparison of 14CO2 release from nodules supplied with [1-14C]- and [6-14C]glucose indicated that the oxidative pentose phosphate pathway accounted for less than 6% of glucose metabolism. Several enzymes of the oxidative pentose phosphate and glycolytic pathways were assayed in vitro using the 12,000g supernatant fraction from nodule homogenates. In all cases, the specific activities were adequate to account for the calculated in vivo fluxes. Three out of four diverse treatments that inhibited nodule nitrogen fixation also inhibited nodule CO2 fixation, and in the case of the fourth treatment, replacement of N2 with He, it was shown that the normal entry of label from exogenous 14CO2 into the nodule amino acid pool was strongly inhibited. PMID:16660746

Laing, William A.; Christeller, John T.; Sutton, William D.

1979-01-01

9

Efficient CO2 Fixation Pathways: Energy Plant: High Efficiency Photosynthetic Organisms  

SciTech Connect

PETRO Project: UCLA is redesigning the carbon fixation pathways of plants to make them more efficient at capturing the energy in sunlight. Carbon fixation is the key process that plants use to convert carbon dioxide (CO2) from the atmosphere into higher energy molecules (such as sugars) using energy from the sun. UCLA is addressing the inefficiency of the process through an alternative biochemical pathway that uses 50% less energy than the pathway used by all land plants. In addition, instead of producing sugars, UCLA’s designer pathway will produce pyruvate, the precursor of choice for a wide variety of liquid fuels. Theoretically, the new biochemical pathway will allow a plant to capture 200% as much CO2 using the same amount of light. The pathways will first be tested on model photosynthetic organisms and later incorporated into other plants, thus dramatically improving the productivity of both food and fuel crops.

None

2012-01-01

10

Dark Carbon Fixation: An Important Process in Lake Sediments  

PubMed Central

Close to redox boundaries, dark carbon fixation by chemoautotrophic bacteria may be a large contributor to overall carbon fixation. Still, little is known about the relative importance of this process in lake systems, in spite the potentially high chemoautotrophic potential of lake sediments. We compared rates of dark carbon fixation, bacterial production and oxygen consumption in sediments from four Swedish boreal and seven tropical Brazilian lakes. Rates were highly variable and dark carbon fixation amounted up to 80% of the total heterotrophic bacterial production. The results indicate that non-photosynthetic carbon fixation can represent a substantial contribution to bacterial biomass production, especially in sediments with low organic matter content. PMID:23776549

Santoro, Ana Lúcia; Bastviken, David; Gudasz, Cristian; Tranvik, Lars; Enrich-Prast, Alex

2013-01-01

11

Dark carbon fixation: an important process in lake sediments.  

PubMed

Close to redox boundaries, dark carbon fixation by chemoautotrophic bacteria may be a large contributor to overall carbon fixation. Still, little is known about the relative importance of this process in lake systems, in spite the potentially high chemoautotrophic potential of lake sediments. We compared rates of dark carbon fixation, bacterial production and oxygen consumption in sediments from four Swedish boreal and seven tropical Brazilian lakes. Rates were highly variable and dark carbon fixation amounted up to 80% of the total heterotrophic bacterial production. The results indicate that non-photosynthetic carbon fixation can represent a substantial contribution to bacterial biomass production, especially in sediments with low organic matter content. PMID:23776549

Santoro, Ana Lúcia; Bastviken, David; Gudasz, Cristian; Tranvik, Lars; Enrich-Prast, Alex

2013-01-01

12

Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation.  

PubMed

Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

Könneke, Martin; Schubert, Daniel M; Brown, Philip C; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J; Stahl, David A; Berg, Ivan A

2014-06-01

13

Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation  

PubMed Central

Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

Könneke, Martin; Schubert, Daniel M.; Brown, Philip C.; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J.; Stahl, David A.; Berg, Ivan A.

2014-01-01

14

A global two component signal transduction system that integrates the control of photosynthesis, carbon dioxide assimilation, and nitrogen?fixation  

PubMed Central

Photosynthesis, biological nitrogen fixation, and carbon dioxide assimilation are three fundamental biological processes catalyzed by photosynthetic bacteria. In the present study, it is shown that mutant strains of the nonsulfur purple photosynthetic bacteria Rhodospirillum rubrum and Rhodobacter sphaeroides, containing a blockage in the primary CO2 assimilatory pathway, derepress the synthesis of components of the nitrogen fixation enzyme complex and abrogate normal control mechanisms. The absence of the Calvin–Benson–Bassham (CBB) reductive pentose phosphate CO2 fixation pathway removes an important route for the dissipation of excess reducing power. Thus, the mutant strains develop alternative means to remove these reducing equivalents, resulting in the synthesis of large amounts of nitrogenase even in the presence of ammonia. This response is under the control of a global two-component signal transduction system previously found to regulate photosystem biosynthesis and the transcription of genes required for CO2 fixation through the CBB pathway and alternative routes. In addition, this two-component system directly controls the ability of these bacteria to grow under nitrogen-fixing conditions. These results indicate that there is a molecular link between the CBB and nitrogen fixation process, allowing the cell to overcome powerful control mechanisms to remove excess reducing power generated by photosynthesis and carbon metabolism. Furthermore, these results suggest that the two-component system integrates the expression of genes required for the three processes of photosynthesis, nitrogen fixation, and carbon dioxide fixation. PMID:8962083

Joshi, Hemalata?M.; Tabita, F.?Robert

1996-01-01

15

Optimization of inorganic carbon sources to improve the carbon fixation efficiency of the non-photosynthetic microbial community with different electron donors.  

PubMed

As the non-photosynthetic microbial community (NPMC) isolated from seawaters utilized inorganic carbon sources for carbon fixation, the concentrations and ratios of Na2CO3, NaHCO3, and CO2 were optimized by response surface methodology design. With H2 as the electron donor, the optimal carbon sources were 270?mg/L Na2CO3, 580?mg/L NaHCO3, and 120?mg/L CO2. The carbon fixation efficiency in response to total organic carbon (TOC) was up to 30.59?mg/L with optimal carbon sources, which was about 50% higher than that obtained with CO2 as the sole carbon source. The mixture of inorganic carbon sources developed a buffer system to prevent acidification or alkalization of the medium caused by CO2 or Na2CO3, respectively. Furthermore, CO2 and HCO3(-), the starting points of carbon fixation in the pathways of Calvin-Benson-Bassham and 3-hydroxypropionate cycles, were provided by the carbon source structure to facilitate carbon fixation by NPMC. However, in the presence of mixed electron donors composed of 1.25% Na2S, 0.50% Na2S2O3, and 0.457% NaNO2, the carbon source structure did not exhibit significant improvement in the carbon fixation efficiency, when compared with that achieved with CO2 as the sole carbon source. The positive effect of mixed electron donors on inorganic carbon fixation was much higher than that of the carbon source structure. Nevertheless, the carbon source structure could be used as an alternative to CO2 when using NPMC to fix carbon in industrial processes. PMID:25367398

Wang, Ya-Nan; Wang, Lei; Shan, Yi-Na; Hu, Jiajun; Tsang, Yiufai; Hu, Yu; Fu, Xiaohua; Le, Yiquan

2014-12-01

16

The influence of carbon dioxide on symbiotic nitrogen fixation  

Microsoft Academic Search

In a previous investigation 12 it was found that the roots of red-clover plants growing on acid sandy soils developed nodules only poorly or not at all. Treatment of the soll with calcium carbonate or sterilized extracts of yeast or Rhizobium cells resulted in much improved nodulation, nitrogen fixation and growth of the clover plants. If the similar effects produced

E. G. Mulder; W. L. Van Veen

1960-01-01

17

Phytoplankton plasticity drives large variability in carbon fixation efficiency  

NASA Astrophysics Data System (ADS)

Phytoplankton C:N stoichiometry is highly flexible due to physiological plasticity, which could lead to high variations in carbon fixation efficiency (carbon consumption relative to nitrogen). However, the magnitude, as well as the spatial and temporal scales of variability, remains poorly constrained. We used a high-resolution biogeochemical model resolving various scales from small to high, spatially and temporally, in order to quantify and better understand this variability. We find that phytoplankton C:N ratio is highly variable at all spatial and temporal scales (5-12 molC/molN), from mesoscale to regional scale, and is mainly driven by nitrogen supply. Carbon fixation efficiency varies accordingly at all scales (±30%), with higher values under oligotrophic conditions and lower values under eutrophic conditions. Hence, phytoplankton plasticity may act as a buffer by attenuating carbon sequestration variability. Our results have implications for in situ estimations of C:N ratios and for future predictions under high CO2 world.

Ayata, Sakina-Dorothée.; Lévy, Marina; Aumont, Olivier; Resplandy, Laure; Tagliabue, Alessandro; Sciandra, Antoine; Bernard, Olivier

2014-12-01

18

Silanediol-catalyzed carbon dioxide fixation.  

PubMed

Carbon dioxide is an abundant and renewable C1 source. However, mild transformations with carbon dioxide at atmospheric pressure are difficult to accomplish. Silanediols have been discovered to operate as effective hydrogen-bond donor organocatalysts for the atom-efficient conversion of epoxides to cyclic carbonates under environmentally friendly conditions. The reaction system is tolerant of a variety of epoxides and the desired cyclic carbonates are isolated in excellent yields. PMID:25328125

Hardman-Baldwin, Andrea M; Mattson, Anita E

2014-12-01

19

Potential carbon dioxide fixation by industrially important microalgae  

Microsoft Academic Search

The present study aimed at investigating the carbon metabolism in terms of carbon dioxide fixation and its destination in microalgae cultivations. To this purpose, analysis of growth parameters, media of cultivation, biomass composition and productivity and nutrients balance were performed. Four microalgae suitable for mass cultivation were evaluated: Dunaliella tertiolecta SAD-13.86, Chlorella vulgaris LEB-104, Spirulina platensis LEB-52 and Botryococcus braunii

Eduardo Bittencourt Sydney; Wilerson Sturm; Julio Cesar de Carvalho; Vanete Thomaz-Soccol; Christian Larroche; Ashok Pandey; Carlos Ricardo Soccol

2010-01-01

20

Potential carbon dioxide fixation by industrially important microalgae.  

PubMed

The present study aimed at investigating the carbon metabolism in terms of carbon dioxide fixation and its destination in microalgae cultivations. To this purpose, analysis of growth parameters, media of cultivation, biomass composition and productivity and nutrients balance were performed. Four microalgae suitable for mass cultivation were evaluated: Dunaliella tertiolecta SAD-13.86, Chlorella vulgaris LEB-104, Spirulina platensis LEB-52 and Botryococcus braunii SAG-30.81. Global rates of carbon dioxide and oxygen were determinated by a system developed in our laboratory. B. braunii presented the highest CO(2) fixation rate, followed by S. platensis,D. tertiolecta and C. vulgaris (496.98, 318.61, 272.4 and 251.64 mg L(-1)day(-1), respectively). Carbon dioxide fixated was mainly used for microalgal biomass production. Nitrogen, phosphorus (calcium for D. tertiolecta), potassium and magnesium consumption rates (mg gX(-1)) were evaluated for the four microalgae. Biomass composition presented a predominance of proteins but also a high amount of lipids, especially in D. tertiolecta and B. braunii. PMID:20350804

Sydney, Eduardo Bittencourt; Sturm, Wilerson; de Carvalho, Julio Cesar; Thomaz-Soccol, Vanete; Larroche, Christian; Pandey, Ashok; Soccol, Carlos Ricardo

2010-08-01

21

Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park  

SciTech Connect

The fixation of inorganic carbon (as carbon dioxide) has been documented in all three domains of life and results in the biosynthesis of a diverse suite of organic compounds that support the growth of heterotrophic organisms. The primary aim of this study was to assess the importance of carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of one of the dominant Fe(II)-oxidizing organisms (Metallosphaera yellowstonensis strain MK1) present in situ. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon fixation pathway were identified in pure-cultures of M. yellowstonensis strain MK1. Metagenome sequencing from the same environments also revealed genes for the 3-HP/4-HB pathway belonging to M. yellowstonensis populations, as well as genes for a complete reductive TCA cycle from Hydrogenobaculum spp. (Aquificales). Stable isotope (13CO2) labeling was used to measure the fixation of CO2 by M. yellowstonensis strain MK1, and in ex situ assays containing live Fe(III)-oxide microbial mats. Results showed that M. yellowstonensis strain MK1 fixes CO2 via the 3-HP/4-HB pathway with a fractionation factor of ~ 2.5 ‰. Direct analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C and microbial mat C showed that mat C is comprised of both DIC and non-DIC sources. The estimated contribution of DIC carbon to biomass C (> ~ 35%) is reasonably consistent with the relative abundance of known chemolithoautotrophs and corresponding CO2 fixation pathways detected in metagenome sequence. The significance of DIC as a major source of carbon for Fe-oxide mat communities provides a foundation for examining microbial interactions in these systems that are dependent on the activity of autotrophic organisms such as Hydrogenobaculum and Metallosphaera spp.

Jennings, Ryan; Whitmore, Laura M.; Moran, James J.; Kreuzer, Helen W.; Inskeep, William P.

2014-05-01

22

Bioengineering of carbon fixation, biofuels, and biochemicals in cyanobacteria and plants.  

PubMed

Development of sustainable energy is a pivotal step towards solutions for today's global challenges, including mitigating the progression of climate change and reducing dependence on fossil fuels. Biofuels derived from agricultural crops have already been commercialized. However the impacts on environmental sustainability and food supply have raised ethical questions about the current practices. Cyanobacteria have attracted interest as an alternative means for sustainable energy productions. Being aquatic photoautotrophs they can be cultivated in non-arable lands and do not compete for land for food production. Their rich genetic resources offer means to engineer metabolic pathways for synthesis of valuable bio-based products. Currently the major obstacle in industrial-scale exploitation of cyanobacteria as the economically sustainable production hosts is low yields. Much effort has been made to improve the carbon fixation and manipulating the carbon allocation in cyanobacteria and their evolutionary photosynthetic relatives, algae and plants. This review aims at providing an overview of the recent progress in the bioengineering of carbon fixation and allocation in cyanobacteria; wherever relevant, the progress made in plants and algae is also discussed as an inspiration for future application in cyanobacteria. PMID:22677697

Rosgaard, Lisa; de Porcellinis, Alice Jara; Jacobsen, Jacob H; Frigaard, Niels-Ulrik; Sakuragi, Yumiko

2012-11-30

23

Pyruvate Is Synthesized by Two Pathways in Pea Bacteroids with Different Efficiencies for Nitrogen Fixation?  

PubMed Central

Nitrogen fixation in legume bacteroids is energized by the metabolism of dicarboxylic acids, which requires their oxidation to both oxaloacetate and pyruvate. In alfalfa bacteroids, production of pyruvate requires NAD+ malic enzyme (Dme) but not NADP+ malic enzyme (Tme). However, we show that Rhizobium leguminosarum has two pathways for pyruvate formation from dicarboxylates catalyzed by Dme and by the combined activities of phosphoenolpyruvate (PEP) carboxykinase (PckA) and pyruvate kinase (PykA). Both pathways enable N2 fixation, but the PckA/PykA pathway supports N2 fixation at only 60% of that for Dme. Double mutants of dme and pckA/pykA did not fix N2. Furthermore, dme pykA double mutants did not grow on dicarboxylates, showing that they are the only pathways for the production of pyruvate from dicarboxylates normally expressed. PckA is not expressed in alfalfa bacteroids, resulting in an obligate requirement for Dme for pyruvate formation and N2 fixation. When PckA was expressed from a constitutive nptII promoter in alfalfa dme bacteroids, acetylene was reduced at 30% of the wild-type rate, although this level was insufficient to prevent nitrogen starvation. Dme has N-terminal, malic enzyme (Me), and C-terminal phosphotransacetylase (Pta) domains. Deleting the Pta domain increased the peak acetylene reduction rate in 4-week-old pea plants to 140 to 150% of the wild-type rate, and this was accompanied by increased nodule mass. Plants infected with Pta deletion mutants did not have increased dry weight, demonstrating that there is not a sustained change in nitrogen fixation throughout growth. This indicates a complex relationship between pyruvate synthesis in bacteroids, nitrogen fixation, and plant growth. PMID:20675477

Mulley, Geraldine; Lopez-Gomez, Miguel; Zhang, Ye; Terpolilli, Jason; Prell, Jurgen; Finan, Turlough; Poole, Philip

2010-01-01

24

Pyruvate is synthesized by two pathways in pea bacteroids with different efficiencies for nitrogen fixation.  

PubMed

Nitrogen fixation in legume bacteroids is energized by the metabolism of dicarboxylic acids, which requires their oxidation to both oxaloacetate and pyruvate. In alfalfa bacteroids, production of pyruvate requires NAD+ malic enzyme (Dme) but not NADP+ malic enzyme (Tme). However, we show that Rhizobium leguminosarum has two pathways for pyruvate formation from dicarboxylates catalyzed by Dme and by the combined activities of phosphoenolpyruvate (PEP) carboxykinase (PckA) and pyruvate kinase (PykA). Both pathways enable N2 fixation, but the PckA/PykA pathway supports N2 fixation at only 60% of that for Dme. Double mutants of dme and pckA/pykA did not fix N2. Furthermore, dme pykA double mutants did not grow on dicarboxylates, showing that they are the only pathways for the production of pyruvate from dicarboxylates normally expressed. PckA is not expressed in alfalfa bacteroids, resulting in an obligate requirement for Dme for pyruvate formation and N2 fixation. When PckA was expressed from a constitutive nptII promoter in alfalfa dme bacteroids, acetylene was reduced at 30% of the wild-type rate, although this level was insufficient to prevent nitrogen starvation. Dme has N-terminal, malic enzyme (Me), and C-terminal phosphotransacetylase (Pta) domains. Deleting the Pta domain increased the peak acetylene reduction rate in 4-week-old pea plants to 140 to 150% of the wild-type rate, and this was accompanied by increased nodule mass. Plants infected with Pta deletion mutants did not have increased dry weight, demonstrating that there is not a sustained change in nitrogen fixation throughout growth. This indicates a complex relationship between pyruvate synthesis in bacteroids, nitrogen fixation, and plant growth. PMID:20675477

Mulley, Geraldine; Lopez-Gomez, Miguel; Zhang, Ye; Terpolilli, Jason; Prell, Jurgen; Finan, Turlough; Poole, Philip

2010-10-01

25

Carbon Dioxide Fixation by Metallosphaera yellowstonensis and Acidothermophilic Iron-Oxidizing Microbial Communities from Yellowstone National Park  

PubMed Central

The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope (13CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ?2.5‰. Analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

Jennings, Ryan M.; Whitmore, Laura M.; Moran, James J.

2014-01-01

26

A Simple Demonstration of Carbon Dioxide Fixation and Acid Production in CAM Plants  

ERIC Educational Resources Information Center

Described is an experiment investigating carbon dioxide fixation in the dark and the diurnal rhythm of acid production in plants exhibiting Crassulacean Acid Metabolism. Included are suggestions for four further investigations. (SL)

Walker, John R. L.; McWha, James A.

1976-01-01

27

Dark inorganic carbon fixation sustains the functioning of benthic deep-sea ecosystems  

NASA Astrophysics Data System (ADS)

studies have provided evidence that dark inorganic carbon fixation is an important process for the functioning of the ocean interior. However, its quantitative relevance and ecological significance in benthic deep-sea ecosystems remain unknown. We investigated the rates of inorganic carbon fixation together with prokaryotic abundance, biomass, assemblage composition, and heterotrophic carbon production in surface sediments of different benthic deep-sea systems along the Iberian margin (northeastern Atlantic Ocean) and in the Mediterranean Sea. Inorganic carbon fixation rates in these surface deep-sea sediments did not show clear depth-related patterns, and, on average, they accounted for 19% of the total heterotrophic biomass production. The incorporation rates of inorganic carbon were significantly related to the abundance of total Archaea (as determined by catalyzed reporter deposition fluorescence in situ hybridization) and completely inhibited using an inhibitor of archaeal metabolism, N1-guanyl-1,7-diaminoheptane. This suggests a major role of the archaeal assemblages in inorganic carbon fixation. We also show that benthic archaeal assemblages contribute approximately 25% of the total 3H-leucine incorporation. Inorganic carbon fixation in surface deep-sea sediments appears to be dependent not only upon chemosynthetic processes but also on heterotrophic/mixotrophic metabolism, as suggested by estimates of the chemolithotrophic energy requirements and the enhanced inorganic carbon fixation due to the increase in the availability of organic trophic resources. Overall, our data suggest that archaeal assemblages of surface deep-sea sediments are responsible for the high rates of inorganic carbon incorporation and thereby sustain the functioning of the food webs as well as influence the carbon cycling of benthic deep-sea ecosystems.

Molari, Massimiliano; Manini, Elena; Dell'Anno, Antonio

2013-01-01

28

Transgenic approaches to manipulate the environmental responses of the C3 carbon fixation cycle.  

PubMed

The limitation to photosynthetic CO2 assimilation in C3 plants in hot, dry environments is dominated by ribulose 1.5-bisphosphate carboxylase/oxygenase (Rubisco) because CO2 availability is restricted and photorespiration is stimulated. Using a combination of genetic engineering and transgenic technology, three approaches to reduce photorespiration have been taken; two of these focused on increasing the carboxylation efficiency of Rubisco either by reducing the oxygenase reaction directly or by manipulating the Rubisco enzyme by concentrating CO2 in the region of Rubisco through the introduction of enzymes of the C4 pathway. The third approach attempted to reduce photorespiration directly by manipulation of enzymes in this pathway. The progress in each of these areas is discussed, and the most promising approaches are highlighted. Under saturating CO2 conditions, Rubisco did not limit photosynthesis, and limitation shifted to ribulose bisphosphate (RuBP) regeneration capacity of the C3 cycle. Transgenic analysis was used to identify the specific enzymes that may be targets for improving carbon fixation, and the way this may be exploited in the high CO2 future is considered. PMID:17080589

Raines, Christine A

2006-03-01

29

In vivo implant fixation of carbon fiber-reinforced PEEK hip prostheses in an ovine model.  

PubMed

Carbon fiber-reinforced polyetheretherketone (CFR/PEEK) is theoretically suitable as a material for use in hip prostheses, offering excellent biocompatibility, mechanical properties, and the absence of metal ions. To evaluate in vivo fixation methods of CFR/PEEK hip prostheses in bone, we examined radiographic and histological results for cementless or cemented CFR/PEEK hip prostheses in an ovine model with implantation up to 52 weeks. CFR/PEEK cups and stems with rough-textured surfaces plus hydroxyapatite (HA) coatings for cementless fixation and CFR/PEEK cups and stems without HA coating for cement fixation were manufactured based on ovine computed tomography (CT) data. Unilateral total hip arthroplasty was performed using cementless or cemented CFR/PEEK hip prostheses. Five cementless cups and stems and six cemented cups and stems were evaluated. On the femoral side, all cementless stems demonstrated bony ongrowth fixation and all cemented stems demonstrated stable fixation without any gaps at both the bone-cement and cement-stem interfaces. All cementless cases and four of the six cemented cases showed minimal stress shielding. On the acetabular side, two of the five cementless cups demonstrated bony ongrowth fixation. Our results suggest that both cementless and cemented CFR/PEEK stems work well for fixation. Cup fixation may be difficult for both cementless and cemented types in this ovine model, but bone ongrowth fixation on the cup was first seen in two cementless cases. Cementless fixation can be achieved using HA-coated CFR/PEEK implants, even under load-bearing conditions. PMID:23097319

Nakahara, Ichiro; Takao, Masaki; Bandoh, Shunichi; Bertollo, Nicky; Walsh, William R; Sugano, Nobuhiko

2013-03-01

30

Microbial carbon and nitrogen fixation on the surface of glaciers and ice sheets  

NASA Astrophysics Data System (ADS)

Studying the microbial sequestration of atmospheric carbon dioxide (via net autochthonous production) and nitrogen (via nitrogen fixation) into organic matter on the surface of glaciers and ice sheets is important for three main reasons. First, they can provide essential nutrients for supporting microbial ecosystems in these cold, typically nutrient-poor environments. Second, nutrients formed in the supraglacial environment may be important for sustaining hydrologically connected subglacial and downstream (e.g. fjords, near-shore marine) ecosystems. Third, organic matter produced or transformed by microbial activity can alter the albedo of ice, either directly by the production of dark pigments, or indirectly through the trapping and agglutination of dark mineral via the production of exopolysaccharides. Here, we present recent results of microbial carbon and nitrogen fixation in surface sediment (cryoconite) on Arctic and Antarctic glaciers and the Greenland Ice Sheet ablation zone. Results suggest that the fixation and recycling of autochthonous carbon in cryoconite on glaciers and ice sheets can support a significant fraction of the total microbial activity in the supraglacial environment during the ablation season. Nitrogen fixation can be important as a nitrogen source for microbial communities on both Arctic and Antarctic glaciers during the main ablation season. Nitrogen fixation could feasibly exceed precipitation as a source of nitrogen to microbial communities in debris rich zones on the margins of the Greenland Ice Sheet, aiding the colonization and subsequent 'greening' of subglacial and moraine derived debris.

Telling, J.; Anesio, A. M.; Stibal, M.; Hawkings, J.; Bellas, C. M.; Tranter, M.; Wadham, J. L.; Cook, J.; Hodson, A. J.; Yallop, M.; Barker, G.; Butler, C. E.; Fountain, A. G.; Nylen, T.; Irvine-Fynn, T. D.; Sole, A. J.; Nienow, P. W.

2012-12-01

31

Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens  

PubMed Central

Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. PMID:24762737

Feist, Adam M.; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P.; Lovley, Derek R.; Zengler, Karsten

2014-01-01

32

Carbon dioxide fixation and respiration relationships observed during closure experiments in Biosphere 2  

NASA Astrophysics Data System (ADS)

Biosphere 2 enclosed several ecosystems - ones analogous to rainforest, tropical savannah, thornscrub, desert, marsh and coral reef - and a diverse agro-ecology, with dozens of food crops, in virtual material isolation from Earth's environment. This permits a detailed examination of fixation and respiration from the continuous record of carbon dioxide concentration from sensors inside the facility. Unlike the Earth, all the ecosystems were active during sunlight hours, while phyto and soil respiration dominated nighttime hours. This resulted in fluctuations of as much as 600-700 ppm CO2 daily during days of high sunlight input. We examine the relationships between daytime fixation as driven by photosynthesis to nighttime respiration and also fixation and respiration as related to carbon dioxide concentration. Since carbon dioxide concentrations varied from near Earth ambient levels to over 3000 ppm (during low-light winter months), the response of the plant communities and impact on phytorespiration and soil respiration may be of relevance to the global climate change research community. An investigation of these dynamics will also allow the testing of models predicting the response of community metabolism to variations in sunlight and degree of previous net carbon fixation.

Nelson, Mark; Dempster, William; Allen, John P.

33

Nodulation Characteristics, Nodule Nitrogen, and Carbon Dioxide Fixation in Pigeon Pea as Affected by Nitrogen  

Microsoft Academic Search

The legume pigeon pea [Cajanus cajan (L.) Millsp.] is an important rainfed crop in many areas of the world. Production can be reduced when high nitrogen is present and symbiotic activity is low. A field experiment was conducted to determine the effects of nitrogen rate on nodulation, nodule carbon, and nitrogen fixation in 40 pigeon pea genotypes. Nitrogen was applied

Bhupinder Singh; Binod Kumar Singh

2011-01-01

34

RuBP Limitation of Photosynthetic Carbon Fixation during NH3 Assimilation 1  

PubMed Central

The effects of ammonium assimilation on photosynthetic carbon fixation and O2 exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP) concentration and the RuBP binding site density of ribulose bisphosphate carboxylase/oxygenase (Rubisco). In both species, ammonium assimilation resulted in a decrease in RuBP concentration. In S. minutum the concentration fell below the RuBP binding site density of Rubisco, indicating RuBP limitation of carboxylation. In contrast, RuBP concentration remained above the binding site density in C. pyrenoidosa. Compromising RuBP regeneration in C. pyrenoidosa with low light resulted in an ammonium-induced decrease in RuBP concentration below the RuBP binding site density of Rubisco. This resulted in a decrease in photosynthetic carbon fixation. In both species, ammonium assimilation resulted in a larger decrease in net O2 evolution than in carbon fixation. Mass spectrometric analysis shows this to be a result of an increase in the rate of mitochondrial respiration in the light. PMID:16666153

Elrifi, Ivor R.; Holmes, Jody J.; Weger, Harold G.; Mayo, William P.; Turpin, David H.

1988-01-01

35

Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean.  

PubMed

Bacteria and archaea in the dark ocean (>200 m) comprise 0.3-1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M

2013-12-01

36

Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean  

PubMed Central

Bacteria and archaea in the dark ocean (>200?m) comprise 0.3–1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M

2013-01-01

37

Photosynthesis in Grass Species Differing in Carbon Dioxide Fixation Pathways  

PubMed Central

Thirty-three grass species were examined in two experiments in an attempt to locate plants with photosynthetic responses to O2, CO2 compensation concentrations, and leaf anatomy intermediate to those of C3 and C4 species. Species examined included seven from the Laxa group in the Panicum genus, one of which, P. milioides Nees ex Trin., has been reported earlier to have intermediate characteristics. The species with O2-sensitive photosynthesis typical of C3 plants showed more than 37% increase in apparent photosynthesis at 2% O2 compared to 21% O2 at 25 C and 335 microliters per liter CO2, whereas in Panicum milioides, P. schenckii Hack., and P. decipiens Nees ex Trin., members of the Laxa group of Panicum, increases ranged from 25 to 30%. The remainder of the species did not respond to O2. Species with O2 responses characteristic of C3 plants exhibited CO2 compensation concentrations of 44 microliters per liter or higher at 21% O2 and 25 to 27.5 C and species characterized as O2-insensitive had values of microliters per liter or less. The CO2 compensation concentration (?) values of P. milioides, P. schenckii, and P. decipiens ranged from 10.3 to 23.3 microliters per liter. Other species of the Laxa group of Panicum exhibited O2 response and ? values of either C3 (P. laxum Sw., P. hylaeicum Mez., and P. rivulare Trin.) or C4 (P. prionitis Griseb.) plants. Leaves of species with O2 response and CO2 compensation values typical of C3 plants had poorly developed or nearly empty bundle sheath cells, and much larger distances and mesophyll cell numbers between veins than did the O2-insensitive ones. Vein spacings in P. milioides, P. schenckii, and P. decipiens ranged from 0.18 to 0.28 millimeter and mesophyll cell number between veins from 5.2 to 7.8. While these vein spacings are closer than those of most C3 grasses, two O2-sensitive species of Dactylis had vein spacings similar to these Panicums and veins in Glyceria striata, another O2-sensitive plant, were separated by only four mesophyll cells and 0.12 millimeter. Bundle sheath cells of the three intermediate Panicums contained greater quantities of organelles than are typical for C3 grasses. Images PMID:16660944

Morgan, Jack A.; Brown, R. Harold

1979-01-01

38

Carbon sequestration in soybean crop soils: the role of hydrogen-coupled CO2 fixation  

NASA Astrophysics Data System (ADS)

Conversion of native vegetation to agricultural land in order to support the world's growing population is a key factor contributing to global climate change. However, the extent to which agricultural activities contribute to greenhouse gas emissions compared to carbon storage is difficult to ascertain, especially for legume crops, such as soybeans. Soybean establishment often leads to an increase in N2O emissions because N-fixation leads to increased soil available N during decomposition of the low C:N legume biomass. However, soybean establishment may also reduce net greenhouse gas emissions by increasing soil fertility, plant growth, and soil carbon storage. The mechanism behind increased carbon storage, however, remains unclear. One explanation points to hydrogen coupled CO2 fixation; the process by which nitrogen fixation releases H2 into the soil system, thereby promoting chemoautotrophic carbon fixation by soil microbes. We used 13CO2 as a tracer to track the amount and fate of carbon fixed by hydrogen coupled CO2 fixation during one-year field and laboratory incubations. The objectives of the research are to 1) quantify rates of 13CO2 fixation in soil collected from a field used for long-term soybean production 2) examine the impact of H2 gas concentration on rates of 13CO2 fixation, and 3) measure changes in ?13C signature over time in 3 soil fractions: microbial biomass, light fraction, and acid stable fraction. If this newly-fixed carbon is incorporated into the acid-stable soil C fraction, it has a good chance of contributing to long-term soil C sequestration under soybean production. Soil was collected in the field both adjacent to root nodules (nodule soil) and >3cm away (root soil) and labelled with 13CO2 (1% v/v) in the presence and absence of H2 gas. After a two week labelling period, ?13C signatures already revealed differences in the four treatments of bulk soil: -17.1 for root, -17.6 for nodule, -14.2 for root + H2, and -6.1 for nodule + H2. Labelled soil was then placed in nylon mesh bags and buried in the field at a depth of 15cm in a soybean field at the Central Experiment Farm in Ottawa, Ontario. Samples will be removed at intervals of 1,2,3,6,9,12, and 15 months, and the ?13C of three soil fractions will be examined to reveal changes in carbon storage over time. Our results will provide insights into the fate of carbon fixed during hydrogen coupled CO2 fixation, and demonstrate whether this CO2 fixation can contribute to the long-term greenhouse gas balance of soybean production systems.

Graham, A.; Layzell, D. B.; Scott, N. A.; Cen, Y.; Kyser, T. K.

2011-12-01

39

Autotrophic Carbon Dioxide Fixation via the Calvin-Benson-Bassham Cycle by the Denitrifying Methanotroph “Candidatus Methylomirabilis oxyfera”  

PubMed Central

Methane is an important greenhouse gas and the most abundant hydrocarbon in the Earth's atmosphere. Methanotrophic microorganisms can use methane as their sole energy source and play a crucial role in the mitigation of methane emissions in the environment. “Candidatus Methylomirabilis oxyfera” is a recently described intra-aerobic methanotroph that is assumed to use nitric oxide to generate internal oxygen to oxidize methane via the conventional aerobic pathway, including the monooxygenase reaction. Previous genome analysis has suggested that, like the verrucomicrobial methanotrophs, “Ca. Methylomirabilis oxyfera” encodes and transcribes genes for the Calvin-Benson-Bassham (CBB) cycle for carbon assimilation. Here we provide multiple independent lines of evidence for autotrophic carbon dioxide fixation by “Ca. Methylomirabilis oxyfera” via the CBB cycle. The activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO), a key enzyme of the CBB cycle, in cell extracts from an “Ca. Methylomirabilis oxyfera” enrichment culture was shown to account for up to 10% of the total methane oxidation activity. Labeling studies with whole cells in batch incubations supplied with either 13CH4 or [13C]bicarbonate revealed that “Ca. Methylomirabilis oxyfera” biomass and lipids became significantly more enriched in 13C after incubation with 13C-labeled bicarbonate (and unlabeled methane) than after incubation with 13C-labeled methane (and unlabeled bicarbonate), providing evidence for autotrophic carbon dioxide fixation. Besides this experimental approach, detailed genomic and transcriptomic analysis demonstrated an operational CBB cycle in “Ca. Methylomirabilis oxyfera.” Altogether, these results show that the CBB cycle is active and plays a major role in carbon assimilation by “Ca. Methylomirabilis oxyfera” bacteria. Our results suggest that autotrophy might be more widespread among methanotrophs than was previously assumed and implies that a methanotrophic community in the environment is not necessarily revealed by 13C-depleted lipids. PMID:24509918

Kool, Dorien M.; Jetten, Mike S. M.; Sinninghe Damsté, Jaap S.; Ettwig, Katharina F.

2014-01-01

40

Slow carboxylation of Rubisco constrains the rate of carbon fixation during Antarctic phytoplankton blooms.  

PubMed

High-latitude oceans are areas of high primary production despite temperatures that are often well below the thermal optima of enzymes, including the key Calvin Cycle enzyme, Ribulose 1,5 bisphosphate carboxylase oxygenase (Rubisco). We measured carbon fixation rates, protein content and Rubisco abundance and catalytic rates during an intense diatom bloom in the Western Antarctic Peninsula (WAP) and in laboratory cultures of a psychrophilic diatom (Fragilariopsis cylindrus). At -1°C, the Rubisco turnover rate, kcat (c) , was 0.4 C s(-1) per site and the half saturation constant for CO2 was 15 ?M (vs c. 3 C s(-1) per site and 50 ?M at 20°C). To achieve high carboxylation rates, psychrophilic diatoms increased Rubisco abundance to c. 8% of biomass (vs c. 0.6% at 20°C), along with their total protein content, resulting in a low carbon : nitrogen ratio of c. 5. In psychrophilic diatoms, Rubisco must be almost fully active and near CO2 saturation to achieve carbon fixation rates observed in the WAP. Correspondingly, total protein concentrations were close to the highest ever measured in phytoplankton and likely near the maximum possible. We hypothesize that this high protein concentration, like that of Rubisco, is necessitated by slow enzyme rates, and that carbon fixation rates in the WAP are near a theoretical maximum. PMID:25283055

Young, Jodi N; Goldman, Johanna A L; Kranz, Sven A; Tortell, Philippe D; Morel, Francois M M

2015-01-01

41

Regulation of Autotrophic and Heterotrophic Carbon Dioxide Fixation in Hydrogenomonas facilis1  

PubMed Central

After growth on various carbon sources, sonic extracts of Hydrogenomonas facilis contained ribulosediphosphate (RuDP) carboxylase and phosphoribulokinase (Ru5-P kinase). After very short sonic treatment, a reductive adenosine triphosphate (ATP)-dependent incorporation of 14CO2 was also detectable. Reduced nicotinamide adenine dinucleotide (NADH2) served as reductant 30-fold more effectively than reduced nicotinamide adenine dinucleotide phosphate (NADPH2). Adenosine 5?-phosphate (AMP) and adenosine 5?-pyrophosphate (ADP) inhibited Ru5-P kinase and NADH2-, ATP-dependent CO2 fixation. The levels and duration of CO2 fixation suggested that it is a cyclic process. The requirement of reduced pyridine nucleotide and ATP and the sensitivity of fixation to AMP and ADP support the conjecture that it occurs via the Calvin cycle. After thorough study of variables affecting catalysis, specific activities (millimicromoles of substrate disappearing per milligram of protein) at 30 C were determined for RuDP carboxylase (C), Ru5-P kinase (K) and ATP-, NADH2- dependent CO2 fixation (CO2 F) after growth autotrophically on fructose, glucose, ribose, glutamate, lactate, succinate, and acetate. Values for these growth modes were, respectively—for C: 67.3, 51.1, 51.4, 24.6, 2.05, 10.2, 2.25, 1.4; for K: 24.7, 24.0, 23.2, 14.2, 12.8, 12.9, 13.4, 2.8; and for CO2 F: 4.54, 4.83, 3.10, 2.87, 0.85, 1.51, 0.24, 0.41. The qualitative parallel between values for RuDP carboxylase and CO2 fixation suggests that one major control point in fixation is the step catalyzed by RuDP carboxylase. Images PMID:4381635

McFadden, Bruce A.; Tu, Chang-Chu L.

1967-01-01

42

Carbon dioxide fixation as a central redox cofactor recycling mechanism in bacteria  

PubMed Central

The Calvin-Benson-Bassham cycle (Calvin cycle) catalyzes virtually all primary productivity on Earth and is the major sink for atmospheric CO2. A less appreciated function of CO2 fixation is as an electron-accepting process. It is known that anoxygenic phototrophic bacteria require the Calvin cycle to accept electrons when growing with light as their sole energy source and organic substrates as their sole carbon source. However, it was unclear why and to what extent CO2 fixation is required when the organic substrates are more oxidized than biomass. To address these questions we measured metabolic fluxes in the photosynthetic bacterium Rhodopseudomonas palustris grown with 13C-labeled acetate. R. palustris metabolized 22% of acetate provided to CO2 and then fixed 68% of this CO2 into cell material using the Calvin cycle. This Calvin cycle flux enabled R. palustris to reoxidize nearly half of the reduced cofactors generated during conversion of acetate to biomass, revealing that CO2 fixation plays a major role in cofactor recycling. When H2 production via nitrogenase was used as an alternative cofactor recycling mechanism, a similar amount of CO2 was released from acetate, but only 12% of it was reassimilated by the Calvin cycle. These results underscore that N2 fixation and CO2 fixation have electron-accepting roles separate from their better-known roles in ammonia production and biomass generation. Some nonphotosynthetic heterotrophic bacteria have Calvin cycle genes, and their potential to use CO2 fixation to recycle reduced cofactors deserves closer scrutiny. PMID:20558750

McKinlay, James B.; Harwood, Caroline S.

2010-01-01

43

Carbon dioxide fixation by microalgae cultivated in open bioreactors  

Microsoft Academic Search

The biofixation of carbon dioxide (CO2) by microalgae has been proven to be an efficient and economical method, mainly due to the photosynthetic ability of these microorganisms to use this gas as a source of nutrients for their development. The aim of this work was to study the growth of Spirulina LEB18 and Chlorella kessleri microalgae, exposed to controlled and

Ana Priscila Centeno da Rosa; Lisiane Fernandes Carvalho; Luzia Goldbeck; Jorge Alberto Vieira Costa

2011-01-01

44

Fixation of carbon dioxide in hydrogenomonas facilis as induced by preliminary oxyhydrogen reaction  

Microsoft Academic Search

1.Using a Knallgas bacterium, Hydrogenomonas facilis, dependence of its CO2-fixing capacity upon the process of Knallgas reaction was investigated under various experimental conditions.2.The CO2-fixation coupled with the Knallgas reaction occurred strongly in bacterial cells which had been grown autotrophically in an oxyhydrogen atmosphere, while it was almost nil when the bacterium was grown heterotrophically using lactate as carbon source. In

Ryuzi Kanai; Shigetoh Miyachi; Atusi Takamiya

1961-01-01

45

Chemoautotrophic carbon fixation rates and active bacterial communities in intertidal marine sediments.  

PubMed

Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, The Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m(-2) d(-1). Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)(-1), which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

Boschker, Henricus T S; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W C; Moodley, Leon

2014-01-01

46

Chemoautotrophic Carbon Fixation Rates and Active Bacterial Communities in Intertidal Marine Sediments  

PubMed Central

Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, the Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m?2 d?1. Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)?1, which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

Boschker, Henricus T. S.; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W. C.; Moodley, Leon

2014-01-01

47

Fixation of carbon dioxide and related small molecules by a bifunctional frustrated pyrazolylborane Lewis pair.  

PubMed

The bifunctional frustrated Lewis pair 1-[bis(pentafluorophenyl)boryl]-3,5-di-tert-butyl-1H-pyrazole (1) was employed for small molecule fixation by reaction with carbon dioxide, paraformaldehyde, tert-butyl isocyanate, tert-butyl isothiocyanate, methyl isothiocyanate and benzonitrile, affording the adducts 3-8 as zwitterionic, bicyclic boraheterocycles. Treatment of 1 with tert-butyl isocyanide gave the isocyanide-borane complex 9, whereas the zwitterionic alkynylborate 10 was formed by C-H bond activation of phenylacetylene. The molecular structures of all products 3-10 were established by X-ray diffraction analyses. DFT calculations at the M06-2X/6-311++G(d,p) level of theory revealed that CO(2) fixation by 1 and formation of the adduct 3 is strongly exothermic and proceeds with a low energy barrier of approximately 7.3 kcal mol(-1) via an intermediate van der Waals complex. PMID:22588317

Theuergarten, Eileen; Schlösser, Janin; Schlüns, Danny; Freytag, Matthias; Daniliuc, Constantin G; Jones, Peter G; Tamm, Matthias

2012-08-14

48

Genomic signatures of fifth autotrophic carbon assimilation pathway in bathypelagic Crenarchaeota  

PubMed Central

Summary Marine Crenarchaeota, ubiquitous and abundant organisms in the oceans worldwide, remain metabolically uncharacterized, largely due to their low cultivability. Identification of candidate genes for bicarbonate fixation pathway in the Cenarchaeum symbiosum A was an initial step in understanding the physiology and ecology of marine Crenarchaeota. Recent cultivation and genome sequencing of obligate chemoautotrophic Nitrosopumilus maritimus SCM1 were a major breakthrough towards understanding of their functioning and provide a valuable model for experimental validation of genomic data. Here we present the identification of multiple key components of 3?hydroxipropionate/4?hydroxybutyrate cycle, the fifth pathway in carbon fixation, found in data sets of environmental sequences representing uncultivated superficial and bathypelagic Crenarchaeota from Sargasso sea (GOS data set) and KM3 (Mediterranean Sea) and ALOHA (Atlantic ocean) stations. These organisms are likely to use acetyl?CoA/propionyl?CoA carboxylase(s) as CO2?fixing enzyme(s) to form succinyl?CoA, from which one molecule of acetyl?CoA is regenerated via 4?hydroxybutyrate cleavage and another acetyl?CoA to be the pathway product. The genetic distinctiveness and matching sympatric abundance imply that marine crenarchaeal genotypes from the three different geographic sites share similar ecophysiological properties, and therefore may represent fundamental units of marine ecosystem functioning. To couple results of sequence comparison with the dark ocean primary production, dissolved inorganic carbon fixation rates were measured at KM3 Station (3000?m depth, Eastern Mediterranean Sea), i.e. at the same site and depth used for metagenomic library construction. PMID:21255356

La Cono, Violetta; Smedile, Francesco; Ferrer, Manuel; Golyshin, Peter N.; Giuliano, Laura; Yakimov, Michail M.

2010-01-01

49

Ecological Aspects of the Distribution of Different Autotrophic CO2 Fixation Pathways?  

PubMed Central

Autotrophic CO2 fixation represents the most important biosynthetic process in biology. Besides the well-known Calvin-Benson cycle, five other totally different autotrophic mechanisms are known today. This minireview discusses the factors determining their distribution. As will be made clear, the observed diversity reflects the variety of the organisms and the ecological niches existing in nature. PMID:21216907

Berg, Ivan A.

2011-01-01

50

Carboxysomal carbonic anhydrases: Structure and role in microbial CO2 fixation  

SciTech Connect

Cyanobacteria and some chemoautotrophic bacteria are able to grow in environments with limiting CO2 concentrations by employing a CO2-concentrating mechanism (CCM) that allows them to accumulate inorganic carbon in their cytoplasm to concentrations several orders of magnitude higher than that on the outside. The final step of this process takes place in polyhedral protein microcompartments known as carboxysomes, which contain the majority of the CO2-fixing enzyme, RubisCO. The efficiency of CO2 fixation by the sequestered RubisCO is enhanced by co-localization with a specialized carbonic anhydrase that catalyzes dehydration of the cytoplasmic bicarbonate and ensures saturation of RubisCO with its substrate, CO2. There are two genetically distinct carboxysome types that differ in their protein composition and in the carbonic anhydrase(s) they employ. Here we review the existing information concerning the genomics, structure and enzymology of these uniquely adapted carbonic anhydrases, which are of fundamental importance in the global carbon cycle.

Cannon, Gordon C.; Heinhorst, Sabine; Kerfeld, Cheryl A.

2010-06-23

51

PH-NEUTRAL CONCRETE FOR ATTACHED MICROALGAE AND ENHANCED CARBON DIOXIDE FIXATION - PHASE I  

SciTech Connect

The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SC-CO {sub 2})-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resistance) cement-based products. SC-CO{sub 2} can rapidly convert the calcium hydroxide in cured cement to calcium carbonate, which increases the density and unconfined compressive strength in the treated region. In cured concrete, this treated region is typically a several-mm thick layer (generally <{approx}5mm, unless treatment time is excessive). However, we have found that by treating the entire cement matrix with SC-CO{sub 2} as part of the curing process, we can carbonate it rapidly, regardless of the thickness. By ''rapidly'' we mean simultaneous carbonation/curing in < 5 ks even for large cement forms, compared to typical carbonation times of several days or even years at low pressures. Carbonation changes the pH in the treated region from {approx}13 to {approx}8, almost exactly compatible with seawater. Therefore the leaching rates from these cements is reduced. These cement improvements are directed to the development of strong but thin artificial reefs, to which can be attached microalgae used for the enhanced fixation of CO{sub 2}. It is shown below that attached microalgae, as algal beds or reefs, are more efficient for CO{sub 2} fixation by a factor of 20, compared to the open ocean on an area basis. We have performed preliminary tests of the pH-neutral cements of our invention for attachment of microalgae populations. We have found pH-neutral materials which attach microalgae readily. These include silica-enriched (pozzolanic) cements, blast-furnace slags and fly ash, which are also silica-rich. We have already developed technology to simultaneously foam, carbonate and cure the cements; this foaming process further increases cement surface areas for microalgae attachment, in some cases to >10 m{sup 2}/g internal surface area. This project involves a team of researchers with backgrounds in cement technology, supercritical fluid technology, materials science, oceanography, and wetland biogeochemistry.

Kerry M. Dooley; F. Carl Knopf; Robert P. Gambrell

1999-05-31

52

P700 Activity and Chlorophyll Content of Plants with Different Photosynthetic Carbon Dioxide Fixation Cycles 1  

PubMed Central

Representative plants containing either the reductive pentose phosphate cycle or the C4 dicarboxylic acid cycle of photosynthetic carbon dioxide fixation have distinctly different contents of P700 and chlorophylls a and b. With leaf extracts and isolated chloroplasts from C4 cycle plants, the mean value of the relative ratio of P700 to total chlorophyll was 1.83 and the mean value of the ratio of chlorophyll a to b was 3.89. The respective values in similar extracts and chloroplasts from pentose cycle plants are 1.2 and 2.78. It seems likely that these results are indicative of a more active Photosystem I or a different size photosynthetic unit in C4 cycle plants than in the reductve pentose phosphate cycle plants. PMID:16657384

Black, C. C.; Mayne, B. C.

1970-01-01

53

Insights into hydrogen bond donor promoted fixation of carbon dioxide with epoxides catalyzed by ionic liquids.  

PubMed

Catalytic coupling of carbon dioxide with epoxides to obtain cyclic carbonates is an important reaction that has been receiving renewed interest. In this contribution, the cycloaddition reaction in the presence of various hydrogen bond donors (HBDs) catalyzed by hydroxyl/carboxyl task-specific ionic liquids (ILs) is studied in detail. It was found that the activity of ILs could be significantly enhanced in the presence of ethylene glycol (EG), and EG/HEBimBr were the most efficient catalysts for the CO2 cycloaddition to propylene oxide. Moreover, the binary catalysts were also efficiently versatile for the CO2 cycloaddition to less active epoxides such as styrene oxide and cyclohexene oxide. Besides, the minimum energy paths for this hydrogen bond-promoted catalytic reaction were calculated using the density functional theory (DFT) method. The DFT results suggested that the ring-closing reaction was the rate-determining step in the HEBimBr-catalyzed cycloaddition reaction but the EG addition could remarkably reduce its energy barrier as the formation of a hydrogen bond between EG and the oxygen atom of epoxides led this process along the standard SN2 mechanism. As a result, the ring-opening reaction became the rate-determining step in the EG/HEBimBr-catalyzed cycloaddition reaction. The work reported herein helped the understanding and design of catalysts for efficient fixation of CO2 to epoxides via hydrogen bond activation. PMID:25639733

Liu, Mengshuai; Gao, Kunqi; Liang, Lin; Wang, Fangxiao; Shi, Lei; Sheng, Li; Sun, Jianmin

2015-02-10

54

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5?-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.  

PubMed Central

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5?- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae. PMID:23585853

Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

2013-01-01

55

Microbial microstratification, inorganic carbon photoassimilation and dark carbon fixation at the chemocline of the meromictic Lake Cadagno (Switzerland) and its relevance to the food web  

Microsoft Academic Search

The microstratification of the microbial community at the chemocline of Lake Cadagno and the associated inorganic carbon fixation activity was studied by fine layer sampling. A deep chlorophyll maximum caused by diatoms overlying Cryptomonas was found at the upper edge of the chemocline. A high population density of phototrophic sulphur bacteria, mainly Amoebobacter cf. purpureus, occurred closely below the oxic-anoxic

Antonio Camacho; Jonathan Erez; Alvaro Chicote; Máximo Florín; Margaret M. Squires; Christine Lehmann; Reinhard Backofen

2001-01-01

56

Biology of a widespread uncultivated archaeon that contributes to carbon fixation in the subsurface.  

PubMed

Subsurface microbial life contributes significantly to biogeochemical cycling, yet it remains largely uncharacterized, especially its archaeal members. This 'microbial dark matter' has been explored by recent studies that were, however, mostly based on DNA sequence information only. Here, we use diverse techniques including ultrastuctural analyses to link genomics to biology for the SM1 Euryarchaeon lineage, an uncultivated group of subsurface archaea. Phylogenomic analyses reveal this lineage to belong to a widespread group of archaea that we propose to classify as a new euryarchaeal order ('Candidatus Altiarchaeales'). The representative, double-membraned species 'Candidatus Altiarchaeum hamiconexum' has an autotrophic metabolism that uses a not-yet-reported Factor420-free reductive acetyl-CoA pathway, confirmed by stable carbon isotopic measurements of archaeal lipids. Our results indicate that this lineage has evolved specific metabolic and structural features like nano-grappling hooks empowering this widely distributed archaeon to predominate anaerobic groundwater, where it may represent an important carbon dioxide sink. PMID:25425419

Probst, Alexander J; Weinmaier, Thomas; Raymann, Kasie; Perras, Alexandra; Emerson, Joanne B; Rattei, Thomas; Wanner, Gerhard; Klingl, Andreas; Berg, Ivan A; Yoshinaga, Marcos; Viehweger, Bernhard; Hinrichs, Kai-Uwe; Thomas, Brian C; Meck, Sandra; Auerbach, Anna K; Heise, Matthias; Schintlmeister, Arno; Schmid, Markus; Wagner, Michael; Gribaldo, Simonetta; Banfield, Jillian F; Moissl-Eichinger, Christine

2014-01-01

57

Oxygen-18 incorporation into malic acid during nocturnal carbon dioxide fixation in crassulacean acid metabolism plants: a new approach to estimating in vivo carbonic anhydrase activity  

SciTech Connect

Crassulacean acid metabolism (CAM) plants fix carbon dioxide at night by the carboxylation of phosphoenolpyruvate. If CO2 fixation is conducted with TC YO2, then in the absence of carbonic anhydrase, the malate formed by dark CO2 fixation should also contain high levels of carbon-13 and oxygen-18. Conversely, if carbonic anhydrase is present and highly active, oxygen exchange between CO2 and cellular H2O will occur more rapidly than carboxylation, and the ( TC) malate formed will contain little or no oxygen-18 above the natural abundance level. The presence of oxygen-18 in these molecules can be detected either by nuclear magnetic resonance or by mass spectrometry. Studies of phosphoenolpyruvate carboxylase in the presence and absence of carbonic anhydrase in vitro confirm the validity of the method. When CAM plants are studied by this method, we find that most species show incorporation of a significant amount of oxygen-18. Comparison of these results with results of isotope fractionation and gas exchange studies permits calculation of the in vivo activity of carbonic anhydrase toward HCO3 compared with that of phosphoenolpyruvate carboxylase. The ratio (carbonic anhydrase activity/phosphoenolpyruvate carboxylase activity) is species dependent and varies from a low of about 7 for Ananas comosus to values near 20 for Hoya carnosa and Bryophyllum pinnatum, 40 for Kalanchoee daigremontiana, and 100 or greater for Bryophyllum tubiflorum, Kalanchoee serrata, and Kalanchoae tomentosa. Carbonic anhydrase activity increases relative to phosphoenolpyruvate carboxylase activity at higher temperature. 37 references, 2 figures, 8 tables.

Holtum, J.A.M.; Summons, R.; Roeske, C.A.; Comins, H.N.; O'Leary, M.H.

1984-01-01

58

Greater efficiency of photosynthetic carbon fixation due to single amino-acid substitution  

PubMed Central

The C4-photosynthetic carbon cycle is an elaborated addition to the classical C3-photosynthetic pathway, which improves solar conversion efficiency. The key enzyme in this pathway, phosphoenolpyruvate carboxylase, has evolved from an ancestral non-photosynthetic C3 phosphoenolpyruvate carboxylase. During evolution, C4 phosphoenolpyruvate carboxylase has increased its kinetic efficiency and reduced its sensitivity towards the feedback inhibitors malate and aspartate. An open question is the molecular basis of the shift in inhibitor tolerance. Here we show that a single-point mutation is sufficient to account for the drastic differences between the inhibitor tolerances of C3 and C4 phosphoenolpyruvate carboxylases. We solved high-resolution X-ray crystal structures of a C3 phosphoenolpyruvate carboxylase and a closely related C4 phosphoenolpyruvate carboxylase. The comparison of both structures revealed that Arg884 supports tight inhibitor binding in the C3-type enzyme. In the C4 phosphoenolpyruvate carboxylase isoform, this arginine is replaced by glycine. The substitution reduces inhibitor affinity and enables the enzyme to participate in the C4 photosynthesis pathway. PMID:23443546

Paulus, Judith Katharina; Schlieper, Daniel; Groth, Georg

2013-01-01

59

The reallocation of carbon in P deficient lupins affects biological nitrogen fixation.  

PubMed

It is not known how phosphate (P) deficiency affects the allocation of carbon (C) to biological nitrogen fixation (BNF) in legumes. The alteration of the respiratory and photosynthetic C costs of BNF was investigated under P deficiency. Although BNF can impose considerable sink stimulation on host respiratory and photosynthetic C, it is not known how the change in the C and energy allocation during P deficiency may affect BNF. Nodulated Lupinus luteus plants were grown in sand culture, using a modified Long Ashton nutrient solution containing no nitrogen (N) for ca. four weeks, after which one set was exposed to a P-deficient nutrient medium, while the other set continued growing on a P-sufficient nutrient medium. Phosphorus stress was measured at 20 days after onset of P-starvation. During P stress the decline in nodular P levels was associated with lower BNF and nodule growth. There was also a shift in the balance of photosynthetic and respiratory C toward a loss of C during P stress. Below-ground respiration declined under limiting P conditions. However, during this decline there was also a shift in the proportion of respiratory energy from maintenance toward growth respiration. Under P stress, there was an increased allocation of C toward root growth, thereby decreasing the amount of C available for maintenance respiration. It is therefore possible that the decline in BNF under P deficiency may be due to this change in resource allocation away from respiration associated with direct nutrient uptake, but rather toward a long term nutrient acquisition strategy of increased root growth. PMID:25155758

Kleinert, Aleysia; Venter, Mauritz; Kossmann, Jens; Valentine, Alexander

2014-11-01

60

SOS and UVM Pathways Have Lesion-Specific Additive and Competing Effects on Mutation Fixation at Replication-Blocking DNA Lesions  

PubMed Central

Escherichia coli cells have multiple mutagenic pathways that are induced in response to environmental and physiological stimuli. Unlike the well-investigated classical SOS response, little is known about newly recognized pathways such as the UVM (UV modulation of mutagenesis) response. In this study, we compared the contributions of the SOS and UVM pathways on mutation fixation at two representative noninstructive DNA lesions: 3,N4-ethenocytosine (?C) and abasic (AP) sites. Because both SOS and UVM responses are induced by DNA damage, and defined UVM-defective E. coli strains are not yet available, we first constructed strains in which expression of the SOS mutagenesis proteins UmuD? and UmuC (and also RecA in some cases) is uncoupled from DNA damage by being placed under the control of a heterologous lac-derived promoter. M13 single-stranded viral DNA bearing site-specific lesions was transfected into cells induced for the SOS or UVM pathway. Survival effects were determined from transfection efficiency, and mutation fixation at the lesion was analyzed by a quantitative multiplex sequence analysis procedure. Our results suggest that induction of the SOS pathway can independently elevate mutagenesis at both lesions, whereas the UVM pathway significantly elevates mutagenesis at ?C in an SOS-independent fashion and at AP sites in an SOS-dependent fashion. Although mutagenesis at ?C appears to be elevated by the induction of either the SOS or the UVM pathway, the mutational specificity profiles for ?C under SOS and UVM pathways are distinct. Interestingly, when both pathways are active, the UVM effect appears to predominate over the SOS effect on mutagenesis at ?C, but the total mutation frequency is significantly increased over that observed when each pathway is individually induced. These observations suggest that the UVM response affects mutagenesis not only at class 2 noninstructive lesions (?C) but also at classical SOS-dependent (class 1) lesions such as AP sites. Our results add new layers of complexity to inducible mutagenic phenomena: DNA damage activates multiple pathways that have lesion-specific additive as well as suppressive effects on mutation fixation, and some of these pathways are not directly regulated by the SOS genetic network. PMID:10049383

Rahman, M. Sayeedur; Humayun, M. Zafri

1999-01-01

61

SOS and UVM pathways have lesion-specific additive and competing effects on mutation fixation at replication-blocking DNA lesions.  

PubMed

Escherichia coli cells have multiple mutagenic pathways that are induced in response to environmental and physiological stimuli. Unlike the well-investigated classical SOS response, little is known about newly recognized pathways such as the UVM (UV modulation of mutagenesis) response. In this study, we compared the contributions of the SOS and UVM pathways on mutation fixation at two representative noninstructive DNA lesions: 3,N4-ethenocytosine (epsilonC) and abasic (AP) sites. Because both SOS and UVM responses are induced by DNA damage, and defined UVM-defective E. coli strains are not yet available, we first constructed strains in which expression of the SOS mutagenesis proteins UmuD' and UmuC (and also RecA in some cases) is uncoupled from DNA damage by being placed under the control of a heterologous lac-derived promoter. M13 single-stranded viral DNA bearing site-specific lesions was transfected into cells induced for the SOS or UVM pathway. Survival effects were determined from transfection efficiency, and mutation fixation at the lesion was analyzed by a quantitative multiplex sequence analysis procedure. Our results suggest that induction of the SOS pathway can independently elevate mutagenesis at both lesions, whereas the UVM pathway significantly elevates mutagenesis at epsilonC in an SOS-independent fashion and at AP sites in an SOS-dependent fashion. Although mutagenesis at epsilonC appears to be elevated by the induction of either the SOS or the UVM pathway, the mutational specificity profiles for epsilonC under SOS and UVM pathways are distinct. Interestingly, when both pathways are active, the UVM effect appears to predominate over the SOS effect on mutagenesis at epsilonC, but the total mutation frequency is significantly increased over that observed when each pathway is individually induced. These observations suggest that the UVM response affects mutagenesis not only at class 2 noninstructive lesions (epsilonC) but also at classical SOS-dependent (class 1) lesions such as AP sites. Our results add new layers of complexity to inducible mutagenic phenomena: DNA damage activates multiple pathways that have lesion-specific additive as well as suppressive effects on mutation fixation, and some of these pathways are not directly regulated by the SOS genetic network. PMID:10049383

Rahman, M S; Humayun, M Z

1999-03-01

62

Enhancing Carbon Fixation by Metabolic Engineering: A Model System of Complex Network Modulation  

SciTech Connect

In the first two years of this research we focused on the development of a DNA microarray for transcriptional studies in the photosynthetic organism Synechocystis and the elucidation of the metabolic pathway for biopolymer synthesis in this organism. In addition we also advanced the molecular biological tools for metabolic engineering of biopolymer synthesis in Synechocystis and initiated a series of physiological studies for the elucidation of the carbon fixing pathways and basic central carbon metabolism of these organisms. During the last two-year period we focused our attention on the continuation and completion of the last task, namely, the development of tools for basic investigations of the physiology of these cells through, primarily, the determination of their metabolic fluxes. The reason for this decision lies in the importance of fluxes as key indicators of physiology and the high level of information content they carry in terms of identifying rate limiting steps in a metabolic pathway. While flux determination is a well-advanced subject for heterotrophic organisms, for the case of autotrophic bacteria, like Synechocystis, some special challenges had to be overcome. These challenges stem mostly from the fact that if one uses {sup 13}C labeled CO{sub 2} for flux determination, the {sup 13}C label will mark, at steady state, all carbon atoms of all cellular metabolites, thus eliminating the necessary differentiation required for flux determination. This peculiarity of autotrophic organisms makes it imperative to carry out flux determination under transient conditions, something that had not been accomplished before. We are pleased to report that we have solved this problem and we are now able to determine fluxes in photosynthetic organisms from stable isotope labeling experiments followed by measurements of label enrichment in cellular metabolites using Gas Chromatography-Mass Spectrometry. We have conducted extensive simulations to test the method and also are presently validating it experimentally using data generated in collaboration with a research group at Purdue University. As result of these studies we can now determine, for the first time, fluxes in photosynthetic organisms and, eventually, in plants.

Dr. Gregory Stephanopoulos

2008-04-10

63

Simultaneous quantification of active carbon- and nitrogen-fixing communities and estimation of fixation rates using fluorescence in situ hybridization and flow cytometry.  

PubMed

Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and (14)C/(15)N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

McInnes, Allison S; Shepard, Alicia K; Raes, Eric J; Waite, Anya M; Quigg, Antonietta

2014-11-01

64

A Synthetic Recursive “+1” Pathway for Carbon Chain Elongation  

PubMed Central

Nature uses four methods of carbon chain elongation for the production of 2-ketoacids, fatty acids, polyketides, and isoprenoids. Using a combination of quantum mechanical (QM) modeling, protein–substrate modeling, and protein and metabolic engineering, we have engineered the enzymes involved in leucine biosynthesis for use as a synthetic “+1” recursive metabolic pathway to extend the carbon chain of 2-ketoacids. This modified pathway preferentially selects longer-chain substrates for catalysis, as compared to the non-recursive natural pathway, and can recursively catalyze five elongation cycles to synthesize bulk chemicals, such as 1-heptanol, 1-octanol, and phenylpropanol directly from glucose. The “+1” chemistry is a valuable metabolic tool in addition to the “+5” chemistry and “+2” chemistry for the biosynthesis of isoprenoids, fatty acids, or polyketides. PMID:22242720

Marcheschi, Ryan J.; Li, Han; Zhang, Kechun; Noey, Elizabeth L.; Kim, Seonah; Chaubey, Asha; Houk, K. N.; Liao, James C.

2013-01-01

65

Geochemical roots of autotrophic carbon fixation: hydrothermal experiments in the system citric acid, H 2O-(±FeS)-(±NiS)  

NASA Astrophysics Data System (ADS)

Recent theories have proposed that life arose from primitive hydrothermal environments employing chemical reactions analogous to the reductive citrate cycle (RCC) as the primary pathway for carbon fixation. This chemistry is presumed to have developed as a natural consequence of the intrinsic geochemistry of the young, prebiotic, Earth. There has been no experimental evidence, however, demonstrating that there exists a natural pathway into such a cycle. Toward this end, the results of hydrothermal experiments involving citric acid are used as a method of deducing such a pathway. Homocatalytic reactions observed in the citric acid-H 2O experiments encompass many of the reactions found in modern metabolic systems, i.e., hydration-dehydration, retro-Aldol, decarboxylation, hydrogenation, and isomerization reactions. Three principal decomposition pathways operate to degrade citric acid under thermal and aquathermal conditions. It is concluded that the acid catalyzed ?? decarboxylation pathway, leading ultimately to propene and CO 2, may provide the most promise for reaction network reversal under natural hydrothermal conditions. Increased pressure is shown to accelerate the principal decarboxylation reactions under strictly hydrothermal conditions. The effect of forcing the pH via the addition of NaOH reveals that the ?? decarboxylation pathway operates even up to intermediate pH levels. The potential for network reversal (the conversion of propene and CO 2 up to a tricarboxylic acid) is demonstrated via the Koch (hydrocarboxylation) reaction promoted heterocatalytically with NiS in the presence of a source of CO. Specifically, an olefin (1-nonene) is converted to a monocarboxylic acid; methacrylic acid is converted to the dicarboxylic acid, methylsuccinic acid; and the dicarboxylic acid, itaconic acid, is converted into the tricarboxylic acid, hydroaconitic acid. A number of interesting sulfur-containing products are also formed that may provide for additional reaction. The intrinsic catalytic qualities of FeS and NiS are also explored in the absence of CO. It was shown that the addition of NiS has a minimal effect in the product distribution, whereas the addition of FeS leads to the formation of hydrogenated and sulfur-containing products (thioethers). These results point to a simple hydrothermal redox pathway for citric acid synthesis that may have provided a geochemical ignition point for the reductive citrate cycle.

Cody, G. D.; Boctor, N. Z.; Hazen, R. M.; Brandes, J. A.; Morowitz, Harold J.; Yoder, H. S.

2001-10-01

66

Will Elevated Carbon Dioxide Concentration Amplify the Benefits of Nitrogen Fixation in Legumes?  

Technology Transfer Automated Retrieval System (TEKTRAN)

Current evidence suggests there are three key features of the response of legumes to elevated [CO2]: (1) unlike other non-leguminous C3 plants, only legumes have the potential to maximize the benefit of elevated [CO2] by matching stimulated photosynthesis with increased N2 fixation; (2) this potenti...

67

Ammonia fixation by humic substances: A nitrogen-15 and carbon-13 NMR study  

USGS Publications Warehouse

The process of ammonia fixation has been studied in three well characterized and structurally diverse fulvic and humic acid samples. The Suwannee River fulvic acid, and the IHSS peat and leonardite humic acids, were reacted with 15N-labelled ammonium hydroxide, and analyzed by liquid phase 15N NMR spectrometry. Elemental analyses and liquid phase 13C NMR spectra also were recorded on the samples before and after reaction with ammonium hydroxide. The largest increase in percent nitrogen occurred with the Suwannee River fulvic acid, which had a nitrogen content of 0.88% before fixation and 3.17% after fixation. The 15N NMR spectra revealed that ammonia reacted similarly with all three samples, indicating that the functional groups which react with ammonia exist in structural configurations common to all three samples. The majority of nitrogcn incorporated into the samples appears to be in the form of indole and pyrrole nitrogen, followed by pyridine, pyrazine, amide and aminohydroquinone nitrogen. Chemical changes in the individual samples upon fixation could not be discerned from the 13C NMR spectra.

Thorn, K.A.; Mikita, M.A.

1992-01-01

68

Single cell protein production of Euglena gracilis and carbon dioxide fixation in an innovative photo-bioreactor.  

PubMed

The biological fixation using microalgae has been known as an effective and economical carbon dioxide reduction technology. Carbon dioxide (CO2) fixation by microalgae has been shown to be effective and economical. Among various algae, a species Euglena gracilis was selected as it has advantages such as high protein content and high digestibility for animal feed. A kinetic model was studied in order to determine the relationship between specific growth rate and light intensity. The half-saturation constant for light intensity in the Monod model was 178.7 micromol photons/m2/s. The most favorable initial pH, temperature, and CO2 concentration were found to be 3.5, 27 degrees C, and 5-10% (vol/vol), respectively. Light intensity and hydraulic retention time were tested for effects on cell yield in a laboratory-scale photo-bioreactor of 100l working volume followed by semi-continuous and continuous culture. Subsequently, an innovative pilot-scale photo-bioreactor that used sunlight and flue gas was developed to increase production of this bioresource. The proposed pilot-scale reactor showed improved cell yield compared with the laboratory-scale reactor. PMID:16171688

Chae, S R; Hwang, E J; Shin, H S

2006-01-01

69

13C Metabolic Flux Analysis Identifies an Unusual Route for Pyruvate Dissimilation in Mycobacteria which Requires Isocitrate Lyase and Carbon Dioxide Fixation  

PubMed Central

Mycobacterium tuberculosis requires the enzyme isocitrate lyase (ICL) for growth and virulence in vivo. The demonstration that M. tuberculosis also requires ICL for survival during nutrient starvation and has a role during steady state growth in a glycerol limited chemostat indicates a function for this enzyme which extends beyond fat metabolism. As isocitrate lyase is a potential drug target elucidating the role of this enzyme is of importance; however, the role of isocitrate lyase has never been investigated at the level of in vivo fluxes. Here we show that deletion of one of the two icl genes impairs the replication of Mycobacterium bovis BCG at slow growth rate in a carbon limited chemostat. In order to further understand the role of isocitrate lyase in the central metabolism of mycobacteria the effect of growth rate on the in vivo fluxes was studied for the first time using 13C-metabolic flux analysis (MFA). Tracer experiments were performed with steady state chemostat cultures of BCG or M. tuberculosis supplied with 13C labeled glycerol or sodium bicarbonate. Through measurements of the 13C isotopomer labeling patterns in protein-derived amino acids and enzymatic activity assays we have identified the activity of a novel pathway for pyruvate dissimilation. We named this the GAS pathway because it utilizes the Glyoxylate shunt and Anapleurotic reactions for oxidation of pyruvate, and Succinyl CoA synthetase for the generation of succinyl CoA combined with a very low flux through the succinate – oxaloacetate segment of the tricarboxylic acid cycle. We confirm that M. tuberculosis can fix carbon from CO2 into biomass. As the human host is abundant in CO2 this finding requires further investigation in vivo as CO2 fixation may provide a point of vulnerability that could be targeted with novel drugs. This study also provides a platform for further studies into the metabolism of M. tuberculosis using 13C-MFA. PMID:21814509

Beste, Dany J. V.; Bonde, Bhushan; Hawkins, Nathaniel; Ward, Jane L.; Beale, Michael H.; Noack, Stephan; Nöh, Katharina; Kruger, Nicholas J.; Ratcliffe, R. George; McFadden, Johnjoe

2011-01-01

70

Abstract In zooxanthellate corals, the photosynthetic fixation of carbon dioxide and the precipitation of  

E-print Network

performed this study to characterize T. aurea carbonic anhydrase and to determine its role, which shares common features with prokary- otic carbonic anhydrases. Keywords Carbonic anhydrase Á Carbon Á Calcification Á Coral Á Biomineralization Á Organic matrix Abbreviations CA Carbonic anhydrase

Adkins, Jess F.

71

Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use  

SciTech Connect

Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such as sulfide and CO2. Remarkably little is known about the physiological strategies that enable chemosynthetic symbioses to colonize oligotrophic environments. In this study, we used metaproteomics and metabolomics to investigate the intricate network of metabolic interactions in the chemosynthetic association between Olavius algarvensis, a gutless marine worm, and its bacterial symbionts. We propose novel pathways for coping with energy and nutrient limitation, some of which may be widespread in both free-living and symbiotic bacteria. These include (i) a pathway for symbiont assimilation of the host waste products acetate, propionate, succinate and malate, (ii) the potential use of carbon monoxide as an energy source, a substrate previously not known to play a role in marine invertebrate symbioses, (iii) the potential use of hydrogen as an energy source, (iv) the strong expression of high affinity uptake transporters, and (v) novel energy efficient steps in CO2 fixation and sulfate reduction. The high expression of proteins involved in pathways for energy and carbon uptake and conservation in the O. algarvensis symbiosis indicates that the oligotrophic nature of its environment exerted a strong selective pressure in shaping these associations.

Kleiner, Manuel [Max Planck Institute for Marine Microbiology; Wentrop, C. [Max Planck Institute for Marine Microbiology; Lott, C. [Max Planck Institute for Marine Microbiology; Teeling, Hanno [Max Planck Institute for Marine Microbiology; Wetzel, Silke [Max Planck Institute for Marine Microbiology; Young, Jacque C [ORNL; Chang, Y. [Oak Ridge National Laboratory (ORNL); Shah, Manesh B [ORNL; Verberkmoes, Nathan C [ORNL; Zarzycki, Jan [University of Freiburg, Germany; Fuchs, Georg [University of Freiburg, Germany; Markert, Stephanie [Institute of Marine Biotechnology, Germany; Hempel, Kristina [Institute for Microbiology, Germany

2012-01-01

72

Crop yield and CO2 fixation monitoring over Asia by a photosynthetic-sterility model comparing with MODIS and carbon amounts in grain yields  

NASA Astrophysics Data System (ADS)

The authors have developed a photosynthesis crop model for grain production under the background of climate change and Asian economic growth in developing countries. This paper presents an application of the model to grain fields of paddy rice, winter wheat, and maize in China and Southeast Asia. The carbon hydrate in grains has the same chemical formula as that of cellulose in grain vegetation. The partitioning of carbon in grain plants can validate fixation amounts of computed carbon using a satellite-based photosynthesis model. The model estimates the photosynthesis fixation of rice reasonably in Japan and China. Results were validated through examination of carbon in grains, but the model tends to underestimate results for winter wheat and maize. This study also provides daily distributions of the PSN, which is the CO2 fixation in Asian areas combined with a land-cover distribution classified from MODIS data, NDVI from SPOT VEGETATION, and meteorological re-analysis data by European Centre for Medium-Range Forecasts (ECMWF). The mean CO2 and carbon fixation rates in paddy areas were 25.92 (t CO2/ha) and 5.28 (t/ha) in Japan, respectively. The method is based on routine observation data, enabling automated monitoring of crop yields.

Kaneko, Daijiro; Yang, Peng; Kumakura, Toshiro

2009-08-01

73

Role of Intracellular Carbon Metabolism Pathways in Shigella flexneri Virulence  

PubMed Central

Shigella flexneri, which replicates in the cytoplasm of intestinal epithelial cells, can use the Embden-Meyerhof-Parnas, Entner-Doudoroff, or pentose phosphate pathway for glycolytic carbon metabolism. To determine which of these pathways is used by intracellular S. flexneri, mutants were constructed and tested in a plaque assay for the ability to invade, replicate intracellularly, and spread to adjacent epithelial cells. Mutants blocked in the Embden-Meyerhof-Parnas pathway (pfkAB and pykAF mutants) invaded the cells but formed very small plaques. Loss of the Entner-Doudoroff pathway gene eda resulted in small plaques, but the double eda edd mutant formed normal-size plaques. This suggested that the plaque defect of the eda mutant was due to buildup of the toxic intermediate 2-keto-3-deoxy-6-phosphogluconic acid rather than a specific requirement for this pathway. Loss of the pentose phosphate pathway had no effect on plaque formation, indicating that it is not critical for intracellular S. flexneri. Supplementation of the epithelial cell culture medium with pyruvate allowed the glycolysis mutants to form larger plaques than those observed with unsupplemented medium, consistent with data from phenotypic microarrays (Biolog) indicating that pyruvate metabolism was not disrupted in these mutants. Interestingly, the wild-type S. flexneri also formed larger plaques in the presence of supplemental pyruvate or glucose, with pyruvate yielding the largest plaques. Analysis of the metabolites in the cultured cells showed increased intracellular levels of the added compound. Pyruvate increased the growth rate of S. flexneri in vitro, suggesting that it may be a preferred carbon source inside host cells. PMID:24733092

Waligora, E. A.; Fisher, C. R.; Hanovice, N. J.; Rodou, A.; Wyckoff, E. E.

2014-01-01

74

Impact of ultraviolet-B radiation on photosystem II activity and its relationship to the inhibition of carbon fixation rates for antarctic ice algae communities  

SciTech Connect

One goal of the Icecolors 1993 study was to determine whether or not photosystem II (PSII) was a major target site for photoinhibition by ultraviolet-B radiation (Q{sub UVB}, 280-320 nm) in natural communities. Second, the degree to which Q{sub UVB} inhibition of PSII could account for Q{sub UVB} effects on whole cell rates of carbon fixation in phytoplankton was assessed. On 1 October, 1993, at Palmer Station (Antarctica), dense samples of a frazil ice algal community were collected and maintained outdoors in the presence or absence of Q{sub UVB} and/or ultraviolet-A (Q{sub UVA}, 320-400 nm) radiation. The time of day course of UV inhibition of primary production was tracted. Over the day, {phi}{sub IIe}{degrees} declined due to increasing time-integrated dose exposure of Q{sub UVB}. The Q{sub UVB}-driven inhibition of {phi}{sub IIe}{degrees} increased from 4% in the early morning hours to a maximum of 23% at the end of the day. The Q{sub UVB} photoinhibition of PSII quantum yield did not recover by 6 h after sunset. In contrast, photoinhibition by Q{sub UVA} and photosynthetically available radiation (Q{sub PAR}, 400-700 nm) recovered during the late afternoon. Fluorescence-based estimates of carbon fixation rates were linearly correlated with measured carbon fixation. Fluorescence overestimated the observed Q{sub UVB} inhibition in measured carbon fixation rates. Researchers should be cautious in using fluorescence measurements to infer ultraviolet inhibition for rates of carbon fixation until there is a greater understanding of the coupling of carbon metabolism to PSII activity for natural populations. Despite these current limitations, fluorescence-based technologies represent powerful tools for studying the impact of the ozone hole on natural populations on spatial/temporal scales not possible using conventional productivity techniques. 55 refs., 11 figs., 2 tabs.

Schofield, O.; Prezelin, B.B. [Univ. of California, Santa Barbara, CA (United States); Kroon, B.M.A. [Univ. of Amsterdam (Netherlands)

1995-10-01

75

RuBP limitation of photosynthetic carbon fixation during NH sub 3 assimilation: Interactions between photosynthesis, respiration, and ammonium assimilation in N-limited green algae  

SciTech Connect

The effects of ammonium assimilation on photosynthetic carbon fixation and O{sub 2} exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP) concentration and the RuBP binding site density of ribulose bisphosphate carboxylase/oxygenase (Rubisco). In both species, ammonium assimilation resulted in a decrease in RuBP concentration. In S. minutum the concentration fell below the RuBP binding site density of Rubisco, indicating RuBP limitation of carboxylation. In contrast, RuBP concentration remained above the binding site density in C. pyrenoidosa. Compromising RuBP regeneration in C. pyrenoidosa with low light resulted in an ammonium-induced decrease in RuBP concentration below the RuBP binding site density of Rubisco. This resulted in a decrease in photosynthetic carbon fixation. In both species, ammonium assimilation resulted in a larger decrease in net O{sub 2} evolution than in carbon fixation. Mass spectrometric analysis shows this to be a result of an increase in the rate of mitochondrial respiration in the light.

Elrifi, I.R.; Holmes, J.J.; Weger, H.G.; Mayo, W.P.; Turpin, D.H. (Queen's Univ., Kingston, Ontario (Canada))

1988-06-01

76

Carbon dioxide fixation by microalgae photosynthesis using actual flue gas discharged from a boiler  

Microsoft Academic Search

To mitigate CO2 discharged from thermal power plants, studies on CO2 fixation by the photosynthesis of microalgae using actual exhaust gas have been carried out. The results are as follows.\\u000a \\u000a \\u000a 1. \\u000a \\u000a A method is proposed for evaluating the maximum photosynthesis rate in the raceway cultivator using only the algal physical\\u000a properties;\\u000a \\u000a \\u000a \\u000a \\u000a 2. \\u000a \\u000a Outdoor cultivation tests taking actual flue gas were

Hiroyo Matsumoto; Norio Shioji; Akihiro Hamasaki; Yoshiaki Ikuta; Yoshinori Fukuda; Minoru Sato; Noriyoshi Endo; Toshiaki Tsukamoto

1995-01-01

77

Activity of carbon dioxide fixation by anthers and leaves of cereal grains  

SciTech Connect

This paper gives a comparative evaluation of the photosynthetic activity of anthers and flag leaves in winter wheat, rye, and triticale. The content of chlorophylls in anthers and leaves was determined. The activity of /sup 14/CO/sub 2/ fixation by anthers and leaf disks was determined by the radiometric method in a chamber floating on mercury under standard exposure conditions (0.1% concentration of /sup 14/CO/sub 2/, illumination of 15,000 1x, temperature of 23 C). Analyses were conducted in three replications and the results of typical biological experiments are cited. Data show that chlorophyll is actively synthesized in the anthers of cereal grains.

Kirichenko, E.B.; Chernyad'ev, I.I.; Doman, N.G.; Talibullina, K.K.; Voronkova, T.V.

1986-05-01

78

Quantifying thermodynamic bottlenecks of metabolic pathways  

E-print Network

Quantifying thermodynamic bottlenecks of metabolic pathways Elad Noor TAU, October 2012 #12;Hulda S select the best candidate for synthetic metabolism? Bar-Even, Noor, Lewis, Milo PNAS, 2010 #12;OptimizingBottleneckEnergetics[kJ/mol] #12;Example: comparing carbon fixation pathway alternatives Natural Synthetic Bar-Even, Noor, Lewis

Beimel, Amos

79

Carbon cost of plant nitrogen acquisition: A mechanistic, globally applicable model of plant nitrogen uptake, retranslocation, and fixation  

NASA Astrophysics Data System (ADS)

Nitrogen (N) generally limits plant growth and controls biosphere responses to climate change. We introduce a new mathematical model of plant N acquisition, called Fixation and Uptake of Nitrogen (FUN), based on active and passive soil N uptake, leaf N retranslocation, and biological N fixation. This model is unified under the theoretical framework of carbon (C) cost economics, or resource optimization. FUN specifies C allocated to N acquisition as well as remaining C for growth, or N-limitation to growth. We test the model with data from a wide range of sites (observed versus predicted N uptake r2 is 0.89, and RMSE is 0.003 kg N m-2·yr-1). Four model tests are performed: (1) fixers versus nonfixers under primary succession; (2) response to N fertilization; (3) response to CO2 fertilization; and (4) changes in vegetation C from potential soil N trajectories for five DGVMs (HYLAND, LPJ, ORCHIDEE, SDGVM, and TRIFFID) under four IPCC scenarios. Nonfixers surpass the productivity of fixers after ˜150-180 years in this scenario. FUN replicates the N uptake response in the experimental N fertilization from a modeled N fertilization. However, FUN cannot replicate the N uptake response in the experimental CO2 fertilization from a modeled CO2 fertilization; nonetheless, the correct response is obtained when differences in root biomass are included. Finally, N-limitation decreases biomass by 50 Pg C on average globally for the DGVMs. We propose this model as being suitable for inclusion in the new generation of Earth system models that aim to describe the global N cycle.

Fisher, J. B.; Sitch, S.; Malhi, Y.; Fisher, R. A.; Huntingford, C.; Tan, S.-Y.

2010-03-01

80

N2 Fixation, Carbon Metabolism, and Oxidative Damage in Nodules of Dark-Stressed Common Bean Plants.  

PubMed Central

Common beans (Phaseolus vulgaris L.) were exposed to continuous darkness to induce nodule senescence, and several nodule parameters were investigated to identify factors that may be involved in the initial loss of N2 fixation. After only 1 d of darkness, total root respiration decreased by 76% and in vivo nitrogenase (N2ase) activity decreased by 95%. This decline coincided with the almost complete depletion (97%) of sucrose and fructose in nodules. At this stage, the O2 concentration in the infected zone increased to 1%, which may be sufficient to inactivate N2ase; however, key enzymes of carbon and nitrogen metabolism were still active. After 2 d of dark stress there was a significant decrease in the level of N2ase proteins and in the activities of enzymes involved in carbon and nitrogen assimilation. However, the general collapse of nodule metabolism occurred only after 4 d of stress, with a large decline in leghemoglobin and antioxidants. At this final senescent stage, there was an accumulation of oxidatively modified proteins. This oxidative stress may have originated from the decrease in antioxidant defenses and from the Fe-catalyzed generation of activated oxygen due to the increased availability of catalytic Fe and O2 in the infected region. PMID:12223669

Gogorcena, Y.; Gordon, A. J.; Escuredo, P. R.; Minchin, F. R.; Witty, J. F.; Moran, J. F.; Becana, M.

1997-01-01

81

Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities  

PubMed Central

The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope–probing experiments with and without methane. The relative incorporation of 13C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both 13C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs. PMID:23129626

Kellermann, Matthias Y.; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe

2012-01-01

82

The carbon assimilation pathways of Methylococcus capsulatus, Pseudomonas methanica and Methylosinus trichosporium (OB3B) during growth on methane  

PubMed Central

d-arabino-3-Hexulose 6-phosphate was prepared by condensation of formaldehyde with ribulose 5-phosphate in the presence of 3-hexulose phosphate synthase from methane-grown Methylococcus capsulatus. The 3-hexulose phosphate was unstable in solutions of pH greater than 3, giving a mixture of products in which, after dephosphorylation, allulose and fructose were detected. A complete conversion of d-ribulose 5-phosphate and formaldehyde into d-fructose 6-phosphate was demonstrated in the presence of 3-hexulose phosphate synthase and phospho-3-hexuloisomerase (prepared from methane-grown M. capsulatus). d-Allulose 6-phosphate was prepared from d-allose by way of d-allose 6-phosphate. No evidence was found for its metabolism by extracts of M. capsulatus, thus eliminating it as an intermediate in the carbon assimilation process of this organism. A survey was made of the enzymes involved in the regeneration of pentose phosphate during C1 assimilation via a modified pentose phosphate cycle. On the basis of the presence of the necessary enzymes, two alternative routes for cleavage of fructose 6-phosphate are suggested, one route involves fructose diphosphate aldolase and the other 6-phospho-2-keto-3-deoxygluconate aldolase. A detailed formulation of the complete ribulose monophosphate cycle of formaldehyde fixation is presented. The energy requirements for carbon assimilation by this cycle are compared with those for the serine pathway and the ribulose diphosphate cycle of carbon dioxide fixation. A cyclic scheme for oxidation of formaldehyde via 6-phosphogluconate is suggested. PMID:4377654

Strøm, Terje; Ferenci, Thomas; Quayle, J. Rodney

1974-01-01

83

Regulation of photosynthetic carbon fixation on the ocean margins. Final report  

SciTech Connect

The US Department of Energy is concerned with the fate of energy-related materials, including carbon dioxide, in the marine environment. Using laboratory studies, as well as field studies, an attempt was made to understand the molecular regulation of photosynthetic carbon reduction. The objectives were: to determine the mechanism of regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBPCase) in phytoplankton in response to changes in light fields; and to determine regulation of (RuBPCase) in response to light under nutrient deprivation.

Paul, J.H.

1997-06-01

84

Chemolithotrophic nitrite oxidation by Nitrobacter: coupling with carbon dioxide fixation for growth and influence of metal ions and inorganic compounds of sulfur  

SciTech Connect

The growth of Nitrobacter winogradskyi was completely inhibited by 0.1 mM persulfate, 0.5 mM tetrathionate, or by 5 mM each of dithionite, metabisulfite, or trithionate. The oxygen uptake activity of washed N. agilis cell suspensions was not influenced by persulfate or tetrathionate. Carbon dioxide fixation was insensitive to tetrathionate and in fact an enhancement by tetrathionate was observed. Persulfate inhibited the fixation of carbon dioxide only at a high concentration. The oxygen uptake activity of washed ell suspensions of N. agilis was tested in the presence of copper, nickel, aluminum, uranyl, and molybdate ions. Copper ion was slightly stimulatory at 0.17 M and strongly inhibitory at 17 mM. Molybdate ion showed either slight enhancement or no inhibition at all test concentrations. With the other test ions inhibition of oxygen uptake was observed.

Tsai, Y.L.

1986-01-01

85

Carbonate hydroxyapatite functionalization: a comparative study towards (bio)molecules fixation  

PubMed Central

Different methods for the functionalization of carbonate hydroxyapatite granules with free amine groups by reaction with (3-aminopropyl)triethoxysilane (APTES) have been compared in order to improve the potential for tethering of bioactive molecules to bioceramics. The combined use of tetraethoxyorthosilicate and APTES with acid catalysis resulted in an evident increase in amine surface grafting. PMID:24501671

Russo, Laura; Taraballi, Francesca; Lupo, Cristina; Poveda, Ana; Jiménez-Barbero, Jesús; Sandri, Monica; Tampieri, Anna; Nicotra, Francesco; Cipolla, Laura

2014-01-01

86

Pathways of Carbon and Energy Metabolism of the Epibiotic Community Associated with the Deep-Sea Hydrothermal Vent Shrimp Rimicaris exoculata  

PubMed Central

Background The shrimp Rimicaris exoculata dominates the faunal biomass at many deep-sea hydrothermal vent sites at the Mid-Atlantic Ridge. In its enlarged gill chamber it harbors a specialized epibiotic bacterial community for which a nutritional role has been proposed. Methodology/Principal Findings We analyzed specimens from the Snake Pit hydrothermal vent field on the Mid-Atlantic Ridge by complementing a 16S rRNA gene survey with the analysis of genes involved in carbon, sulfur and hydrogen metabolism. In addition to Epsilon- and Gammaproteobacteria, the epibiotic community unexpectedly also consists of Deltaproteobacteria of a single phylotype, closely related to the genus Desulfocapsa. The association of these phylogenetic groups with the shrimp was confirmed by fluorescence in situ hybridization. Based on functional gene analyses, we hypothesize that the Gamma- and Epsilonproteobacteria are capable of autotrophic growth by oxidizing reduced sulfur compounds, and that the Deltaproteobacteria are also involved in sulfur metabolism. In addition, the detection of proteobacterial hydrogenases indicates the potential for hydrogen oxidation in these communities. Interestingly, the frequency of these phylotypes in 16S rRNA gene clone libraries from the mouthparts differ from that of the inner lining of the gill chamber, indicating potential functional compartmentalization. Conclusions Our data show the specific association of autotrophic bacteria with Rimicaris exoculata from the Snake Pit hydrothermal vent field, and suggest that autotrophic carbon fixation is contributing to the productivity of the epibiotic community with the reductive tricarboxylic acid cycle as one important carbon fixation pathway. This has not been considered in previous studies of carbon fixation and stable carbon isotope composition of the shrimp and its epibionts. Furthermore, the co-occurrence of sulfur-oxidizing and sulfur-reducing epibionts raises the possibility that both may be involved in the syntrophic exchange of sulfur compounds, which could increase the overall efficiency of this epibiotic community. PMID:21249205

Hügler, Michael; Petersen, Jillian M.; Dubilier, Nicole; Imhoff, Johannes F.; Sievert, Stefan M.

2011-01-01

87

Investigation of metallic and carbon fibre PEEK fracture fixation devices for three-part proximal humeral fractures.  

PubMed

A computational investigation of proximal humeral fracture fixation has been conducted. Four devices were selected for the study; a locking plate, intramedullary nail (IM Nail), K-wires and a Bilboquet device. A 3D model of a humerus was created using a process of thresholding based on the grayscale values of a CT scan of an intact humerus. An idealised three part fracture was created in addition to removing a standard volume from the humeral head as a representation of bone voids that occur as a result of the injury. All finite element simulations conducted represent 90° arm abduction. Simulations were conducted to investigate the effect of filling this bone void with calcium phosphate cement for each device. The effect of constructing devices from carbon fibre polyetheretherketone (CFPEEK) was investigated. Simulations of cement reinforced devices predict greater stability for each device. The average unreinforced fracture line opening (FLO) is reduced by 48.5% for metallic devices with a lesser effect on composite devices with FLO reduced by 23.6%. Relative sliding (shear displacement) is also reduced between fracture fragments by an average of 58.34%. CFPEEK device simulations predict reduced stresses at the device-bone interface. PMID:22989528

Feerick, Emer M; Kennedy, Jim; Mullett, Hannan; FitzPatrick, David; McGarry, Patrick

2013-06-01

88

Edinburgh Research Explorer Modelling Urban scale Retrofit, Pathways to 2050 Low Carbon  

E-print Network

Edinburgh Research Explorer Modelling Urban scale Retrofit, Pathways to 2050 Low Carbon Residential date: 28. Jun. 2014 #12;MODELLING URBAN SCALE RETROFIT, PATHWAYS TO 2050 LOW CARBON RESIDENTIAL Building Stock Citation for published version: Lannon, S, Georgakaki, A & Macdonald, S 2013, 'Modelling

Millar, Andrew J.

89

Pyrolysis pathways of sulfonated polyethylene, an alternative carbon fiber precursor.  

PubMed

Polyethylene is an emerging precursor material for the production of carbon fibers. Its sulfonated derivative yields ordered carbon when pyrolyzed under inert atmosphere. Here, we investigate its pyrolysis pathways by selecting n-heptane-4-sulfonic acid (H4S) as a model compound. Density functional theory and transition state theory were used to determine the rate constants of pyrolysis for H4S from 300 to 1000 K. Multiple reaction channels from two different mechanisms were explored: (1) internal five-centered elimination (Ei5) and (2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain thermogravimetric (TGA) plots that compared favorably to experiment. We observed that at temperatures <550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial ?H radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440 to 460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene (~31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOS?2 became competitive to ?-H abstraction by HOS?2, making ?H the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures >600 K. Low-scale carbonization utilizes temperatures <620 K; thus, internal elimination will not be competitive. E(i)5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. PMID:23560686

Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A; Naskar, Amit K; Beste, Ariana

2013-04-24

90

Biochemistry and control of the reductive tricarboxylic acid pathway of CO2 fixation and physiological role of the RubisCO-like protein  

SciTech Connect

During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris. 1. Reductive TCA pathway of CO2 assimilation Many diverse microorganisms use the reductive TCA (RTCA) pathway for CO2 assimilation. Included are photoautotrophic and chemoautotrophic organisms that occupy important niches in various ecosystems. Inasmuch as the biochemistry and regulation of the RTCA pathway has been virtually neglected, especially in comparison to the Calvin-Benson-Bassham (CBB) reductive pentose pathway of CO2 fixation, we sought to develop a system that would allow for detailed biochemical analysis of the RTCA enzymes and associated proteins, along with the genes that encode these proteins. We have focused on the green sulfur photosynthetic bacterium Chlorobium tepidum, a fast growing moderate thermophile originally isolated by Professor Mike Madigan and colleagues. Because of its rapid growth and relative ease to produce massive cell amounts via high-density fermentator vessels, C. tepidum has become the organism of choice for investigators interested in studying all aspects of the physiology and biochemistry of green sulfur bacteria. Moreover, this organism possesses a very convenient natural transformation system that allows routine genetic transfer and the generation of knockout mutations via homologous recombination at specific genetic loci. The first such mutations were generated in our laboratory [Hanson & Tabita, PNAS USA, 98 (2001), 4397-4402], such that these protocols have now become relatively routine. Moreover, the genome of C. tepidum was recently sequenced. Thus, all the tools are in place for productive analysis of key processes catalyzed by this organism, in particular for analysis of the RTCA pathway and the rather unique RubisCO-like protein (RLP) that we first discovered during the last grant period of this project [Hanson & Tabita, 2001]. We have concentrated on the enzymology of the key proteins of this pathway, in particular pyruvate synthase (PS), ?-ketoglutarate synthase (KGS), and ATP-citrate lyase (ACL). In addition, we have also focused on key electron transfer proteins that must provide needed reducing equivalents to PS and KGS, including two separate ferredoxins that were shown to be abundantly produced by this organism. 2. Physiological/biochemical/genetic studies on the RubisCO-like Protein (RLP) During the prior grant period we identified what we believe is an evolutional precursor to bona fide RubisCO in C. tepidum, the RubisCO-like protein (RLP) [Hanson & Tabita, 2001]. Typical bioinformatics software incorrectly indicates that RLP is RubisCO, however our previous experience with RubisCO enabled us to establish that C. tepidum RLP has substitutions in 9 out of the 19 residues known to be important for RubisCO-catalyzed CO2 fixation. After purifying recombinant RLP, we showed that the RLP is not a bona fide RubisCO that catalyzes RuBP-dependent CO2 fixation, but appears to function in some aspect of the oxidation of reduced sulfur compounds by this organism. More recent studies [Hanson & Tabita, Photosynth. Res. 78 (2003) 231-248] during the past grant period have established that this effect is related to some aspect of thiosulfate oxidation in the reduced sulfur compound oxidation pathway, as sulfide oxidation was not affected. When we first discovered the RLP, we noted that RLP homologs were also found in other organisms, including heterotrophic bacteria and at least one archaeon [Hanson & Tabita, 2001, 2003]. Finally, as long-time Rubiscologists we have always been intrigued with how the active site of RubisCO might have evolved for its key functional role in metabolizing CO2 and O2 [Tabita, Photosynth. Res. 60 (1999) 1-

Tabita, F Robert

2008-12-04

91

Effects of dissolved inorganic carbon and nutrient levels on carbon fixation and properties of Thermosynechococcus sp. in a continuous system.  

PubMed

The concept of CO(2) chemo-absorption by sodium hydroxide in a wet scrubber followed by microalgae cultivation was used as a means to reduce the major greenhouse gas. A thermophilic and alkaline tolerable cyanobacterium named Thermosynechococcus CL-1 (TCL-1) was cultivated in continuous system, with a carbonate-bicarbonate buffer as carbon source. The effects of dissolved inorganic carbon (DIC(in)) and nutrient levels in influent on cell mass productivity, DIC removal efficiency, and alkaline solution regeneration by TCL-1 were investigated. The results show the highest cell mass productivity reaches 1.7 g L(-1)d(-1) under the highest DIC and nutrients level. Conversely, the best regeneration of alkaline solution proceeds from pH 9.5 to 11.3 under the lowest level. In addition, the highest ?DIC (DIC consumption) and DIC removal efficiency are 42 mM and 43% at 113.2 and 57 mM DIC(in), respectively. PMID:22560699

Su, Chih Ming; Hsueh, Hsin Ta; Chen, Hsing Hui; Chu, Hsin

2012-07-01

92

Nitrogen fixation within a tropical upwelling ecosystem: Evidence for a Redfield budget of carbon/nitrogen cycling by the total phytoplankton community  

NASA Astrophysics Data System (ADS)

Recent measurements and paradigms suggest that (1) the uptake of dissolved carbon and nitrate by phytoplankton may be greater than the Redfield ratio of 6.6 and (2) the oceans may be loosing nitrogen from an imbalance in the global rates of nitrogen fixation and denitrification. An analysis of concurrent ?DIC/?NO3 depletion ratios within the Venezuelan and Peruvian upwelling ecosystems, indeed, suggests that values of 10.1-28.6 may pertain to these tropical eutrophic habitats. Nitrogen fixation may provide a Redfield balance in at least the former system, with 34-77% of the new production attributed to assimilation of N2. Independent confirmation of such new production on the Venezuelan shelf is provided by the interannual increases of H2S and DIC within the adjacent Cariaco Trench.

Walsh, John J.

1996-09-01

93

Will elevated carbon dioxide concentration amplify the benefits of nitrogen fixation in legumes?  

SciTech Connect

Growth at elevated [CO{sub 2}] stimulates photosynthesis and increases carbon (C) supply in all C3 species. A sustained and maximal stimulation in productivity at elevated [CO{sub 2}] requires an enhanced nutrient supply to match the increase in C acquisition. The ability of legumes to exchange C for nitrogen (N) with their N{sub 2}-fixing symbionts has led to the hypothesis that legumes will have a competitive advantage over nonleguminous species when grown at elevated [CO{sub 2}]. On balance, evidence suggests that in managed systems, legumes are more responsive to elevated [CO{sub 2}] than other plants (e.g. Ainsworth and Long, 2005); however, in natural ecosystems, nutrient availability can limit the response of legumes to elevated [CO{sub 2}] (Hungate et al., 2004; van Groenigen et al., 2006). Here, we consider these observations, outline the mechanisms that underlie them, and examine recent work that advances our understanding of how legumes respond to growth at elevated [CO{sub 2}]. First we highlight the global importance of legumes and provide a brief overview of the symbiotic relationship.

Rogers, A.; Ainsworth, E. A.; Leakey, A. D. B.

2009-11-01

94

How sensitive are estimates of carbon fixation in agricultural models to input data?  

PubMed Central

Background Process based vegetation models are central to understand the hydrological and carbon cycle. To achieve useful results at regional to global scales, such models require various input data from a wide range of earth observations. Since the geographical extent of these datasets varies from local to global scale, data quality and validity is of major interest when they are chosen for use. It is important to assess the effect of different input datasets in terms of quality to model outputs. In this article, we reflect on both: the uncertainty in input data and the reliability of model results. For our case study analysis we selected the Marchfeld region in Austria. We used independent meteorological datasets from the Central Institute for Meteorology and Geodynamics and the European Centre for Medium-Range Weather Forecasts (ECMWF). Land cover / land use information was taken from the GLC2000 and the CORINE 2000 products. Results For our case study analysis we selected two different process based models: the Environmental Policy Integrated Climate (EPIC) and the Biosphere Energy Transfer Hydrology (BETHY/DLR) model. Both process models show a congruent pattern to changes in input data. The annual variability of NPP reaches 36% for BETHY/DLR and 39% for EPIC when changing major input datasets. However, EPIC is less sensitive to meteorological input data than BETHY/DLR. The ECMWF maximum temperatures show a systematic pattern. Temperatures above 20°C are overestimated, whereas temperatures below 20°C are underestimated, resulting in an overall underestimation of NPP in both models. Besides, BETHY/DLR is sensitive to the choice and accuracy of the land cover product. Discussion This study shows that the impact of input data uncertainty on modelling results need to be assessed: whenever the models are applied under new conditions, local data should be used for both input and result comparison. PMID:22296931

2012-01-01

95

Regulation of Multiple Carbon Monoxide Consumption Pathways in Anaerobic Bacteria  

PubMed Central

Carbon monoxide (CO), well known as a toxic gas, is increasingly recognized as a key metabolite and signaling molecule. Microbial utilization of CO is quite common, evidenced by the rapid escalation in description of new species of CO-utilizing bacteria and archaea. Carbon monoxide dehydrogenase (CODH), the protein complex that enables anaerobic CO-utilization, has been well-characterized from an increasing number of microorganisms, however the regulation of multiple CO-related gene clusters in single isolates remains unexplored. Many species are extraordinarily resistant to high CO concentrations, thriving under pure CO at more than one atmosphere. We hypothesized that, in strains that can grow exclusively on CO, both carbon acquisition via the CODH/acetyl CoA synthase complex and energy conservation via a CODH-linked hydrogenase must be differentially regulated in response to the availability of CO. The CO-sensing transcriptional activator, CooA is present in most CO-oxidizing bacteria. Here we present a genomic and phylogenetic survey of CODH operons and cooA genes found in CooA-containing bacteria. Two distinct groups of CooA homologs were found: one clade (CooA-1) is found in the majority of CooA-containing bacteria, whereas the other clade (CooA-2) is found only in genomes that encode multiple CODH clusters, suggesting that the CooA-2 might be important for cross-regulation of competing CODH operons. Recombinant CooA-1 and CooA-2 regulators from the prototypical CO-utilizing bacterium Carboxydothermus hydrogenoformans were purified, and promoter binding analyses revealed that CooA-1 specifically regulates the hydrogenase-linked CODH, whereas CooA-2 is able to regulate both the hydrogenase-linked CODH and the CODH/ACS operons. These studies point to the ability of dual CooA homologs to partition CO into divergent CO-utilizing pathways resulting in efficient consumption of a single limiting growth substrate available across a wide range of concentrations. PMID:21808633

Techtmann, Stephen M.; Colman, Albert S.; Murphy, Michael B.; Schackwitz, Wendy S.; Goodwin, Lynne A.; Robb, Frank T.

2011-01-01

96

Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway.  

PubMed

Carbon disulfide (CS2), one of the most important volatile organic chemicals, was shown to have serious impairment to male reproductive system. But the underline mechanism is still unclear. In the present study, we aim to investigate the male germ cell apoptosis induced by CS2 exposure alone and by co-administration with cyclosporin A (CsA), which is the inhibitor of membrane permeability transition pore (MPTP). It was shown that CS2 exposure impaired ultrastructure of germ cells, increased the numbers of apoptotic germ cells, accumulated intracellular level of calcium, elevated ROS level, and increased activities of complexes of respiratory chain. Meanwhile, exposure to CS2 dramatically decreased the mitochondrial transmembrane potential (??m) and levels of ATP and MPTP opening. Exposure to CS2 can also cause a significantly dose-dependent increase in the expression levels of Bax, Cytc, Caspase-9, and Caspase-3, but decreased the expression level of Bcl-2. Moreover, co-administration of CsA with CS2 can reverse or alleviate the above apoptotic damage effects of CS2 on testicular germ cells. Taken together, our findings suggested that CS2 can cause damage to testicular germ cells via mitochondrial apoptotic pathway, and MPTP play a crucial role in this process. PMID:24582363

Guo, Yinsheng; Wang, Wei; Dong, Yu; Zhang, Zhen; Zhou, Yijun; Chen, Guoyuan

2014-08-01

97

A model of biogeochemical cycles of carbon, nitrogen and phosphorus including symbiotic nitrogen fixation and phosphatase production.  

NASA Astrophysics Data System (ADS)

Global climate models have not yet considered the effects of nutrient cycles and limitation when forecasting carbon uptake by the terrestrial biosphere into the future. Using the principle of resource optimization, we here develop a new theory by which C, N and P cycles interact. Our model is able to replicate the observed responses of net primary production to nutrient additions in N-limited, N and P co-limited, and P-limited environments. Our framework identifies a new pathway by which N2 fixers can alter P availability: by investing in N-rich phosphorus liberation enzymes (phosphatases), fixers can greatly accelerate soil P availability and its cycling rates. This is critical for the successive invasion and establishment of N2 fixers into an N limited environment. We conclude that our model can be used to examine nutrient limitation broadly, and thus offers promise for coupling the biogeochemical system of C, N, and P to broader climate-system models.

Wang, Y.; Houlton, B.; Field, C. B.

2006-12-01

98

sup 14 C fixation by leaves and leaf cell protoplasts of the submerged aquatic angiosperm Potamogeton lucens: Carbon dioxide or bicarbonate  

SciTech Connect

Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant.

Staal, M.; Elzenga, J.T.M.; Prins, H.B.A. (Univ. of Groningen, Haren (Netherlands))

1989-07-01

99

Simulation of permeability evolution of leakage pathway in carbonate-rich caprocks in carbon sequestration  

NASA Astrophysics Data System (ADS)

Geologic carbon sequestration in deep saline aquifers is a promising strategy for mitigating climate change. A major concern is the possibility of brine and CO2 migration through the caprock such as through fractures and faults. In this work, we examine the extent to which mineral dissolution will substantially alter the porosity and permeability of caprock leakage pathways as CO2-acidified brine flows through them. Three models were developed. Firstly, a reactive transport model, Permeability Evolution of Leakage pathway (PEL), was developed to simulate permeability evolution of a leakage pathway during the injection period, and assumes calcite is the only reactive mineral. The system domain is a 100 m long by 0.2 m diameter cylindrical flow path with fixed boundaries containing a rock matrix with an initial porosity of 30% and initial permeability of 1×10-13 m2. One example result is for an initial calcite volume fraction (CVF) of 0.20, in which all the calcite is dissolved after 50 years and the permeability reaches 3.2×10-13 m2. For smaller values of CVF, the permeability reaches its final value earlier but the increase in permeability is minimal. For a large value of CVF such as 0.50, the permeability could eventually reach 1×10-12 m2, but the large amount of dissolved calcium buffers the solution and slows the reaction. After 50 years the permeability change is negligible. Thus, there is a non-monotonic relationship between the amount of calcite in the rock and the resulting permeability change because of the competing dynamics of calcite dissolution and alkalinity build-up. In the second model, PEL was coupled to an existing basin-scale multiphase flow model, Princeton's Estimating Leakage Semi-Analytical (ELSA) model. The new model, ELSA-PEL, estimates the brine and CO2 leakage rates during the injection period under conditions of permeability evolution. The scenario considered in this work is for 50 years of CO2 injection into the Mt. Simon formation in the Michigan basin at an injection rate of 1 Mt/y. As an example, for a CVF value of 5%, the brine leakage rate after fifty years for a leakage pathway 1,000 m distance from the injection well is 0.88 kg/s, which is 2.4% larger than if there were no geochemical evolution of the permeability. In a sensitivity analysis with regard to the distance between the leakage pathway and the injection well, it was found that the cumulative leakage first increases with the distance and the relationship reverses after a certain distance. When the leakage pathway is farther away, the pressure increment drops leading to less acid brine flow; meanwhile, the time before the CO2 plume reaches the pathway is longer and this lengthens the reaction time with brine. Thirdly, we explored the role that SO2 would play if it were present as a co-injectant in carbon sequestration. The reaction considered is SO2 hydrolysis to form sulfurous acid. We expect the sulfurous acid will erode the calcite faster than carbonic acid because it is a stronger acid. Contrary to intuition, the simulation results showed a decrease in permeability due to CaSO3 precipitation in replacement of CaCO3, as CaSO3 has a larger molar volume.

Guo, B.; Fitts, J. P.; Dobossy, M. E.; Peters, C. A.

2013-12-01

100

Modelling Urban scale Retrofit, Pathways to 2050 Low Carbon Residential Building Stock   

E-print Network

A bottom up engineering modelling approach has been used to investigate the pathways to 2050 low carbon residential building stock. The impact of housing retrofit, renewable technologies, occupant behaviour, and grid decarbonisation is measured at a...

Lannon, Simon; Georgakaki, Aliki; Macdonald, Stuart

101

Changes in pathways for carbon and nitrogen assimilation in spruce roots under mycorrhization  

E-print Network

Changes in pathways for carbon and nitrogen assimilation in spruce roots under mycorrhization C and carbon metabolism were examined in spruce ectomycorrhizae and in each partner (uninfected root and fungus in Pachlewski's medium. Spruce roots (Picea abies L. Karsten) and mycorrhizae, infected with Hebeloma sp., were

Paris-Sud XI, Université de

102

Modelling nitrogen fixation of pea (Pisum sativumL.)  

Microsoft Academic Search

Nitrogen fixation was simulated for a leafless variety (Delta) of pea (Pisum sativum L.) in central Sweden. It is assumed that N2 fixation is basically proportional to root biomass, but limited by high root N or low substrate carbon concentrations. Input data on root carbon and nitrogen were estimated from observations of above-ground biomass and nitrogen. The simulated N2 fixation

Henrik Eckersten; Linda AF Geijersstam; Bengt Torssell

2006-01-01

103

Carbon partitioning to the terpenoid biosynthetic pathway enables heterologous ?-phellandrene production in Escherichia coli cultures.  

PubMed

Escherichia coli was used as a microbial system for the heterologous synthesis of ?-phellandrene, a monoterpene of plant origin with several potential commercial applications. Expression of Lavandula angustifolia ?-phellandrene synthase (PHLS), alone or in combination with Picea abies geranyl-diphosphate synthase in E. coli, resulted in no ?-phellandrene accumulation, in sharp contrast to observations with PHLS-transformed cyanobacteria. Lack of ?-phellandrene biosynthesis in E. coli was attributed to the limited endogenous carbon partitioning through the native 2-C-methylerythritol-4-phosphate (MEP) pathway. Heterologous co-expression of the mevalonic acid pathway, enhancing cellular carbon partitioning and flux toward the universal isoprenoid precursors, isopentenyl-diphosphate and dimethylallyl-diphosphate, was required to confer ?-phellandrene production. Differences in endogenous carbon flux toward the synthesis of isoprenoids between photosynthetic (Synechocystis) and non-photosynthetic bacteria (E. coli) are discussed in terms of differences in the regulation of carbon partitioning through the MEP biosynthetic pathway in the two systems. PMID:25116411

Formighieri, Cinzia; Melis, Anastasios

2014-12-01

104

A model of biogeochemical cycles of carbon, nitrogen, and phosphorus including symbiotic nitrogen fixation and phosphatase production  

NASA Astrophysics Data System (ADS)

Global climate models have not yet considered the effects of nutrient cycles and limitation when forecasting carbon uptake by the terrestrial biosphere into the future. Using the principle of resource optimization, we here develop a new theory by which C, N, and P cycles interact. Our model is able to replicate the observed responses of net primary production to nutrient additions in N-limited, N- and P-colimited, and P-limited terrestrial environments. Our framework identifies a new pathway by which N2 fixers can alter P availability: By investing in N-rich, phosphorus liberation enzymes (phosphatases), fixers can greatly accelerate soil P availability and P cycling rates. This interaction is critical for the successful invasion and establishment of N2 fixers in an N-limited environment. We conclude that our model can be used to examine nutrient limitation broadly, and thus offers promise for coupling the biogeochemical system of C, N, and P to broader climate-system models.

Wang, Y.-P.; Houlton, B. Z.; Field, C. B.

2007-03-01

105

Carbon Assimilation Pathways, Water Relationships and Plant Ecology.  

ERIC Educational Resources Information Center

Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

Etherington, John R.

1988-01-01

106

Carbon dioxide fixation and photoevolution of hydrogen and oxygen in a mutant of Chlamydomonas lacking Photosystem I  

SciTech Connect

Sustained photoassimilation of atmospheric CO{sub 2} and simultaneous photoevolution of molecular hydrogen and oxygen has been observed in a Photosystem I deficient mutant B4 of Chlamydomonas reinhardtii that contains only Photosystem II. The data indicate that Photosystem II alone is capable of spanning the potential difference between water oxidation/oxygen evolution and ferredoxin reduction. The rates of both CO{sub 2} fixation and hydrogen and oxygen evolution are similar in the mutant to that of the wild-type C. reinhardtii 137c containing both photosystems. The wild-type had stable photosynthetic activity, measured as CO{sub 2} fixation, under both air and anaerobic conditions, while the mutant was stable only under anaerobic conditions. The results are discussed in terms of the fundamental mechanisms and energetics of photosynthesis and possible implications for the evolution of oxygenic photosynthesis.

Greenbaum, E.; Lee, J.W.; Tevault, C.V. [Oak Ridge National Lab., TN (United States)] [and others

1995-09-01

107

Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem  

NASA Astrophysics Data System (ADS)

An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the theoretical acidic conditions of these soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. Regarding the carbonate flux, another direct consequence of wood feeding is a concomitant flux of carbonate formed in wood tissues, which is not consumed by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter. Therefore, an oxalate pool is formed on the forest ground. Then, wood rotting gents (mainly termites, fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition some of these gents are themselves producers of oxalate (fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with ?13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as define by the ecological theory.

Cailleau, G.; Braissant, O.; Verrecchia, E. P.

2011-02-01

108

Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem  

NASA Astrophysics Data System (ADS)

An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. In addition, a concomitant flux of carbonate formed in wood tissues contributes to the carbonate flux and is identified as a direct consequence of wood feeding by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter, and an oxalate pool is formed on the forest ground. Then, wood rotting agents (mainly termites, saprophytic fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition, some of these agents are themselves producers of oxalate (e.g. fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can then start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with ?13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as defined by ecological theory.

Cailleau, G.; Braissant, O.; Verrecchia, E. P.

2011-07-01

109

Interactions between CCM and N2 fixation in Trichodesmium.  

PubMed

In view of the current increase in atmospheric pCO(2) and concomitant changes in the marine environment, it is crucial to assess, understand, and predict future responses of ecologically relevant phytoplankton species. The diazotrophic cyanobacterium Trichodesmium erythraeum was found to respond strongly to elevated pCO(2) by increasing growth, production rates, and N(2) fixation. The magnitude of these CO(2) effects exceeds those previously seen in other phytoplankton, raising the question about the underlying mechanisms. Here, we review recent publications on metabolic pathways of Trichodesmium from a gene transcription level to the protein activities and energy fluxes. Diurnal patterns of nitrogenase activity change markedly with CO(2) availability, causing higher diel N(2) fixation rates under elevated pCO(2). The observed responses to elevated pCO(2) could not be attributed to enhanced energy generation via gross photosynthesis, although there are indications for CO(2)-dependent changes in ATP/NADPH + H(+) production. The CO(2) concentrating mechanism (CCM) in Trichodesmium is primarily based on HCO(3)(-) uptake. Although only little CO(2) uptake was detected, the NDH complex seems to play a crucial role in internal cycling of inorganic carbon, especially under elevated pCO(2). Affinities for inorganic carbon change over the day, closely following the pattern in N(2) fixation, and generally decrease with increasing pCO(2). This down-regulation of CCM activity and the simultaneously enhanced N(2) fixation point to a shift in energy allocation from carbon acquisition to N(2) fixation under elevated pCO(2) levels. A strong light modulation of CO(2) effects further corroborates the role of energy fluxes as a key to understand the responses of Trichodesmium. PMID:21190135

Kranz, Sven A; Eichner, Meri; Rost, Björn

2011-09-01

110

Root Carbon Dioxide Fixation by Phosphorus-Deficient Lupinus albus (Contribution to Organic Acid Exudation by Proteoid Roots).  

PubMed Central

When white lupin (Lupinus albus L.) is subjected to P deficiency lateral root development is altered and densely clustered, tertiary lateral roots (proteoid roots) are initiated. These proteoid roots exude large amounts of citrate, which increases P solubilization. In the current study plants were grown with either 1 mM P (+P-treated) or without P (-P-treated). Shoots or roots of intact plants from both P treatments were labeled independently with 14CO2 to compare the relative contribution of C fixed in each with the C exuded from roots as citrate and other organic acids. About 25-fold more acid-stable 14C, primarily in citrate and malate, was recovered in exudates from the roots of -P-treated plants compared with +P-treated plants. The rate of in vivo C fixation in roots was about 4-fold higher in -P-treated plants than in +P-treated plants. Evidence from labeling intact shoots or roots indicates that synthesis of citrate exuded by -P-treated roots is directly related to nonphotosynthetic C fixation in roots. C fixed in roots of -P-treated plants contributed about 25 and 34% of the C exuded as citrate and malate, respectively. Nonphotosynthetic C fixation in white lupin roots is an integral component in the exudation of large amounts of citrate and malate, thus increasing the P available to the plant. PMID:12226371

Johnson, J. F.; Allan, D. L.; Vance, C. P.; Weiblen, G.

1996-01-01

111

Carbon nanotubes: selective breakdown of metallic pathways in double-walled carbon nanotube networks (small 1/2015).  

PubMed

On page 96, C.-F. Chen, Y. Wang, and co-workers demonstrate how electrical breakdown of the metallic pathways in double-walled carbon nanotubes yields high-performance thin-film transistors with simultaneous high ON-state conductance and high ON/OFF ratios. PMID:25558047

Ng, Allen L; Sun, Yong; Powell, Lyndsey; Sun, Chuan-Fu; Chen, Chien-Fu; Lee, Cheng S; Wang, YuHuang

2015-01-01

112

Degradation pathways of dissolved carbon in landfill leachate traced with compound-specific C analysis of DOC  

Microsoft Academic Search

The isotopic compositions of carbon compounds in landfill leachate provide insights into the biodegradation pathways that dominate the different stages of waste decomposition. In this study, the carbon geochemistry of different carbon pools, environmental stable isotopes and compound-specific isotope analysis (CSIA) of leachate dissolved organic carbon (DOC) fractions and gases show distinctions in leachate biogeochemistry and methane production between the

Hossein Mohammadzadeh; Ian Clark

2008-01-01

113

Dependence of wheat and rice respiration on tissue nitrogen and the corresponding net carbon fixation efficiency under different rates of nitrogen application  

NASA Astrophysics Data System (ADS)

To quantitatively address the role of tissue N in crop respiration under various agricultural practices, and to consequently evaluate the impact of synthetic fertilizer N application on biomass production and respiration, and hence net carbon fixation efficiency ( E ncf), pot and field experiments were carried out for an annual rotation of a rice-wheat cropping system from 2001 to 2003. The treatments of the pot experiments included fertilizer N application, sowing date and planting density. Different rates of N application were tested in the field experiments. Static opaque chambers were used for sampling the gas. The respiration as CO2 emission was detected by a gas chromatograph. A successive biomass clipping method was employed to determine the crop autotrophic respiration coefficient ( R a). Results from the pot experiments revealed a linear relationship between R a and tissue N content as R a = 4.74N-1.45 ( R 2 = 0.85, P < 0.001). Measurements and calculations from the field experiments indicated that fertilizer N application promoted not only biomass production but also increased the respiration of crops. A further investigation showed that the increase of carbon loss in terms of respiration owing to fertilizer N application exceeded that of net carbon gain in terms of aboveground biomass when fertilizer N was applied over a certain rate. Consequently, the E ncf declined as the N application rate increased.

Sun, Wenjuan; Huang, Yao; Chen, Shutao; Zou, Jianwen; Zheng, Xunhua

2007-02-01

114

Catalytic wet air oxidation of phenol with functionalized carbon materials as catalysts: reaction mechanism and pathway.  

PubMed

The development of highly active carbon material catalysts in catalytic wet air oxidation (CWAO) has attracted a great deal of attention. In this study different carbon material catalysts (multi-walled carbon nanotubes, carbon fibers and graphite) were developed to enhance the CWAO of phenol in aqueous solution. The functionalized carbon materials exhibited excellent catalytic activity in the CWAO of phenol. After 60 min reaction, the removal of phenol was nearly 100% over the functionalized multi-walled carbon, while it was only 14% over the purified multi-walled carbon under the same reaction conditions. Carboxylic acid groups introduced on the surface of the functionalized carbon materials play an important role in the catalytic activity in CWAO. They can promote the production of free radicals, which act as strong oxidants in CWAO. Based on the analysis of the intermediates produced in the CWAO reactions, a new reaction pathway for the CWAO of phenol was proposed in this study. There are some differences between the proposed reaction pathway and that reported in the literature. First, maleic acid is transformed directly into malonic acid. Second, acetic acid is oxidized into an unknown intermediate, which is then oxidized into CO2 and H2O. Finally, formic acid and oxalic acid can mutually interconvert when conditions are favorable. PMID:25108731

Wang, Jianbing; Fu, Wantao; He, Xuwen; Yang, Shaoxia; Zhu, Wanpeng

2014-08-01

115

Methanotrophy induces nitrogen fixation during peatland development.  

PubMed

Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

Larmola, Tuula; Leppänen, Sanna M; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja

2014-01-14

116

Methanotrophy induces nitrogen fixation during peatland development  

PubMed Central

Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

Larmola, Tuula; Leppänen, Sanna M.; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja

2014-01-01

117

Carboxylases in Natural and Synthetic Microbial Pathways  

PubMed Central

Carboxylases are among the most important enzymes in the biosphere, because they catalyze a key reaction in the global carbon cycle: the fixation of inorganic carbon (CO2). This minireview discusses the physiological roles of carboxylases in different microbial pathways that range from autotrophy, carbon assimilation, and anaplerosis to biosynthetic and redox-balancing functions. In addition, the current and possible future uses of carboxylation reactions in synthetic biology are discussed. Such uses include the possible transformation of the greenhouse gas carbon dioxide into value-added compounds and the production of novel antibiotics. PMID:22003013

Erb, Tobias J.

2011-01-01

118

ENZYMOLOGY: A Trio of Transition Metals in Anaerobic CO2 Fixation  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Certain anaerobic microorganisms can gain energy and biomass using carbon monoxide or dioxide and dihydrogen as sole sources of carbon and energy. In his Perspective, Peters explains how new results by Doukov et al. illuminate the carbon dioxide fixation pathway. Doukov et al. report that the enzyme responsible for the process contains a highly unusual metal cluster, with three different transition metals including copper, in one of its active sites.

John W. Peters (Montana State University;Department of Chemistry and Biochemistry)

2002-10-18

119

Chemical mechanism of the high solubility pathway for the carbon dioxide free production of iron.  

PubMed

We determine the fundamental iron oxide high solubility mechanism that drives a new electrolytic pathway to iron production, and eliminates a major CO(2) emission source, for example it is produced using wind and solar energy, in a molten carbonate electrolyte, at a high rate and a low electrolysis energy. PMID:21301745

Licht, Stuart; Wu, Hongjun; Zhang, Zhonghai; Ayub, Hina

2011-03-21

120

Non-riverine pathways of terrigenous carbon to the ocean  

NASA Astrophysics Data System (ADS)

The extent and nature of non-riverine fluxes of carbon from land to ocean are poorly understood. Tidal pumping from highly productive coastal environments, atmospheric deposition and submarine groundwater discharge can be significant transport mechanisms for carbon to the ocean. Evidence is mounting that tidally-induced porewater fluxes ("outwelling") of dissolved organic matter (DOM) from mangroves and salt marshes alone may be similar in magnitude as the global riverine flux of DOM. Tidal pumping of dissolved inorganic carbon (DIC) might exceed organic carbon fluxes by far, but the existing knowledge on DIC outwelling is too scarce for a first global estimate. Results from two case studies on the biogeochemistry of DOM outwelling are presented, from the mangroves in Northern Brazil and the salt marshes in the Northern Gulf of Mexico. Ongoing research in the Northern Gulf of Mexico indicates that outwelling and groundwater inputs probably exceed riverine DOM fluxes in this region. Similar observations were made in Northern Brazil. There, the fate of mangrove-derived DOM could be traced from its source in the mangrove sediments to the outer North Brazil shelf by using a combination of isotopic and molecular approaches. Reversed-phase liquid chromatography / mass spectrometry (LC/MS) provided a multifaceted array of information that mirrors the molecular complexity of DOM. Statistical analyses on these data revealed significant differences between mangrove and open-ocean DOM which successively disappeared by irradiating the samples with natural sunlight. Nuclear magnetic resonance analyses yielded concurrent results. Ultrahigh-resolution Fourier transform-ion cyclotron resonance mass spectrometry (FT-ICR MS) is the only technique capable of resolving and identifying individual elemental compositions in these complex mixtures. We applied this technique for characterizing mangrove-derived DOM and to assess the molecular changes that occur in the initial stages of outwelling. The different approaches concordantly show the presence of photodegraded mangrove DOM on the North Brazil shelf. During transport offshore, sunlight efficiently destroyed aromatic molecules, removing about one third of mangrove-derived DOM. The remainder was refractory and may thus be distributed over the oceans.

Dittmar, T.

2007-12-01

121

Incomplete Wood–Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi  

PubMed Central

The acetyl-CoA “Wood–Ljungdahl” pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood–Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood–Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L.; Feng, Xueyang; Men, Yujie; Conrad, Mark E.; Tang, Yinjie J.; Alvarez-Cohen, Lisa

2014-01-01

122

Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor  

SciTech Connect

Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. We observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.

Younker, Jarod M [ORNL; Saito, Tomonori [ORNL; Hunt, Marcus A [ORNL; Beste, Ariana [ORNL; Naskar, Amit K [ORNL

2013-01-01

123

Heterologous expression of the mevalonic acid pathway in cyanobacteria enhances endogenous carbon partitioning to isoprene.  

PubMed

Heterologous expression of the isoprene synthase gene in the cyanobacterium Synechocystis PCC 6803 conferred upon these microorganisms the property of photosynthetic isoprene (C?H?) hydrocarbons production. Continuous production of isoprene from CO? and H?O was achieved in the light, occurring via the endogenous methylerythritol-phosphate (MEP) pathway, in tandem with the growth of Synechocystis. This work addressed the issue of photosynthetic carbon partitioning between isoprene and biomass in Synechocystis. Evidence is presented to show heterologous genomic integration and cellular expression of the mevalonic acid (MVA) pathway genes in Synechocystis endowing a non-native pathway for carbon flux amplification to isopentenyl-diphosphate (IPP) and dimethylallyl-diphosphate (DMAPP) precursors of isoprene. Heterologous expression of the isoprene synthase in combination with the MVA pathway enzymes resulted in photosynthetic isoprene yield improvement by approximately 2.5-fold, compared with that measured in cyanobacteria transformed with the isoprene synthase gene only. These results suggest that the MVA pathway introduces a bypass in the flux of endogenous cellular substrate in Synechocystis to IPP and DMAPP, overcoming flux limitations of the native MEP pathway. The work employed a novel chromosomal integration and expression of synthetic gene operons in Synechocystis, comprising up to four genes under the control of a single promoter, and expressing three operons simultaneously. This is the first time an entire biosynthetic pathway with seven recombinant enzymes has been heterologously expressed in a photosynthetic microorganism. It constitutes contribution to the genetic engineering toolkit of photosynthetic microorganisms and a paradigm in the pursuit of photosynthetic approaches for the renewable generation of high-impact products. PMID:24157609

Bentley, Fiona K; Zurbriggen, Andreas; Melis, Anastasios

2014-01-01

124

Selective breakdown of metallic pathways in double-walled carbon nanotube networks.  

PubMed

Covalently functionalized, semiconducting double-walled carbon nanotubes exhibit remarkable properties and can outperform their single-walled carbon nanotube counterparts. In order to harness their potential for electronic applications, metallic double-walled carbon nanotubes must be separated from the semiconductors. However, the inner wall is inaccessible to current separation techniques which rely on the surface properties. Here, the first approach to address this challenge through electrical breakdown of metallic double-walled carbon nanotubes, both inner and outer walls, within networks of mixed electronic types is described. The intact semiconductors demonstrate a ?62% retention of the ON-state conductance in thin film transistors in response to covalent functionalization. The selective elimination of the metallic pathways improves the ON/OFF ratio, by more than 360 times, to as high as 40 700, while simultaneously retaining high ON-state conductance. PMID:25180916

Ng, Allen L; Sun, Yong; Powell, Lyndsey; Sun, Chuan-Fu; Chen, Chien-Fu; Lee, Cheng S; Wang, YuHuang

2015-01-01

125

Malonyl-Coenzyme A Reductase in the Modified 3-Hydroxypropionate Cycle for Autotrophic Carbon Fixation in Archaeal Metallosphaera and Sulfolobus spp.?  

PubMed Central

Autotrophic members of the Sulfolobales (Crenarchaeota) contain acetyl-coenzyme A (CoA)/propionyl-CoA carboxylase as the CO2 fixation enzyme and use a modified 3-hydroxypropionate cycle to assimilate CO2 into cell material. In this central metabolic pathway malonyl-CoA, the product of acetyl-CoA carboxylation, is further reduced to 3-hydroxypropionate. Extracts of Metallosphaera sedula contained NADPH-specific malonyl-CoA reductase activity that was 10-fold up-regulated under autotrophic growth conditions. Malonyl-CoA reductase was partially purified and studied. Based on N-terminal amino acid sequencing the corresponding gene was identified in the genome of the closely related crenarchaeum Sulfolobus tokodaii. The Sulfolobus gene was cloned and heterologously expressed in Escherichia coli, and the recombinant protein was purified and studied. The enzyme catalyzes the following reaction: malonyl-CoA + NADPH + H+ ? malonate-semialdehyde + CoA + NADP+. In its native state it is associated with small RNA. Its activity was stimulated by Mg2+ and thiols and inactivated by thiol-blocking agents, suggesting the existence of a cysteine adduct in the course of the catalytic cycle. The enzyme was specific for NADPH (Km = 25 ?M) and malonyl-CoA (Km = 40 ?M). Malonyl-CoA reductase has 38% amino acid sequence identity to aspartate-semialdehyde dehydrogenase, suggesting a common ancestor for both proteins. It does not exhibit any significant similarity with malonyl-CoA reductase from Chloroflexus aurantiacus. This shows that the autotrophic pathway in Chloroflexus and Sulfolobaceae has evolved convergently and that these taxonomic groups have recruited different genes to bring about similar metabolic processes. PMID:17041055

Alber, Birgit; Olinger, Marc; Rieder, Annika; Kockelkorn, Daniel; Jobst, Björn; Hügler, Michael; Fuchs, Georg

2006-01-01

126

Lung macrophages "digest" carbon nanotubes using a superoxide/peroxynitrite oxidative pathway.  

PubMed

In contrast to short-lived neutrophils, macrophages display persistent presence in the lung of animals after pulmonary exposure to carbon nanotubes. While effective in the clearance of bacterial pathogens and injured host cells, the ability of macrophages to "digest" carbonaceous nanoparticles has not been documented. Here, we used chemical, biochemical, and cell and animal models and demonstrated oxidative biodegradation of oxidatively functionalized single-walled carbon nanotubes via superoxide/NO* ? peroxynitrite-driven oxidative pathways of activated macrophages facilitating clearance of nanoparticles from the lung. PMID:24871084

Kagan, Valerian E; Kapralov, Alexandr A; St Croix, Claudette M; Watkins, Simon C; Kisin, Elena R; Kotchey, Gregg P; Balasubramanian, Krishnakumar; Vlasova, Irina I; Yu, Jaesok; Kim, Kang; Seo, Wanji; Mallampalli, Rama K; Star, Alexander; Shvedova, Anna A

2014-06-24

127

Photosynthetic carbon reduction pathway is absent in chloroplasts of Vicia faba guard cells  

PubMed Central

Four cell types from Vicia faba Linnaeus “Long Pod” leaflets were assayed for three enzymes unique to the photosynthetic carbon reduction pathway. The enzymes were ribulosebisphosphate carboxylase [3-phospho-D-glycerate carboxy-lyase (dimerizing), EC 4.1.1.39], phosphoribulokinase (ATP:D-ribulose-5-phosphate 1-phosphotransferase, EC 2.7.1.19), and glyceraldehyde-phosphate dehydrogenase (NADP+) (phosphorylating) [D-glyceraldehyde-3-phosphate:NADP+ oxidoreductase (phosphorylating), EC 1.2.1.13]. On a dry weight basis, these enzyme activities were about twice as high in palisade as in spongy parenchyma. Two of the enzymes were not detected in epidermal cells and the other was present in only a trace amount. In guard cells, these enzyme activities were absent or present at les than 1% of the amount in palisade cells. Immunoelectrophoresis showed that ribulosebisphosphate carboxylase was absent in extracts of guard cell protoplasts. Microscopy confirmed the abundance of typical guard cell chloroplasts. These results demonstrate the absence of the photosynthetic carbon reduction pathway in guard cell chloroplasts. This is the only chloroplast type known to be deficient in this pathway in plants whose primary CO2 acceptor is ribulose bisphosphate. Possible reasons for the absence of this pathway in guard cells are discussed. Images PMID:16592740

Outlaw, William H.; Manchester, Jill; DiCamelli, Cynthia A.; Randall, Douglas D.; Rapp, Barbara; Veith, George M.

1979-01-01

128

Free atmospheric CO2 enrichment did not affect symbiotic N2-fixation and soil carbon dynamics in a mixed deciduous stand in Wales  

NASA Astrophysics Data System (ADS)

Through increases in net primary production (NPP), elevated CO2 is hypothesizes to increase the amount of plant litter entering the soil. The fate of this extra carbon on the forest floor or in mineral soil is currently not clear. Moreover, increased rates of NPP can be maintained only if forests can escape nitrogen limitation. In a Free atmospheric CO2 Enrichment (FACE) experiment near Bangor, Wales, 4 ambient CO2 and 4 FACE plots were planted with patches of Betula pendula, Alnus glutinosa and Fagus sylvatica on a former arable field. Four years after establishment, only a shallow L forest floor litter layer had formed due to intensive bioturbation. Total soil C and N contents increased irrespective of treatment and species as a result of afforestation. We could not detect an additional C sink in the soil, nor were soil C stabilization processes affected by FACE. We observed a decrease of leaf N content in Betula and Alnus under FACE, while the soil C/N ratio decreased regardless of CO2 treatment. The ratio of N taken up from the soil and by N2-fixation in Alnus was not affected by FACE. We infer that increased nitrogen use efficiency is the mechanism by which increased NPP is sustained under elevated CO2 at this site.

Hoosbeek, M. R.; Lukac, M.; Velthorst, E. J.; Godbold, D. L.

2010-06-01

129

C(4) Photosynthesis: Light-dependent CO(2) Fixation by Mesophyll Cells, Protoplasts, and Protoplast Extracts of Digitaria sanguinalis.  

PubMed

Mesophyll cells, protoplasts, and protoplast extracts of Digitaria sanguinalis were used for comparative studies of light-dependent CO(2) fixation. CO(2) fixation was low without the addition of organic substrates. Pyruvate, oxaloacetate, and 3-phosphoglycerate induced relatively low rates (10 to 90 mumoles/mg chlorophyll.hr) of CO(2) fixation when added separately. However, a highly synergistic relationship was found between pyruvate + oxaloacetate and pyruvate + 3-phosphoglycerate for inducing light-dependent CO(2) fixation in the mesophyll preparations. Highest rates of CO(2) fixation were obtained with protoplast extracts. Pyruvate, in combination with oxaloacetate or 3-phosphoglycerate induced light-dependent rates from 150 to 380 mumoles of CO(2) fixed/mg chlorophyll.hr which are equivalent to or exceed reported rates of whole leaf photosynthesis in C(4) species. Concentrations of various substrates required to give half-maximum velocities of CO(2) fixation were determined, with the protoplast extracts generally saturating at the lowest substrate concentrations. Chloroplasts separated from protoplast extracts showed little capacity for CO(2) fixation. The results suggest that CO(2) fixation in C(4) mesophyll cells is dependent on chloroplasts and extrachloroplastic phosphoenolpyruvate carboxylase.The stimulation of pyruvate-induced CO(2) fixation by oxaloacetate and 3-phosphoglycerate is thought to be due to induction of noncyclic electron transport which generates ATP for the conversion of pyruvate to phosphoenolpyruvate by pyruvate Pi dikinase. The primary products of the substrate-induced CO(2) fixation were oxaloacetate and malate, which provides further evidence for carbon fixation through the beta-carboxylation pathway. High rates of light-dependent CO(2) fixation with a significant percentage of (14)C fixed into malate suggest an efficient operation of both photosystems I and II.The substrate inductions are discussed with respect to the proposed role of the mesophyll cell in C(4) photosynthesis, and schemes suggesting the stoichiometry of energy requirements for photosynthetic carbon metabolism in C(4) mesophyll cells are presented. PMID:16659177

Huber, S C; Edwards, G E

1975-05-01

130

Aquatic carbon and GHG losses via the aquatic pathway in an arctic catchment  

NASA Astrophysics Data System (ADS)

Based in Northwest Canada, the HYDRA project ('Permafrost catchments in transition: hydrological controls on carbon cycling and greenhouse gas budgets') aims to understand the fundamental role that hydrological processes play in regulating landscape-scale carbon fluxes. The project aims to determine a) the role of vegetation functional type in carbon uptake, turnover and allocation, b) how the same functional types influence the delivery of soil-derived carbon to surface waters, and c) how important the aquatic carbon and greenhouse gas (GHG) losses are relative to catchment scale terrestrial fluxes. Here we focus on the magnitude of the aquatic concentrations and fluxes, presenting results from the first year of field sampling. Concentrations of the greenhouse gases CO2, CH4 and N2O, as well as dissolved organic and inorganic carbon (DOC and DIC), will be presented from a range of freshwater types within the tundra landscape; sites include lakes, polygons and the 'Siksik' stream which drains the primary study catchment. Eight sampling locations were selected along the approximately 2km long Siksik stream to allow carbon and GHG concentrations to be considered within a set of nested subcatchments. This synoptic sampling regime, in combination with stable isotopes and major ion concentrations also measured at each sampling point, will allow inputs of carbon and GHGs to be traced to source areas within the catchment. Evasion and downstream export will also be calculated and preliminary results presented in the context of quantifying the relative importance of the aquatic pathway to the full catchment carbon and greenhouse gas budgets. This analysis will also allow an initial comparison between the relative importance of different water bodies within the catchment, highlighting spatial hotspots to be prioritized in future campaigns.

Dinsmore, Kerry; Billett, Mike; Lessels, Jason; Street, Lorna; Wookey, Philip; Baxter, Robert; Subke, Jens-Arne; Tetzlaff, Doerthe

2014-05-01

131

Carbon Metabolic Pathways in Phototrophic Bacteria and Their Broader Evolutionary Implications  

PubMed Central

Photosynthesis is the biological process that converts solar energy to biomass, bio-products, and biofuel. It is the only major natural solar energy storage mechanism on Earth. To satisfy the increased demand for sustainable energy sources and identify the mechanism of photosynthetic carbon assimilation, which is one of the bottlenecks in photosynthesis, it is essential to understand the process of solar energy storage and associated carbon metabolism in photosynthetic organisms. Researchers have employed physiological studies, microbiological chemistry, enzyme assays, genome sequencing, transcriptomics, and 13C-based metabolomics/fluxomics to investigate central carbon metabolism and enzymes that operate in phototrophs. In this report, we review diverse CO2 assimilation pathways, acetate assimilation, carbohydrate catabolism, the tricarboxylic acid cycle and some key, and/or unconventional enzymes in central carbon metabolism of phototrophic microorganisms. We also discuss the reducing equivalent flow during photoautotrophic and photoheterotrophic growth, evolutionary links in the central carbon metabolic network, and correlations between photosynthetic and non-photosynthetic organisms. Considering the metabolic versatility in these fascinating and diverse photosynthetic bacteria, many essential questions in their central carbon metabolism still remain to be addressed. PMID:21866228

Tang, Kuo-Hsiang; Tang, Yinjie J.; Blankenship, Robert Eugene

2011-01-01

132

Gene regulation of carbon fixation, storage, and utilization in the diatom Phaeodactylum tricornutum acclimated to light/dark cycles.  

PubMed

The regulation of carbon metabolism in the diatom Phaeodactylum tricornutum at the cell, metabolite, and gene expression levels in exponential fed-batch cultures is reported. Transcriptional profiles and cell chemistry sampled simultaneously at all time points provide a comprehensive data set on carbon incorporation, fate, and regulation. An increase in Nile Red fluorescence (a proxy for cellular neutral lipids) was observed throughout the light period, and water-soluble glucans increased rapidly in the light period. A near-linear decline in both glucans and lipids was observed during the dark period, and transcription profile data indicated that this decline was associated with the onset of mitosis. More than 4,500 transcripts that were differentially regulated during the light/dark cycle are identified, many of which were associated with carbohydrate and lipid metabolism. Genes not previously described in algae and their regulation in response to light were integrated in this analysis together with proposed roles in metabolic processes. Some very fast light-responding genes in, for example, fatty acid biosynthesis were identified and allocated to biosynthetic processes. Transcripts and cell chemistry data reflect the link between light energy availability and light energy-consuming metabolic processes. Our data confirm the spatial localization of processes in carbon metabolism to either plastids or mitochondria or to glycolysis/gluconeogenesis, which are localized to the cytosol, chloroplast, and mitochondria. Localization and diel expression pattern may be of help to determine the roles of different isoenzymes and the mining of genes involved in light responses and circadian rhythms. PMID:23209127

Chauton, Matilde Skogen; Winge, Per; Brembu, Tore; Vadstein, Olav; Bones, Atle M

2013-02-01

133

Pathways for utilization of carbon reserves in Desulfovibrio gigas under fermentative and respiratory conditions.  

PubMed Central

The sulfate-reducing bacterium Desulfovibrio gigas accumulates large amounts of polyglucose as an endogenous carbon and energy reserve. In the absence of exogenous substrates, the intracellular polysaccharide was utilized, and energy was conserved in the process (H. Santos, P. Fareleira, A. V. Xavier, L. Chen, M.-Y. Liu, and J. LeGall, Biochem. Biophys. Res. Commun. 195:551-557, 1993). When an external electron acceptor was not provided, degradation of polyglucose by cell suspensions of D. gigas yielded acetate, glycerol, hydrogen, and ethanol. A detailed investigation of the metabolic pathways involved in the formation of these end products was carried out, based on measurements of the activities of glycolytic enzymes in cell extracts, by either spectrophotometric or nuclear magnetic resonance (NMR) assays. All of the enzyme activities associated with the glycogen cleavage and the Embden-Meyerhof pathway were determined as well as those involved in the formation of glycerol from dihydroxyacetone phosphate (glycerol-3-phosphate dehydrogenase and glycerol phosphatase) and the enzymes that catalyze the reactions leading to the production of ethanol (pyruvate decarboxylase and ethanol dehydrogenase). The key enzymes of the Entner-Doudoroff pathway were not detected. The methylglyoxal bypass was identified as a second glycolytic branch operating simultaneously with the Embden-Meyerhof pathway. The relative contribution of these two pathways for polyglucose degradation was 2:3. 13C-labeling experiments with cell extracts using isotopically enriched glucose and 13C-NMR analysis supported the proposed pathways. The information on the metabolic pathways involved in polyglucose catabolism combined with analyses of the end products formed from polyglucose under fermentative conditions provided some insight into the role of NADH in D. gigas. In the presence of electron acceptors, NADH resulting from polyglucose degradation was utilized for the reduction of sulfate, thiosulfate, or nitrite, leading to the formation of acetate as the only carbon end product besides CO2. Evidence supporting the role of NADH as a source of reducing equivalents for the production of hydrogen is also presented. PMID:9190814

Fareleira, P; Legall, J; Xavier, A V; Santos, H

1997-01-01

134

Pathways for utilization of carbon reserves in Desulfovibrio gigas under fermentative and respiratory conditions.  

PubMed

The sulfate-reducing bacterium Desulfovibrio gigas accumulates large amounts of polyglucose as an endogenous carbon and energy reserve. In the absence of exogenous substrates, the intracellular polysaccharide was utilized, and energy was conserved in the process (H. Santos, P. Fareleira, A. V. Xavier, L. Chen, M.-Y. Liu, and J. LeGall, Biochem. Biophys. Res. Commun. 195:551-557, 1993). When an external electron acceptor was not provided, degradation of polyglucose by cell suspensions of D. gigas yielded acetate, glycerol, hydrogen, and ethanol. A detailed investigation of the metabolic pathways involved in the formation of these end products was carried out, based on measurements of the activities of glycolytic enzymes in cell extracts, by either spectrophotometric or nuclear magnetic resonance (NMR) assays. All of the enzyme activities associated with the glycogen cleavage and the Embden-Meyerhof pathway were determined as well as those involved in the formation of glycerol from dihydroxyacetone phosphate (glycerol-3-phosphate dehydrogenase and glycerol phosphatase) and the enzymes that catalyze the reactions leading to the production of ethanol (pyruvate decarboxylase and ethanol dehydrogenase). The key enzymes of the Entner-Doudoroff pathway were not detected. The methylglyoxal bypass was identified as a second glycolytic branch operating simultaneously with the Embden-Meyerhof pathway. The relative contribution of these two pathways for polyglucose degradation was 2:3. 13C-labeling experiments with cell extracts using isotopically enriched glucose and 13C-NMR analysis supported the proposed pathways. The information on the metabolic pathways involved in polyglucose catabolism combined with analyses of the end products formed from polyglucose under fermentative conditions provided some insight into the role of NADH in D. gigas. In the presence of electron acceptors, NADH resulting from polyglucose degradation was utilized for the reduction of sulfate, thiosulfate, or nitrite, leading to the formation of acetate as the only carbon end product besides CO2. Evidence supporting the role of NADH as a source of reducing equivalents for the production of hydrogen is also presented. PMID:9190814

Fareleira, P; Legall, J; Xavier, A V; Santos, H

1997-06-01

135

Metabolic turnover analysis by a combination of in vivo 13 C-labelling from 13 CO 2 and metabolic profiling with CE-MS\\/ MS reveals rate-limiting steps of the C 3 photosynthetic pathway in Nicotiana tabacum leaves  

Microsoft Academic Search

Understanding of the control of metabolic pathways in plants requires direct measurement of the metabolic turnover rate. Sugar phosphate metabolism, including the Calvin cycle, is the primary pathway in C3 photosynthesis, the dynamic status of which has not been assessed quantitatively in the leaves of higher plants. Since the flux of photosynthetic carbon metabolism is affected by the CO2 fixation

Tomohisa Hasunuma; Kazuo Harada; Shin-Ichi Miyazawa; Akihiko Kondo; Eiichiro Fukusaki; Chikahiro Miyake

2009-01-01

136

Autotrophic Methanotrophy in Verrucomicrobia: Methylacidiphilum fumariolicumSolV Uses the Calvin-Benson-Bassham Cycle for Carbon Dioxide Fixation ? †  

PubMed Central

Genome data of the extreme acidophilic verrucomicrobial methanotroph Methylacidiphilum fumariolicumstrain SolV indicated the ability of autotrophic growth. This was further validated by transcriptome analysis, which showed that all genes required for a functional Calvin-Benson-Bassham (CBB) cycle were transcribed. Experiments with 13CH4or 13CO2in batch and chemostat cultures demonstrated that CO2is the sole carbon source for growth of strain SolV. In the presence of CH4, CO2concentrations in the headspace below 1% (vol/vol) were growth limiting, and no growth was observed when CO2concentrations were below 0.3% (vol/vol). The activity of the key enzyme of the CBB cycle, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), measured with a 13C stable-isotope method was about 70 nmol CO2fixed · min?1· mg of protein?1. An immune reaction with antibody against the large subunit of RuBisCO on Western blots was found only in the supernatant fractions of cell extracts. The apparent native mass of the RuBisCO complex in strain SolV was about 482 kDa, probably consisting of 8 large (53-kDa) and 8 small (16-kDa) subunits. Based on phylogenetic analysis of the corresponding RuBisCO gene, we postulate that RuBisCO of the verrucomicrobial methanotrophs represents a new type of form I RuBisCO. PMID:21725016

Khadem, Ahmad F.; Pol, Arjan; Wieczorek, Adam; Mohammadi, Seyed S.; Francoijs, Kees-Jan; Stunnenberg, Henk G.; Jetten, Mike S. M.; Op den Camp, Huub J. M.

2011-01-01

137

Fixation strength of taper connection at head-neck junction in retrieved carbon fiber-reinforced PEEK hip stems.  

PubMed

Carbon fiber-reinforced polyetheretherketone (CFR-PEEK) hip prostheses possess numerous advantages over metal prostheses; however, the security of the taper connection between the CFR-PEEK stem and the modular femoral head in vivo has not been verified. Therefore, we mechanically examined the taper connection of retrieved in vivo loaded CFR-PEEK stems in comparison with in vivo loaded titanium alloy stems. CFR-PEEK and titanium alloy femoral stems with a 12/14 taper trunnion were implanted in ovine hips. A 22-mm ceramic head was intraoperatively impacted to the stem. Retrieved specimens were obtained following weight-bearing conditions for up to 39 postoperative weeks and taper junction pull-off tests were conducted. Postoperative retrieved CFR-PEEK stem pull-off strength was significantly greater than that at time zero. Postoperative retrieved CFR-PEEK stem pull-off strength was also significantly higher than that of postoperative retrieved titanium alloy stem. Microscopic findings of the taper surface revealed no obvious damage in the retrieved CFR-PEEK stems, whereas fretting and corrosion were observed in the retrieved titanium alloy stems. The present findings suggest that the taper connection between the ceramic head and the 12/14 CFR-PEEK stem trunnion is more secure than that between the ceramic head and the titanium alloy trunnion. PMID:25190272

Nakahara, Ichiro; Takao, Masaki; Bandoh, Shunichi; Sugano, Nobuhiko

2014-12-01

138

Free atmospheric CO2 enrichment increased above ground biomass but did not affect symbiotic N2-fixation and soil carbon dynamics in a mixed deciduous stand in Wales  

NASA Astrophysics Data System (ADS)

Through increases in net primary production (NPP), elevated CO2 is hypothesized to increase the amount of plant litter entering the soil. The fate of this extra carbon on the forest floor or in mineral soil is currently not clear. Moreover, increased rates of NPP can be maintained only if forests can escape nitrogen limitation. In a Free atmospheric CO2 Enrichment (FACE) experiment near Bangor, Wales, 4 ambient and 4 elevated [CO2] plots were planted with patches of Betula pendula, Alnus glutinosa and Fagus sylvatica on a former arable field. After 4 years, biomass averaged for the 3 species was 5497 (se 270) g m-2 in ambient and 6450 (se 130) g m-2 in elevated [CO2] plots, a significant increase of 17% (P = 0.018). During that time, only a shallow L forest floor litter layer had formed due to intensive bioturbation. Total soil C and N contents increased irrespective of treatment and species as a result of afforestation. We could not detect an additional C sink in the soil, nor were soil C stabilization processes affected by elevated [CO2]. We observed a decrease of leaf N content in Betula and Alnus under elevated [CO2], while the soil C/N ratio decreased regardless of CO2 treatment. The ratio of N taken up from the soil and by N2-fixation in Alnus was not affected by elevated [CO2]. We infer that increased nitrogen use efficiency is the mechanism by which increased NPP is sustained under elevated [CO2] at this site.

Hoosbeek, M. R.; Lukac, M.; Velthorst, E.; Smith, A. R.; Godbold, D. L.

2011-02-01

139

Dinitrogen fixation in aphotic oxygenated marine environments  

PubMed Central

We measured N2 fixation rates from oceanic zones that have traditionally been ignored as sources of biological N2 fixation; the aphotic, fully oxygenated, nitrate (NO?3)-rich, waters of the oligotrophic Levantine Basin (LB) and the Gulf of Aqaba (GA). N2 fixation rates measured from pelagic aphotic waters to depths up to 720 m, during the mixed and stratified periods, ranged from 0.01 nmol N L?1 d?1 to 0.38 nmol N L?1 d?1. N2 fixation rates correlated significantly with bacterial productivity and heterotrophic diazotrophs were identified from aphotic as well as photic depths. Dissolved free amino acid amendments to whole water from the GA enhanced bacterial productivity by 2–3.5 fold and N2 fixation rates by ~2-fold in samples collected from aphotic depths while in amendments to water from photic depths bacterial productivity increased 2–6 fold while N2 fixation rates increased by a factor of 2 to 4 illustrating that both BP and heterotrophic N2 fixation were carbon limited. Experimental manipulations of aphotic waters from the LB demonstrated a significant positive correlation between transparent exopolymeric particle (TEP) concentrations and N2 fixation rates. This suggests that sinking organic material and high carbon (C): nitrogen (N) micro-environments (such as TEP-based aggregates or marine snow) could support high heterotrophic N2 fixation rates in oxygenated surface waters and in the aphotic zones. Indeed, our calculations show that aphotic N2 fixation accounted for 37 to 75% of the total daily integrated N2 fixation rates at both locations in the Mediterranean and Red Seas with rates equal or greater to those measured from the photic layers. Moreover, our results indicate that that while N2 fixation may be limited in the surface waters, aphotic, pelagic N2 fixation may contribute significantly to new N inputs in other oligotrophic basins, yet it is currently not included in regional or global N budgets. PMID:23986748

Rahav, Eyal; Bar-Zeev, Edo; Ohayon, Sarah; Elifantz, Hila; Belkin, Natalia; Herut, Barak; Mulholland, Margaret R.; Berman-Frank, Ilana

2013-01-01

140

The influence of pCO2 and temperature on gene expression of carbon and nitrogen pathways in Trichodesmium IMS101.  

PubMed

Growth, protein amount, and activity levels of metabolic pathways in Trichodesmium are influenced by environmental changes such as elevated pCO(2) and temperature. This study examines changes in the expression of essential metabolic genes in Trichodesmium grown under a matrix of pCO(2) (400 and 900 µatm) and temperature (25 and 31°C). Using RT-qPCR, we studied 21 genes related to four metabolic functional groups: CO(2) concentrating mechanism (bicA1, bicA2, ccmM, ccmK2, ccmK3, ndhF4, ndhD4, ndhL, chpX), energy metabolism (atpB, sod, prx, glcD), nitrogen metabolism (glnA, hetR, nifH), and inorganic carbon fixation and photosynthesis (rbcL, rca, psaB, psaC, psbA). nifH and most photosynthetic genes exhibited relatively high abundance and their expression was influenced by both environmental parameters. A two to three orders of magnitude increase was observed for glnA and hetR only when both pCO(2) and temperature were elevated. CO(2) concentrating mechanism genes were not affected by pCO(2) and temperature and their expression levels were markedly lower than that of the nitrogen metabolism and photosynthetic genes. Many of the CO(2) concentrating mechanism genes were co-expressed throughout the day. Our results demonstrate that in Trichodesmium, CO(2) concentrating mechanism genes are constitutively expressed. Co-expression of genes from different functional groups were frequently observed during the first half of the photoperiod when oxygenic photosynthesis and N(2) fixation take place, pointing at the tight and complex regulation of gene expression in Trichodesmium. Here we provide new data linking environmental changes of pCO(2) and temperature to gene expression in Trichodesmium. Although gene expression indicates an active metabolic pathway, there is often an uncoupling between transcription and enzyme activity, such that transcript level cannot usually be directly extrapolated to metabolic activity. PMID:21151907

Levitan, Orly; Sudhaus, Stefanie; LaRoche, Julie; Berman-Frank, Ilana

2010-01-01

141

A Central Role for Carbon-Overflow Pathways in the Modulation of Bacterial Cell Death  

PubMed Central

Similar to developmental programs in eukaryotes, the death of a subpopulation of cells is thought to benefit bacterial biofilm development. However mechanisms that mediate a tight control over cell death are not clearly understood at the population level. Here we reveal that CidR dependent pyruvate oxidase (CidC) and ?-acetolactate synthase/decarboxylase (AlsSD) overflow metabolic pathways, which are active during staphylococcal biofilm development, modulate cell death to achieve optimal biofilm biomass. Whereas acetate derived from CidC activity potentiates cell death in cells by a mechanism dependent on intracellular acidification and respiratory inhibition, AlsSD activity effectively counters CidC action by diverting carbon flux towards neutral rather than acidic byproducts and consuming intracellular protons in the process. Furthermore, the physiological features that accompany metabolic activation of cell death bears remarkable similarities to hallmarks of eukaryotic programmed cell death, including the generation of reactive oxygen species and DNA damage. Finally, we demonstrate that the metabolic modulation of cell death not only affects biofilm development but also biofilm-dependent disease outcomes. Given the ubiquity of such carbon overflow pathways in diverse bacterial species, we propose that the metabolic control of cell death may be a fundamental feature of prokaryotic development. PMID:24945831

Thomas, Vinai Chittezham; Sadykov, Marat R.; Chaudhari, Sujata S.; Jones, Joselyn; Endres, Jennifer L.; Widhelm, Todd J.; Ahn, Jong-Sam; Jawa, Randeep S.; Zimmerman, Matthew C.; Bayles, Kenneth W.

2014-01-01

142

Methylamine utilization via the N-methylglutamate pathway in Methylobacterium extorquens PA1 involves a novel flow of carbon through C1 assimilation and dissimilation pathways.  

PubMed

Methylotrophs grow on reduced single-carbon compounds like methylamine as the sole source of carbon and energy. In Methylobacterium extorquens AM1, the best-studied aerobic methylotroph, a periplasmic methylamine dehydrogenase that catalyzes the primary oxidation of methylamine to formaldehyde has been examined in great detail. However, recent metagenomic data from natural ecosystems are revealing the abundance and importance of lesser-known routes, such as the N-methylglutamate pathway, for methylamine oxidation. In this study, we used M. extorquens PA1, a strain that is closely related to M. extorquens AM1 but is lacking methylamine dehydrogenase, to dissect the genetics and physiology of the ecologically relevant N-methylglutamate pathway for methylamine oxidation. Phenotypic analyses of mutants with null mutations in genes encoding enzymes of the N-methylglutamate pathway suggested that ?-glutamylmethylamide synthetase is essential for growth on methylamine as a carbon source but not as a nitrogen source. Furthermore, analysis of M. extorquens PA1 mutants with defects in methylotrophy-specific dissimilatory and assimilatory modules suggested that methylamine use via the N-methylglutamate pathway requires the tetrahydromethanopterin (H4MPT)-dependent formaldehyde oxidation pathway but not a complete tetrahydrofolate (H4F)-dependent formate assimilation pathway. Additionally, we present genetic evidence that formaldehyde-activating enzyme (FAE) homologs might be involved in methylotrophy. Null mutants of FAE and homologs revealed that FAE and FAE2 influence the growth rate and FAE3 influences the yield during the growth of M. extorquens PA1 on methylamine. PMID:25225269

Nayak, Dipti D; Marx, Christopher J

2014-12-01

143

Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria  

SciTech Connect

Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

Ferry, J.G.

1991-12-31

144

Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria  

SciTech Connect

Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

Ferry, J.G.

1991-01-01

145

13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose  

PubMed Central

Background The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions and the utilization of the respirative pathway has not been investigated on the level of in vivo fluxes. Results The biosynthetic pathways of amino acids in T. reesei supported by genome-level evidence were reconstructed with computational carbon path analysis. The pathway reconstructions were a prerequisite for analysis of in vivo fluxes. The distribution of in vivo fluxes in both wild type strain and cre1, a key regulator of carbon catabolite repression, deletion strain were quantitatively studied by performing 13C-labeling on both repressive carbon source glucose and non-repressive carbon source sorbitol. In addition, the 13C-labeling on sorbitol was performed both in the presence and absence of sophorose that induces the expression of cellulase genes. Carbon path analyses and the 13C-labeling patterns of proteinogenic amino acids indicated high similarity between biosynthetic pathways of amino acids in T. reesei and yeast Saccharomyces cerevisiae. In contrast to S. cerevisiae, however, mitochondrial rather than cytosolic biosynthesis of Asp was observed under all studied conditions. The relative anaplerotic flux to the TCA cycle was low and thus characteristic to respiratory metabolism in both strains and independent of the carbon source. Only minor differences were observed in the flux distributions of the wild type and cre1 deletion strain. Furthermore, the induction of the hydrolytic gene expression did not show altered flux distributions and did not affect the relative amino acid requirements or relative anabolic and respirative activities of the TCA cycle. Conclusion High similarity between the biosynthetic pathways of amino acids in T. reesei and yeast S. cerevisiae was concluded. In vivo flux distributions confirmed that T. reesei uses primarily the respirative pathway also when growing on the repressive carbon source glucose in contrast to Saccharomyces cerevisiae, which substantially diminishes the respirative pathway flux under glucose repression. PMID:19874611

Jouhten, Paula; Pitkänen, Esa; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Maaheimo, Hannu

2009-01-01

146

Carbon and chlorine isotope analysis to identify abiotic degradation pathways of 1,1,1-trichloroethane.  

PubMed

This study investigates dual C-Cl isotope fractionation during 1,1,1-TCA transformation by heat-activated persulfate (PS), hydrolysis/dehydrohalogenation (HY/DH) and Fe(0). Compound-specific chlorine isotope analysis of 1,1,1-TCA was performed for the first time, and transformation-associated isotope fractionation ? bulk C and ? bulk Cl values were -4.0 ± 0.2‰ and no chlorine isotope fractionation with PS, -1.6 ± 0.2‰ and -4.7 ± 0.1‰ for HY/DH, -7.8 ± 0.4‰ and -5.2 ± 0.2‰ with Fe(0). Distinctly different dual isotope slopes (??13C/??37Cl): ? with PS, 0.33 ± 0.04 for HY/DH and 1.5 ± 0.1 with Fe(0) highlight the potential of this approach to identify abiotic degradation pathways of 1,1,1-TCA in the field. The trend observed with PS agreed with a C-H bond oxidation mechanism in the first reaction step. For HY/DH and Fe(0) pathways, different slopes were obtained although both pathways involve cleavage of a C-Cl bond in their initial reaction step. In contrast to the expected larger primary carbon isotope effects relative to chlorine for C-Cl bond cleavage, ? bulk C < ? bulk Cl was observed for HY/DH and in a similar range for reduction by Fe(0), suggesting the contribution of secondary chlorine isotope effects. Therefore, different magnitude of secondary chlorine isotope effects could at least be partly responsible for the distinct slopes between HY/DH and Fe(0) pathways. Following this dual isotope approach, abiotic transformation processes can unambiguously be identified and quantified. PMID:25379605

Palau, Jordi; Shouakar-Stash, Orfan; Hunkeler, Daniel

2014-12-16

147

New Pathways and Metrics for Enhanced, Reversible Hydrogen Storage in Boron-Doped Carbon Nanospaces  

SciTech Connect

This project, since its start in 2007—entitled “Networks of boron-doped carbon nanopores for low-pressure reversible hydrogen storage” (2007-10) and “New pathways and metrics for enhanced, reversible hydrogen storage in boron-doped carbon nanospaces” (2010-13)—is in support of the DOE's National Hydrogen Storage Project, as part of the DOE Hydrogen and Fuel Cells Program’s comprehensive efforts to enable the widespread commercialization of hydrogen and fuel cell technologies in diverse sectors of the economy. Hydrogen storage is widely recognized as a critical enabling technology for the successful commercialization and market acceptance of hydrogen powered vehicles. Storing sufficient hydrogen on board a wide range of vehicle platforms, at energy densities comparable to gasoline, without compromising passenger or cargo space, remains an outstanding technical challenge. Of the main three thrust areas in 2007—metal hydrides, chemical hydrogen storage, and sorption-based hydrogen storage—sorption-based storage, i.e., storage of molecular hydrogen by adsorption on high-surface-area materials (carbons, metal-organic frameworks, and other porous organic networks), has emerged as the most promising path toward achieving the 2017 DOE storage targets of 0.055 kg H2/kg system (“5.5 wt%”) and 0.040 kg H2/liter system. The objective of the project is to develop high-surface-area carbon materials that are boron-doped by incorporation of boron into the carbon lattice at the outset, i.e., during the synthesis of the material. The rationale for boron-doping is the prediction that boron atoms in carbon will raise the binding energy of hydro- gen from 4-5 kJ/mol on the undoped surface to 10-14 kJ/mol on a doped surface, and accordingly the hydro- gen storage capacity of the material. The mechanism for the increase in binding energy is electron donation from H2 to electron-deficient B atoms, in the form of sp2 boron-carbon bonds. Our team is proud to have demonstrated the predicted increase in binding energy experimentally, currently at ~10 kJ/mol. The synthetic route for incorporation of boron at the outset is to create appropriately designed copoly- mers, with a boron-free and a boron-carrying monomer, followed by pyrolysis of the polymer, yielding a bo- ron-substituted carbon scaffold in which boron atoms are bonded to carbon atoms by synthesis. This is in contrast to a second route (funded by DE-FG36-08GO18142) in which first high-surface area carbon is cre- ated and doped by surface vapor deposition of boron, with incorporation of the boron into the lattice the final step of the fabrication. The challenge in the first route is to create high surface areas without compromising sp2 boron-carbon bonds. The challenge in the second route is to create sp2 boron-carbon bonds without com- promising high surface areas.

Pfeifer, Peter [University of Missouri; Wexler, Carlos [University of Missouri; Hawthorne, M. Frederick [University of Missouri; Lee, Mark W. [University of Missouri; Jalistegi, Satish S. [University of Missouri

2014-08-14

148

The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast  

SciTech Connect

The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates.

Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

2007-08-08

149

C1 metabolism in Corynebacterium glutamicum: an endogenous pathway for oxidation of methanol to carbon dioxide.  

PubMed

Methanol is considered an interesting carbon source in "bio-based" microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert (13)C-labeled methanol to (13)CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

Witthoff, Sabrina; Mühlroth, Alice; Marienhagen, Jan; Bott, Michael

2013-11-01

150

C1 Metabolism in Corynebacterium glutamicum: an Endogenous Pathway for Oxidation of Methanol to Carbon Dioxide  

PubMed Central

Methanol is considered an interesting carbon source in “bio-based” microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert 13C-labeled methanol to 13CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

Witthoff, Sabrina; Mühlroth, Alice

2013-01-01

151

Fixation: A Bibliography.  

ERIC Educational Resources Information Center

Fixation and regression were considered complementary by Freud. You tend to regress to a point of fixation. They are both opposed to progression. In the general area, Anna Freud has written (The Ego and the Mechanisms of Defence. London: Hogarth and the Psycho-Analytic Institute, 1937), Sears has evaluated (Survey of Objective Studies of…

Pedrini, D. T.; Pedrini, Bonnie C.

152

Method for isolation of auxotrophs in the methanogenic archaebacteria: role of the acetyl-CoA pathway of autotrophic CO2 fixation in Methanococcus maripaludis.  

PubMed Central

A procedure was developed for the enrichment of auxotrophs in the antibiotic-insensitive archaebacterium Methanococcus. After mutagenesis with ethyl methanesulfonate, growing cells were selectively killed upon exposure to the base analogs 6-azauracil and 8-azahypoxanthine for 48 hr. Using this method, eight independent acetate autotrophs of Methanococcus maripaludis were isolated. Six of the auxotrophs had an absolute growth requirement for acetate and contained 1-16% of the wild-type levels of CO dehydrogenase. Three of these six also contained 14-29% of the wild-type levels of pyruvate oxidoreductase and 12-30% of the wild-type levels of pyruvate synthase. Two spontaneous revertants of these latter auxotrophs regained the ability to grow normally in the absence of acetate and wild-type levels of CO dehydrogenase, acetyl-CoA synthase, pyruvate oxidoreductase, and pyruvate synthase. Likewise, a spontaneous revertant of an auxotroph with reduced levels of CO dehydrogenase and wild-type levels of pyruvate oxidoreductase regained the ability to grow normally in the absence of acetate and wild-type levels of CO dehydrogenase and acetyl-CoA synthase. Two additional auxotrophs grew poorly in the absence of acetate but contained wild-type levels of CO dehydrogenase and pyruvate oxidoreductase. These results provide direct genetic evidence for the Ljungdahl-Wood pathway [Ljungdahl, L. G. (1986) Annu. Rev. Microbiol. 40, 415-450; Wood, H. G., Ragsdale, S. W. & Pezacka, E. (1986) Trends Biochem. Sci. 11, 14-18] of autotrophic acetyl-CoA biosynthesis in the methanogenic archaebacteria. Moreover, it suggests that the acetyl-CoA and pyruvate synthases may share a common protein or coenzyme component, be linked genetically, or be regulated by a common system. PMID:11607093

Ladapo, J; Whitman, W B

1990-01-01

153

The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast  

Microsoft Academic Search

The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and

Kent W. Warnken; Peter H. Santschi; Kimberly A. Roberts; Gary A. Gill

2008-01-01

154

Pathways of carbon oxidation in continental margin sediments off central Chile.  

PubMed

Rates and oxidative pathways of organic carbon mineralization were determined in sediments at six stations on the shelf and slope off Concepcion Bay at 36.5 degrees S. The depth distribution of C oxidation rates was determined to 10 cm from accumulation of dissolved inorganic C in 1-5-d incubations. Pathways of C oxidation were inferred from the depth distributions of the potential oxidants (O2, NO3-, and oxides of Mn and Fe) and from directly determined rates of SO4(2-) reduction. The study area is characterized by intense seasonal upwelling, and during sampling in late summer the bottom water over the shelf was rich in NO3- and depleted of O2. Sediments at the four shelf stations were covered by mats of filamentous bacteria of the genera Thioploca and Beggiatoa. Carbon oxidation rates at these sites were extremely high near the sediment surface (>3 micromol cm-3 d-1) and decreased exponentially with depth. The process was entirely coupled to SO4(2-) reduction. At the two slope stations where bottom-water O2 was > 100 microM, C oxidation rates were 10-fold lower and varied less with depth; C oxidation coupled to the reduction of O2, NO3-, and Mn oxides combined to yield an estimated 15% of the total C oxidation between 0 and 10 cm. Carbon oxidation through Fe reduction contributed a further 12-29% of the depth-integrated rate, while the remainder of C oxidation was through SO4(2-) reduction. The depth distribution of Fe reduction agreed well with the distribution of poorly crystalline Fe oxides, and as this pool decreased with depth, the importance of SO4(2-) reduction increased. The results point to a general importance of Fe reduction in C oxidation in continental margin sediments. At the shelf stations, Fe reduction was mainly coupled to oxidation of reduced S. These sediments were generally H2S-free despite high SO4(2-) reduction rates, and precipitation of Fe sulfides dominated H2S scavenging during the incubations. A large NO3- pool was associated with the Thioploca, and the shelf sediments were thus enriched in NO3- relative to the bottom water, with maximum concentrations of 3 micromol cm-3. The NO3- was consumed during our sediment incubations, but no effects on either C or S cycles could be discerned. PMID:11540503

Thamdrup, B; Canfield, D E

1996-12-01

155

Tight coupling of root-associated nitrogen fixation and plant photosynthesis in the salt marsh Spartina alterniflora and carbon dioxide enhancement of Nitrogenase activity  

SciTech Connect

The coupling of root-associated nitrogen fixation and plant photosynthesis was examined in the salt marsh grass Spartina alterniflora. In both field experiments and hydroponic assay chambers, nitrogen fixation associated with the roots was rapidly enhanced by stimulating plant photosynthesis. A kinetic analysis of acetylene reduction activity (ARA) showed that a five-to-sixfold stimulation occurred within 10 to 60 min after the plant leaves were exposed to light or increase CO/sub 2/ concentrations (with the light held constant). In field experiments, CO/sub 2/ enrichment increased plant-associated ARA by 27%. Further evidence of the dependence of ARA on plant photosynthate was obtained when activity in excised roots was shown to decrease after young greenhouse plants were placed in the dark. Seasonal variation in the ARA of excised plant roots from field cores appears to be related to the annual cycle of net photosynthesis in S. alterniflora.

Whiting, G.J.; Gandy, E.L.; Yoch, D.C.

1986-07-01

156

Hydrogen production and CO 2 fixation by flue-gas treatment using methane tri-reforming or coke\\/coal gasification combined with lime carbonation  

Microsoft Academic Search

The production of hydrogen and the fixation of CO2 can be achieved by treatment of flue gases derived from fossil fuel fired power plants via catalytic methane tri-reforming or by coal gasification in the presence of CaO. A two-step process is designed to be carried out in two reactors: a) a catalytic gasifier or steam-reformer, operating exothermally at 900–1000K, with

M. Halmann; A. Steinfeld

2009-01-01

157

Ontogenetic Interactions between Photosynthesis and Symbiotic Nitrogen Fixation in Legumes  

Microsoft Academic Search

Photosynthetic data collected from Pisum sativum L. and Phaseolus vulgaris L. plants at different stages of development were related to symbiotic N2 fixation in the root nodules. The net carbon exchange rate of each leaf varied directly with carboxylation efficiency and inversely with the CO2 compensation point. Net carbon exchange of the lowest leaves reputed to supply fixed carbon to

GABOR J. BETHLENFALVAY; DONALD A. PHILLIPS

1977-01-01

158

Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway.  

PubMed

Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 ± 0.026 ng/mL for 1 mg/L, 0.21 ± 0.024 ng/mL for 5 mg/L, and 0.27 ± 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 ± 0.01 ng/mL for 1 mg/L, 0.12 ± 0.017 ng/mL for 5 mg/L, and 0.17 ± 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus. PMID:24039418

Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian

2013-01-01

159

Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway  

PubMed Central

Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 ± 0.026 ng/mL for 1 mg/L, 0.21 ± 0.024 ng/mL for 5 mg/L, and 0.27 ± 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 ± 0.01 ng/mL for 1 mg/L, 0.12 ± 0.017 ng/mL for 5 mg/L, and 0.17 ± 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus. PMID:24039418

Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian

2013-01-01

160

Catabolite Regulation of the pta Gene as Part of Carbon Flow Pathways in Bacillus subtilis  

PubMed Central

In Bacillus subtilis, the products of the pta and ackA genes, phosphotransacetylase and acetate kinase, play a crucial role in the production of acetate, one of the most abundant by-products of carbon metabolism in this gram-positive bacterium. Although these two enzymes are part of the same pathway, only mutants with inactivated ackA did not grow in the presence of glucose. Inactivation of pta had only a weak inhibitory effect on growth. In contrast to pta and ackA in Escherichia coli, the corresponding B. subtilis genes are not cotranscribed. Expression of the pta gene was increased in the presence of glucose, as has been reported for ackA. The effects of the predicted cis-acting catabolite response element (CRE) located upstream from the promoter and of the trans-acting proteins CcpA, HPr, Crh, and HPr kinase on the catabolite regulation of pta were investigated. As for ackA, glucose activation was abolished in ccpA and hprK mutants and in the ptsH1 crh double mutant. Footprinting experiments demonstrated an interaction between CcpA and the pta CRE sequence, which is almost identical to the proposed CRE consensus sequence. This interaction occurs only in the presence of Ser-46-phosphorylated HPr (HPrSer-P) or Ser-46-phosphorylated Crh (CrhSer-P) and fructose-1,6-bisphosphate (FBP). In addition to CcpA, carbon catabolite activation of the pta gene therefore requires at least two other cofactors, FBP and either HPr or Crh, phosphorylated at Ser-46 by the ATP-dependent Hpr kinase. PMID:10559153

Presecan-Siedel, Elena; Galinier, Anne; Longin, Robert; Deutscher, Josef; Danchin, Antoine; Glaser, Philippe; Martin-Verstraete, Isabelle

1999-01-01

161

Nitrogen fixation in peanut nodules during dark periods and detopped conditions with special reference to lipid bodies  

SciTech Connect

The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of {beta}-oxidation pathway and glyoxylate cycle is shown by the release of {sup 14}CO{sub 2} from {sup 14}C lineoleoyl coenzyme A by the nodule homogenate.

Siddique, A.M.; Bal, A.K. (Memorial Univ. of Newfoundland, St. John's (Canada))

1991-03-01

162

Transport of dissolved organic carbon from soil to surface water: Identifying the transport pathways  

NASA Astrophysics Data System (ADS)

Over the last decades, increasing concentrations of dissolved organic carbon (DOC) have been found in surface waters. It has also become clear that land use is an important driver for DOC export. However, causal factors controlling this temporal and spatial variation are not clear. Efforts to model DOC export on a catchment scale are rare. In this research, we aim to determine the factors controlling variations in DOC concentration and quality in surface waters. Secondly, the importance of the different pathways (surface runoff, subsurface flow and groundwater flow) for the transport of dissolved organic matter from the soil to the surface water is investigated. Six headwater catchments (100 - 400 ha) were selected in Belgium, representing three different types of land use, namely forest, grassland and arable land. At the outlet of each catchment, a flow-proportional sampler has been collecting samples of base flow and peak discharge since January 2010. In addition, samples of groundwater, subsurface water and precipitation water were collected on a regular base in three of the catchments. Samples were analyzed for DOC, specific UV absorbance (SUVA) and dissolved silica (DSi). Elemental analysis was carried out using ICP-OES. Since 2012, precipitation water and a selection of river water samples was also analyzed for O and H isotopes. Overall, DOC concentrations were highest in forest catchments and lowest in grassland catchments. For all land use types, measured DOC concentrations were highest during peak discharge. The rise in DOC concentrations was associated with a change in DOC quality. During periods of greater discharge, higher SUVA values were measured, indicating DOC with higher aromaticity (humic and fulvic fractions) reaches the outlet. ICP and DSi results also showed a significant difference in geochemical composition of the river water if peak events are compared to base flow samples. During an event, Ca, Mg, Na, S and DSi concentrations were lowered, while K concentrations rose. Isotope analysis showed more heavy O an H isotopes during peak events than during baseflow. Results of the river water were combined with analysis of possible end-members in the catchments, using the groundwater, soil water and precipitation samples. An end-member-mixing-analysis (EMMA) gained more insight into the contributing pathways for the transport of organic matter from the soil to the surface water during base and peak flow. Furthermore, results from the different catchments were compared, and allowed to relate DOC transport to land use type. This is an important step towards a model describing DOC transport at the catchment scale.

Van Gaelen, Nele

2013-04-01

163

Cleaner pathways of hydrogen, carbon nano-materials and metals production via solar thermal processing  

Microsoft Academic Search

This paper describes various solar thermochemical processes for the production of hydrogen, carbon nano particles, industrial grade carbon black, and metals with substantially reduced CO2 emission footprint. The paper introduces an innovative approach of a three-dimensional volumetric production of carbon nano particles via thermal cracking of methane gained by carbon seeding as an alternative to the existing two dimensional modes.

Nesrin Ozalp; Michael Epstein; Abraham Kogan

2010-01-01

164

A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime  

NASA Technical Reports Server (NTRS)

A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

Carr, Mary-Elena

1998-01-01

165

Carbon and nitrogen uptake in the South Pacific Ocean: evidence for efficient dinitrogen fixation and regenerated production leading to large accumulation of dissolved organic matter in nitrogen-depleted waters  

NASA Astrophysics Data System (ADS)

A major goal of the BIOSOPE cruise on the R/V Atalante to the South Pacific Ocean (conducted in October-November 2004) was to establish rate of productivity along a longitudinal section across the oligotrophic South Pacific Gyre (SPG), and compared these measurements with those obtained in nutrient-repleted waters from Chilean upwelling and around Marquesas Islands. A dual 13C/15N isotopic technique was used to estimate rates of carbon fixation, inorganic nitrogen uptake (including dinitrogen fixation), ammonium (NH4) and nitrate (NO3) regeneration, and dissolved organic nitrogen (DON) release resulting from both NH4 and NO3 uptake. The SPG had revealed the lowest rates of primary production (0.1 gC.m-2.d-1), while rates were 7 to 20 fold higher around the Marquesas Islands and in the Chilean upwelling, respectively. In this very low productive area, most of primary production was sustained by active regeneration processes which fuelled up to 95% of the biological nitrogen demand. Since nitrification was very active in the surface layer and often balanced the biological demand of nitrate, dinitrogen fixation, although acting at low daily rate (?1-2 nmoles l-1d-1), sustained the main part of new production. Then, new production in the SPG (0.008±0.007 gC m-2.d-1) was two orders of magnitude lower than this measured in the upwelling where it essentially sustained by nitrate (0.69±0.49 gC.m-2.d-1). In the whole investigated region, the percentage of nitrogen release as DON represented a large part of the inorganic nitrogen uptake (13-15% in average), and reaching 26-41% in the SPG where the production of DON appeared to be a major part of the nitrogen cycle. Due to the lack of annual vertical mixing and very low lateral advection, the high release rates could explain the large accumulation of dissolved organic matter observed in the nitrogen-depleted and low productive waters of the South Pacific Gyre.

Raimbault, P.; Garcia, N.

2007-10-01

166

The Fixation of Nitrogen.  

ERIC Educational Resources Information Center

Discusses the fixation of atmospheric nitrogen in the form of ammonia as one of the foundations of modern chemical industry. The article describes ammonia production and synthesis, purifying the hydrogen-nitrogen mix, nitric acid production, and its commericial plant. (HM)

Andrew, S. P. S.

1978-01-01

167

Update: Biological Nitrogen Fixation.  

ERIC Educational Resources Information Center

Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,…

Wiseman, Alan; And Others

1985-01-01

168

Elevated carbon dioxide ameliorates the eects of ozone on photosynthesis and growth: species respond similarly regardless of photosynthetic pathway or plant functional group  

Microsoft Academic Search

summary Due to their dierent physiological eects, elevated carbon dioxide and elevated ozone might have interactive impacts on plants, and dierentially so on plants diering in photosynthetic pathway and growth rate. To test several hypotheses related to these issues, we examined the physiological, morphological and growth responses of six perennial species grown at various atmospheric concentrations of carbon dioxide and

JOHN C. V OLIN; P ETER B. R EICH; THOMAS J. G IVNISH

169

External fixation of tibial fractures.  

PubMed

External fixation for definitive or initial management of tibial fractures has a long history, with pin-to-bar external fixation being the standard of care for definitive management of tibial fractures. However, the use of this method lessened because of the increased popularity of intramedullary nailing and drawbacks associated with external fixation. This method is still commonly in use in the military environment and can be used for temporary stabilization of tibial fractures, especially in the setting of periarticular injuries. These fixators also may be useful for salvage of open and/or infected fractures that are unsuitable for internal fixation. PMID:25613987

Tejwani, Nirmal; Polonet, David; Wolinsky, Philip R

2015-02-01

170

A batch study on the bio-fixation of carbon dioxide in the absorbed solution from a chemical wet scrubber by hot spring and marine algae.  

PubMed

Carbon dioxide mass transfer is a key factor in cultivating micro-algae except for the light limitation of photosynthesis. It is a novel idea to enhance mass transfer with the cyclic procedure of absorbing CO(2) with a high performance alkaline abosorber such as a packed tower and regenerating the alkaline solution with algal photosynthesis. Hence, the algae with high affinity for alkaline condition must be purified. In this study, a hot spring alga (HSA) was purified from an alkaline hot spring (pH 9.3, 62 degrees C) in Taiwan and grows well over pH 11.5 and 50 degrees C. For performance of HSA, CO(2) removal efficiencies in the packed tower increase about 5-fold in a suitable growth condition compared to that without adding any potassium hydroxide. But ammonia solution was not a good choice for this system with regard to carbon dioxide removal efficiency because of its toxicity on HSA. In addition, HSA also exhibits a high growth rate under the controlled pHs from 7 to 11. Besides, a well mass balance of carbon and nitrogen made sure that less other byproducts formed in the procedure of carboxylation. For analysis of some metals in HSA, such as Mg, Mn, Fe, Zn, related to the photosynthesis increased by a rising cultivated pH and revealed that those metals might be accumulated under alkaline conditions but the growth rate was still limited by the ratio of bicarbonate (useful carbon source) and carbonate. Meanwhile, Nannochlopsis oculta (NAO) was also tested under different additional carbon sources. The results revealed that solutions of sodium/potassium carbonate are better carbon sources than ammonia carbonate/bicarbonate for the growth of NAO. However, pH 9.6 of growth limitation based on sodium was lower than one of HSA. The integrated system is, therefore, more feasible to treat CO(2) in the flue gases using the algae with higher alkaline affinity such as HSA in small volume bioreactors. PMID:16860839

Hsueh, H T; Chu, H; Yu, S T

2007-01-01

171

Expression of Hypoxia-inducible Carbonic Anhydrase-9 Relates to Angiogenic Pathways and Independently to Poor Outcome in Non-Small Cell Lung Cancer  

Microsoft Academic Search

Carbonic anhydrase-9 (CA9), a transmembrane enzyme with an extra- cellular active site, is involved in the reversible metabolism of the carbon dioxide to carbonic acid. Up-regulation of CA by hypoxia and the hypoxia- inducible factor (HIF) pathway has been recently postulated (Wykoff et al. Cancer Res., 60: 7075-7083, 2000). In the present study we examined the expression of this enzyme

Alexandra Giatromanolaki; Michael I. Koukourakis; Efthimios Sivridis; Jaromir Pastorek; Charles C. Wykoff; Kevin C. Gatter; Adrian L. Harris

172

Pathways and Mechanisms of OceanTracer Transport: Implications for Carbon Sequestration  

SciTech Connect

This funding enabled the following published manuscripts in which we have developed models of direct relevance to ocean carbon sequestration and of the oceanic iron cycle, its connection to the global carbon cycle, and the sensitivity of atmospheric carbon dioxide to the external source of iron. As part of this process we have developed the adjoint of the MIT ocean biogeochemistry model which has enabled us to perform rigorous and efficient sensitivity studies.

Marshall, John; Follows, MIchael

2006-11-06

173

Re-engineering of carbon fixation in plants - challenges for plant biotechnology to improve yields in a high-CO2 world.  

PubMed

Source and sink strength control plant carbon gain and yield. Source strength was recently engineered by modifying the large subunit of Rubisco, replacing the small subunit, and creating improved thermostable Rubisco activases. This technological breakthrough makes Rubisco engineering feasible at last. Enhancement of leaf transitory starch synthesis or induction of artificial sinks in leaves increased biomass and yield. Importantly, such approaches also had a positive feedback on source strength. In addition, novel targets for the improvement of carbon gain in crops have been identified that are especially relevant in the light of climate change. PMID:22261558

Peterhansel, Christoph; Offermann, Sascha

2012-04-01

174

Regulation of Development and Nitrogen Fixation in Anabaena  

SciTech Connect

The nitrogen-fixing filamentous cyanobacterium Anabaena sp. strain PCC 7120 is being used as a simple model of microbial development and pattern formation in a multicellular prokaryotic organism. Anabaena reduces atmospheric nitrogen to ammonia in highly specialized, terminally differentiated cells called heterocysts. Anabaena is an important model system because of the multicellular growth pattern, the suspected antiquity of heterocyst development, and the contribution of fixed nitrogen to the environment. We are especially interested in understanding the molecular signaling pathways and genetic regulation that control heterocyst development. In the presence of an external source of reduced nitrogen, the differentiation of heterocysts is inhibited. When Anabaena is grown on dinitrogen, a one-dimensional developmental pattern of single heterocysts separated by approximately ten vegetative cells is established to form a multicellular organism composed of two interdependent cell types. The goal of this project is to understand the signaling and regulatory pathways that commit a vegetative cell to terminally differentiate into a nitrogen-fixing heterocyst. Several genes identified by us and by others were chosen as entry points into the regulatory network. Our research, which was initially focused on transcriptional regulation by group 2 sigma factors, was expanded to include group 3 sigma factors and their regulators after the complete Anabaena genome sequence became available. Surprisingly, no individual sigma factor is essential for heterocyst development. We have used the isolation of extragenic suppressors to study genetic interactions between key regulatory genes such as patS, hetR, and hetC in signaling and developmental pathways. We identified a hetR R223W mutation as a bypass suppressor of patS overexpression. Strains containing the hetR R223W allele fail to respond to pattern formation signals and overexpression of this allele results in a lethal phenotype because all cells differentiate a few days after nitrogen step-down. Our continued analysis of these genes will provide a better understanding of how a simple prokaryotic organism can perform both photosynthetic carbon fixation and nitrogen fixation simultaneously by separating these processes in different cell types.

James W Golden

2004-08-05

175

Ammonia oxidation coupled to CO2 fixation by archaea and bacteria in an agricultural soil.  

PubMed

Ammonia oxidation is an essential part of the global nitrogen cycling and was long thought to be driven only by bacteria. Recent findings expanded this pathway also to the archaea. However, most questions concerning the metabolism of ammonia-oxidizing archaea, such as ammonia oxidation and potential CO(2) fixation, remain open, especially for terrestrial environments. Here, we investigated the activity of ammonia-oxidizing archaea and bacteria in an agricultural soil by comparison of RNA- and DNA-stable isotope probing (SIP). RNA-SIP demonstrated a highly dynamic and diverse community involved in CO(2) fixation and carbon assimilation coupled to ammonia oxidation. DNA-SIP showed growth of the ammonia-oxidizing bacteria but not of archaea. Furthermore, the analysis of labeled RNA found transcripts of the archaeal acetyl-CoA/propionyl-CoA carboxylase (accA/pccB) to be expressed and labeled. These findings strongly suggest that ammonia-oxidizing archaeal groups in soil autotrophically fix CO(2) using the 3-hydroxypropionate-4-hydroxybutyrate cycle, one of the two pathways recently identified for CO(2) fixation in Crenarchaeota. Catalyzed reporter deposition (CARD)-FISH targeting the gene encoding subunit A of ammonia monooxygenase (amoA) mRNA and 16S rRNA of archaea also revealed ammonia-oxidizing archaea to be numerically relevant among the archaea in this soil. Our results demonstrate a diverse and dynamic contribution of ammonia-oxidizing archaea in soil to nitrification and CO(2) assimilation and that their importance to the overall archaeal community might be larger than previously thought. PMID:21368116

Pratscher, Jennifer; Dumont, Marc G; Conrad, Ralf

2011-03-01

176

Internal fixation of nonunions.  

PubMed

We review the two major types of internal fixation of nonunions (plating and intramedullary nailing), and analyze nonunions in different locations (upper and lower extremities). Depending on the type and the location of the nonunion, plating or intramedullary nailing may be selected. Both have advantages and disadvantages: plating requires opening the nonunion site, which entails some damage to the soft tissues, and carries with it a risk of secondary infection. With plating, it often is impossible to do a real decortication because the periosteum may be thin and poorly adherent to bone, and the quality of bone may prove insufficient to achieve good fixation with most of the screws. However, plating still is used in metaphyseal nonunions, and angular deformities may be corrected by applying a plate under tension on the convex side of the bone. Nailing can be done percutaneously in numerous cases; it has a smaller risk of infection but, should an infection be present, there is a risk that it may spread over the entire length of the medullary cavity. Nailing stimulates bone formation, but noninterlocking nails may cause shortening and rotational instability of the nonunion site. Plate fixation was popular approximately 20 years ago, but now has been largely superseded by intramedullary nailing except for proximal or distal nonunions. Dynamic locking nails are preferable. Successful treatment of nonunions often requires several consecutive surgical actions and a global strategy must be established from the beginning, taking care not to interfere with the successive steps. PMID:15021126

Rodriguez-Merchan, E Carlos; Gomez-Castresana, Fernando

2004-02-01

177

Understanding Nitrogen Fixation  

SciTech Connect

The purpose of our program is to explore fundamental chemistry relevant to the discovery of energy efficient methods for the conversion of atmospheric nitrogen (N{sub 2}) into more value-added nitrogen-containing organic molecules. Such transformations are key for domestic energy security and the reduction of fossil fuel dependencies. With DOE support, we have synthesized families of zirconium and hafnium dinitrogen complexes with elongated and activated N-N bonds that exhibit rich N{sub 2} functionalization chemistry. Having elucidated new methods for N-H bond formation from dihydrogen, C-H bonds and Broensted acids, we have since turned our attention to N-C bond construction. These reactions are particularly important for the synthesis of amines, heterocycles and hydrazines with a range of applications in the fine and commodity chemicals industries and as fuels. One recent highlight was the discovery of a new N{sub 2} cleavage reaction upon addition of carbon monoxide which resulted in the synthesis of an important fertilizer, oxamide, from the diatomics with the two strongest bonds in chemistry. Nitrogen-carbon bonds form the backbone of many important organic molecules, especially those used in the fertilizer and pharamaceutical industries. During the past year, we have continued our work in the synthesis of hydrazines of various substitution patterns, many of which are important precursors for heterocycles. In most instances, the direct functionalization of N{sub 2} offers a more efficient synthetic route than traditional organic methods. In addition, we have also discovered a unique CO-induced N{sub 2} bond cleavage reaction that simultaneously cleaves the N-N bond of the metal dinitrogen compound and assembles new C-C bond and two new N-C bonds. Treatment of the CO-functionalized core with weak Broensted acids liberated oxamide, H{sub 2}NC(O)C(O)NH{sub 2}, an important slow release fertilizer that is of interest to replace urea in many applications. The synthesis of ammonia, NH{sub 3}, from its elements, H{sub 2} and N{sub 2}, via the venerable Haber-Bosch process is one of the most significant technological achievements of the past century. Our research program seeks to discover new transition metal reagents and catalysts to disrupt the strong N {triple_bond} N bond in N{sub 2} and create new, fundamental chemical linkages for the construction of molecules with application as fuels, fertilizers and fine chemicals. With DOE support, our group has discovered a mild method for ammonia synthesis in solution as well as new methods for the construction of nitrogen-carbon bonds directly from N{sub 2}. Ideally these achievements will evolve into more efficient nitrogen fixation schemes that circumvent the high energy demands of industrial ammonia synthesis. Industrially, atmospheric nitrogen enters the synthetic cycle by the well-established Haber-Bosch process whereby N{sub 2} is hydrogenated to ammonia at high temperature and pressure. The commercialization of this reaction represents one of the greatest technological achievements of the 20th century as Haber-Bosch ammonia is responsible for supporting approximately 50% of the world's population and serves as the source of half of the nitrogen in the human body. The extreme reaction conditions required for an economical process have significant energy consequences, consuming 1% of the world's energy supply mostly in the form of pollution-intensive coal. Moreover, industrial H{sub 2} synthesis via the water gas shift reaction and the steam reforming of methane is fossil fuel intensive and produces CO{sub 2} as a byproduct. New synthetic methods that promote this thermodynamically favored transformation ({Delta}G{sup o} = -4.1 kcal/mol) under milder conditions or completely obviate it are therefore desirable. Most nitrogen-containing organic molecules are derived from ammonia (and hence rely on the Haber-Bosch and H{sub 2} synthesis processes) and direct synthesis from atmospheric nitrogen could, in principle, be more energy-efficient. This is particularly attractive giv

Paul J. Chirik

2012-05-25

178

Utilization of aromatic compounds as carbon and energy sources during growth and N 2 -fixation by free-living nitrogen fixing bacteria  

Microsoft Academic Search

Six species of free-living nitrogen fixing bacteria, Azomonas agilis, Azospirillum brasilense, Azospirillum lipoferum, Azotobacter chroococcum, Azotobacter vinelandii, and Beijerinckia mobilis, were surveyed for their ability to grow and fix N2 using aromatic compounds as sole carbon and energy source. All six species grew and expressed nitrogenase activity on benzoate, catechol, 4-hydroxybenzoate, naphthalene, protocatechuate, and 4-toluate. In many cases, growth rates

Yung Pin Chen; Geralyne Lopez-de-Victoria; Charles R. Lovell

1993-01-01

179

5:3 Polyfluorinated acid aerobic biotransformation in activated sludge via novel "one-carbon removal pathways".  

PubMed

The polyfluorinated carboxylic acids 5:3 acid (C(5)F(11)CH(2)CH(2)CO(2)H) and 7:3 acid (C(7)F(15)CH(2)CH(2)CO(2)H) are major products from 6:2 FTOH (C(6)F(13)CH(2)CH(2)OH) and 8:2 FTOH (C(8)F(17)CH(2)CH(2)OH) aerobic biotransformation, respectively. The 5:3 and 7:3 acids were dosed into domestic WWTP activated sludge for 90 d to determine their biodegradability. The 7:3 acid aerobic biodegradability was low, only 1.7 mol% conversion to perfluoroheptanoic acid (PFHpA), whereas no transformation was observed previously in soil. In stark contrast, 5:3 acid aerobic biodegradability was enhanced 10 times in activated sludge compared to soil. The 5:3 acid was not activated by acyl CoEnzyme A (CoA) synthetase, a key step required for further ?- or ß-oxidation. Instead, 5:3 acid was directly converted to 4:3 acid (C(4)F(9)CH(2)CH(2)CO(2)H, 14.2 mol%) and 3:3 acid (C(3)F(7)CH(2)CH(2)CO(2)H, 0.9 mol%) via "one-carbon removal pathways". The 5:3 acid biotransformation also yielded perfluoropentanoic acid (PFPeA, 5.9 mol%) and perfluorobutanoic acid (PFBA, 0.8 mol%). This is the first report to identify key biotransformation intermediates which demonstrate novel one-carbon removal pathways with sequential removal of CF(2) groups. Identified biotransformation intermediates (10.2 mol% in sum) were 5:3 Uacid, ?-OH 5:3 acid, 5:2 acid, and 5:2 Uacid. The 5:2 Uacid and 5:2 acid are novel intermediates identified for the first time which confirm the proposed pathways. In the biodegradation pathways, the genesis of the one carbon removal is CO(2) elimination from ?-OH 5:3 acid. These results suggest that there are enzymatic mechanisms available in the environment that can lead to 6:2 FTOH and 5:3 acid mineralization. The dehydrogenation from 5:3 acid to 5:3 Uacid was the rate-limiting enzymatic step for 5:3 acid conversion to 4:3 acid. PMID:22264858

Wang, Ning; Buck, Robert C; Szostek, Bogdan; Sulecki, Lisa M; Wolstenholme, Barry W

2012-04-01

180

Effect of multiple mutations in tricarboxylic acid cycle and one-carbon metabolism pathways on Edwardsiella ictaluri pathogenesis.  

PubMed

Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of catfish (ESC). We have shown recently that tricarboxylic acid cycle (TCA) and one-carbon (C1) metabolism are involved in E. ictaluri pathogenesis. However, the effect of multiple mutations in these pathways is unknown. Here, we report four novel E. ictaluri mutants carrying double gene mutations in TCA cycle (Ei?mdh?sdhC, Ei?frdA?sdhC), C1 metabolism (Ei?glyA?gcvP), and both TCA and C1 metabolism pathways (Ei?gcvP?sdhC). In-frame gene deletions were constructed by allelic exchange and mutants' virulence and vaccine efficacy were evaluated using in vivo bioluminescence imaging (BLI) as well as end point mortality counts in catfish fingerlings. Results indicated that all the double gene mutants were attenuated compared to wild-type (wt) E. ictaluri. There was a 1.39-fold average reduction in bioluminescence, and hence bacterial numbers, from all the mutants except for Ei?frdA?sdhC at 144 h post-infection. Vaccination with mutants was very effective in protecting channel catfish against subsequent infection with virulent E. ictaluri 93-146 strain. In particular, immersion vaccination resulted in complete protection. Our results provide further evidence on the importance of TCA and C1 metabolism pathways in bacterial pathogenesis. PMID:24418045

Dahal, N; Abdelhamed, H; Lu, J; Karsi, A; Lawrence, M L

2014-02-21

181

Phosphorus limitation of nitrogen fixation by Trichodesmium in the central Atlantic Ocean  

Microsoft Academic Search

Marine fixation of atmospheric nitrogen is believed to be an important source of biologically useful nitrogen to ocean surface waters, stimulating productivity of phytoplankton and so influencing the global carbon cycle. The majority of nitrogen fixation in tropical waters is carried out by the marine cyanobacterium Trichodesmium, which supplies more than half of the new nitrogen used for primary production.

Sergio A. Sañudo-Wilhelmy; Adam B. Kustka; Christopher J. Gobler; David A. Hutchins; Min Yang; Kamazima Lwiza; James Burns; Douglas G. Capone; John A. Raven; Edward J. Carpenter

2001-01-01

182

Degradation pathways of dissolved carbon in landfill leachate traced with compound-specific (13)C analysis of DOC.  

PubMed

The isotopic compositions of carbon compounds in landfill leachate provide insights into the biodegradation pathways that dominate the different stages of waste decomposition. In this study, the carbon geochemistry of different carbon pools, environmental stable isotopes and compound-specific isotope analysis (CSIA) of leachate dissolved organic carbon (DOC) fractions and gases show distinctions in leachate biogeochemistry and methane production between the young area of active waste emplacement and the old area of historical emplacement at the Trail Road Landfill (TRL). The active area leachate has low DOC concentrations (<200 mg l(-1)) dominated by fulvic acid (FA=160 mg l(-1)), and produces CH(4) dominantly by CO(2) reduction (D- excess=20.6 per thousand). Leachate generated in the area of older waste has high DOC (>4770 mg l(-1)) dominated by FA (4482 mg l(-1)) and simple fatty acids (acetic=1008 mg l(-1) and propionic=608 mg l(-1)), and produces CH(4) by the acetate fermentation pathway (D- excess=9.8 per thousand). CSIA shows an advanced degradation and a progressive accumulation of (13)C of fatty acids in leachate from the older area. The enriched (13)C value of FA (-20 and-26 per thousand for the older and active parts, respectively,) and of low molecular weight DOC (-8 and-27 per thousand) as well as of the bulk DOC (-21 and-25 per thousand) shows more advanced degradation in the older part of the landfill, which is consistent with the shift in the humic/FA ratios (0.05 and 0.18). The (13)C enrichment of acetate (-12 per thousand) above the (13)C of DOC (-21 per thousand) and of propionic acid (-19 per thousand), in older leachate, suggests that this acetate has not evolved from the simple degradation of larger organic molecules, but by homoacetogenesis from the enriched dissolved inorganic carbon (DIC) pool (8 per thousand) and H(2,) which produce a more enriched (13)C of acetate. In contrast, the (13)C of the minor acetate in the active area (-17 per thousand) indicates that CO(2)-reducing bacteria must be the primary consumers of H(2), which has resulted in enriched (13)C(DIC) (10 per thousand) and depleted (13)C(CH4) (-58 per thousand). PMID:18763184

Mohammadzadeh, Hossein; Clark, Ian

2008-09-01

183

Absorbable Biologically Based Internal Fixation.  

PubMed

Absorbable fixation devices have developed since first being introduced. Current products are manufactured for greater strength and stiffness and slower break down. Absorbable devices for internal fixation should not be used when fracture fragments exclusively depend on screws for bearing direct load; rather, they are preferred for maintaining adequate compression and preventing displacement when some intrinsic stability exists between bones. The main advantage of absorbable internal fixation devices is their flexibility of use. A newer generation synthesized from silk has emerged and may help to overcome current limitations and address a broader range of fixation needs. PMID:25440418

Ibrahim, Ahmed M S; Koolen, Pieter G L; Kim, Kuylhee; Perrone, Gabe S; Kaplan, David L; Lin, Samuel J

2015-01-01

184

Trophic structure and pathways of biogenic carbon flow in the eastern North Water Polynya  

NASA Astrophysics Data System (ADS)

In the eastern North Water, most of the estimated annual new and net production of carbon (C) occurred during the main diatom bloom in 1998. During the bloom, at least 30% of total and new phytoplankton production occurred as dissolved organic carbon (DOC) and was unavailable for short-term assimilation into the herbivorous food web or sinking export. Based on particle interceptor traps and 234Th deficits, 27% of the particulate primary production (PP) sank out of the upper 50 m, with only 7% and 1% of PP reaching the benthos at shallow (?200 m) and deep (?500 m) sites, respectively. Mass balance calculations and grazing estimates agree that ?79% of PP was ingested by pelagic consumers between April and July. During this period, the vertical flux of biogenic silica (BioSi) at 50 m was equivalent to the total BioSi produced, indicating that all of the diatom production was removed from the euphotic zone as intact cells (direct sinking) or empty frustules (grazing or lysis). The estimated flux of empty frustules was consistent with rates of herbivory by the large, dominant copepods and appendicularians during incubations. Since the carbon demand of the dominant planktivorous bird, Alle alle, amounted to ?2% of the biomass synthesized by its main prey, the large copepod Calanus hyperboreus, most of the secondary carbon production was available to pelagic carnivores. Stable isotopes indicated that the biomass of predatory amphipods, polar cod and marine mammals was derived from these herbivores, but corresponding carbon fluxes were not quantified. Our analysis shows that a large fraction of PP in the eastern North Water was ingested by consumers in the upper 50 m, leading to substantial carbon respiration and DOC accumulation in surface waters. An increasingly early and prolonged opening of the Artic Ocean is likely to promote the productivity of the herbivorous food web, but not the short-term efficiency of the particulate, biological CO 2 pump.

Tremblay, Jean-Éric; Hattori, Hiroshi; Michel, Christine; Ringuette, Marc; Mei, Zhi-Ping; Lovejoy, Connie; Fortier, Louis; Hobson, Keith A.; Amiel, David; Cochran, Kirk

2006-10-01

185

Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501  

PubMed Central

The capacity to fix nitrogen is widely distributed in phyla of Bacteria and Archaea but has long been considered to be absent from the Pseudomonas genus. We report here the complete genome sequencing of nitrogen-fixing root-associated Pseudomonas stutzeri A1501. The genome consists of a single circular chromosome with 4,567,418 bp. Comparative genomics revealed that, among 4,146 protein-encoding genes, 1,977 have orthologs in each of the five other Pseudomonas representative species sequenced to date. The genome contains genes involved in broad utilization of carbon sources, nitrogen fixation, denitrification, degradation of aromatic compounds, biosynthesis of polyhydroxybutyrate, multiple pathways of protection against environmental stress, and other functions that presumably give A1501 an advantage in root colonization. Genetic information on synthesis, maturation, and functioning of nitrogenase is clustered in a 49-kb island, suggesting that this property was acquired by lateral gene transfer. New genes required for the nitrogen fixation process have been identified within the nif island. The genome sequence offers the genetic basis for further study of the evolution of the nitrogen fixation property and identification of rhizosphere competence traits required in the interaction with host plants; moreover, it opens up new perspectives for wider application of root-associated diazotrophs in sustainable agriculture. PMID:18495935

Yan, Yongliang; Yang, Jian; Dou, Yuetan; Chen, Ming; Ping, Shuzhen; Peng, Junping; Lu, Wei; Zhang, Wei; Yao, Ziying; Li, Hongquan; Liu, Wei; He, Sheng; Geng, Lizhao; Zhang, Xiaobing; Yang, Fan; Yu, Haiying; Zhan, Yuhua; Li, Danhua; Lin, Zhanglin; Wang, Yiping; Elmerich, Claudine; Lin, Min; Jin, Qi

2008-01-01

186

Definitive Bone Fixation and Reconstruction: Conversion from Temporary External Fixation to Internal Fixation Methods  

Microsoft Academic Search

\\u000a Temporary external fixation is frequently employed in the military combat theater of operations to temporize devastating extremity\\u000a injuries and facilitate transport of the wounded soldier. Multiple civilian and a few military studies have provided helpful\\u000a insight into the staged treatment of these injuries including conversion of temporary external fixation to definitive stabilization\\u000a with internal fixation. Diaphyseal fractures of the long

Craig S. Bartlett; Benjamin Geer; David L. Helfet

187

Carbon monoxide ameliorates chronic murine colitis through a heme oxygenase 1- dependent pathway  

Microsoft Academic Search

Heme oxygenase (HO)-1 and its metabolic product carbon monoxide (CO) play regulatory roles in acute inflammatory states. In this study, we demonstrate that CO administration is effective as a therapeutic modality in mice with established chronic colitis. CO administration ameliorates chronic intestinal inflammation in a T helper (Th)1-mediated model of murine colitis, interleukin (IL)-10-deficient ( IL-10 ? \\/ ? )

Refaat A. F. Hegazi; Kavitha N. Rao; Aqila Mayle; Antonia R. Sepulveda; Leo E. Otterbein; Scott E. Plevy

2005-01-01

188

Carbon Supported Polyaniline as Anode Catalyst: Pathway to Platinum-Free Fuel Cells  

E-print Network

The effectiveness of carbon supported polyaniline as anode catalyst in a fuel cell (FC) with direct formic acid electrooxidation is experimentally demonstrated. A prototype FC with such a platinum-free composite anode exhibited a maximum room-temperature specific power of about 5 mW/cm2

Zabrodskii, A G; Malyshkin, V G; Sapurina, I Y

2006-01-01

189

Molybdenum limitation of asymbiotic nitrogen fixation in tropical forest soils  

NASA Astrophysics Data System (ADS)

Nitrogen fixation, the biological conversion of di-nitrogen to plant-available ammonium, is the primary natural input of nitrogen to ecosystems, and influences plant growth and carbon exchange at local to global scales. The role of this process in tropical forests is of particular concern, as these ecosystems harbour abundant nitrogen-fixing organisms and represent one third of terrestrial primary production. Here we show that the micronutrient molybdenum, a cofactor in the nitrogen-fixing enzyme nitrogenase, limits nitrogen fixation by free-living heterotrophic bacteria in soils of lowland Panamanian forests. We measured the fixation response to long-term nutrient manipulations in intact forests, and to short-term manipulations in soil microcosms. Nitrogen fixation increased sharply in treatments of molybdenum alone, in micronutrient treatments that included molybdenum by design and in treatments with commercial phosphorus fertilizer, in which molybdenum was a `hidden' contaminant. Fixation did not respond to additions of phosphorus that were not contaminated by molybdenum. Our findings show that molybdenum alone can limit asymbiotic nitrogen fixation in tropical forests and raise new questions about the role of molybdenum and phosphorus in the tropical nitrogen cycle. We suggest that molybdenum limitation may be common in highly weathered acidic soils, and may constrain the ability of some forests to acquire new nitrogen in response to CO2 fertilization.

Barron, Alexander R.; Wurzburger, Nina; Bellenger, Jean Phillipe; Wright, S. Joseph; Kraepiel, Anne M. L.; Hedin, Lars O.

2009-01-01

190

Eighth international congress on nitrogen fixation  

SciTech Connect

This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

Not Available

1990-01-01

191

Using C and S isotopes to elucidate carbonic versus sulfuric acid reaction pathways during shale weathering in the Susquehanna Shale Hills Critical Zone Observatory  

NASA Astrophysics Data System (ADS)

Chemical weathering of silicate minerals via the carbonic acid reaction pathway regulates global climate on geological timescales. However, strong acids are also key dissolution agents that drive silicate and carbonate weathering. In order to assess the potentials of silicate weathering on CO2 consumption, it is crucial to separate carbonic acid versus sulfuric acid reaction pathways, and also to separate the contribution of stream-dissolved inorganic carbon (DIC) from silicate versus carbonate dissoution. Here we address these two questions using C and S isotopes at the well-studied Susquehanna Shale Hills Critical Zone Observatory (SSHO). In shallow soils of SSHO, clay dissolution dominates. Here soil waters are charaterized by low [DIC], which is controlled by equilibrium with soil pCO2. Carbonate minerals, in this Rose Hill Shale formation, are depleted in soils and have only been observed in few bedrock boreholes, i.e. at > 23m depth at ridges and > 2m depth under the valley. Indeed, some groundwaters have much higher [DIC], [Mg] and [Ca], presumably due to ankerite dissolution. Accompanied by the transition from silicate weathering in shallow soils to carbonate weathering below the water table, the source of sulfate shifts with depth from atmospheric deposition to pyrite dissolution. Apparently, the weathering fronts of ankerite and pyrite are at almost the same depth. The ?13CDIC values of these groundwaters indicate C mixing equally from ankerite and soil CO2, with only slight modification by the sulfuric acid pathway. Groundwater chemistry evolves to different extents with respect to ankerite saturation because the depths to ankerite weathering fronts vary due to heterogeneity of the Rose Hill shales and landscape position. Interestingly, groundwaters along the valley floor at the outlet of the first-order catchment are influenced by carbonate dissolution but also show S isotope signatures indicative of anthropogenic sulfate in wet precipitation. This provides another line of evidence that at least some of the carbonate we observe at shallow depths in the valley floor may be secondary. Indeed, C isotopes of some of the shallow carbonates differ from those in Rose Hill bedrock. Comparison between groundwater and soil water chemistry shows that at SSHO most DIC derives from the dissolution of carbonate minerals, i.e., primary ankerite or secondary carbonate. Sulfate derives almost entirely from atmospheric deposition in soil waters and some groundwater near the outlet; however, its source shifts to pyrite dissolution in groundwaters from ridges and headwater areas. Overall, in this catchment underlain by grey shale, the sulfuric acid pathway is insignicant due to the low pyrite content in comparison to ankerite or secondary carbonate.

Jin, L.; Ogrinc, N.; Yesavage, T.; Hasenmueller, E. A.; Ma, L.; Kaye, J. P.; Brantley, S. L.

2013-12-01

192

Multi-Walled Carbon Nanotubes Promote Cementoblast Differentiation and Mineralization through the TGF-?/Smad Signaling Pathway.  

PubMed

Excretion of cementum by cementoblasts on the root surface is a process indispensable for the formation of a functional periodontal ligament. This study investigated whether carboxyl group-functionalized multi-walled carbon nanotubes (MWCNT-COOH) could enhance differentiation and mineralization of mammalian cementoblasts (OCCM-30) and the possible signaling pathway involved in this process. Cementoblasts were incubated with various doses of MWCNT-COOH suspension. Cell viability was detected, and a scanning electron microscopy (SEM) observed both the nanomaterials and the growth of cells cultured with the materials. Alizarin red staining was used to investigate the formation of calcium deposits. Real-time PCR and western blot were used to detect cementoblast differentiation and the underlying mechanisms through the expression of the osteogenic genes and the downstream effectors of the TGF-?/Smad signaling. The results showed that 5 µg/mL MWCNT-COOH had the most obvious effects on promoting differentiation without significant toxicity. Alp, Ocn, Bsp, Opn, Col1 and Runx2 gene expression was up-regulated. Smad2 and Smad3 mRNA was up-regulated, while Smad7 was first down-regulated on Day 3 and later up-regulated on Day 7. The elevated levels of phospho-Smad2/3 were also confirmed by western blot. In sum, the MWCNT-COOH promoted cementoblast differentiation and mineralization, at least partially, through interactions with the TGF-?/Smad pathway. PMID:25648319

Li, Lu; Zhu, Zhimin; Xiao, Weixiong; Li, Lei

2015-01-01

193

Complement activation by PEGylated single-walled carbon nanotubes is independent of C1q and alternative pathway turnover  

PubMed Central

We have investigated the interaction between long circulating poly(ethylene glycol)-stabilized single-walled carbon nanotubes (SWNTs) and the complement system. Aminopoly(ethylene glycol)5000–distearoylphosphatidylethanolamine (aminoPEG5000–DSPE) and methoxyPEG5000–DSPE coated as-grown HIPco SWNTs activated complement in undiluted normal human serum as reflected in significant rises in C4d and SC5b-9 levels, but not the alternative pathway split-product Bb, thus indicating activation exclusively through C4 cleavage. Studies in C2-depleted serum confirmed that PEGylated nanotube-mediated elevation of SC5b-9 was C4b2a convertase-dependent. With the aid of monoclonal antibodies against C1s and human serum depleted from C1q, nanotube-mediated complement activation in C1q-depleted serum was also shown to be independent of classical pathway. Nanotube-mediated C4d elevation in C1q-depleted serum, however, was inhibited by N-acetylglucosamine, Futhan (a broad-spectrum serine protease inhibitor capable of preventing complement activation through all three pathways) and anti-MASP-2 antibodies; this strongly suggests a role for activation of MASP-2 in subsequent C4 cleavage and assembly of C4b2a covertases. Intravenous injection of PEGylated nanotubes in some rats was associated with a significant rise in plasma thromboxane B2 levels, indicative of in vivo nanotube-mediated complement activation. The clinical implications of these observations are discussed. PMID:18602161

Hamad, Islam; Hunter, A. Christy; Rutt, Kenneth J.; Liu, Zhuang; Dai, Hongjie; Moghimi, S. Moein

2010-01-01

194

System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses  

SciTech Connect

The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 ?g MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung inflammation and fibrosis were revealed. • Two functional, representative genes, ccl2 and vegfa, were validated in vitro.

Snyder-Talkington, Brandi N. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Dymacek, Julian [Lane Department of Computer Science and Electrical Engineering, West Virginia University, Morgantown, WV 26506-6070 (United States); Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Pacurari, Maricica [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Denvir, James [Department of Biochemistry and Microbiology, Marshall University, Huntington, WV 25755 (United States); Castranova, Vincent [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Qian, Yong, E-mail: yaq2@cdc.gov [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Guo, Nancy L., E-mail: lguo@hsc.wvu.edu [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States)

2013-10-15

195

Specific inhibitors for identifying pathways for methane production from carbon monoxide by a nonadapted anaerobic mixed culture.  

PubMed

Specific inhibitors such as 2-bromoethanesulfonate (BES) and vancomycin were employed in activity batch tests to decipher metabolic pathways that are preferentially used by a mixed anaerobic consortium (sludge from an anaerobic digester) to transform carbon monoxide (CO) into methane (CH4). We first evaluated the inhibitory effect of both BES and vancomycin on the microbial community, as well as the efficiency and stability of vancomycin at 35 °C, over time. The activity tests with CO2-H2, CO, glucose, acetate, formate, propionate, butyrate, methanol, and ethanol showed that vancomycin does not inhibit some Gram-negative bacteria, and 50 mmol/L BES effectively blocks CH4 production in the sludge. However, when sludge was incubated with propionate, butyrate, methanol, or ethanol as the sole energy and carbon source, methanogenesis was only partially inhibited by BES. Separate tests showed that 0.07 mmol/L vancomycin is enough to maintain its inhibitory efficiency and stability in the population for at least 32 days at 35 °C. Using the inhibitors above, it was demonstrated that CO conversion to CH4 is an indirect, 2-step process, in which the CO is converted first to acetate and subsequently to CH4. PMID:24896194

Navarro, Silvia Sancho; Cimpoia, Ruxandra; Bruant, Guillaume; Guiot, Serge R

2014-06-01

196

Single-walled carbon nanotubes as nano-electrode and nano-reactor to control the pathways of a redox reaction.  

PubMed

Single-walled carbon nanotubes have been demonstrated as effective nanoscale containers for a redox active organometallic complex Cp(Me)Mn(CO)3, acting simultaneously as nano-electrode and nano-reactor. Extreme spatial confinement of the redox reaction within the nanotubes changes its pathway compared to bulk solution due to stabilisation of a reactive intermediate. PMID:25286415

McSweeney, Robert L; Chamberlain, Thomas W; Davies, E Stephen; Khlobystov, Andrei N

2014-11-28

197

Carbon isotopic composition of individual Precambrian microfossils  

NASA Technical Reports Server (NTRS)

Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

House, C. H.; Schopf, J. W.; McKeegan, K. D.; Coath, C. D.; Harrison, T. M.; Stetter, K. O.

2000-01-01

198

Ontogenetic Interactions between Photosynthesis and Symbiotic Nitrogen Fixation in Legumes.  

PubMed

Photosynthetic data collected from Pisum sativum L. and Phaseolus vulgaris L. plants at different stages of development were related to symbiotic N(2) fixation in the root nodules. The net carbon exchange rate of each leaf varied directly with carboxylation efficiency and inversely with the CO(2) compensation point. Net carbon exchange of the lowest leaves reputed to supply fixed carbon to root nodules declined in parallel with H(2) evolution from root nodules. The decrease in H(2) evolution also coincided with the onset of flowering but preceded the peak in N(2) fixation activity measured by acetylene-dependent ethylene production. A result of these changes was that the relative efficiency of N(2) fixation in peas increased to 0.7 from an initial value of 0.4. The data reveal that attempts to identify photosynthetic contributions of leaves to root nodules will require careful timing and suggest that the relative efficiency of N(2) fixation may be influenced by source-sink relationships. PMID:16660105

Bethlenfalvay, G J; Phillips, D A

1977-09-01

199

Mineral-assisted pathways in prebiotic synthesis: photoelectrochemical reduction of carbon(+IV) by manganese sulfide.  

PubMed

Photoelectrochemistry on mineral surfaces has the potential to play a central role in the prebiotic syntheses of building blocks for biomolecules. In this study, photoreduction of C(+IV) as bicarbonate is used as a probe to investigate the photoelectrochemical properties of alabandite (MnS) colloidal particles. Our experimental results show that photoreduction occurs and that formate is the initial photoproduct. A quantum efficiency of 4.2% is obtained (pH = 7.5). The quantum efficiency is temperature-independent from 298 to 328 K. In addition to formate, longer chain carbon products are also produced. Ion chromatography shows the presence of acetate and propionate. Infrared spectroscopy and mass spectrometry indicate the formation of longer chain organic molecules that contain oxygenated functional groups. Our results suggest that some prebiotic syntheses could have occurred via photoelectrochemical reactions on semiconducting minerals. PMID:15355106

Zhang, Xiang V; Martin, Scot T; Friend, Cynthia M; Schoonen, Martin A A; Holland, Heinrich D

2004-09-15

200

Carbon monoxide alleviates ethanol-induced oxidative damage and inflammatory stress through activating p38 MAPK pathway  

SciTech Connect

Stress-inducible protein heme oxygenase-1(HO-1) is well-appreciative to counteract oxidative damage and inflammatory stress involving the pathogenesis of alcoholic liver diseases (ALD). The potential role and signaling pathways of HO-1 metabolite carbon monoxide (CO), however, still remained unclear. To explore the precise mechanisms, ethanol-dosed adult male Balb/c mice (5.0 g/kg.bw.) or ethanol-incubated primary rat hepatocytes (100 mmol/L) were pretreated by tricarbonyldichlororuthenium (II) dimmer (CORM-2, 8 mg/kg for mice or 20 ?mol/L for hepatocytes), as well as other pharmacological reagents. Our data showed that CO released from HO-1 induction by quercetin prevented ethanol-derived oxidative injury, which was abolished by CO scavenger hemoglobin. The protection was mimicked by CORM-2 with the attenuation of GSH depletion, SOD inactivation, MDA overproduction, and the leakage of AST, ALT or LDH in serum and culture medium induced by ethanol. Moreover, CORM-2 injection or incubation stimulated p38 phosphorylation and suppressed abnormal Tnfa and IL-6, accompanying the alleviation of redox imbalance induced by ethanol and aggravated by inflammatory factors. The protective role of CORM-2 was abolished by SB203580 (p38 inhibitor) but not by PD98059 (ERK inhibitor) or SP600125 (JNK inhibitor). Thus, HO-1 released CO prevented ethanol-elicited hepatic oxidative damage and inflammatory stress through activating p38 MAPK pathway, suggesting a potential therapeutic role of gaseous signal molecule on ALD induced by naturally occurring phytochemicals. - Highlights: • CO alleviated ethanol-derived liver oxidative and inflammatory stress in mice. • CO eased ethanol and inflammatory factor-induced oxidative damage in hepatocytes. • The p38 MAPK is a key signaling mechanism for the protective function of CO in ALD.

Li, Yanyan; Gao, Chao; Shi, Yanru; Tang, Yuhan; Liu, Liang; Xiong, Ting; Du, Min [Department of Nutrition and Food Hygiene, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Ministry of Education Lab of Environment and Health, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Hubei Key Laboratory of Food Nutrition and Safety, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Xing, Mingyou [Department of Infectious Diseases, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Liu, Liegang [Department of Nutrition and Food Hygiene, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Ministry of Education Lab of Environment and Health, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Hubei Key Laboratory of Food Nutrition and Safety, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Yao, Ping, E-mail: yaoping@mails.tjmu.edu.cn [Department of Nutrition and Food Hygiene, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Ministry of Education Lab of Environment and Health, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Hubei Key Laboratory of Food Nutrition and Safety, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China)

2013-11-15

201

System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses.  

PubMed

The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 ?g MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. PMID:23845593

Snyder-Talkington, Brandi N; Dymacek, Julian; Porter, Dale W; Wolfarth, Michael G; Mercer, Robert R; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L

2013-10-15

202

Evaluation of Bone Fixation Implants  

E-print Network

This research investigates the effects of the human body on the mechanical, chemical, and morphological properties of the surface of internal fixation devices. Stainless steel and titanium devices that had failed were provided from the Shandong...

Perkins, Luke 1990-

2012-12-10

203

Internal fixation of osteoporotic fractures.  

PubMed

Osteoporosis leads to bone fragility and increased risk of fracture. Despite advances in diagnosis and treatment, the prevalence continues to rise. Osteoporotic fracture treatment has a unique set of difficulties related to poor bone quality and traditional approaches, and implants may not perform well. Fixation failure and repeat surgery are poorly tolerated and highly undesirable in this patient population. This review illustrates the most recent updates in internal fixation, implant design, and surgical theory regarding treatment of patients with osteoporotic fractures. PMID:25424965

Rothberg, David L; Lee, Mark A

2015-02-01

204

Genetic regulation of nitrogen fixation in rhizobia.  

PubMed Central

This review presents a comparison between the complex genetic regulatory networks that control nitrogen fixation in three representative rhizobial species, Rhizobium meliloti, Bradyrhizobium japonicum, and Azorhizobium caulinodans. Transcription of nitrogen fixation genes (nif and fix genes) in these bacteria is induced primarily by low-oxygen conditions. Low-oxygen sensing and transmission of this signal to the level of nif and fix gene expression involve at least five regulatory proteins, FixL, FixJ, FixK, NifA, and RpoN (sigma 54). The characteristic features of these proteins and their functions within species-specific regulatory pathways are described. Oxygen interferes with the activities of two transcriptional activators, FixJ and NifA. FixJ activity is modulated via phosphorylation-dephosphorylation by the cognate sensor hemoprotein FixL. In addition to the oxygen responsiveness of the NifA protein, synthesis of NifA is oxygen regulated at the level of transcription. This type of control includes FixLJ in R. meliloti and FixLJ-FixK in A. caulinodans or is brought about by autoregulation in B. japonicum. NifA, in concert with sigma 54 RNA polymerase, activates transcription from -24/-12-type promoters associated with nif and fix genes and additional genes that are not directly involved in nitrogen fixation. The FixK proteins constitute a subgroup of the Crp-Fnr family of bacterial regulators. Although the involvement of FixLJ and FixK in nifA regulation is remarkably different in the three rhizobial species discussed here, they constitute a regulatory cascade that uniformly controls the expression of genes (fixNOQP) encoding a distinct cytochrome oxidase complex probably required for bacterial respiration under low-oxygen conditions. In B. japonicum, the FixLJ-FixK cascade also controls genes for nitrate respiration and for one of two sigma 54 proteins. Images PMID:7968919

Fischer, H M

1994-01-01

205

Tricarboxylic acid cycle and one-carbon metabolism pathways are important in Edwardsiella ictaluri virulence.  

PubMed

Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of channel catfish (ESC). The disease causes considerable economic losses in the commercial catfish industry in the United States. Although antibiotics are used as feed additive, vaccination is a better alternative for prevention of the disease. Here we report the development and characterization of novel live attenuated E. ictaluri mutants. To accomplish this, several tricarboxylic acid cycle (sdhC, mdh, and frdA) and one-carbon metabolism genes (gcvP and glyA) were deleted in wild type E. ictaluri strain 93-146 by allelic exchange. Following bioluminescence tagging of the E. ictaluri ?sdhC, ?mdh, ?frdA, ?gcvP, and ?glyA mutants, their dissemination, attenuation, and vaccine efficacy were determined in catfish fingerlings by in vivo imaging technology. Immunogenicity of each mutant was also determined in catfish fingerlings. Results indicated that all of the E. ictaluri mutants were attenuated significantly in catfish compared to the parent strain as evidenced by 2,265-fold average reduction in bioluminescence signal from all the mutants at 144 h post-infection. Catfish immunized with the E. ictaluri ?sdhC, ?mdh, ?frdA, and ?glyA mutants had 100% relative percent survival (RPS), while E. ictaluri ?gcvP vaccinated catfish had 31.23% RPS after re-challenge with the wild type E. ictaluri. PMID:23762452

Dahal, Neeti; Abdelhamed, Hossam; Lu, Jingjun; Karsi, Attila; Lawrence, Mark L

2013-01-01

206

Tricarboxylic Acid Cycle and One-Carbon Metabolism Pathways Are Important in Edwardsiella ictaluri Virulence  

PubMed Central

Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of channel catfish (ESC). The disease causes considerable economic losses in the commercial catfish industry in the United States. Although antibiotics are used as feed additive, vaccination is a better alternative for prevention of the disease. Here we report the development and characterization of novel live attenuated E. ictaluri mutants. To accomplish this, several tricarboxylic acid cycle (sdhC, mdh, and frdA) and one-carbon metabolism genes (gcvP and glyA) were deleted in wild type E. ictaluri strain 93-146 by allelic exchange. Following bioluminescence tagging of the E. ictaluri ?sdhC, ?mdh, ?frdA, ?gcvP, and ?glyA mutants, their dissemination, attenuation, and vaccine efficacy were determined in catfish fingerlings by in vivo imaging technology. Immunogenicity of each mutant was also determined in catfish fingerlings. Results indicated that all of the E. ictaluri mutants were attenuated significantly in catfish compared to the parent strain as evidenced by 2,265-fold average reduction in bioluminescence signal from all the mutants at 144 h post-infection. Catfish immunized with the E. ictaluri ?sdhC, ?mdh, ?frdA, and ?glyA mutants had 100% relative percent survival (RPS), while E. ictaluri ?gcvP vaccinated catfish had 31.23% RPS after re-challenge with the wild type E. ictaluri. PMID:23762452

Dahal, Neeti; Abdelhamed, Hossam; Lu, Jingjun; Karsi, Attila; Lawrence, Mark L.

2013-01-01

207

Carbon Monoxide Signaling in Human Red Blood Cells: Evidence for Pentose Phosphate Pathway Activation and Protein Deglutathionylation  

PubMed Central

Abstract Aims: The biochemistry underlying the physiological, adaptive, and toxic effects of carbon monoxide (CO) is linked to its affinity for reduced transition metals. We investigated CO signaling in the vasculature, where hemoglobin (Hb), the CO most important metal-containing carrier is highly concentrated inside red blood cells (RBCs). Results: By combining NMR, MS, and spectrophotometric techniques, we found that CO treatment of whole blood increases the concentration of reduced glutathione (GSH) in RBC cytosol, which is linked to a significant Hb deglutathionylation. In addition, this process (i) does not activate glycolytic metabolism, (ii) boosts the pentose phosphate pathway (PPP), (iii) increases glutathione reductase activity, and (iv) decreases oxidized glutathione concentration. Moreover, GSH concentration was partially decreased in the presence of 2-deoxyglucose and the PPP antagonist dehydroepiandrosterone. Our MS results show for the first time that, besides Cys93, Hb glutathionylation occurs also at Cys112 of the ?-chain, providing a new potential GSH source hitherto unknown. Innovation: This work provides new insights on the signaling and antioxidant-boosting properties of CO in human blood, identifying Hb as a major source of GSH release and the PPP as a metabolic mechanism supporting Hb deglutathionylation. Conclusions: CO-dependent GSH increase is a new RBC process linking a redox-inactive molecule, CO, to GSH redox signaling. This mechanism may be involved in the adaptive responses aimed to counteract stress conditions in mammalian tissues. Antioxid. Redox Signal. 20, 403–416. PMID:23815439

Metere, Alessio; Iorio, Egidio; Scorza, Giuseppe; Camerini, Serena; Casella, Marialuisa; Crescenzi, Marco; Minetti, Maurizio

2014-01-01

208

Perspectives on Marine Nitrogen Fixation  

NASA Astrophysics Data System (ADS)

The importance of nitrogen fixation in ocean biogeochemistry has only recently come to be fully appreciated. As biological nitrogen fixation was being uncovered in terrestrial ecosystems (late 1800s), some ocean surveys were mapping the large-scale distribution of important planktonic diazotrophs, such as the cyanobacterium Trichodesmium, unaware of their functional significance. Early marine N biogeochemists speculated that nitrogen fixation was largely confined to the terrestrial realm, with combined nitrogen being transferred to the ocean from land, there to be taken up by phytoplankton or denitrified. Later, A. Redfield invoked nitrogen fixation as a mechanism to prevent N limitation in the sea. Systematic studies of nitrogen fixation started rolling in the 1960s with the introduction of enriched 15N tracer methodology by R. Dugdale and his associates and, subsequently, with the introduction of a simple field assay for this activity. While results from field studies in the 1980s, largely limited to mid-latitudes and marginal tropical and subtropical seas, also indicated a relatively limited role for nitrogen fixation, several lines of geochemical evidence emerged in the late 1990s which suggested otherwise. This prompted a resurgence in field efforts examining this process which in turn provided direct evidence to support the biogeochemical significance of nitrogen fixation in the oligotrophic ocean. Research in this area continues to move rapidly. The infusion of molecular biological methods also provided new tools to explore and appreciate the real diversity of marine diazotrophs. Many current biogeochemical models incorporate nitrogen fixation as an explicit function providing input of new reactive nitrogen into marine ecosystems. However, there are still major puzzles to be solved. Two current and related conundrums are whether denitrification and nitrogen fixation are near balance in the current ocean, and how closely they are coupled. Recent experimental and modeling results suggests diazotrophs, which are not limited by nitrogen availability, may be limited by other macro and micronutrient factors in different ocean basins. Finally, atmospheric N deposition to the ocean is rapidly accelerating and will soon exceed current estimates of oceanic nitrogen fixation.

Capone, D. G.

2008-05-01

209

Nitrogen fixation in boreal peatlands: the effects of increased N deposition on N2-fixation  

NASA Astrophysics Data System (ADS)

Boreal peatlands are of great importance to global carbon and nitrogen cycling. While covering only 3-4 % of the terrestrial surface, they account for 25-30 % of the world's soil C and 9-15 % of the world's soil N. In Western Canada atmospheric dry deposition rates are extremely low: approximately 1 kg N ha-1 yr-1. Though these systems have been functioning as net sinks over the past 11,000 years, natural and anthropogenic disturbances might compromise the historical balance of C and N. Biological N2-fixation has recently been shown to represent a very significant input of N into these systems, contributing to 62% of total N in Western Canada. Interactions between N deposition and biological N2-fixation are as yet, unknown, but the impact of elevated deposition of N-compounds from increased industrial expansion of oil sands mining to peatlands, is concerning. Given that nitrogenase, the enzyme responsible for catalyzing N2-fixation, is energetically costly when active, enhanced inputs of atmospheric N deposition could be a major determinant for enzyme activity and rates of biological N input to these bogs. Understanding interactions between N deposition and N2 fixation in boreal peatlands can aid in predicting the consequences of increased N deposition and setting critical loads. We conducted a field-fertilization experiment in a poor fen in Alberta, Canada, to determine the effects of enhanced N deposition on a dominant fen species Sphagnum angustifolium. The experiment consisted of seven N treatments: Control, 0, 5, 10, 15, 20 and 25 kg N ha-1 y1, n=3. N2-fixation was measured during summer 2012 and 2013 using the acetylene reduction assay (ARA). ARA rates were converted to rates of N2-fixation by calibrating ARA with paired 15N2-incubations. In both 2012 and 2013, with increasing N deposition from 0 kg N ha-1 yr-1 to 25 kg N ha-1 yr-1, rates of N2 fixation decreased, with highest rates in the 0 kg N ha-1 yr-1 treatment mosses (54.2 × 1.40; 48.58 × 7.12 kg N ha-1 yr-1, mean × std err for 2012 and 2013, respectively) followed by progressively lower rates with a low of 5.02 × 0.87 in 2012 and 8.94 × 3.09 in 2013 (mean × std err). As biological N2-fixation is an energetically costly process, up-regulating enzyme activity when N availability is low and down-regulating activity when N deposition is enhanced makes thermodynamic and evolutionary sense. N2-fixation shows to be one of the most early-warning indicators to the early response of boreal peatlands to increased N deposition, and can aid in setting critical loads to protect these historically pristine ecosystems.

Popma, J. M.; Wieder, R.; Lamers, L.; Vile, M. A.

2013-12-01

210

Comparison of Routine Fixation of Tissues with Rapid Tissue Fixation  

PubMed Central

Introduction: Conventional formalin-fixed, paraffin-embedded tissue provides superior cellular morphology and long-term storage. Problems with formalin fixation comprise delay of fixation and variations in the duration of fixation. Microwave assisted tissue fixation removes the use of noxious and potentially toxic formalin that decreases the turnaround time and creates a personnel friendly workflow. Material and Methods: The present study was conducted over a period of two years. One hundred and forty paired tissue sections were taken including both neoplastic and non-neoplastic tissues. One of the paired tissues was fixed in formalin and the other was fixed by using microwave irradiation in phosphate buffered saline. Both were then processed by conventional method. Each slide was examined and rated for the adequacy of fixation by two pathologists in a blinded fashion using 7 parameters: Cellular outline, cytoplasmic detail, nuclear detail, erythrocyte integrity, lymphocyte appearance, overall morphology and overall staining. Results: Statistical analysis showed that sections obtained from microwave fixed tissues were comparable to that of routinely fixed tissue. The p-values of all parameters were not significant except for the overall morphology for which p-value was significant owing to loss of tissue in some cases. Conclusion: Microwave irradiation substantially shortened the time from specimen reception to diagnosis (turnaround time) and allowed same-day tissue processing and diagnosis of specimens without compromising the overall quality of the histologic section. PMID:24551633

Tripathi, Meenakshi; Bansal, Rani; Gupta, Mamta; Bharat, Vinay

2013-01-01

211

The importance of nodule CO2 fixation for the efficiency of symbiotic nitrogen fixation in pea at vegetative growth and during pod formation.  

PubMed

Nodule CO2 fixation is of pivotal importance for N2 fixation. The process provides malate for bacteroids and oxaloacetate for nitrogen assimilation. The hypothesis of the present paper was that grain legume nodules would adapt to higher plant N demand and more restricted carbon availability at pod formation through increased nodule CO2 fixation and a more efficient N2 fixation. Growth, N2 fixation, and nodule composition during vegetative growth and at pod formation were studied in pea plants (Pisum sativum L.). In parallel experiments, 15N2 and 13CO2 uptake, as well as nodule hydrogen and CO2 release, was measured. Plants at pod formation showed higher growth rates and N2 fixation per plant when compared with vegetative growth. The specific activity of active nodules was about 25% higher at pod formation. The higher nodule activity was accompanied by higher amino acid concentration in nodules and xylem sap with a higher share of asparagine. Nodule 13CO2 fixation was increased at pod formation, both per plant and per 15N2 fixed unit. However, malate concentration in nodules was only 40% of that during vegetative growth and succinate was no longer detectable. The data indicate that increased N2 fixation at pod formation is connected with strongly increased nodule CO2 fixation. While the sugar concentration in nodules at pod formation was not altered, the concentration of organic acids, namely malate and succinate, was significantly lower. It is concluded that strategies to improve the capability of nodules to fix CO2 and form organic acids might prolong intensive N2 fixation into the later stages of pod formation and pod filling in grain legumes. PMID:20363863

Fischinger, Stephanie Anastasia; Schulze, Joachim

2010-05-01

212

The importance of nodule CO2 fixation for the efficiency of symbiotic nitrogen fixation in pea at vegetative growth and during pod formation  

PubMed Central

Nodule CO2 fixation is of pivotal importance for N2 fixation. The process provides malate for bacteroids and oxaloacetate for nitrogen assimilation. The hypothesis of the present paper was that grain legume nodules would adapt to higher plant N demand and more restricted carbon availability at pod formation through increased nodule CO2 fixation and a more efficient N2 fixation. Growth, N2 fixation, and nodule composition during vegetative growth and at pod formation were studied in pea plants (Pisum sativum L.). In parallel experiments, 15N2 and 13CO2 uptake, as well as nodule hydrogen and CO2 release, was measured. Plants at pod formation showed higher growth rates and N2 fixation per plant when compared with vegetative growth. The specific activity of active nodules was about 25% higher at pod formation. The higher nodule activity was accompanied by higher amino acid concentration in nodules and xylem sap with a higher share of asparagine. Nodule 13CO2 fixation was increased at pod formation, both per plant and per 15N2 fixed unit. However, malate concentration in nodules was only 40% of that during vegetative growth and succinate was no longer detectable. The data indicate that increased N2 fixation at pod formation is connected with strongly increased nodule CO2 fixation. While the sugar concentration in nodules at pod formation was not altered, the concentration of organic acids, namely malate and succinate, was significantly lower. It is concluded that strategies to improve the capability of nodules to fix CO2 and form organic acids might prolong intensive N2 fixation into the later stages of pod formation and pod filling in grain legumes. PMID:20363863

Fischinger, Stephanie Anastasia; Schulze, Joachim

2010-01-01

213

Metabolite Profile Analysis Reveals Functional Effects of 28-Day Vitamin B-6 Restriction on One-Carbon Metabolism and Tryptophan Catabolic Pathways in Healthy Men and Women123  

PubMed Central

Suboptimal vitamin B-6 status, as reflected by low plasma pyridoxal 5?-phosphate (PLP) concentration, is associated with increased risk of vascular disease. PLP plays many roles, including in one-carbon metabolism for the acquisition and transfer of carbon units and in the transsulfuration pathway. PLP also serves as a coenzyme in the catabolism of tryptophan. We hypothesize that the pattern of these metabolites can provide information reflecting the functional impact of marginal vitamin B-6 deficiency. We report here the concentration of major constituents of one-carbon metabolic processes and the tryptophan catabolic pathway in plasma from 23 healthy men and women before and after a 28-d controlled dietary vitamin B-6 restriction (<0.35 mg/d). liquid chromatography-tandem mass spectrometry analysis of the compounds relevant to one-carbon metabolism showed that vitamin B-6 restriction yielded increased cystathionine (53% pre- and 76% postprandial; P < 0.0001) and serine (12% preprandial; P < 0.05), and lower creatine (40% pre- and postprandial; P < 0.0001), creatinine (9% postprandial; P < 0.05), and dimethylglycine (16% postprandial; P < 0.05) relative to the vitamin B-6–adequate state. In the tryptophan pathway, vitamin B-6 restriction yielded lower kynurenic acid (22% pre- and 20% postprandial; P < 0.01) and higher 3-hydroxykynurenine (39% pre- and 34% postprandial; P < 0.01). Multivariate ANOVA analysis showed a significant global effect of vitamin B-6 restriction and multilevel partial least squares-discriminant analysis supported this conclusion. Thus, plasma concentrations of creatine, cystathionine, kynurenic acid, and 3-hydroxykynurenine jointly reveal effects of vitamin B-6 restriction on the profiles of one-carbon and tryptophan metabolites and serve as biomarkers of functional effects of marginal vitamin B-6 deficiency. PMID:23966327

da Silva, Vanessa R.; Rios-Avila, Luisa; Lamers, Yvonne; Ralat, Maria A.; Midttun, Øivind; Quinlivan, Eoin P.; Garrett, Timothy J.; Coats, Bonnie; Shankar, Meena N.; Percival, Susan S.; Chi, Yueh-Yun; Muller, Keith E.; Ueland, Per Magne; Stacpoole, Peter W.; Gregory, Jesse F.

2013-01-01

214

Metabolite profile analysis reveals functional effects of 28-day vitamin B-6 restriction on one-carbon metabolism and tryptophan catabolic pathways in healthy men and women.  

PubMed

Suboptimal vitamin B-6 status, as reflected by low plasma pyridoxal 5'-phosphate (PLP) concentration, is associated with increased risk of vascular disease. PLP plays many roles, including in one-carbon metabolism for the acquisition and transfer of carbon units and in the transsulfuration pathway. PLP also serves as a coenzyme in the catabolism of tryptophan. We hypothesize that the pattern of these metabolites can provide information reflecting the functional impact of marginal vitamin B-6 deficiency. We report here the concentration of major constituents of one-carbon metabolic processes and the tryptophan catabolic pathway in plasma from 23 healthy men and women before and after a 28-d controlled dietary vitamin B-6 restriction (<0.35 mg/d). liquid chromatography-tandem mass spectrometry analysis of the compounds relevant to one-carbon metabolism showed that vitamin B-6 restriction yielded increased cystathionine (53% pre- and 76% postprandial; P < 0.0001) and serine (12% preprandial; P < 0.05), and lower creatine (40% pre- and postprandial; P < 0.0001), creatinine (9% postprandial; P < 0.05), and dimethylglycine (16% postprandial; P < 0.05) relative to the vitamin B-6-adequate state. In the tryptophan pathway, vitamin B-6 restriction yielded lower kynurenic acid (22% pre- and 20% postprandial; P < 0.01) and higher 3-hydroxykynurenine (39% pre- and 34% postprandial; P < 0.01). Multivariate ANOVA analysis showed a significant global effect of vitamin B-6 restriction and multilevel partial least squares-discriminant analysis supported this conclusion. Thus, plasma concentrations of creatine, cystathionine, kynurenic acid, and 3-hydroxykynurenine jointly reveal effects of vitamin B-6 restriction on the profiles of one-carbon and tryptophan metabolites and serve as biomarkers of functional effects of marginal vitamin B-6 deficiency. PMID:23966327

da Silva, Vanessa R; Rios-Avila, Luisa; Lamers, Yvonne; Ralat, Maria A; Midttun, Øivind; Quinlivan, Eoin P; Garrett, Timothy J; Coats, Bonnie; Shankar, Meena N; Percival, Susan S; Chi, Yueh-Yun; Muller, Keith E; Ueland, Per Magne; Stacpoole, Peter W; Gregory, Jesse F

2013-11-01

215

Evolution of fracture and fault-controlled fluid pathways in carbonates of the Albanides fold-thrust belt  

USGS Publications Warehouse

The process of fracture and fault formation in carbonates of the Albanides fold-thrust belt has been systematically documented using hierarchical development of structural elements from hand sample, outcrop, and geologic-map scales. The function of fractures and faults in fluid migration was elucidated using calcite cement and bitumen in these structures as a paleoflow indicator. Two prefolding pressure-solution and vein assemblages were identified: an overburden assemblage and a remote tectonic stress assemblage. Sheared layer-parallel pressure-solution surfaces of the overburden assemblage define mechanical layers. Shearing of mechanical layers associated with folding resulted in the formation of a series of folding assemblage fractures at different orientations, depending on the slip direction of individual mechanical layers. Prefolding- and folding-related fracture assemblages together formed fragmentation zones in mechanical layers and are the sites of incipient fault localization. Further deformation along these sites was accommodated by rotation and translation of fragmented rock, which formed breccia and facilitated fault offset across multiple mechanical layers. Strike-slip faults formed by this process are organized in two sets in an apparent conjugate pattern. Calcite cement and bitumen that accumulated along fractures and faults are evidence of localized fluid flow along fault zones. By systematic identification of fractures and faults, their evolution, and their fluid and bitumen contents, along with subsurface core and well-log data, we identify northeast-southwest-trending strike-slip faults and the associated structures as dominant fluid pathways in the Albanides fold-thrust belt. Copyright ?? 2006. The American Association of Petroleum Geologists. All rights reserved.

Graham, Wall B.R.; Girbacea, R.; Mesonjesi, A.; Aydin, A.

2006-01-01

216

[A rapid intermaxillary fixation technic].  

PubMed

The authors describe a new intermaxillary fixation (IMF) technique. This technique is particularly easy and quick. It needs usual 4/10 or 5/10 steel wire with a small pearl fixed at one extremity. Four wires are used, passed from lingual side to vestibular side, between premolars. Wires are then linked and intermaxillary fixation is performed. Osteosynthesis is realised by intraoral approach. This technique does not allow to maintain IMF during a long postoperative period. Therefore, it should be reserved for cases where miniplate osteosynthesis will be sufficient. It seems interesting to use this technique for monofocal mandibular fractures, in association with rigid miniplate osteosynthesis. PMID:8685623

Paoli, J R; Lauwers, F; Boutault, F

1996-01-01

217

NCI-Frederick PHL - Fixatives and Solutions  

Cancer.gov

Services Price List Courier Services & Shipment Procedures Scheduling Contact Information Related Links Establishing an Account PHL Forms PHL Portal Fixatives and Solutions Routine fixatives: 10% Neutral Buffered Formalin (NBF) 37 - 40% Formaldehyde………………………………………1000mL distilled

218

The metabolic significance of octulose phosphates in the photosynthetic carbon reduction cycle in spinach  

Microsoft Academic Search

14C-Labelled octulose phosphates were formed during photosynthetic 14CO2 fixation and were measured in spinach leaves and chloroplasts. Because mono- and bisphosphates of d-glycero-\\u000a d-ido-octulose are the active 8-carbon ketosugar intermediates of the L-type pentose pathway, it was proposed that they may also\\u000a be reactants in a modified Calvin–Benson–Bassham pathway reaction scheme. This investigation therefore initially focussed\\u000a only on the ido-epimer

John F. Williams; John K. MacLeod

2006-01-01

219

Determination of pathways of glycogen synthesis and the dilution of the three-carbon pool with (U- sup 13 C)glucose  

SciTech Connect

Rats were infused with glucose at 30 mg/min, containing 18% enriched (U-{sup 13}C)glucose and (1-{sup 14}C)- and (3-{sup 3}H)glucose and liver glycogen were determined by gas chromatography/mass spectroscopy. The contribution of the direct pathway to glycogen was calculated from the three tracers, and the values by all three were nearly identical, about 50%. The {sup 14}C specific activity in carbon 6 of glycogen glucose was about 6% that of carbon 1. The ({sup 3}H)glucose/(1-{sup 14}C)glucose ratio in glycogen was 80-90% that is blood glucose. The enrichment of {sup 13}C and the specific activity of {sup 14}C in glycogen formed by the indirect path were 20-25% of glycogen formed directly from glucose. The dilution is of two kinds: (1) an exchange of labeled carbon with unlabeled carbon in the tricarboxylic acid cycle and (2) dilution by unlabeled nonglucose carbon. Methods to calculate the two types of dilution are presented. In rate preinjected with glucagon, the dilution through the tricarboxylic acid cycle was unaffected but that by nonglucose carbon was decreased.

Katz, J.; Wals, P.A. (Cedars-Sinai Medical Center, Los Angeles, CA (United States)); Lee, W.N.P. (Los Angeles Research and Education Inst., Torrance, CA (United States))

1991-03-15

220

Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre.  

PubMed

Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N(2)-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N(2)-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200 m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of (15)N-labeled ammonium and leucine in our incubation experiments. N(2)-fixation was detectable throughout the upper 200 m at most stations, with rates ranging from 0.001 to 0.19 nM N h(-1). N(2)-fixation in the SPG may account for the production of 8-20% of global oceanic new nitrogen. Interestingly, comparable (15)N(2)-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel M M

2012-06-01

221

Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre  

PubMed Central

Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N2-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N2-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200?m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of 15N-labeled ammonium and leucine in our incubation experiments. N2-fixation was detectable throughout the upper 200?m at most stations, with rates ranging from 0.001 to 0.19?nM?N?h?1. N2-fixation in the SPG may account for the production of 8–20% of global oceanic new nitrogen. Interestingly, comparable 15N2-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel MM

2012-01-01

222

OVEREXPRESSION OF A NODULE-ENHANCED MALATE DEHYDROGENASE INCREASES NITROGEN FIXATION IN ALFALFA  

Technology Transfer Automated Retrieval System (TEKTRAN)

Malate is crucial for symbiotic dinitrogen (N2) fixation, occurring in high concentrations in N2-fixing nodules as the major carbon source for bacteroid respiration. Malate also provides carbon skeletons for the assimilation of fixed nitrogen from ammonia into amino acids and is proposed to be invol...

223

Options for acetabular fixation surfaces.  

PubMed

Aseptic loosening is the most common cause for revision total hip arthroplasty (THA). Due to poor long-term results with cemented acetabular components, cementless implants that rely on biologic fixation became popular in the United States for both primary and revision procedures in the early 1980s. Cementless acetabular components used in THA have been reported to have superior radiographic performance compared with cemented fixation, although the optimal method of acetabular fixation remains controversial. Cementless acetabular components require initial implant stability to allow for bone ingrowth and remodeling into the acetabular shell, providing long-term durability of the prosthesis. Many improved implant materials are available to facilitate bone growth and remodeling, including the 3 most common surface treatments; fibermesh, sintered beads, and plasma spray coatings. Recently added to these are porous metal surfaces, which have increased porosity and optimal pore sizes when compared with titanium fibermesh. The most studied of these materials is the titanium fibermesh fixation surface, which has demonstrated a mechanical failure rate of 1% at 10 to 15 years. This technology utilizes the diffusion bonding process to attach fiber metal pads to a titanium substrate using heat and pressure. The sintered bead fixation surface offers a porous coating of various sizes of spherical beads, achieved by the sintering process, and has been shown to provide long-term fixation. While there are less long-term published data regarding the titanium plasma spray surface, its early results have provided evidence of its durability, even in the face of significant osteolysis. The most recently added alternative fixation surface is porous tantalum metal, which offers potentially greater bone ingrowth and bone graft incorporation due to its high porosity (80%) and low modulus of elasticity (3 MPa). Porous tantalum implants have shown early favorable clinical results and have been reported to have excellent bone graft incorporation of the acetabular component based on serial radiograph data at a minimum 1-year follow-up. Tritanium is a porous metal, which has emerged as a promising new surface technology for acetabular shells. While no clinical data are yet available, basic science research has demonstrated enhanced bone ingrowth and mechanical strength. PMID:19023943

Klika, Alison K; Murray, Trevor G; Darwiche, Hussein; Barsoum, Wael K

2007-01-01

224

Proteomic analysis of Bacillus thuringiensis ?phaC mutant BMB171/PHB(-1) reveals that the PHB synthetic pathway warrants normal carbon metabolism.  

PubMed

A phaC knockout mutant from Bacillus thuringiensis (Bt) strain BMB171, named BMB171/PHB(-1), was constructed. A physiological and metabolic investigation and a proteomic analysis were conducted for both ?phaC mutant and its parent strain. Grown in peptone medium with 5 gram glucose per liter as sole carbon source, BMB171/PHB(-1) produced various organic acids. Here the excreted pyruvate, citrate, lactate, acetate and glutamate were quantitatively analyzed. Deletion of phaC gene from the BMB171 strain resulted in 1) growth delay; 2) higher consumption of dioxigen but lower cell yield; 3) stagnation of pH movement; 4) overproduction of organic acids; 5) rapid descent of cell density in the stationary phase; and 6) a sporulation-deficient phenotype. Our proteomic study with qPCR reconfirmation reveals that the absence of PhaC led to a metabolic turmoil which showed repressed glycolysis, and over-expressed TCA cycle, various futile pathways and amino acid synthesis during vegetative growth. It is thus thought that B. thuringiensis BMB171 effectively regulated its carbon metabolism upon the presence of the functional PHB synthetic pathway. The presence of this pathway warrants a PHB-producing bacterium better surviving under different environmental conditions. PMID:22705120

Chen, Deju; Xu, Dong; Li, Mingshun; He, Jin; Gong, Yuhua; Wu, Dandan; Sun, Ming; Yu, Ziniu

2012-09-18

225

Investigations of potential microbial methanogenic and carbon monoxide utilization pathways in ultra-basic reducing springs associated with present-day continental serpentinization: the Tablelands, NL, CAN  

PubMed Central

Ultra-basic reducing springs at continental sites of serpentinization act as portals into the biogeochemistry of a subsurface environment with H2 and CH4 present. Very little, however, is known about the carbon substrate utilization, energy sources, and metabolic pathways of the microorganisms that live in this ultra-basic environment. The potential for microbial methanogenesis with bicarbonate, formate, acetate, and propionate precursors and carbon monoxide (CO) utilization pathways were tested in laboratory experiments by adding substrates to water and sediment from the Tablelands, NL, CAD, a site of present-day continental serpentinization. Microbial methanogenesis was not observed after bicarbonate, formate, acetate, or propionate addition. CO was consumed in the live experiments but not in the killed controls and the residual CO in the live experiments became enriched in 13C. The average isotopic enrichment factor resulting from this microbial utilization of CO was estimated to be 11.2 ± 0.2‰. Phospholipid fatty acid concentrations and ?13C values suggest limited incorporation of carbon from CO into microbial lipids. This indicates that in our experiments, CO was used primarily as an energy source, but not for biomass growth. Environmental DNA sequencing of spring fluids collected at the same time as the addition experiments yielded a large proportion of Hydrogenophaga-related sequences, which is consistent with previous metagenomic data indicating the potential for these taxa to utilize CO. PMID:25431571

Morrill, Penny L.; Brazelton, William J.; Kohl, Lukas; Rietze, Amanda; Miles, Sarah M.; Kavanagh, Heidi; Schrenk, Matthew O.; Ziegler, Susan E.; Lang, Susan Q.

2014-01-01

226

Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways  

NASA Astrophysics Data System (ADS)

Stable hydrogen, carbon, and nitrogen isotopic ratios (?D, ?13C, and ?15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ?13C and increasing ?D with increasing carbon number in the ?-H, ?-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light ?13C signatures for ?-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-?-amino acids). Higher deuterium enrichments are observed in ?-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

2012-09-01

227

Implant fixation by bone ingrowth.  

PubMed

The term osseointegration referred originally to an intimate contact of bone tissue with the surface of a titanium implant; the term bone ingrowth refers to bone formation within an irregular (beads, wire mesh, casting voids, cut grooves) surface of an implant. The section dealing with the historical background describes the development of macroporous, microporous, and textured surfaces with an emphasis on the evolution of porous and textured metal surfaces. The principal requirements for osseointegration and bone ingrowth are systematically reviewed as follows: i) the physiology of osseointegration and bone ingrowth, including biomaterial biocompatibility with respect to cellular and matrix response at the interface; ii) the implant surface geometry characteristics; iii) implant micromotion and fixation modes; and iv) the implant-bone interface distances. Based on current methods of bone ingrowth assessment, this article comparatively reviews and discusses the results of experimental studies with the objective of determining local and systemic factors that enhance bone ingrowth fixation. PMID:10220191

Kienapfel, H; Sprey, C; Wilke, A; Griss, P

1999-04-01

228

The parageneses thermodynamic analysis of chemoautotrophic CO2 fixation archaic cycle components, their stability and self-organization in hydrothermal systems.  

PubMed

The parageneses physico-chemical analysis based on a method of thermodynamic potentials has been used to study the system of C-H-O organic compounds, which are, in particular, components of biomimetically built primordial cycles of carbon dioxide chemoautotrophic fixation. Thermodynamic data for aqueous organic compounds allowed one to construct the chemical potential diagrams and establish the areas of thermodynamic stability (facies) of components of CO2 fixation pathways in hydrothermal systems, in particular, a reductive citric cycle (RCC), 3-hydroxypropionate cycle (3-HPC) and acetyl-CoA pathway. An alternative deep source of carbon (hydrocarbons) proved by the data on endogenous emission of hydrocarbons in hydrothermal fields of oceanic ridges was suggested. The system was determined, which combines hydrocarbons, CO2 and components of RCC, 3-HPC and acetyl-CoA pathway with characteristic parageneses of methane and ethylene with acetate in two-component CH4-CO2 and C2H4-O2 subsystems, respectively. The thermodynamic analysis of a redox mode at various pressures and temperatures allowed one to uniquely determine hydrocarbon-organic system able to independently generate acetate and succinate at oxidation of deep hydrothermal hydrocarbon fluids emerging on sea surface. The limits for thermodynamic stability of CO2 archaic fixation (CAF) components responsible for generation and self-organization in hydrothermal environment was identified. The tentative integrated system of CAF was developed as a combined acetyl-CoA pathway, 3-HPC and RCC containing a succinate-fumarate core, capable of switching electron flow in forward or reverse direction depending on redox potential of geochemical environment that is governed by the (CH)2(COOH)2+H2=(CH2)2(COOH)2 reaction. This core is a "redox switch", which is sensitive to certain conditions of hydrothermal environment and defines electron flow direction. The redox geochemical mode caused by temperature, pressure, composition of a hydrothermal fluid and a mineralogical setting defines stability of CAF cycle components in paragenesis with hydrocarbons and possibility of cycle self-organization. PMID:19168083

Marakushev, Sergey A; Belonogova, Ol'ga V

2009-04-21

229

First direct measurements of N2 fixation during a Trichodesmium bloom in the eastern Arabian Sea  

NASA Astrophysics Data System (ADS)

We report the first direct estimates of N2 fixation rates measured during the spring, 2009 using the 15N2 gas tracer technique in the eastern Arabian Sea, which is well known for significant loss of nitrogen due to intense denitrification. Carbon uptake rates are also concurrently estimated using the 13C tracer technique. The N2 fixation rates vary from ˜0.1 to 34 mmol N m-2d-1 after correcting for the isotopic under-equilibrium with dissolved air in the samples. These higher N2 fixation rates are consistent with higher chlorophyll a and low ?15N of natural particulate organic nitrogen. Our estimates of N2 fixation is a useful step toward reducing the uncertainty in the nitrogen budget.

Gandhi, Naveen; Singh, Arvind; Prakash, S.; Ramesh, R.; Raman, Mini; Sheshshayee, M. S.; Shetye, Suhas

2011-12-01

230

Biological fixation of endosseous implants.  

PubMed

Primary implant stability is ensured by a mechanical fixation of implants. However, during implant healing a biological anchorage is necessary to achieve final osseointegration. Aim of this study was to investigate the histological aspects of biological fixation around titanium screws. Forty-eight titanium screws with different surfaces (smooth, plasma sprayed, sand blasted) were inserted in tibiae and femura of sheep and analyzed by light microscope and SEM 1 hour, 14 and 90 days after implantation. One hour after implantation the implant-bone gap was filled with a blood clot and host bone chips arising from burr surgical preparation or friction during implant insertion. Fourteen days after implantation new trabecular bone and enveloped bone chips were observed in the gap: no osteogenesis developed where implant threads were in contact with host bone. Ninety days after surgery all trabecular bone and most of the bone chips were substituted by a mature lamellar bone with few marrow spaces. Our results suggest that the trabecular bone and bone chips represent a three-dimensional network ensuring a biological implant fixation in all different implant surfaces 2 weeks after surgery. Host bone chips could favour the peri-implant osteogenesis. Inter-trabecular and implant-trabecular marrow spaces of both trabecular and lamellar bone may favour the peri-implant bone turnover. PMID:16233979

Franchi, M; Fini, M; Martini, D; Orsini, E; Leonardi, L; Ruggeri, A; Giavaresi, G; Ottani, V

2005-01-01

231

Symbiotic nitrogen fixation in legume nodules: metabolism and regulatory mechanisms.  

PubMed

The special issue "Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms" aims to investigate the physiological and biochemical advances in the symbiotic process with an emphasis on nodule establishment, development and functioning. The original research articles included in this issue provide important information regarding novel aspects of nodule metabolism and various regulatory pathways, which could have important future implications. This issue also included one review article that highlights the importance of using legume trees in the production of renewable biofuels. PMID:25347276

Sulieman, Saad; Tran, Lam-Son Phan

2014-01-01

232

Fixational eye movements and binocular vision  

PubMed Central

During attempted visual fixation, small involuntary eye movements–called fixational eye movements–continuously change of our gaze’s position. Disagreement between the left and right eye positions during such motions can produce diplopia (double vision). Thus, the ability to properly coordinate the two eyes during gaze fixation is critical for stable perception. For the last 50 years, researchers have studied the binocular characteristics of fixational eye movements. Here we review classical and recent studies on the binocular coordination (i.e., degree of conjugacy) of each fixational eye movement type: microsaccades, drift and tremor, and its perceptual contribution to increasing or reducing binocular disparity. We also discuss how amblyopia and other visual pathologies affect the binocular coordination of fixational eye movements. PMID:25071480

Otero-Millan, Jorge; Macknik, Stephen L.; Martinez-Conde, Susana

2014-01-01

233

Overcoming fixation with repeated memory suppression.  

PubMed

Fixation (blocks to memories or ideas) can be alleviated not only by encouraging productive work towards a solution, but, as the present experiments show, by reducing counterproductive work. Two experiments examined relief from fixation in a word-fragment completion task. Blockers, orthographically similar negative primes (e.g., ANALOGY), blocked solutions to word fragments (e.g., A_L_ _GY) in both experiments. After priming, but before the fragment completion test, participants repeatedly suppressed half of the blockers using the Think/No-Think paradigm, which results in memory inhibition. Inhibiting blockers did not alleviate fixation in Experiment 1 when conscious recollection of negative primes was not encouraged on the fragment completion test. In Experiment 2, however, when participants were encouraged to remember negative primes at fragment completion, relief from fixation was observed. Repeated suppression may nullify fixation effects, and promote creative thinking, particularly when fixation is caused by conscious recollection of counterproductive information. PMID:24575886

Angello, Genna; Storm, Benjamin C; Smith, Steven M

2015-04-01

234

Preservation of tracheal mucus by nonaqueous fixative.  

PubMed

Two nonaqueous fixatives, composed of fluorocarbon solvents with dissolved osmium tetroxide, were used to determine the feasibility of preserving the mucous coat in bovine and rat trachea for light and electron microscopy. Aqueous fixatives, while providing excellent cytological preservation, wash away the mucous lining, precluding ultrastructural analysis. Inclusion of ruthenium red or alcian blue within aqueous fixative improved retention of mucus, but provided incomplete, patchy results. Fixation with nonaqueous fluorocarbon solvent and dissolved osmium tetroxide preserved a continuous mucous epiphase layer above a clear hypophase layer. Subcomponents of the mucus included an electron dense surface layer, interrupted patches of mucus above the surface layer and electron dense membrane-like material within the mucus. This method of fixation will preserve mucus for light, scanning and transmission electron microscopy, using either intratracheal or immersion methods of fixation. The latter would enable use of materials from large animal models, autopsy or an abattoir. PMID:1832970

Sims, D E; Westfall, J A; Kiorpes, A L; Horne, M M

1991-01-01

235

Biomet reunite absorbable fixation in lesser metatarsal chevron shortening osteotomy: A new fixation technique  

Microsoft Academic Search

A procedure to fixate lesser metatarsal osteotomies with absorbable internal fixation is presented. This method may help prevent metatarsal head and toe elevatus. (The Journal of Foot & Ankle Surgery 42(2):105-107, 2003)

Louis D. Centrella; Robert L. van Brederode

2003-01-01

236

Elementary Flux Mode Analysis of Acetyl-CoA Pathway in Carboxydothermus hydrogenoformans Z-2901  

PubMed Central

Carboxydothermus hydrogenoformans is a carboxydotrophic hydrogenogenic bacterium species that produces hydrogen molecule by utilizing carbon monoxide (CO) or pyruvate as a carbon source. To investigate the underlying biochemical mechanism of hydrogen production, an elementary mode analysis of acetyl-CoA pathway was performed to determine the intermediate fluxes by combining linear programming (LP) method available in CellNetAnalyzer software. We hypothesized that addition of enzymes necessary for carbon monoxide fixation and pyruvate dissimilation would enhance the theoretical yield of hydrogen. An in silico gene knockout of pyk, pykC, and mdh genes of modeled acetyl-CoA pathway allows the maximum theoretical hydrogen yield of 47.62?mmol/gCDW/h for 1 mole of carbon monoxide (CO) uptake. The obtained hydrogen yield is comparatively two times greater than the previous experimental data. Therefore, it could be concluded that this elementary flux mode analysis is a crucial way to achieve efficient hydrogen production through acetyl-CoA pathway and act as a model for strain improvement. PMID:24822064

Chinnasamy Perumal, Rajadurai; Selvaraj, Ashok; Ramesh Kumar, Gopal

2014-01-01

237

Carbon dioxide consumption during soil development  

Microsoft Academic Search

Carbon is sequestered in soils by accumulation of recalcitrant organic matter and by bicarbonate weathering of silicate minerals. Carbon fixation by ecosystems helps drive weathering processes in soils and that in turn diverts carbon from annual photosynthesis-soil respiration cycling into the long-term geological carbon cycle. To quantify rates of carbon transfer during soil development in moist temperate grassland and desert

Oliver A. Chadwick; Eugene F. Kelly; Dorothy M. Merritts; Ronald G. Amundson

1994-01-01

238

Initial Fixation Strength of Modified Patellar Tendon Grafts for Anatomic Fixation in Anterior Cruciate Ligament Reconstruction  

Microsoft Academic Search

Summary: Recently it has been shown that anatomic tibial graft fixation in anterior cruciate ligament (ACL) reconstruction is preferable in order to increase isometry and knee stability. To facilitate anatomic patellar tendon graft fixation, customized graft length shortening is necessary. The purpose of this study was to compare the initial fixation strength of four different shortened patellar tendon grafts including

Reinhard F. G. Hoffmann; Ricarda Peine; Hermann J. Bail; Norbert P. Südkamp; Andreas Weiler

1999-01-01

239

Serine Biosynthesis with One Carbon Catabolism and the Glycine Cleavage System Represents a Novel Pathway for ATP Generation  

Microsoft Academic Search

Previous experimental evidence indicates that some cancer cells have an alternative glycolysis pathway with net zero ATP production, implying that upregulation of glycolysis in these cells may not be related to the generation of ATP. Here we use a genome-scale model of human cell metabolism to investigate the potential metabolic alterations in cells using net zero ATP glycolysis. We uncover

Alexei Vazquez; Elke K. Markert; Zoltán N. Oltvai

2011-01-01

240

Nitrogen fixation method and apparatus  

DOEpatents

A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O[sub 2]/cm promotes the formation of vibrationally excited N[sub 2]. Atomic oxygen interacts with vibrationally excited N[sub 2] at a much quicker rate than unexcited N[sub 2], greatly improving the rate at which NO is formed. 1 fig.

Chen, H.L.

1983-08-16

241

Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}  

NASA Astrophysics Data System (ADS)

Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (?13C = {[13C/12Csample/13C/12Cstandard] - 1} × 1000). Five different forms of RubisCO (IA, IB, IC, ID, and II) are utilized by algae and autotrophic bacteria reliant on the Calvin-Benson cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs, and their ? values (={[12k/13k] - 1} × 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, explaining the variation in biomass ?13C values of autotrophs utilizing these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides and Ralstonia eutropha. The purpose of this work was to determine the ? values for form IC RubisCO enzymes from R. sphaeroides and R. eutropha. Recombinant form IC RubisCOs were purified by conventional column chromatography procedures. Assay conditions (pH, dissolved inorganic carbon concentration) were tested to determine which parameters were conducive to the high rates of carbon fixation necessary for ? determination. Under standard conditions (pH 8.5 and 5 mM DIC), form IC RubisCO activities were sufficient for ? determination. Experiments are currently being conducted to measure the ? values of these enzymes. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of ?13C values of organisms fixing carbon via the Calvin-Benson cycle. These results are critical for determining the degree to which Calvin cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.

Thomas, P. J.; Boller, A. J.; Zhao, Z.; Tabita, F. R.; Cavanaugh, C. M.; Scott, K. M.

2006-12-01

242

Laboratory Studies on the Carbon Kinetic Isotope Effects on the Production Mechanism of Particulate Phenolic Compounds Formed by Toluene Photooxidation: A Tool to Constrain Reaction Pathways.  

PubMed

In this study, we examined compound-specific stable carbon isotope ratios for phenolic compounds in secondary organic aerosols (SOA) formed by photooxidation of isotope-label free toluene. SOA generated by photooxidation of toluene using a continuous-flow reactor and an 8-m3 indoor smog chamber was collected on filters, which were extracted with acetonitrile for compound-specific analysis. Eight phenolic compounds were identified in the extracts using a gas chromatograph coupled with a mass spectrometer, and their compound-specific stable carbon isotope ratios were determined using a gas chromatograph coupled with a combustion furnace followed by an isotope ratio mass spectrometer. The majority of products, including methylnitrophenols and methylnitrocatechols, were isotopically depleted by 5‰-6‰ compared to the initial isotope ratio of toluene, whereas the isotope ratio for 4-nitrophenol remained identical to that of toluene. Based on the reaction mechanisms proposed in previous reports, stable carbon isotope ratios of these products were calculated. By comparing the observed isotope ratios with the predicted isotope ratios, we explored possible production pathways for the particulate phenolic compounds. PMID:25490235

Irei, Satoshi; Rudolph, Jochen; Huang, Lin; Auld, Janeen; Collin, Fabrice; Hastie, Donald

2014-12-01

243

21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.  

Code of Federal Regulations, 2014 CFR

...false Spinal intervertebral body fixation orthosis. 888...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL...3060 Spinal intervertebral body fixation orthosis. (a... A spinal intervertebral body fixation orthosis is a...

2014-04-01

244

21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.  

Code of Federal Regulations, 2013 CFR

...false Spinal intervertebral body fixation orthosis. 888...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL...3060 Spinal intervertebral body fixation orthosis. (a... A spinal intervertebral body fixation orthosis is a...

2013-04-01

245

21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.  

Code of Federal Regulations, 2012 CFR

...false Spinal intervertebral body fixation orthosis. 888...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL...3060 Spinal intervertebral body fixation orthosis. (a... A spinal intervertebral body fixation orthosis is a...

2012-04-01

246

21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.  

Code of Federal Regulations, 2011 CFR

...false Spinal intervertebral body fixation orthosis. 888...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL...3060 Spinal intervertebral body fixation orthosis. (a... A spinal intervertebral body fixation orthosis is a...

2011-04-01

247

21 CFR 872.4880 - Intraosseous fixation screw or wire.  

Code of Federal Regulations, 2011 CFR

...false Intraosseous fixation screw or wire. 872.4880 Section...4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended...be inserted into fractured jaw bone segments to prevent their...

2011-04-01

248

21 CFR 872.4880 - Intraosseous fixation screw or wire.  

Code of Federal Regulations, 2013 CFR

...false Intraosseous fixation screw or wire. 872.4880 Section...4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended...be inserted into fractured jaw bone segments to prevent their...

2013-04-01

249

21 CFR 872.4880 - Intraosseous fixation screw or wire.  

Code of Federal Regulations, 2014 CFR

...false Intraosseous fixation screw or wire. 872.4880 Section...4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended...be inserted into fractured jaw bone segments to prevent their...

2014-04-01

250

21 CFR 872.4880 - Intraosseous fixation screw or wire.  

Code of Federal Regulations, 2010 CFR

...false Intraosseous fixation screw or wire. 872.4880 Section...4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended...be inserted into fractured jaw bone segments to prevent their...

2010-04-01

251

21 CFR 872.4880 - Intraosseous fixation screw or wire.  

Code of Federal Regulations, 2012 CFR

...false Intraosseous fixation screw or wire. 872.4880 Section...4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended...be inserted into fractured jaw bone segments to prevent their...

2012-04-01

252

The ecology and genomics of C02 fixation in oceanic river plumes  

SciTech Connect

The ocean/atmosphere interface is the major conduit for the entry of atmospheric CO2 into oceanic carbon pools that can lead to sequestration or recycled release. The surface layers of the temperate and tropical oceans are often too oligotrophic to result in significant primary production that might lead to carbon sequestration. However, nutrient-rich river plumes can alter the primary production schemes of oligotrophic ocean basins, resulting in increased phytoplankton biomass and carbon fixation. The ultimate goal of this proposal is to understand these carbon cycling processes in major river plumes from the molecular processes involved in biological DIC uptake to contribution to basin-wide production and potential sequestration. Our research efforts include a field component to answer the questions raised concerning DIC in plumes entering ocean basins and an intensive genomics approach to understanding these processes on the cellular level using genomic fragments obtained from plume biota. This project is actually composed of 3 separate PI-initiated projects, including projects at the University of South Florida (USF) College of Marine Science, the University of Puerto Rico, and The Ohio State University. This report concerns research conducted at The Ohio State University and studies performed in collaboration with USF. In order to understand what might occur in the field, two model sysytems were studied in the laboratory. Carbon fixation in the unicellular cyanobacterium Synechococcus sp Strain PCC 7002 took place mainly through the CBB pathway. Nitrogen nutrition in cyanobacteria is regulated by NtcA, a transcriptional regulatory protein. We show that the rubisco activity and gene (rbcL) expression were not affected when cells were exposed to prolonged periods of nitrogen stress, however cells appear to use intracellular nitrogen reserves during nitrogen starvation. Transcripts of the global transcriptional regulator NtcA are expressed under nitrogen starved and nitrogen replete (nitrate or ammonia) growth conditions, with slight decrease in transcription in the presence of ammonia. These results suggest that intracellular levels of NtcA do not directly affect carbon metabolism. Gene expression of the other nitrogen regulatory signal transducer, encoded by glnB was also studied. The glnB gene was highly transcribed in nitrogen-limited cells compared to nitrogen depleted growth conditions. Therefore in the cyanobacterium Synechococcus sp PCC 7002, nitrogen does not affect the metabolic potential and carbon fixation. The NtcA regulator behaved differently and studies indicate that the product of the ntcA gene (NtcA) has an indirect effect on ca rbon assimilation and the genes involved in the carbon concentrating mechanism of strain 7002. The product of the ccmM gene plays an important role in carboxysome assembly and inorganic carbon transport within the cell. We hypothesized that under nitrogen limiting conditions the transcriptional regulator NtcA binds at the region upstream of ccmM, near the transcription start site, and blocks the transcription of ccmM. This hypothesis was experimentally proven. In another study, with USF researchers, we performed experiments in situ on RubisCO espression. To determine the relationship between expression of the major gene in carbon fixation, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO2 in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30–32) stations were dominated by rbcL mRNA concentrations from heterokonts; i.e., diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, a-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34–36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO2. While Prochlorococcus cells did not exhibit a large difference between low and high pCO2

F. Robert Tabita

2008-09-12

253

Autotrophic Microbe Metagenomes and Metabolic Pathways Differentiate Adjacent Red Sea Brine Pools  

PubMed Central

In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens. PMID:23624511

Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

2013-01-01

254

Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria.  

PubMed

Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light--but only in Ala--contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy. PMID:25136122

Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M; Pinhassi, Jarone

2014-09-01

255

Eighth international congress on nitrogen fixation. Final program  

SciTech Connect

This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

Not Available

1990-12-31

256

Evidence for carbon flux shortage and strong carbon/nitrogen interactions in pea nodules at early stages of water stress.  

PubMed

Symbiotic N2 fixation in legume nodules declines under a wide range of environmental stresses. A high correlation between N2 fixation decline and sucrose synthase (SS; EC 2.4.1.13) activity down-regulation has been reported, although it has still to be elucidated whether a causal relationship between SS activity down-regulation and N2 fixation decline can be established. In order to study the likely C/N interactions within nodules and the effects on N2 fixation, pea plants (Pisum sativum L. cv. Sugar snap) were subjected to progressive water stress by withholding irrigation. Under these conditions, nodule SS activity declined concomitantly with apparent nitrogenase activity. The levels of UDP-glucose, glucose-1-phosphate, glucose-6-phosphate, and fructose-6-phosphate decreased in water-stressed nodules compared with unstressed nodules. Drought also had a marked effect on nodule concentrations of malate, succinate, and alpha-ketoglutarate. Moreover, a general decline in nodule adenylate content was detected. NADP+-dependent isocitrate dehydrogenase (ICDH; EC 1.1.1.42) was the only enzyme whose activity increased as a result of water deficit, compensating for a possible C/N imbalance and/or supplying NADPH in circumstances that the pentose phosphate pathway was impaired, as suggested by the decline in glucose-6-phosphate dehydrogenase (G6PDH; EC 1.1.1.49) activity. The overall results show the occurrence of strong C/N interactions in nodules subjected to water stress and support a likely limitation of carbon flux that might be involved in the decline of N2 fixation under drought. PMID:16061503

Gálvez, Loli; González, Esther M; Arrese-Igor, Cesar

2005-09-01

257

Bioabsorbable fixation in orthopaedic surgery and traumatology  

Microsoft Academic Search

Bioabsorbable internal fixation devices were introduced clinically in the treatment of fractures and osteotomies of the extremities at the Department of Orthopaedics and Traumatology, Helsinki University, in 1984. Since November 5, 1984, a total of 3200 patients were managed using bone or ligament fixation devices made of self-reinforced (matrix and fibres of the same polymer) bioabsorbable alpha-hydroxy polyesters. The devices

Pentti U Rokkanen; Ole Böstman; Eero Hirvensalo; E. Antero Mäkelä; Esa K Partio; Hannu Pätiälä; Seppo Vainionpää; Kimmo Vihtonen; Pertti Törmälä

2000-01-01

258

3, 779801, 2006 Nitrogen fixation and  

E-print Network

BGD 3, 779­801, 2006 Nitrogen fixation and temperature E. Breitbarth et al. Title Page Abstract #12;BGD 3, 779­801, 2006 Nitrogen fixation and temperature E. Breitbarth et al. Title Page Abstract nitrogen cycle due to its significant input of atmospheric nitrogen into the ocean. Incorporating Tri

Boyer, Edmond

259

Fixation and the Road Not Taken  

Microsoft Academic Search

In this article, the psychic and existential impact that fixation has on an individual's life is addressed. A person may drift through years that are dictated by the circuitous path of a fixation and its vicissitude of the repetition compulsion. When such \\

Peter Shabad

1987-01-01

260

Chemical fixation of arsenic in contaminated soils  

Microsoft Academic Search

Arsenic-contaminated soils have been successfully treated using fixation methods whereby chemicals are added to prevent As mobilization. However, the chemistry of the fixation process used in the field is poorly understood. We have examined one process which succeeded in immobilizing 0. I to 0.2 weight % As in soil at a 69 a old dump site through the addition of

Remy J.-C. Hennet; S. L. Brantley

1996-01-01

261

Fixin internal fixator: concept and technique.  

PubMed

This report describes the Fixin internal fixator system(a), a fracture fixation device characterised by a locking conical coupling between screw heads and titanium alloy inserts that are screwed into a stainless steel plate construct. The mechanical principles, implants, instruments and surgical technique are discussed. PMID:20585717

Petazzoni, M; Urizzi, A; Verdonck, B; Jaeger, G

2010-01-01

262

Foveated analysis of image features at fixations  

Microsoft Academic Search

Analysis of the statistics of image features at observers' gaze can provide insights into the mechanisms of fixation selection in humans. Using a foveated analysis framework, in which image patches were analyzed at the resolution corresponding to their eccentricity from the prior fixation, we studied the statistics of four low-level local image features: luminance, RMS contrast, and bandpass outputs of

Umesh Rajashekar; Ian van der Linde; Alan C. Bovik; Lawrence K. Cormack

2007-01-01

263

HERBERT SCREW FIXATION OF SCAPHOID FRACTURES  

Microsoft Academic Search

er eviewed the records of 431 patients who had open reduction and internal fixation of the scaphoid performed by one surgeon (TJH) over a 13-year period. The Herbert bone screw provided adequate internal fixation without the use of plaster immobilisation, promoting a rapid functional recovery. On average, patients returned to work 4.7 weeks after surgery and wrist function was significantly

S. L. FILAN; T. J. HERBERT

264

Outcome comparison of Lisfranc injuries treated through dorsal plate fixation versus screw fixation  

PubMed Central

OBJECTIVE: The objective of this prospective study was to test whether the treatment of Lisfranc injuries with open reduction and dorsal plate fixation would have the same or better functional outcomes as treatment with standard trans-articular screw fixation. METHODS: Sixty patients with primarily isolated Lisfranc joint injury were treated by open reduction and dorsal plate fixation or standard screw fixation. The patients were followed on average for 31 months. Evaluation was performed with patients' chief complaint, clinical examination, radiography, and AOFAS Midfoot Scale. RESULTS: Thirty two patients were treated with open reduction and dorsal plate fixation, and twenty eight patients were treated with open reduction and screw fixation. After two years follow-up, the mean AOFAS Midfoot score was 83.1 points in the dorsal plate fixation group and 78.5 points in the screw fixation group (p<0.01). Of the dorsal plate fixation group, radiographic analysis revealed anatomic reduction in twenty-nine patients (90.6%, 29/32) and nonanatomic reduction in three patients. Of the screw fixation group, radiographic analysis revealed anatomic reduction in twenty-three patients and nonanatomic reduction in five patients (82.1%, 23/28). CONCLUSIONS: Open reduction and dorsal plate fixation for a dislocated Lisfranc injury do have better short and median term outcome and a lower reoperation rate than standard screw ORIF. In our experience, we recommend using dorsal plate in ORIF on dislocated Lisfranc injuries. Level of Evidence II, Prospective Comparative Study.

Hu, Sun-jun; Chang, Shi-min; Li, Xiao-hua; Yu, Guang-rong

2014-01-01

265

Biological nitrogen fixation in sugar cane: A key to energetically viable biofuel production  

Microsoft Academic Search

The advantages of producing biofuels to replace fossil energy sources are derived from the fact that the energy accumulated in the biomass in captured directly from photosynthesis and is thus renewable, and that the cycle of carbon dioxide fixation by the crop, followed by burning of the fuel makes no overall contribution to atmospheric COâ or, consequently, to global warming.

R. M. Boddey

1995-01-01

266

Light quality, symbiotic nitrogen fixation and growth in white clover plants  

Microsoft Academic Search

Summary The possibilities of using light quality treatments to gain an understanding of the mechanisms controlling the allocation of photosynthate for symbiotic nitrogen fixation were studied. White clover (Trifolium repens) plants were grown at the same photon irradiance in red, blue and green light treatments. Growth, nodulation and the carbon\\/nitrogen economies of the plants were measured. Both photosynthetic rates per

J. E. Sheehy; C. Vazzana; F. R. Minchin

1983-01-01

267

Controls over pathways of carbon efflux from soils along climate and black spruce productivity gradients in interior Alaska  

Microsoft Academic Search

Small changes in C cycling in boreal forests can change the sign of their C balance, so it is important to gain an understanding of the factors controlling small exports like water-soluble organic carbon (WSOC) fluxes from the soils in these systems. To examine this, we estimated WSOC fluxes based on measured concentrations along four replicate gradients in upland black

E. S. Kane; D. W. Valentine; G. J. Michaelson; J. D. Fox; C. L. Ping

2006-01-01

268

Rapid eye-fixation training without eyetracking.  

PubMed

Maintenance of stable central eye fixation is crucial for a variety of behavioral, electrophysiological, and neuroimaging experiments. Naive observers in these experiments are not typically accustomed to fixating, either requiring the use of cumbersome and costly eyetracking or producing confounds in results. We devised a flicker display that produced an easily detectable visual phenomenon whenever the eyes moved. A few minutes of training using this display dramatically improved the accuracy of eye fixation while observers performed a demanding spatial attention cuing task. The same amount of training using control displays did not produce significant fixation improvements, and some observers consistently made eye movements to the peripheral attention cue, contaminating the cuing effect. Our results indicate that (1) eye fixation can be rapidly improved in naive observers by providing real-time feedback about eye movements, and (2) our simple flicker technique provides an easy and effective method for providing this feedback. PMID:19451374

Guzman-Martinez, Emmanuel; Leung, Parkson; Franconeri, Steve; Grabowecky, Marcia; Suzuki, Satoru

2009-06-01

269

Global N2 fixation and its response to global climate change and increasing CO2 level  

NASA Astrophysics Data System (ADS)

Biological nitrogen fixation is the largest nitrogen input to many natural terrestrial ecosystems, particularly tropical ecosystems, thereby influencing primary production, CO2 uptake, and responses to climate change. However, our understanding of biological nitrogen fixation is still very limited, and the dominant plant family capable of fixing N2 symbiotically, the Leguminasae, exhibits considerable geographic variation in the terrestrial biosphere. Based on the principles of resource optimization, we developed a new model to constrain our understanding of the geographic distribution of N fixation globally. Our model treats N fixation according to the C cost of fixing N, coupled with the N cost associated with acquiring P from the soil for plant growth. The model was used to estimate the rate of global symbiotic N2 fixation and the response of symbiotic N2 fixers to changes in climate and rising atmospheric CO2. We shall discuss global N limitation of terrestrial carbon uptake and its implications for climate-carbon cycle feedbacks from present to year 2100.

Wang, Y.; Houlton, B. Z.; Field, C. B.; Vitousek, P. M.

2007-12-01

270

Malate-Mediated Carbon Catabolite Repression in Bacillus subtilis Involves the HPrK/CcpA Pathway ? §  

PubMed Central

Most organisms can choose their preferred carbon source from a mixture of nutrients. This process is called carbon catabolite repression. The Gram-positive bacterium Bacillus subtilis uses glucose as the preferred source of carbon and energy. Glucose-mediated catabolite repression is caused by binding of the CcpA transcription factor to the promoter regions of catabolic operons. CcpA binds DNA upon interaction with its cofactors HPr(Ser-P) and Crh(Ser-P). The formation of the cofactors is catalyzed by the metabolite-activated HPr kinase/phosphorylase. Recently, it has been shown that malate is a second preferred carbon source for B. subtilis that also causes catabolite repression. In this work, we addressed the mechanism by which malate causes catabolite repression. Genetic analyses revealed that malate-dependent catabolite repression requires CcpA and its cofactors. Moreover, we demonstrate that HPr(Ser-P) is present in malate-grown cells and that CcpA and HPr interact in vivo in the presence of glucose or malate but not in the absence of a repressing carbon source. The formation of the cofactor HPr(Ser-P) could be attributed to the concentrations of ATP and fructose 1,6-bisphosphate in cells growing with malate. Both metabolites are available at concentrations that are sufficient to stimulate HPr kinase activity. The adaptation of cells to environmental changes requires dynamic metabolic and regulatory adjustments. The repression strength of target promoters was similar to that observed in steady-state growth conditions, although it took somewhat longer to reach the second steady-state of expression when cells were shifted to malate. PMID:22001508

Meyer, Frederik M.; Jules, Matthieu; Mehne, Felix M. P.; Le Coq, Dominique; Landmann, Jens J.; Görke, Boris; Aymerich, Stéphane; Stülke, Jörg

2011-01-01

271

Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes  

NASA Astrophysics Data System (ADS)

Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and Arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multiyear mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) buildup and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

2014-12-01

272

Carbon and nitrogen metabolism in Rhizobium.  

PubMed

One of the paradigms of symbiotic nitrogen fixation has been that bacteroids reduce N2 to ammonium and secrete it without assimilation into amino acids. This has recently been challenged by work with soybeans showing that only alanine is excreted in 15N2 labelling experiments. Work with peas shows that the bacteroid nitrogen secretion products during in vitro experiments depend on the experimental conditions. There is a mixed secretion of both ammonium and alanine depending critically on the concentration of bacteroids and ammonium concentration. The pathway of alanine synthesis has been shown to be via alanine dehydrogenase, and mutation of this enzyme indicates that in planta there is likely to be mixed secretion of ammonium and alanine. Alanine synthesis directly links carbon catabolism and nitrogen assimilation in the bacteroid. There is now overwhelming evidence that the principal carbon sources of bacteroids are the C4-dicarboxylic acids. This is based on labelling and bacteroid respiration data, and mutation of both the dicarboxylic acid transport system (dct) and malic enzyme. L-malate is at a key bifurcation point in bacteroid metabolism, being oxidized to oxaloacetate and oxidatively decarboxylated to pyruvate. Pyruvate can be aminated to alanine or converted to acetyl-CoA where it either enters the TCA cycle by condensation with oxaloacetate or forms polyhydroxybutyrate (PHB). Thus regulation of carbon and nitrogen metabolism are strongly connected. Efficient catabolism of C4-dicarboxylates requires the balanced input and removal of intermediates from the TCA cycle. The TCA cycle in bacteroids may be limited by the redox state of NADH/NAD+ at the 2-ketoglutarate dehydrogenase complex, and a number of pathways may be involved in bypassing this block. These pathways include PHB synthesis, glutamate synthesis, glycogen synthesis, GABA shunt and glutamine cycling. Their operation may be critical in maintaining the optimum redox poise and carbon balance of the TCA cycle. They can also be considered to be overflow pathways since they act to remove or add electrons and carbon into the TCA cycle. Optimum operation of the TCA cycle has a major impact on nitrogen fixation. PMID:10907556

Poole, P; Allaway, D

2000-01-01

273

Oxygen-Poor Microzones as Potential Sites of Microbial N2 Fixation in Nitrogen-Depleted Aerobic Marine Waters  

PubMed Central

The nitrogen-deficient coastal waters of North Carolina contain suspended bacteria potentially able to fix N2. Bioassays aimed at identifying environmental factors controlling the development and proliferation of N2 fixation showed that dissolved organic carbon (as simple sugars and sugar alcohols) and particulate organic carbon (derived from Spartina alterniflora) additions elicited and enhanced N2 fixation (nitrogenase activity) in these waters. Nitrogenase activity occurred in samples containing flocculent, mucilage-covered bacterial aggregates. Cyanobacterium-bacterium aggregates also revealed N2 fixation. In all cases bacterial N2 fixation occurred in association with surficial microenvironments or microzones. Since nitrogenase is oxygen labile, we hypothesized that the aggregates themselves protected their constituent microbes from O2. Microelectrode O2 profiles revealed that aggregates had lower internal O2 tensions than surrounding waters. Tetrazolium salt (2,3,5-triphenyl-3-tetrazolium chloride) reduction revealed that patchy zones existed both within microbes and extracellularly in the mucilage surrounding microbes where free O2 was excluded. Triphenyltetrazolium chloride reduction also strongly inhibited nitrogenase activity. These findings suggest that N2 fixation is mediated by the availability of the appropriate types of reduced microzones. Organic carbon enrichment appears to serve as an energy and structural source for aggregate formation, both of which were required for eliciting N2 fixation responses of these waters. Images PMID:16347337

Paerl, Hans W.; Prufert, Leslie E.

1987-01-01

274

Glycolate Pathway in Algae 1  

PubMed Central

No glycolate oxidase activity could be detected by manometric, isotopic, or spectrophotometric techniques in cell extracts from 5 strains of algae grown in the light with CO2. However, NADH:glyoxylate reductase, phosphoglycolate phosphatase and isocitrate dehydrogenase were detected in the cell extracts. The serine formed by Chlorella or Chlamydomonas after 12 seconds of photosynthetic 14CO2 fixation contained 70 to 80% of its 14C in the carboxyl carbon. This distribution of label in serine was similar to that in phosphoglycerate from the same experiment. Thus, in algae serine is probably formed directly from phosphoglycerate. These results differ from those of higher plants which form uniformly labeled serine from glycolate in short time periods when phosphoglycerate is still carboxyl labeled. In glycolate formed by algae in 5 and 10 seconds of 14CO2 fixation, C2 was at least twice as radioactive as C1. A similar skewed labeling in C2 and C3 of 3-phosphoglycerate and serine suggests a common precursor for glycolate and 3-phosphoglycerate. Glycine formed by the algae, however, from the same experiments was uniformly labeled. Manganese deficient Chlorella incorporated only 2% of the total 14CO2 fixed in 10 minutes into glycolate, while in normal Chlorella 30% of the total 14C was found in glycolate. Manganese deficient Chlorella also accumulated more 14C in glycine and serine. Glycolate excretion by Chlorella was maximal in 10 mm bicarbonate and occurred only in the light, and was not influenced by the addition of glycolate. No time dependent uptake of significant amounts of either glycolate or phosphoglycolate was observed. When small amounts of glycolate-2-14C were fed to Chlorella or Scenedesmus, only 2 to 3% was metabolized after 30 to 60 minutes. The algae were not capable of significant glycolate metabolism as is the higher plant. The failure to detect glycolate oxidase, the low level glycolate-14C metabolism, and the formation of serine from phosphoglycerate rather than from glycolate are consistent with the concept of an incomplete glycolate pathway in algae. PMID:6045296

Hess, J. L.; Tolbert, N. E.

1967-01-01

275

The role of formate metabolism in nitrogen fixation in Rhizobium Spp  

Microsoft Academic Search

Formate metabolism supported nitrogen-fixation activity in free-living cultures of Rhizobium japonicum. However, formate0dependent nitrogense activity was observed only in the presence of carbon sources such as glutamate, ribose or aspartate which by themselves were unable to support nitrogenase activity. Formate-dependent nitrogenase activity was not detected in the presence of carbon sources such as malate, gluconate or glycerol which by themselves

Sundaram S. Manian; Robert Gumbleton; Fergal O'Gara

1982-01-01

276

Direct and Indirect Costs of Dinitrogen Fixation in Crocosphaera watsonii WH8501 and Possible Implications for the Nitrogen Cycle  

PubMed Central

The recent detection of heterotrophic nitrogen (N2) fixation in deep waters of the southern Californian and Peruvian OMZ questions our current understanding of marine N2 fixation as a process confined to oligotrophic surface waters of the oceans. In experiments with Crocosphaera watsonii WH8501, a marine unicellular diazotrophic (N2 fixing) cyanobacterium, we demonstrated that the presence of high nitrate concentrations (up to 800??M) had no inhibitory effect on growth and N2 fixation over a period of 2?weeks. In contrast, the environmental oxygen concentration significantly influenced rates of N2 fixation and respiration, as well as carbon and nitrogen cellular content of C. watsonii over a 24-h period. Cells grown under lowered oxygen atmosphere (5%) had a higher nitrogenase activity and respired less carbon during the dark cycle than under normal oxygen atmosphere (20%). Respiratory oxygen drawdown during the dark period could be fully explained (104%) by energetic needs due to basal metabolism and N2 fixation at low oxygen, while at normal oxygen these two processes could only account for 40% of the measured respiration rate. Our results revealed that under normal oxygen concentration most of the energetic costs during N2 fixation (?60%) are not derived from the process of N2 fixation per se but rather from the indirect costs incurred for the removal of intracellular oxygen or by the reversal of oxidative damage (e.g., nitrogenase de novo synthesis). Theoretical calculations suggest a slight energetic advantage of N2 fixation relative to assimilatory nitrate uptake, when oxygen supply is in balance with the oxygen requirement for cellular respiration (i.e., energy generation for basal metabolism and N2 fixation). Taken together our results imply the existence of a niche for diazotrophic organisms inside oxygen minimum zones, which are predicted to further expand in the future ocean. PMID:22833737

Großkopf, Tobias; LaRoche, Julie

2012-01-01

277

Effects of soil structure destruction on methane production and carbon partitioning between methanogenic pathways in tropical rain forest soils  

NASA Astrophysics Data System (ADS)

Controls on methanogenesis are often determined from laboratory incubations of soils converted to slurries. Destruction of soil structure during slurry conversion may disrupt syntrophic associations, kill methanogens, and/or alter the microsite distribution of methanogenic activity, suppressing CH4 production. The effects of slurry conversion on methanogenesis were investigated to determine if disruption of aggregate structure impacted methanogenesis, substrate utilization, and C partitioning between methanogenic pathways. Soils were collected from the tropical rain forest life zone of the Luquillo Experimental Forest, Puerto Rico, and exposed to different physical disturbances, including flooding and physical homogenization. Slurry conversion negatively impacted methanogenesis. Rates of CH4 production declined by a factor of 17 after well-aggregated soils were converted to slurries. Significantly more 13C-acetate was recovered in CO2 compared to CH4 after slurry conversion, suggesting that methanogens consumed less acetate after slurry conversion and may have competed less effectively with other anaerobes for acetate. Isotopic data indicate that the relative partitioning of C between aceticlastic and hydrogenotrophic pathways was unchanged after slurry conversion. These data suggest that experiments which destroy soil structure may significantly underestimate methanogenesis and overestimate the potential for other microorganisms to compete with methanogens for organic substrates. Current knowledge of the factors that regulate methanogenesis in soil may be biased by the findings of slurry-based experiments, that do not accurately represent the complex, spatially heterogeneous conditions found in well-aggregated soils.

Teh, Yit Arn; Silver, Whendee L.

2006-03-01

278

One-Carbon Metabolism Pathway Gene Variants and Risk of Clear Cell Renal Cell Carcinoma in a Chinese Population  

PubMed Central

Background One-carbon metabolism is the basement of nucleotide synthesis and the methylation of DNA linked to cancer risk. Variations in one-carbon metabolism genes are reported to affect the risk of many cancers, including renal cancer, but little knowledge about this mechanism is known in Chinese population. Methods Each subject donated 5 mL venous blood after signing the agreement. The study was approved by the Institutional Review Board of the Nanjing Medical University, Nanjing, China. 18 SNPs in six one-carbon metabolism-related genes (CBS, MTHFR, MTR, MTRR, SHMT1, and TYMS) were genotyped in 859 clear cell renal cell carcinoma (ccRCC) patients and 1005 cancer-free controls by the Snapshot. Results Strong associations with ccRCC risk were observed for rs706209 (P?=?0.006) in CBS and rs9332 (P?=?0.027) in MTRR. Compared with those carrying none variant allele, individuals carrying one or more variant alleles in these two genes had a statistically significantly decreased risk of ccRCC [P?=?0.001, adjusted odds ratio (OR)?=?0.73, 95% confidence interval (CI)?=?0.06–0.90]. In addition, patients carrying one or more variant alleles were more likely to develop localized stage disease (P?=?0.002, adjusted OR?=?1.37, 95%CI?=?1.11–1.69) and well-differentiated ccRCC (P<0.001, adjusted OR?=?1.42, 95%CI?=?0.87–1.68). In the subgroup analysis, individuals carrying none variant allele in older group (P?=?0.007, adjusted OR?=?0.67, 95%CI?=?0.49–0.91), male group (P?=?0.007, adjusted OR?=?0.71, 95%CI?=?0.55–0.92), never smoking group (P?=?0.002, adjusted OR?=?0.68, 95%CI?=?0.53–0.88) and never drinking group (P<0.001, adjusted OR?=?0.68, 95%CI?=?0.53–0.88) had an increased ccRCC risk. Conclusions Our results suggest that the polymorphisms of the one-carbon metabolism-related genes are associated with ccRCC risk in Chinese population. Future population-based prospective studies are required to confirm the results. PMID:24278388

Cai, Hongzhou; Li, Pu; Cao, Qiang; Shao, Pengfei; Qin, Chao; Yin, Changjun

2013-01-01

279

Quantum Chemistry Study of Cycloaddition Pathways for the Reaction of o-Benzyne with Fullerenes and Carbon Nanotubes  

NASA Technical Reports Server (NTRS)

Functionalization of fullerenes via the [2+2] cycloaddition reaction with o-benzyne has been demonstrated in the laboratory. In contrast, [2+4) cycloaddition products are formed when benzyne reacts with planar polycyclic aromatic hydrocarbons. Using density functional theory (DFT) calculations with Becke's hybrid functional and small contracted gaussian basis sets, we are able to reproduce these product preferences. The objective of this work is to explore the functionalization of carbon nanotubes. We have studied o-benzyne cycloaddition products with a [14,0] single-walled nanotube. We find both the [2+2] and [2+4] adducts to be stable, with the latter product being somewhat favored.

Jaffe, Richard; Han, Jie; Langhoff, Stephen R. (Technical Monitor)

1997-01-01

280

Carbon metabolism in legume nodules. Progress report, July 1982-July 1983  

SciTech Connect

The goal is to understand how the legume nodule metabolizes carbohydrate to provide energy and reductant for symbiotic fixation. The working hypothesis has been that the plant cytosol is microacrobic and that some carbon metabolism may be via anaerobic pathways similar to those in roots of flood tolerant plants. A method of analyzing redox changes in intact mitochondria, bacteroids or bacteria was adapted; a method of manipulating nitrogenase activity by oxygen inhibition was developed; the production of alcohol by soybean nodules was studied; and enzymes metabolizing alcohol/aldehyde were found in other nitrogen fixing systems. (ACR)

LaRue, T.A.

1983-01-01

281

Deciphering diatom biochemical pathways via whole-cell proteomics  

PubMed Central

Diatoms play a critical role in the oceans’ carbon and silicon cycles; however, a mechanistic understanding of the biochemical processes that contribute to their ecological success remains elusive. Completion of the Thalassiosira pseudonana genome provided ‘blueprints’ for the potential biochemical machinery of diatoms, but offers only a limited insight into their biology under various environmental conditions. Using high-throughput shotgun proteomics, we identified a total of 1928 proteins expressed by T. pseudonana cultured under optimal growth conditions, enabling us to analyze this diatom’s primary metabolic and biosynthetic pathways. Of the proteins identified, 70% are involved in cellular metabolism, while 11% are involved in the transport of molecules. We identified all of the enzymes involved in the urea cycle, thereby describing the complete pathway to convert ammonia to urea, along with urea transporters, and the urea-degrading enzyme urease. Although metabolic exchange between these pathways remains ambiguous, their constitutive presence suggests complex intracellular nitrogen recycling. In addition, all C4 related enzymes for carbon fixation have been identified to be in abundance, with high protein sequence coverage. Quantification of mass spectra acquisitions demonstrated that the 20 most abundant proteins included an unexpectedly high expression of clathrin, which is the primary structural protein involved in endocytic transport. This result highlights a previously overlooked mechanism for the inter- and intra-cellular transport of nutrients and macromolecules in diatoms, potentially providing a missing link to organelle communication and metabolite exchange. Our results demonstrate the power of proteomics, and lay the groundwork for future comparative proteomic studies and directed analyses of specifically expressed proteins and biochemical pathways of oceanic diatoms. PMID:19829762

Nunn, Brook L.; Aker, Jocelyn R.; Shaffer, Scott A.; Tsai, Shannon; Strzepek, Robert F.; Boyd, Philip W.; Freeman, Theodore Larson; Brittnacher, Mitchell; Malmström, Lars; Goodlett, David R.

2009-01-01

282

Is Supplementary Fixation Necessary in Anterior Cruciate Ligament Reconstructions?  

Microsoft Academic Search

Background: There has been concern regarding the fixation of anterior cruciate ligament reconstruction, with soft tissue grafts being strong and stiff enough to allow for early accelerated postoperative rehabilitation. Therefore, some have recommended supplementary fixation for soft tissue tibia interference screw fixation with a staple, to improve the strength and stiffness of the fixation. Unfortunately, with staple supplementation, there is

John J. Lee; Karimdad Otarodifard; Bong Jae Jun; Michelle H. McGarry; George F. Hatch; Thay Q. Lee

2011-01-01

283

Fixation stability in schizophrenia, bipolar, and control subjects  

Microsoft Academic Search

A few investigators have suggested that visual fixation abnormalities may serve as an endophenotype of liability for schizophrenia. However, the data are equivocal. Conflicting reports regarding the specificity of fixation deficits to schizophrenia may be attributable to methodological differences. Thirty-four schizophrenia patients, 20 bipolar patients, and 30 non-patient controls were presented targets for central fixation. Fixation was scored in terms

Diane C. Gooding; Jeffrey A. Grabowski; Christian S. Hendershot

2000-01-01

284

Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion  

PubMed Central

Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C?C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

2013-01-01

285

Diel nitrogen fixation pattern of Trichodesmium: the interactive control of light and Ni  

PubMed Central

Trichodesmium, a nonheterocystous cyanobacterium widely abundant in the surface water of the tropical and subtropical ocean, fixes dinitrogen under high light conditions while concurrently undergoing photosynthesis. The new production considerably influences the cycling of nitrogen and carbon in the ocean. Here, we investigated how light intensity and nickel (Ni) availability interplay to control daily rates and diel patterns of N2 fixation in Trichodesmium. We found that increasing Ni concentration increased N2 fixation rates by up to 30-fold in the high light treatment. Cultures subjected to high Ni and light levels fixed nitrogen throughout most of the 24 H light:dark regime with the highest rate coinciding with the end of the 12 H light period. Our study demonstrates the importance of Ni on nitrogen fixation rates for Trichodesmium under high light conditions. PMID:24658259

Rodriguez, Irene B.; Ho, Tung-Yuan

2014-01-01

286

Diel nitrogen fixation pattern of Trichodesmium: the interactive control of light and Ni.  

PubMed

Trichodesmium, a nonheterocystous cyanobacterium widely abundant in the surface water of the tropical and subtropical ocean, fixes dinitrogen under high light conditions while concurrently undergoing photosynthesis. The new production considerably influences the cycling of nitrogen and carbon in the ocean. Here, we investigated how light intensity and nickel (Ni) availability interplay to control daily rates and diel patterns of N2 fixation in Trichodesmium. We found that increasing Ni concentration increased N2 fixation rates by up to 30-fold in the high light treatment. Cultures subjected to high Ni and light levels fixed nitrogen throughout most of the 24 H light:dark regime with the highest rate coinciding with the end of the 12 H light period. Our study demonstrates the importance of Ni on nitrogen fixation rates for Trichodesmium under high light conditions. PMID:24658259

Rodriguez, Irene B; Ho, Tung-Yuan

2014-01-01

287

Diel nitrogen fixation pattern of Trichodesmium: the interactive control of light and Ni  

NASA Astrophysics Data System (ADS)

Trichodesmium, a nonheterocystous cyanobacterium widely abundant in the surface water of the tropical and subtropical ocean, fixes dinitrogen under high light conditions while concurrently undergoing photosynthesis. The new production considerably influences the cycling of nitrogen and carbon in the ocean. Here, we investigated how light intensity and nickel (Ni) availability interplay to control daily rates and diel patterns of N2 fixation in Trichodesmium. We found that increasing Ni concentration increased N2 fixation rates by up to 30-fold in the high light treatment. Cultures subjected to high Ni and light levels fixed nitrogen throughout most of the 24 H light:dark regime with the highest rate coinciding with the end of the 12 H light period. Our study demonstrates the importance of Ni on nitrogen fixation rates for Trichodesmium under high light conditions.

Rodriguez, Irene B.; Ho, Tung-Yuan

2014-03-01

288

Rigid fixation of mandibular condyle fractures.  

PubMed

This article reviews the anatomy and surgical approaches for treating fractures of the mandibular condyle with plate and screw fixation. Advantages and disadvantages of the preauricular, submandibular, intraoral, retromandibular, and rhytidectomy approaches are presented. PMID:8351124

Ellis, E; Dean, J

1993-07-01

289

An examination of fixation in brainstorming  

E-print Network

In this dissertation, two areas of creativity are reviewed. “Fixation” refers to the inability to solve a problem or retrieve a memory due to prior experience or an inappropriate solution path. Brainstorming is the process of generating as many...

Kohn, Nicholas William

2009-05-15

290

Biological construction of single-walled carbon nanotube electron transfer pathways in dye-sensitized solar cells.  

PubMed

We designed and mass-produced a versatile protein supramolecule that can be used to manufacture a highly efficient dye-sensitized solar cell (DSSC). Twelve single-walled carbon-nanotube (SWNT)-binding and titanium-mineralizing peptides were genetically integrated on a cage-shaped dodecamer protein (CDT1). A process involving simple mixing of highly conductive SWNTs with CDT1 followed by TiO2 biomineralization produces a high surface-area/weight TiO2 -(anatase)-coated intact SWNT nanocomposite under environmentally friendly conditions. A DSSC with a TiO2 photoelectrode containing 0.2?wt?% of the SWNT-TiO2 nanocomposite shows a current density improvement by 80% and a doubling of the photoelectric conversion efficiency. The SWNT-TiO2 nanocomposite transfers photon-generated electrons from dye molecules adsorbed on the TiO2 to the anode electrode swiftly. PMID:25111295

Inoue, Ippei; Watanabe, Kiyoshi; Yamauchi, Hirofumi; Ishikawa, Yasuaki; Yasueda, Hisashi; Uraoka, Yukiharu; Yamashita, Ichiro

2014-10-01

291

Open pisiform fracture: excision or internal fixation?  

PubMed Central

A 53-year-old man presented with an open fracture of the pisiform after a fall on his left wrist. Treatment of the patient presented a dilemma between excision of the proximal fragment and internal fixation. The patient underwent internal fixation with a 2.5 cortical screw. At 6?months follow-up the fracture appeared fully consolidated with full functional recovery of the wrist. PMID:23307459

Agathangelidis, Filon; Boutsiadis, Achilleas; Ditsios, Konstantinos

2013-01-01

292

Dinitrogen fixation in the Indian Ocean  

NASA Astrophysics Data System (ADS)

Several lines of geochemical evidence suggest that biological dinitrogen (N2) fixation is a quantitatively important process in the marine nitrogen (N) cycle. However, global and basin-scale rates of N2 fixation remain poorly constrained due to spatial and temporal under-sampling; this is particularly the case in the Indian Ocean (IO). Recent and multiple lines of evidence also suggest that N2 fixation and denitrification may be more closely coupled in space than previously suggested. In the Arabian Sea's (AS) oxygen minimum zone (OMZ), isotopic evidence and N2 supersaturation suggests N2 fixation is a significant process, and new analyses using a nutrient tracer, P*, suggests substantial N2 fixation in surface waters downstream of the AS OMZ. However, despite the geochemical inferences regarding the location and magnitude of N2 fixation in the AS, and the importance of this basin in removing fixed N from the ocean, observations of diazotrophic organisms supporting these conjectures are sparse, and rate measurements are few. The limited observational data available suggest the presence of a diverse group of diazotrophs, including Trichodesmium, cyanobacterial symbionts, and coccoid cyanobacteria. Specific controls on N2 fixation likely vary across the basin in response to external forcing (e.g., seasonal monsoons and upwelling) and inputs (e.g., aeolian and riverine fluxes). To better model the N cycle under current and future (and by extension, past) oceanic conditions, we need a better understanding of where N2 fixation occurs with respect to the OMZ, at what rates, and the physiological and environmental controls on diazotrophy in the IO.

Mulholland, Margaret R.; Capone, Douglas G.

293

Internal fixation in pediatric maxillofacial fractures.  

PubMed

Pediatric facial trauma presents unique problems in diagnosis and management. The following review highlights relevant points of craniofacial growth and applied anatomy. The epidemiology of pediatric facial fractures is presented followed by pertinent features of clinical presentation and diagnosis. Management of midfacial injuries is discussed individually for each specific type of fracture with emphasis on the role of rigid fixation. Finally, the relationships between childhood fractures, rigid fixation and craniofacial growth are reviewed. PMID:10371893

Winzenburg, S M; Imola, M J

1998-01-01

294

Foveation dynamics in congenital nystagmus I: Fixation  

Microsoft Academic Search

Congenital nystagmus (CN) has been described as a ‘fixation’ nystagmus implying an inability to fixate a target. However, each cycle of CN contains a target-foveation period during which the eye velocity is at, or near, zero. Prolongation of foveation time, reduction of retinal image velocity and cycle-to-cycle foveation repeatability all contribute to increased visual acuity. We developed several methods to

L. F. Dell'osso; J. Steen; R. M. Steinman; H. Coleewijn

1992-01-01

295

Resource Optimization and Symbiotic Nitrogen Fixation  

Microsoft Academic Search

In temperate forests, symbiotic nitrogen (N) fixation is restricted to the early phases of succession despite the persistence\\u000a of N limitation on production late in succession. This paradox has yet to be explained adequately. We hypothesized that the\\u000a restriction of N fixation to early stages of succession results from the optimization of resource allocation in the vegetation.\\u000a Because of this

E. B. Rastetter; P. M. Vitousek; C. Field; G. R. Shaver; D. Herbert; G. I. gren

2001-01-01

296

Gaze shifts and fixations dominate gaze behavior of walking cats.  

PubMed

Vision is important for locomotion in complex environments. How it is used to guide stepping is not well understood. We used an eye search coil technique combined with an active marker-based head recording system to characterize the gaze patterns of cats walking over terrains of different complexity: (1) on a flat surface in the dark when no visual information was available, (2) on the flat surface in light when visual information was available but not required for successful walking, (3) along the highly structured but regular and familiar surface of a horizontal ladder, a task for which visual guidance of stepping was required, and (4) along a pathway cluttered with many small stones, an irregularly structured surface that was new each day. Three cats walked in a 2.5-m corridor, and 958 passages were analyzed. Gaze activity during the time when the gaze was directed at the walking surface was subdivided into four behaviors based on speed of gaze movement along the surface: gaze shift (fast movement), gaze fixation (no movement), constant gaze (movement at the body's speed), and slow gaze (the remainder). We found that gaze shifts and fixations dominated the cats' gaze behavior during all locomotor tasks, jointly occupying 62-84% of the time when the gaze was directed at the surface. As visual complexity of the surface and demand on visual guidance of stepping increased, cats spent more time looking at the surface, looked closer to them, and switched between gaze behaviors more often. During both visually guided locomotor tasks, gaze behaviors predominantly followed a repeated cycle of forward gaze shift followed by fixation. We call this behavior "gaze stepping". Each gaze shift took gaze to a site approximately 75-80cm in front of the cat, which the cat reached in 0.7-1.2s and 1.1-1.6 strides. Constant gaze occupied only 5-21% of the time cats spent looking at the walking surface. PMID:24973656

Rivers, T J; Sirota, M G; Guttentag, A I; Ogorodnikov, D A; Shah, N A; Beloozerova, I N

2014-09-01

297

Thermus oshimai JL-2 and T. thermophilus JL-18 genome analysis illuminates pathways for carbon, nitrogen, and sulfur cycling.  

PubMed

The complete genomes of Thermus oshimai JL-2 and T. thermophilus JL-18 each consist of a circular chromosome, 2.07 Mb and 1.9 Mb, respectively, and two plasmids ranging from 0.27 Mb to 57.2 kb. Comparison of the T. thermophilus JL-18 chromosome with those from other strains of T. thermophilus revealed a high degree of synteny, whereas the megaplasmids from the same strains were highly plastic. The T. oshimai JL-2 chromosome and megaplasmids shared little or no synteny with other sequenced Thermus strains. Phylogenomic analyses using a concatenated set of conserved proteins confirmed the phylogenetic and taxonomic assignments based on 16S rRNA phylogenetics. Both chromosomes encode a complete glycolysis, tricarboxylic acid (TCA) cycle, and pentose phosphate pathway plus glucosidases, glycosidases, proteases, and peptidases, highlighting highly versatile heterotrophic capabilities. Megaplasmids of both strains contained a gene cluster encoding enzymes predicted to catalyze the sequential reduction of nitrate to nitrous oxide; however, the nitrous oxide reductase required for the terminal step in denitrification was absent, consistent with their incomplete denitrification phenotypes. A sox gene cluster was identified in both chromosomes, suggesting a mode of chemolithotrophy. In addition, nrf and psr gene clusters in T. oshmai JL-2 suggest respiratory nitrite ammonification and polysulfide reduction as possible modes of anaerobic respiration. PMID:24019992

Murugapiran, Senthil K; Huntemann, Marcel; Wei, Chia-Lin; Han, James; Detter, J C; Han, Cliff; Erkkila, Tracy H; Teshima, Hazuki; Chen, Amy; Kyrpides, Nikos; Mavrommatis, Konstantinos; Markowitz, Victor; Szeto, Ernest; Ivanova, Natalia; Pagani, Ioanna; Pati, Amrita; Goodwin, Lynne; Peters, Lin; Pitluck, Sam; Lam, Jenny; McDonald, Austin I; Dodsworth, Jeremy A; Woyke, Tanja; Hedlund, Brian P

2013-01-01

298

Maxwellian Eye Fixation during Natural Scene Perception  

PubMed Central

When we explore a visual scene, our eyes make saccades to jump rapidly from one area to another and fixate regions of interest to extract useful information. While the role of fixation eye movements in vision has been widely studied, their random nature has been a hitherto neglected issue. Here we conducted two experiments to examine the Maxwellian nature of eye movements during fixation. In Experiment 1, eight participants were asked to perform free viewing of natural scenes displayed on a computer screen while their eye movements were recorded. For each participant, the probability density function (PDF) of eye movement amplitude during fixation obeyed the law established by Maxwell for describing molecule velocity in gas. Only the mean amplitude of eye movements varied with expertise, which was lower in experts than novice participants. In Experiment 2, two participants underwent fixed time, free viewing of natural scenes and of their scrambled version while their eye movements were recorded. Again, the PDF of eye movement amplitude during fixation obeyed Maxwell's law for each participant and for each scene condition (normal or scrambled). The results suggest that eye fixation during natural scene perception describes a random motion regardless of top-down or of bottom-up processes. PMID:23226987

Duchesne, Jean; Bouvier, Vincent; Guillemé, Julien; Coubard, Olivier A.

2012-01-01

299

Contribution of dinitrogen fixation to bacterial and primary productivity in the Gulf of Aqaba (Red Sea)  

NASA Astrophysics Data System (ADS)

We evaluated the seasonal contribution of heterotrophic and autotrophic diazotrophy to the total dinitrogen (N2) fixation in a representative pelagic station in the northern Gulf of Aqaba in early spring when the water column was mixed and during summer under full thermal stratification. N2 fixation rates were low during the mixed period (˜ 0.1 nmol N L-1 d-1) and were significantly coupled with both primary and bacterial productivity. During the stratified period N2 fixation rates were four-fold higher (˜ 0.4 nmol N L-1 d-1) and were significantly correlated solely with bacterial productivity. Furthermore, while experimental enrichment of seawater by phosphorus (P) enhanced bacterial productivity and N2 fixation rates during both seasons primary productivity was stimulated by P only in the early spring. Metatranscriptomic analyses from the stratified period identified the major diazotrophic contributors as related to heterotrophic prokaryotes from the Euryarchaeota and Desulfobacterales (Deltaproteobacteria) or Chlorobiales (Chlorobia). Moreover, during this season, experimental amendments to seawater applying a combination of the photosynthetic inhibitor 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and a mixture of amino acids increased both bacterial productivity and N2 fixation rates. Our findings from the northern Gulf of Aqaba indicate a~shift in the diazotrophic community from phototrophic and heterotrophic populations, including small blooms of the cyanobacterium Trichodesmium, in winter/early spring, to predominantly heterotrophic diazotrophs in summer that may be both P and carbon limited as the additions of P and amino acids illustrated.

Rahav, E.; Herut, B.; Mulholland, M. R.; Voß, B.; Stazic, D.; Steglich, C.; Hess, W. R.; Berman-Frank, I.

2013-06-01

300

Increase in cell motility by carbon ion irradiation via the Rho signaling pathway and its inhibition by the ROCK inhibitor Y-27632 in lung adenocarcinoma A549 cells  

PubMed Central

This study aimed to investigate the effect of carbon ion (C-ion) irradiation on cell motility through the ras homolog gene family member (Rho) signaling pathway in the human lung adenocarcinoma cell line A549. Cell motility was assessed by a wound-healing assay, and the formation of cell protrusions was evaluated by F-actin staining. Cell viability was examined by the WST-1 assay. The expression of myosin light chain 2 (MLC2) and the phosphorylation of MLC2 at Ser19 (P-MLC2-S19) were analyzed by Western blot. At 48 h after irradiation, the wound-healing assay demonstrated that migration was significantly greater in cells irradiated with C-ion (2 or 8 Gy) than in unirradiated cells. Similarly, F-actin staining showed that the formation of protrusions was significantly increased in cells irradiated with C-ion (2 or 8 Gy) compared with unirradiated cells. The observed increase in cell motility due to C-ion irradiation was similar to that observed due to X-ray irradiation. Western-blot analysis showed that C-ion irradiation (8 Gy) increased P-MLC2-S19 expression compared with in unirradiated controls, while total MLC2 expression was unchanged. Exposure to a non-toxic concentration of Y-27632, a specific inhibitor of Rho-associated coiled-coil-forming protein kinase (ROCK), reduced the expression of P-MLC2-S19 after C-ion irradiation (8 Gy), resulting in a significant reduction in migration. These data suggest that C-ion irradiation increases cell motility in A549 cells via the Rho signaling pathway and that ROCK inhibition reduces that effect. PMID:24659807

Murata, Kazutoshi; Noda, Shin-ei; Oike, Takahiro; Takahashi, Akihisa; Yoshida, Yukari; Suzuki, Yoshiyuki; Ohno, Tatsuya; Funayama, Tomoo; Kobayashi, Yasuhiko; Takahashi, Takeo; Nakano, Takashi

2014-01-01

301

Cost of external fixation vs external fixation then nailing in bone infection  

PubMed Central

AIM: To study the cost benefit of external fixation vs external fixation then nailing in treatment of bone infection by segment transfer. METHODS: Out of 71 patients with infected nonunion tibia treated between 2003 and 2006, 50 patients fitted the inclusion criteria (26 patients were treated by external fixation only, and 24 patients were treated by external fixation early removal after segment transfer and replacement by internal fixation). Cost of inpatient treatment, total cost of inpatient and outpatient treatment till full healing, and the weeks of absence from school or work were calculated and compared between both groups. RESULTS: The cost of hospital stay and surgery in the group of external fixation only was 22.6 ± 3.3 while the cost of hospital stay and surgery in the group of early external fixation removal and replacement by intramedullary nail was 26.0 ± 3.2. The difference was statistically significant regarding the cost of hospital stay and surgery in favor of the group of external fixation only. The total cost of medical care (surgery, hospital stay, treatment outside the hospital including medications, dressing, physical therapy, outpatient laboratory work, etc.) in group of external fixation only was 63.3 ± 15.1, and total absence from work was 38.6 ± 6.6 wk. While the group of early removal of external fixation and replacement by IM nail, total cost of medical care was 38.3 ± 6.4 and total absence from work or school was 22.7 ± 4.1. The difference was statistically significant regarding the total cost and absence from work in favor of the group of early removal and replacement by IM nail. CONCLUSION: Early removal of external fixation and replacement by intramedullary nail in treatment of infected nonunion showed more cost effectiveness. Orthopaedic society needs to show the cost effectiveness of different procedures to the community, insurance, and health authorities.

Emara, Khaled Mohamed; Diab, Ramy Ahmed; Ghafar, Khaled Abd EL

2015-01-01

302

Remodulation of central carbon metabolic pathway in response to arsenite exposure in Rhodococcus sp. strain NAU?1  

PubMed Central

Summary Arsenite?tolerant bacteria were isolated from an organic farm of Navsari Agricultural University (NAU), Gujarat, India (Latitude: 20°55?39.04?N; Longitude: 72°54?6.34?E). One of the isolates, NAU?1 (aerobic, Gram?positive, non?motile, coccobacilli), was hyper?tolerant to arsenite (AsIII, 23?mM) and arsenate (AsV, 180?mM). 16S rRNA gene of NAU?1 was 99% similar to the 16S rRNA genes of Rhodococcus (Accession No. HQ659188). Assays confirmed the presence of membrane bound arsenite oxidase and cytoplasmic arsenate reductase in NAU?1. Genes for arsenite transporters (arsB and ACR3(1)) and arsenite oxidase gene (aoxB) were confirmed by PCR. Arsenite oxidation and arsenite efflux genes help the bacteria to tolerate arsenite. Specific activities of antioxidant enzymes (catalase, ascorbate peroxidase, superoxide dismutase and glutathione S?transferase) increased in dose?dependent manner with arsenite, whereas glutathione reductase activity decreased with increase in AsIII concentration. Metabolic studies revealed that Rhodococcus NAU?1 produces excess of gluconic and succinic acids, and also activities of glucose dehydrogenase, phosphoenol pyruvate carboxylase and isocitrate lyase were increased, to cope with the inhibited activities of glucose?6?phosphate dehydrogenase, pyruvate dehydrogenase and ??ketoglutarate dehydrogenase enzymes respectively, in the presence of AsIII. Enzyme assays revealed the increase in direct oxidative and glyoxylate pathway in Rhodococcus NAU?1 in the presence of AsIII. PMID:23062201

Jain, Raina; Adhikary, Hemanta; Jha, Sanjay; Jha, Anamika; Kumar, G. Naresh

2012-01-01

303

Diazotrophy in the Deep: Measuring Rates and Identifying Biological Mediators of N2 fixation in Deep-Sea Sediments  

NASA Astrophysics Data System (ADS)

Biological N2 fixation (the conversion of N2 to NH3) is the largest natural source of bioavailable nitrogen to the biosphere, and dictates the rate of community productivity in many nitrogen-limited environments. Deep-sea sediments are traditionally not thought to host N2 fixation, however evidence from a metagenomics dataset targeting deep-sea methanotrophic archaea (ANME) suggested their ability to fix N2 (Pernthaler, et al., PNAS 2008). Using stable isotope labeling experiments and FISH-NanoSIMS, a technique which allows the visualization of isotopic composition within phylogenetically identified cells on the nanometer scale, we demonstrated that the ANME are capable of N2 fixation (Dekas et al., Science 2009). In the present work, we use FISH-NanoSIMS and bulk Isotope Ratio Mass Spectrometry (IRMS) to show that the ANME are the most significant source of new nitrogen at a Costa Rican methane seep. This suggests that the ANME may play a significant role in N2 fixation in methane seeps worldwide. We expand our investigation of deep-sea diazotrophy to include diverse habitats, including sulfide- and carbon-rich whalefalls, and observe that N2 fixation is widespread in sediments on the seafloor. Outside of methane seeps, N2 fixation appears to be mediated by a diversity of anaerobic microbes potentially including methanogens and sulfate reducing bacteria. Interestingly, deep-sea N2 fixation often occurs in the presence of high levels of NH4+. Our observations challenge long-held hypotheses about where and when N2 fixation occurs, and suggest a bigger role for N2 fixation on the seafloor - and potentially the deep-biosphere - than previously realized.

Dekas, A. E.; Fike, D. A.; Chadwick, G.; Connon, S. A.; Orphan, V. J.

2013-12-01

304

Role of CcpA in Regulation of the Central Pathways of Carbon Catabolism in Bacillus subtilis  

PubMed Central

The Bacillus subtilis two-dimensional (2D) protein index contains almost all glycolytic and tricarboxylic acid (TCA) cycle enzymes, among them the most abundant housekeeping proteins of growing cells. Therefore, a comprehensive study on the regulation of glycolysis and the TCA cycle was initiated. Whereas expression of genes encoding the upper and lower parts of glycolysis (pgi, pfk, fbaA, and pykA) is not affected by the glucose supply, there is an activation of the glycolytic gap gene and the pgk operon by glucose. This activation seems to be dependent on the global regulator CcpA, as shown by 2D polyacrylamide gel electrophoresis analysis as well as by transcriptional analysis. Furthermore, a high glucose concentration stimulates production and excretion of organic acids (overflow metabolism) in the wild type but not in the ccpA mutant. Finally, CcpA is involved in strong glucose repression of almost all TCA cycle genes. In addition to TCA cycle and glycolytic enzymes, the levels of many other proteins are affected by the ccpA mutation. Our data suggest (i) that ccpA mutants are unable to activate glycolysis or carbon overflow metabolism and (ii) that CcpA might be a key regulator molecule, controlling a superregulon of glucose catabolism. PMID:10559165

Tobisch, Steffen; Zühlke, Daniela; Bernhardt, Jörg; Stülke, Jörg; Hecker, Michael

1999-01-01

305

Transcriptional analysis of bglPH expression in Bacillus subtilis: evidence for two distinct pathways mediating carbon catabolite repression.  

PubMed

In Bacillus subtilis, aryl-beta-glucosides such as salicin and arbutin are catabolized by the gene products of bglP and bglH, encoding an enzyme II of the phosphoenolpyruvate sugar-phosphotransferase system and a phospho-beta-glucosidase, respectively. These two genes are transcribed from a single promoter. The presence of a transcript of about 4,000 nucleotides detected by Northern (RNA) blot analysis indicates that bglP and bglH are part of an operon. However, this transcript is only present when cells are grown in the presence of the inducing substrate, salicin. In the absence of the inducer, a transcript of about 110 nucleotides can be detected, suggesting that transcription terminates downstream of the promoter at a stable termination structure. Initiation of transcription is abolished in the presence of rapidly metabolized carbon sources. Catabolite repression of bglPH expression involves the trans-acting factors CcpA and HPr. In a ccpA mutant, transcription initiation is relieved from glucose repression. Furthermore, we report a catabolite responsive element-CcpA-independent form of catabolite repression requiring the ribonucleic antiterminator-terminator region, which is the target of antitermination, and the wild-type HPr protein of the phosphotransferase system. Evidence that the antitermination protein LicT is a crucial element for this type of regulation is provided. PMID:8626332

Krüger, S; Gertz, S; Hecker, M

1996-05-01

306

DOC sources and DOC transport pathways in a small headwater catchment as revealed by carbon isotope fluctuation during storm events  

NASA Astrophysics Data System (ADS)

Monitoring the isotopic composition (?13CDOC) of dissolved organic carbon (DOC) during flood events can be helpful for locating DOC sources in catchments and quantifying their relative contribution to stream DOC flux. High-resolution (< hourly basis) ?13CDOC data were obtained during six successive storm events occurring during the high-flow period in a small headwater catchment in western France. Intra-storm ?13CDOC values exhibit a marked temporal variability, with some storms showing large variations (> 2 ‰), and others yielding a very restricted range of values (< 1 ‰). Comparison of these results with previously published data shows that the range of intra-storm ?13CDOC values closely reflects the temporal and spatial variation in ?13CDOC observed in the riparian soils of this catchment during the same period. Using ?13CDOC data in conjunction with hydrometric monitoring and an end-member mixing approach (EMMA), we show that (i) > 80% of the stream DOC flux flows through the most superficial soil horizons of the riparian domain and (ii) the riparian soil DOC flux is comprised of DOC coming ultimately from both riparian and upland domains. Based on its ?13C fingerprint, we find that the upland DOC contribution decreases from ca.~30% of the stream DOC flux at the beginning of the high-flow period to < 10% later in this period. Overall, upland domains contribute significantly to stream DOC export, but act as a size-limited reservoir, whereas soils in the wetland domains act as a near-infinite reservoir. Through this study, we show that ?13CDOC provides a powerful tool for tracing DOC sources and DOC transport mechanisms in headwater catchments, having a high-resolution assessment of temporal and spatial variability.

Lambert, T.; Pierson-Wickmann, A.-C.; Gruau, G.; Jaffrezic, A.; Petitjean, P.; Thibault, J. N.; Jeanneau, L.

2014-06-01

307

Fixational saccades reflect volitional action preparation.  

PubMed

Human volitional actions are preceded by preparatory processes, a critical mental process of cognitive control for future behavior. Volitional action preparation is regulated by large-scale neural circuits including the cerebral cortex and the basal ganglia. Because volitional action preparation is a covert process, the network dynamics of such neural circuits have been examined by neuroimaging and recording event-related potentials. Here, we examined whether such covert processes can be measured by the overt responses of fixational saccades (including microsaccades), the largest miniature eye movements that occur during eye fixation. We analyzed fixational saccades while adult humans maintained fixation on a central visual stimulus as they prepared to generate a volitional saccade in response to peripheral stimulus appearance. We used the antisaccade paradigm, in which subjects generate a saccade toward the opposite direction of a peripheral stimulus. Appropriate antisaccade performance requires the following two aspects of volitional control: 1) facilitation of saccades away from the stimulus and 2) suppression of inappropriate saccades toward the stimulus. We found that fixational saccades that occurred before stimulus appearance reflected the dual preparatory states of saccade facilitation and suppression and correlated with behavioral outcome (i.e., whether subjects succeeded or failed to cancel inappropriate saccades toward the stimulus). Moreover, fixational saccades explained a large proportion of individual differences in behavioral performance (poor/excellent) across subjects. These results suggest that fixational saccades predict the outcome of future volitional actions and may be used as a potential biomarker to detect people with difficulties in volitional action preparation. PMID:23636719

Watanabe, Masayuki; Matsuo, Yuka; Zha, Ling; Munoz, Douglas P; Kobayashi, Yasushi

2013-07-01

308

Fixation Methods for Implantable Port Chamber: Comparative Study Using Glue, Self-stabilizing Leg and Suture Fixations in Rabbits  

PubMed Central

Objective To evaluate the fixation strength and tissue reaction of the glue fixation and self-stabilizing leg fixation methods and to compare the results with those of the conventional tagging suture fixation method. Materials and Methods Twelve healthy rabbits were selected and three different methods of implanting the port chamber were employed on the back of each rabbit. A total of thirty six port chambers were implanted with these three different methods, viz. the glue fixation method using tissue adhesive, the self-stabilizing leg method using a self-expandable stabilizing leg, and the suture fixation method. The fixation strength and the gross and histopathologic changes of each fixation method were evaluated at three days, one week, two weeks and four weeks after port implantation. Results The glue fixation method showed a good fixation strength, which was similar to that of the tagging suture method (p = 0.3486). Five of the six ports (83%) implanted with the glue fixation method which were examined after two weeks showed cracks on the external surface, but this had no adverse effects on their function. A large amount of granulation tissue reaction was found at the bottom of the chamber (p = 0.0025). The fixation with the self-stabilizing leg showed relatively lower fixation strength (p = 0.0043), but no turning-over of the chamber occurred. The fixation strength improved with time after the first week, and minimal granulation tissue reaction was observed with this method. Conclusion The glue fixation method exhibited equal fixation strength compared to the suture fixation, but showed cracking and a large amount of granulation tissue, whereas the fixation with a self-stabilizing leg showed weaker fixation strength. PMID:15637477

Na, Hyoung Il; Kwak, Byung Kook; Kim, Hyeon Joo; Lee, Yong Cheol

2004-01-01

309

The threonine degradation pathway of the Trypanosoma brucei procyclic form: the main carbon source for lipid biosynthesis is under metabolic control  

PubMed Central

The Trypanosoma brucei procyclic form resides within the digestive tract of its insect vector, where it exploits amino acids as carbon sources. Threonine is the amino acid most rapidly consumed by this parasite, however its role is poorly understood. Here, we show that the procyclic trypanosomes grown in rich medium only use glucose and threonine for lipid biosynthesis, with threonine's contribution being ??2.5 times higher than that of glucose. A combination of reverse genetics and NMR analysis of excreted end-products from threonine and glucose metabolism, shows that acetate, which feeds lipid biosynthesis, is also produced primarily from threonine. Interestingly, the first enzymatic step of the threonine degradation pathway, threonine dehydrogenase (TDH, EC 1.1.1.103), is under metabolic control and plays a key role in the rate of catabolism. Indeed, a trypanosome mutant deleted for the phosphoenolpyruvate decarboxylase gene (PEPCK, EC 4.1.1.49) shows a 1.7-fold and twofold decrease of TDH protein level and activity, respectively, associated with a 1.8-fold reduction in threonine-derived acetate production. We conclude that TDH expression is under control and can be downregulated in response to metabolic perturbations, such as in the PEPCK mutant in which the glycolytic metabolic flux was redirected towards acetate production. PMID:23899193

Millerioux, Yoann; Ebikeme, Charles; Biran, Marc; Morand, Pauline; Bouyssou, Guillaume; Vincent, Isabel M; Mazet, Muriel; Riviere, Loïc; Franconi, Jean-Michel; Burchmore, Richard J S; Moreau, Patrick; Barrett, Michael P; Bringaud, Frédéric

2013-01-01

310

Carbon monoxide offers neuroprotection from hippocampal cell damage induced by recurrent febrile seizures through the PERK-activated ER stress pathway.  

PubMed

Carbon monoxide (CO) is neuroprotective in various models of brain injury, but the precise mechanisms for this are yet to be established. In the present study, using a rat model of recurrent febrile seizures (FSs), we found an increase in plasma CO, evidence of neuronal damage and apoptosis, an increase in the expression of the endoplasmic reticulum stress (ERS) marker glucose-regulated protein 78 (GRP78) and C/EBP homologous binding protein (CHOP), and an increase in phosphorylated protein kinase RNA-like endoplasmic reticulum kinase (p-PERK)/eukaryotic translation initiation factor 2 alpha (p-eIF2?) in the hippocampus after 10 FSs. Administration of Hemin (a CO donor) in FS rats alleviated the neuronal damage, reduced neuronal apoptosis, upregulated GRP78 expression, decreased CHOP, and increased p-PERK and p-eIF2? expression in the hippocampus, compared to FS control rats. In contrast, treating FS rats with ZnPP-IX (a CO synthase inhibitor) aggravated the neuronal damage, enhanced neuronal apoptosis, downregulated GRP78 expression, increased CHOP, and decreased p-PERK and p-eIF2? expression, compared to FS control rats. These results suggest that endogenous CO limits the neuronal damage induced by recurrent FSs, through the PERK-activated ERS pathway. PMID:25434873

Han, Ying; Yi, Wenxia; Qin, Jiong; Zhao, Yang; Zhang, Jing; Chang, Xingzhi

2015-01-12

311

The importance of regulation of nitrogen fixation  

NASA Astrophysics Data System (ADS)

I am not a proponent of including more detail in models simply because it makes them more realistic. More complexity increases the difficulty of model interpretation, so it only makes sense to include complexity if its benefit exceeds its costs. Biological nitrogen (N) fixation (BNF) is one process for which I feel the benefits of including greater complexity far outweigh the costs. I don't think that just because I work on BNF; I work on BNF because I think that. BNF, a microbial process carried out by free-living and symbiotic microbes, is the dominant N input to many ecosystems, the primary mechanism by which N deficiency can feed back to N inputs, and a main mechanism by which N surplus can develop. The dynamics of BNF, therefore, have huge implications for the rate of carbon uptake and the extent of CO2 fertilization, as well as N export to waterways and N2O emissions to the atmosphere. Unfortunately, there are serious deficiencies in our understanding of BNF. One main deficiency in our understanding is the extent to which various symbiotic N fixing organisms respond to imbalanced nutrition. Theory suggests that these responses, which I will call "strategies," have fundamental consequences for N fixer niches and ecosystem-level N and C cycling. Organisms that fix N regardless of whether they need it, a strategy that I will call "obligate," occupy post-disturbance niches and rapidly lead to N surplus. On the contrary, organisms that only fix as much N as they need, a "facultative" strategy, can occupy a wider range of successional niches, do not produce surplus N, and respond more rapidly to increased atmospheric CO2. In this talk I will show new results showing that consideration of these strategies could on its own explain the latitudinal distribution of symbiotic N fixing trees in North America. Specifically, the transition in N-fixing tree abundance from ~10% of basal area south of 35° latitude to ~1% of basal area north of 35° latitude that we observe from systematic forest inventory data can be explained by a concomitant switch from predominantly facultative N-fixing trees to predominantly obligate N-fixing trees. This transition in the dominant N-fixing strategy would have important consequences for the rate at which CO2 fertilization can occur and the extent of N surplus in different biomes. These theoretical and forest inventory results suggest that greater knowledge of BNF strategies would greatly increase our understanding of the distribution of N fixers and ecosystem responses to global change. I will finish the talk with a brief literature synthesis that attempts to draw generalizations about BNF strategies. With the limited data available, actinorhizal symbioses in temperate environments appear to be obligate but rhizobial symbioses appear to employ different strategies in different environments. From these results it is unclear whether the strategy is more strongly influenced by the microbes, the plants, or the environments in which the symbiosis has evolved; answering this question would point toward the best ways to incorporate N fixation into global ecosystem models.

Menge, D. N.

2012-12-01

312

Carbon Monoxide Abrogates Ischemic Insult to Neuronal Cells via the Soluble Guanylate Cyclase-cGMP Pathway  

PubMed Central

Purpose Carbon monoxide (CO) is an accepted cytoprotective molecule. The extent and mechanisms of protection in neuronal systems have not been well studied. We hypothesized that delivery of CO via a novel releasing molecule (CORM) would impart neuroprotection in vivo against ischemia-reperfusion injury (IRI)-induced apoptosis of retinal ganglion cells (RGC) and in vitro of neuronal SH-SY5Y-cells via activation of soluble guanylate-cyclase (sGC). Methods To mimic ischemic respiratory arrest, SH-SY5Y-cells were incubated with rotenone (100 nmol/L, 4 h) ± CORM ALF186 (10–100 µmol/L) or inactivated ALF186 lacking the potential of releasing CO. Apoptosis and reactive oxygen species (ROS) production were analyzed using flow-cytometry (Annexin V, mitochondrial membrane potential, CM-H2DCFDA) and Western blot (Caspase-3). The impact of ALF186± respiratory arrest on cell signaling was assessed by measuring expression of nitric oxide synthase (NOS) and soluble guanylate-cyclase (sGC) and by analyzing cellular cGMP levels. The effect of ALF186 (10 mg/kg iv) on retinal IRI in Sprague-Dawley rats was assessed by measuring densities of fluorogold-labeled RGC after IRI and by analysis of apoptosis-related genes in retinal tissue. Results ALF186 but not inactivated ALF186 inhibited rotenone-induced apoptosis (Annexin V positive cells: 25±2% rotenone vs. 14±1% ALF186+rotenone, p<0.001; relative mitochondrial membrane potential: 17±4% rotenone vs. 55±3% ALF186+rotenone, p<0.05). ALF186 increased cellular cGMP levels (33±5 nmol/L vs. 23±3 nmol/L; p<0.05) and sGC expression. sGC-inhibition attenuated ALF186-mediated protection (relative mitochondrial membrane potential: 55±3% ALF186+rotenone vs. 20±1% ODQ+ALF186+rotenone, p<0.05). ALF186 protected RGC in vivo (IRI 1255±327 RGC/mm2 vs. ALF186+IRI 2036±83; p<0.05) while sGC inhibition abolished the protective effects of ALF186 (ALF186+IRI 2036±83 RGC/mm2 vs. NS-2028+ALF186+IRI 1263±170, p<0.05). Conclusions The CORM ALF186 inhibits IRI-induced neuronal cell death via activation of sGC and may be a useful treatment option for acute ischemic insults to the retina and the brain. PMID:23593279

Schallner, Nils; Romão, Carlos C.; Biermann, Julia; Lagrèze, Wolf A.; Otterbein, Leo E.; Buerkle, Hartmut; Loop, Torsten; Goebel, Ulrich

2013-01-01

313

The biodiversity of carbon assimilation.  

PubMed

As all plastids that have been investigated so far can be traced back to endosymbiotic uptake of cyanobacteria by heterotrophic host cells, they accordingly show a high similarity regarding photosynthesis, which includes both the photosystems and the biochemical reactions around the CO2 fixation via the Calvin-Bassham cycle. Major differences between the different algal and plant groups may include the presence or absence of carbon concentrating mechanisms, pyrenoids, Rubisco activases, carbonic anhydrases as well as differences in the regulation of the Calvin-Bassham cycle. This review describes the diversity of primary carbon fixation steps in algae and plants and the respective regulatory mechanisms. PMID:25239594

Kroth, Peter G

2015-01-01

314

Photosynthetic carbon metabolism in photoautotrophic cell suspension cultures grown at low and high CO sub 2  

SciTech Connect

Photosynthetic carbon metabolism was characterized in four photoautotrophic cell suspension cultures. There was no apparent difference between two soybeans (Glycine max) and one cotton (Gossypium hirsutum) cell line which required 5% CO{sub 2} for growth, and a unique cotton cell line that grows at ambient CO{sub 2} (660 microliters per liter). Photosynthetic characteristics in all four lines were more like C{sub 3} mesophyll leaf cells than the cell suspension cultures previously studied. The pattern of {sup 14}C-labeling reflected the high ratio of ribulosebisphosphate carboxylase to phosphoenolpyruvate carboxylase activity and showed that CO{sub 2} fixation occurred primarily by the C{sub 3} pathway. Photorespiration occurred at 330 microliters per liter CO{sub 2}, 21% O{sub 2} as indicated by the synthesis of high levels of {sup 14}C-labeled glycine and serine in a pulse-chase experiment and by oxygen inhibition of CO{sub 2} fixation. Short-term CO{sub 2} fixation in the presence and absence of carbonic anhydrase showed CO{sub 2}, not HCO{sub 3}{sup {minus}}, to be the main source of inorganic carbon taken up by the low CO{sub 2}-requiring cotton cells. The cells did not have a CO{sub 2}-concentrating mechanism as indicated by silicone oil centrifugation experiments. Carbonic anhydrase was absent in the low CO{sub 2}-requiring cotton cells, present in the high CO{sub 2}-requiring soybean cell lines, and absent in other high CO{sub 2} cell lines examined. Thus, the presence of carbonic anhydrase is not an essential requirement for photoautotrophy in cell suspension cultures which grow at either high or low CO{sub 2} concentrations.

Roeske, C.A.; Widholm, J.M. (Univ. of Illinois at Urbana-Champaign (USA)); Ogren, W.L. (Department of Agriculture, Urbana, IL (USA))

1989-12-01

315

Photosynthetic Carbon Metabolism in Photoautotrophic Cell Suspension Cultures Grown at Low and High CO(2).  

PubMed

Photosynthetic carbon metabolism was characterized in four photoautotrophic cell suspension cultures. There was no apparent difference between two soybean (Glycine max) and one cotton (Gossypium hirsutum) cell line which required 5% CO(2) for growth, and a unique cotton cell line that grows at ambient CO(2) (660 microliters per liter). Photosynthetic characteristics in all four lines were more like C(3) mesophyll leaf cells than the cell suspension cultures previously studied. The pattern of (14)C-labeling reflected the high ratio of ribulosebisphosphate carboxylase to phosphoenolpyruvate carboxylase activity and showed that CO(2) fixation occurred primarily by the C(3) pathway. Photorespiration occurred at 330 microliters per liter CO(2), 21% O(2) as indicated by the synthesis of high levels of (14)C-labeled glycine and serine in a pulse-chase experiment and by oxygen inhibition of CO(2) fixation. Short-term CO(2) fixation in the presence and absence of carbonic anhydrase showed CO(2), not HCO(3) (-), to be the main source of inorganic carbon taken up by the low CO(2)-requiring cotton cells. The cells did not have a CO(2)-concentrating mechanism as indicated by silicone oil centrifugation experiments. Carbonic anhydrase was absent in the low CO(2)-requiring cotton cells, present in the high CO(2)-requiring soybean cell lines, and absent in other high CO(2) cell lines examined. Thus, the presence of carbonic anhydrase is not an essential requirement for photoautotrophy in cell suspension cultures which grow at either high or low CO(2) concentrations. PMID:16667210

Roeske, C A; Widholm, J M; Ogren, W L

1989-12-01

316

Pathways and regulation of carbon, sulfur and energy transfer in marine sediments overlying methane gas hydrates on the Opouawe Bank (New Zealand)  

NASA Astrophysics Data System (ADS)

This study combines sediment geochemical analysis, in situ benthic lander deployments and numerical modeling to quantify the biogeochemical cycles of carbon and sulfur and the associated rates of Gibbs energy production at a novel methane seep. The benthic ecosystem is dominated by a dense population of tube-building ampharetid polychaetes and conspicuous microbial mats were unusually absent. A 1D numerical reaction-transport model, which allows for the explicit growth of sulfide and methane oxidizing microorganisms, was tuned to the geochemical data using a fluid advection velocity of 14 cm yr -1. The fluids provide a deep source of dissolved hydrogen sulfide and methane to the sediment with fluxes equal to 4.1 and 18.2 mmol m -2 d -1, respectively. Chemosynthetic biomass production in the subsurface sediment is estimated to be 2.8 mmol m -2 d -1 of C biomass. However, carbon and oxygen budgets indicate that chemosynthetic organisms living directly above or on the surface sediment have the potential to produce 12.3 mmol m -2 d -1 of C biomass. This autochthonous carbon source meets the ampharetid respiratory carbon demand of 23.2 mmol m -2 d -1 to within a factor of 2. By contrast, the contribution of photosynthetically-fixed carbon sources to ampharetid nutrition is minor (3.3 mmol m -2 d -1 of C). The data strongly suggest that mixing of labile autochthonous microbial detritus below the oxic layer sustains high measured rates of sulfate reduction in the uppermost 2 cm of the sulfidic sediment (100-200 nmol cm -3 d -1). Similar rates have been reported in the literature for other seeps, from which we conclude that autochthonous organic matter is an important substrate for sulfate reducing bacteria in these sediment layers. A system-scale energy budget based on the chemosynthetic reaction pathways reveals that up to 8.3 kJ m -2 d -1 or 96 mW m -2 of catabolic (Gibbs) energy is dissipated at the seep through oxidation reactions. The microorganisms mediating sulfide oxidation and anaerobic oxidation of methane (AOM) produce 95% and 2% of this energy flux, respectively. The low power output by AOM is due to strong bioenergetic constraints imposed on the reaction rate by the composition of the chemical environment. These constraints provide a high potential for dissolved methane efflux from the sediment (12.0 mmol m -2 d -1) and indicates a much lower efficiency of (dissolved) methane sequestration by AOM at seeps than considered previously. Nonetheless, AOM is able to consume a third of the ascending methane flux (5.9 mmol m -2 d -1 of CH 4) with a high efficiency of energy expenditure (35 mmol CH 4 kJ -1). It is further proposed that bioenergetic limitation of AOM provides an explanation for the non-zero sulfate concentrations below the AOM zone observed here and in other active and passive margin sediments.

Dale, A. W.; Sommer, S.; Haeckel, M.; Wallmann, K.; Linke, P.; Wegener, G.; Pfannkuche, O.

2010-10-01

317

Internal fracture fixation in patients with osteoporosis.  

PubMed

Because of the decreased holding power of plate-and-screw fixation in osteoporotic bone fractures, internal fixation can have a high failure rate, ranging from 10% to 25%. Screws placed into cortical bone have better resistance to pullout than do those placed into adjacent trabecular bone. Plates should not be used to bridge unstable regions of bony comminution in osteoporotic patients. Fixation stability is optimized by securing stable bone contact across the fracture site and by placing screws both as close to and as far from the fracture as possible. Intentional shortening can improve stability and load sharing of the fracture construct. Structural bone graft or other types of fillers can be used to fill voids when comminution prevents stable contact. Load-sharing fixation devices such as the sliding hip screw, intramedullary nail, antiglide plate, and tension band constructs are better alternatives for osteoporotic metaphyseal locations. Proper planning is essential for improved fracture fixation in this high-risk patient group. PMID:12670137

Cornell, Charles N

2003-01-01

318

The Fixation and Saccade P3  

PubMed Central

Although most instances of object recognition during natural viewing occur in the presence of saccades, the neural correlates of objection recognition have almost exclusively been examined during fixation. Recent studies have indicated that there are post-saccadic modulations of neural activity immediately following eye movement landing; however, whether post-saccadic modulations affect relatively late occurring cognitive components such as the P3 has not been explored. The P3 as conventionally measured at fixation is commonly used in brain computer interfaces, hence characterizing the post-saccadic P3 could aid in the development of improved brain computer interfaces that allow for eye movements. In this study, the P3 observed after saccadic landing was compared to the P3 measured at fixation. No significant differences in P3 start time, temporal persistence, or amplitude were found between fixation and saccade trials. Importantly, sensory neural responses canceled in the target minus distracter comparisons used to identify the P3. Our results indicate that relatively late occurring cognitive neural components such as the P3 are likely less sensitive to post saccadic modulations than sensory neural components and other neural activity occurring shortly after eye movement landing. Furthermore, due to the similarity of the fixation and saccade P3, we conclude that the P3 following saccadic landing could possibly be used as a viable signal in brain computer interfaces allowing for eye movements. PMID:23144959

Dandekar, Sangita; Ding, Jian; Privitera, Claudio; Carney, Thom; Klein, Stanley A.

2012-01-01

319

Chemical and physical basics of routine formaldehyde fixation  

PubMed Central

Formaldehyde is the widely employed fixative that has been studied for decades. The chemistry of fixation has been studied widely since the early 20th century. However, very few studies have been focused on the actual physics/chemistry aspect of process of this fixation. This article attempts to explain the chemistry of formaldehyde fixation and also to study the physical aspects involved in the fixation. The factors involved in the fixation process are discussed using well documented mathematical and physical formulae. The deeper understanding of these factors will enable pathologist to optimize the factors and use them in their favor. PMID:23248474

Thavarajah, Rooban; Mudimbaimannar, Vidya Kazhiyur; Elizabeth, Joshua; Rao, Umadevi Krishnamohan; Ranganathan, Kannan

2012-01-01

320

Molecular Basis of Microbial One-Carbon Metabolism 2008 Gordon Research Conference (July 20-25, 2008)  

SciTech Connect

One-carbon (C-1) compounds play a central role in microbial metabolism. C-1 compounds include methane, carbon monoxide, CO2, and methanol as well as coenzyme-bound one-carbon compounds (methyl-B12, CH3-H4folate, etc). Such compounds are of broad global importance because several C-1 compounds (e.g., CH4) are important energy sources, some (e.g., CO2 and CH4) are potent greenhouse gases, and others (e.g., CH2Cl2) are xenobiotics. They are central in pathways of energy metabolism and carbon fixation by microbes and many are of industrial interest. Research on the pathways of one-carbon metabolism has added greatly to our understanding of evolution, structural biology, enzyme mechanisms, gene regulation, ecology, and applied biology. The 2008 meeting will include recent important findings in the following areas: (a) genomics, metagenomics, and proteomic studies that have expanded our understanding of autotrophy and C-1 metabolism and the evolution of these pathways; (b) redox regulation of carbon cycles and the interrelationship between the carbon cycle and other biogeochemical cycles (sulfur, nitrogen, oxygen); (c) novel pathways for carbon assimilation; (d) biotechnology related to C-1 metabolism; (e) novel enzyme mechanisms including channeling of C-1 intermediates during metabolism; and (f) the relationship between metal homeostasis and the global carbon cycle. The conference has a diverse and gender-balanced slate of speakers and session leaders. The wide variety of disciplines brought to the study of C-1 metabolism make the field an excellent one in which to train young researchers.

Stephen W. Ragsdale

2009-08-12

321

A global proteome study of Mycobacterium gilvum PYR-GCK grown on pyrene and glucose reveals the activation of glyoxylate, shikimate and gluconeogenetic pathways through the central carbon metabolism highway.  

PubMed

Various hydrocarbons have been released into the environment as a result of industrialization. An effective way of removing these materials without further environmental contamination is microbial bioremediation. Mycobacterium gilvum PYR-GCK, a bacteria isolated from a PAH polluted estuary, was studied using comparative shotgun proteomics to gain insight on its molecular activity while using pyrene and glucose as sole carbon and energy sources. Based on annotated genomic information, a confirmation analysis was first performed to confirm its pyrene degradation activity, using gas chromatography-mass spectrometry technology. One dimensional gel electrophoresis and liquid chromatography-mass spectrometry technologies employed in the proteomics analysis revealed the expression of pyrene degrading gene products along with upregulated expression of proteins functioning in the glyoxylate and shikimate pathways, in the pyrene-induced cells. The study also revealed the pathway of pyrene degraded intermediates, via partial gluconeogenesis, into the pentose phosphate pathway to produce precursors for nucleotides and amino acids biosynthesis. PMID:23361126

Badejo, Abimbola Comfort; Choi, Chi-Won; Badejo, Adegoke Olugboyega; Shin, Kyung-Hoon; Hyun, Jung-Ho; Lee, Yeol-Gyun; Kim, Seung-Il; Park, Kang-Sik; Kim, Sang Hoon; Jung, Kyoung Hwa; Chung, Young-Ho; Chai, Young Gyu

2013-11-01

322

Wire-free fixation of jaw fractures.  

PubMed

Stainless steel wire is often used in the management of jaw fractures to provide intraoperative or postoperative intermaxillary fixation (IMF). Wiring of the jaws is time-consuming, a second procedure is needed to remove it, and needlestick injuries occur during placement. We report on 151 consecutive patients who had wire-free fixation of jaw fractures, and outline the value of a system of plastic anchorage points applied to individual teeth in both jaws that allows for wire-free IMF when they are linked by elastics (Rapid IMF, Synthes, PA, USA). A total of 150 successive patients had wire-free fixation of 146 mandibular and 5 maxillary fractures. Ninety-eight were hand-held in occlusion, and 52 were treated using Rapid IMF. There were few complications. PMID:19608310

Cousin, G C S

2009-10-01

323

Biometric recognition via fixation density maps  

NASA Astrophysics Data System (ADS)

This work introduces and evaluates a novel eye movement-driven biometric approach that employs eye fixation density maps for person identification. The proposed feature offers a dynamic representation of the biometric identity, storing rich information regarding the behavioral and physical eye movement characteristics of the individuals. The innate ability of fixation density maps to capture the spatial layout of the eye movements in conjunction with their probabilistic nature makes them a particularly suitable option as an eye movement biometrical trait in cases when free-viewing stimuli is presented. In order to demonstrate the effectiveness of the proposed approach, the method is evaluated on three different datasets containing a wide gamut of stimuli types, such as static images, video and text segments. The obtained results indicate a minimum EER (Equal Error Rate) of 18.3 %, revealing the perspectives on the utilization of fixation density maps as an enhancing biometrical cue during identification scenarios in dynamic visual environments.

Rigas, Ioannis; Komogortsev, Oleg V.

2014-05-01

324

Antimicrobial activity of UMFix tissue fixative  

PubMed Central

Aims: The aim of this study was to determine the antimicrobial effects of UMFix, an alcohol based tissue fixative, on various microorganisms. The UMFix solution was compared with 10% neutral buffered formalin. Methods: Standard methods to determine microorganism colony counts were performed after exposure of the microorganisms to UMFix and 10% neutral buffered formalin. Results: After a short exposure, UMFix rapidly killed vegetative bacteria, yeasts, moulds, and viruses. Bacterial spores were resistant to killing by UMFix. All organisms were killed by the 10% neutral buffered formalin preparation. Conclusions: UMFix was microbicidal for vegetative bacteria, yeasts, and aspergillus species after a short exposure, although it was not active against spore forming bacillus species. The methanol content of the fixative was responsible for the killing effect of this fixative. No killing was seen when polyethylene glycol was used alone. PMID:15623477

Cleary, T J; Morales, A R; Nadji, M; Nassiri, M; Vincek, V

2005-01-01

325

External fixation and limited internal fixation for complex fractures of the tibial plateau.  

PubMed

Twenty-one complex fractures of the tibial plateau in twenty patients were treated with closed reduction, interfragmental screw fixation of the articular fragments, and application of a unilateral half-pin external fixator. The average duration of external fixation was twelve weeks (range, three to twenty weeks). The fixator was left in situ until the fracture had united in all but two patients. All of the fractures healed. The complications with this technique were attributable primarily to the proximal half-pins of the external fixator. Seven patients needed antibiotics for an infection at a pin site, and two had septic arthritis that necessitated arthrotomy and débridement. The average duration of follow-up was thirty-eight months. The range of motion of nineteen of the twenty-one knees was at least a 115-degree arc. Laxity was evident in seven knees, but no patient complained of instability of the knee. Radiographs showed malalignment of more than 6 degrees in three knees compared with the normal, contralateral knee and evidence of post-traumatic osteoarthrosis in five knees. The Iowa knee score, determined for nineteen patients, averaged 87 points (range, 55 to 100 points). The SF-36 general health survey demonstrated that most patients had function close to that of age-matched controls. We concluded that external fixation with limited internal fixation is a satisfactory technique for the treatment of selected complex fractures of the tibial plateau. PMID:7744891

Marsh, J L; Smith, S T; Do, T T

1995-05-01

326

Physical forcing of nitrogen fixation and diazotroph community structure in the North Pacific subtropical gyre  

NASA Astrophysics Data System (ADS)

Dinitrogen (N2) fixing microorganisms (termed diazotrophs) exert important control on the ocean carbon cycle. However, despite increased awareness on the roles of these microorganisms in ocean biogeochemistry and ecology, the processes controlling variability in diazotroph distributions, abundances, and activities remain largely unknown. In this study, we examine 3 years (2004-2007) of approximately monthly measurements of upper ocean diazotroph community structure and rates of N2 fixation at Station ALOHA (22°45'N, 158°W), the field site for the Hawaii Ocean Time-series program in the central North Pacific subtropical gyre (NPSG). The structure of the N2-fixing microorganism assemblage varied widely in time with unicellular N2-fixing microorganisms frequently dominating diazotroph abundances in the late winter and early spring, while filamentous microorganisms (specifically various heterocyst-forming cyanobacteria and Trichodesmium spp.) fluctuated episodically during the summer. On average, a large fraction (˜80%) of the daily N2 fixation was partitioned into the biomass of <10 ?m microorganisms. Rates of N2 fixation were variable in time, with peak N2 fixation frequently coinciding with periods when heterocystous N2-fixing cyanobacteria were abundant. During the summer months when sea surface temperatures exceeded 25.2°C and concentrations of nitrate plus nitrite were at their annual minimum, rates of N2 fixation often increased during periods of positive sea surface height anomalies, as reflected in satellite altimetry. Our results suggest mesoscale physical forcing may comprise an important control on variability in N2 fixation and diazotroph community structure in the NPSG.

Church, Matthew J.; Mahaffey, Claire; Letelier, Ricardo M.; Lukas, Roger; Zehr, Jonathan P.; Karl, David M.

2009-06-01

327

Effects of Fixational Eye Movements on Retinal Ganglion Cell Responses: A Modelling Study  

PubMed Central

Visual response properties of retinal ganglion cells (GCs), the retinal output neurons, are shaped by numerous processes and interactions within the retina. In particular, amacrine cells are known to form microcircuits that affect GC responses in specific ways. So far, relatively little is known about the influence of retinal processing on GC responses under naturalistic viewing conditions, in particular in the presence of fixational eye movements. Here we used a detailed model of the mammalian retina to investigate possible effects of fixational eye movements on retinal GC activity. Populations of linear, sustained (parvocellular, PC) and nonlinear, transient (magnocellular, MC) GCs were simulated during fixation of a star-shaped stimulus, and two distinct effects were found: (1) a fading of complete wedges of the star and (2) an apparent splitting of stimulus lines. Both effects only occur in MC-cells, and an analysis shows that fading is caused by an expression of the aperture problem in retinal GCs, and the splitting effect by spatiotemporal nonlinearities in the MC-cell receptive field. These effects strongly resemble perceived instabilities during fixation of the same stimulus, and we propose that these illusions may have a retinal origin. We further suggest that in this case two parallel retinal streams send conflicting, rather than complementary, information to the higher visual system, which here leads to a dominant influence of the MC pathway. Similar situations may be common during natural vision, since retinal processing involves numerous nonlinearities. PMID:18946524

Hennig, Matthias H.; Wörgötter, Florentin

2007-01-01

328

Spatially robust estimates of biological nitrogen (N) fixation imply substantial human alteration of the  

E-print Network

cluster sampling | free-living nitrogen fixation | nitrogen deposition | symbiotic nitrogen fixation OverSpatially robust estimates of biological nitrogen (N) fixation imply substantial human alteration, 2013) Biological nitrogen fixation (BNF) is the largest natural source of exogenous nitrogen (N

Cleveland, Cory

329

Fixation of tibial components of knee prostheses.  

PubMed

Twelve different tibial components were compared for fixation. The components included compartmental, anteriorly joined, posterior-cruciate retaining, and one-place with one, two, or three fixation posts; all-plastic or with a metal tray. The apparatus applied compressive load with anterior-posterior force, rotational torque, or varus-valgus moment. The relative deflections, both compressive and distractive, were measured between the component and the bone. The least deflections occurred with one-piece metal-tray components with one or two posts and with one-piece plastic components with a post on each side. Compartmental components deflected the most. PMID:7462283

Walker, P S; Greene, D; Reilly, D; Thatcher, J; Ben-Dov, M; Ewald, F C

1981-02-01

330

A mechanistic, globally-applicable model of plant nitrogen uptake, retranslocation and fixation  

NASA Astrophysics Data System (ADS)

Nitrogen is one of the nutrients that can most limit plant growth, and nitrogen availability may be a controlling factor on biosphere responses to climate change. We developed a plant nitrogen assimilation model based on a) advective transport through the transpiration stream, b) retranslocation whereby carbon is expended to resorb nitrogen from leaves, c) active uptake whereby carbon is expended to acquire soil nitrogen, and d) biological nitrogen fixation whereby carbon is expended for symbiotic nitrogen fixers. The model relies on 9 inputs: 1) net primary productivity (NPP), 2) plant C:N ratio, 3) available soil nitrogen, 4) root biomass, 5) transpiration rate, 6) saturated soil depth,7) leaf nitrogen before senescence, 8) soil temperature, and 9) ability to fix nitrogen. A carbon cost of retranslocation is estimated based on leaf nitrogen and compared to an active uptake carbon cost based on root biomass and available soil nitrogen; for nitrogen fixers both costs are compared to a carbon cost of fixation dependent on soil temperature. The NPP is then allocated to optimize growth while maintaining the C:N ratio. The model outputs are total plant nitrogen uptake, remaining NPP available for growth, carbon respired to the soil and updated available soil nitrogen content. We test and validate the model (called FUN: Fixation and Uptake of Nitrogen) against data from the UK, Germany and Peru, and run the model under simplified scenarios of primary succession and climate change. FUN is suitable for incorporation into a land surface scheme of a General Circulation Model and will be coupled with a soil model and dynamic global vegetation model as part of a land surface model (JULES).

Fisher, J. B.; Tan, S.; Malhi, Y.; Fisher, R. A.; Sitch, S.; Huntingford, C.

2008-12-01

331

Unfamiliar metabolic links in the central carbon metabolism.  

PubMed

The central carbon metabolism of all organisms is considered to follow a well established fixed scheme. However, recent studies of autotrophic carbon fixation in prokaryotes revealed unfamiliar metabolic links. A new route interconnects acetyl-coenzyme A (CoA) via 3-hydroxypropionate with succinyl-CoA. Succinyl-CoA in turn may be metabolized via 4-hydroxybutyrate to two molecules of acetyl-CoA; a reversal of this route would result in the assimilation of two molecules of acetyl-CoA into C4 compounds. C5-dicarboxylic acids are a rather neglected class of metabolites; yet, they play a key role not only in one of the CO2 fixation cycles, but also in two acetate assimilation pathways that replace the glyoxylate cycle. C5 compounds such as ethylmalonate, methylsuccinate, methylmalate, mesaconate, itaconate and citramalate or their CoA esters are thereby linked to the acetyl-CoA, propionyl-CoA, glyoxylate and pyruvate pools. A novel carboxylase/reductase converts crotonyl-CoA into ethylmalonyl-CoA; similar reductive carboxylations apply to other alpha-beta-unsaturated carboxy-CoA thioesters. These unfamiliar metabolic links may provide useful tools for metabolic engineering. PMID:24576434

Fuchs, Georg; Berg, Ivan A

2014-12-20

332

Biochemistry and physiology of nitrogen fixation with particular emphasis on nitrogen-fixing phototrophs  

Microsoft Academic Search

Summary  This paper presents an overview of aspects of N2-fixation in phototrophic N2-fixers. Nitrogenase is little different in phototrophs from other organisms. Evidence suggests that fixed carbon dissimilation rather than direct photoreduction from oxidised inorganic compounds or exogenous photosynthetic electron donors is the major route of reductant supply to nitrogenase in phototrophs; inRhodospirillum rubrum pyruvate is a possible electron donor to

W. D. P. Stewart; P. Rowell

1986-01-01

333

Renewable Hydrogen Carrier Carbohydrate: Constructing the Carbon-Neutral Carbohydrate Economy  

SciTech Connect

Abstract The hydrogen economy presents an appealing energy future but its implementation must solve numerous problems ranging from low-cost sustainable production, high-density storage, costly infrastructure, to eliminating safety concern. The use of renewable carbohydrate as a high-density hydrogen carrier and energy source for hydrogen production is possible due to emerging cell-free synthetic biology technology called cell-free synthetic pathway biotransformation (SyPaB). Assembly of numerous enzymes and co-enzymes in vitro can create complicated set of biological reactions or pathways that microorganisms cannot complete, for example, C6H10O5 (aq) + 7 H2O (l) 12 H2 (g) + 6 CO2 (g) (PLoS One 2007, 2:e456). Thanks to 100% selectivity of enzymes, modest reaction conditions, and high-purity of generated hydrogen, carbohydrate is a promising hydrogen carrier for end users. Gravimetric density of carbohydrate is 14.8 H2 mass% if water can be recycled from PEM fuel cells or 8.33% H2 mass% without water recycling. Renewable carbohydrate can be isolated from plant biomass or would be produced from a combination of solar electricity/hydrogen and carbon dioxide fixation mediated by high-efficiency artificial photosynthesis mediated by SyPaB. The construction of this carbon-neutral carbohydrate economy would address numerous sustainability challenges, such as electricity and hydrogen storage, CO2 fixation and long-term storage, water conservation, transportation fuel production, plus feed and food production.

Zhang, Y.-H. Percival [Virginia Polytechnic Institute and State University (Virginia Tech); Mielenz, Jonathan R [ORNL

2011-01-01

334

Aerobic nitrogen fixation by the marine non-heterocystous cyanobacterium Trichodesmium (Oscillatoria) spp.: Its protective mechanism against oxygen  

Microsoft Academic Search

Nitrogen fixation (acetylene reduction) by the marine non-heterocystous cyanobacteria, Trichodesmium thiebautii and T. erythraeum, is sensitive to oxygen. Its sensitivity to oxygen was intensified when the colonies of T. thiebautii were disintegrated, but the separate trichomes yielded still retained the capacity for light dependent acetylene reduction. Trichodesmium colonies evolved hydrogen under argon in the light. The addition of carbon monoxide

T. Saino; A. Hattori

1982-01-01

335

Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change  

PubMed Central

Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of “new” nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review. PMID:24967086

Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

2014-01-01

336

Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change.  

PubMed

Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of "new" nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review. PMID:24967086

Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

2014-05-01

337

Drivers of increased organic carbon concentrations in stream water following forest disturbance: Separating effects of changes in flow pathways and soil warming  

NASA Astrophysics Data System (ADS)

disturbance such as clear-cutting has been identified as an important factor for increasing dissolved organic carbon (DOC) concentrations in boreal streams. We used a long-term data set of soil temperature, soil moisture, shallow groundwater (GW) levels, and stream DOC concentrations from three boreal first-order streams to investigate mechanisms causing these increases. Clear-cutting was found to alter soil conditions with warmer and wetter soils during summer. The application of a riparian flow concentration integration model (RIM) explained a major part of variation in stream [DOC] arising from changing flow pathways in riparian soils during the pretreatment period (r2 = 0.4-0.7), but less well after the harvest. Model residuals were sensitive to changes in soil temperature. The linear regression models for the temperature dependence of [DOC] in soils were not different in the disturbed and undisturbed catchments, whereas a nonlinear response to soil moisture was found. Overall these results suggest that the increased DOC mobilization after forest disturbance is caused by (i) increased GW levels leading to increased water fluxes in shallow flow path in riparian soils and (ii) increased soil temperature increasing the DOC availability in soils during summer. These relationships indicate that the mechanisms of DOC mobilization after forest disturbance are not different to those of undisturbed catchments, but that catchment soils respond to the higher hydro-climatic variation observed after clear-cutting. This highlights the sensitivity of boreal streams to changes in the energy and water balance, which may be altered as a result of both land management and climate change.

Schelker, J.; Grabs, T.; Bishop, K.; Laudon, H.

2013-12-01

338

Using an explicit emission tagging method in global modeling of source-receptor relationships for black carbon in the Arctic: Variations, sources, and transport pathways  

NASA Astrophysics Data System (ADS)

introduce an explicit emission tagging technique in the Community Atmosphere Model to quantify source-region-resolved characteristics of black carbon (BC), focusing on the Arctic. Explicit tagging of BC source regions without perturbing the emissions provides a physically consistent and computationally efficient approach to establish source-receptor relationships and transport pathways. Our analysis shows that the contributions of major source regions to the global BC burden are not proportional to the respective emissions due to strong region-dependent removal rates and lifetimes, while the contributions to BC direct radiative forcing show a near-linear dependence on their respective contributions to the burden. Arctic BC concentrations, deposition, and source contributions all have strong seasonal variations. Eastern Asia contributes the most to the wintertime Arctic BC burden, but has much less impact on lower-level concentrations and deposition. Northern Europe emissions are more important to both surface concentration and deposition in winter than in summer. The largest contribution to Arctic BC in the summer is from Northern Asia. Although local emissions contribute less than 10% to the annual mean BC burden and deposition within the Arctic, the per-emission efficiency is much higher than for non-Arctic sources. The interannual variability (1996-2005) due to meteorology is small in annual mean BC burden and radiative forcing but is significant in yearly seasonal means over the Arctic. When a slow aging treatment of BC is introduced, the increase of BC lifetime and burden is source dependent. Global BC forcing-per-burden efficiency also increases primarily due to changes in BC vertical distributions.

Wang, Hailong; Rasch, Philip J.; Easter, Richard C.; Singh, Balwinder; Zhang, Rudong; Ma, Po-Lun; Qian, Yun; Ghan, Steven J.; Beagley, Nathaniel

2014-11-01

339

Unfixing Design Fixation: From Cause to Computer Simulation  

ERIC Educational Resources Information Center

This paper argues that design fixation, in part, entails fixation at the level of meta-representation, the representation of the relation between a representation and its reference. In this paper, we present a mathematical model that mimics the idea of how fixation can occur at the meta-representation level. In this model, new abstract concepts…

Dong, Andy; Sarkar, Somwrita

2011-01-01

340

Original article Nitrogen fixation by Trifolium repens and Lotus  

E-print Network

Original article Nitrogen fixation by Trifolium repens and Lotus tenuis-based pastures. (© Inra/ Elsevier, Paris.) N2fixation / Lotus tenuis / Trifolium repens / Festuca arundinacea / continuous grazing Résumé - Fixation d'azote par des prairies à base de Trifolium repens ou Lotus tenuis de

Paris-Sud XI, Université de

341

Functional Ecology of Free-Living Nitrogen Fixation  

E-print Network

Functional Ecology of Free-Living Nitrogen Fixation: A Contemporary Perspective Sasha C. Reed,1;1. INTRODUCTION Nitrogen (N) is essential to all life, and a single process--biological N2 fixation--is thought fixation that does not consist of a demarcated symbiotic relationship between plants and microorganisms

Cleveland, Cory

342

Probability of fixation and evolution of cooperation  

E-print Network

of cooperation Sabin Lessard Universit´e de Montr´eal 1. Examples of cooperation 2. Prisoner's Dilemma 3. Evolutionary dynamics in an infinite population 4. Probability of fixation in a finite population 5. Generalized one-third law 6. Projected average allelic effect 7. Effect of population structure 8. Variants

Lessard, Sabin

343

Titanium alloys for fracture fixation implants  

Microsoft Academic Search

This paper is intended to provide an overview of the composition, mechanical properties, biocompatibility, and clinical applications for titanium alloys that are used for fracture fixation implants. A new class of titanium implant alloys has emerged in recent years that exhibits a ? microstructure and a unique combination of mechanical properties. Important information regarding notch sensitivity testing and clinical significance

J. A. Disegi

2000-01-01

344

Foveated analysis of image features at fixations.  

PubMed

Analysis of the statistics of image features at observers' gaze can provide insights into the mechanisms of fixation selection in humans. Using a foveated analysis framework, in which image patches were analyzed at the resolution corresponding to their eccentricity from the prior fixation, we studied the statistics of four low-level local image features: luminance, RMS contrast, and bandpass outputs of both luminance and contrast, and discovered that the image patches around human fixations had, on average, higher values of each of these features at all eccentricities than the image patches selected at random. Bandpass contrast showed the greatest difference between human and random fixations, followed by bandpass luminance, RMS contrast, and luminance. An eccentricity-based analysis showed that shorter saccades were more likely to land on patches with higher values of these features. Compared to a full-resolution analysis, foveation produced an increased difference between human and random patch ensembles for contrast and its higher-order statistics. PMID:17889221

Rajashekar, Umesh; van der Linde, Ian; Bovik, Alan C; Cormack, Lawrence K

2007-11-01

345

Biomechanical evaluation of rotator cuff fixation methods  

Microsoft Academic Search

Initial fixation strength and failure mode for various rotator cuff reattachment techniques (variations of the McLaughlin technique) were evaluated. Repair methods included standard suture (control), reinforced suture [expanded polytetrafluoroethylene (PTFE) patch and polydioxanone (PDS) tape augmentation] and stapling (nonarthroscopic and arthroscopic soft-tissue staples). The average strength of intact rotator cuff tissue (su praspinatus tendon) was also determined. The different rotator

E. Paul France; Lonnie E. Paulos; Chris D. Harner; Chris B. Straight

1989-01-01

346

Methods for enhancing symbiotic nitrogen fixation  

Microsoft Academic Search

Biological nitrogen fixation of leguminous crops is becoming increasingly important in attempts to develop sustainable agricultural production. However, these crops are quite variable in their effectiveness in fixing nitrogen. By the use of the 15N isotope dilution method some species have been found to fix large proportions of their nitrogen, while others like common bean have been considered rather inefficient.

Gudni Hardarson

1993-01-01

347

Cloned nodulin genes for symbiotic nitrogen fixation  

Microsoft Academic Search

plant genes encoding nodule-specific proteins (nodulins) are expressed only after the infection of the legume plant with Rhizobium and their expression occurs prior to and independent of the commencement of nitrogen fixation in nodules. Nodulins appear to play three major roles: they participate in the morphogenesis of the nodule including the formation of the endosymbiotic compartment; they are involved in

Ashton J. Delauney; Desh Pal S. Verma

1988-01-01

348

Molybdenum and Sulphur in Symbiotic Nitrogen Fixation  

Microsoft Academic Search

NITRATE accumulation due to ineffective nitrate utilization may occur in plants in cases of deficiencies of either molybdenum1-3 or of sulphur4, 5. Though high in nitrogen, such affected plants show symptoms of nitrogen deficiency. It has also been suggested that the effect of molybdenum on legumes is due to its influence in the actual process of symbiotic nitrogen fixation rather

A. J. Anderson; D. Spencer

1949-01-01

349

Genomics insights into symbiotic nitrogen fixation  

Microsoft Academic Search

Following an interaction with rhizobial soil bacteria, legume plants are able to form a novel organ, termed the root nodule. This organ houses the rhizobial microsymbionts, which perform the biological nitrogen fixation process resulting in the incorporation of ammonia into plant organic molecules. Recent advances in genomics have opened exciting new perspectives in this field by providing the complete gene

Stefan Weidner; Alfred Pühler; Helge Küster

2003-01-01

350

Antimicrobial activity of UMFix tissue fixative  

Microsoft Academic Search

Aims: The aim of this study was to determine the antimicrobial effects of UMFix, an alcohol based tissue fixative, on various microorganisms. The UMFix solution was compared with 10% neutral buffered formalin.Methods: Standard methods to determine microorganism colony counts were performed after exposure of the microorganisms to UMFix and 10% neutral buffered formalin.Results: After a short exposure, UMFix rapidly killed

T J Cleary; A R Morales; M Nadji; M Nassiri; V Vincek

2005-01-01

351

Environmental forcing of nitrogen fixation in the eastern tropical and sub-tropical North Atlantic Ocean.  

PubMed

During the winter of 2006 we measured nifH gene abundances, dinitrogen (N(2)) fixation rates and carbon fixation rates in the eastern tropical and sub-tropical North Atlantic Ocean. The dominant diazotrophic phylotypes were filamentous cyanobacteria, which may include Trichodesmium and Katagnymene, with up to 10(6) L(-1)nifH gene copies, unicellular group A cyanobacteria with up to 10(5) L(-1)nifH gene copies and gamma A proteobacteria with up to 10(4) L(-1)nifH gene copies. N(2) fixation rates were low and ranged between 0.032-1.28 nmol N L(-1) d(-1) with a mean of 0.30 ± 0.29 nmol N L(-1) d(-1) (1?, n = 65). CO(2)-fixation rates, representing primary production, appeared to be nitrogen limited as suggested by low dissolved inorganic nitrogen to phosphate ratios (DIN:DIP) of about 2 ± 3.2 in surface waters. Nevertheless, N(2) fixation rates contributed only 0.55 ± 0.87% (range 0.03-5.24%) of the N required for primary production. Boosted regression trees analysis (BRT) showed that the distribution of the gamma A proteobacteria and filamentous cyanobacteria nifH genes was mainly predicted by the distribution of Prochlorococcus, Synechococcus, picoeukaryotes and heterotrophic bacteria. In addition, BRT indicated that multiple a-biotic environmental variables including nutrients DIN, dissolved organic nitrogen (DON) and DIP, trace metals like dissolved aluminum (DAl), as a proxy of dust inputs, dissolved iron (DFe) and Fe-binding ligands as well as oxygen and temperature influenced N(2) fixation rates and the distribution of the dominant diazotrophic phylotypes. Our results suggest that lower predicted oxygen concentrations and higher temperatures due to climate warming may increase N(2) fixation rates. However, the balance between a decreased supply of DIP and DFe from deep waters as a result of more pronounced stratification and an enhanced supply of these nutrients with a predicted increase in deposition of Saharan dust may ultimately determine the consequences of climate warming for N(2) fixation in the North Atlantic. PMID:22174940

Rijkenberg, Micha J A; Langlois, Rebecca J; Mills, Matthew M; Patey, Matthew D; Hill, Polly G; Nielsdóttir, Maria C; Compton, Tanya J; Laroche, Julie; Achterberg, Eric P

2011-01-01

352

Environmental Forcing of Nitrogen Fixation in the Eastern Tropical and Sub-Tropical North Atlantic Ocean  

PubMed Central

During the winter of 2006 we measured nifH gene abundances, dinitrogen (N2) fixation rates and carbon fixation rates in the eastern tropical and sub-tropical North Atlantic Ocean. The dominant diazotrophic phylotypes were filamentous cyanobacteria, which may include Trichodesmium and Katagnymene, with up to 106 L?1 nifH gene copies, unicellular group A cyanobacteria with up to 105 L?1 nifH gene copies and gamma A proteobacteria with up to 104 L?1 nifH gene copies. N2 fixation rates were low and ranged between 0.032–1.28 nmol N L?1 d?1 with a mean of 0.30±0.29 nmol N L?1 d?1 (1?, n?=?65). CO2-fixation rates, representing primary production, appeared to be nitrogen limited as suggested by low dissolved inorganic nitrogen to phosphate ratios (DIN:DIP) of about 2±3.2 in surface waters. Nevertheless, N2 fixation rates contributed only 0.55±0.87% (range 0.03–5.24%) of the N required for primary production. Boosted regression trees analysis (BRT) showed that the distribution of the gamma A proteobacteria and filamentous cyanobacteria nifH genes was mainly predicted by the distribution of Prochlorococcus, Synechococcus, picoeukaryotes and heterotrophic bacteria. In addition, BRT indicated that multiple a-biotic environmental variables including nutrients DIN, dissolved organic nitrogen (DON) and DIP, trace metals like dissolved aluminum (DAl), as a proxy of dust inputs, dissolved iron (DFe) and Fe-binding ligands as well as oxygen and temperature influenced N2 fixation rates and the distribution of the dominant diazotrophic phylotypes. Our results suggest that lower predicted oxygen concentrations and higher temperatures due to climate warming may increase N2 fixation rates. However, the balance between a decreased supply of DIP and DFe from deep waters as a result of more pronounced stratification and an enhanced supply of these nutrients with a predicted increase in deposition of Saharan dust may ultimately determine the consequences of climate warming for N2 fixation in the North Atlantic. PMID:22174940

Rijkenberg, Micha J. A.; Langlois, Rebecca J.; Mills, Matthew M.; Patey, Matthew D.; Hill, Polly G.; Nielsdóttir, Maria C.; Compton, Tanya J.; LaRoche, Julie; Achterberg, Eric P.

2011-01-01

353

Analysis of initial fixation strength of press-fit fixation technique in anterior cruciate ligament reconstruction  

Microsoft Academic Search

We performed a controlled laboratory study to evaluate the initial fixation strength of press-fit technique. Forty porcine lower limbs were used and divided into four groups according to the method of fixation; group 1 (press-fit+1.4 mm), in which the diameter difference between the bone plug and the femoral tunnel was 1.4 mm; group 2 (press-fit+1.4 mm, 30°), in which the

Myung Chul Lee; Hyunchul Jo; Tae-Soo Bae; Jin Dae Jang; Sang Cheol Seong

2003-01-01

354

Tacks: a new technique for craniofacial fixation.  

PubMed

Biodegradable fixation in craniofacial surgery provides secure fixation while eliminating much of the concern over intracranial migration of metallic plates and screws. One limitation of present biodegradable systems, however, is the need for tapping the drill hole before screw insertion. Herein, a new method of rigid, biodegradable fixation with tacks (Macrapore, Inc., San Diego, CA) is described. The tacks are made of a 70:30 ratio of the L and DL form of polylactic acid (L,DL-PLA). Degradation times range from 18 to 36 months. Newer prototypes are nearly developed for more rapid dissolution times. From April 1999 to February 2000, tack fixation has been applied in 100 patients (51 males, 49 females aged 3 months to 61 years). Indications for operation were craniosynostosis (n = 33); craniofacial trauma or post-traumatic deformities (n = 11); cleft lip and palate (n = 13); craniofacial syndromes (n = 18); other diagnoses (n = 11). Patients underwent fronto-orbital advancement with cranial reshaping; monobloc osteotomy, open reduction-internal fixation of fractures; hypertelorbitism repair; cranioplasty; stabilization of grafts; major cranial reconstruction; zygomatic advancement; alveolar cleft repair; and iliac bone graft donor site protection. Tacks were also used for temporalis muscle and lateral canthal suspension. Follow-up ranged from 16 to 28 months. Complications occurred in 7 patients, 4 of whom had infections and during debridement had biodegradable implants removed. None of the complications appeared to be related to the use of tacks. The tacks are carried in a specially designed holder and may be placed by hand or with the light tap of a mallet on the tack driver. An automatic driver has been developed. Overall, the performance of the tacks has been excellent. They are easily handled by the nursing personnel and rapidly inserted by the surgeon. Stability appears to be excellent. At this time, it is probably preferable to employ tap and screws for orthognathic surgery or other osteotomies with substantial load bearing. PMID:11711829

Cohen, S R; Holmes, R E; Amis, P; Fitchner, H; Shusterman, E M

2001-11-01

355

Molecular basis of a microbe-mediated enhancement of symbiotic N/sub 2/-fixation. [Rhizobium meliloti; Pseudomonas syringae pv. tabaci  

SciTech Connect

Improvement of biological nitrogen fixation represents a potential source of both increased food production and decreased dependence on costly chemical fertilizer. They report the results of an investigation of the molecular basis of a unique, microbial-mediated mechanism for increased growth and nitrogen fixation rates in alfalfa. Inoculation of alfalfa plants with both Rhizobium meliloti and Pseudomonas syringae pv tabaci provides increased growth and N/sub 2/-fixation rates of alfalfa. Tabaci produces tabtoxinine-..beta..-lactam (T..beta..L), an exocellular product and glutamine synthetase (GS) inhibitor. The association of this pathogen with nodulating alfalfa plants appears to alter the normal regulation of nitrogen fixation such that nitrogenase activity is stimulated and GS activity is inhibited. Studies of the soluble amino acids in these nodules and the activities of the ammonia assimilatory enzymes indicate alternative pathways of ammonia assimilation are being employed.

Unkefer, P.J.; Knight, T.J.

1987-04-01

356

Percutaneous S2 alar iliac fixation for pelvic insufficiency fracture.  

PubMed

Pelvic insufficiency fractures are fairly common in elderly patients and can be a source of major functional impairment, particularly when they involve the ilium. Early rehabilitation with adequate pain relief has been the traditional method of treatment. The recently developed S2 alar iliac technique involves placing pelvic fixation into the ilium through a pathway from the sacral ala. The bony channel between the second dorsal sacral foramen and the anterior inferior iliac spine is used to provide rigid sacropelvic fixation for adult and pediatric spine deformities. The authors describe a new minimally invasive approach that allows percutaneous stabilization of an iliac fracture with 2 S2 alar iliac screws. A 65-year-old woman with a history of rectal carcinoma that was treated with pelvic radiation had an iliac stress fracture that progressed to nonunion. Extensive nonoperative treatment was unsuccessful, and the patient continued to have symptoms 5 years after the initial diagnosis. An open approach vs a minimally invasive technique was debated. The S2 alar iliac screws were used to stabilize the fracture through a minimally invasive approach. Most of the symptoms resolved in 2 months, with radiographic evidence of union at 6 months. To the authors' knowledge, this report is the first to describe a percutaneous approach for stabilizing iliac insufficiency fractures. This technique provides a safe surgical option for treating iliac stress fractures in some patients for whom nonoperative treatment fails while avoiding the complications and soft tissue compromise associated with open procedures. Longer follow-up and a larger series are needed to show the safety and efficacy of this technique. PMID:25361366

El Dafrawy, Mostafa H; Kebaish, Khaled M

2014-11-01

357

ORV Arthroscopic Reduction and Internal Fixation of Tibial Eminence Fractures.  

PubMed

Tibial eminence fractures are an uncommon but well-described avulsion of the anterior cruciate ligament. Treatment principles are based on the amount and pattern of fracture displacement. Management has evolved from closed reduction and immobilization to arthroscopic reduction and internal fixation followed by early rehabilitation. Various fixation methods have evolved, ranging from arthroscopic reduction and percutaneous screw fixation to arthroscopic suture repair. We present a technique for arthroscopic reduction and internal fixation using a cannulated drill bit and high-strength suture. This technique facilitates anatomic reduction with uncomplicated tunnel placement and suture passing in an effort to allow strong fixation and early rehabilitation. PMID:24400179

Myer, Daniel M; Purnell, Gregory J; Caldwell, Paul E; Pearson, Sara E

2013-01-01

358

ORV Arthroscopic Reduction and Internal Fixation of Tibial Eminence Fractures  

PubMed Central

Tibial eminence fractures are an uncommon but well-described avulsion of the anterior cruciate ligament. Treatment principles are based on the amount and pattern of fracture displacement. Management has evolved from closed reduction and immobilization to arthroscopic reduction and internal fixation followed by early rehabilitation. Various fixation methods have evolved, ranging from arthroscopic reduction and percutaneous screw fixation to arthroscopic suture repair. We present a technique for arthroscopic reduction and internal fixation using a cannulated drill bit and high-strength suture. This technique facilitates anatomic reduction with uncomplicated tunnel placement and suture passing in an effort to allow strong fixation and early rehabilitation. PMID:24400179

Myer, Daniel M.; Purnell, Gregory J.; Caldwell, Paul E.; Pearson, Sara E.

2013-01-01

359

Elevated temperature alters carbon cycling in a model microbial community  

NASA Astrophysics Data System (ADS)

Earth's climate is regulated by biogeochemical carbon exchanges between the land, oceans and atmosphere that are chiefly driven by microorganisms. Microbial communities are therefore indispensible to the study of carbon cycling and its impacts on the global climate system. In spite of the critical role of microbial communities in carbon cycling processes, microbial activity is currently minimally represented or altogether absent from most Earth System Models. Method development and hypothesis-driven experimentation on tractable model ecosystems of reduced complexity, as presented here, are essential for building molecularly resolved, benchmarked carbon-climate models. Here, we use chemoautotropic acid mine drainage biofilms as a model community to determine how elevated temperature, a key parameter of global climate change, regulates the flow of carbon through microbial-based ecosystems. This study represents the first community proteomics analysis using tandem mass tags (TMT), which enable accurate, precise, and reproducible quantification of proteins. We compare protein expression levels of biofilms growing over a narrow temperature range expected to occur with predicted climate changes. We show that elevated temperature leads to up-regulation of proteins involved in amino acid metabolism and protein modification, and down-regulation of proteins involved in growth and reproduction. Closely related bacterial genotypes differ in their response to temperature: Elevated temperature represses carbon fixation by two Leptospirillum genotypes, whereas carbon fixation is significantly up-regulated at higher temperature by a third closely related genotypic group. Leptospirillum group III bacteria are more susceptible to viral stress at elevated temperature, which may lead to greater carbon turnover in the microbial food web through the release of viral lysate. Overall, this proteogenomics approach revealed the effects of climate change on carbon cycling pathways and other microbial activities. When scaled to more complex ecosystems and integrated into Earth System Models, this approach could significantly improve predictions of global carbon-climate feedbacks. Experiments such as these are a critical first step designed at understanding climate change impacts in order to better predict ecosystem adaptations, assess the viability of mitigation strategies, and inform relevant policy decisions.

Mosier, A.; Li, Z.; Thomas, B. C.; Hettich, R. L.; Pan, C.; Banfield, J. F.

2013-12-01

360

Carbon Cycle Diagram  

NSDL National Science Digital Library

This diagram illustrates some of the most abundant stores of carbon and identifies some of the pathways in the carbon cycle along which carbon is transferred from one form to another. Long-term sinks of carbon are labelled in black; shorter-term fluxes are labelled in purple. Amounts are in billions of tons.

361

Southwick Osteotomy Stabilised with External Fixator  

PubMed Central

ABSTRACT Introduction: Epiphysiolysis of the femoral head is the most common accident occurring towards the end of pre-puberty and puberty growth. Case report: The author describes the experience in the treatment of chronic epiphysiolysis in two patients treated by Southwick osteotomy. The site is accessed by way of a 15-cm long lateral skin incision and the trochanteric region is reached through the layers. The osteotomy angles prepared beforehand on a thin aluminium model are used to mark the Southwick osteotomy site on the anterior and lateral sides at the level of the lesser trochanter. Before performing the trochanteric osteotomy, two Mitkovi? convergent pins type M20 are applied distally and proximally, above the planned osteotomy site. A tenotomy of the iliopsas muscle is performed, and then the previously marked bone triangle is redissected up to three quarters of the width of the femur. The distal part of the femur is rotated inwards, so that the patella is turned towards the ceiling. The osteotomised fragments of the femur are adapted, repositioned and fixated by installing an external fixator on the previously placed pins. Two more pins are placed, one proximally and one distally, with a view to adequately stabilising the femur. The patient was mobile from day two after the surgery. If, after the surgery, the lead surgeon realises that there is a requirement to make a correction of 5, 10 and 15 degrees of the valgus, varus, anteversion or retroversion deformity, the correction shall be performed without surgically opening the patient, using the fixator pins. Conclusion: After performing a Southwick osteotomy it is easier to adapt, reposition and fixate the osteotomised fragments of the femur using a fixator type M20. Adequate stability allows regaining mobility quickly, which in turn is the best prevention of chondrolysis of the hip. It is possible to make post-operative valgus, varus, anteversion and retroversion corrections of 5, 10 and 15 degrees without performing a surgery. Once the osteotomy is healed, the fixator type M20 is removed without any additional surgery. PMID:25568571

Grubor, Predrag; Mitkovic, Milorad; Grubor, Milan

2014-01-01

362

Using an Explicit Emission Tagging Method in Global Modeling of Source-Receptor Relationships for Black Carbon in the Arctic: Variations, Sources and Transport Pathways  

SciTech Connect

We introduce an explicit emission tagging technique in the Community Atmosphere Model to quantify source-region-resolved characteristics of black carbon (BC), focusing on the Arctic. Explicit tagging of BC source regions without perturbing the emissions makes it straightforward to establish source-receptor relationships and transport pathways, providing a physically consistent and computationally efficient approach to produce a detailed characterization of the destiny of regional BC emissions and the potential for mitigation actions. Our analysis shows that the contributions of major source regions to the global BC burden are not proportional to the respective emissions due to strong region-dependent removal rates and lifetimes, while the contributions to BC direct radiative forcing show a near-linear dependence on their respective contributions to the burden. Distant sources contribute to BC in remote regions mostly in the mid- and upper troposphere, having much less impact on lower-level concentrations (and deposition) than on burden. Arctic BC concentrations, deposition and source contributions all have strong seasonal variations. Eastern Asia contributes the most to the wintertime Arctic burden. Northern Europe emissions are more important to both surface concentration and deposition in winter than in summer. The largest contribution to Arctic BC in the summer is from Northern Asia. Although local emissions contribute less than 10% to the annual mean BC burden and deposition within the Arctic, the per-emission efficiency is much higher than for major non-Arctic sources. The interannual variability (1996-2005) due to meteorology is small in annual mean BC burden and radiative forcing but is significant in yearly seasonal means over the Arctic. When a slow aging treatment of BC is introduced, the increase of BC lifetime and burden is source-dependent. Global BC forcing-per-burden efficiency also increases primarily due to changes in BC vertical distributions. The relative contribution from major non-Arctic sources to the Arctic BC burden increases only slightly, although the contribution of Arctic local sources is reduced by a factor of 2 due to the slow aging treatment.

Wang, Hailong; Rasch, Philip J.; Easter, Richard C.; Singh, Balwinder; Zhang, Rudong; Ma, Po-Lun; Qian, Yun; Ghan, Steven J.; Beagley, Nathaniel

2014-11-27

363

Nitrogen Fixation in the Eastern Equatorial Atlantic: Who and How Much?  

NASA Astrophysics Data System (ADS)

The Eastern Equatorial Atlantic is a physically dynamic and complex region that is vastly understudied. The carbon and nitrogen cycles in this region is affected by seasonal coastal and equatorial upwelling as well as terrigenous inputs from the Congo, Niger, and other smaller central African rivers. We undertook two cruises in the summer of 2006 and 2007 to measure nitrogen fixation rates as well as quantify the major known diazotrophs using 15N uptake measurements, enumeration using epifluorescent microscopy, and nifH gene copies and gene transcript abundance. Trichodesmium was the most abundant diazotroph with the highest abundance in the Gulf of Guinea. Highest nitrogen fixation rates and nifH transcript abundance were measured along the central African coast and in the Congo River plume up to 500 km offshore and were as high as 20 nmol/L/hr. But our novel findings were the high abundance of the group A diazotroph and Trichodesmium resulting in high nitrogen fixation rates in the core of the Equatorial upwelling zone. We will present results of our measurements and discuss the implications to our understanding of the carbon and nitrogen cycles in the Eastern Equatorial Atlantic Ocean.

Subramaniam, A.; Montoya, J. P.; Foster, R. A.; Capone, D. G.

2009-04-01

364

Nitrogen fixation in distinct microbial niches within a chemoautotrophy-driven cave ecosystem  

PubMed Central

Microbial sulfur and carbon cycles in ecosystems driven by chemoautotrophy—present at deep-sea hydrothermal vents, cold seeps and sulfidic caves—have been studied to some extent, yet little is known about nitrogen fixation in these systems. Using a comprehensive approach comprising of 15N2 isotope labeling, acetylene reduction assay and nitrogenase gene expression analyses, we investigated nitrogen fixation in the sulfide-rich, chemoautotrophy-based Frasassi cave ecosystem (Italy). Nitrogen fixation was examined in three different microbial niches within the cave waters: (1) symbiotic bacterial community of Niphargus amphipods, (2) Beggiatoa-dominated biofilms, which occur at the sulfide–oxygen interface, and (3) sulfidic sediment. We found evidence for nitrogen fixation in all the three niches, and the nitrogenase gene (homologs of nifH) expression data clearly show niche differentiation of diazotrophic Proteobacteria within the water streams. The nifH transcript originated from the symbiotic community of Niphargus amphipods might belong to the Thiothrix ectosymbionts. Two abundantly expressed nifH genes in the Beggiatoa-dominated biofilms are closely related to those from Beggiatoa- and Desulfovibrio-related bacteria. These two diazotrophs were consistently found in Beggiatoa-dominated biofilms collected at various time points, thus illustrating species-specific associations of the diazotrophs in biofilm formation, and micron-scale niche partitioning of sulfur-oxidizing and sulfate-reducing bacteria driven by steep redox gradients within the biofilm. Finally, putative heterotrophs (Geobacter, Azoarcus and Desulfovibrio related) were the active diazotrophs in the sulfidic sediment. Our study is the first to shed light on nitrogen fixation in permanently dark caves and suggests that diazotrophy may be widespread in chemosynthetic communities. PMID:23924780

Desai, Mahesh S; Assig, Karoline; Dattagupta, Sharmishtha

2013-01-01

365

Nitrogen fixation in distinct microbial niches within a chemoautotrophy-driven cave ecosystem.  

PubMed

Microbial sulfur and carbon cycles in ecosystems driven by chemoautotrophy-present at deep-sea hydrothermal vents, cold seeps and sulfidic caves-have been studied to some extent, yet little is known about nitrogen fixation in these systems. Using a comprehensive approach comprising of (15)N2 isotope labeling, acetylene reduction assay and nitrogenase gene expression analyses, we investigated nitrogen fixation in the sulfide-rich, chemoautotrophy-based Frasassi cave ecosystem (Italy). Nitrogen fixation was examined in three different microbial niches within the cave waters: (1) symbiotic bacterial community of Niphargus amphipods, (2) Beggiatoa-dominated biofilms, which occur at the sulfide-oxygen interface, and (3) sulfidic sediment. We found evidence for nitrogen fixation in all the three niches, and the nitrogenase gene (homologs of nifH) expression data clearly show niche differentiation of diazotrophic Proteobacteria within the water streams. The nifH transcript originated from the symbiotic community of Niphargus amphipods might belong to the Thiothrix ectosymbionts. Two abundantly expressed nifH genes in the Beggiatoa-dominated biofilms are closely related to those from Beggiatoa- and Desulfovibrio-related bacteria. These two diazotrophs were consistently found in Beggiatoa-dominated biofilms collected at various time points, thus illustrating species-specific associations of the diazotrophs in biofilm formation, and micron-scale niche partitioning of sulfur-oxidizing and sulfate-reducing bacteria driven by steep redox gradients within the biofilm. Finally, putative heterotrophs (Geobacter, Azoarcus and Desulfovibrio related) were the active diazotrophs in the sulfidic sediment. Our study is the first to shed light on nitrogen fixation in permanently dark caves and suggests that diazotrophy may be widespread in chemosynthetic communities. PMID:23924780

Desai, Mahesh S; Assig, Karoline; Dattagupta, Sharmishtha

2013-12-01

366

The penny drops: change blindness at fixation.  

PubMed

Our perception of the visual world is fallible. Unattended objects may change without us noticing as long as the change does not capture attention (change blindness). However, it is often assumed that changes to a fixated object will be noticed if it is attended. In this experiment we demonstrate that participants fail to detect a change in identity of a coin during a magic trick even though eyetracking indicates that the coin is tracked by the eyes throughout the trick. The change is subsequently detected when participants are instructed to look for it. These results suggest that during naturalistic viewing, attention can be focused on an object at fixation without including all of its features. PMID:22896921

Smith, Tim J; Lamont, Peter; Henderson, John M

2012-01-01

367

Extra corporeal fixation of fractured mandibular condyle.  

PubMed

Condylar fracture is the second most common site in the mandibular fractures. Motor vehicle accident and fall are the major causes of such fractures. Because of the anatomical weakness of the condyle and the shape of the condylar head the antero-medial dislocation of the condyle is common. Open reduction and closed reduction is always debatable. The open reduction will bring back the normal function much earlier than closed reduction. Medially dislocated condylar fracture fragments are always managed with open method. In superior or high condylar fractures,exact reduction with conventional open reduction can be difficult due to the limited surgical and visual fields. In such cases extracorporeal fixation of condyle using vertical ramus osteotomy may be better choice to achieve perfect alignment and absolute maintaince of vertical height of the ramus and facial symmetry. We here present a case of extracorporeal fixation of unilateral left high condylar fracture. PMID:25386546

Kannadasan, Kamal; Shenoy K, Vandana; Kengagsubbiah, Srivatsa; V, Sathyabhama; Priya, Vishnu

2014-09-01

368

Extra Corporeal Fixation of Fractured Mandibular Condyle  

PubMed Central

Condylar fracture is the second most common site in the mandibular fractures. Motor vehicle accident and fall are the major causes of such fractures. Because of the anatomical weakness of the condyle and the shape of the condylar head the antero-medial dislocation of the condyle is common. Open reduction and closed reduction is always debatable. The open reduction will bring back the normal function much earlier than closed reduction. Medially dislocated condylar fracture fragments are always managed with open method. In superior or high condylar fractures,exact reduction with conventional open reduction can be difficult due to the limited surgical and visual fields. In such cases extracorporeal fixation of condyle using vertical ramus osteotomy may be better choice to achieve perfect alignment and absolute maintaince of vertical height of the ramus and facial symmetry. We here present a case of extracorporeal fixation of unilateral left high condylar fracture. PMID:25386546

Shenoy K, Vandana; Kengagsubbiah, Srivatsa; V, Sathyabhama; Priya, Vishnu

2014-01-01

369

Evidence of Coexistence of C3 and C4 Photosynthetic Pathways in a Green-Tide-Forming Alga, Ulva prolifera  

PubMed Central

Ulva prolifera, a typical green-tide-forming alga, can accumulate a large biomass in a relatively short time period, suggesting that photosynthesis in this organism, particularly its carbon fixation pathway, must be very efficient. Green algae are known to generally perform C3 photosynthesis, but recent metabolic labeling and genome sequencing data suggest that they may also perform C4 photosynthesis, so C4 photosynthesis might be more wide-spread than previously anticipated. Both C3 and C4 photosynthesis genes were found in U. prolifera by transcriptome sequencing. We also discovered the key enzymes of C4 metabolism based on functional analysis, such as pyruvate orthophosphate dikinase (PPDK), phosphoenolpyruvate carboxylase (PEPC), and phosphoenolpyruvate carboxykinase (PCK). To investigate whether the alga operates a C4-like pathway, the expression of rbcL and PPDK and their enzyme activities were measured under various forms and intensities of stress (differing levels of salinity, light intensity, and temperature). The expression of rbcL and PPDK and their enzyme activities were higher under adverse circumstances. However, under conditions of desiccation, the expression of rbcL and ribulose-1, 5-biphosphate carboxylase (RuBPCase) activity was lower, whereas that of PPDK was higher. These results suggest that elevated PPDK activity may alter carbon metabolism and lead to a partial operation of C4-type carbon metabolism in U. prolifera, probably contributing to its wide distribution and massive, repeated blooms in the Yellow Sea. PMID:22616009

Zhang, Xiaowen; Xu, Dong; Mou, Shanli; Cao, Shaona; Zheng, Zhou; Miao, Jinlai; Ye, Naihao

2012-01-01

370

Posterior Reduction and Temporary Fixation for Odontoid Fracture-a Salvage Maneuver to Anterior Screw Fixation.  

PubMed

Study Design. A prospective study.Objective. To evaluate the outcomes of posterior reduction and temporary fixation using the C1-C2 screw-rod system for odontoid fracture unsuitable for anterior screw fixation.Summary of Background Data. Anterior screw fixation has become the most widely used surgical procedure for the stabilization of odontoid fractures. However, if there is any contraindication for anterior fixation, posterior atlantoaxial fusion is preferred, eliminating the normal rotation of the atlantoaxial complex.Methods. A consecutive series of 22 patients with odontoid fracture unsuitable for anterior screw fixation were involved in this study. Posterior reduction and fixation without fusion using the C1-C2 screw-rod system was performed. Once fracture healing was obtained, instrumentation was removed. The visual analog scale (VAS) of neck pain, neck stiffness, American Spinal Injury Association (ASIA) impairment scale, patient satisfaction, and neck disability index (NDI) were recorded. The range of motion (ROM) of C1-C2 in flexion-extension and rotation was calculated.Results. The average age at internal fixation surgery was 40.2±11.3 years. The mean duration of follow up was 41.8±26.8 months. There were no complications associated with instrumentation. All patients returned to their pre-operative work. Fracture healing was observed in 21 patients and the instrumentation was removed. After removing the instrumentation, the VAS was reduced and neck stiffness were relieved (all P < 0.01). Patient satisfaction and NDI were improved (all P < 0.01). The ROM of C1-C2 was returned to 4.75°±1.62°and 25.70°±5.51°in flexion-extension and in rotation, respectively. No osteoarthritis was observed at the C1-C2 lateral mass joints.Conclusions. Posterior reduction and temporary fixation using the C1-C2 screw-rod system was an optimal salvage maneuver to anterior screw fixation for odontoid fracture. It could effectively avoid the motion loss of C1-C2 caused by posterior atlantoaxial fusion. PMID:25398034

Ni, Bin; Guo, Qunfeng; Lu, Xuhua; Xie, Ning; Wang, Liang; Guo, Xiang; Chen, Fei

2014-11-13

371

Carbon Dioxide Fixation by Algal Cultivation Using Wastewater Nutrients  

Microsoft Academic Search

Chlorella vulgaris was cultivated in wastewater discharged from a steel- making plant with the aim of developing an economically feasible system to remove ammonia from wastewater and from Ñue gas simultaneously. Since CO 2 no phosphorus compounds existed in wastewater, external phosphate (15É3È 46É 0gm ~3) was added to the wastewater. After adaptation to 5% (v\\/v) the CO 2 ,

Sun Bok Lee; Jong Moon Park

1997-01-01

372

Nitrogen fixation control in Herbaspirillum seropedicae  

Microsoft Academic Search

Herbaspirillum seropedicae is a Gram-negative endophytic diazotroph that associates with important agricultural crops. Several studies have shown that\\u000a this organism can contribute to plant growth suggesting potential for use as a biofertilizer. Nitrogen fixation in H. seropedicae is highly regulated both at the transcriptional and post-translational levels. Both of these regulatory levels respond to\\u000a the ammonium availability in the external

Leda Satie Chubatsu; Rose Adele Monteiro; Emanuel Maltempi de Souza; Marco Aurelio Schuler de Oliveira; Marshall Geoffrey Yates; Roseli Wassem; Ana Claudia Bonatto; Luciano Fernandes Huergo; Maria Berenice Reynaud Steffens; Liu Un Rigo; Fabio de Oliveira Pedrosa

373

Efficient Biological Nitrogen Fixation Under Warming Climates  

Microsoft Academic Search

\\u000a Nitrogen fixation (NF) in legumes results from their symbiotic interaction with soil bacteria called rhizobia to form nitrogen\\u000a fixing root nodules.The reduction of atmospheric nitrogen (N2) to ammonium by rhizobia is an important activity making N available for agricultural soils. Drought is one of the most common\\u000a stress factors affecting legume yields worldwide. Given the climatic trends viz a viz

F. Kantar; B. G. Shivakumar; C. Arrese-Igor; F. Y. Hafeez; E. M. González; A. Imran; E. Larrainzar

374

Arren Bar-Even The Weizmann Institute of Science  

E-print Network

are abundant), carbon fixation becomes a growth limiting factor. Calvin-Cycle limited by low catalysis rate://www.genome.jp/kegg/pathway/map/map01100.html Carbon dioxide A carbon Fixation Cycle 13 #12;Finding alternatives to the Calvin-Benson Cycle-Benson Cycle Evaluating the synthetic carbon fixation cycles Promising carbon fixation cycles How can we

Beimel, Amos

375

Accumulation of terrestrial organic carbon on an active continental margin offshore southwestern Taiwan: Source-to-sink pathways of river-borne organic particles  

NASA Astrophysics Data System (ADS)

Sediment samples (213 sites) collected from the tectonic-active continental margin, offshore southwestern Taiwan were analyzed for grain sizes, organic carbon, nitrogen and carbon isotopic composition to obtain mass accumulation rate of terrestrial organic carbon and carbon budget to evaluate fate of terrestrial organic carbon from small mountainous rivers on the continental margin offshore southwestern Taiwan. Terrestrial organic carbon accumulation rates range from 0.29 to 45.6 g C m-2 yr-1 with a total accumulation budget of 0.063 Mt yr-1, which accounts for less than 13% of total river particulate organic carbon loads exported from the adjacent rivers, the Gaoping (a.k.a., Kaoping), Erhjen and Tsengwen rivers. This low burial efficiency of terrestrial organic carbon demonstrated that a majority of river-borne particles together with organic materials was moved away from the study area. For the river-borne particles from the Gaoping river, a pair of depocenters in the upper slope flanking the Gaoping submarine canyon are the locations where the maximum TCorg accumulation rate were observed which hold up to 45% (0.016 Mt yr-1) of the calculated accumulation found in the study region. On the other hand, the occurrence of higher-fraction terrestrial organic carbon in the upper and middle Gaoping submarine canyon suggests that a majority of particulate organic carbon of the Gaoping river was transported directly into the deep-sea basin through the Gaoping submarine canyon. Our results demonstrated that active margin with narrow shelf and slope is not an efficient sink for the large amount of terrigenous organic carbon supplied by the small rivers, but, a transient environment for these river derived particles.

Hsu, Feng-Hsin; Su, Chih-Chieh; Wang, Chung-Ho; Lin, Saulwood; Liu, James; Huh, Chih-An

2014-09-01

376

Characterization of thecycHJKLGenes Involved in Cytochromec Biogenesis and Symbiotic Nitrogen Fixation inRhizobium leguminosarum  

Microsoft Academic Search

Mutants of Rhizobium leguminosarum bv. viciae unable to respire via the cytochrome aa3 pathway were identified by the inability to oxidize N,N*-dimethyl-p-phenylenediamine. Two mutants which were comple- mentedbycosmidpIJ1942fromanR.leguminosarumclonebankwereidentified.Althoughpeanodulesinduced by these mutants contained many bacteroids, no symbiotic nitrogen fixation was detected. Heme staining of cellular proteins revealed that all cytochrome c-type heme proteins were absent. These mutants lacked spectroscopically detectable cytochrome

MARIA-JESUS DELGADO; KAY H. YEOMAN; GUANGHUI WU; CARMEN VARGAS; ANDREA E. DAVIES; ROBERT K. POOLE; ANDREW W. B. JOHNSTON; ALLAN DOWNIE

1995-01-01

377

A dechlorination pathway for synthesis of horn shaped carbon nanotubes and its adsorption properties for CO2, CH4, CO and N2.  

PubMed

Using metallic copper as reductant and tetrachloroethylene as carbon precursor, a simple, low temperature solvothermal method for the synthesis of horn shaped carbon nanotubes is reported. The detail study of reaction parameters such as temperature, time, carbon precursor amount, type and catalyst proportion has been carried out to optimize the conditions wherein that the copper metal (10 g) mediated reduction of tetrachloroethylene (25 mL) at 200°C for 5h resulted in the horn shaped carbon nanotubes with high yield and structural selectivity. The adsorption properties of horn shaped carbon nanotubes were investigated for carbon dioxide, methane, carbon monoxide and nitrogen as adsorbate by volumetric measurements up to 850 mm Hg. The prepared horn shaped carbon nanotubes showed good adsorption capacity for CO(2) (45 cm(3)/g) and CO (17 cm(3)/g), at 303 K and 850 mm Hg pressure, with high equilibrium selectivity (73.3 for CO(2) and 110.7 for CO at 318 K) and capacity selectivity (9.1 for CO(2) and 3.1 for CO at 850 mm Hg and 318 K) over nitrogen which provides the tool for the separation of CO(2) from its mixture with nitrogen observed in flue gas of thermal power plants and boilers, as well as with CO such as syngas. PMID:22682801

Sawant, Sandesh Y; Somani, Rajesh S; Bajaj, Hari C; Sharma, Sangita S

2012-08-15

378

Processing and evaluation of long fiber thermoplastic composite plates for internal fixation  

NASA Astrophysics Data System (ADS)

The metallic plates used in internal fracture fixation may have up to ten times the elastic modulus of normal bone tissue, causing stress shielding-induced osteopenia in healed bone that can lead to re-fracture after plate removal and prolonged and painful recovery. Thermoplastic polymer matrix composites reinforced with long carbon fiber are promising alternative materials for internal fixation plates because they may be produced with relative ease and be tailored to have specific mechanical properties, alleviating the stress shielding problem. Long carbon fiber-reinforced polyetheretherketone (LCF PEEK) plates were produced using the extrusion / compression molding process. Static flexural testing determined that LCF PEEK plates with rectangular cross-section had an average flexural modulus of 12 GPa, or 23% of the flexural modulus of a stainless steel plate. The LCF PEEK plates also experienced negligible (14.7%, 14.5%, and 16.7%) reductions in modulus after fatigue testing at applied moments of 2.5, 3.0, and 3.5 N•m, respectively, over 106 load cycles. Aging the plates in 0.9% NaCl solution for four and eight weeks caused 0.34% and 0.28% increases in plate mass, respectively. No significant decrease of flexural properties due to aging was detected. Differential scanning calorimetry (DSC) revealed the PEEK matrix of the plates to be 24.5% crystalline, which is lower than typical PEEK crystallinity values of 30-35%. Scanning electron microscopy (SEM) revealed three times as many fiber pullout areas in LCF PEEK fracture surfaces as in fracture surfaces of long carbon fiber-reinforced polyphenylenesulfide (LCF PPS), another plate material tested. DSC and SEM data suggest that improvements in processing conditions and fiber/matrix bonding, along with higher carbon fiber fractions, would enhance LCF PEEK plate performance. LCF PEEK remains a promising alternative to stainless steel for internal fixation plates.

Warren, Paul B.

379

Arthroscopic Bony Bankart Fixation Using a Modified Sugaya Technique  

PubMed Central

Arthroscopic fixation of bony Bankart lesions in the setting of anterior shoulder instability has had successful long-term results. Key factors such as patient positioning, portal placement, visualization, mobilization of bony/soft tissues, and anatomic reduction and fixation are crucial to yield such results. We present a modified Sugaya technique that is reproducible and based on such key principles. This technique facilitates ease of anchor and suture placement to allow for anatomic reduction and fixation. PMID:24265994

Gupta, Anil K.; McCormick, Frank M.; Abrams, Geoffrey D.; Harris, Joshua D.; Bach, Bernard R.; Romeo, Anthony A.; Verma, Nikhil N.

2013-01-01

380

Nitrogen fixation in subarctic streams influenced by beaver (Castor canadensis)  

Microsoft Academic Search

Nitrogen fixation was measured in four subarctic streams substantially modified by beaver (Castor canadensis) in Quebec. Acetylene-ethylene (C2H2 ? C2H4) reduction techniques were used during the 1982 ice-free period (May–October) to estimate nitrogen fixation by microorganisms colonizing wood and sediment. Mean seasonal fixation rates were low and patchy, ranging from zero to 2.3 × 10-3 µmol C2H4 · cm-2 ·

Margaret M. Francis; Robert J. Naimant; Jerry M. Melillo

1985-01-01

381

Pentose pathway in human liver.  

PubMed Central

[1-14C]Ribose and [2-14C]glucose were given to normal subjects along with glucose loads (1 g per kg of body weight) after administration of diflunisal and acetaminophen, drugs that are excreted in urine as glucuronides. Distributions of 14C were determined in the carbons of the excreted glucuronides and in the glucose from blood samples drawn from hepatic veins before and after glucagon administration. Eighty percent or more of the 14C from [1-14C]ribose incorporated into the glucuronic acid moiety of the glucuronides was in carbons 1 and 3, with less than 8% in carbon 2. In glucuronic acid from glucuronide excreted when [2-14C]glucose was given, 3.5-8.1% of the 14C was in carbon 1, 2.5-4.3% in carbon 3, and more than 70% in carbon 2. These distributions are in accord with the glucuronides sampling the glucose unit of the glucose 6-phosphate pool that is a component of the pentose pathway and is intermediate in glycogen formation. It is concluded that the glucuronic acid conjugates of the drugs can serve as a noninvasive means of sampling hepatic glucose 6-phosphate. In human liver, as in animal liver, the classical pentose pathway functions, not the L-type pathway, and only a small percentage of the glucose is metabolized via the pathway. PMID:3133657

Magnusson, I; Chandramouli, V; Schumann, W C; Kumaran, K; Wahren, J; Landau, B R

1988-01-01

382

Pentose pathway in human liver  

SciTech Connect

(1-{sup 14}C)Ribose and (1-{sup 14}C)glucose were given to normal subjects along with glucose loads (1 g per kg of body weight) after administration of diflunisal and acetaminophen, drugs that are excreted in urine as glucuronides. Distributions of {sup 14}C were determined in the carbons of the excreted glucoronides and in the glucose from blood samples drawn from hepatic veins before and after glucagon administration. Eighty percent or more of the {sup 14}C from (1-{sup 14}C)ribose incorporated into the glucuronic acid moiety of the glucuronides was in carbons 1 and 3, with less than 8% in carbon 2. In glucuronic acid from glucuronide excreted when (2-{sup 14}C)glucose was given, 3.5-8.1% of the {sup 14}C was in carbon 1, 2.5-4.3% in carbon 3, and more than 70% in carbon 2. These distributions are in accord with the glucuronides sampling the glucose unit of the glucose 6-phosphate pool that is a component of the pentose pathway and is intermediate in glycogen formation. It is concluded that the glucuronic acid conjugates of the drugs can serve as a noninvasive means of sampling hepatic glucose 6-phosphate. In human liver, as in animal liver, the classical pentose pathway functions, not the L-type pathway, and only a small percentage of the glucose is metabolized via the pathway.

Magnusson, I.; Chandramouli, V.; Schumann, W.C.; Kumaran, K.; Wahren, J.; Landau, B.R. (Karolinska Institute at Huddinge Hospital, Stockholm (Sweden))

1988-07-01

383

Will rising CO2 influence how nutrients interact to control tropical N2-fixation?  

NASA Astrophysics Data System (ADS)

The response of terrestrial tropical carbon sinks to increasing CO2 is a pressing question in biogeochemistry. Limitation of nutrients such as N may constrain these sinks. Biological N2-fixation, an important biogeochemical process that provides new nitrogen to ecosystems, potentially plays an important role in supporting tropical carbon sinks. Despite the importance of N2-fixation to the linked nitrogen and carbon cycles, we know little about how nutrient limitation of the process of biological N2-fixation, itself, will affect tropical fixation and N2-fixing plants. While rising CO2 levels may increase tree growth and N2-fixation when nutrients are abundant, at the same time, the increased growth may force N2-fixing plants into phosphorus (P) and molybdenum (Mo) limitation, both elements that are scarce in tropical forests and critical to N2-fixers. This study improves our understanding on what controls fixation through a series of greenhouse and in situ field experiments. First, we used a greenhouse experiment where we manipulated CO2 levels combined with a field study in forest gaps. In the greenhouse study we grew a N2-fixing seedling and a non-fixing seedling at pre-industrial (280 ppm), current (400 ppm), and double (800 ppm) CO2 concentrations with and without P, Mo, or both. In the year-long field study, we applied the same nutrient treatments to seedlings planting in natural light gaps and ambient CO2. To supplement our year-long seedling experiment, we also examined 11 years of growth data from a long-term N x P x K factorial fertilization experiment also on the Gigante Peninsula. In the greenhouse study, we found nutrient limitation was minimal at pre-industrial CO2 levels, but that limitation appeared with increasing CO2. Phosphorus limitation of tree growth and N2-fixation significantly increased with higher CO2. The additions of Mo and P together allowed for even greater growth and fixation, suggesting Mo-P co-limitation at elevated CO2. Compared to the control, the phosphorus addition treatment grew ~50% faster and fixed 10-15x more N2 at the present day and doubled CO2 levels. When plants received both P and Mo, they grew 66- 200% more, and fixed up to 25 times more N2. In the year-long field study, we did not find significant differences between nutrient treatments, but there was a correlation with canopy openness. In the long-term fertilization study, we found N2-fixing trees to be marginally limited by P. These experiments illustrate both hypothetical limitations at future higher global CO2 levels as well as the difficulty in scaling up to natural forests where herbivory and competition for light and nutrients confound clear treatment effects.

Trierweiler, A.; Winter, K.; Wright, S. J.; Wurzburger, N.; Hedin, L.

2013-12-01

384

Arthroscopic reduction and internal fixation of acetabular fractures.  

PubMed

Arthroscopic reduction and screw fixation of acetabular fractures have not been reported. In this case report, arthroscopic treatment for acetabular fracture is reported for two patients. A 49-year-old man diagnosed with acetabular posterior wall fracture was treated by arthroscopic reduction and fixation using two screws. A 20-year-old woman who diagnosed with anterior column fracture was fixed using a screw using the arthroscopic technique prior to open reduction and internal fixation in the iliac bone fracture. Arthroscopic reduction and fixation in some case of acetabular fracture could be good indication with additional advantages of joint debridement and loose body removal. PMID:24306124

Kim, Hyangkyoung; Baek, Ji-Hoon; Park, Sang-Min; Ha, Yong-Chan

2014-04-01

385

Decreased Fronto-Temporal Interaction during Fixation after Memory Retrieval  

PubMed Central

Previous studies have revealed top-down control during memory retrieval from the prefrontal cortex to the temporal cortex. In the present functional MRI study, we investigated whether the fronto-temporal functional interaction occurs even during fixation periods after m