Sample records for carbon fixation pathways

  1. MICROBIOLOGY: A Fifth Pathway of Carbon Fixation

    NSDL National Science Digital Library

    Rudolf K. Thauer (Max Planck Institute for Terrestrial Microbiology; )

    2007-12-14

    Access to the article is free, however registration and sign-in are required. Genome sequence analyses and enzymatic studies reveal a novel CO2 fixation cycle in some autotrophic archaea. Autotrophs are organisms that can grow using carbon dioxide (CO2) as their sole source of carbon. Four mechanisms are known by which autotrophic organisms fix carbon. Berg et al. describe a fifth autotrophic CO2 fixation pathway in archaea that may have been used by some of the earliest organisms on Earth.

  2. Design and analysis of synthetic carbon fixation pathways

    PubMed Central

    Bar-Even, Arren; Noor, Elad; Lewis, Nathan E.; Milo, Ron

    2010-01-01

    Carbon fixation is the process by which CO2 is incorporated into organic compounds. In modern agriculture in which water, light, and nutrients can be abundant, carbon fixation could become a significant growth-limiting factor. Hence, increasing the fixation rate is of major importance in the road toward sustainability in food and energy production. There have been recent attempts to improve the rate and specificity of Rubisco, the carboxylating enzyme operating in the Calvin–Benson cycle; however, they have achieved only limited success. Nature employs several alternative carbon fixation pathways, which prompted us to ask whether more efficient novel synthetic cycles could be devised. Using the entire repertoire of approximately 5,000 metabolic enzymes known to occur in nature, we computationally identified alternative carbon fixation pathways that combine existing metabolic building blocks from various organisms. We compared the natural and synthetic pathways based on physicochemical criteria that include kinetics, energetics, and topology. Our study suggests that some of the proposed synthetic pathways could have significant quantitative advantages over their natural counterparts, such as the overall kinetic rate. One such cycle, which is predicted to be two to three times faster than the Calvin–Benson cycle, employs the most effective carboxylating enzyme, phosphoenolpyruvate carboxylase, using the core of the naturally evolved C4 cycle. Although implementing such alternative cycles presents daunting challenges related to expression levels, activity, stability, localization, and regulation, we believe our findings suggest exciting avenues of exploration in the grand challenge of enhancing food and renewable fuel production via metabolic engineering and synthetic biology. PMID:20410460

  3. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

    PubMed Central

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker

    2012-01-01

    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  4. Widespread Occurrence of Two Carbon Fixation Pathways in Tubeworm Endosymbionts: Lessons from Hydrothermal Vent Associated Tubeworms from the Mediterranean Sea

    PubMed Central

    Thiel, Vera; Hügler, Michael; Blümel, Martina; Baumann, Heike I.; Gärtner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schönberg, Dieter; Petersen, Sven; Cowart, Dominique A.; Fisher, Charles R.; Imhoff, Johannes F.

    2012-01-01

    Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL – the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat. PMID:23248622

  5. Insights into the Autotrophic CO2 Fixation Pathway of the Archaeon Ignicoccus hospitalis: Comprehensive Analysis of the Central Carbon Metabolism?

    PubMed Central

    Jahn, Ulrike; Huber, Harald; Eisenreich, Wolfgang; Hügler, Michael; Fuchs, Georg

    2007-01-01

    Ignicoccus hospitalis is an autotrophic hyperthermophilic archaeon that serves as a host for another parasitic/symbiotic archaeon, Nanoarchaeum equitans. In this study, the biosynthetic pathways of I. hospitalis were investigated by in vitro enzymatic analyses, in vivo 13C-labeling experiments, and genomic analyses. Our results suggest the operation of a so far unknown pathway of autotrophic CO2 fixation that starts from acetyl-coenzyme A (CoA). The cyclic regeneration of acetyl-CoA, the primary CO2 acceptor molecule, has not been clarified yet. In essence, acetyl-CoA is converted into pyruvate via reductive carboxylation by pyruvate-ferredoxin oxidoreductase. Pyruvate-water dikinase converts pyruvate into phosphoenolpyruvate (PEP), which is carboxylated to oxaloacetate by PEP carboxylase. An incomplete citric acid cycle is operating: citrate is synthesized from oxaloacetate and acetyl-CoA by a (re)-specific citrate synthase, whereas a 2-oxoglutarate-oxidizing enzyme is lacking. Further investigations revealed that several special biosynthetic pathways that have recently been described for various archaea are operating. Isoleucine is synthesized via the uncommon citramalate pathway and lysine via the ?-aminoadipate pathway. Gluconeogenesis is achieved via a reverse Embden-Meyerhof pathway using a novel type of fructose 1,6-bisphosphate aldolase. Pentosephosphates are formed from hexosephosphates via the suggested ribulose-monophosphate pathway, whereby formaldehyde is released from C-1 of hexose. The organism may not contain any sugar-metabolizing pathway. This comprehensive analysis of the central carbon metabolism of I. hospitalis revealed further evidence for the unexpected and unexplored diversity of metabolic pathways within the (hyperthermophilic) archaea. PMID:17400748

  6. Potential role of multiple carbon fixation pathways during lipid accumulation in Phaeodactylum tricornutum

    PubMed Central

    2012-01-01

    Background Phaeodactylum tricornutum is a unicellular diatom in the class Bacillariophyceae. The full genome has been sequenced (<30?Mb), and approximately 20 to 30% triacylglyceride (TAG) accumulation on a dry cell basis has been reported under different growth conditions. To elucidate P. tricornutum gene expression profiles during nutrient-deprivation and lipid-accumulation, cell cultures were grown with a nitrate to phosphate ratio of 20:1 (N:P) and whole-genome transcripts were monitored over time via RNA-sequence determination. Results The specific Nile Red (NR) fluorescence (NR fluorescence per cell) increased over time; however, the increase in NR fluorescence was initiated before external nitrate was completely exhausted. Exogenous phosphate was depleted before nitrate, and these results indicated that the depletion of exogenous phosphate might be an early trigger for lipid accumulation that is magnified upon nitrate depletion. As expected, many of the genes associated with nitrate and phosphate utilization were up-expressed. The diatom-specific cyclins cyc7 and cyc10 were down-expressed during the nutrient-deplete state, and cyclin B1 was up-expressed during lipid-accumulation after growth cessation. While many of the genes associated with the C3 pathway for photosynthetic carbon reduction were not significantly altered, genes involved in a putative C4 pathway for photosynthetic carbon assimilation were up-expressed as the cells depleted nitrate, phosphate, and exogenous dissolved inorganic carbon (DIC) levels. P. tricornutum has multiple, putative carbonic anhydrases, but only two were significantly up-expressed (2-fold and 4-fold) at the last time point when exogenous DIC levels had increased after the cessation of growth. Alternative pathways that could utilize HCO3- were also suggested by the gene expression profiles (e.g., putative propionyl-CoA and methylmalonyl-CoA decarboxylases). Conclusions The results indicate that P. tricornutum continued carbon dioxide reduction when population growth was arrested and different carbon-concentrating mechanisms were used dependent upon exogenous DIC levels. Based upon overall low gene expression levels for fatty acid synthesis, the results also suggest that the build-up of precursors to the acetyl-CoA carboxylases may play a more significant role in TAG synthesis rather than the actual enzyme levels of acetyl-CoA carboxylases per se. The presented insights into the types and timing of cellular responses to inorganic carbon will help maximize photoautotrophic carbon flow to lipid accumulation. PMID:22672912

  7. CARBON DIOXIDE FIXATION.

    SciTech Connect

    FUJITA,E.

    2000-01-12

    Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO{sub 2} conversion. Recent achievements in the efficiency of solar energy conversion and in catalysis suggest that this approach holds a great deal of promise for contributing to future needs for fuels and chemicals.

  8. Carbon Dioxide Fixation in Cultured Animal Cells

    E-print Network

    Kyner, David Smith

    1969-01-01

    Dioxide Fixation Iii Effects of Olucose 15 Effects of Tryptophan « • 17 Effects of Insulin 18 Effects of Glucagon and Catecholamines 19 Effects of Glucocorticoids « • • • 20 Other Metabolic Pathways 25 Carbon Dioxide Fixing Enzymes 26 Beta-Me thyl... phosphate (101) to catalyze the formation of PEP from pyruvate. Oluconeogenesis will be discussed under the following headings* control of gluconeogenesis; gluconeogenesis and carbon dioxide fixation; effects of glucose, tryptophan, insulin, glucagon...

  9. Structural studies of metalloenzyme complexes in acetogenic carbon fixation

    E-print Network

    Kung, Yan

    2011-01-01

    Acetogenic bacteria use the Wood-Ljungdahl carbon fixation pathway to produce cellular carbon from CO?. This process requires several metalloenzymes that employ transition metals such as iron, nickel, and cobalt towards ...

  10. Photosynthesis of Grass Species Differing in Carbon Dioxide Fixation Pathways 1

    PubMed Central

    Bouton, Joseph H.; Brown, R. Harold; Bolton, Jacqueline K.; Campagnoli, Raymond P.

    1981-01-01

    Panicum species of the Laxa group were investigated in a series of published reports and were found to possess C4, C3, and intermediate photosynthetic characteristics. Taxonomic and other relationships among these plants, however, are not clear. It was the objective of this investigation to document chromosome number, metaphase I chromosome behavior, and mode of reproduction, including abnormalities in the embryo sac, for these species. Chromosome counts showed a basic number (x) of 10 and ploidy levels of diploid (2n = 2x = 20), tetraploid (2n = 4x = 40), and hexaploid (2n = 6x = 60) in this group of Panicum. One diploid and one tetraploid accession of the C4 species, Panicum prionitis Griseb., were obtained. Of the intermediate species, Panicum milioides Nees ex Trin. was diploid, Panicum schenckii Hack. was hexaploid, and Panicum decipiens Nees, ex Trin. was found to possess two ploidy levels, one accession being diploid and the other accession being hexaploid. All the C3 species, which included two accessions of Panicum laxum Sw., three accessions of Panicum hylaeicum Mez., and one accession of Panicum rivulare Trin., were tetraploid. Meiosis was regular with primarily bivalent pairing at metaphase I in all species except the tetraploid accession of P. prionitis which possessed from 4 to 10 tetravalents. Stainable pollen was high in all species, ranging from 70 to 99%. Embryo sac analyses showed a single sac in all plants except the tetraploid accession of P. prionitis, which was found to possess an additional sac at anthesis. An additional sac was also observed in some ovaries of the P. schenckii accession. Self-pollinated seed set was high in all accessions except the diploid accession of P. prionitis and one accession of P. laxum where no seed was set under bagged conditions. This information establishes, within the limits of this collection, a base for future studies on genetic, taxonomic, photosynthetic, and evolutionary relationships among these plants. Possession of the same basic chromosome number, regular meiotic pairing, a high degree of stainable pollen, and good seed set in most of the plants studied indicate possible success in making hybrids for a genetic study of photosynthetic pathways in Panicum. Images PMID:16661689

  11. Conversion of 4-hydroxybutyrate to acetyl coenzyme A and its anapleurosis in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate carbon fixation pathway.

    PubMed

    Hawkins, Aaron B; Adams, Michael W W; Kelly, Robert M

    2014-04-01

    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73°C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA ?-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula. PMID:24532060

  12. Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway

    PubMed Central

    Hawkins, Aaron B.; Adams, Michael W. W.

    2014-01-01

    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73°C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA ?-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula. PMID:24532060

  13. Evidence of Carbon Fixation Pathway in a Bacterium from Candidate Phylum SBR1093 Revealed with Genomic Analysis

    PubMed Central

    Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

    2014-01-01

    Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30?50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30?80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere. PMID:25310003

  14. De Novo Transcriptome Analysis of an Aerial Microalga Trentepohlia jolithus: Pathway Description and Gene Discovery for Carbon Fixation and Carotenoid Biosynthesis

    PubMed Central

    Li, Qianqian; Liu, Jianguo; Zhang, Litao; Liu, Qian

    2014-01-01

    Background Algae in the order Trentepohliales have a broad geographic distribution and are generally characterized by the presence of abundant ?-carotene. The many monographs published to date have mainly focused on their morphology, taxonomy, phylogeny, distribution and reproduction; molecular studies of this order are still rare. High-throughput RNA sequencing (RNA-Seq) technology provides a powerful and efficient method for transcript analysis and gene discovery in Trentepohlia jolithus. Methods/Principal Findings Illumina HiSeq 2000 sequencing generated 55,007,830 Illumina PE raw reads, which were assembled into 41,328 assembled unigenes. Based on NR annotation, 53.28% of the unigenes (22,018) could be assigned to gene ontology classes with 54 subcategories and 161,451 functional terms. A total of 26,217 (63.44%) assembled unigenes were mapped to 128 KEGG pathways. Furthermore, a set of 5,798 SSRs in 5,206 unigenes and 131,478 putative SNPs were identified. Moreover, the fact that all of the C4 photosynthesis genes exist in T. jolithus suggests a complex carbon acquisition and fixation system. Similarities and differences between T. jolithus and other algae in carotenoid biosynthesis are also described in depth. Conclusions/Significance This is the first broad transcriptome survey for T. jolithus, increasing the amount of molecular data available for the class Ulvophyceae. As well as providing resources for functional genomics studies, the functional genes and putative pathways identified here will contribute to a better understanding of carbon fixation and fatty acid and carotenoid biosynthesis in T. jolithus. PMID:25254555

  15. ORIGINAL ARTICLE Sulfur oxidizers dominate carbon fixation

    E-print Network

    Hansell, Dennis

    ORIGINAL ARTICLE Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system

  16. Efficient CO2 Fixation Pathways: Energy Plant: High Efficiency Photosynthetic Organisms

    SciTech Connect

    None

    2012-01-01

    PETRO Project: UCLA is redesigning the carbon fixation pathways of plants to make them more efficient at capturing the energy in sunlight. Carbon fixation is the key process that plants use to convert carbon dioxide (CO2) from the atmosphere into higher energy molecules (such as sugars) using energy from the sun. UCLA is addressing the inefficiency of the process through an alternative biochemical pathway that uses 50% less energy than the pathway used by all land plants. In addition, instead of producing sugars, UCLA’s designer pathway will produce pyruvate, the precursor of choice for a wide variety of liquid fuels. Theoretically, the new biochemical pathway will allow a plant to capture 200% as much CO2 using the same amount of light. The pathways will first be tested on model photosynthetic organisms and later incorporated into other plants, thus dramatically improving the productivity of both food and fuel crops.

  17. Dark Carbon Fixation: An Important Process in Lake Sediments

    PubMed Central

    Santoro, Ana Lúcia; Bastviken, David; Gudasz, Cristian; Tranvik, Lars; Enrich-Prast, Alex

    2013-01-01

    Close to redox boundaries, dark carbon fixation by chemoautotrophic bacteria may be a large contributor to overall carbon fixation. Still, little is known about the relative importance of this process in lake systems, in spite the potentially high chemoautotrophic potential of lake sediments. We compared rates of dark carbon fixation, bacterial production and oxygen consumption in sediments from four Swedish boreal and seven tropical Brazilian lakes. Rates were highly variable and dark carbon fixation amounted up to 80% of the total heterotrophic bacterial production. The results indicate that non-photosynthetic carbon fixation can represent a substantial contribution to bacterial biomass production, especially in sediments with low organic matter content. PMID:23776549

  18. Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation

    PubMed Central

    Könneke, Martin; Schubert, Daniel M.; Brown, Philip C.; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J.; Stahl, David A.; Berg, Ivan A.

    2014-01-01

    Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

  19. Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation.

    PubMed

    Könneke, Martin; Schubert, Daniel M; Brown, Philip C; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J; Stahl, David A; Berg, Ivan A

    2014-06-01

    Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

  20. CARBON FIXATION BY CULTURED CLAMSCARBON FIXATION BY CULTURED CLAMSCARBON FIXATION BY CULTURED CLAMSCARBON FIXATION BY CULTURED CLAMS Patrick BakerPatrick Baker

    E-print Network

    Florida, University of

    CLAMSCARBON FIXATION BY CULTURED CLAMS Patrick BakerPatrick Baker School of Forest Resources and Conservation, Gainesville, FL, USA Clam Farming in FloridaClam Farming in Florida Calculating Carbon per Clam Bag E t l th E th g Calculating Carbon per Clam Bag Eat a clam, save the EarthEat a clam, save the Earth · Northern

  1. Acetogenesis and the Wood-Ljungdahl Pathway of CO2 Fixation

    PubMed Central

    Ragsdale, Stephen W.; Pierce, Elizabeth

    2008-01-01

    I. Summary Conceptually, the simplest way to synthesize an organic molecule is to construct it one carbon at a time. The Wood-Ljungdahl pathway of CO2 fixation involves this type of stepwise process. The biochemical events that underlie the condensation of two one-carbon units to form the two-carbon compound, acetate, have intrigued chemists, biochemists, and microbiologists for many decades. We begin this review with a description of the biology of acetogenesis. Then, we provide a short history of the important discoveries that have led to the identification of the key components and steps of this usual mechanism of CO and CO2 fixation. In this historical perspective, we have included reflections that hopefully will sketch the landscape of the controversies, hypotheses, and opinions that led to the key experiments and discoveries. We then describe the properties of the genes and enzymes involved in the pathway and conclude with a section describing some major questions that remain unanswered. PMID:18801467

  2. ORIGINAL ARTICLE Carbon and nitrogen fixation and

    E-print Network

    Capone, Douglas G.

    cells of Anabaena oscillarioides Radu Popa1 , Peter K Weber2 , Jennifer Pett-Ridge2 , Juliette A Finzi3 incubations of Anabaena oscillarioides, we imaged the cellular distributions of C, N and P and 13 C and 15 N: cyanobacteria; heterocyst; nitrogen fixation; nitrogenase; Anabaena Introduction Some cyanobacteria are uniquely

  3. Phytoplankton plasticity drives large variability in carbon fixation efficiency

    NASA Astrophysics Data System (ADS)

    Ayata, Sakina-Dorothée.; Lévy, Marina; Aumont, Olivier; Resplandy, Laure; Tagliabue, Alessandro; Sciandra, Antoine; Bernard, Olivier

    2014-12-01

    Phytoplankton C:N stoichiometry is highly flexible due to physiological plasticity, which could lead to high variations in carbon fixation efficiency (carbon consumption relative to nitrogen). However, the magnitude, as well as the spatial and temporal scales of variability, remains poorly constrained. We used a high-resolution biogeochemical model resolving various scales from small to high, spatially and temporally, in order to quantify and better understand this variability. We find that phytoplankton C:N ratio is highly variable at all spatial and temporal scales (5-12 molC/molN), from mesoscale to regional scale, and is mainly driven by nitrogen supply. Carbon fixation efficiency varies accordingly at all scales (±30%), with higher values under oligotrophic conditions and lower values under eutrophic conditions. Hence, phytoplankton plasticity may act as a buffer by attenuating carbon sequestration variability. Our results have implications for in situ estimations of C:N ratios and for future predictions under high CO2 world.

  4. Abundance and Distribution of Diagnostic Carbon Fixation Genes in a Deep-Sea Hydrothermal Gradient Ecosystem

    NASA Astrophysics Data System (ADS)

    Blumenfeld, H. N.; Kelley, D. S.; Girguis, P. R.; Schrenk, M. O.

    2010-12-01

    The walls of deep-sea hydrothermal vent chimneys sustain steep thermal and chemical gradients resulting from the mixing of hot (350°C+) hydrothermal fluids with cold, oxygenated seawater. The chemical disequilibrium generated from this process has the potential to drive numerous chemolithoautotrophic metabolisms, many of which have been demonstrated to be operative in microbial pure cultures. In addition to the well-known Calvin Cycle, at least five additional pathways have been discovered including the Reverse Tricarboxylic Acid Cycle (rTCA), the Reductive Acetyl-CoA pathway, and the 3-hydroxyproprionate pathway. Most of the newly discovered pathways have been found in thermophilic and hyperthermophilic Bacteria and Archaea, which are the well represented in microbial diversity studies of hydrothermal chimney walls. However, to date, little is known about the environmental controls that impact various carbon fixation pathways. The overlap of limited microbial diversity with distinct habitat conditions in hydrothermal chimney walls provides an ideal setting to explore these relationships. Hydrothermal chimney walls from multiple structures recovered from the Juan de Fuca Ridge in the northeastern Pacific were sub-sampled and analyzed using PCR-based assays. Earlier work showed elevated microbial abundances in the outer portions of mature chimney walls, with varying ratios of Archaea to Bacteria from the outer to inner portions of the chimneys. Common phylotypes identified in these regions included Epsilonproteobacteria, Gammaproteobacteria, and Desulfurococcales. Total genomic DNA was extracted from mineralogically distinct niches within these structures and queried for genes coding key regulatory enzymes for each of the well studied carbon fixation pathways. Preliminary results show the occurrence of genes representing rTCA cycle (aclB) and methyl coenzyme A reductase (mcrA) - a proxy for the Reductive Acetyl-CoA Pathway within interior portion of mature hydrothermal chimneys. Ongoing analyses are aimed at quantifying the abundances of these diagnostic carbon fixation genes within the hydrothermal chimney gradients. These data are being compared to a broad array of contextual data to provide insight into the environmental and biological controls that may impact the distribution of the various carbon fixation pathways. Application of genomic approaches to the hydrothermal chimney ecosystem will provide insight into the microbial ecology of such structures and refine our ability to measure autotrophy in hydrothermal habitats sustained by chemical energy.

  5. Carbon dioxide fixation by detached cereal caryopses

    SciTech Connect

    Watson, P.A.; Duffus, C.M. (Univ. of Edinburgh (Scotland))

    1988-06-01

    Immature detached cereal caryposes from barley (Hordeum vulgare L. var distichum cv Midas) and wheat (Triticum aestivum L. cv Sicco) were shown to be capable of fixing externally supplied {sup 14}CO{sub 2} in the light or dark. Green cross cells and the testa contained the majority of the {sup 14}C-labeled material. Some {sup 14}C-labeled material was also found in the outer, or transparent, layer and in the endosperm/embryo fraction. More {sup 14}C was recovered from caryopses when they were incubated in {sup 14}CO{sub 2} without the transparent layer, thus suggesting that this layer is a barrier to the uptake of CO{sub 2}. In all cases, significant amounts of {sup 14}C-labeled material were found in caryopses after dark incubation with {sup 14}CO{sub 2}. Interestingly, CO{sub 2} fixation in the chlorophyll-less mutant Albino lemma was significantly greater in the light than in the dark. The results indicate that intact caryopses have the ability to translocate {sup 14}C-labeled assimilate derived from external CO{sub 2} to the endosperm/embryo. Carboxylating activity in the transparent layer appears to be confined to phosphoenolpyruvate carboxylase activity but that in the chloroplast-containing cross-cells may be accounted for by both ribulose-1,5-bisphosphate carboxylase-oxygenase and phosphoenolpyruvate carboxylase activity. Depending on a number of assumptions, the amount of CO{sub 2} fixed is sufficient to account for about 2% of the weight of starch found in the mature caryposis.

  6. Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park

    SciTech Connect

    Jennings, Ryan; Whitmore, Laura M.; Moran, James J.; Kreuzer, Helen W.; Inskeep, William P.

    2014-05-01

    The fixation of inorganic carbon (as carbon dioxide) has been documented in all three domains of life and results in the biosynthesis of a diverse suite of organic compounds that support the growth of heterotrophic organisms. The primary aim of this study was to assess the importance of carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of one of the dominant Fe(II)-oxidizing organisms (Metallosphaera yellowstonensis strain MK1) present in situ. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon fixation pathway were identified in pure-cultures of M. yellowstonensis strain MK1. Metagenome sequencing from the same environments also revealed genes for the 3-HP/4-HB pathway belonging to M. yellowstonensis populations, as well as genes for a complete reductive TCA cycle from Hydrogenobaculum spp. (Aquificales). Stable isotope (13CO2) labeling was used to measure the fixation of CO2 by M. yellowstonensis strain MK1, and in ex situ assays containing live Fe(III)-oxide microbial mats. Results showed that M. yellowstonensis strain MK1 fixes CO2 via the 3-HP/4-HB pathway with a fractionation factor of ~ 2.5 ‰. Direct analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C and microbial mat C showed that mat C is comprised of both DIC and non-DIC sources. The estimated contribution of DIC carbon to biomass C (> ~ 35%) is reasonably consistent with the relative abundance of known chemolithoautotrophs and corresponding CO2 fixation pathways detected in metagenome sequence. The significance of DIC as a major source of carbon for Fe-oxide mat communities provides a foundation for examining microbial interactions in these systems that are dependent on the activity of autotrophic organisms such as Hydrogenobaculum and Metallosphaera spp.

  7. Isocyanate- and phosgene-free routes to polyfunctional cyclic carbonates and green polyurethanes by fixation of carbon dioxide.

    PubMed

    Blattmann, Hannes; Fleischer, Maria; Bähr, Moritz; Mülhaupt, Rolf

    2014-07-01

    The catalytic chemical fixation of carbon dioxide by carbonation of oxiranes, oxetanes, and polyols represents a very versatile green chemistry route to environmentally benign di- and polyfunctional cyclic carbonates as intermediates for the formation of non-isocyanate poly-urethane (NIPU). Two synthetic pathways lead to NIPU thermoplastics and thermosets: i) polycondensation of diacarbamates or acyclic dicarbonates with diols or diamines, respectively, and ii) polyaddition by ring-opening polymerization of di- and polyfunctional cyclic carbonates with di- and polyamines. The absence of hazardous and highly moisture-sensitive isocyanates as intermediates eliminates the need for special safety precautions, drying and handling procedures. Incorporated into polymer backbones and side chains, carbonate groups enable facile tailoring of a great variety of urethane-functional polymers. As compared with conventional polyurethanes, ring-opening polymerization of polyfunctional cyclic carbonates affords polyhydroxyurethanes with unconventional architectures including NIPUs containing carbohydrate segments. NIPU/epoxy hybrid coatings can be applied on wet surfaces and exhibit improved adhesion, thermal stability and wear resistance. Combining chemical with biological carbon dioxide fixation affords 100% bio-based NIPUs derived from plant oils, terpenes, carbohydrates, and bio polyols. Biocompatible and biodegradable NIPU as well as NIPU biocomposites hold great promise for biomedical applications. PMID:24979310

  8. Recovering of carbon fixation in a eucalyptus site after felling

    NASA Astrophysics Data System (ADS)

    Rodrigues, A. M.; Pita, G. P. A.; Mateus, A.; Santos Pereira, J.

    2009-04-01

    Espirra site (38°38'N,8°36'W) is located in a 300ha Eucalyptus globulus plantation, with a Mediterranean type climate with a mean annual precipitation of 709mm and a mean annual air temperature of 15.9°C. The plantation was established in 1986 with about 1100 trees ha-1. A 33m observation tower was installed in 2002, with an ultrasonic Gill anemometer R2, an open path analyzer IRGA LI-7500 and a microclimate unit at its top. A harvesting of trees was made at the end of the 2nd rotation period, from November to December 2006. During the last four years of the second rotation the coppice were 20m height. Harvesting was planned in order to initiate a new 12 year productive cycle. In October 2008 a first thinning was made in three fourths of emerging stems from stumps. At this stage the forest trees had a mean height of 6m. For the 2002-2006 period, mean annual values of carbon net ecosystem exchange (NEE), gross production(GPP) and ecosystem respiration(Reco) were -533.3 gCm-2, 1628.6 gCm-2 and 1095.2 gCm-2. Seasonal patterns of carbon fixation for the five years showed a decrease in July-August periods due to highest air temperatures, atmospheric water vapour deficits and stomata partial closure to prevent water transpiration losses. For the period 2002-2006, the dry year of 2005 with a precipitation of about 390 mm, corresponded to the smaller carbon fixation of 390 gCm-2. Similarly, values of Reco, GPP and estimated leaf area index (less than three) were also minimal in 2005. Water use efficiency, WUE (ratio GPP/precipitation) was maximum in summer periods and in driest years, reaching values of about 12g/L-1. Recovery of carbon sink capacity, after the felling, begun after August 2007. The 2007 and 2008 annual NEE values were respectively 105.8 gCm-2 and -35.78 gCm-2. This negative value of NEE for 2008 is indicative of a carbon sink recovery. Annual Reco values for 2007 and 2008 were respectively 1059.03 gCm-2 and 1148.21 gCm-2. For GPP the annual values of 2007 and 2008 were respectively 953.24 gCm-2 and 1148.10 gCm-2. After the felling, stems rapidly grew and monthly GPP increased from 32 gCm-2 to 114 gCm-2 from January to October 2007. In November and December 2007, GPP decreased as a consequence of less solar radiation and frost in the young plants. In 2008 monthly GPP increased again till September. In the last three months of 2008, GPP diminished as a consequence of lack of water loss by evapotranspiration and the thinning. The results showed a chronological tendency for carbon fixation of the eucalyptus site according to physiological status of plants, concerning age and physical environmental factors.

  9. Computational protein design enables a novel one-carbon assimilation pathway.

    PubMed

    Siegel, Justin B; Smith, Amanda Lee; Poust, Sean; Wargacki, Adam J; Bar-Even, Arren; Louw, Catherine; Shen, Betty W; Eiben, Christopher B; Tran, Huu M; Noor, Elad; Gallaher, Jasmine L; Bale, Jacob; Yoshikuni, Yasuo; Gelb, Michael H; Keasling, Jay D; Stoddard, Barry L; Lidstrom, Mary E; Baker, David

    2015-03-24

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway. PMID:25775555

  10. Carbon Dioxide Fixation by Metallosphaera yellowstonensis and Acidothermophilic Iron-Oxidizing Microbial Communities from Yellowstone National Park

    PubMed Central

    Jennings, Ryan M.; Whitmore, Laura M.; Moran, James J.

    2014-01-01

    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope (13CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ?2.5‰. Analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  11. Stapes fixation accompanied with abnormal facial nerve pathway.

    PubMed

    Inagaki, Taro; Kawano, Atsushi; Ogawa, Yasuo; Shimizu, Masaaki; Negishi, Miho; Kawada, Yuri; Suzuki, Mamoru

    2014-06-01

    The patient was a 52-year-old woman. She had been aware of her bilateral hearing loss since she was 20 years old. The hearing in her left ear started to deteriorate at the age of 49. Pure-tone audiometry showed a bilateral mixed hearing loss. The hearing levels for the right ear and the left ear were 52 dB and 68 dB, respectively. There were no remarkable findings in a computed tomography (CT) scan of the temporal bone. We suspected that she had otosclerosis, and an operation was performed on her left ear. When the incudostapedial joint (I-S joint) was exposed to investigate the movement of the stapes, a soft white band that ran under the superstructure of the stapes was noted. By using a nerve monitoring system, we confirmed that the white band was the bare facial nerve. The ossicular chain was normal, except for a malformed stape due to the facial nerve, and the footplate of the stapes was fixed. Therefore, she was diagnosed as having otosclerosis with an abnormal facial nerve pathway. The malformed superstructure of the stapes was removed carefully. When the ectopic facial nerve was shifted to anteroinferior side, the oval window could be seen. Stapedotomy using a Teflon piston prosthesis was performed with no complications. PMID:24581447

  12. Dark inorganic carbon fixation sustains the functioning of benthic deep-sea ecosystems

    NASA Astrophysics Data System (ADS)

    Molari, Massimiliano; Manini, Elena; Dell'Anno, Antonio

    2013-01-01

    studies have provided evidence that dark inorganic carbon fixation is an important process for the functioning of the ocean interior. However, its quantitative relevance and ecological significance in benthic deep-sea ecosystems remain unknown. We investigated the rates of inorganic carbon fixation together with prokaryotic abundance, biomass, assemblage composition, and heterotrophic carbon production in surface sediments of different benthic deep-sea systems along the Iberian margin (northeastern Atlantic Ocean) and in the Mediterranean Sea. Inorganic carbon fixation rates in these surface deep-sea sediments did not show clear depth-related patterns, and, on average, they accounted for 19% of the total heterotrophic biomass production. The incorporation rates of inorganic carbon were significantly related to the abundance of total Archaea (as determined by catalyzed reporter deposition fluorescence in situ hybridization) and completely inhibited using an inhibitor of archaeal metabolism, N1-guanyl-1,7-diaminoheptane. This suggests a major role of the archaeal assemblages in inorganic carbon fixation. We also show that benthic archaeal assemblages contribute approximately 25% of the total 3H-leucine incorporation. Inorganic carbon fixation in surface deep-sea sediments appears to be dependent not only upon chemosynthetic processes but also on heterotrophic/mixotrophic metabolism, as suggested by estimates of the chemolithotrophic energy requirements and the enhanced inorganic carbon fixation due to the increase in the availability of organic trophic resources. Overall, our data suggest that archaeal assemblages of surface deep-sea sediments are responsible for the high rates of inorganic carbon incorporation and thereby sustain the functioning of the food webs as well as influence the carbon cycling of benthic deep-sea ecosystems.

  13. In vivo implant fixation of carbon fiber-reinforced PEEK hip prostheses in an ovine model.

    PubMed

    Nakahara, Ichiro; Takao, Masaki; Bandoh, Shunichi; Bertollo, Nicky; Walsh, William R; Sugano, Nobuhiko

    2013-03-01

    Carbon fiber-reinforced polyetheretherketone (CFR/PEEK) is theoretically suitable as a material for use in hip prostheses, offering excellent biocompatibility, mechanical properties, and the absence of metal ions. To evaluate in vivo fixation methods of CFR/PEEK hip prostheses in bone, we examined radiographic and histological results for cementless or cemented CFR/PEEK hip prostheses in an ovine model with implantation up to 52 weeks. CFR/PEEK cups and stems with rough-textured surfaces plus hydroxyapatite (HA) coatings for cementless fixation and CFR/PEEK cups and stems without HA coating for cement fixation were manufactured based on ovine computed tomography (CT) data. Unilateral total hip arthroplasty was performed using cementless or cemented CFR/PEEK hip prostheses. Five cementless cups and stems and six cemented cups and stems were evaluated. On the femoral side, all cementless stems demonstrated bony ongrowth fixation and all cemented stems demonstrated stable fixation without any gaps at both the bone-cement and cement-stem interfaces. All cementless cases and four of the six cemented cases showed minimal stress shielding. On the acetabular side, two of the five cementless cups demonstrated bony ongrowth fixation. Our results suggest that both cementless and cemented CFR/PEEK stems work well for fixation. Cup fixation may be difficult for both cementless and cemented types in this ovine model, but bone ongrowth fixation on the cup was first seen in two cementless cases. Cementless fixation can be achieved using HA-coated CFR/PEEK implants, even under load-bearing conditions. PMID:23097319

  14. A model for diurnal patterns of carbon fixation in a Precambrian microbial mat based on a modern analog

    NASA Technical Reports Server (NTRS)

    Rothschild, L. J.

    1991-01-01

    Microbial mat communities are one of the first and most prevalent biological communities known from the Precambrian fossil record. These fossil mat communities are found as laminated sedimentary rock structures called stromatolites. Using a modern microbial mat as an analog for Precambrian stromatolites, a study of carbon fixation during a diurnal cycle under ambient conditions was undertaken. The rate of carbon fixation depends primarily on the availability of light (consistent with photosynthetic carbon fixation) and inorganic carbon, and not nitrogen or phosphorus. Atmospheric PCO2 is thought to have decreased from 10 bars at 4 Ga (10(9) years before present) to approximately 10(-4) bars today, implying a change in the availability of inorganic carbon for carbon fixation. Experimental manipulation of levels of inorganic carbon to levels that may have been available to Precambrian mat communities resulted in increased levels of carbon fixation during daylight hours. Combining these data with models of daylength during the Precambrian, models are derived for diurnal patterns of photosynthetic carbon fixation in a Precambrian microbial mat community. The models suggest that, even in the face of shorter daylengths during the Precambrian, total daily carbon fixation has been declining over geological time, with most of the decrease having occurred during the Precambrian.

  15. Earth Exploration Toolbook Chapter: Visualizing Carbon Pathways

    NSDL National Science Digital Library

    LuAnn Dahlman

    DATA: NASA Satellite Images TOOLS: ImageJ and Image Composite Explorer (ICE) of NASA Earth Observations (NEO). SUMMARY: Build animations of satellite data to illustrate and explore carbon pathways through the Earth system.

  16. Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

    PubMed Central

    Feist, Adam M.; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P.; Lovley, Derek R.; Zengler, Karsten

    2014-01-01

    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. PMID:24762737

  17. Carbon dioxide fixation and respiration relationships observed during closure experiments in Biosphere 2

    Microsoft Academic Search

    Mark Nelson; William Dempster; John P. Allen

    2008-01-01

    Biosphere 2 enclosed several ecosystems - ones analogous to rainforest, tropical savannah, thornscrub, desert, marsh and coral reef - and a diverse agro-ecology, with dozens of food crops, in virtual material isolation from Earth's environment. This permits a detailed examination of fixation and respiration from the continuous record of carbon dioxide concentration from sensors inside the facility. Unlike the Earth,

  18. Author's personal copy Radiation transfer in photobiological carbon dioxide fixation and fuel

    E-print Network

    Pilon, Laurent

    to photobiologically fixate carbon dioxide and convert solar energy into biofuels. Thus, careful radiation transfer of California, Los Angeles, 420 Westwood Plaza, Eng. IV 37-132, Los Angeles, CA 9095-1597, USA b Mechanical Street, Austin, TX 78705, USA a r t i c l e i n f o Article history: Received 26 April 2011 Received

  19. Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean

    PubMed Central

    Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M

    2013-01-01

    Bacteria and archaea in the dark ocean (>200?m) comprise 0.3–1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

  20. Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean.

    PubMed

    Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M

    2013-12-01

    Bacteria and archaea in the dark ocean (>200 m) comprise 0.3-1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

  1. Photosynthesis in Grass Species Differing in Carbon Dioxide Fixation Pathways

    PubMed Central

    Morgan, Jack A.; Brown, R. Harold

    1979-01-01

    Thirty-three grass species were examined in two experiments in an attempt to locate plants with photosynthetic responses to O2, CO2 compensation concentrations, and leaf anatomy intermediate to those of C3 and C4 species. Species examined included seven from the Laxa group in the Panicum genus, one of which, P. milioides Nees ex Trin., has been reported earlier to have intermediate characteristics. The species with O2-sensitive photosynthesis typical of C3 plants showed more than 37% increase in apparent photosynthesis at 2% O2 compared to 21% O2 at 25 C and 335 microliters per liter CO2, whereas in Panicum milioides, P. schenckii Hack., and P. decipiens Nees ex Trin., members of the Laxa group of Panicum, increases ranged from 25 to 30%. The remainder of the species did not respond to O2. Species with O2 responses characteristic of C3 plants exhibited CO2 compensation concentrations of 44 microliters per liter or higher at 21% O2 and 25 to 27.5 C and species characterized as O2-insensitive had values of microliters per liter or less. The CO2 compensation concentration (?) values of P. milioides, P. schenckii, and P. decipiens ranged from 10.3 to 23.3 microliters per liter. Other species of the Laxa group of Panicum exhibited O2 response and ? values of either C3 (P. laxum Sw., P. hylaeicum Mez., and P. rivulare Trin.) or C4 (P. prionitis Griseb.) plants. Leaves of species with O2 response and CO2 compensation values typical of C3 plants had poorly developed or nearly empty bundle sheath cells, and much larger distances and mesophyll cell numbers between veins than did the O2-insensitive ones. Vein spacings in P. milioides, P. schenckii, and P. decipiens ranged from 0.18 to 0.28 millimeter and mesophyll cell number between veins from 5.2 to 7.8. While these vein spacings are closer than those of most C3 grasses, two O2-sensitive species of Dactylis had vein spacings similar to these Panicums and veins in Glyceria striata, another O2-sensitive plant, were separated by only four mesophyll cells and 0.12 millimeter. Bundle sheath cells of the three intermediate Panicums contained greater quantities of organelles than are typical for C3 grasses. Images PMID:16660944

  2. Carbon and nitrogen fixation differ between successional stages of biological soil crusts in the Colorado Plateau and Chihuahuan Desert

    Microsoft Academic Search

    D. C. Housman; H. H. Powers; A. D. Collins; J. Belnap

    2006-01-01

    Biological soil crusts (cyanobacteria, mosses and lichens collectively) perform essential ecosystem services, including carbon (C) and nitrogen (N) fixation. Climate and land-use change are converting later successional soil crusts to early successional soil crusts with lower C and N fixation rates. To quantify the effect of such conversions on C and N dynamics in desert ecosystems we seasonally measured diurnal

  3. Autotrophic carbon dioxide fixation via the Calvin-Benson-Bassham cycle by the denitrifying methanotroph "Candidatus Methylomirabilis oxyfera".

    PubMed

    Rasigraf, Olivia; Kool, Dorien M; Jetten, Mike S M; Sinninghe Damsté, Jaap S; Ettwig, Katharina F

    2014-04-01

    Methane is an important greenhouse gas and the most abundant hydrocarbon in the Earth's atmosphere. Methanotrophic microorganisms can use methane as their sole energy source and play a crucial role in the mitigation of methane emissions in the environment. "Candidatus Methylomirabilis oxyfera" is a recently described intra-aerobic methanotroph that is assumed to use nitric oxide to generate internal oxygen to oxidize methane via the conventional aerobic pathway, including the monooxygenase reaction. Previous genome analysis has suggested that, like the verrucomicrobial methanotrophs, "Ca. Methylomirabilis oxyfera" encodes and transcribes genes for the Calvin-Benson-Bassham (CBB) cycle for carbon assimilation. Here we provide multiple independent lines of evidence for autotrophic carbon dioxide fixation by "Ca. Methylomirabilis oxyfera" via the CBB cycle. The activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO), a key enzyme of the CBB cycle, in cell extracts from an "Ca. Methylomirabilis oxyfera" enrichment culture was shown to account for up to 10% of the total methane oxidation activity. Labeling studies with whole cells in batch incubations supplied with either (13)CH4 or [(13)C]bicarbonate revealed that "Ca. Methylomirabilis oxyfera" biomass and lipids became significantly more enriched in (13)C after incubation with (13)C-labeled bicarbonate (and unlabeled methane) than after incubation with (13)C-labeled methane (and unlabeled bicarbonate), providing evidence for autotrophic carbon dioxide fixation. Besides this experimental approach, detailed genomic and transcriptomic analysis demonstrated an operational CBB cycle in "Ca. Methylomirabilis oxyfera." Altogether, these results show that the CBB cycle is active and plays a major role in carbon assimilation by "Ca. Methylomirabilis oxyfera" bacteria. Our results suggest that autotrophy might be more widespread among methanotrophs than was previously assumed and implies that a methanotrophic community in the environment is not necessarily revealed by (13)C-depleted lipids. PMID:24509918

  4. Autotrophic Carbon Dioxide Fixation via the Calvin-Benson-Bassham Cycle by the Denitrifying Methanotroph “Candidatus Methylomirabilis oxyfera”

    PubMed Central

    Kool, Dorien M.; Jetten, Mike S. M.; Sinninghe Damsté, Jaap S.; Ettwig, Katharina F.

    2014-01-01

    Methane is an important greenhouse gas and the most abundant hydrocarbon in the Earth's atmosphere. Methanotrophic microorganisms can use methane as their sole energy source and play a crucial role in the mitigation of methane emissions in the environment. “Candidatus Methylomirabilis oxyfera” is a recently described intra-aerobic methanotroph that is assumed to use nitric oxide to generate internal oxygen to oxidize methane via the conventional aerobic pathway, including the monooxygenase reaction. Previous genome analysis has suggested that, like the verrucomicrobial methanotrophs, “Ca. Methylomirabilis oxyfera” encodes and transcribes genes for the Calvin-Benson-Bassham (CBB) cycle for carbon assimilation. Here we provide multiple independent lines of evidence for autotrophic carbon dioxide fixation by “Ca. Methylomirabilis oxyfera” via the CBB cycle. The activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO), a key enzyme of the CBB cycle, in cell extracts from an “Ca. Methylomirabilis oxyfera” enrichment culture was shown to account for up to 10% of the total methane oxidation activity. Labeling studies with whole cells in batch incubations supplied with either 13CH4 or [13C]bicarbonate revealed that “Ca. Methylomirabilis oxyfera” biomass and lipids became significantly more enriched in 13C after incubation with 13C-labeled bicarbonate (and unlabeled methane) than after incubation with 13C-labeled methane (and unlabeled bicarbonate), providing evidence for autotrophic carbon dioxide fixation. Besides this experimental approach, detailed genomic and transcriptomic analysis demonstrated an operational CBB cycle in “Ca. Methylomirabilis oxyfera.” Altogether, these results show that the CBB cycle is active and plays a major role in carbon assimilation by “Ca. Methylomirabilis oxyfera” bacteria. Our results suggest that autotrophy might be more widespread among methanotrophs than was previously assumed and implies that a methanotrophic community in the environment is not necessarily revealed by 13C-depleted lipids. PMID:24509918

  5. Carbon dioxide fixation by microalgae photosynthesis using actual flue gas discharged from a boiler

    Microsoft Academic Search

    Masaaki Negoro; Akihiro Hamasaki; Yoshiaki Ikuta; Takenori Makita; Kohei Hirayama; Shinji Suzuki

    1993-01-01

    To mitigate the effects of carbon dioxide discharged from a boiler in a power plant, CO2 fixation by microalgae photosynthesis was studied. For the algae cultivation, actual flue gas from a boiler was used in two\\u000a sets of small-sized raceway-type cultivators installed at Tohoku Electric Power Company's Shin-Sendai power station. UsingNannochloropsis sp. NANNP-2 andPhaeodactylum sp. PHAEO-2 strains from the SERI

  6. Carbon dioxide fixation by microalgae photosynthesis using actual flue gas discharged from a boiler

    Microsoft Academic Search

    Masaaki Negoro; Akihiro Hamasaki; Yoshiaki Ikuta; Takenori Makita; Kohei Hirayama; Shinji Suzuki

    2009-01-01

    To mitigate the effects of carbon dioxide discharged from a boiler in a power plant, CO[sub 2] fixation by microalgae photosynthesis was studied. For the algae cultivation, actual flue gas from a boiler was used in two sets of small-sized raceway-type cultivators installed at Tohoku Electric Power Company's Shin-Sendai power station. Using Nannochloropsis sp. NANNP-2 and Phaeodactylum sp. PHAEO-2 strains

  7. Unravelling Carbon Fixation under Nutrient limited Conditions - a Water Column Perspective

    NASA Astrophysics Data System (ADS)

    Thomas, Helmuth; Craig, Susanne; Shadwick, Elizabeth H.; Li, William K.; Greenan, Blair J. W.

    2014-05-01

    Phytoplankton plays a critical role in the uptake of atmospheric carbon dioxide (CO2) by the ocean, and is comprised of a spectrum of cell sizes that are strongly regulated by oceanographic conditions. Elevated CO2 fixation relative to nutrient availability, also called carbon overconsumption, has been observed in various mid to high latitude systems, such as the Baltic and North Seas, the North Atlantic Ocean, the Canadian Arctic Archipelago or the Scotian Shelf. We shed light on this phenomenon relying on an extensive data set of water column observations of the CO2 system and phytoplankton cell counts from the Scotian Shelf, a temperate shelf sea. We show that in the summertime, the population of numerically abundant small cells, which favour warmer, nutrient poor conditions, accounts for approximately 20% of annual carbon uptake. At the broader scale, the neglection of this "non-Redfieldian" contribution typically leads to an underestimation of net community production by approximately 20% to 50%. These small cells are not well represented by chlorophyll a - the ubiquitously used proxy of phytoplankton biomass - but rather, are strongly correlated with surface water temperature. Given the persistent near-zero nutrient concentrations during the summer, it appears that small cells drive carbon overconsumption, and suggest that their role in carbon fixation will become increasingly important in a warming, increasingly stratified ocean.

  8. Chemoautotrophic Carbon Fixation Rates and Active Bacterial Communities in Intertidal Marine Sediments

    PubMed Central

    Boschker, Henricus T. S.; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W. C.; Moodley, Leon

    2014-01-01

    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, the Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m?2 d?1. Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)?1, which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  9. Chemoautotrophic carbon fixation rates and active bacterial communities in intertidal marine sediments.

    PubMed

    Boschker, Henricus T S; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W C; Moodley, Leon

    2014-01-01

    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, The Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m(-2) d(-1). Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)(-1), which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  10. Carboxysomal carbonic anhydrases: Structure and role in microbial CO2 fixation

    SciTech Connect

    Cannon, Gordon C.; Heinhorst, Sabine; Kerfeld, Cheryl A.

    2010-06-23

    Cyanobacteria and some chemoautotrophic bacteria are able to grow in environments with limiting CO2 concentrations by employing a CO2-concentrating mechanism (CCM) that allows them to accumulate inorganic carbon in their cytoplasm to concentrations several orders of magnitude higher than that on the outside. The final step of this process takes place in polyhedral protein microcompartments known as carboxysomes, which contain the majority of the CO2-fixing enzyme, RubisCO. The efficiency of CO2 fixation by the sequestered RubisCO is enhanced by co-localization with a specialized carbonic anhydrase that catalyzes dehydration of the cytoplasmic bicarbonate and ensures saturation of RubisCO with its substrate, CO2. There are two genetically distinct carboxysome types that differ in their protein composition and in the carbonic anhydrase(s) they employ. Here we review the existing information concerning the genomics, structure and enzymology of these uniquely adapted carbonic anhydrases, which are of fundamental importance in the global carbon cycle.

  11. PH-NEUTRAL CONCRETE FOR ATTACHED MICROALGAE AND ENHANCED CARBON DIOXIDE FIXATION - PHASE I

    SciTech Connect

    Kerry M. Dooley; F. Carl Knopf; Robert P. Gambrell

    1999-05-31

    The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SC-CO {sub 2})-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resistance) cement-based products. SC-CO{sub 2} can rapidly convert the calcium hydroxide in cured cement to calcium carbonate, which increases the density and unconfined compressive strength in the treated region. In cured concrete, this treated region is typically a several-mm thick layer (generally <{approx}5mm, unless treatment time is excessive). However, we have found that by treating the entire cement matrix with SC-CO{sub 2} as part of the curing process, we can carbonate it rapidly, regardless of the thickness. By ''rapidly'' we mean simultaneous carbonation/curing in < 5 ks even for large cement forms, compared to typical carbonation times of several days or even years at low pressures. Carbonation changes the pH in the treated region from {approx}13 to {approx}8, almost exactly compatible with seawater. Therefore the leaching rates from these cements is reduced. These cement improvements are directed to the development of strong but thin artificial reefs, to which can be attached microalgae used for the enhanced fixation of CO{sub 2}. It is shown below that attached microalgae, as algal beds or reefs, are more efficient for CO{sub 2} fixation by a factor of 20, compared to the open ocean on an area basis. We have performed preliminary tests of the pH-neutral cements of our invention for attachment of microalgae populations. We have found pH-neutral materials which attach microalgae readily. These include silica-enriched (pozzolanic) cements, blast-furnace slags and fly ash, which are also silica-rich. We have already developed technology to simultaneously foam, carbonate and cure the cements; this foaming process further increases cement surface areas for microalgae attachment, in some cases to >10 m{sup 2}/g internal surface area. This project involves a team of researchers with backgrounds in cement technology, supercritical fluid technology, materials science, oceanography, and wetland biogeochemistry.

  12. Genomic signatures of fifth autotrophic carbon assimilation pathway in bathypelagic Crenarchaeota

    PubMed Central

    La Cono, Violetta; Smedile, Francesco; Ferrer, Manuel; Golyshin, Peter N.; Giuliano, Laura; Yakimov, Michail M.

    2010-01-01

    Summary Marine Crenarchaeota, ubiquitous and abundant organisms in the oceans worldwide, remain metabolically uncharacterized, largely due to their low cultivability. Identification of candidate genes for bicarbonate fixation pathway in the Cenarchaeum symbiosum A was an initial step in understanding the physiology and ecology of marine Crenarchaeota. Recent cultivation and genome sequencing of obligate chemoautotrophic Nitrosopumilus maritimus SCM1 were a major breakthrough towards understanding of their functioning and provide a valuable model for experimental validation of genomic data. Here we present the identification of multiple key components of 3?hydroxipropionate/4?hydroxybutyrate cycle, the fifth pathway in carbon fixation, found in data sets of environmental sequences representing uncultivated superficial and bathypelagic Crenarchaeota from Sargasso sea (GOS data set) and KM3 (Mediterranean Sea) and ALOHA (Atlantic ocean) stations. These organisms are likely to use acetyl?CoA/propionyl?CoA carboxylase(s) as CO2?fixing enzyme(s) to form succinyl?CoA, from which one molecule of acetyl?CoA is regenerated via 4?hydroxybutyrate cleavage and another acetyl?CoA to be the pathway product. The genetic distinctiveness and matching sympatric abundance imply that marine crenarchaeal genotypes from the three different geographic sites share similar ecophysiological properties, and therefore may represent fundamental units of marine ecosystem functioning. To couple results of sequence comparison with the dark ocean primary production, dissolved inorganic carbon fixation rates were measured at KM3 Station (3000?m depth, Eastern Mediterranean Sea), i.e. at the same site and depth used for metagenomic library construction. PMID:21255356

  13. Lipid Biomarkers and Molecular Carbon Isotopes for Elucidating Carbon Cycling Pathways in Hydrothermal Vents

    NASA Astrophysics Data System (ADS)

    Zhang, C. L.; Dai, J.; Campbell, B.; Cary, C.; Sun, M.

    2003-12-01

    Increasing molecular evidence suggests that hydrothermal vents in mid-ocean ridges harbor large populations of free-living bacteria, particularly the epsilon Proteobacteria. However, pathways for carbon metabolism by these bacteria are poorly known. We are addressing this question by analyzing the lipid biomarkers and their isotope signatures in environments where the epsilon Proteobacteria are likely predominant. Solid materials were collected from hydrothermal vents in the East Pacific Rise and at the Guaymas Basin in the Gulf of California. Fatty acids extracted from these samples are dominated by 16:0 (27-41%), 18:0 (16-48%), 18:1 (11-42%), 16:1 (7-12%), and 14:0 (5-28%). In addition, 15:0 and anteiso-15:0 are significantly present (2-3%) in samples from the Guaymas Basin. The isotopic compositions of these fatty acids range from -15.0\\permil to -33.1\\permil with the most positive values occurring only in monounsaturated fatty acids (16:1 and 18:1). We are currently unable to assign these biomarkers to any of the epsilon Proteobacteria because biomarkers are poorly known for these organisms isolated from the vents. However, no polyunsaturated fatty acids were detected in these samples, which are consistent with the absence of vent animals at the sampling sites. Signature biomarkers of 20:1 and cy21:0, which are characteristic of the thermophilic chemolithoautotrophs such as Aquificales, are also absent in these samples. These results imply that the deeply branched Aquificales species do not constitute the major microbial community in these vent environments. The large range of molecular isotopic compositions suggests that these lipids are synthesized from various carbon sources with different isotopic compositions or through different biosynthetic pathways, or both. We are currently measuring the isotopic compositions of the total organic carbon in the bulk samples and will determine the fractionations between lipid biomarkers and the total organic carbon. Molecular DNA data from these vent environments indicate that the reversed TCA cycle may be used for CO2 fixation by the epsilon Proteobacteria for chemolithoautotrophic growth. Isotopic fractionation patterns between lipid biomarkers and the bulk organic carbon can provide independent information on this unique biosynthetic pathway.

  14. Predicting the Electron Requirement for Carbon Fixation in Seas and Oceans

    PubMed Central

    Lawrenz, Evelyn; Silsbe, Greg; Capuzzo, Elisa; Ylöstalo, Pasi; Forster, Rodney M.; Simis, Stefan G. H.; Prášil, Ond?ej; Kromkamp, Jacco C.; Hickman, Anna E.; Moore, C. Mark; Forget, Marie-Hélèn; Geider, Richard J.; Suggett, David J.

    2013-01-01

    Marine phytoplankton account for about 50% of all global net primary productivity (NPP). Active fluorometry, mainly Fast Repetition Rate fluorometry (FRRf), has been advocated as means of providing high resolution estimates of NPP. However, not measuring CO2-fixation directly, FRRf instead provides photosynthetic quantum efficiency estimates from which electron transfer rates (ETR) and ultimately CO2-fixation rates can be derived. Consequently, conversions of ETRs to CO2-fixation requires knowledge of the electron requirement for carbon fixation (?e,C, ETR/CO2 uptake rate) and its dependence on environmental gradients. Such knowledge is critical for large scale implementation of active fluorescence to better characterise CO2-uptake. Here we examine the variability of experimentally determined ?e,C values in relation to key environmental variables with the aim of developing new working algorithms for the calculation of ?e,C from environmental variables. Coincident FRRf and 14C-uptake and environmental data from 14 studies covering 12 marine regions were analysed via a meta-analytical, non-parametric, multivariate approach. Combining all studies, ?e,C varied between 1.15 and 54.2 mol e? (mol C)?1 with a mean of 10.9±6.91 mol e? mol C)?1. Although variability of ?e,C was related to environmental gradients at global scales, region-specific analyses provided far improved predictive capability. However, use of regional ?e,C algorithms requires objective means of defining regions of interest, which remains challenging. Considering individual studies and specific small-scale regions, temperature, nutrient and light availability were correlated with ?e,C albeit to varying degrees and depending on the study/region and the composition of the extant phytoplankton community. At the level of large biogeographic regions and distinct water masses, ?e,C was related to nutrient availability, chlorophyll, as well as temperature and/or salinity in most regions, while light availability was also important in Baltic Sea and shelf waters. The novel ?e,C algorithms provide a major step forward for widespread fluorometry-based NPP estimates and highlight the need for further studying the natural variability of ?e,C to verify and develop algorithms with improved accuracy. PMID:23516441

  15. Carbon and nitrogen fixation differ between successional stages of biological soil crusts in the Colorado Plateau and Chihuahuan Desert

    USGS Publications Warehouse

    Housman, D.C.; Powers, H.H.; Collins, A.D.; Belnap, J.

    2006-01-01

    Biological soil crusts (cyanobacteria, mosses and lichens collectively) perform essential ecosystem services, including carbon (C) and nitrogen (N) fixation. Climate and land-use change are converting later successional soil crusts to early successional soil crusts with lower C and N fixation rates. To quantify the effect of such conversions on C and N dynamics in desert ecosystems we seasonally measured diurnal fixation rates in different biological soil crusts. We classified plots on the Colorado Plateau (Canyonlands) and Chihuahuan Desert (Jornada) as early (Microcoleus) or later successional (Nostoc/Scytonema or Placidium/Collema) and measured photosynthesis (Pn), nitrogenase activity (NA), and chlorophyll fluorescence (Fv/Fm) on metabolically active (moist) soil crusts. Later successional crusts typically had greater Pn, averaging 1.2-1.3-fold higher daily C fixation in Canyonlands and 2.4-2.8-fold higher in the Jornada. Later successional crusts also had greater NA, averaging 1.3-7.5-fold higher daily N fixation in Canyonlands and 1.3-25.0-fold higher in the Jornada. Mean daily Fv/Fm was also greater in later successional Canyonlands crusts during winter, and Jornada crusts during all seasons except summer. Together these findings indicate conversion of soil crusts back to early successional stages results in large reductions of C and N inputs into these ecosystems.

  16. Insights into hydrogen bond donor promoted fixation of carbon dioxide with epoxides catalyzed by ionic liquids.

    PubMed

    Liu, Mengshuai; Gao, Kunqi; Liang, Lin; Wang, Fangxiao; Shi, Lei; Sheng, Li; Sun, Jianmin

    2015-02-28

    Catalytic coupling of carbon dioxide with epoxides to obtain cyclic carbonates is an important reaction that has been receiving renewed interest. In this contribution, the cycloaddition reaction in the presence of various hydrogen bond donors (HBDs) catalyzed by hydroxyl/carboxyl task-specific ionic liquids (ILs) is studied in detail. It was found that the activity of ILs could be significantly enhanced in the presence of ethylene glycol (EG), and EG/HEBimBr were the most efficient catalysts for the CO2 cycloaddition to propylene oxide. Moreover, the binary catalysts were also efficiently versatile for the CO2 cycloaddition to less active epoxides such as styrene oxide and cyclohexene oxide. Besides, the minimum energy paths for this hydrogen bond-promoted catalytic reaction were calculated using the density functional theory (DFT) method. The DFT results suggested that the ring-closing reaction was the rate-determining step in the HEBimBr-catalyzed cycloaddition reaction but the EG addition could remarkably reduce its energy barrier as the formation of a hydrogen bond between EG and the oxygen atom of epoxides led this process along the standard SN2 mechanism. As a result, the ring-opening reaction became the rate-determining step in the EG/HEBimBr-catalyzed cycloaddition reaction. The work reported herein helped the understanding and design of catalysts for efficient fixation of CO2 to epoxides via hydrogen bond activation. PMID:25639733

  17. Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5?-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

    PubMed Central

    Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

    2013-01-01

    Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5?- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae. PMID:23585853

  18. Microbial microstratification, inorganic carbon photoassimilation and dark carbon fixation at the chemocline of the meromictic Lake Cadagno (Switzerland) and its relevance to the food web

    Microsoft Academic Search

    Antonio Camacho; Jonathan Erez; Alvaro Chicote; Máximo Florín; Margaret M. Squires; Christine Lehmann; Reinhard Backofen

    2001-01-01

    The microstratification of the microbial community at the chemocline of Lake Cadagno and the associated inorganic carbon fixation activity was studied by fine layer sampling. A deep chlorophyll maximum caused by diatoms overlying Cryptomonas was found at the upper edge of the chemocline. A high population density of phototrophic sulphur bacteria, mainly Amoebobacter cf. purpureus, occurred closely below the oxic-anoxic

  19. Establishment of microbial eukaryotic enrichment cultures from a chemically stratified antarctic lake and assessment of carbon fixation potential.

    PubMed

    Dolhi, Jenna M; Ketchum, Nicholas; Morgan-Kiss, Rachael M

    2012-01-01

    Lake Bonney is one of numerous permanently ice-covered lakes located in the McMurdo Dry Valleys, Antarctica. The perennial ice cover maintains a chemically stratified water column and unlike other inland bodies of water, largely prevents external input of carbon and nutrients from streams. Biota are exposed to numerous environmental stresses, including year-round severe nutrient deficiency, low temperatures, extreme shade, hypersalinity, and 24-hour darkness during the winter (1). These extreme environmental conditions limit the biota in Lake Bonney almost exclusively to microorganisms (2). Single-celled microbial eukaryotes (called "protists") are important players in global biogeochemical cycling (3) and play important ecological roles in the cycling of carbon in the dry valley lakes, occupying both primary and tertiary roles in the aquatic food web. In the dry valley aquatic food web, protists that fix inorganic carbon (autotrophy) are the major producers of organic carbon for organotrophic organisms (4, 2). Phagotrophic or heterotrophic protists capable of ingesting bacteria and smaller protists act as the top predators in the food web (5). Last, an unknown proportion of the protist population is capable of combined mixotrophic metabolism (6, 7). Mixotrophy in protists involves the ability to combine photosynthetic capability with phagotrophic ingestion of prey microorganisms. This form of mixotrophy differs from mixotrophic metabolism in bacterial species, which generally involves uptake dissolved carbon molecules. There are currently very few protist isolates from permanently ice-capped polar lakes, and studies of protist diversity and ecology in this extreme environment have been limited (8, 4, 9, 10, 5). A better understanding of protist metabolic versatility in the simple dry valley lake food web will aid in the development of models for the role of protists in the global carbon cycle. We employed an enrichment culture approach to isolate potentially phototrophic and mixotrophic protists from Lake Bonney. Sampling depths in the water column were chosen based on the location of primary production maxima and protist phylogenetic diversity (4, 11), as well as variability in major abiotic factors affecting protist trophic modes: shallow sampling depths are limited for major nutrients, while deeper sampling depths are limited by light availability. In addition, lake water samples were supplemented with multiple types of growth media to promote the growth of a variety of phototrophic organisms. RubisCO catalyzes the rate limiting step in the Calvin Benson Bassham (CBB) cycle, the major pathway by which autotrophic organisms fix inorganic carbon and provide organic carbon for higher trophic levels in aquatic and terrestrial food webs (12). In this study, we applied a radioisotope assay modified for filtered samples (13) to monitor maximum carboxylase activity as a proxy for carbon fixation potential and metabolic versatility in the Lake Bonney enrichment cultures. PMID:22546995

  20. Establishment of Microbial Eukaryotic Enrichment Cultures from a Chemically Stratified Antarctic Lake and Assessment of Carbon Fixation Potential

    PubMed Central

    Dolhi, Jenna M.; Ketchum, Nicholas; Morgan-Kiss, Rachael M.

    2012-01-01

    Lake Bonney is one of numerous permanently ice-covered lakes located in the McMurdo Dry Valleys, Antarctica. The perennial ice cover maintains a chemically stratified water column and unlike other inland bodies of water, largely prevents external input of carbon and nutrients from streams. Biota are exposed to numerous environmental stresses, including year-round severe nutrient deficiency, low temperatures, extreme shade, hypersalinity, and 24-hour darkness during the winter 1. These extreme environmental conditions limit the biota in Lake Bonney almost exclusively to microorganisms 2. Single-celled microbial eukaryotes (called "protists") are important players in global biogeochemical cycling 3 and play important ecological roles in the cycling of carbon in the dry valley lakes, occupying both primary and tertiary roles in the aquatic food web. In the dry valley aquatic food web, protists that fix inorganic carbon (autotrophy) are the major producers of organic carbon for organotrophic organisms 4, 2. Phagotrophic or heterotrophic protists capable of ingesting bacteria and smaller protists act as the top predators in the food web 5. Last, an unknown proportion of the protist population is capable of combined mixotrophic metabolism 6, 7. Mixotrophy in protists involves the ability to combine photosynthetic capability with phagotrophic ingestion of prey microorganisms. This form of mixotrophy differs from mixotrophic metabolism in bacterial species, which generally involves uptake dissolved carbon molecules. There are currently very few protist isolates from permanently ice-capped polar lakes, and studies of protist diversity and ecology in this extreme environment have been limited 8, 4, 9, 10, 5. A better understanding of protist metabolic versatility in the simple dry valley lake food web will aid in the development of models for the role of protists in the global carbon cycle. We employed an enrichment culture approach to isolate potentially phototrophic and mixotrophic protists from Lake Bonney. Sampling depths in the water column were chosen based on the location of primary production maxima and protist phylogenetic diversity 4, 11, as well as variability in major abiotic factors affecting protist trophic modes: shallow sampling depths are limited for major nutrients, while deeper sampling depths are limited by light availability. In addition, lake water samples were supplemented with multiple types of growth media to promote the growth of a variety of phototrophic organisms. RubisCO catalyzes the rate limiting step in the Calvin Benson Bassham (CBB) cycle, the major pathway by which autotrophic organisms fix inorganic carbon and provide organic carbon for higher trophic levels in aquatic and terrestrial food webs 12. In this study, we applied a radioisotope assay modified for filtered samples 13 to monitor maximum carboxylase activity as a proxy for carbon fixation potential and metabolic versatility in the Lake Bonney enrichment cultures. PMID:22546995

  1. Evolution and Adaptation of Phytoplankton Photosynthetic Pathways to perturbations of the geological carbon system

    NASA Astrophysics Data System (ADS)

    Rickaby, R. E.; Young, J. N.; Hermoso, M.; Heureux, A.; McCLelland, H.; Lee, R.; Eason Hubbard, M.

    2012-12-01

    The ocean and atmosphere carbon system has varied greatly over geological history both in response to initial evolutionary innovation, and as a driver of adaptive change. Here we establish that positive selection in Rubisco, the most abundant enzyme on the Earth responsible for all photosynthetic carbon fixation, occurred early in Earth's history, and basal to the radiation of the modern marine algal groups. Our signals of positive selection appear to be triggered by changing intracellular concentrations of carbon dioxide (CO2) due to the emergence of carbon concentrating mechanisms between 1.56 and 0.41 Ba in response to declining atmospheric CO2 . We contend that, at least in terms of carbon, phytoplankton generally were well poised to manage subsequent abrupt carbon cycle perturbations. The physiological pathways for optimising carbon acquisition across a wide range of ambient carbon dioxide concentrations had already been established and were genetically widespread across open ocean phytoplankton groups. We will further investigate some case studies from the Mesozoic and Cenozoic abrupt carbon cycle excursions using isotopic tools to probe the community photosynthetic response and demonstrate the flexibility of phytoplankton photosynthesis in the face of major perturbations. In particular, an unprecedented resolution record across the Toarcian (Early Jurassic) carbon isotope excursion in the Paris Basin reveals a selection and evolution towards a community reliant solely on diffusive carbon dioxide supply for photosynthesis at the height of the excursion at 1500-2500 ppm CO2. The continued flourishing of the phytoplankton biological pump throughout this excursion was able to remove the excess carbon injected into the water column in less than 45 kyrs.

  2. Characterization of microalgae-bacteria consortium cultured in landfill leachate for carbon fixation and lipid production.

    PubMed

    Zhao, Xin; Zhou, Yan; Huang, Sheng; Qiu, Duanyang; Schideman, Lance; Chai, Xiaoli; Zhao, Youcai

    2014-03-01

    The characteristics of cultivating high-density microalgae-bacteria consortium with landfill leachate was tested in this study. Landfill leachate was collected from Laogang landfill operated for over 10 years in Shanghai, China. The maximum biomass concentration of 1.58g L(-1) and chlorophyll a level of 22mg L(-1) were obtained in 10% leachate spike ratio. Meanwhile, up to 90% of the total nitrogen in landfill leachate was removed in culture with 10% leachate spike ratio with a total nitrogen concentration of 221.6mg L(-1). The fluorescence peak of humic-like organic matters red shifted to longer wavelengths by the end of culture, indicating that microalgae-bacteria consortium was effective for treating landfill leachate contaminants. Furthermore, with the leachate spike ratio of 10%, the maximum lipid productivity and carbon fixation were 24.1 and 65.8mg L(-1)d(-1), respectively. Results of this research provide valuable information for optimizing microalgae culture in landfill leachate. PMID:24525217

  3. Biology of a widespread uncultivated archaeon that contributes to carbon fixation in the subsurface.

    PubMed

    Probst, Alexander J; Weinmaier, Thomas; Raymann, Kasie; Perras, Alexandra; Emerson, Joanne B; Rattei, Thomas; Wanner, Gerhard; Klingl, Andreas; Berg, Ivan A; Yoshinaga, Marcos; Viehweger, Bernhard; Hinrichs, Kai-Uwe; Thomas, Brian C; Meck, Sandra; Auerbach, Anna K; Heise, Matthias; Schintlmeister, Arno; Schmid, Markus; Wagner, Michael; Gribaldo, Simonetta; Banfield, Jillian F; Moissl-Eichinger, Christine

    2014-01-01

    Subsurface microbial life contributes significantly to biogeochemical cycling, yet it remains largely uncharacterized, especially its archaeal members. This 'microbial dark matter' has been explored by recent studies that were, however, mostly based on DNA sequence information only. Here, we use diverse techniques including ultrastuctural analyses to link genomics to biology for the SM1 Euryarchaeon lineage, an uncultivated group of subsurface archaea. Phylogenomic analyses reveal this lineage to belong to a widespread group of archaea that we propose to classify as a new euryarchaeal order ('Candidatus Altiarchaeales'). The representative, double-membraned species 'Candidatus Altiarchaeum hamiconexum' has an autotrophic metabolism that uses a not-yet-reported Factor420-free reductive acetyl-CoA pathway, confirmed by stable carbon isotopic measurements of archaeal lipids. Our results indicate that this lineage has evolved specific metabolic and structural features like nano-grappling hooks empowering this widely distributed archaeon to predominate anaerobic groundwater, where it may represent an important carbon dioxide sink. PMID:25425419

  4. Rates of fixation by lightning of carbon and nitrogen in possible primitive atmospheres

    NASA Technical Reports Server (NTRS)

    Chameides, W. L.; Walker, J. C. G.

    1981-01-01

    A thermochemical-hydrodynamic model of the production of trace species by electrical discharges has been used to estimate the rates of fixation of C and N by lightning in the primitive atmosphere. Calculations for various possible mixtures of CH4, CO2, CO, N2, H2, and H2O reveal that the prime species produced were probably HCN and NO and that the key parameter determining the rates of fixation was the ratio of C atoms to O atoms in the atmosphere. Atmospheres with C more abundant than O have large HCN fixation rates, in excess of 10 to the 17th molecules/J, but small NO yields. However, when O is more abundant than C, the NO fixation rate approaches 10 to the 17th molecules/J while the HCN yield is small. The implications for the evolution of life are discussed.

  5. Modeling the effect of nitrogen fixation on carbon and nitrogen fluxes at BATS

    Microsoft Academic Search

    Raleigh R Hood; Nicholas R Bates; Douglas G Capone; Donald B Olson

    2001-01-01

    Recent geochemical estimates of N2-fixation in the North Atlantic ocean indicate rates that are significantly higher than those derived from direct observations. In this paper different N2-fixation rate scenarios are explored using a one-dimensional, biogeochemical model that includes an explicit representation of Trichodesmium. This model reproduces most of the observed interannual variability in phytoplankton production and generates seasonal Trichodesmium biomass

  6. The reallocation of carbon in P deficient lupins affects biological nitrogen fixation.

    PubMed

    Kleinert, Aleysia; Venter, Mauritz; Kossmann, Jens; Valentine, Alexander

    2014-11-01

    It is not known how phosphate (P) deficiency affects the allocation of carbon (C) to biological nitrogen fixation (BNF) in legumes. The alteration of the respiratory and photosynthetic C costs of BNF was investigated under P deficiency. Although BNF can impose considerable sink stimulation on host respiratory and photosynthetic C, it is not known how the change in the C and energy allocation during P deficiency may affect BNF. Nodulated Lupinus luteus plants were grown in sand culture, using a modified Long Ashton nutrient solution containing no nitrogen (N) for ca. four weeks, after which one set was exposed to a P-deficient nutrient medium, while the other set continued growing on a P-sufficient nutrient medium. Phosphorus stress was measured at 20 days after onset of P-starvation. During P stress the decline in nodular P levels was associated with lower BNF and nodule growth. There was also a shift in the balance of photosynthetic and respiratory C toward a loss of C during P stress. Below-ground respiration declined under limiting P conditions. However, during this decline there was also a shift in the proportion of respiratory energy from maintenance toward growth respiration. Under P stress, there was an increased allocation of C toward root growth, thereby decreasing the amount of C available for maintenance respiration. It is therefore possible that the decline in BNF under P deficiency may be due to this change in resource allocation away from respiration associated with direct nutrient uptake, but rather toward a long term nutrient acquisition strategy of increased root growth. PMID:25155758

  7. Role of dark carbon dioxide fixation in root nodules of soybean. [Rhizobium japonicum

    SciTech Connect

    King, B.J.; Layzell, D.B.; Canvin, D.T.

    1986-05-01

    The magnitude and role of dark Co/sub 2/ fixation were examined in nodules of intact soybean plants (Harosoy 63 x Rhizobium japonicum strain USDA 16). The estimated rate of nodule dark CO/sub 2/ fixation, based on a 2 minute pulse-feed with /sup 14/CO/sub 2/ under saturating conditions, was 102 micromoles per gram dry weight per hour. This was equivalent to 14% of net nodule respiration. Only 18% of this CO/sub 2/ fixation was estimated to be required for organic and amino acid synthesis for growth and export processes. The major portion (75-92%) of fixed label was released as CO/sub 2/ within 60 minutes. The labeling pattern during pulse-chase experiments was consistent with CO/sub 2/ fixation by phosphoenolpyruvate carboxylase. During the chase, the greatest loss of label occurred in organic acids. Exposure of nodulated roots to Ar:O/sub 2/(80:20) did not affect dark CO/sub 2/ fixation, while exposure to O/sub 2/:CO/sub 2/(95:5) resulted in 54% inhibition. From these results, it was concluded that at least 66% of dark CO/sub 2/ fixation in soybean may be involved with the production of organic acids, which when oxidized would be capable of providing at least 48% of the requirement for ATP equivalents to support nitrogenase activity.

  8. Simultaneous quantification of active carbon- and nitrogen-fixing communities and estimation of fixation rates using fluorescence in situ hybridization and flow cytometry.

    PubMed

    McInnes, Allison S; Shepard, Alicia K; Raes, Eric J; Waite, Anya M; Quigg, Antonietta

    2014-11-01

    Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and (14)C/(15)N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

  9. Simultaneous Quantification of Active Carbon- and Nitrogen-Fixing Communities and Estimation of Fixation Rates Using Fluorescence In Situ Hybridization and Flow Cytometry

    PubMed Central

    Shepard, Alicia K.; Raes, Eric J.; Waite, Anya M.; Quigg, Antonietta

    2014-01-01

    Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and 14C/15N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

  10. Enhancing Carbon Fixation by Metabolic Engineering: A Model System of Complex Network Modulation

    SciTech Connect

    Dr. Gregory Stephanopoulos

    2008-04-10

    In the first two years of this research we focused on the development of a DNA microarray for transcriptional studies in the photosynthetic organism Synechocystis and the elucidation of the metabolic pathway for biopolymer synthesis in this organism. In addition we also advanced the molecular biological tools for metabolic engineering of biopolymer synthesis in Synechocystis and initiated a series of physiological studies for the elucidation of the carbon fixing pathways and basic central carbon metabolism of these organisms. During the last two-year period we focused our attention on the continuation and completion of the last task, namely, the development of tools for basic investigations of the physiology of these cells through, primarily, the determination of their metabolic fluxes. The reason for this decision lies in the importance of fluxes as key indicators of physiology and the high level of information content they carry in terms of identifying rate limiting steps in a metabolic pathway. While flux determination is a well-advanced subject for heterotrophic organisms, for the case of autotrophic bacteria, like Synechocystis, some special challenges had to be overcome. These challenges stem mostly from the fact that if one uses {sup 13}C labeled CO{sub 2} for flux determination, the {sup 13}C label will mark, at steady state, all carbon atoms of all cellular metabolites, thus eliminating the necessary differentiation required for flux determination. This peculiarity of autotrophic organisms makes it imperative to carry out flux determination under transient conditions, something that had not been accomplished before. We are pleased to report that we have solved this problem and we are now able to determine fluxes in photosynthetic organisms from stable isotope labeling experiments followed by measurements of label enrichment in cellular metabolites using Gas Chromatography-Mass Spectrometry. We have conducted extensive simulations to test the method and also are presently validating it experimentally using data generated in collaboration with a research group at Purdue University. As result of these studies we can now determine, for the first time, fluxes in photosynthetic organisms and, eventually, in plants.

  11. Engineering the Cyanobacterial Carbon Concentrating Mechanism for Enhanced CO2 Capture and Fixation

    SciTech Connect

    Sandh, Gustaf; Cai, Fei; Shih, Patrick; Kinney, James; Axen, Seth; Salmeen, Annette; Zarzycki, Jan; Sutter, Markus; Kerfeld, Cheryl

    2011-06-02

    In cyanobacteria CO2 fixation is localized in a special proteinaceous organelle, the carboxysome. The CO2 fixation enzymes are encapsulated by a selectively permeable protein shell. By structurally and functionally characterizing subunits of the carboxysome shell and the encapsulated proteins, we hope to understand what regulates the shape, assembly and permeability of the shell, as well as the targeting mechanism and organization of the encapsulated proteins. This knowledge will be used to enhance CO2 fixation in both cyanobacteria and plants through synthetic biology. The same strategy can also serve as a template for the production of modular synthetic bacterial organelles. Our research is conducted using a variety of techniques such as genomic sequencing and analysis, transcriptional regulation, DNA synthesis, synthetic biology, protein crystallization, Small Angle X-ray Scattering (SAXS), protein-protein interaction assays and phenotypic characterization using various types of cellular imaging, e.g. fluorescence microscopy, Transmission Electron Microscopy (TEM), and Soft X-ray Tomography (SXT).

  12. Carbon fixation prediction during a bloom of Emiliania huxleyi is highly sensitive to the assumed regulation mechanism

    NASA Astrophysics Data System (ADS)

    Bernard, O.; Sciandra, A.; Rabouille, S.

    2009-05-01

    Large scale precipitation of calcium carbonate in the oceans by coccolithophorids plays an important role in carbon sequestration. However, there is a controversy on the effect of an increase in atmospheric CO2 concentration on both calcification and photosynthesis of coccolithophorids. Indeed recent experiments, performed under nitrogen limitation, revealed that the associated fluxes may be slowed down, while other authors claim the reverse. We designed models to account for various scenarii of calcification and photosynthesis regulation in chemostat cultures of Emiliania huxleyi, based on different hypotheses on the regulation mechanism. These models consider that either carbon dioxide, bicarbonate, carbonate or calcite saturation state (?) is the regulating factor. All were calibrated to predict the same carbon fixation rate in nowadays pCO2, but they turn out to respond differently to an increase in CO2 concentration. Thus, using the four possible models, we simulated a large bloom of Emiliania huxleyi. It results that models assuming a regulation by CO32- or ? predicted much higher carbon fluxes. The response when considering a doubled pCO2 was different and models controlled by CO2 or HCO3 - led to increased carbon fluxes. In addition, the variability between the various scenarii proved to be in the same order of magnitude than the response to pCO2 increase. These sharp discrepancies reveal the consequences of model assumptions on the simulation outcome.

  13. Transitions in pathways of human development and carbon emissions

    NASA Astrophysics Data System (ADS)

    Lamb, W. F.; Steinberger, J. K.; Bows-Larkin, A.; Peters, G. P.; Roberts, J. T.; Wood, F. R.

    2014-01-01

    Countries are known to follow diverse pathways of life expectancy and carbon emissions, but little is known about factors driving these dynamics. In this letter we estimate the cross-sectional economic, demographic and geographic drivers of consumption-based carbon emissions. Using clustering techniques, countries are grouped according to their drivers, and analysed with respect to a criteria of one tonne of carbon emissions per capita and a life expectancy over 70 years (Goldemberg’s Corner). Five clusters of countries are identified with distinct drivers and highly differentiated outcomes of life expectancy and carbon emissions. Representatives from four clusters intersect within Goldemberg’s Corner, suggesting diverse combinations of drivers may still lead to sustainable outcomes, presenting many countries with an opportunity to follow a pathway towards low-carbon human development. By contrast, within Goldemberg’s Corner, there are no countries from the core, wealthy consuming nations. These results reaffirm the need to address economic inequalities within international agreements for climate mitigation, but acknowledge plausible and accessible examples of low-carbon human development for countries that share similar underlying drivers of carbon emissions. In addition, we note differences in drivers between models of territorial and consumption-based carbon emissions, and discuss interesting exceptions to the drivers-based cluster analysis.

  14. Ammonia fixation by humic substances: A nitrogen-15 and carbon-13 NMR study

    USGS Publications Warehouse

    Thorn, K.A.; Mikita, M.A.

    1992-01-01

    The process of ammonia fixation has been studied in three well characterized and structurally diverse fulvic and humic acid samples. The Suwannee River fulvic acid, and the IHSS peat and leonardite humic acids, were reacted with 15N-labelled ammonium hydroxide, and analyzed by liquid phase 15N NMR spectrometry. Elemental analyses and liquid phase 13C NMR spectra also were recorded on the samples before and after reaction with ammonium hydroxide. The largest increase in percent nitrogen occurred with the Suwannee River fulvic acid, which had a nitrogen content of 0.88% before fixation and 3.17% after fixation. The 15N NMR spectra revealed that ammonia reacted similarly with all three samples, indicating that the functional groups which react with ammonia exist in structural configurations common to all three samples. The majority of nitrogcn incorporated into the samples appears to be in the form of indole and pyrrole nitrogen, followed by pyridine, pyrazine, amide and aminohydroquinone nitrogen. Chemical changes in the individual samples upon fixation could not be discerned from the 13C NMR spectra.

  15. Single cell protein production of Euglena gracilis and carbon dioxide fixation in an innovative photo-bioreactor.

    PubMed

    Chae, S R; Hwang, E J; Shin, H S

    2006-01-01

    The biological fixation using microalgae has been known as an effective and economical carbon dioxide reduction technology. Carbon dioxide (CO2) fixation by microalgae has been shown to be effective and economical. Among various algae, a species Euglena gracilis was selected as it has advantages such as high protein content and high digestibility for animal feed. A kinetic model was studied in order to determine the relationship between specific growth rate and light intensity. The half-saturation constant for light intensity in the Monod model was 178.7 micromol photons/m2/s. The most favorable initial pH, temperature, and CO2 concentration were found to be 3.5, 27 degrees C, and 5-10% (vol/vol), respectively. Light intensity and hydraulic retention time were tested for effects on cell yield in a laboratory-scale photo-bioreactor of 100l working volume followed by semi-continuous and continuous culture. Subsequently, an innovative pilot-scale photo-bioreactor that used sunlight and flue gas was developed to increase production of this bioresource. The proposed pilot-scale reactor showed improved cell yield compared with the laboratory-scale reactor. PMID:16171688

  16. Rates of fixation by lightning of carbon and nitrogen in possible primitive atmospheres

    Microsoft Academic Search

    W. L. Chameides; J. C. G. Walker

    1981-01-01

    A thermochemical-hydrodynamic model of the production of trace species by electrical discharges has been used to estimate the rates of fixation of C and N by lightning in the primitive atmosphere. Calculations for various possible mixtures of CH4, CO2, N2, H2, and H2O reveal that the prime species produced were probably HCN and NO and that the key parameter determining

  17. Trichodesmium in coastal waters of Tanzania: diversity, seasonality, nitrogen and carbon fixation

    Microsoft Academic Search

    Charles Lugomela; Thomas J. Lyimo; Ian Bryceson; Adelaida K. Semesi; Birgitta Bergman

    2002-01-01

    Seasonal distribution, nitrogen fixation and primary productivity of Trichodesmium species were intermittently studied in the coastal waters of Tanzania. Samples were collected in 1975\\/6, 1980, 1993\\/4, 1994\\/5 and 1998\\/9. Four colony forming species were found, i.e. T. erythraeum, T. tenue, T. thiebautii and one unidentified Trichodesmium sp. while T. contortum was rarely encountered, and only as individual trichomes. T. erythraeum

  18. Carbon metabolism and strobilation in Cassiopea andromedea (Cnidaria: Scyphozoa): Significance of endosymbiotic dinoflagellates

    Microsoft Academic Search

    D. K. Hofmann; B. P. Kremer

    1981-01-01

    Scyphopolyps and scyphomedusae of Cassiopea andromeda Forskål (Cnidaria, Scyphozoa) containing dinoflagellate endosymbionts (zooxanthellae) were investigated for rates and pathways of carbon fixation. Photosynthesis by the algae, accounting for 80 and 15 µmol C h-1 on a dry weight basis in medusae and polyps, respectively, by far exceeds dark incorporation of inorganic carbon by the intact association. Photosynthetic carbon fixation is

  19. Pathways of human development and carbon emissions embodied in trade

    NASA Astrophysics Data System (ADS)

    Steinberger, Julia K.; Timmons Roberts, J.; Peters, Glen P.; Baiocchi, Giovanni

    2012-02-01

    It has long been assumed that human development depends on economic growth, that national economic expansion in turn requires greater energy use and, therefore, increased greenhouse-gas emissions. These interdependences are the topic of current research. Scarcely explored, however, is the impact of international trade: although some nations develop socio-economically and import high-embodied-carbon products, it is likely that carbon-exporting countries gain significantly fewer benefits. Here, we use new consumption-based measures of national carbon emissions to explore how the relationship between human development and carbon changes when we adjust national emission rates for trade. Without such adjustment of emissions, some nations seem to be getting far better development `bang' for the carbon `buck' than others, who are showing scant gains for disproportionate shares of global emissions. Adjusting for the transfer of emissions through trade explains many of these outliers, but shows that further socio-economic benefits are accruing to carbon-importing rather than carbon-exporting countries. We also find that high life expectancies are compatible with low carbon emissions but high incomes are not. Finally, we see that, despite strong international trends, there is no deterministic industrial development trajectory: there is great diversity in pathways, and national histories do not necessarily follow the global trends.

  20. Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use

    SciTech Connect

    Kleiner, Manuel [Max Planck Institute for Marine Microbiology; Wentrop, C. [Max Planck Institute for Marine Microbiology; Lott, C. [Max Planck Institute for Marine Microbiology; Teeling, Hanno [Max Planck Institute for Marine Microbiology; Wetzel, Silke [Max Planck Institute for Marine Microbiology; Young, Jacque C [ORNL; Chang, Y. [Oak Ridge National Laboratory (ORNL); Shah, Manesh B [ORNL; Verberkmoes, Nathan C [ORNL; Zarzycki, Jan [University of Freiburg, Germany; Fuchs, Georg [University of Freiburg, Germany; Markert, Stephanie [Institute of Marine Biotechnology, Germany; Hempel, Kristina [Institute for Microbiology, Germany

    2012-01-01

    Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such as sulfide and CO2. Remarkably little is known about the physiological strategies that enable chemosynthetic symbioses to colonize oligotrophic environments. In this study, we used metaproteomics and metabolomics to investigate the intricate network of metabolic interactions in the chemosynthetic association between Olavius algarvensis, a gutless marine worm, and its bacterial symbionts. We propose novel pathways for coping with energy and nutrient limitation, some of which may be widespread in both free-living and symbiotic bacteria. These include (i) a pathway for symbiont assimilation of the host waste products acetate, propionate, succinate and malate, (ii) the potential use of carbon monoxide as an energy source, a substrate previously not known to play a role in marine invertebrate symbioses, (iii) the potential use of hydrogen as an energy source, (iv) the strong expression of high affinity uptake transporters, and (v) novel energy efficient steps in CO2 fixation and sulfate reduction. The high expression of proteins involved in pathways for energy and carbon uptake and conservation in the O. algarvensis symbiosis indicates that the oligotrophic nature of its environment exerted a strong selective pressure in shaping these associations.

  1. RuBP limitation of photosynthetic carbon fixation during NH sub 3 assimilation: Interactions between photosynthesis, respiration, and ammonium assimilation in N-limited green algae

    SciTech Connect

    Elrifi, I.R.; Holmes, J.J.; Weger, H.G.; Mayo, W.P.; Turpin, D.H. (Queen's Univ., Kingston, Ontario (Canada))

    1988-06-01

    The effects of ammonium assimilation on photosynthetic carbon fixation and O{sub 2} exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP) concentration and the RuBP binding site density of ribulose bisphosphate carboxylase/oxygenase (Rubisco). In both species, ammonium assimilation resulted in a decrease in RuBP concentration. In S. minutum the concentration fell below the RuBP binding site density of Rubisco, indicating RuBP limitation of carboxylation. In contrast, RuBP concentration remained above the binding site density in C. pyrenoidosa. Compromising RuBP regeneration in C. pyrenoidosa with low light resulted in an ammonium-induced decrease in RuBP concentration below the RuBP binding site density of Rubisco. This resulted in a decrease in photosynthetic carbon fixation. In both species, ammonium assimilation resulted in a larger decrease in net O{sub 2} evolution than in carbon fixation. Mass spectrometric analysis shows this to be a result of an increase in the rate of mitochondrial respiration in the light.

  2. Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L

    SciTech Connect

    Singal, H.R.; Sheoran, I.S.; Singh, R.

    1987-04-01

    Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwall and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.

  3. Antioxidant pathways are up-regulated during biological nitrogen fixation to prevent ROS-induced nitrogenase inhibition in Gluconacetobacter diazotrophicus

    PubMed Central

    Oliveira, Jose Henrique M.; Nogueira, Eduardo M.; Guedes, Helma V.; Oliveira, Pedro L.; Câmara, Fernando; Baldani, Jose I.; Martins, Orlando B.

    2010-01-01

    Gluconacetobacter diazotrophicus, an endophyte isolated from sugarcane, is a strict aerobe that fixates N2. This process is catalyzed by nitrogenase and requires copious amounts of ATP. Nitrogenase activity is extremely sensitive to inhibition by oxygen and reactive oxygen species (ROS). However, the elevated oxidative metabolic rates required to sustain biological nitrogen fixation (BNF) may favor an increased production of ROS. Here, we explored this paradox and observed that ROS levels are, in fact, decreased in nitrogen-fixing cells due to the up-regulation of transcript levels of six ROS-detoxifying genes. A cluster analyses based on common expression patterns revealed the existence of a stable cluster with 99.8% similarity made up of the genes encoding the ?-subunit of nitrogenase Mo–Fe protein (nifD), superoxide dismutase (sodA) and catalase type E (katE). Finally, nitrogenase activity was inhibited in a dose-dependent manner by paraquat, a redox cycler that increases cellular ROS levels. Our data revealed that ROS can strongly inhibit nitrogenase activity, and G. diazotrophicus alters its redox metabolism during BNF by increasing antioxidant transcript levels resulting in a lower ROS generation. We suggest that careful controlled ROS production during this critical phase is an adaptive mechanism to allow nitrogen fixation. PMID:20697694

  4. Carbon dioxide fixation by microalgae photosynthesis using actual flue gas discharged from a boiler

    SciTech Connect

    Matsumoto, Hiroyo; Shioji, Norio; Hamasaki, Akihiro [Mitsubishi Heavy Industries, Ltd., Hyogo (Japan)] [and others

    1995-12-31

    To mitigate CO{sub 2} discharged from thermal power plants, studies on CO{sub 2} fixation by the photosynthesis of microalgae using actual exhaust gas have been carried out. The results are as follows: (1) A method is proposed for evaluating the maximum photosynthesis rate in the raceway cultivator using only the algal physical properties; (2) Outdoor cultivation tests taking actual flue gas were performed with no trouble or break throughout 1 yr using the strain collected in the test; (3) The produced microalgae is effective as solid fuel; and (4) The feasibility studies of this system were performed. The system required large land area, but the area is smaller than that required for other biomass systems, such as tree farms.

  5. Nitrogen Fixation (Acetylene Reduction) in a Salt Marsh Amended with Sewage Sludge and Organic Carbon and Nitrogen Compounds 1

    PubMed Central

    Hanson, Roger B.

    1977-01-01

    Seasonal distribution of nitrogen fixation by Spartina alterniflora epiphytes and in surface and soil samples was investigated in a Georgia salt marsh which was amended with sewage sludge or with glucose and/or ammonium nitrate. There was no significant difference between the rates of fixation in the unamended and sewage sludge plots. Additional perturbation experiments suggested that nitrogen addition indirectly stimulates nitrogen fixation by enhancing Spartina production and root exudation. Glucose additions, on the other hand, suppressed nitrogen fixation on a long-term basis. It is suggested that the microbial population in the soil out-competed the plants for the available nitrogen and in turn suppressed plant production and possibly root exudation. A comparison of nitrogen fixation in clipped and unclipped Spartina plots substantiated the suggestion that root exudation probably supports nitrogen fixation. Fixation in the clipped plots was significantly lower (P < 0.05) than the rates in the unclipped plots. PMID:16345239

  6. Fixation and distribution of bacterial activity in sand to induce carbonate precipitation for ground reinforcement

    Microsoft Academic Search

    Marien P. Harkes; Leon A. van Paassen; Jacco L. Booster; Victoria S. Whiffin; Mark C. M. van Loosdrecht

    2010-01-01

    The mechanical properties of soil (cohesion, friction, stiffness and permeability) are important parameters for engineering constructions and ecosystems in sedimentary environments. BioGrout is an in situ soil strengthening technique involving microbial-induced carbonate precipitation (MICP). This process involves hydrolysis of urea by bacteria containing the enzyme urease in the presence of dissolved calcium ions, resulting in calcium carbonate precipitation. In order

  7. Pathways of organic carbon oxidation in three continental margin sediments

    NASA Technical Reports Server (NTRS)

    Canfield, D. E.; Jorgensen, B. B.; Fossing, H.; Glud, R.; Gundersen, J.; Ramsing, N. B.; Thamdrup, B.; Hansen, J. W.; Nielsen, L. P.; Hall, P. O.

    1993-01-01

    We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and Mn reduction) has probably been well underestimated.

  8. Significance of non-sinking particulate organic carbon and dark CO2 fixation to heterotrophic carbon demand in the mesopelagic northeast Atlantic

    NASA Astrophysics Data System (ADS)

    Baltar, Federico; Arístegui, Javier; Sintes, Eva; Gasol, Josep M.; Reinthaler, Thomas; Herndl, Gerhard J.

    2010-05-01

    It is generally assumed that sinking particulate organic carbon (POC) constitutes the main source of organic carbon supply to the deep ocean's food webs. However, a major discrepancy between the rates of sinking POC supply (collected with sediment traps) and the prokaryotic organic carbon demand (the total amount of carbon required to sustain the heterotrophic metabolism of the prokaryotes; i.e., production plus respiration, PCD) of deep-water communities has been consistently reported for the dark realm of the global ocean. While the amount of sinking POC flux declines exponentially with depth, the concentration of suspended, buoyant non-sinking POC (nsPOC; obtained with oceanographic bottles) exhibits only small variations with depth in the (sub)tropical Northeast Atlantic. Based on available data for the North Atlantic we show here that the sinking POC flux would contribute only 4-12% of the PCD in the mesopelagic realm (depending on the primary production rate in surface waters). The amount of nsPOC potentially available to heterotrophic prokaryotes in the mesopelagic realm can be partly replenished by dark dissolved inorganic carbon fixation contributing between 12% to 72% to the PCD daily. Taken together, there is evidence that the mesopelagic microheterotrophic biota is more dependent on the nsPOC pool than on the sinking POC supply. Hence, the enigmatic major mismatch between the organic carbon demand of the deep-water heterotrophic microbiota and the POC supply rates might be substantially smaller by including the potentially available nsPOC and its autochthonous production in oceanic carbon cycling models.

  9. Photosynthesis of Grass Species Differing in Carbon Dioxide Fixation Pathways 1

    PubMed Central

    Brown, R. Harold; Bouton, Joseph H.; Rigsby, Luanne; Rigler, Mark

    1983-01-01

    Ultrastructural studies of leaves of seven Panicum species in or closely related to the Laxa group and classified as C3, C4 or C3-C4 intermediate were undertaken to examine features associated with C3 and C4 photosynthesis. The C3 species Panicum rivulare Trin. had few organelles in bundle sheath cell profiles (2 chloroplasts, 1.1 mitochondria, and 0.3 peroxisomes per cell section) compared to an average of 10.6 chloroplasts, 17.7 mitochondria, and 3.2 peroxisomes per bundle sheath cell profile for three C3-C4 species, Panicum milioides Nees ex Trin., Panicum decipiens Nees ex Trin. and Panicum schenckii Hack. However, two other C3 species, Panicum laxum Sw. and Panicum hylaeicum Mez, contained about 0.7, 0.5, and 0.3 as many chloroplasts, mitochondria, and peroxisomes, respectively, as in bundle sheath cell profiles of the C3-C4 species. Chloroplasts and mitochondria in bundle sheath cells were larger than those in mesophyll cells for the C4 species Panicum prionitis Griseb. and the C3-C4 species, but in C3 species the organelles were similar in size or were smaller in the bundle sheath cells. The C3-C4 species and P. laxum and P. hylaeicum exhibited an unusually close association of organelles in bundle sheath cells with mitochondria frequently surrounded in profile by chloroplasts. The high concentrations in bundle sheath cells of somewhat larger organelles than in mesophyll cells correlates with the reduced photorespiration of the C3-C4 species. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:16662841

  10. Znbr2-based Choline Chloride Ionic Liquid for Efficient Fixation of CO2 to Cyclic Carbonate

    Microsoft Academic Search

    Weiguo Cheng; Zengzeng Fu; Jinquan Wang; Jian Sun; Suojiang Zhang

    2012-01-01

    In this work, ZnBr2-based choline chloride (CH) was first investigated to catalyze the synthesis of cyclic carbonates from CO2 and epoxides under solventless condition. It was demonstrated that ZnBr2-based CH was very efficient and selective. Under the optimum reaction conditions, 99% yield of propylene carbonate was achieved. The catalyst can be reused for five times without loss of catalytic activity.

  11. Pathways to Adoption of Carbon Capture and Sequestration in India: Technologies and Policies

    E-print Network

    Pathways to Adoption of Carbon Capture and Sequestration in India: Technologies and Policies, Technology and Policy Program #12;2 #12;Pathways to Carbon Capture and Sequestration in India: Technologies to control India's emissions will have to be a global priority. Carbon capture and sequestration (CCS) can

  12. Carbon nanopipettes characterize calcium release pathways in breast cancer cells

    NASA Astrophysics Data System (ADS)

    Schrlau, Michael G.; Brailoiu, Eugen; Patel, Sandip; Gogotsi, Yury; Dun, Nae J.; Bau, Haim H.

    2008-08-01

    Carbon-based nanoprobes are attractive for minimally invasive cell interrogation but their application in cell physiology has thus far been limited. We have developed carbon nanopipettes (CNPs) with nanoscopic tips and used them to inject calcium-mobilizing messengers into cells without compromising cell viability. We identify pathways sensitive to cyclic adenosine diphosphate ribose (cADPr) and nicotinic acid adenine dinucleotide phosphate (NAADP) in breast carcinoma cells. Our findings demonstrate the superior utility of CNPs for intracellular delivery of impermeant molecules and, more generally, for cell physiology studies. The CNPs do not appear to cause any lasting damage to cells. Their advantages over commonly used glass pipettes include smaller size, breakage and clogging resistance, and potential for multifunctionality such as in concurrent injection and electrical measurements.

  13. Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities

    PubMed Central

    Kellermann, Matthias Y.; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe

    2012-01-01

    The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope–probing experiments with and without methane. The relative incorporation of 13C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both 13C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs. PMID:23129626

  14. AN EXPERIMENTAL SEPARATION OF OXYGEN LIBERATION FROM CARBON DIOXIDE FIXATION IN PHOTOSYNTHESIS BY CHLORELLA

    PubMed Central

    Fan, C. S.; Stauffer, J. F.; Umbreit, W. W.

    1943-01-01

    Using intact cells of Chlorella pyrenoidosa it is possible to obtain oxygen by the reduction of certain reducible materials other than carbon dioxide. Of these, benzaldehyde was studied in some detail. This reduction does not involve the production of carbon dioxide from the benzaldehyde. Stoichiometrical relationships as expressed by the following equation: 2C6H5CHO + 2H2O ? 2C6H5CH2OH + O2 are somewhat difficult to obtain because the benzaldehyde can disappear from the reaction mixtures by dark reactions. The technique is now available which permits detailed studies of the oxygen-liberating mechanisms in photosynthesis. PMID:19873369

  15. Regulation of photosynthetic carbon fixation on the ocean margins. Final report

    SciTech Connect

    Paul, J.H.

    1997-06-01

    The US Department of Energy is concerned with the fate of energy-related materials, including carbon dioxide, in the marine environment. Using laboratory studies, as well as field studies, an attempt was made to understand the molecular regulation of photosynthetic carbon reduction. The objectives were: to determine the mechanism of regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBPCase) in phytoplankton in response to changes in light fields; and to determine regulation of (RuBPCase) in response to light under nutrient deprivation.

  16. Nitrogen-Dependent Carbon Fixation by Picoplankton In Culture and in the Mississippi River

    SciTech Connect

    Aubrey Smith; Marguerite W. Coomes; Thomas E. Smith

    2005-04-30

    The pepc gene, which encodes phosphoenolpyruvate carboxylase (PEPC), of the marine cyanobacterium Synechococcus PCC 7002, was isolated and sequenced. PEPC is an anaplerotic enzyme, but it may also contribute to overall CO2 fixation through β-carboxylation reactions. A consensus sequence generated by aligning the pepc genes of Anabaena variabilis, Anacystis nidulans and Synechocystis PCC 6803 was used to design two sets of primers that were used to amplify segments of Synechococcus PCC 7002 pepc. In order to isolate the gene, the sequence of the PCR product was used to search for the pepc nucleotide sequence from the publicly available genome of Synechococcus PCC 7002. At the time, the genome for this organism had not been completed although sequences of a significant number of its fragments are available in public databases. Thus, the major challenge was to find the pepc gene among those fragments and to complete gaps as necessary. Even though the search did not yield the complete gene, PCR primers were designed to amplify a DNA fragment using a high fidelity thermostable DNA polymerase. An open reading frame (ORF) consisting of 2988 base pairs coding for 995 amino acids was found in the 3066 bp PCR product. The pepc gene had a GC content of 52% and the deduced protein had a calculated molecular mass of 114,049 Da. The amino acid sequence was closely related to that of PEPC from other cyanobacteria, exhibiting 59-61% identity. The sequence differed significantly from plant and E. coli PEPC with only 30% homology. However, comparing the Synechococcus PCC 7002 sequence to the recently resolved E. coli PEPC revealed that most of the essential domains and amino acids involved in PEPC activity were shared by both proteins. The recombinant Synechococcus PCC 7002 PEPC was expressed in E. coli.

  17. Chemolithotrophic nitrite oxidation by Nitrobacter: coupling with carbon dioxide fixation for growth and influence of metal ions and inorganic compounds of sulfur

    SciTech Connect

    Tsai, Y.L.

    1986-01-01

    The growth of Nitrobacter winogradskyi was completely inhibited by 0.1 mM persulfate, 0.5 mM tetrathionate, or by 5 mM each of dithionite, metabisulfite, or trithionate. The oxygen uptake activity of washed N. agilis cell suspensions was not influenced by persulfate or tetrathionate. Carbon dioxide fixation was insensitive to tetrathionate and in fact an enhancement by tetrathionate was observed. Persulfate inhibited the fixation of carbon dioxide only at a high concentration. The oxygen uptake activity of washed ell suspensions of N. agilis was tested in the presence of copper, nickel, aluminum, uranyl, and molybdate ions. Copper ion was slightly stimulatory at 0.17 M and strongly inhibitory at 17 mM. Molybdate ion showed either slight enhancement or no inhibition at all test concentrations. With the other test ions inhibition of oxygen uptake was observed.

  18. Thermodynamics and high-pressure kinetics of a fast carbon dioxide fixation reaction by a (2,6-pyridinedicarboxamidato-hydroxo)nickel(II) complex.

    PubMed

    Troeppner, O; Huang, D; Holm, R H; Ivanovi?-Burmazovi?, I

    2014-04-14

    The previously reported carbon dioxide fixation reaction by the planar terminal hydroxide complex [Ni(pyN2(Me2))(OH)](1-) in DMF has been further characterized by determination of the equilibrium constants K(eq)²?? = 2.4 ± 0.2 × 10(5) M(-1) and K(eq)²²³ = 1.3 ± 0.1 × 10(7) M(-1), as well as the volume of activation for the CO2 binding (?V(on)(?223) = -21 ± 3 cm(3) mol(-1)) and back decarboxylation (?V(off)(?223) = -13 ± 1 cm(3) mol(-1)) by high-pressure kinetics. The data are consistent with an earlier DFT computation, including the probable nature of the transition state, and support designating the reaction as one of the most completely investigated carbon dioxide fixation reactions of any type. PMID:24572679

  19. A hypersaline microbial mat from the Pacific Atoll Kiritimati: insights into composition and carbon fixation

    E-print Network

    Gilli, Adrian

    A hypersaline microbial mat from the Pacific Atoll Kiritimati: insights into composition and carbon 6 School of Oceanography, University of Washington, Seattle, WA, USA ABSTRACT Modern microbial mats phototrophic microbial mat system from a hypersaline lake on Kiritimati (Christmas Island) in the Northern Line

  20. Carbonate hydroxyapatite functionalization: a comparative study towards (bio)molecules fixation

    PubMed Central

    Russo, Laura; Taraballi, Francesca; Lupo, Cristina; Poveda, Ana; Jiménez-Barbero, Jesús; Sandri, Monica; Tampieri, Anna; Nicotra, Francesco; Cipolla, Laura

    2014-01-01

    Different methods for the functionalization of carbonate hydroxyapatite granules with free amine groups by reaction with (3-aminopropyl)triethoxysilane (APTES) have been compared in order to improve the potential for tethering of bioactive molecules to bioceramics. The combined use of tetraethoxyorthosilicate and APTES with acid catalysis resulted in an evident increase in amine surface grafting. PMID:24501671

  1. Factors influencing carbon fixation and water use by mediterranean sclerophyll shrubs during summer drought

    Microsoft Academic Search

    J. D. Tenhunen; A. Sala Serra; P. C. Harley; R. L. Dougherty; J. F. Reynolds

    1990-01-01

    Mediterranean sclerophyll shrubs respond to seasonal drought by adjusting the amount of leaf area exposed and by reducing gas exchange via stomatal closure mechanisms. The degree to which each of these modifications can influence plant carbon and water balances under typical mediterranean-type climate conditions is examined. Leaf area changes are assessed in the context of a canopy structure and light

  2. Carbon-carbon bond formation pathways in CO hydrogenation to higher alcohols

    SciTech Connect

    Xu, M.; Iglesia, E.

    1999-11-15

    Carbon-carbon bond formation pathways during CO hydrogenation to higher alcohols were studied on alkali-promoted Cu-based catalysts (K-CuMgCeO{sub x} and Cs-Cu/ZnO/Al{sub 2}O{sub 3}) using {sup 13}CO/H{sub 2}/{sup 12}CH{sub 3}OH reactants. C-C bonds in ethanol form via two pathways, direct reactions of {sup 13}CO and direct coupling of {sup 12}CH{sub 3}OH. On K-CU{sub 0.5}Mg{sub 5}CeO{sub x}, direct reactions of {sup 13}CO are the predominant pathway for the initial C-C bond steps. On Cs-Cu/ZnO/Al{sub 2}O{sub 3}, ethanol is predominantly formed via direct coupling of oxygen-containing C{sub 1} intermediates derived from {sup 12}CH{sub 3}OH. Ca{sup +} cations introduce a methanol-coupling pathway unavailable on catalysts without Cs{sup +} promoter, leading to higher alcohol synthesis rates. After ethanol formation, additional chain growth occurs via aldol-type coupling pathways using C{sub 1} intermediates derived from {sup 12}CH{sub 3}OH on both K-Cu{sub 0.5}Mg{sub 5}CeO{sub x} and Cs-Cu/ZnO/Al{sub 2}O{sub 3} catalysts.

  3. Urea Uptake and Carbon Fixation by Marine Pelagic Bacteria and Archaea during the Arctic Summer and Winter Seasons

    PubMed Central

    Connelly, Tara L.; Baer, Steven E.; Cooper, Joshua T.; Bronk, Deborah A.

    2014-01-01

    How Arctic climate change might translate into alterations of biogeochemical cycles of carbon (C) and nitrogen (N) with respect to inorganic and organic N utilization is not well understood. This study combined 15N uptake rate measurements for ammonium, nitrate, and urea with 15N- and 13C-based DNA stable-isotope probing (SIP). The objective was to identify active bacterial and archeal plankton and their role in N and C uptake during the Arctic summer and winter seasons. We hypothesized that bacteria and archaea would successfully compete for nitrate and urea during the Arctic winter but not during the summer, when phytoplankton dominate the uptake of these nitrogen sources. Samples were collected at a coastal station near Barrow, AK, during August and January. During both seasons, ammonium uptake rates were greater than those for nitrate or urea, and nitrate uptake rates remained lower than those for ammonium or urea. SIP experiments indicated a strong seasonal shift of bacterial and archaeal N utilization from ammonium during the summer to urea during the winter but did not support a similar seasonal pattern of nitrate utilization. Analysis of 16S rRNA gene sequences obtained from each SIP fraction implicated marine group I Crenarchaeota (MGIC) as well as Betaproteobacteria, Firmicutes, SAR11, and SAR324 in N uptake from urea during the winter. Similarly, 13C SIP data suggested dark carbon fixation for MGIC, as well as for several proteobacterial lineages and the Firmicutes. These data are consistent with urea-fueled nitrification by polar archaea and bacteria, which may be advantageous under dark conditions. PMID:25063662

  4. Urea uptake and carbon fixation by marine pelagic bacteria and archaea during the Arctic summer and winter seasons.

    PubMed

    Connelly, Tara L; Baer, Steven E; Cooper, Joshua T; Bronk, Deborah A; Wawrik, Boris

    2014-10-01

    How Arctic climate change might translate into alterations of biogeochemical cycles of carbon (C) and nitrogen (N) with respect to inorganic and organic N utilization is not well understood. This study combined 15N uptake rate measurements for ammonium, nitrate, and urea with 15N- and 13C-based DNA stable-isotope probing (SIP). The objective was to identify active bacterial and archeal plankton and their role in N and C uptake during the Arctic summer and winter seasons. We hypothesized that bacteria and archaea would successfully compete for nitrate and urea during the Arctic winter but not during the summer, when phytoplankton dominate the uptake of these nitrogen sources. Samples were collected at a coastal station near Barrow, AK, during August and January. During both seasons, ammonium uptake rates were greater than those for nitrate or urea, and nitrate uptake rates remained lower than those for ammonium or urea. SIP experiments indicated a strong seasonal shift of bacterial and archaeal N utilization from ammonium during the summer to urea during the winter but did not support a similar seasonal pattern of nitrate utilization. Analysis of 16S rRNA gene sequences obtained from each SIP fraction implicated marine group I Crenarchaeota (MGIC) as well as Betaproteobacteria, Firmicutes, SAR11, and SAR324 in N uptake from urea during the winter. Similarly, 13C SIP data suggested dark carbon fixation for MGIC, as well as for several proteobacterial lineages and the Firmicutes. These data are consistent with urea-fueled nitrification by polar archaea and bacteria, which may be advantageous under dark conditions. PMID:25063662

  5. Biochemistry and control of the reductive tricarboxylic acid pathway of CO2 fixation and physiological role of the RubisCO-like protein

    SciTech Connect

    Tabita, F Robert

    2008-12-04

    During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris. 1. Reductive TCA pathway of CO2 assimilation Many diverse microorganisms use the reductive TCA (RTCA) pathway for CO2 assimilation. Included are photoautotrophic and chemoautotrophic organisms that occupy important niches in various ecosystems. Inasmuch as the biochemistry and regulation of the RTCA pathway has been virtually neglected, especially in comparison to the Calvin-Benson-Bassham (CBB) reductive pentose pathway of CO2 fixation, we sought to develop a system that would allow for detailed biochemical analysis of the RTCA enzymes and associated proteins, along with the genes that encode these proteins. We have focused on the green sulfur photosynthetic bacterium Chlorobium tepidum, a fast growing moderate thermophile originally isolated by Professor Mike Madigan and colleagues. Because of its rapid growth and relative ease to produce massive cell amounts via high-density fermentator vessels, C. tepidum has become the organism of choice for investigators interested in studying all aspects of the physiology and biochemistry of green sulfur bacteria. Moreover, this organism possesses a very convenient natural transformation system that allows routine genetic transfer and the generation of knockout mutations via homologous recombination at specific genetic loci. The first such mutations were generated in our laboratory [Hanson & Tabita, PNAS USA, 98 (2001), 4397-4402], such that these protocols have now become relatively routine. Moreover, the genome of C. tepidum was recently sequenced. Thus, all the tools are in place for productive analysis of key processes catalyzed by this organism, in particular for analysis of the RTCA pathway and the rather unique RubisCO-like protein (RLP) that we first discovered during the last grant period of this project [Hanson & Tabita, 2001]. We have concentrated on the enzymology of the key proteins of this pathway, in particular pyruvate synthase (PS), ?-ketoglutarate synthase (KGS), and ATP-citrate lyase (ACL). In addition, we have also focused on key electron transfer proteins that must provide needed reducing equivalents to PS and KGS, including two separate ferredoxins that were shown to be abundantly produced by this organism. 2. Physiological/biochemical/genetic studies on the RubisCO-like Protein (RLP) During the prior grant period we identified what we believe is an evolutional precursor to bona fide RubisCO in C. tepidum, the RubisCO-like protein (RLP) [Hanson & Tabita, 2001]. Typical bioinformatics software incorrectly indicates that RLP is RubisCO, however our previous experience with RubisCO enabled us to establish that C. tepidum RLP has substitutions in 9 out of the 19 residues known to be important for RubisCO-catalyzed CO2 fixation. After purifying recombinant RLP, we showed that the RLP is not a bona fide RubisCO that catalyzes RuBP-dependent CO2 fixation, but appears to function in some aspect of the oxidation of reduced sulfur compounds by this organism. More recent studies [Hanson & Tabita, Photosynth. Res. 78 (2003) 231-248] during the past grant period have established that this effect is related to some aspect of thiosulfate oxidation in the reduced sulfur compound oxidation pathway, as sulfide oxidation was not affected. When we first discovered the RLP, we noted that RLP homologs were also found in other organisms, including heterotrophic bacteria and at least one archaeon [Hanson & Tabita, 2001, 2003]. Finally, as long-time Rubiscologists we have always been intrigued with how the active site of RubisCO might have evolved for its key functional role in metabolizing CO2 and O2 [Tabita, Photosynth. Res. 60 (1999) 1-

  6. Experimental and Computational Insights into Carbon Dioxide Fixation by RZnOH Species.

    PubMed

    Soko?owski, Kamil; Bury, Wojciech; Tulewicz, Adam; Cie?lak, Anna M; Justyniak, Iwona; Kubicki, Dominik; Krajewska, El?bieta; Milet, Anne; Moszy?ski, Robert; Lewi?ski, Janusz

    2015-03-27

    Organozinc hydroxides, RZnOH, possessing the proton-reactive alkylzinc group and the CO2 -reactive Zn?OH group, represent an intriguing group of organometallic precursors for the synthesis of novel zinc carbonates. Comprehensive experimental and computational investigations on 1)?solution and solid-state behavior of tBuZnOH (1) species in the presence of Lewis bases, namely, THF and 4-methylpyridine; 2)?step-by-step sequence of the reaction between 1 and CO2 ; and 3)?the effect of a donor ligand and/or an excess of tBu2 Zn as an external proton acceptor on the reaction course are reported. DFT calculations for the insertion of carbon dioxide into the dinuclear alkylzinc hydroxide 12 are fully consistent with (1) H?NMR spectroscopy studies and indicate that this process is a multistep reaction, in which the insertion of CO2 seems to be the rate-determining step. Moreover, DFT studies show that the mechanism of the rearrangement between key intermediates, that is, the primary alkylzinc bicarbonate with a proximal position of hydrogen and the secondary alkylzinc bicarbonate with a distal position of hydrogen, most likely proceeds through internal rotation of the dinuclear bicarbonate. PMID:25693575

  7. Will elevated carbon dioxide concentration amplify the benefits of nitrogen fixation in legumes?

    SciTech Connect

    Rogers, A.; Ainsworth, E. A.; Leakey, A. D. B.

    2009-11-01

    Growth at elevated [CO{sub 2}] stimulates photosynthesis and increases carbon (C) supply in all C3 species. A sustained and maximal stimulation in productivity at elevated [CO{sub 2}] requires an enhanced nutrient supply to match the increase in C acquisition. The ability of legumes to exchange C for nitrogen (N) with their N{sub 2}-fixing symbionts has led to the hypothesis that legumes will have a competitive advantage over nonleguminous species when grown at elevated [CO{sub 2}]. On balance, evidence suggests that in managed systems, legumes are more responsive to elevated [CO{sub 2}] than other plants (e.g. Ainsworth and Long, 2005); however, in natural ecosystems, nutrient availability can limit the response of legumes to elevated [CO{sub 2}] (Hungate et al., 2004; van Groenigen et al., 2006). Here, we consider these observations, outline the mechanisms that underlie them, and examine recent work that advances our understanding of how legumes respond to growth at elevated [CO{sub 2}]. First we highlight the global importance of legumes and provide a brief overview of the symbiotic relationship.

  8. How sensitive are estimates of carbon fixation in agricultural models to input data?

    PubMed Central

    2012-01-01

    Background Process based vegetation models are central to understand the hydrological and carbon cycle. To achieve useful results at regional to global scales, such models require various input data from a wide range of earth observations. Since the geographical extent of these datasets varies from local to global scale, data quality and validity is of major interest when they are chosen for use. It is important to assess the effect of different input datasets in terms of quality to model outputs. In this article, we reflect on both: the uncertainty in input data and the reliability of model results. For our case study analysis we selected the Marchfeld region in Austria. We used independent meteorological datasets from the Central Institute for Meteorology and Geodynamics and the European Centre for Medium-Range Weather Forecasts (ECMWF). Land cover / land use information was taken from the GLC2000 and the CORINE 2000 products. Results For our case study analysis we selected two different process based models: the Environmental Policy Integrated Climate (EPIC) and the Biosphere Energy Transfer Hydrology (BETHY/DLR) model. Both process models show a congruent pattern to changes in input data. The annual variability of NPP reaches 36% for BETHY/DLR and 39% for EPIC when changing major input datasets. However, EPIC is less sensitive to meteorological input data than BETHY/DLR. The ECMWF maximum temperatures show a systematic pattern. Temperatures above 20°C are overestimated, whereas temperatures below 20°C are underestimated, resulting in an overall underestimation of NPP in both models. Besides, BETHY/DLR is sensitive to the choice and accuracy of the land cover product. Discussion This study shows that the impact of input data uncertainty on modelling results need to be assessed: whenever the models are applied under new conditions, local data should be used for both input and result comparison. PMID:22296931

  9. 14C Fixation by Leaves and Leaf Cell Protoplasts of the Submerged Aquatic Angiosperm Potamogeton lucens: Carbon Dioxide or Bicarbonate? 1

    PubMed Central

    Staal, Marten; Elzenga, J. Theo M.; Prins, Hidde B. A.

    1989-01-01

    Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is, acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant. PMID:16666848

  10. A model of biogeochemical cycles of carbon, nitrogen and phosphorus including symbiotic nitrogen fixation and phosphatase production.

    NASA Astrophysics Data System (ADS)

    Wang, Y.; Houlton, B.; Field, C. B.

    2006-12-01

    Global climate models have not yet considered the effects of nutrient cycles and limitation when forecasting carbon uptake by the terrestrial biosphere into the future. Using the principle of resource optimization, we here develop a new theory by which C, N and P cycles interact. Our model is able to replicate the observed responses of net primary production to nutrient additions in N-limited, N and P co-limited, and P-limited environments. Our framework identifies a new pathway by which N2 fixers can alter P availability: by investing in N-rich phosphorus liberation enzymes (phosphatases), fixers can greatly accelerate soil P availability and its cycling rates. This is critical for the successive invasion and establishment of N2 fixers into an N limited environment. We conclude that our model can be used to examine nutrient limitation broadly, and thus offers promise for coupling the biogeochemical system of C, N, and P to broader climate-system models.

  11. Oxygen Pathways and Carbon Dioxide Utilization in Methane Partial Oxidation in Ambient Temperature

    E-print Network

    Mallinson, Richard

    Oxygen Pathways and Carbon Dioxide Utilization in Methane Partial Oxidation in Ambient Temperature and lower environmental impacts make this the carbon-based fuel of choice well into the twenty-first century into enhance- ment of the carbon balance of methane conversion by reforming with CO2 in order to "recycle

  12. Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata

    PubMed Central

    Ponsard, Julie; Cambon-Bonavita, Marie-Anne; Zbinden, Magali; Lepoint, Gilles; Joassin, André; Corbari, Laure; Shillito, Bruce; Durand, Lucile; Cueff-Gauchard, Valérie; Compère, Philippe

    2013-01-01

    The shrimp Rimicaris exoculata dominates several hydrothermal vent ecosystems of the Mid-Atlantic Ridge and is thought to be a primary consumer harbouring a chemoautotrophic bacterial community in its gill chamber. The aim of the present study was to test current hypotheses concerning the epibiont's chemoautotrophy, and the mutualistic character of this association. In-vivo experiments were carried out in a pressurised aquarium with isotope-labelled inorganic carbon (NaH13CO3 and NaH14CO3) in the presence of two different electron donors (Na2S2O3 and Fe2+) and with radiolabelled organic compounds (14C-acetate and 3H-lysine) chosen as potential bacterial substrates and/or metabolic by-products in experiments mimicking transfer of small biomolecules from epibionts to host. The bacterial epibionts were found to assimilate inorganic carbon by chemoautotrophy, but many of them (thick filaments of epsilonproteobacteria) appeared versatile and able to switch between electron donors, including organic compounds (heterotrophic acetate and lysine uptake). At least some of them (thin filamentous gammaproteobacteria) also seem capable of internal energy storage that could supply chemosynthetic metabolism for hours under conditions of electron donor deprivation. As direct nutritional transfer from bacteria to host was detected, the association appears as true mutualism. Import of soluble bacterial products occurs by permeation across the gill chamber integument, rather than via the digestive tract. This first demonstration of such capabilities in a decapod crustacean supports the previously discarded hypothesis of transtegumental absorption of dissolved organic matter or carbon as a common nutritional pathway. PMID:22914596

  13. Simulation of permeability evolution of leakage pathway in carbonate-rich caprocks in carbon sequestration

    NASA Astrophysics Data System (ADS)

    Guo, B.; Fitts, J. P.; Dobossy, M. E.; Peters, C. A.

    2013-12-01

    Geologic carbon sequestration in deep saline aquifers is a promising strategy for mitigating climate change. A major concern is the possibility of brine and CO2 migration through the caprock such as through fractures and faults. In this work, we examine the extent to which mineral dissolution will substantially alter the porosity and permeability of caprock leakage pathways as CO2-acidified brine flows through them. Three models were developed. Firstly, a reactive transport model, Permeability Evolution of Leakage pathway (PEL), was developed to simulate permeability evolution of a leakage pathway during the injection period, and assumes calcite is the only reactive mineral. The system domain is a 100 m long by 0.2 m diameter cylindrical flow path with fixed boundaries containing a rock matrix with an initial porosity of 30% and initial permeability of 1×10-13 m2. One example result is for an initial calcite volume fraction (CVF) of 0.20, in which all the calcite is dissolved after 50 years and the permeability reaches 3.2×10-13 m2. For smaller values of CVF, the permeability reaches its final value earlier but the increase in permeability is minimal. For a large value of CVF such as 0.50, the permeability could eventually reach 1×10-12 m2, but the large amount of dissolved calcium buffers the solution and slows the reaction. After 50 years the permeability change is negligible. Thus, there is a non-monotonic relationship between the amount of calcite in the rock and the resulting permeability change because of the competing dynamics of calcite dissolution and alkalinity build-up. In the second model, PEL was coupled to an existing basin-scale multiphase flow model, Princeton's Estimating Leakage Semi-Analytical (ELSA) model. The new model, ELSA-PEL, estimates the brine and CO2 leakage rates during the injection period under conditions of permeability evolution. The scenario considered in this work is for 50 years of CO2 injection into the Mt. Simon formation in the Michigan basin at an injection rate of 1 Mt/y. As an example, for a CVF value of 5%, the brine leakage rate after fifty years for a leakage pathway 1,000 m distance from the injection well is 0.88 kg/s, which is 2.4% larger than if there were no geochemical evolution of the permeability. In a sensitivity analysis with regard to the distance between the leakage pathway and the injection well, it was found that the cumulative leakage first increases with the distance and the relationship reverses after a certain distance. When the leakage pathway is farther away, the pressure increment drops leading to less acid brine flow; meanwhile, the time before the CO2 plume reaches the pathway is longer and this lengthens the reaction time with brine. Thirdly, we explored the role that SO2 would play if it were present as a co-injectant in carbon sequestration. The reaction considered is SO2 hydrolysis to form sulfurous acid. We expect the sulfurous acid will erode the calcite faster than carbonic acid because it is a stronger acid. Contrary to intuition, the simulation results showed a decrease in permeability due to CaSO3 precipitation in replacement of CaCO3, as CaSO3 has a larger molar volume.

  14. Carbon dioxide fixation in batch culture of Chlorella sp. using a photobioreactor with a sunlight-cellection device

    Microsoft Academic Search

    Satoshi Hirata; Masao Hayashitani; Masahito Taya; Setsuji Tone

    1996-01-01

    In a batch culture of Chlorella sp. using sunlight as a light source, the cell concentration reached a maximum of 150 mg dry cells dm?3 at 200 h. The mean rate of CO2 fixation during the culture was 31.8 mg CO2 dm?3 d?1. The efficiency of conversion of energy to biomass was estimated as 4.3%.

  15. Modelling Urban scale Retrofit, Pathways to 2050 Low Carbon Residential Building Stock 

    E-print Network

    Lannon, Simon; Georgakaki, Aliki; Macdonald, Stuart

    A bottom up engineering modelling approach has been used to investigate the pathways to 2050 low carbon residential building stock. The impact of housing retrofit, renewable technologies, occupant behaviour, and grid decarbonisation is measured at a...

  16. A model of biogeochemical cycles of carbon, nitrogen, and phosphorus including symbiotic nitrogen fixation and phosphatase production

    NASA Astrophysics Data System (ADS)

    Wang, Y.-P.; Houlton, B. Z.; Field, C. B.

    2007-03-01

    Global climate models have not yet considered the effects of nutrient cycles and limitation when forecasting carbon uptake by the terrestrial biosphere into the future. Using the principle of resource optimization, we here develop a new theory by which C, N, and P cycles interact. Our model is able to replicate the observed responses of net primary production to nutrient additions in N-limited, N- and P-colimited, and P-limited terrestrial environments. Our framework identifies a new pathway by which N2 fixers can alter P availability: By investing in N-rich, phosphorus liberation enzymes (phosphatases), fixers can greatly accelerate soil P availability and P cycling rates. This interaction is critical for the successful invasion and establishment of N2 fixers in an N-limited environment. We conclude that our model can be used to examine nutrient limitation broadly, and thus offers promise for coupling the biogeochemical system of C, N, and P to broader climate-system models.

  17. Nitrogen and carbon fixation byAnabaena sp. isolated from a rice paddy and grown under P and light limitations

    Microsoft Academic Search

    Hee-Mock Oh; J. Maeng; G-Yull Rhee

    1991-01-01

    Anabaena sp., isolated from a rice paddy, was investigated for its nitrogen fixation as measured by acetylene reduction activity (ARA) in P-limited continuous and light-limited semi-continuous cultures. Growth rate (µ) under P limitation was a function of cell P content (qp). Both the photosynthetic capacity (Pmax) and photosynthetic efficiency (a) increased with µ when expressed per cell, but not per

  18. Nitrogen and carbon fixation by Anabaena sp. isolated from a rice paddy and grown under P and light limitations

    Microsoft Academic Search

    Hee-Mock Oh; J. Maeng; G-Yull Rhee

    1991-01-01

    Anabaena sp., isolated from a rice paddy, was investigated for its nitrogen fixation as measured by acetylene reduction activity (ARA)\\u000a in P-limited continuous and light-limited semi-continuous cultures. Growth rate (?) under P limitation was a function of cell\\u000a P content (q\\u000a p). Both the photosynthetic capacity (Pmax) and photosynthetic efficiency (?) increased with ? when expressed per cell, but not

  19. Changes in pathways for carbon and nitrogen assimilation in spruce roots under mycorrhization

    E-print Network

    Paris-Sud XI, Université de

    Changes in pathways for carbon and nitrogen assimilation in spruce roots under mycorrhization C and carbon metabolism were examined in spruce ectomycorrhizae and in each partner (uninfected root and fungus in Pachlewski's medium. Spruce roots (Picea abies L. Karsten) and mycorrhizae, infected with Hebeloma sp., were

  20. Carbon Assimilation Pathways, Water Relationships and Plant Ecology.

    ERIC Educational Resources Information Center

    Etherington, John R.

    1988-01-01

    Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

  1. Reduced Carbon Availability to Bacteroids and Elevated Ureides in Nodules, But Not in Shoots, Are Involved in the Nitrogen Fixation Response to Early Drought in Soybean1[OA

    PubMed Central

    Ladrera, Rubén; Marino, Daniel; Larrainzar, Estíbaliz; González, Esther M.; Arrese-Igor, Cesar

    2007-01-01

    Nitrogen fixation (NF) in soybean (Glycine max L. Merr.) is highly sensitive to soil drying. This sensitivity has been related to an accumulation of nitrogen compounds, either in shoots or in nodules, and a nodular carbon flux shortage under drought. To assess the relative importance of carbon and nitrogen status on NF regulation, the responses to the early stages of drought were monitored with two soybean cultivars with known contrasting tolerance to drought. In the sensitive cultivar (‘Biloxi’), NF inhibition occurred earlier and was more dramatic than in the tolerant cultivar (‘Jackson’). The carbon flux to bacteroids was also more affected in ‘Biloxi’ than in ‘Jackson’, due to an earlier inhibition of sucrose synthase activity and a larger decrease of malate concentration in the former. Drought provoked ureide accumulation in nodules of both cultivars, but this accumulation was higher and occurred earlier in ‘Biloxi’. However, at this early stage of drought, there was no accumulation of ureides in the leaves of either cultivar. These results indicate that a combination of both reduced carbon flux and nitrogen accumulation in nodules, but not in shoots, is involved in the inhibition of NF in soybean under early drought. PMID:17720761

  2. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    NASA Astrophysics Data System (ADS)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.

    2011-07-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. In addition, a concomitant flux of carbonate formed in wood tissues contributes to the carbonate flux and is identified as a direct consequence of wood feeding by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter, and an oxalate pool is formed on the forest ground. Then, wood rotting agents (mainly termites, saprophytic fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition, some of these agents are themselves producers of oxalate (e.g. fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can then start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with ?13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as defined by ecological theory.

  3. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    NASA Astrophysics Data System (ADS)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.

    2011-02-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the theoretical acidic conditions of these soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. Regarding the carbonate flux, another direct consequence of wood feeding is a concomitant flux of carbonate formed in wood tissues, which is not consumed by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter. Therefore, an oxalate pool is formed on the forest ground. Then, wood rotting gents (mainly termites, fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition some of these gents are themselves producers of oxalate (fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with ?13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as define by the ecological theory.

  4. Carbon Mineralization Pathways and Early Diagenesis in Lake Erie Sediments

    NASA Astrophysics Data System (ADS)

    O Neill, A. H.; Crowe, S. A.; Song, Z.; Mucci, A.; Sundby, B.; Fryer, B. J.; Fowle, D. A.

    2004-12-01

    In spite of the long-standing paradigm whereby organic matter degradation proceeds by redox reactions that consume oxidants in the order of free energy yield, diagenesis in marine and fresh water sediments often yield different results. The reasons for this are the highly variable absolute and relative abundances of electron acceptors and the different microbial populations found in freshwater environments. As contaminant availability and subsequent impact on aquatic ecosystems are directly linked to these transformations, it is important to understand the most important degradation pathways and their rates. To this end we have conducted chemical analyses of Lake Erie sediment pore-waters and a preliminary characterization of the vertical distribution of microbiological populations. Sediments were collected at four locations in the Central and Eastern basins of Lake Erie during cruises of the R/V LIMNOS in May and June of 2004 respectively. High-resolution vertical profiles of several redox-active species (O2, Fe2+, Mn2+, Fe3+ and S2-) have been obtained by voltammetry using Au/Hg amalgam micro-electrodes. These are the first high-resolution pore-water profiles obtained for multiple redox species using Au/Hg amalgam microelectrodes in the Great Lakes. These profiles show oxygen depletion to levels below detection (5 uM) at depths that range from <1 to 6 mm below the sediment-water interface. Frequently, there is up to 1 cm separation between the depth at which O2 became undetectable and the depth of the first measurable Mn2+. The vertical concentration profiles of Mn2+ and Fe2+ are highly variable between stations and seem to be related to the local bathymetry. Alternatively this variability may be related to the abundance of solid phase Mn and Fe at these sites. The presence of voltammetric peaks measured between -0.5 and -0.6 V, that are often attributed to dissolved organic Fe (III) species, could be produced as part of a strategy by Fe reducing microorganisms to render solid phase Fe (III) bioavailable. Mn2+ voltammetric peaks were shifted to potentials more negative than the -1.53 to -1.55 mV commonly observed in marine pore waters. This shift is consistent with previous studies in freshwaters and has been ascribed to Mn2+ complexation by organic ligands (e.g. Luther et al, 2003). However, this shift may be due to analytical artifacts associated with using a solid state Ag/AgCl reference electrode in low ionic strength solutions. Measurable sulphide in the first 5 cm below the sediment-water interface is sporadic which suggests that sulphate reduction occurs in micro-environments locally enriched in organic carbon. Preliminary cultivation-independent, microbiological analyses have revealed 16s rDNA clones that are closely related to known species capable of enzymatic reduction of Fe(III) and the dechlorination of organic compounds (e.g. Anaeromyxobacter dehalogenans). These organisms were vertically dispersed within several different core sections suggestive of an intriguing tie between diagenetic reactions and anthropogenic organic compound degradation in these sediments. Coupling high-resolution voltammetry and spatially resolved genomic tools to investigate the controls on sediment pore water chemistry holds a promising future for elucidating the controls on early diagenesis in freshwater ecosystems.

  5. Methanotrophy induces nitrogen fixation during peatland development

    PubMed Central

    Larmola, Tuula; Leppänen, Sanna M.; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja

    2014-01-01

    Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

  6. Methanotrophy induces nitrogen fixation during peatland development.

    PubMed

    Larmola, Tuula; Leppänen, Sanna M; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja

    2014-01-14

    Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

  7. The importance of slope aspect and stand age on the photosynthetic carbon fixation capacity of forest: a case study with black locust ( Robinia pseudoacacia ) plantations on the Loess Plateau

    Microsoft Academic Search

    Yuan ZhengZhong; Zhong Zhao; Jing-Jing Zhou; Hui Zhou; Zong-Suo Liang; Zhi-Bin Luo

    2011-01-01

    The black locust (Robinia pseudoacacia L.) is an important tree species not only for the vegetation rehabilitation but also for the photosynthetic carbon dynamics\\u000a on the Loess Plateau. Slope aspect and stand age play important roles in the photosynthesis of the black locusts. To investigate\\u000a the photosynthetic carbon fixation capacity (PCFC) of the juvenile and mature black locusts located on

  8. Carbon dioxide concentration dictates alternative methanogenic pathways in oil reservoirs

    PubMed Central

    Mayumi, Daisuke; Dolfing, Jan; Sakata, Susumu; Maeda, Haruo; Miyagawa, Yoshihiro; Ikarashi, Masayuki; Tamaki, Hideyuki; Takeuchi, Mio; Nakatsu, Cindy H.; Kamagata, Yoichi

    2013-01-01

    Deep subsurface formations (for example, high-temperature oil reservoirs) are candidate sites for carbon capture and storage technology. However, very little is known about how the subsurface microbial community would respond to an increase in CO2 pressure resulting from carbon capture and storage. Here we construct microcosms mimicking reservoir conditions (55?°C, 5?MPa) using high-temperature oil reservoir samples. Methanogenesis occurs under both high and low CO2 conditions in the microcosms. However, the increase in CO2 pressure accelerates the rate of methanogenesis to more than twice than that under low CO2 conditions. Isotope tracer and molecular analyses show that high CO2 conditions invoke acetoclastic methanogenesis in place of syntrophic acetate oxidation coupled with hydrogenotrophic methanogenesis that typically occurs in this environment (low CO2 conditions). Our results present a possibility of carbon capture and storage for enhanced microbial energy production in deep subsurface environments that can mitigate global warming and energy depletion. PMID:23759740

  9. ENZYMOLOGY: A Trio of Transition Metals in Anaerobic CO2 Fixation

    NSDL National Science Digital Library

    John W. Peters (Montana State University; Department of Chemistry and Biochemistry)

    2002-10-18

    Access to the article is free, however registration and sign-in are required. Certain anaerobic microorganisms can gain energy and biomass using carbon monoxide or dioxide and dihydrogen as sole sources of carbon and energy. In his Perspective, Peters explains how new results by Doukov et al. illuminate the carbon dioxide fixation pathway. Doukov et al. report that the enzyme responsible for the process contains a highly unusual metal cluster, with three different transition metals including copper, in one of its active sites.

  10. Mechanistic models of oceanic nitrogen fixation

    E-print Network

    Monteiro, Fanny

    2009-01-01

    Oceanic nitrogen fixation and biogeochemical interactions between the nitrogen, phosphorus and iron cycles have important implications for the control of primary production and carbon storage in the ocean. The biological ...

  11. The intramolecular ¹³C-distribution in ethanol reveals the influence of the CO? -fixation pathway and environmental conditions on the site-specific ¹³C variation in glucose.

    PubMed

    Gilbert, Alexis; Silvestre, Virginie; Segebarth, Nicolas; Tcherkez, Guillaume; Guillou, Claude; Robins, Richard J; Akoka, Serge; Remaud, Gérald S

    2011-07-01

    Efforts to understand the cause of ¹²C versus ¹³C isotope fractionation in plants during photosynthesis and post-photosynthetic metabolism are frustrated by the lack of data on the intramolecular ¹³C-distribution in metabolites and its variation with environmental conditions. We have exploited isotopic carbon-13 nuclear magnetic resonance (¹³C NMR) spectrometry to measure the positional isotope composition (?¹³C(i) , ‰) in ethanol samples from different origins: European wines, liquors and sugars from C?, C? and crassulacean acid metabolism (CAM) plants. In C?-ethanol samples, the methylene group was always ¹³C-enriched (?2‰) relative to the methyl group. In wines, this pattern was correlated with both air temperature and ?(18)O of wine water, indicating that water vapour deficit may be a critical defining factor. Furthermore, in C?-ethanol, the reverse relationship was observed (methylene-C relatively ¹³C-depleted), supporting the concept that photorespiration is the key metabolic process leading to the ¹³C distribution in C?-ethanol. By contrast, in CAM-ethanol, the isotopic pattern was similar to but stronger than C?-ethanol, with a relative ¹³C-enrichment in the methylene-C of up to 13‰. Plausible causes of this ¹³C-pattern are briefly discussed. As the intramolecular ?¹³C(i) -values in ethanol reflect that in source glucose, our data point out the crucial impact on the ratio of metabolic pathways sustaining glucose synthesis. PMID:21410708

  12. INCREASING CO2 FROM SUBAMBIENT TO ELEVATED CONCENTRATIONS INCREASES GRASSLAND RESPIRATION PER UNIT OF NET CARBON FIXATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Respiration (carbon efflux) by terrestrial ecosystems is a major component of the global carbon (C) cycle, but the response of C efflux to atmospheric CO2 enrichment remains uncertain. Respiration may respond directly to an increase in the availability of C substrates at high CO2, but also may be a...

  13. Molybdenum Trafficking for Nitrogen Fixation

    PubMed Central

    Hernandez, Jose A.; George, Simon J.; Rubio, Luis M.

    2009-01-01

    The molybdenum nitrogenase is responsible for most biological nitrogen fixation, a prokaryotic metabolic process that determines the global biogeochemical cycles of nitrogen and carbon. Here we describe the trafficking of molybdenum for nitrogen fixation in the model diazotrophic bacterium Azotobacter vinelandii. The genes and proteins involved in molybdenum uptake, homeostasis, storage, regulation, and nitrogenase cofactor biosynthesis are reviewed. Molybdenum biochemistry in A. vinelandii reveals unexpected mechanisms and a new role for iron-sulfur clusters in the sequestration and delivery of molybdenum. PMID:19772354

  14. Developing pathways to low carbon land-based passenger transport in Great Britain by 2050

    Microsoft Academic Search

    Abigail L. Bristow; Miles Tight; Alison Pridmore; Anthony D. May

    2008-01-01

    The key aim of this paper is to examine strategic pathways to low carbon personal transport in Britain and to compare these with the current trajectory of transport policy. A 2050 baseline was established using trend information, forecasts and best evidence from the literature on response to policy intervention. A range of strategies are tested including: technological development, pricing, public

  15. Atmospheric sulfur deposition alters pathways of gaseous carbon production in peatlands

    Microsoft Academic Search

    Melanie A. Vile; Scott D. Bridgham; R. Kelman Wieder; Martin Novak

    2003-01-01

    Peatlands represent large carbon (C) reservoirs that can act as a source or sink for greenhouse gases. The response of peatland gaseous C fluxes to global climate change and atmospheric sulfate deposition, however, remains uncertain. Methanogenesis is thought to be one of the most important anaerobic C mineralization pathways in peatlands, especially in regions where input of sulfate from acid

  16. Mineral-Assisted Pathways in Prebiotic Synthesis: Photoelectrochemical Reduction of Carbon(+IV) by

    E-print Network

    Mineral-Assisted Pathways in Prebiotic Synthesis: Photoelectrochemical Reduction of Carbon and propionate. Infrared spectroscopy and mass spectrometry indicate the formation of longer chain organic started on early Earth more than 3.8 Ga ago is an intriguing and open question. Prebiotic synthesis, which

  17. Investigation of a HA/PDLGA/Carbon Foam Material System for Orthopedic Fixation Plates Based on Time-Dependent Properties

    E-print Network

    Rodriguez, Douglas E.

    2010-01-14

    of the same material as healing progresses. The present research focuses on the development and characterization of a material system consisting of carbon foam infiltrated with hydroxyapatite (HA) reinforced poly(D,L-lactide)-co-poly(glycolide) (PDLGA). A...

  18. Incomplete Wood-Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi.

    PubMed

    Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L; Feng, Xueyang; Men, Yujie; Conrad, Mark E; Tang, Yinjie J; Alvarez-Cohen, Lisa

    2014-04-29

    The acetyl-CoA "Wood-Ljungdahl" pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood-Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood-Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

  19. Incomplete Wood–Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi

    PubMed Central

    Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L.; Feng, Xueyang; Men, Yujie; Conrad, Mark E.; Tang, Yinjie J.; Alvarez-Cohen, Lisa

    2014-01-01

    The acetyl-CoA “Wood–Ljungdahl” pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood–Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood–Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

  20. Pathways of Carbon Assimilation and Ammonia Oxidation Suggested by Environmental Genomic Analyses of Marine Crenarchaeota

    PubMed Central

    Hallam, Steven J; Mincer, Tracy J; Schleper, Christa; Preston, Christina M; Roberts, Katie; Richardson, Paul M

    2006-01-01

    Marine Crenarchaeota represent an abundant component of oceanic microbiota with potential to significantly influence biogeochemical cycling in marine ecosystems. Prior studies using specific archaeal lipid biomarkers and isotopic analyses indicated that planktonic Crenarchaeota have the capacity for autotrophic growth, and more recent cultivation studies support an ammonia-based chemolithoautotrophic energy metabolism. We report here analysis of fosmid sequences derived from the uncultivated marine crenarchaeote, Cenarchaeum symbiosum, focused on the reconstruction of carbon and energy metabolism. Genes predicted to encode multiple components of a modified 3-hydroxypropionate cycle of autotrophic carbon assimilation were identified, consistent with utilization of carbon dioxide as a carbon source. Additionally, genes predicted to encode a near complete oxidative tricarboxylic acid cycle were also identified, consistent with the consumption of organic carbon and in the production of intermediates for amino acid and cofactor biosynthesis. Therefore, C. symbiosum has the potential to function either as a strict autotroph, or as a mixotroph utilizing both carbon dioxide and organic material as carbon sources. From the standpoint of energy metabolism, genes predicted to encode ammonia monooxygenase subunits, ammonia permease, urease, and urea transporters were identified, consistent with the use of reduced nitrogen compounds as energy sources fueling autotrophic metabolism. Homologues of these genes, recovered from ocean waters worldwide, demonstrate the conservation and ubiquity of crenarchaeal pathways for carbon assimilation and ammonia oxidation. These findings further substantiate the likely global metabolic importance of Crenarchaeota with respect to key steps in the biogeochemical transformation of carbon and nitrogen in marine ecosystems. PMID:16533068

  1. Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor

    SciTech Connect

    Younker, Jarod M [ORNL; Saito, Tomonori [ORNL; Hunt, Marcus A [ORNL; Beste, Ariana [ORNL; Naskar, Amit K [ORNL

    2013-01-01

    Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. We observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.

  2. Quantifying carbon fixation in trace minerals from processed kimberlite: A comparative study of quantitative methods using X-ray powder diffraction data with applications to the Diavik Diamond Mine, Northwest Territories, Canada

    Microsoft Academic Search

    Siobhan A. Wilson; Mati Raudsepp; Gregory M. Dipple

    2009-01-01

    The capacity of mine waste to trap CO2 is, in some cases, much larger than the greenhouse gas production of a mining operation. In mine tailings, the presence of secondary carbonate minerals that trap CO2 can therefore represent substantial fixation of this greenhouse gas. The abilities of three methods of quantitative phase analysis to measure trace nesquehonite (MgCO3·3H2O) in samples

  3. C(4) Photosynthesis: Light-dependent CO(2) Fixation by Mesophyll Cells, Protoplasts, and Protoplast Extracts of Digitaria sanguinalis.

    PubMed

    Huber, S C; Edwards, G E

    1975-05-01

    Mesophyll cells, protoplasts, and protoplast extracts of Digitaria sanguinalis were used for comparative studies of light-dependent CO(2) fixation. CO(2) fixation was low without the addition of organic substrates. Pyruvate, oxaloacetate, and 3-phosphoglycerate induced relatively low rates (10 to 90 mumoles/mg chlorophyll.hr) of CO(2) fixation when added separately. However, a highly synergistic relationship was found between pyruvate + oxaloacetate and pyruvate + 3-phosphoglycerate for inducing light-dependent CO(2) fixation in the mesophyll preparations. Highest rates of CO(2) fixation were obtained with protoplast extracts. Pyruvate, in combination with oxaloacetate or 3-phosphoglycerate induced light-dependent rates from 150 to 380 mumoles of CO(2) fixed/mg chlorophyll.hr which are equivalent to or exceed reported rates of whole leaf photosynthesis in C(4) species. Concentrations of various substrates required to give half-maximum velocities of CO(2) fixation were determined, with the protoplast extracts generally saturating at the lowest substrate concentrations. Chloroplasts separated from protoplast extracts showed little capacity for CO(2) fixation. The results suggest that CO(2) fixation in C(4) mesophyll cells is dependent on chloroplasts and extrachloroplastic phosphoenolpyruvate carboxylase.The stimulation of pyruvate-induced CO(2) fixation by oxaloacetate and 3-phosphoglycerate is thought to be due to induction of noncyclic electron transport which generates ATP for the conversion of pyruvate to phosphoenolpyruvate by pyruvate Pi dikinase. The primary products of the substrate-induced CO(2) fixation were oxaloacetate and malate, which provides further evidence for carbon fixation through the beta-carboxylation pathway. High rates of light-dependent CO(2) fixation with a significant percentage of (14)C fixed into malate suggest an efficient operation of both photosystems I and II.The substrate inductions are discussed with respect to the proposed role of the mesophyll cell in C(4) photosynthesis, and schemes suggesting the stoichiometry of energy requirements for photosynthetic carbon metabolism in C(4) mesophyll cells are presented. PMID:16659177

  4. Membrane perturbation by carbon nanotube insertion: pathways to internalization.

    PubMed

    Lelimousin, Mickaël; Sansom, Mark S P

    2013-11-11

    Carbon nanotubes (CNTs) can penetrate the membranes of cells, offering prospects for nanomedicine but problems for nanotoxicity. Molecular simulations are used to provide a systematic analysis of the interactions of single-walled and multi-walled CNTs of different radii with a model lipid bilayer membrane. The simulations allow characterization of the mechanism of spontaneous exothermic insertion of CNTs into lipid bilayer membranes. The size and type of CNT determine the nature and extent of the local perturbation of the bilayer. Single-walled CNTs are shown to insert via a two-step mechanism with initial transient formation of a water filled pore followed by full insertion of the CNT into the bilayer. The latter stage is associated with formation of a persistent inverted micelle arrangement of lipid molecules trapped inside the CNT. This suggests a possible vehicle for nano-encapsulation of drugs, enabling their entry into and subsequent release within cells following endocytosis of CNT-containing membranes. PMID:23418066

  5. A critical knowledge pathway to low-carbon, sustainable futures: Integrated understanding of urbanization, urban areas, and carbon

    NASA Astrophysics Data System (ADS)

    Romero-Lankao, Patricia; Gurney, Kevin R.; Seto, Karen C.; Chester, Mikhail; Duren, Riley M.; Hughes, Sara; Hutyra, Lucy R.; Marcotullio, Peter; Baker, Lawrence; Grimm, Nancy B.; Kennedy, Christopher; Larson, Elisabeth; Pincetl, Stephanie; Runfola, Dan; Sanchez, Landy; Shrestha, Gyami; Feddema, Johannes; Sarzynski, Andrea; Sperling, Joshua; Stokes, Eleanor

    2014-10-01

    Independent lines of research on urbanization, urban areas, and carbon have advanced our understanding of some of the processes through which energy and land uses affect carbon. This synthesis integrates some of these diverse viewpoints as a first step toward a coproduced, integrated framework for understanding urbanization, urban areas, and their relationships to carbon. It suggests the need for approaches that complement and combine the plethora of existing insights into interdisciplinary explorations of how different urbanization processes, and socio-ecological and technological components of urban areas, affect the spatial and temporal patterns of carbon emissions, differentially over time and within and across cities. It also calls for a more holistic approach to examining the carbon implications of urbanization and urban areas, based not only on demographics or income but also on other interconnected features of urban development pathways such as urban form, economic function, economic-growth policies, and other governance arrangements. It points to a wide array of uncertainties around the urbanization processes, their interactions with urban socio-institutional and built environment systems, and how these impact the exchange of carbon flows within and outside urban areas. We must also understand in turn how carbon feedbacks, including carbon impacts and potential impacts of climate change, can affect urbanization processes. Finally, the paper explores options, barriers, and limits to transitioning cities to low-carbon trajectories, and suggests the development of an end-to-end, coproduced and integrated scientific understanding that can more effectively inform the navigation of transitional journeys and the avoidance of obstacles along the way.

  6. NifA- and CooA-Coordinated cowN Expression Sustains Nitrogen Fixation by Rhodobacter capsulatus in the Presence of Carbon Monoxide

    PubMed Central

    Hoffmann, Marie-Christine; Pfänder, Yvonne; Fehringer, Maria; Narberhaus, Franz

    2014-01-01

    Rhodobacter capsulatus fixes atmospheric dinitrogen via two nitrogenases, Mo- and Fe-nitrogenase, which operate under different conditions. Here, we describe the functions in nitrogen fixation and regulation of the rcc00574 (cooA) and rcc00575 (cowN) genes, which are located upstream of the structural genes of Mo-nitrogenase, nifHDK. Disruption of cooA or cowN specifically impaired Mo-nitrogenase-dependent growth at carbon monoxide (CO) concentrations still tolerated by the wild type. The cooA gene was shown to belong to the Mo-nitrogenase regulon, which is exclusively expressed when ammonium is limiting. Its expression was activated by NifA1 and NifA2, the transcriptional activators of nifHDK. AnfA, the transcriptional activator of Fe-nitrogenase genes, repressed cooA, thereby counteracting NifA activation. CooA activated cowN expression in response to increasing CO concentrations. Base substitutions in the presumed CooA binding site located upstream of the cowN transcription start site abolished cowN expression, indicating that cowN regulation by CooA is direct. In conclusion, a transcription factor-based network controls cowN expression to protect Mo-nitrogenase (but not Fe-nitrogenase) under appropriate conditions. PMID:25070737

  7. Free atmospheric CO2 enrichment did not affect symbiotic N2-fixation and soil carbon dynamics in a mixed deciduous stand in Wales

    NASA Astrophysics Data System (ADS)

    Hoosbeek, M. R.; Lukac, M.; Velthorst, E. J.; Godbold, D. L.

    2010-06-01

    Through increases in net primary production (NPP), elevated CO2 is hypothesizes to increase the amount of plant litter entering the soil. The fate of this extra carbon on the forest floor or in mineral soil is currently not clear. Moreover, increased rates of NPP can be maintained only if forests can escape nitrogen limitation. In a Free atmospheric CO2 Enrichment (FACE) experiment near Bangor, Wales, 4 ambient CO2 and 4 FACE plots were planted with patches of Betula pendula, Alnus glutinosa and Fagus sylvatica on a former arable field. Four years after establishment, only a shallow L forest floor litter layer had formed due to intensive bioturbation. Total soil C and N contents increased irrespective of treatment and species as a result of afforestation. We could not detect an additional C sink in the soil, nor were soil C stabilization processes affected by FACE. We observed a decrease of leaf N content in Betula and Alnus under FACE, while the soil C/N ratio decreased regardless of CO2 treatment. The ratio of N taken up from the soil and by N2-fixation in Alnus was not affected by FACE. We infer that increased nitrogen use efficiency is the mechanism by which increased NPP is sustained under elevated CO2 at this site.

  8. Imaging conduction pathways in carbon nanotube network transistors by voltage-contrast scanning electron microscopy

    NASA Astrophysics Data System (ADS)

    Vijayaraghavan, Aravind; Timmermans, Marina Y.; Grigoras, Kestutis; Nasibulin, Albert G.; Kauppinen, Esko I.; Krupke, Ralph

    2011-07-01

    The performance of field-effect transistors based on single-walled carbon nanotube (SWCNT) networks depends on the electrical percolation of semiconducting and metallic nanotube pathways within the network. We present voltage-contrast scanning electron microscopy (VC-SEM) as a new tool for imaging percolation in a SWCNT network with nano-scale resolution. Under external bias, the secondary-electron contrast of SWCNTs depends on their conductivity, and therefore it is possible to image the preferred conduction pathways within a network by following the contrast evolution under bias in a scanning electron microscope. The experimental VC-SEM results are correlated to percolation models of SWCNT-bundle networks.

  9. Involvement of Photosynthetic Carbon Reduction Cycle Intermediates in CO(2) Fixation and O(2) Evolution by Isolated Chloroplasts.

    PubMed

    Schacter, B; Eley, J H; Gibbs, M

    1971-12-01

    The photosynthetic carbon reduction cycle intermediates can be divided into three classes according to their effects on the rate of photosynthetic CO(2) evolution by whole spinach (Spinacia oleracea) chloroplasts and on their ability to affect reversal of certain inhibitors (nigericin, arsenate, arsenite, iodoacetate, antimycin A) of photosynthesis: class I (maximal): fructose 1, 6-diphosphate, dihydroxyacetone phosphate, glyceraldehyde-3-phosphate, ribose-5-phosphate; class 2 (slight): glucose 6-phosphate, fructose 6-phosphate, ribulose-1, 5-diphosphate; class 3 (variable): glycerate 3-phosphate. While class 1 compounds influence the photosynthetic rate, they do not lower the Michaelis constant of the chloroplast for bicarbonate or affect strongly other photosynthetic properties such as the isotopic distribution pattern. It was concluded that the class 1 compounds influence the chloroplast by not only supplying components to the carbon cycle but also by activating or stabilizing a structural component of the chloroplast. PMID:16657865

  10. Biological carbon fixation: A study of Isochrysis sp. growth under actual coal-fired power plant's flue gas

    NASA Astrophysics Data System (ADS)

    >Liyana Yahya, Muhammad Nazry Chik, Mohd Asyraf Mohd Azmir Pang,

    2013-06-01

    Preliminary study on the growth of marine microalgae Isochrysis sp. was carried out using actual flue gas from a coal-fired power station. The species was cultured using a 2×10-L customized bubble column photobioreactor skid under specified culture conditions. With an initial culture density of 0.459 Abs (optical density at 560 nm wavelength), the species was found able to survive - observed by increases in optical densities, number of cells and weights - in the presence of actual coal-fired flue gas containing on average 4.08 % O2, 200.21 mg/m3 SO2, 212.29 mg/m3 NOx, 4.73 % CO2 and 50.72 mg/m3 CO. Results thus add value to the potential and capability of microalgae, especially for Isochrysis sp., to be the biological carbon fixer in neutralizing carbon emissions from power plants.

  11. Phytoplankton carbon fixation gene (RuBisCO) transcripts and air-sea CO(2) flux in the Mississippi River plume.

    PubMed

    John, David E; Wang, Zhaohui A; Liu, Xuewu; Byrne, Robert H; Corredor, Jorge E; López, José M; Cabrera, Alvaro; Bronk, Deborah A; Tabita, F Robert; Paul, John H

    2007-10-01

    River plumes deliver large quantities of nutrients to oligotrophic oceans, often resulting in significant CO(2) drawdown. To determine the relationship between expression of the major gene in carbon fixation (large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, RuBisCO) and CO(2) dynamics, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO(2) in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30-32) stations were dominated by rbcL mRNA concentrations from heterokonts, such as diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, alpha-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34-36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO(2). While Prochlorococcus cells did not exhibit a large difference between low and high pCO(2) water, Prochlorococcus rbcL RNA concentrations had a strong positive correlation to pCO(2), suggesting a very low level of RuBisCO RNA transcription among Prochlorococcus in the plume waters, possibly due to their relatively poor carbon concentrating mechanisms (CCMs). These results provide molecular evidence that diatom/pelagophyte productivity is largely responsible for the large CO(2) drawdown occurring in the MRP, based on the co-occurrence of elevated RuBisCO gene transcript concentrations from this group and reduced seawater pCO(2) levels. This may partly be due to efficient CCMs that enable heterokont eukaryotes such as diatoms to continue fixing CO(2) in the face of strong CO(2) drawdown. Our work represents the first attempt to relate in situ microbial gene expression to contemporaneous CO(2) flux measurements in the ocean. PMID:18043653

  12. Japan roadmaps toward low-carbon society by backcasting: Optimal CO2 reduction pathways and investment timing for low-carbon technologies

    Microsoft Academic Search

    Shuichi Ashina; Junichi Fujino; Toshihiko Masui; Kazuya Fujiwara; Go Hibino; Mikiko Kainuma; Yuzuru Matsuoka

    2010-01-01

    In this paper we draw up future roadmaps for technologies, policies, and optimal investment timing toward the achievement of a low-carbon society (LCS) in Japan by 2050. Future pathways for Japan to follow are calculated using an analytical model based on a backcasting methodology. Early actions can lead to pathways for minimizing the costs toward a LCS in Japan. However,

  13. Carbon Metabolic Pathways in Phototrophic Bacteria and Their Broader Evolutionary Implications

    PubMed Central

    Tang, Kuo-Hsiang; Tang, Yinjie J.; Blankenship, Robert Eugene

    2011-01-01

    Photosynthesis is the biological process that converts solar energy to biomass, bio-products, and biofuel. It is the only major natural solar energy storage mechanism on Earth. To satisfy the increased demand for sustainable energy sources and identify the mechanism of photosynthetic carbon assimilation, which is one of the bottlenecks in photosynthesis, it is essential to understand the process of solar energy storage and associated carbon metabolism in photosynthetic organisms. Researchers have employed physiological studies, microbiological chemistry, enzyme assays, genome sequencing, transcriptomics, and 13C-based metabolomics/fluxomics to investigate central carbon metabolism and enzymes that operate in phototrophs. In this report, we review diverse CO2 assimilation pathways, acetate assimilation, carbohydrate catabolism, the tricarboxylic acid cycle and some key, and/or unconventional enzymes in central carbon metabolism of phototrophic microorganisms. We also discuss the reducing equivalent flow during photoautotrophic and photoheterotrophic growth, evolutionary links in the central carbon metabolic network, and correlations between photosynthetic and non-photosynthetic organisms. Considering the metabolic versatility in these fascinating and diverse photosynthetic bacteria, many essential questions in their central carbon metabolism still remain to be addressed. PMID:21866228

  14. Integrated carbon dioxide/sludge gasification using waste heat from hot slags: Syngas production and sulfur dioxide fixation.

    PubMed

    Sun, Yongqi; Zhang, Zuotai; Liu, Lili; Wang, Xidong

    2015-04-01

    The integrated CO2/sludge gasification using the waste heat in hot slags, was explored with the aim of syngas production, waste heat recovery and sewage sludge disposal. The results demonstrated that hot slags presented multiple roles on sludge gasification, i.e., not only a good heat carrier (500-950°C) but also an effective desulfurizer (800-900°C). The total gas yields increased from 0.022kg/kgsludge at 500°C to 0.422kg/kgsludge at 900°C; meanwhile, the SO2 concentration at 900°C remarkably reduced from 164ppm to 114ppm by blast furnace slags (BFS) and 93ppm by steel slags (SS), respectively. A three-stage reaction was clarified including volatile release, char transformation and fixed carbon using Gaussian fittings and the kinetic model was analyzed. Accordingly, a decline process using the integrated method was designed and the optimum slag/sludge ratio was deduced. These deciphered results appealed potential ways of reasonable disposal of sewage sludge and efficient recovery of waste heat from hot slags. PMID:25647028

  15. Free atmospheric CO2 enrichment increased above ground biomass but did not affect symbiotic N2-fixation and soil carbon dynamics in a mixed deciduous stand in Wales

    NASA Astrophysics Data System (ADS)

    Hoosbeek, M. R.; Lukac, M.; Velthorst, E.; Smith, A. R.; Godbold, D. L.

    2011-02-01

    Through increases in net primary production (NPP), elevated CO2 is hypothesized to increase the amount of plant litter entering the soil. The fate of this extra carbon on the forest floor or in mineral soil is currently not clear. Moreover, increased rates of NPP can be maintained only if forests can escape nitrogen limitation. In a Free atmospheric CO2 Enrichment (FACE) experiment near Bangor, Wales, 4 ambient and 4 elevated [CO2] plots were planted with patches of Betula pendula, Alnus glutinosa and Fagus sylvatica on a former arable field. After 4 years, biomass averaged for the 3 species was 5497 (se 270) g m-2 in ambient and 6450 (se 130) g m-2 in elevated [CO2] plots, a significant increase of 17% (P = 0.018). During that time, only a shallow L forest floor litter layer had formed due to intensive bioturbation. Total soil C and N contents increased irrespective of treatment and species as a result of afforestation. We could not detect an additional C sink in the soil, nor were soil C stabilization processes affected by elevated [CO2]. We observed a decrease of leaf N content in Betula and Alnus under elevated [CO2], while the soil C/N ratio decreased regardless of CO2 treatment. The ratio of N taken up from the soil and by N2-fixation in Alnus was not affected by elevated [CO2]. We infer that increased nitrogen use efficiency is the mechanism by which increased NPP is sustained under elevated [CO2] at this site.

  16. Carbon dioxide metabolism by Actinomyces viscosus: pathways for succinate and aspartate production.

    PubMed Central

    Brown, A T; Breeding, L C

    1980-01-01

    14C-labeled bicarbonate was incorporated into trichloroacetic acid-insoluble material by cell suspensions of A. viscosus strain M100 and also into the four-carbon fermentation product, succinate, but not into the three-carbon fermentation product, lactate. The initial step in the conversion of 14C-labeled bicarbonate into both trichloroacetic acid-insoluble material and succinate was catalyzed by the enzyme phosphoenolypyruvate carboxylase, which served to convert the glycolytic intermediate, phosphoenolpyruvate, and bicarbonate to the four-carbon compound, oxalacetate. The metabolic fate of oxalacetate was its conversion to either trichloroacetic acid-insoluble material or succinate. One pathway by which oxalacetate may be metabolized into acid-insoluble material is via its conversion to the biosynthetic precursor aspartate by the action of glutamate aspartate aminotransferase. One source of the alpha-amino group of aspartate was the ammonium ion, which could be incorporated into glutamate, the substrate of the glutamate aspartate aminotransferase reaction, by the action of a reduced nicotinamide adenine dinucleotide phosphate-dependent glutamate dehydrogenase whose reducing equivalents could be derived from the nicotinamide adenine dinucleotide phosphate-dependent oxidative reactions of the hexose monophosphate pathway catalyzed by glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase. Alternatively, oxalacetate was converted to the fermentation product, succinate, through the sequential action of malate dehydrogenase, fumarase, and succinic dehydrogenase. The resolution and partial purification of phosphoenolpyruvate carboxylase, glutamate aspartate aminotransferase, glutamate dehydrogenase, malate dehydrogenase, fumarase, and succinic dehydrogenase are also reported. PMID:6769822

  17. Imaging conduction pathways in carbon nanotube network transistors by voltage-contrast scanning electron microscopy.

    PubMed

    Vijayaraghavan, Aravind; Timmermans, Marina Y; Grigoras, Kestutis; Nasibulin, Albert G; Kauppinen, Esko I; Krupke, Ralph

    2011-07-01

    The performance of field-effect transistors based on single-walled carbon nanotube (SWCNT) networks depends on the electrical percolation of semiconducting and metallic nanotube pathways within the network. We present voltage-contrast scanning electron microscopy (VC-SEM) as a new tool for imaging percolation in a SWCNT network with nano-scale resolution. Under external bias, the secondary-electron contrast of SWCNTs depends on their conductivity, and therefore it is possible to image the preferred conduction pathways within a network by following the contrast evolution under bias in a scanning electron microscope. The experimental VC-SEM results are correlated to percolation models of SWCNT-bundle networks. PMID:21586812

  18. Photoluminescence saturation independent of excitation pathway in air-suspended single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Xiao, Yee-fang; Anderson, Mitchell D.; Fraser, James M.

    2014-06-01

    Photoluminescence (PL) spectroscopy is a useful probe of excitonic interactions in optically excited nanostructures. Under intense optical excitation, the diffusion-annihilation of excitons in single-walled carbon nanotubes (SWCNTs) results in strong nonlinear PL. This behavior has been observed in a number of samples and has, until recently, been believed to be independent of excitation pathway. Contrary to this assumption, recent studies show that nonlinear PL in encapsulated SWCNTs, excited resonant to E22, is not dominated by diffusion-annihilation but instead by laser induced quenching sites. In this paper, we show that, unlike encapsulated SWCNTs, air-suspended SWCNT PL saturation is independent of excitation pathway, validating the use of a diffusion model for excitons generated via E22 excitation. In addition, we show that the diffusion of excitons in air-suspended SWCNTs is independent of atmospheric adsorbates, strengthening the assertion that in this system exciton diffusion is intrinsic and not disorder limited.

  19. Two pathways of carbon dioxide catalyzed oxidative coupling of phenol by peroxynitrite.

    PubMed

    Papina, Alina A; Koppenol, Willem H

    2006-03-01

    Carbon dioxide catalyzed oxidative coupling of phenol by peroxynitrite occurs by two pathways distinguished by the isomer ratio of 2,2'- to 4,4'-biphenols. As already established, at neutral pH and moderate phenol concentrations, both biphenols are formed in comparable yields by the coupling of two phenoxyl radicals. However, at high pH and phenol concentration, 2,2'-biphenol is the only identified coupled product, and its formation does not involve phenoxyl radicals. Instead, under these conditions, a previously unreported long-lived (t(1/2) approximately 10 s at pH 10 and 1 mM phenol) diamagnetic intermediate with an absorption maximum at 400 nm is observed. This intermediate is formed from phenolate concomitantly with the decay of peroxynitrite and disappears via reaction with phenol [k = (2.4 +/- 0.1) x 10 M(-)(1) s(-)(1) at pH 10.5] to form 2,2'-biphenol. We also find that para-benzoquinone, previously unreported, is formed in up to 5% yield relative to the initial peroxynitrite concentration. The appearance of an absorption band above 500 nm, which might be due to quinhydrone, indicates that hydroquinone is a likely para-benzoquinone precursor. The dependence of para-benzoquinone yields on pH and phenol concentration suggests that its formation is related to the nonradical pathway of 2,2'-biphenol formation. This novel nonradical pathway of 2,2'-biphenol formation might be relevant to the mechanisms of reaction of phenolic antioxidants with peroxynitrite. The existence of two distinct pathways of biphenol formation implies that, apart from a CO(3)(*)(-)/NO(2)(*) radical pair, another reactive intermediate is formed during the carbon dioxide catalyzed decay of peroxynitrite. PMID:16544942

  20. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.

    2015-04-01

    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher ?13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of ?13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ?31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of ?13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic compounds is critical for understanding deep subsurface ecosystems and the origin of organic compounds on Mars and other planets.

  1. A Central Role for Carbon-Overflow Pathways in the Modulation of Bacterial Cell Death

    PubMed Central

    Thomas, Vinai Chittezham; Sadykov, Marat R.; Chaudhari, Sujata S.; Jones, Joselyn; Endres, Jennifer L.; Widhelm, Todd J.; Ahn, Jong-Sam; Jawa, Randeep S.; Zimmerman, Matthew C.; Bayles, Kenneth W.

    2014-01-01

    Similar to developmental programs in eukaryotes, the death of a subpopulation of cells is thought to benefit bacterial biofilm development. However mechanisms that mediate a tight control over cell death are not clearly understood at the population level. Here we reveal that CidR dependent pyruvate oxidase (CidC) and ?-acetolactate synthase/decarboxylase (AlsSD) overflow metabolic pathways, which are active during staphylococcal biofilm development, modulate cell death to achieve optimal biofilm biomass. Whereas acetate derived from CidC activity potentiates cell death in cells by a mechanism dependent on intracellular acidification and respiratory inhibition, AlsSD activity effectively counters CidC action by diverting carbon flux towards neutral rather than acidic byproducts and consuming intracellular protons in the process. Furthermore, the physiological features that accompany metabolic activation of cell death bears remarkable similarities to hallmarks of eukaryotic programmed cell death, including the generation of reactive oxygen species and DNA damage. Finally, we demonstrate that the metabolic modulation of cell death not only affects biofilm development but also biofilm-dependent disease outcomes. Given the ubiquity of such carbon overflow pathways in diverse bacterial species, we propose that the metabolic control of cell death may be a fundamental feature of prokaryotic development. PMID:24945831

  2. Methylamine utilization via the N-methylglutamate pathway in Methylobacterium extorquens PA1 involves a novel flow of carbon through C1 assimilation and dissimilation pathways.

    PubMed

    Nayak, Dipti D; Marx, Christopher J

    2014-12-01

    Methylotrophs grow on reduced single-carbon compounds like methylamine as the sole source of carbon and energy. In Methylobacterium extorquens AM1, the best-studied aerobic methylotroph, a periplasmic methylamine dehydrogenase that catalyzes the primary oxidation of methylamine to formaldehyde has been examined in great detail. However, recent metagenomic data from natural ecosystems are revealing the abundance and importance of lesser-known routes, such as the N-methylglutamate pathway, for methylamine oxidation. In this study, we used M. extorquens PA1, a strain that is closely related to M. extorquens AM1 but is lacking methylamine dehydrogenase, to dissect the genetics and physiology of the ecologically relevant N-methylglutamate pathway for methylamine oxidation. Phenotypic analyses of mutants with null mutations in genes encoding enzymes of the N-methylglutamate pathway suggested that ?-glutamylmethylamide synthetase is essential for growth on methylamine as a carbon source but not as a nitrogen source. Furthermore, analysis of M. extorquens PA1 mutants with defects in methylotrophy-specific dissimilatory and assimilatory modules suggested that methylamine use via the N-methylglutamate pathway requires the tetrahydromethanopterin (H4MPT)-dependent formaldehyde oxidation pathway but not a complete tetrahydrofolate (H4F)-dependent formate assimilation pathway. Additionally, we present genetic evidence that formaldehyde-activating enzyme (FAE) homologs might be involved in methylotrophy. Null mutants of FAE and homologs revealed that FAE and FAE2 influence the growth rate and FAE3 influences the yield during the growth of M. extorquens PA1 on methylamine. PMID:25225269

  3. Carbon black and titanium dioxide nanoparticles elicit distinct apoptotic pathways in bronchial epithelial cells

    PubMed Central

    2010-01-01

    Background Increasing environmental and occupational exposures to nanoparticles (NPs) warrant deeper insight into the toxicological mechanisms induced by these materials. The present study was designed to characterize the cell death induced by carbon black (CB) and titanium dioxide (TiO2) NPs in bronchial epithelial cells (16HBE14o- cell line and primary cells) and to investigate the implicated molecular pathways. Results Detailed time course studies revealed that both CB (13 nm) and TiO2(15 nm) NP exposed cells exhibit typical morphological (decreased cell size, membrane blebbing, peripheral chromatin condensation, apoptotic body formation) and biochemical (caspase activation and DNA fragmentation) features of apoptotic cell death. A decrease in mitochondrial membrane potential, activation of Bax and release of cytochrome c from mitochondria were only observed in case of CB NPs whereas lipid peroxidation, lysosomal membrane destabilization and cathepsin B release were observed during the apoptotic process induced by TiO2 NPs. Furthermore, ROS production was observed after exposure to CB and TiO2 but hydrogen peroxide (H2O2) production was only involved in apoptosis induction by CB NPs. Conclusions Both CB and TiO2 NPs induce apoptotic cell death in bronchial epithelial cells. CB NPs induce apoptosis by a ROS dependent mitochondrial pathway whereas TiO2 NPs induce cell death through lysosomal membrane destabilization and lipid peroxidation. Although the final outcome is similar (apoptosis), the molecular pathways activated by NPs differ depending upon the chemical nature of the NPs. PMID:20398356

  4. Predicting preference from fixations

    Microsoft Academic Search

    Mackenzie G. Glaholt; Mei-chun Wu; Eyal M. Reingold

    2009-01-01

    We measured the strength of the association between looking behaviour and preference. Participants selected the most preferred face out of a grid of 8 faces. Fixation times were correlated with selection on a trial-by-trial basis, as well as with explicit preference ratings. Furthermore, by ranking features based on fixation times, we were able to successfully predict participants' preferences for novel

  5. Fixation: A Bibliography.

    ERIC Educational Resources Information Center

    Pedrini, D. T.; Pedrini, Bonnie C.

    Fixation and regression were considered complementary by Freud. You tend to regress to a point of fixation. They are both opposed to progression. In the general area, Anna Freud has written (The Ego and the Mechanisms of Defence. London: Hogarth and the Psycho-Analytic Institute, 1937), Sears has evaluated (Survey of Objective Studies of…

  6. Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria

    SciTech Connect

    Ferry, J.G.

    1991-12-31

    Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

  7. Amino Acid biosynthesis pathways in diatoms.

    PubMed

    Bromke, Mariusz A

    2013-01-01

    Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

  8. Amino Acid Biosynthesis Pathways in Diatoms

    PubMed Central

    Bromke, Mariusz A.

    2013-01-01

    Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

  9. Carbon and chlorine isotope analysis to identify abiotic degradation pathways of 1,1,1-trichloroethane.

    PubMed

    Palau, Jordi; Shouakar-Stash, Orfan; Hunkeler, Daniel

    2014-12-16

    This study investigates dual C-Cl isotope fractionation during 1,1,1-TCA transformation by heat-activated persulfate (PS), hydrolysis/dehydrohalogenation (HY/DH) and Fe(0). Compound-specific chlorine isotope analysis of 1,1,1-TCA was performed for the first time, and transformation-associated isotope fractionation ? bulk C and ? bulk Cl values were -4.0 ± 0.2‰ and no chlorine isotope fractionation with PS, -1.6 ± 0.2‰ and -4.7 ± 0.1‰ for HY/DH, -7.8 ± 0.4‰ and -5.2 ± 0.2‰ with Fe(0). Distinctly different dual isotope slopes (??13C/??37Cl): ? with PS, 0.33 ± 0.04 for HY/DH and 1.5 ± 0.1 with Fe(0) highlight the potential of this approach to identify abiotic degradation pathways of 1,1,1-TCA in the field. The trend observed with PS agreed with a C-H bond oxidation mechanism in the first reaction step. For HY/DH and Fe(0) pathways, different slopes were obtained although both pathways involve cleavage of a C-Cl bond in their initial reaction step. In contrast to the expected larger primary carbon isotope effects relative to chlorine for C-Cl bond cleavage, ? bulk C < ? bulk Cl was observed for HY/DH and in a similar range for reduction by Fe(0), suggesting the contribution of secondary chlorine isotope effects. Therefore, different magnitude of secondary chlorine isotope effects could at least be partly responsible for the distinct slopes between HY/DH and Fe(0) pathways. Following this dual isotope approach, abiotic transformation processes can unambiguously be identified and quantified. PMID:25379605

  10. Investigation of inter-individual variability of the one-carbon folate pathway: a bioinformatic and genetic review

    Microsoft Academic Search

    D F Carr; G Whiteley; A Alfirevic; M Pirmohamed

    2009-01-01

    Genetic polymorphisms in the one-carbon folate pathway have been widely studied in association with a number of conditions. Most of the research has focused on the 677C>T polymorphism in the coding region of the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene. However, there are a total of 25 genes in this pathway coding for enzymes, transporters and receptors, which can be investigated using

  11. New Pathways and Metrics for Enhanced, Reversible Hydrogen Storage in Boron-Doped Carbon Nanospaces

    SciTech Connect

    Pfeifer, Peter [University of Missouri; Wexler, Carlos [University of Missouri; Hawthorne, M. Frederick [University of Missouri; Lee, Mark W. [University of Missouri; Jalistegi, Satish S. [University of Missouri

    2014-08-14

    This project, since its start in 2007—entitled “Networks of boron-doped carbon nanopores for low-pressure reversible hydrogen storage” (2007-10) and “New pathways and metrics for enhanced, reversible hydrogen storage in boron-doped carbon nanospaces” (2010-13)—is in support of the DOE's National Hydrogen Storage Project, as part of the DOE Hydrogen and Fuel Cells Program’s comprehensive efforts to enable the widespread commercialization of hydrogen and fuel cell technologies in diverse sectors of the economy. Hydrogen storage is widely recognized as a critical enabling technology for the successful commercialization and market acceptance of hydrogen powered vehicles. Storing sufficient hydrogen on board a wide range of vehicle platforms, at energy densities comparable to gasoline, without compromising passenger or cargo space, remains an outstanding technical challenge. Of the main three thrust areas in 2007—metal hydrides, chemical hydrogen storage, and sorption-based hydrogen storage—sorption-based storage, i.e., storage of molecular hydrogen by adsorption on high-surface-area materials (carbons, metal-organic frameworks, and other porous organic networks), has emerged as the most promising path toward achieving the 2017 DOE storage targets of 0.055 kg H2/kg system (“5.5 wt%”) and 0.040 kg H2/liter system. The objective of the project is to develop high-surface-area carbon materials that are boron-doped by incorporation of boron into the carbon lattice at the outset, i.e., during the synthesis of the material. The rationale for boron-doping is the prediction that boron atoms in carbon will raise the binding energy of hydro- gen from 4-5 kJ/mol on the undoped surface to 10-14 kJ/mol on a doped surface, and accordingly the hydro- gen storage capacity of the material. The mechanism for the increase in binding energy is electron donation from H2 to electron-deficient B atoms, in the form of sp2 boron-carbon bonds. Our team is proud to have demonstrated the predicted increase in binding energy experimentally, currently at ~10 kJ/mol. The synthetic route for incorporation of boron at the outset is to create appropriately designed copoly- mers, with a boron-free and a boron-carrying monomer, followed by pyrolysis of the polymer, yielding a bo- ron-substituted carbon scaffold in which boron atoms are bonded to carbon atoms by synthesis. This is in contrast to a second route (funded by DE-FG36-08GO18142) in which first high-surface area carbon is cre- ated and doped by surface vapor deposition of boron, with incorporation of the boron into the lattice the final step of the fabrication. The challenge in the first route is to create high surface areas without compromising sp2 boron-carbon bonds. The challenge in the second route is to create sp2 boron-carbon bonds without com- promising high surface areas.

  12. C1 Metabolism in Corynebacterium glutamicum: an Endogenous Pathway for Oxidation of Methanol to Carbon Dioxide

    PubMed Central

    Witthoff, Sabrina; Mühlroth, Alice

    2013-01-01

    Methanol is considered an interesting carbon source in “bio-based” microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert 13C-labeled methanol to 13CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

  13. Modulation of Apoptotic Pathways of Macrophages by Surface-Functionalized Multi-Walled Carbon Nanotubes

    PubMed Central

    Jiang, Yuanqin; Zhang, Honggang; Wang, Yange; Chen, Min; Ye, Shefang; Hou, Zhenqing; Ren, Lei

    2013-01-01

    Biomedical applications of carbon nanotubes (CNTs) often involve improving their hydrophilicity and dispersion in biological media by modifying them through noncovalent or covalent functionalization. However, the potential adverse effects of surface-functionalized CNTs have not been well characterized. In this study, we functionalized multi-walled CNTs (MWCNTs) via carboxylation, to produce MWCNTs-COOH, and via poly (ethylene glycol) linking, to produce MWCNTs-PEG. We used these functionalized MWCNTs to study the effect of surface functionalization on MWCNTs-induced toxicity to macrophages, and elucidate the underlying mechanisms of action. Our results revealed that MWCNTs-PEG were less cytotoxic and were associated with less apoptotic cell death of macrophages than MWCNTs-COOH. Additionally, MWCNTs-PEG induced less generation of reactive oxygen species (ROS) involving less activation of NADPH oxidase compared with MWCNTs-COOH, as evidenced by membrane translocation of p47phox and p67phox in macrophages. The less cytotoxic and apoptotic effect of MWCNTs-PEG compared with MWCNTs-COOH resulted from the lower cellular uptake of MWCNTs-PEG, which resulted in less activation of oxidative stress-responsive pathways, such as p38 mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-?B. These results demonstrate that surface functionalization of CNTs may alter ROS-mediated cytotoxic and apoptotic response by modulating apoptotic signaling pathways. Our study thus provides new insights into the molecular basis for the surface properties affecting CNTs toxicity. PMID:23755279

  14. Candidate pathway polymorphisms in one-carbon metabolism and risk of rectal tumor mutations

    PubMed Central

    Curtin, Karen; Ulrich, Cornelia M; Samowitz, Wade S; Wolff, Roger K; Duggan, David J; Makar, Karen W; Caan, Bette J; Slattery, Martha L

    2011-01-01

    We examined candidate polymorphisms in genes involved in the folate-mediated, one-carbon metabolism pathway, DNMT1 1311V, MTHFD1 R134K and R653Q, MTHFR R594Q, MTR D919G, MTRR H595Y and I22M, SHMT1 L474F, SLC19A1 H27R, and TDG G199S, and associations with rectal tumor characteristics. We hypothesized that these candidate genes would influence CpG Island Methylator Phenotype and potentially KRAS2 or TP53 tumors. Data from a population-based study of 747 rectal cases (593 with tumor markers) and 956 controls were evaluated using generalized estimating equations. We observed an increased risk of TP53 tumor mutations in homozygous carriers of the MTHFD1 134K allele (0R=2.0, 95%CI 1.2-3.1, P- trend=0.02). In the presence of low folate intake, the R134K variant was associated with increased risk of CIMP+ tumors (OR=2.8, 95%CI 1.04-7.7). The MTRR I22M variant genotype was associated with a modest increased risk of TP53 mutations (OR=1.7, 95%CI 1.2-2.5, P-trend=0.001). Our findings offer limited support that polymorphisms in one-carbon metabolism genes influence rectal tumor phenotype, and that folate may interact with MTHFD1 to alter CIMP+ risk. PMID:21537397

  15. Genetic analysis of the archaeon Methanosarcina barkeri Fusaro reveals a central role for Ech hydrogenase and ferredoxin in methanogenesis and carbon fixation

    PubMed Central

    Meuer, Jörn; Kuettner, H. Craig; Zhang, Jun Kai; Hedderich, Reiner; Metcalf, William W.

    2002-01-01

    Ech hydrogenase (Ech) from the methanogenic archaeon Methanosarcina barkeri catalyzes the reversible reduction of ferredoxin by H2 and is a member of a distinct group of membrane-bound [NiFe] hydrogenases with sequence similarity to energy-conserving NADH:quinone oxidoreductase (complex I). To elucidate the physiological role(s) of Ech a mutant lacking this enzyme was constructed. The mutant was unable to grow on methanol/H2/CO2, H2/CO2, or acetate as carbon and energy sources but showed wild-type growth rates with methanol as sole substrate. Addition of pyruvate to the growth medium restored growth on methanol/H2/CO2 but not on H2/CO2 or acetate. Results obtained from growth experiments, cell suspension experiments, and enzyme activity measurements in cell extracts provide compelling evidence for essential functions of Ech and a 2[4Fe-4S] ferredoxin in the metabolism of M. barkeri. The following conclusions were made. (i) In acetoclastic methanogenesis, Ech catalyzes H2 formation from reduced ferredoxin, generated by the oxidation of the carbonyl group of acetate to CO2. (ii) Under autotrophic growth conditions, the enzyme catalyzes the energetically unfavorable reduction of ferredoxin by H2, most probably driven by reversed electron transport, and the reduced ferredoxin thus generated functions as low potential electron donor for the synthesis of pyruvate in an anabolic pathway. (iii) Reduced ferredoxin in addition provides the reducing equivalents for the first step of methanogenesis from H2/CO2, the reduction of CO2 to formylmethanofuran. Thus, in vivo genetic analysis has led to the identification of the electron donor of this key initial step of methanogenesis. PMID:11929975

  16. Nitrogen fixation in peanut nodules during dark periods and detopped conditions with special reference to lipid bodies

    SciTech Connect

    Siddique, A.M.; Bal, A.K. (Memorial Univ. of Newfoundland, St. John's (Canada))

    1991-03-01

    The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of {beta}-oxidation pathway and glyoxylate cycle is shown by the release of {sup 14}CO{sub 2} from {sup 14}C lineoleoyl coenzyme A by the nodule homogenate.

  17. Nitrogen Fixation in Peanut Nodules during Dark Periods and Detopped Conditions with Special Reference to Lipid Bodies 1

    PubMed Central

    Siddique, Abu-baker M.; Bal, Arya K.

    1991-01-01

    The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of ?-oxidation pathway and, glyoxylate cycle is shown by the release of 14CO2 from 14C lineoleoyl coenzyme A by the nodule homogenate. Images Figure 2 Figure 4 PMID:16668069

  18. Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway

    PubMed Central

    Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian

    2013-01-01

    Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 ± 0.026 ng/mL for 1 mg/L, 0.21 ± 0.024 ng/mL for 5 mg/L, and 0.27 ± 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 ± 0.01 ng/mL for 1 mg/L, 0.12 ± 0.017 ng/mL for 5 mg/L, and 0.17 ± 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus. PMID:24039418

  19. A Pathway for Photosynthetic Carbon Flow to Mannitol in Celery Leaves 1

    PubMed Central

    Rumpho, Mary E.; Edwards, Gerald E.; Loescher, Wayne H.

    1983-01-01

    In the polyol producing plant, celery (Apium graveolens L.), mannitol is a major photosynthetic product and a form in which carbohydrate is translocated. Measurements of whole leaf extracts of celery indicated substantial activity of the following enzymes: mannose-6-P reductase, mannose-6-P isomerase, mannitol-1-P phosphatase, and nonreversible glyceraldehyde-3-P dehydrogenase. The activities of these enzymes were either undetectable or very low in the nonpolyol producing plants, Secale cereale L. (rye) and Vigna mungo (L.) Hepper (black gram). Mesophyll protoplasts were enzymically isolated from celery leaves, broken with a Yeda press and the intracellular localization of the above enzymes for mannitol synthesis studied following differential and/or sucrose density gradient centrifugation of the protoplast extract. These data suggested the enzymes involved in mannitol synthesis are exclusively localized in the cytoplasm. Ninety-five to 100% of the activity of these enzymes, along with the cytoplasmic marker enzyme phosphoenolpyruvate carboxylase, was found in the cytosolic fraction. We propose the pathway of photosynthetic carbon flow from triose-P to mannitol in celery occurs via fructose-6-P, mannose-6-P, and mannitol-1-P; these final reactions being catalyzed by the cytoplasmic enzymes, mannose-6-P isomerase, NADPH-dependent mannose-6-P reductase, and mannitol-1-P phosphatase, respectively. The requirement for NADPH may be met via the cytoplasmically located NADP-linked nonreversible glyceraldehyde-3-P dehydrogenase. PMID:16663332

  20. Carbonic Anhydrase-8 Regulates Inflammatory Pain by Inhibiting the ITPR1-Cytosolic Free Calcium Pathway

    PubMed Central

    Zhuang, Gerald Z.; Keeler, Benjamin; Grant, Jeff; Bianchi, Laura; Fu, Eugene S.; Zhang, Yan Ping; Erasso, Diana M.; Cui, Jian-Guo; Wiltshire, Tim; Li, Qiongzhen; Hao, Shuanglin; Sarantopoulos, Konstantinos D.; Candiotti, Keith; Wishnek, Sarah M.; Smith, Shad B.; Maixner, William; Diatchenko, Luda; Martin, Eden R.; Levitt, Roy C.

    2015-01-01

    Calcium dysregulation is causally linked with various forms of neuropathology including seizure disorders, multiple sclerosis, Huntington’s disease, Alzheimer’s, spinal cerebellar ataxia (SCA) and chronic pain. Carbonic anhydrase-8 (Car8) is an allosteric inhibitor of inositol trisphosphate receptor-1 (ITPR1), which regulates intracellular calcium release fundamental to critical cellular functions including neuronal excitability, neurite outgrowth, neurotransmitter release, mitochondrial energy production and cell fate. In this report we test the hypothesis that Car8 regulation of ITPR1 and cytoplasmic free calcium release is critical to nociception and pain behaviors. We show Car8 null mutant mice (MT) exhibit mechanical allodynia and thermal hyperalgesia. Dorsal root ganglia (DRG) from MT also demonstrate increased steady-state ITPR1 phosphorylation (pITPR1) and cytoplasmic free calcium release. Overexpression of Car8 wildtype protein in MT nociceptors complements Car8 deficiency, down regulates pITPR1 and abolishes thermal and mechanical hypersensitivity. We also show that Car8 nociceptor overexpression alleviates chronic inflammatory pain. Finally, inflammation results in downregulation of DRG Car8 that is associated with increased pITPR1 expression relative to ITPR1, suggesting a possible mechanism of acute hypersensitivity. Our findings indicate Car8 regulates the ITPR1-cytosolic free calcium pathway that is critical to nociception, inflammatory pain and possibly other neuropathological states. Car8 and ITPR1 represent new therapeutic targets for chronic pain. PMID:25734498

  1. Abiotic Nitrogen Fixation on Terrestrial Planets

    NASA Astrophysics Data System (ADS)

    Summers, David P.; Khare, B.; Basa, R. C. B.; Rodoni, D.

    2009-09-01

    The abiotic fixation of nitrogen is critical to planetary evolution and the potential for life on terrestrial planets. A non-biological source of nitrogen, in a biochemically accessible form, is necessary for the origin and early evolution of life. Loss of nitrogen can result in atmospheric pressures too low for liquid water and will impact planetary habitability and hydrological processes. Shock heating of a non-reducing atmosphere produces NO and this has been well studied. Our understanding of the subsequent reactions was, in the past, theoretical. It was postulated that NO was photochemically converted to HNO which then, in surface waters, reacts to form nitrate and nitrite. This chemistry, including reactions in both the gas phase and the liquid phase, has now been studied experimentally. Our work has observed that there are multiple pathways for the fixation. One pathway observed is consistent with the theoretically predicted route via the formation of HNO. Interestingly, this pathway is coupled to photochemical formation of formaldehyde from CO through the formation of HCO. In the presence of liquid water, this pathway leads to the formation of nitrate and nitrite. In the presence of water vapor, but no liquid water, HNO appears to mostly dimerize to form N2O. A second pathway involves the formation of NO2 from CO2 and NO. This pathway becomes more dominant without water, but the reaction of NO2 with even adsorbed water can lead to the formation of nitric acid. Finally, with FeS suspended in liquid water, the direct reduction of NO to ammonia is observed. This last pathway represents the most efficient way to reduced nitrogen, with product yields well above 20% (nitrite/nitrate, from the first two pathways can also be reduced to ammonia thought the overall efficiency suffers). We wish to thank the NASA Astrobiology Institute for support.

  2. Dissolved CO2 in small catchment streams of eastern Amazonia: A minor pathway of terrestrial carbon loss

    Microsoft Academic Search

    Eric A. Davidson; Ricardo O. Figueiredo; Daniel Markewitz; Anthony K. Aufdenkampe

    2010-01-01

    Production of carbon dioxide (CO2) in soils can lead to supersaturation of dissolved free CO2 (pCO2) in groundwater, which later evades to the atmosphere as groundwater enters streams and rivers. This process could be a significant pathway for return of terrestrially fixed C to the atmosphere. We measured pCO2 monthly over two years at multiple stations along three streams from

  3. Soil Carbon Dynamics Along the Pathway From Diverse Microbial Carbon to Humus in a Temperate and Tropical Forest

    NASA Astrophysics Data System (ADS)

    Throckmorton, H. M.; Bird, J. A.; Firestone, M. K.; Horwath, W. R.

    2008-12-01

    This research investigates the importance of microbial biochemistry to humification pathways in two climatically different forest ecosystems; Blodgett forest (BF), a temperate forest in the Sierra Nevada and Luquillo forest (LF), a tropical forest in Puerto Rico. Non-living 13C enriched temperate and tropical microorganisms from four biochemically contrasting microbial groups (fungi, actinomycetes, bacteria gram (+), and bacteria gram (-)) were separately added to soil at both sites in a reciprocal transplant experiment. Decomposition rates were substantially greater at LF than BF for all microbial inputs. Although there were initial differences in microbial C turnover and recovery within the soil microbial biomass and dissolved organic carbon pools for unique microbial C inputs at both sites, over time treatment differences converge within each site and the quality of input microbial C becomes less important to C remaining and maintained within these soil C pools. Physical soil fractionation revealed important trends which illustrate the role of the soil mineral matrix to protect and stabilize C in soil. Results indicate different C turnover rates associated with the light, aggregate- occluded, and mineral-associated soil fractions at both sites. At BF input C recovered within the light and mineral-associated fractions decreased substantially over time (1 to 13 months), while C occluded within aggregates only slightly decreased. Similarly, LF soils exhibit only a slight decrease in aggregate-occluded C over time (0.5 to 3.5 months), while C recovered within the light fraction decreased substantially; however, unlike BF, LF soils exhibited only a slight decrease in C recovered within the mineral fraction. The distribution of total C among these physical soil pools differs substantially for either site, suggesting differences in the relative importance of the mineral matrix to protect and stabilize C. Preliminary compound-specific isotope analyses employing pyrolysis gas chromatography mass spectrometry and isotope ratio spectrometry (Py-GC-MS/IRMS) for temperate BF soils treated with 13C enriched temperate fungal residues indicates a substantial enrichment of low molecular weight (MW) compounds from microbial additions after 1 month in the field; however, after 5 months in the field the 13C enrichment shifts to higher MW compounds. These trends suggest higher MW compounds are formed through humification as synthesis or condensation products, which highlights the importance of monitoring biogeochemical transformations of unique sources of C over time. Future and ongoing work examines specific compounds associated with these high 13C enrichment values in an effort to understand the link between microbial C quality and humification products.

  4. The Fixation of Nitrogen.

    ERIC Educational Resources Information Center

    Andrew, S. P. S.

    1978-01-01

    Discusses the fixation of atmospheric nitrogen in the form of ammonia as one of the foundations of modern chemical industry. The article describes ammonia production and synthesis, purifying the hydrogen-nitrogen mix, nitric acid production, and its commericial plant. (HM)

  5. Update: Biological Nitrogen Fixation.

    ERIC Educational Resources Information Center

    Wiseman, Alan; And Others

    1985-01-01

    Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,…

  6. Synthetic Pathway for Production of Five-Carbon Alcohols from Isopentenyl Diphosphate

    PubMed Central

    Chou, Howard H.

    2012-01-01

    Synthetic biological pathways could enhance the development of novel processes to produce chemicals from renewable resources. On the basis of models that describe the evolution of metabolic pathways and enzymes in nature, we developed a framework to rationally identify enzymes able to catalyze reactions on new substrates that overcomes one of the major bottlenecks in the assembly of a synthetic biological pathway. We verified the framework by implementing a pathway with two novel enzymatic reactions to convert isopentenyl diphosphate into 3-methyl-3-butenol, 3-methyl-2-butenol, and 3-methylbutanol. To overcome competition with native pathways that share the same substrate, we engineered two bifunctional enzymes that redirect metabolic flux toward the synthetic pathway. Taken together, our work demonstrates a new approach to the engineering of novel synthetic pathways in the cell. PMID:22941086

  7. Synthetic pathway for production of five-carbon alcohols from isopentenyl diphosphate.

    PubMed

    Chou, Howard H; Keasling, Jay D

    2012-11-01

    Synthetic biological pathways could enhance the development of novel processes to produce chemicals from renewable resources. On the basis of models that describe the evolution of metabolic pathways and enzymes in nature, we developed a framework to rationally identify enzymes able to catalyze reactions on new substrates that overcomes one of the major bottlenecks in the assembly of a synthetic biological pathway. We verified the framework by implementing a pathway with two novel enzymatic reactions to convert isopentenyl diphosphate into 3-methyl-3-butenol, 3-methyl-2-butenol, and 3-methylbutanol. To overcome competition with native pathways that share the same substrate, we engineered two bifunctional enzymes that redirect metabolic flux toward the synthetic pathway. Taken together, our work demonstrates a new approach to the engineering of novel synthetic pathways in the cell. PMID:22941086

  8. The Mechanics of External Fixation

    PubMed Central

    Rozbruch, S. Robert

    2006-01-01

    External fixation has evolved from being used primarily as a last resort fixation method to becoming a main stream technique used to treat a myriad of bone and soft tissue pathologies. Techniques in limb reconstruction continue to advance largely as a result of the use of these external devices. A thorough understanding of the biomechanical principles of external fixation is useful for all orthopedic surgeons as most will have to occasionally mount a fixator throughout their career. In this review, various types of external fixators and their common clinical applications are described with a focus on unilateral and circular frames. The biomechanical principles that govern bony and fixator stability are reviewed as well as the recommended techniques for applying external fixators to maximize stability. Additionally, we have illustrated methods for managing patients while they are in the external frames to facilitate function and shorten treatment duration. PMID:18751766

  9. One-carbon metabolism in methanogenic bacteria: analysis of short-term fixation products of 14CO2 and 14CH3OH incorporated into whole cells.

    PubMed Central

    Daniels, L; Zeikus, J G

    1978-01-01

    Methanobacterium thermoautotrophicum, M. ruminantium, and Methanosarcina barkeri were labeled with 14CO2 (14CO2 + H14CO3- + 14CO32-) for from 2 to 45 s. Radioactivity was recovered in coenzyme M derivatives, alanine, aspartate, glutamate, and several unidentified compounds. The properties of one important structurally unidentified intermediate (yellow fluorescent compound) displayed UV absorbance maxima at pH 1 of 290 and 335 nm, no absorbance in the visible region, and a fluorescence maximum at 460 nm. Label did not appear in organic phosphates until after 1 min. 14CH3OH was converted by M. barkeri primarily into coenzyme M derivatives at 25 s. [2-14C]acetate was assimilated by M. thermoautotrophicum mainly into alanine and succinate during 2 to 240 s, but not into coenzyme M derivatives or yellow fluorescent compound. Cell-free extracts of M. thermoautotrophicum lacked ribulose 1,5-bisphosphate carboxylase activity. The data indicated the absence of the Calvin, serine, and hexulose phosphate paths of C1 assimilation in the methanogens examined and indicated that pyruvate was an early intermediate product of net CO2 fixation. The in vivo importance of coenzyme M derivatives in methanogenesis was demonstrated. Images PMID:101522

  10. A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime

    NASA Technical Reports Server (NTRS)

    Carr, Mary-Elena

    1998-01-01

    A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

  11. A batch study on the bio-fixation of carbon dioxide in the absorbed solution from a chemical wet scrubber by hot spring and marine algae.

    PubMed

    Hsueh, H T; Chu, H; Yu, S T

    2007-01-01

    Carbon dioxide mass transfer is a key factor in cultivating micro-algae except for the light limitation of photosynthesis. It is a novel idea to enhance mass transfer with the cyclic procedure of absorbing CO(2) with a high performance alkaline abosorber such as a packed tower and regenerating the alkaline solution with algal photosynthesis. Hence, the algae with high affinity for alkaline condition must be purified. In this study, a hot spring alga (HSA) was purified from an alkaline hot spring (pH 9.3, 62 degrees C) in Taiwan and grows well over pH 11.5 and 50 degrees C. For performance of HSA, CO(2) removal efficiencies in the packed tower increase about 5-fold in a suitable growth condition compared to that without adding any potassium hydroxide. But ammonia solution was not a good choice for this system with regard to carbon dioxide removal efficiency because of its toxicity on HSA. In addition, HSA also exhibits a high growth rate under the controlled pHs from 7 to 11. Besides, a well mass balance of carbon and nitrogen made sure that less other byproducts formed in the procedure of carboxylation. For analysis of some metals in HSA, such as Mg, Mn, Fe, Zn, related to the photosynthesis increased by a rising cultivated pH and revealed that those metals might be accumulated under alkaline conditions but the growth rate was still limited by the ratio of bicarbonate (useful carbon source) and carbonate. Meanwhile, Nannochlopsis oculta (NAO) was also tested under different additional carbon sources. The results revealed that solutions of sodium/potassium carbonate are better carbon sources than ammonia carbonate/bicarbonate for the growth of NAO. However, pH 9.6 of growth limitation based on sodium was lower than one of HSA. The integrated system is, therefore, more feasible to treat CO(2) in the flue gases using the algae with higher alkaline affinity such as HSA in small volume bioreactors. PMID:16860839

  12. The solar photovoltaics wedge: pathways for growth and potential carbon mitigation in the US

    Microsoft Academic Search

    Easan Drury; Paul Denholm; Robert M. Margolis

    2009-01-01

    The challenge of stabilizing global carbon emissions over the next 50 years has been framed in the context of finding seven 1.0 Gton C\\/year carbon reduction wedges. Solar photovoltaics (PV) could provide at least one carbon wedge, but will require significant growth in PV manufacturing capacity. The actual amount of installed PV capacity required to reach wedge-level carbon reductions will

  13. Novel posterior fixation keratoprosthesis

    NASA Astrophysics Data System (ADS)

    Lacombe, Emmanuel

    1992-08-01

    The keratoprosthesis is the last solution for corneally blind patients that cannot benefit from corneal transplants. Keratoprostheses that have been designed to be affixed anteriorly usually necessitate multi-step surgical procedures and are continuously subjected to the extrusion forces generated by the positive intraocular pressure; therefore, clinical results in patients prove inconsistent. We proposed a novel keratoprosthesis concept that utilizes posterior corneal fixation which `a priori' minimizes the risk of aqueous leakage and expulsion. This prosthesis is implanted in a single procedure thereby reducing the number of surgical complications normally associated with anterior fixation devices. In addition, its novel design makes this keratoprosthesis implantable in phakic eyes. With an average follow-up of 13 months (range 3 to 25 months), our results on 21 cases are encouraging. Half of the keratoprostheses were implanted in severe burn cases, with the remainder in cases of pseudo- pemphigus. Good visual results and cosmetic appearance were obtained in 14 of 21 eyes.

  14. Mobilization pathways of organic carbon from permafrost to arctic rivers in a changing climate

    E-print Network

    Guo, Laodong

    ; published 7 July 2007. [1] Arctic warming may cause the release of vast amounts of soil organic carbon (SOC]. The difficulty in understanding the consequences of projected Arctic climate change for the organic carbon cycle; Matheus et al., 2003]. To better understand relationships between carbon dynamics and arctic climate

  15. [Advances on CO2 fixation by microalgae].

    PubMed

    Cheng, Li-Hua; Zhang, Lin; Chen, Huan-Lin; Gao, Cong-Jie

    2005-03-01

    The greenhouse effect, which is believed to occur primarily as a result of the accumulation of carbon dioxide in the atmosphere, has become one of the major environmental concerns and received worldwide attention. In this paper, algae species screening and cultivation for efficient CO2 fixation are reviewed. The related dissolved inorganic carbon (DIC) utilization form and CO2 concentration mechanism (CCM) in the process of CO2 fixation by microalgae are analyzed. Four objectives of the highly effective photobioreactor design and operation are discussed, and the advances on CO2 mitigation technology with integration of microalgae (enzyme) and membrane bioreactor are also briefly introduced. In response to elevated CO2 concentration, much attention needs to be paid to the construction of transgenic microalgae with higher performance in CO2 fixation based on the further ascertainment of the related mechanism, and the development of effective CO2 biofixation system integrated with other kinds of advanced technology, such as membrane immobilization and separation. PMID:16013471

  16. Nitrogen Fixation by a Blue-Green Epiphyte on Pelagic Sargassum

    Microsoft Academic Search

    Edward J. Carpent

    1972-01-01

    Nitrogen fixation by Dichothrix fucicola, an epiphyte on pelagic Sargassum, was measured in May and June 1972 in the western Sargasso Sea and the Gulf Stream. This is the first report of nitrogen fixation by a heterocyst-bearing blue-green alga in the open ocean, and also the first observation of nitrogen fixation in the genus Dichothrix. Cellular carbon\\/nitrogen ratios suggested that

  17. Re-engineering of carbon fixation in plants - challenges for plant biotechnology to improve yields in a high-CO2 world.

    PubMed

    Peterhansel, Christoph; Offermann, Sascha

    2012-04-01

    Source and sink strength control plant carbon gain and yield. Source strength was recently engineered by modifying the large subunit of Rubisco, replacing the small subunit, and creating improved thermostable Rubisco activases. This technological breakthrough makes Rubisco engineering feasible at last. Enhancement of leaf transitory starch synthesis or induction of artificial sinks in leaves increased biomass and yield. Importantly, such approaches also had a positive feedback on source strength. In addition, novel targets for the improvement of carbon gain in crops have been identified that are especially relevant in the light of climate change. PMID:22261558

  18. Regulation of Development and Nitrogen Fixation in Anabaena

    SciTech Connect

    James W Golden

    2004-08-05

    The nitrogen-fixing filamentous cyanobacterium Anabaena sp. strain PCC 7120 is being used as a simple model of microbial development and pattern formation in a multicellular prokaryotic organism. Anabaena reduces atmospheric nitrogen to ammonia in highly specialized, terminally differentiated cells called heterocysts. Anabaena is an important model system because of the multicellular growth pattern, the suspected antiquity of heterocyst development, and the contribution of fixed nitrogen to the environment. We are especially interested in understanding the molecular signaling pathways and genetic regulation that control heterocyst development. In the presence of an external source of reduced nitrogen, the differentiation of heterocysts is inhibited. When Anabaena is grown on dinitrogen, a one-dimensional developmental pattern of single heterocysts separated by approximately ten vegetative cells is established to form a multicellular organism composed of two interdependent cell types. The goal of this project is to understand the signaling and regulatory pathways that commit a vegetative cell to terminally differentiate into a nitrogen-fixing heterocyst. Several genes identified by us and by others were chosen as entry points into the regulatory network. Our research, which was initially focused on transcriptional regulation by group 2 sigma factors, was expanded to include group 3 sigma factors and their regulators after the complete Anabaena genome sequence became available. Surprisingly, no individual sigma factor is essential for heterocyst development. We have used the isolation of extragenic suppressors to study genetic interactions between key regulatory genes such as patS, hetR, and hetC in signaling and developmental pathways. We identified a hetR R223W mutation as a bypass suppressor of patS overexpression. Strains containing the hetR R223W allele fail to respond to pattern formation signals and overexpression of this allele results in a lethal phenotype because all cells differentiate a few days after nitrogen step-down. Our continued analysis of these genes will provide a better understanding of how a simple prokaryotic organism can perform both photosynthetic carbon fixation and nitrogen fixation simultaneously by separating these processes in different cell types.

  19. Understanding Nitrogen Fixation

    SciTech Connect

    Paul J. Chirik

    2012-05-25

    The purpose of our program is to explore fundamental chemistry relevant to the discovery of energy efficient methods for the conversion of atmospheric nitrogen (N{sub 2}) into more value-added nitrogen-containing organic molecules. Such transformations are key for domestic energy security and the reduction of fossil fuel dependencies. With DOE support, we have synthesized families of zirconium and hafnium dinitrogen complexes with elongated and activated N-N bonds that exhibit rich N{sub 2} functionalization chemistry. Having elucidated new methods for N-H bond formation from dihydrogen, C-H bonds and Broensted acids, we have since turned our attention to N-C bond construction. These reactions are particularly important for the synthesis of amines, heterocycles and hydrazines with a range of applications in the fine and commodity chemicals industries and as fuels. One recent highlight was the discovery of a new N{sub 2} cleavage reaction upon addition of carbon monoxide which resulted in the synthesis of an important fertilizer, oxamide, from the diatomics with the two strongest bonds in chemistry. Nitrogen-carbon bonds form the backbone of many important organic molecules, especially those used in the fertilizer and pharamaceutical industries. During the past year, we have continued our work in the synthesis of hydrazines of various substitution patterns, many of which are important precursors for heterocycles. In most instances, the direct functionalization of N{sub 2} offers a more efficient synthetic route than traditional organic methods. In addition, we have also discovered a unique CO-induced N{sub 2} bond cleavage reaction that simultaneously cleaves the N-N bond of the metal dinitrogen compound and assembles new C-C bond and two new N-C bonds. Treatment of the CO-functionalized core with weak Broensted acids liberated oxamide, H{sub 2}NC(O)C(O)NH{sub 2}, an important slow release fertilizer that is of interest to replace urea in many applications. The synthesis of ammonia, NH{sub 3}, from its elements, H{sub 2} and N{sub 2}, via the venerable Haber-Bosch process is one of the most significant technological achievements of the past century. Our research program seeks to discover new transition metal reagents and catalysts to disrupt the strong N {triple_bond} N bond in N{sub 2} and create new, fundamental chemical linkages for the construction of molecules with application as fuels, fertilizers and fine chemicals. With DOE support, our group has discovered a mild method for ammonia synthesis in solution as well as new methods for the construction of nitrogen-carbon bonds directly from N{sub 2}. Ideally these achievements will evolve into more efficient nitrogen fixation schemes that circumvent the high energy demands of industrial ammonia synthesis. Industrially, atmospheric nitrogen enters the synthetic cycle by the well-established Haber-Bosch process whereby N{sub 2} is hydrogenated to ammonia at high temperature and pressure. The commercialization of this reaction represents one of the greatest technological achievements of the 20th century as Haber-Bosch ammonia is responsible for supporting approximately 50% of the world's population and serves as the source of half of the nitrogen in the human body. The extreme reaction conditions required for an economical process have significant energy consequences, consuming 1% of the world's energy supply mostly in the form of pollution-intensive coal. Moreover, industrial H{sub 2} synthesis via the water gas shift reaction and the steam reforming of methane is fossil fuel intensive and produces CO{sub 2} as a byproduct. New synthetic methods that promote this thermodynamically favored transformation ({Delta}G{sup o} = -4.1 kcal/mol) under milder conditions or completely obviate it are therefore desirable. Most nitrogen-containing organic molecules are derived from ammonia (and hence rely on the Haber-Bosch and H{sub 2} synthesis processes) and direct synthesis from atmospheric nitrogen could, in principle, be more energy-efficient. This is particularly attractive giv

  20. Ammonia oxidation coupled to CO2 fixation by archaea and bacteria in an agricultural soil.

    PubMed

    Pratscher, Jennifer; Dumont, Marc G; Conrad, Ralf

    2011-03-01

    Ammonia oxidation is an essential part of the global nitrogen cycling and was long thought to be driven only by bacteria. Recent findings expanded this pathway also to the archaea. However, most questions concerning the metabolism of ammonia-oxidizing archaea, such as ammonia oxidation and potential CO(2) fixation, remain open, especially for terrestrial environments. Here, we investigated the activity of ammonia-oxidizing archaea and bacteria in an agricultural soil by comparison of RNA- and DNA-stable isotope probing (SIP). RNA-SIP demonstrated a highly dynamic and diverse community involved in CO(2) fixation and carbon assimilation coupled to ammonia oxidation. DNA-SIP showed growth of the ammonia-oxidizing bacteria but not of archaea. Furthermore, the analysis of labeled RNA found transcripts of the archaeal acetyl-CoA/propionyl-CoA carboxylase (accA/pccB) to be expressed and labeled. These findings strongly suggest that ammonia-oxidizing archaeal groups in soil autotrophically fix CO(2) using the 3-hydroxypropionate-4-hydroxybutyrate cycle, one of the two pathways recently identified for CO(2) fixation in Crenarchaeota. Catalyzed reporter deposition (CARD)-FISH targeting the gene encoding subunit A of ammonia monooxygenase (amoA) mRNA and 16S rRNA of archaea also revealed ammonia-oxidizing archaea to be numerically relevant among the archaea in this soil. Our results demonstrate a diverse and dynamic contribution of ammonia-oxidizing archaea in soil to nitrification and CO(2) assimilation and that their importance to the overall archaeal community might be larger than previously thought. PMID:21368116

  1. Evaluating the effects of carbon nanoreactor diameter and internal structure on the pathways of the catalytic hydrosilylation reaction.

    PubMed

    Solomonsz, William A; Rance, Graham A; Khlobystov, Andrei N

    2014-05-14

    Three different types of carbon nanoreactors, double-walled nanotubes (DWNT), multi-walled nanotubes (MWNT) and graphitised carbon nanofibers (GNF) have been appraised for the first time as containers for the reactions of phenylacetylene hydrosilylation catalysed by a confined molecular catalyst [Rh?(CO)??]. Interactions of [Rh?(CO)??] with carbon nanoreactors determining the ratio of ?-addition products are unchanged for all nanoreactors and are virtually unaffected by the confinement of [Rh?(CO)??] inside carbon nanostructures. Conversely, the relative concentrations of reactants affecting the ratio of addition and dehydrogenative silylation products is very sensitive to nanoscale confinement, with all nanoreactors demonstrating significant effects on the distribution of reaction products as compared to control experiments with the catalyst in bulk solution or adsorbed on the outer surface of nanoreactors. Surprisingly, the widest nanoreactors (GNF) change the reaction pathway most significantly, which is attributed to the graphitic step-edges inside GNF providing effective anchoring points for the catalyst and creating local environments with greatly altered concentrations of reactants as compared to bulk solution. Possessing diameters significantly wider than molecules, GNF impose no restrictions on the transfer of reactants while providing the strongest confinement effects for the reaction. Furthermore, GNF facilitate the effective recyclability of the catalyst and thus represents a superior nanoreactor system to carbon nanotubes. PMID:24914447

  2. Elevated carbon dioxide ameliorates the eects of ozone on photosynthesis and growth: species respond similarly regardless of photosynthetic pathway or plant functional group

    Microsoft Academic Search

    JOHN C. V OLIN; P ETER B. R EICH; THOMAS J. G IVNISH

    summary Due to their dierent physiological eects, elevated carbon dioxide and elevated ozone might have interactive impacts on plants, and dierentially so on plants diering in photosynthetic pathway and growth rate. To test several hypotheses related to these issues, we examined the physiological, morphological and growth responses of six perennial species grown at various atmospheric concentrations of carbon dioxide and

  3. The effect of gross primary production, net primary production and net ecosystem exchange on the carbon fixation by chemical weathering of basalt in northeastern Iceland

    Microsoft Academic Search

    Marin Ivanov Kardjilov; Sigurdur Reynir Gíslason; Gudrún Gísladóttir

    2006-01-01

    The overall objective of this study is to define and interpret the annual dissolved inorganic carbon (DIC) flux in selected river catchments in North Eastern Iceland. The flux stems primarily from chemical weathering of basalt. The DIC flux out of the catchments is compared with the spatial distribution of the various vegetation communities and their gross primary production (GPP), net

  4. A Dynamic Pathway for Stone-Wales Bond Rotation on Carbon Nanotubes through Diamond-Like Bonds

    NASA Technical Reports Server (NTRS)

    Wei, Chen-Yu; Srivastava, Deepak; Cho, Kyeong-Jae; Menon, Madhu

    2003-01-01

    A new lower energy barrier with a two-step pathway of Stone-Wales (SW) ,ond rotation on carbon nanotubes (CNTs) is found through molecular dynamics (MD) simulations of CNTs under tension. The first step involves going over to a stable sp3-like metastable configuration with half rotated and partially tilted C-C bond. The second step involves going over to the fully rotated C-C bond with the formation of a SW defect in the nanotube. The energy barrier for this two-step dynamic pathway is significantly lower than the previously known static barrier for in-plane rotation of the C-C bond on a tensile strained (> 4%) CNT.

  5. Photosynthesis in Grass Species Differing in Carbon Dioxide Fixation Pathways: II. A Search for Species with Intermediate Gas Exchange and Anatomical Characteristics.

    PubMed

    Morgan, J A; Brown, R H

    1979-08-01

    Thirty-three grass species were examined in two experiments in an attempt to locate plants with photosynthetic responses to O(2), CO(2) compensation concentrations, and leaf anatomy intermediate to those of C(3) and C(4) species. Species examined included seven from the Laxa group in the Panicum genus, one of which, P. milioides Nees ex Trin., has been reported earlier to have intermediate characteristics. The species with O(2)-sensitive photosynthesis typical of C(3) plants showed more than 37% increase in apparent photosynthesis at 2% O(2) compared to 21% O(2) at 25 C and 335 microliters per liter CO(2), whereas in Panicum milioides, P. schenckii Hack., and P. decipiens Nees ex Trin., members of the Laxa group of Panicum, increases ranged from 25 to 30%. The remainder of the species did not respond to O(2). Species with O(2) responses characteristic of C(3) plants exhibited CO(2) compensation concentrations of 44 microliters per liter or higher at 21% O(2) and 25 to 27.5 C and species characterized as O(2)-insensitive had values of microliters per liter or less. The CO(2) compensation concentration (capital GHE, Cyrillic) values of P. milioides, P. schenckii, and P. decipiens ranged from 10.3 to 23.3 microliters per liter. Other species of the Laxa group of Panicum exhibited O(2) response and capital GHE, Cyrillic values of either C(3) (P. laxum Sw., P. hylaeicum Mez., and P. rivulare Trin.) or C(4) (P. prionitis Griseb.) plants. Leaves of species with O(2) response and CO(2) compensation values typical of C(3) plants had poorly developed or nearly empty bundle sheath cells, and much larger distances and mesophyll cell numbers between veins than did the O(2)-insensitive ones. Vein spacings in P. milioides, P. schenckii, and P. decipiens ranged from 0.18 to 0.28 millimeter and mesophyll cell number between veins from 5.2 to 7.8. While these vein spacings are closer than those of most C(3) grasses, two O(2)-sensitive species of Dactylis had vein spacings similar to these Panicums and veins in Glyceria striata, another O(2)-sensitive plant, were separated by only four mesophyll cells and 0.12 millimeter. Bundle sheath cells of the three intermediate Panicums contained greater quantities of organelles than are typical for C(3) grasses. PMID:16660944

  6. Synthetic non-oxidative glycolysis enables complete carbon conservation.

    PubMed

    Bogorad, Igor W; Lin, Tzu-Shyang; Liao, James C

    2013-10-31

    Glycolysis, or its variations, is a fundamental metabolic pathway in life that functions in almost all organisms to decompose external or intracellular sugars. The pathway involves the partial oxidation and splitting of sugars to pyruvate, which in turn is decarboxylated to produce acetyl-coenzyme A (CoA) for various biosynthetic purposes. The decarboxylation of pyruvate loses a carbon equivalent, and limits the theoretical carbon yield to only two moles of two-carbon (C2) metabolites per mole of hexose. This native route is a major source of carbon loss in biorefining and microbial carbon metabolism. Here we design and construct a non-oxidative, cyclic pathway that allows the production of stoichiometric amounts of C2 metabolites from hexose, pentose and triose phosphates without carbon loss. We tested this pathway, termed non-oxidative glycolysis (NOG), in vitro and in vivo in Escherichia coli. NOG enables complete carbon conservation in sugar catabolism to acetyl-CoA, and can be used in conjunction with CO2 fixation and other one-carbon (C1) assimilation pathways to achieve a 100% carbon yield to desirable fuels and chemicals. PMID:24077099

  7. Absorbable biologically based internal fixation.

    PubMed

    Ibrahim, Ahmed M S; Koolen, Pieter G L; Kim, Kuylhee; Perrone, Gabe S; Kaplan, David L; Lin, Samuel J

    2015-01-01

    Absorbable devices for use in internal fixation have advanced over the years to become reliable and cost-effective alternatives to metallic hardware. In the past, biodegradable fixation involved a laborious implantation process, and induced osteolysis and inflammatory reactions. Modern iterations exhibit increased strength, smoother resorption, and lower rates of reactivity. A newer generation manufactured from silk has emerged that may address existing limitations and provide a greater range of fixation applications. PMID:25440418

  8. Historical and future anthropogenic emission pathways derived from coupled climate–carbon cycle simulations

    Microsoft Academic Search

    Erich Roeckner; M. A. Giorgetta; T. Crueger; M. Esch; Julia Pongratz

    2011-01-01

    Using a coupled climate–carbon cycle model, fossil fuel carbon dioxide (CO2) emissions are derived through a reverse approach of prescribing atmospheric CO2 concentrations according to observations and future projections, respectively. In the second half of the twentieth century,\\u000a the implied fossil fuel emissions, and also the carbon uptake by land and ocean, are within the range of observational estimates.\\u000a Larger

  9. Pathways and Mechanisms of OceanTracer Transport: Implications for Carbon Sequestration

    SciTech Connect

    Marshall, John; Follows, MIchael

    2006-11-06

    This funding enabled the following published manuscripts in which we have developed models of direct relevance to ocean carbon sequestration and of the oceanic iron cycle, its connection to the global carbon cycle, and the sensitivity of atmospheric carbon dioxide to the external source of iron. As part of this process we have developed the adjoint of the MIT ocean biogeochemistry model which has enabled us to perform rigorous and efficient sensitivity studies.

  10. The fate of new production from N2 fixation

    NASA Astrophysics Data System (ADS)

    Mulholland, M. R.

    2006-07-01

    While we now know that marine N2 fixation is a significant source of new nitrogen (N) in the marine environment, little is known about the fate of this production, despite the importance of diazotrophs to global carbon and nutrient cycles. Specifically, does new production from N2 fixation fuel autotrophic or heterotrophic growth, facilitate carbon (C) export from the euphotic zone, or contribute primarily to microbial productivity and respiration in the euphotic zone? For Trichodesmium, the diazotroph we know the most about, the transfer of recently fixed N2 (and C) appears to be primarily through dissolved pools. The release of N appears to vary among and within populations and, probably as a result of the changing physiological state of cells and populations. The net result of trophic transfers appears to depend on the complexity of the colonizing community and co-occurring organisms. In order to understand the impact of diazotrophy on carbon flow and export in marine systems, we need a better assessment of the trophic flow of elements in Trichodesmium communities dominated by different species, various free and colonial morphologies, and in various defined physiological states. Nitrogen and carbon fixation rates themselves vary by orders of magnitude within and among studies highlighting the difficulty in extrapolating global rates of N2 fixation from direct measurements. Because the stoichiometry of N2 and C fixation does not appear to be in balance with the stoichiometry of particles, and the relationship between C and N2 fixation rates is also variable, it is equally difficult to derive global rates of one from the other. A better understanding of the physiology and physiological ecology of Trichodesmium and other marine diazotrophs is necessary to understand and predict the effects of increased or decreased diazotrophy in the context of the carbon cycle and global change.

  11. Photosynthesis in Ceratophyllum demersum . Carbon fixation rates in relation to the plants' physiological stage, and the contents of chlorophylland non-structural carbohydrates

    Microsoft Academic Search

    Elly P. H. Best

    1979-01-01

    Summary  Since the role of the submerged aquatic macrophytes in the carbon cycle of lake Vechten (the Netherlands) is in study, attention is paid to several aspects of their productivity.Ceratophyllum demersum is a predominant macrophytic species in the littoral zone of this lake, occurring mainly from three to five metres depth.\\u000aIn situ measurements of its photosynthetic rate demonstrated a maximum

  12. Phosphorus limitation of nitrogen fixation by Trichodesmium in the central Atlantic Ocean

    Microsoft Academic Search

    Sergio A. Sañudo-Wilhelmy; Adam B. Kustka; Christopher J. Gobler; David A. Hutchins; Min Yang; Kamazima Lwiza; James Burns; Douglas G. Capone; John A. Raven; Edward J. Carpenter

    2001-01-01

    Marine fixation of atmospheric nitrogen is believed to be an important source of biologically useful nitrogen to ocean surface waters, stimulating productivity of phytoplankton and so influencing the global carbon cycle. The majority of nitrogen fixation in tropical waters is carried out by the marine cyanobacterium Trichodesmium, which supplies more than half of the new nitrogen used for primary production.

  13. Definitive Bone Fixation and Reconstruction: Conversion from Temporary External Fixation to Internal Fixation Methods

    Microsoft Academic Search

    Craig S. Bartlett; Benjamin Geer; David L. Helfet

    \\u000a Temporary external fixation is frequently employed in the military combat theater of operations to temporize devastating extremity\\u000a injuries and facilitate transport of the wounded soldier. Multiple civilian and a few military studies have provided helpful\\u000a insight into the staged treatment of these injuries including conversion of temporary external fixation to definitive stabilization\\u000a with internal fixation. Diaphyseal fractures of the long

  14. Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501.

    PubMed

    Yan, Yongliang; Yang, Jian; Dou, Yuetan; Chen, Ming; Ping, Shuzhen; Peng, Junping; Lu, Wei; Zhang, Wei; Yao, Ziying; Li, Hongquan; Liu, Wei; He, Sheng; Geng, Lizhao; Zhang, Xiaobing; Yang, Fan; Yu, Haiying; Zhan, Yuhua; Li, Danhua; Lin, Zhanglin; Wang, Yiping; Elmerich, Claudine; Lin, Min; Jin, Qi

    2008-05-27

    The capacity to fix nitrogen is widely distributed in phyla of Bacteria and Archaea but has long been considered to be absent from the Pseudomonas genus. We report here the complete genome sequencing of nitrogen-fixing root-associated Pseudomonas stutzeri A1501. The genome consists of a single circular chromosome with 4,567,418 bp. Comparative genomics revealed that, among 4,146 protein-encoding genes, 1,977 have orthologs in each of the five other Pseudomonas representative species sequenced to date. The genome contains genes involved in broad utilization of carbon sources, nitrogen fixation, denitrification, degradation of aromatic compounds, biosynthesis of polyhydroxybutyrate, multiple pathways of protection against environmental stress, and other functions that presumably give A1501 an advantage in root colonization. Genetic information on synthesis, maturation, and functioning of nitrogenase is clustered in a 49-kb island, suggesting that this property was acquired by lateral gene transfer. New genes required for the nitrogen fixation process have been identified within the nif island. The genome sequence offers the genetic basis for further study of the evolution of the nitrogen fixation property and identification of rhizosphere competence traits required in the interaction with host plants; moreover, it opens up new perspectives for wider application of root-associated diazotrophs in sustainable agriculture. PMID:18495935

  15. Eighth international congress on nitrogen fixation

    SciTech Connect

    Not Available

    1990-01-01

    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  16. Molybdenum limitation of asymbiotic nitrogen fixation in tropical forest soils

    NASA Astrophysics Data System (ADS)

    Barron, Alexander R.; Wurzburger, Nina; Bellenger, Jean Phillipe; Wright, S. Joseph; Kraepiel, Anne M. L.; Hedin, Lars O.

    2009-01-01

    Nitrogen fixation, the biological conversion of di-nitrogen to plant-available ammonium, is the primary natural input of nitrogen to ecosystems, and influences plant growth and carbon exchange at local to global scales. The role of this process in tropical forests is of particular concern, as these ecosystems harbour abundant nitrogen-fixing organisms and represent one third of terrestrial primary production. Here we show that the micronutrient molybdenum, a cofactor in the nitrogen-fixing enzyme nitrogenase, limits nitrogen fixation by free-living heterotrophic bacteria in soils of lowland Panamanian forests. We measured the fixation response to long-term nutrient manipulations in intact forests, and to short-term manipulations in soil microcosms. Nitrogen fixation increased sharply in treatments of molybdenum alone, in micronutrient treatments that included molybdenum by design and in treatments with commercial phosphorus fertilizer, in which molybdenum was a `hidden' contaminant. Fixation did not respond to additions of phosphorus that were not contaminated by molybdenum. Our findings show that molybdenum alone can limit asymbiotic nitrogen fixation in tropical forests and raise new questions about the role of molybdenum and phosphorus in the tropical nitrogen cycle. We suggest that molybdenum limitation may be common in highly weathered acidic soils, and may constrain the ability of some forests to acquire new nitrogen in response to CO2 fertilization.

  17. DINITROGEN FIXATION IN ILLINOIS BUNDLEFLOWER

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Illinois bundleflower [Desmanthus illinoensis (Michx.) MacMillan] is a warm-season perennial forage legume that may serve as a pulse crop. Its productivity is influenced by its N2 fixation capability. Our objective was to estimate symbiotic N2 fixation of three Illinois bundleflower accessions from ...

  18. Solar Photovoltaics Wedge: Pathways for Growth and Potential Carbon Mitigation in the U.S.

    SciTech Connect

    Drury, E.; Denholm, P.; Margolis, R. M.

    2009-01-01

    The challenge of stabilizing global carbon emissions over the next 50 years has been framed in the context of finding seven 1.0 Gton C/year carbon reduction wedges. Solar photovoltaics (PV) could provide at least one carbon wedge, but will require significant growth in PV manufacturing capacity. The actual amount of installed PV capacity required to reach wedge-level carbon reductions will vary greatly depending on the mix of avoided fuels and the additional emissions from manufacturing PV capacity. In this work, we find that the US could reduce its carbon emissions by 0.25 Gton C/year, equal to the fraction of a global carbon wedge proportional to its current domestic electricity use, by installing 792-811 GW of PV capacity. We evaluate a series of PV growth scenarios and find that wedge-level reductions could be met by increasing PV manufacturing capacity and annual installations by 0.95 GW/year/year each year from 2009 to 2050 or by increasing up to 4 GW/year/year for a period of 4-17 years for early and late growth scenarios. This challenge of increasing PV manufacturing capacity and market demand is significant but not out of line with the recent rapid growth in both the global and US PV industry. We find that the rapid growth in PV manufacturing capacity leads to a short term increase in carbon emissions from the US electric sector. However, this increase is small, contributing less than an additional 0.3% to electric sector emissions for less than 4.5 years, alleviating recent concern regarding carbon emissions from rapid PV growth scenarios.

  19. Surgical rib fixation - Technical aspects.

    PubMed

    Marasco, Silvana; Saxena, Pankaj

    2015-05-01

    Surgical rib fixation (SRF) for severe rib fracture injuries is increasingly becoming an accepted treatment modality. There is now adequate evidence in randomised controlled trials that rib fixation in flail chest patients reduces ventilator times, intensive care stay and costs of treatment in ventilator dependent patients [1-3]. Despite this, rib fixation has not become standard of care for these patients and remains a treatment modality practised by few centres, usually those with large trauma loads who see high volumes of severe rib fracture injury patients. The purpose of this article is to outline the available prostheses, indications, operative planning and techniques of rib fixation. Surgical approaches to rib fractures in anterior, lateral and posterior positions are described as are the use of currently available cortical and medullary fixation prostheses. PMID:25624272

  20. The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast

    NASA Astrophysics Data System (ADS)

    Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

    2008-01-01

    The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates. Using 7Be and 234Th XS, the sediment-mixing coefficient ( Db) was 4.3 ± 1.8 cm 2 y -1, a value that lies at the lower limit for marine environments, indicating that mixing was not important in these sediments at this time. Sediment accumulation rates ( Sa), estimated using 137Cs and 210Pb XS, were 0.16 ± 0.02 g cm -2 y -1. The supply rate of organic carbon to the sediment-water interface was 30 ± 3.9 mmol C m -2 d -1, of which ˜10% or 2.9 ± 0.44 mmol C m -2 d -1was lost from the system through burial below the 1-cm thick surface mixed layer. Measured fluxes of O 2 were 26 ± 3.8 mmol m -2 d -1 and equated to a carbon oxidation rate of 20 ± 3.3 mmol C m -2 d -1, which is an upper limit due to the potential for oxidation of additional reduced species. Using organic carbon gradients in the surface mixed layer, carbon oxidation was estimated at 2.6 ± 1.1 mmol C m -2 d -1. Independent estimates made using pore water concentration gradients of ammonium and C:N stoichiometry, equaled 2.8 ± 0.46 mmol C m -2 d -1. The flux of DOC out of the sediments (DOC efflux) was 5.6 ± 1.3 mmol C m -2 d -1. In general, while mass balance was achieved indicating the sediments were at steady state during this time, changes in environmental conditions within the bay and the surrounding area, mean this conclusion might not always hold. These results show that the majority of carbon oxidation occurred at the sediment-water interface, via O 2 reduction. This likely results from the high frequency of sediment resuspension events combined with the shallow sediment mixing zone, leaving anaerobic oxidants responsible for only ˜10-15% of the carbon oxidized in these sediments.

  1. Degradation pathways of dissolved carbon in landfill leachate traced with compound-specific (13)C analysis of DOC.

    PubMed

    Mohammadzadeh, Hossein; Clark, Ian

    2008-09-01

    The isotopic compositions of carbon compounds in landfill leachate provide insights into the biodegradation pathways that dominate the different stages of waste decomposition. In this study, the carbon geochemistry of different carbon pools, environmental stable isotopes and compound-specific isotope analysis (CSIA) of leachate dissolved organic carbon (DOC) fractions and gases show distinctions in leachate biogeochemistry and methane production between the young area of active waste emplacement and the old area of historical emplacement at the Trail Road Landfill (TRL). The active area leachate has low DOC concentrations (<200 mg l(-1)) dominated by fulvic acid (FA=160 mg l(-1)), and produces CH(4) dominantly by CO(2) reduction (D- excess=20.6 per thousand). Leachate generated in the area of older waste has high DOC (>4770 mg l(-1)) dominated by FA (4482 mg l(-1)) and simple fatty acids (acetic=1008 mg l(-1) and propionic=608 mg l(-1)), and produces CH(4) by the acetate fermentation pathway (D- excess=9.8 per thousand). CSIA shows an advanced degradation and a progressive accumulation of (13)C of fatty acids in leachate from the older area. The enriched (13)C value of FA (-20 and-26 per thousand for the older and active parts, respectively,) and of low molecular weight DOC (-8 and-27 per thousand) as well as of the bulk DOC (-21 and-25 per thousand) shows more advanced degradation in the older part of the landfill, which is consistent with the shift in the humic/FA ratios (0.05 and 0.18). The (13)C enrichment of acetate (-12 per thousand) above the (13)C of DOC (-21 per thousand) and of propionic acid (-19 per thousand), in older leachate, suggests that this acetate has not evolved from the simple degradation of larger organic molecules, but by homoacetogenesis from the enriched dissolved inorganic carbon (DIC) pool (8 per thousand) and H(2,) which produce a more enriched (13)C of acetate. In contrast, the (13)C of the minor acetate in the active area (-17 per thousand) indicates that CO(2)-reducing bacteria must be the primary consumers of H(2), which has resulted in enriched (13)C(DIC) (10 per thousand) and depleted (13)C(CH4) (-58 per thousand). PMID:18763184

  2. Atrial fixation leads--a visual aid confirming actual fixation.

    PubMed

    Conti, J B; Curtis, A B

    1992-02-01

    Various active fixation mechanisms are available for atrial lead implantation. Confirmation of actual fixation of the lead tip in the myocardium is sometimes difficult with standard techniques such as fluoroscopy. Our observation of organized clockwise/counterclockwise motions of the fixation stylet in synchrony with atrial systole confirms adequate positioning of the Accufix model #330-801 atrial lead in the right atrial appendage, which is helpful when the screw is difficult to visualize under fluoroscopy. This observation was confirmed in nine patients. PMID:1372408

  3. Autotrophic CO2 Fixation by Chloroflexus aurantiacus: Study of Glyoxylate Formation and Assimilation via the 3-Hydroxypropionate Cycle

    PubMed Central

    Herter, Sylvia; Farfsing, Jan; Gad'On, Nasser; Rieder, Christoph; Eisenreich, Wolfgang; Bacher, Adelbert; Fuchs, Georg

    2001-01-01

    In the facultative autotrophic organism Chloroflexus aurantiacus, a phototrophic green nonsulfur bacterium, the Calvin cycle does not appear to be operative in autotrophic carbon assimilation. An alternative cyclic pathway, the 3-hydroxypropionate cycle, has been proposed. In this pathway, acetyl coenzyme A (acetyl-CoA) is assumed to be converted to malate, and two CO2 molecules are thereby fixed. Malyl-CoA is supposed to be cleaved to acetyl-CoA, the starting molecule, and glyoxylate, the carbon fixation product. Malyl-CoA cleavage is shown here to be catalyzed by malyl-CoA lyase; this enzyme activity is induced severalfold in autotrophically grown cells. Malate is converted to malyl-CoA via an inducible CoA transferase with succinyl-CoA as a CoA donor. Some enzyme activities involved in the conversion of malonyl-CoA via 3-hydroxypropionate to propionyl-CoA are also induced under autotrophic growth conditions. So far, no clue as to the first step in glyoxylate assimilation has been obtained. One possibility for the assimilation of glyoxylate involves the conversion of glyoxylate to glycine and the subsequent assimilation of glycine. However, such a pathway does not occur, as shown by labeling of whole cells with [1,2-13C2]glycine. Glycine carbon was incorporated only into glycine, serine, and compounds that contained C1 units derived therefrom and not into other cell compounds. PMID:11418572

  4. Autotrophic CO(2) fixation by Chloroflexus aurantiacus: study of glyoxylate formation and assimilation via the 3-hydroxypropionate cycle.

    PubMed

    Herter, S; Farfsing, J; Gad'On, N; Rieder, C; Eisenreich, W; Bacher, A; Fuchs, G

    2001-07-01

    In the facultative autotrophic organism Chloroflexus aurantiacus, a phototrophic green nonsulfur bacterium, the Calvin cycle does not appear to be operative in autotrophic carbon assimilation. An alternative cyclic pathway, the 3-hydroxypropionate cycle, has been proposed. In this pathway, acetyl coenzyme A (acetyl-CoA) is assumed to be converted to malate, and two CO(2) molecules are thereby fixed. Malyl-CoA is supposed to be cleaved to acetyl-CoA, the starting molecule, and glyoxylate, the carbon fixation product. Malyl-CoA cleavage is shown here to be catalyzed by malyl-CoA lyase; this enzyme activity is induced severalfold in autotrophically grown cells. Malate is converted to malyl-CoA via an inducible CoA transferase with succinyl-CoA as a CoA donor. Some enzyme activities involved in the conversion of malonyl-CoA via 3-hydroxypropionate to propionyl-CoA are also induced under autotrophic growth conditions. So far, no clue as to the first step in glyoxylate assimilation has been obtained. One possibility for the assimilation of glyoxylate involves the conversion of glyoxylate to glycine and the subsequent assimilation of glycine. However, such a pathway does not occur, as shown by labeling of whole cells with [1,2-(13)C(2)]glycine. Glycine carbon was incorporated only into glycine, serine, and compounds that contained C(1) units derived therefrom and not into other cell compounds. PMID:11418572

  5. Trophic structure and pathways of biogenic carbon flow in the eastern North Water Polynya

    NASA Astrophysics Data System (ADS)

    Tremblay, Jean-Éric; Hattori, Hiroshi; Michel, Christine; Ringuette, Marc; Mei, Zhi-Ping; Lovejoy, Connie; Fortier, Louis; Hobson, Keith A.; Amiel, David; Cochran, Kirk

    2006-10-01

    In the eastern North Water, most of the estimated annual new and net production of carbon (C) occurred during the main diatom bloom in 1998. During the bloom, at least 30% of total and new phytoplankton production occurred as dissolved organic carbon (DOC) and was unavailable for short-term assimilation into the herbivorous food web or sinking export. Based on particle interceptor traps and 234Th deficits, 27% of the particulate primary production (PP) sank out of the upper 50 m, with only 7% and 1% of PP reaching the benthos at shallow (?200 m) and deep (?500 m) sites, respectively. Mass balance calculations and grazing estimates agree that ?79% of PP was ingested by pelagic consumers between April and July. During this period, the vertical flux of biogenic silica (BioSi) at 50 m was equivalent to the total BioSi produced, indicating that all of the diatom production was removed from the euphotic zone as intact cells (direct sinking) or empty frustules (grazing or lysis). The estimated flux of empty frustules was consistent with rates of herbivory by the large, dominant copepods and appendicularians during incubations. Since the carbon demand of the dominant planktivorous bird, Alle alle, amounted to ?2% of the biomass synthesized by its main prey, the large copepod Calanus hyperboreus, most of the secondary carbon production was available to pelagic carnivores. Stable isotopes indicated that the biomass of predatory amphipods, polar cod and marine mammals was derived from these herbivores, but corresponding carbon fluxes were not quantified. Our analysis shows that a large fraction of PP in the eastern North Water was ingested by consumers in the upper 50 m, leading to substantial carbon respiration and DOC accumulation in surface waters. An increasingly early and prolonged opening of the Artic Ocean is likely to promote the productivity of the herbivorous food web, but not the short-term efficiency of the particulate, biological CO 2 pump.

  6. Mineralization pathways in lake sediments with different oxygen and organic carbon supply

    E-print Network

    Wehrli, Bernhard

    sediments has been studied extensively and depends on various factors, such as sedimentation rate (Berner, because inland waters transport and transform a significant fraction of the continental carbon flux to marine sediments, OM burial efficiency (i.e., the ratio between OM sedimentation and long

  7. Using C and S isotopes to elucidate carbonic versus sulfuric acid reaction pathways during shale weathering in the Susquehanna Shale Hills Critical Zone Observatory

    NASA Astrophysics Data System (ADS)

    Jin, L.; Ogrinc, N.; Yesavage, T.; Hasenmueller, E. A.; Ma, L.; Kaye, J. P.; Brantley, S. L.

    2013-12-01

    Chemical weathering of silicate minerals via the carbonic acid reaction pathway regulates global climate on geological timescales. However, strong acids are also key dissolution agents that drive silicate and carbonate weathering. In order to assess the potentials of silicate weathering on CO2 consumption, it is crucial to separate carbonic acid versus sulfuric acid reaction pathways, and also to separate the contribution of stream-dissolved inorganic carbon (DIC) from silicate versus carbonate dissoution. Here we address these two questions using C and S isotopes at the well-studied Susquehanna Shale Hills Critical Zone Observatory (SSHO). In shallow soils of SSHO, clay dissolution dominates. Here soil waters are charaterized by low [DIC], which is controlled by equilibrium with soil pCO2. Carbonate minerals, in this Rose Hill Shale formation, are depleted in soils and have only been observed in few bedrock boreholes, i.e. at > 23m depth at ridges and > 2m depth under the valley. Indeed, some groundwaters have much higher [DIC], [Mg] and [Ca], presumably due to ankerite dissolution. Accompanied by the transition from silicate weathering in shallow soils to carbonate weathering below the water table, the source of sulfate shifts with depth from atmospheric deposition to pyrite dissolution. Apparently, the weathering fronts of ankerite and pyrite are at almost the same depth. The ?13CDIC values of these groundwaters indicate C mixing equally from ankerite and soil CO2, with only slight modification by the sulfuric acid pathway. Groundwater chemistry evolves to different extents with respect to ankerite saturation because the depths to ankerite weathering fronts vary due to heterogeneity of the Rose Hill shales and landscape position. Interestingly, groundwaters along the valley floor at the outlet of the first-order catchment are influenced by carbonate dissolution but also show S isotope signatures indicative of anthropogenic sulfate in wet precipitation. This provides another line of evidence that at least some of the carbonate we observe at shallow depths in the valley floor may be secondary. Indeed, C isotopes of some of the shallow carbonates differ from those in Rose Hill bedrock. Comparison between groundwater and soil water chemistry shows that at SSHO most DIC derives from the dissolution of carbonate minerals, i.e., primary ankerite or secondary carbonate. Sulfate derives almost entirely from atmospheric deposition in soil waters and some groundwater near the outlet; however, its source shifts to pyrite dissolution in groundwaters from ridges and headwater areas. Overall, in this catchment underlain by grey shale, the sulfuric acid pathway is insignicant due to the low pyrite content in comparison to ankerite or secondary carbonate.

  8. Multi-Walled Carbon Nanotubes Promote Cementoblast Differentiation and Mineralization through the TGF-?/Smad Signaling Pathway

    PubMed Central

    Li, Lu; Zhu, Zhimin; Xiao, Weixiong; Li, Lei

    2015-01-01

    Excretion of cementum by cementoblasts on the root surface is a process indispensable for the formation of a functional periodontal ligament. This study investigated whether carboxyl group-functionalized multi-walled carbon nanotubes (MWCNT-COOH) could enhance differentiation and mineralization of mammalian cementoblasts (OCCM-30) and the possible signaling pathway involved in this process. Cementoblasts were incubated with various doses of MWCNT-COOH suspension. Cell viability was detected, and a scanning electron microscopy (SEM) observed both the nanomaterials and the growth of cells cultured with the materials. Alizarin red staining was used to investigate the formation of calcium deposits. Real-time PCR and western blot were used to detect cementoblast differentiation and the underlying mechanisms through the expression of the osteogenic genes and the downstream effectors of the TGF-?/Smad signaling. The results showed that 5 µg/mL MWCNT-COOH had the most obvious effects on promoting differentiation without significant toxicity. Alp, Ocn, Bsp, Opn, Col1 and Runx2 gene expression was up-regulated. Smad2 and Smad3 mRNA was up-regulated, while Smad7 was first down-regulated on Day 3 and later up-regulated on Day 7. The elevated levels of phospho-Smad2/3 were also confirmed by western blot. In sum, the MWCNT-COOH promoted cementoblast differentiation and mineralization, at least partially, through interactions with the TGF-?/Smad pathway. PMID:25648319

  9. Multi-walled carbon nanotubes promote cementoblast differentiation and mineralization through the TGF-?/Smad signaling pathway.

    PubMed

    Li, Lu; Zhu, Zhimin; Xiao, Weixiong; Li, Lei

    2015-01-01

    Excretion of cementum by cementoblasts on the root surface is a process indispensable for the formation of a functional periodontal ligament. This study investigated whether carboxyl group-functionalized multi-walled carbon nanotubes (MWCNT-COOH) could enhance differentiation and mineralization of mammalian cementoblasts (OCCM-30) and the possible signaling pathway involved in this process. Cementoblasts were incubated with various doses of MWCNT-COOH suspension. Cell viability was detected, and a scanning electron microscopy (SEM) observed both the nanomaterials and the growth of cells cultured with the materials. Alizarin red staining was used to investigate the formation of calcium deposits. Real-time PCR and western blot were used to detect cementoblast differentiation and the underlying mechanisms through the expression of the osteogenic genes and the downstream effectors of the TGF-?/Smad signaling. The results showed that 5 µg/mL MWCNT-COOH had the most obvious effects on promoting differentiation without significant toxicity. Alp, Ocn, Bsp, Opn, Col1 and Runx2 gene expression was up-regulated. Smad2 and Smad3 mRNA was up-regulated, while Smad7 was first down-regulated on Day 3 and later up-regulated on Day 7. The elevated levels of phospho-Smad2/3 were also confirmed by western blot. In sum, the MWCNT-COOH promoted cementoblast differentiation and mineralization, at least partially, through interactions with the TGF-?/Smad pathway. PMID:25648319

  10. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    SciTech Connect

    John J. Kilbane III

    2003-12-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage pathway. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum.

  11. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    SciTech Connect

    Snyder-Talkington, Brandi N. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Dymacek, Julian [Lane Department of Computer Science and Electrical Engineering, West Virginia University, Morgantown, WV 26506-6070 (United States); Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Pacurari, Maricica [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Denvir, James [Department of Biochemistry and Microbiology, Marshall University, Huntington, WV 25755 (United States); Castranova, Vincent [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Qian, Yong, E-mail: yaq2@cdc.gov [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Guo, Nancy L., E-mail: lguo@hsc.wvu.edu [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States)

    2013-10-15

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 ?g MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung inflammation and fibrosis were revealed. • Two functional, representative genes, ccl2 and vegfa, were validated in vitro.

  12. Functional ecology of free-living nitrogen fixation: A contemporary perspective

    USGS Publications Warehouse

    Reed, Sasha C.; Cleveland, Cory C.; Townsend, Alan R.

    2011-01-01

    Nitrogen (N) availability is thought to frequently limit terrestrial ecosystem processes, and explicit consideration of N biogeochemistry, including biological N2 fixation, is central to understanding ecosystem responses to environmental change. Yet, the importance of free-living N2 fixation—a process that occurs on a wide variety of substrates, is nearly ubiquitous in terrestrial ecosystems, and may often represent the dominant pathway for acquiring newly available N—is often underappreciated. Here, we draw from studies that investigate free-living N2 fixation from functional, physiological, genetic, and ecological perspectives. We show that recent research and analytical advances have generated a wealth of new information that provides novel insight into the ecology of N2 fixation as well as raises new questions and priorities for future work. These priorities include a need to better integrate free-living N2 fixation into conceptual and analytical evaluations of the N cycle's role in a variety of global change scenarios.

  13. Molecular Biology of Nitrogen Fixation

    ERIC Educational Resources Information Center

    Shanmugam, K. T.; Valentine, Raymond C.

    1975-01-01

    Reports that as a result of our increasing knowledge of the molecular biology of nitrogen fixation it might eventually be possible to increase the biological production of nitrogenous fertilizer from atmospheric nitrogen. (GS)

  14. Evaluation of Bone Fixation Implants

    E-print Network

    Perkins, Luke 1990-

    2012-12-10

    This research investigates the effects of the human body on the mechanical, chemical, and morphological properties of the surface of internal fixation devices. Stainless steel and titanium devices that had failed were provided from the Shandong...

  15. Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds

    SciTech Connect

    John J. Kilbane II

    2005-10-01

    The objective of the project is to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. The selective cleavage of the second C-N bond has been challenging, and efforts to overcome that challenge have been the focus of recent research in this project. Enrichment culture experiments succeeded in isolating bacterial cultures that can metabolize 2-aminobiphenyl, but no enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl has been identified. Aniline is very similar to the structure of 2-aminobiphenyl and aniline dioxygenase catalyzes the conversion of aniline to catechol and ammonia. For the remainder of the project the emphasis of research will be to simultaneously express the genes for carbazole dioxygenase and for aniline dioxygenase in the same bacterial host and then to select for derivative cultures capable of using carbazole as the sole source of nitrogen.

  16. Carbon isotopic composition of individual Precambrian microfossils

    NASA Technical Reports Server (NTRS)

    House, C. H.; Schopf, J. W.; McKeegan, K. D.; Coath, C. D.; Harrison, T. M.; Stetter, K. O.

    2000-01-01

    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

  17. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    SciTech Connect

    John J. Kilbane II

    2004-10-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project was focused on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate deaminase. The objective of the final phase of the project will be to develop derivative C-N bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments resulted in the isolation of microbial cultures that utilize aromatic amides as sole nitrogen sources, several amidase genes were cloned and were included in directed evolution experiments to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. During the second year of the project (October, 2003-September, 2004) enrichment culture experiments succeeded in isolating a mixed bacterial culture that can utilize 2-aminobiphenyl as a sole nitrogen source, directed evolution experiments were focused on the aniline dioxygenase enzyme that is capable of deaminating aniline, and expression vectors were constructed to enable the expression of genes encoding C-N bond cleaving enzymes in Rhodococcus hosts. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum. Aromatic compounds such as carbazole are representative of the difficult-to-treat organonitrogen compounds most commonly encountered in petroleum. There are two C-N bonds in carbazole and the construction of a metabolic pathway for the removal of nitrogen from carbazole will require enzymes capable cleaving both C-N bonds. A multi-component enzyme, carbazole dioxygenase, which can selectively cleave the first C-N bond has been identified and the genes that encode this enzyme have been cloned, sequenced, and are being expressed in Rhodococcus erythropolis, a bacterial culture that tolerates exposure to petroleum. An enzyme capable of selectively cleaving the second C-N bond in carbazole has not yet been identified, but enrichment culture experiments have recently succeeded in isolating a bacterial culture that is a likely candidate and may possess a suitable enzyme. Research in the near future will verify if a suitable enzyme for the cleavage of the second C-N bond in carbazole has indeed been found, then the genes encoding a suitable enzyme will be identified, cloned, and sequenced. Ultimately genes encoding enzymes for selective cleavage of both C-N bonds in carbazole will be assembled into a new metabolic pathway and the ability of the resulting bacterial culture to remove nitrogen from petroleum will be determined.

  18. 3D-Stacked Carbon Composites Employing Networked Electrical Intra-Pathways for Direct-Printable, Extremely Stretchable Conductors.

    PubMed

    Chae, Changju; Seo, Yeong-Hui; Jo, Yejin; Kim, Ki Woong; Song, Wooseok; An, Ki-Seok; Choi, Sungho; Choi, Youngmin; Lee, Sun Sook; Jeong, Sunho

    2015-02-25

    The newly designed materials for stretchable conductors meeting the demands for both electrical and mechanical stability upon morphological elongation have recently been of paramount interest in the applications of stretchable, wearable electronics. To date, carbon nanotube-elastomeric polymer mixtures have been mainly developed; however, the method of preparing such CNT-polymer mixtures as stretchable conductors has been limited to an ionic liquid-mediated approach. In this study, we suggest a simple wet-chemical method for producing newly designed, three-dimensionally stacked carbon composite materials that facilitate the stable morphological elongation up to a strain of 300% with normalized conductivity variation of only 0.34 under a strain of 300%. Through a comparative study with other control samples, it is demonstrated that the intraconnected electrical pathways in hierarchically structured composite materials enable the generation of highly stretchable conductors. Their direct patternability is also evaluated by printing on demand using a programmable disperser without the use of prepatterned masks. PMID:25647807

  19. Transition pathways for a low carbon energy system in the UK: assessing the compatibility of large-scale and small-scale options

    Microsoft Academic Search

    Timothy J Foxon; Geoffrey P Hammond; Peter J Pearson

    This paper describes initial work on transition pathways for a low carbon energy system in the UK, being pursued in a major new research project. The project is a collaboration between leading UK engineers, social scientists and policy analysts, supported by the UK Engineering and Physical Sciences Research Council (EPSRC) and the energy company E.ON UK. The project aims to

  20. Carbon dioxide fixation by artificial photosynthesis

    SciTech Connect

    Ibusuki, Takashi; Koike, Kazuhide; Ishitani, Osamu [National Inst. for Resources and Environment, AIST, MITI, Tsukuba, Ibaraki (Japan)

    1993-12-31

    Green plants can absorb atmospheric CO{sub 2} and transform it to sugars, carbohydrates through their photosynthetic systems, but they become the source of CO{sub 2} when they are dead. This is the reason why artificial leaves which can be alive forever should be developed to meet with global warming due to the increase of CO{sub 2} concentration. The goal of artificial photosynthesis is not to construct the same system as the photosynthetic one, but to mimic the ability of green plants to utilize solar energy to make high energy chemicals. Needless to say, the artificial photosynthetic system is desired to be as simple as possible and to be as efficient as possible. From the knowledge on photosynthesis and the results of previous investigations, the critical components of artificial photosynthetic system are understood as follows: (1) light harvesting chromophore, (2) a center for electron transfer and charge separation, (3) catalytic sites for converting small molecules like water and CO{sub 2} (mutilelectron reactions) which are schematically described.

  1. The importance of nodule CO2 fixation for the efficiency of symbiotic nitrogen fixation in pea at vegetative growth and during pod formation

    PubMed Central

    Fischinger, Stephanie Anastasia; Schulze, Joachim

    2010-01-01

    Nodule CO2 fixation is of pivotal importance for N2 fixation. The process provides malate for bacteroids and oxaloacetate for nitrogen assimilation. The hypothesis of the present paper was that grain legume nodules would adapt to higher plant N demand and more restricted carbon availability at pod formation through increased nodule CO2 fixation and a more efficient N2 fixation. Growth, N2 fixation, and nodule composition during vegetative growth and at pod formation were studied in pea plants (Pisum sativum L.). In parallel experiments, 15N2 and 13CO2 uptake, as well as nodule hydrogen and CO2 release, was measured. Plants at pod formation showed higher growth rates and N2 fixation per plant when compared with vegetative growth. The specific activity of active nodules was about 25% higher at pod formation. The higher nodule activity was accompanied by higher amino acid concentration in nodules and xylem sap with a higher share of asparagine. Nodule 13CO2 fixation was increased at pod formation, both per plant and per 15N2 fixed unit. However, malate concentration in nodules was only 40% of that during vegetative growth and succinate was no longer detectable. The data indicate that increased N2 fixation at pod formation is connected with strongly increased nodule CO2 fixation. While the sugar concentration in nodules at pod formation was not altered, the concentration of organic acids, namely malate and succinate, was significantly lower. It is concluded that strategies to improve the capability of nodules to fix CO2 and form organic acids might prolong intensive N2 fixation into the later stages of pod formation and pod filling in grain legumes. PMID:20363863

  2. Carbon monoxide alleviates ethanol-induced oxidative damage and inflammatory stress through activating p38 MAPK pathway

    SciTech Connect

    Li, Yanyan; Gao, Chao; Shi, Yanru; Tang, Yuhan; Liu, Liang; Xiong, Ting; Du, Min [Department of Nutrition and Food Hygiene, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Ministry of Education Lab of Environment and Health, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Hubei Key Laboratory of Food Nutrition and Safety, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Xing, Mingyou [Department of Infectious Diseases, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Liu, Liegang [Department of Nutrition and Food Hygiene, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Ministry of Education Lab of Environment and Health, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Hubei Key Laboratory of Food Nutrition and Safety, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Yao, Ping, E-mail: yaoping@mails.tjmu.edu.cn [Department of Nutrition and Food Hygiene, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Ministry of Education Lab of Environment and Health, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China); Hubei Key Laboratory of Food Nutrition and Safety, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030 (China)

    2013-11-15

    Stress-inducible protein heme oxygenase-1(HO-1) is well-appreciative to counteract oxidative damage and inflammatory stress involving the pathogenesis of alcoholic liver diseases (ALD). The potential role and signaling pathways of HO-1 metabolite carbon monoxide (CO), however, still remained unclear. To explore the precise mechanisms, ethanol-dosed adult male Balb/c mice (5.0 g/kg.bw.) or ethanol-incubated primary rat hepatocytes (100 mmol/L) were pretreated by tricarbonyldichlororuthenium (II) dimmer (CORM-2, 8 mg/kg for mice or 20 ?mol/L for hepatocytes), as well as other pharmacological reagents. Our data showed that CO released from HO-1 induction by quercetin prevented ethanol-derived oxidative injury, which was abolished by CO scavenger hemoglobin. The protection was mimicked by CORM-2 with the attenuation of GSH depletion, SOD inactivation, MDA overproduction, and the leakage of AST, ALT or LDH in serum and culture medium induced by ethanol. Moreover, CORM-2 injection or incubation stimulated p38 phosphorylation and suppressed abnormal Tnfa and IL-6, accompanying the alleviation of redox imbalance induced by ethanol and aggravated by inflammatory factors. The protective role of CORM-2 was abolished by SB203580 (p38 inhibitor) but not by PD98059 (ERK inhibitor) or SP600125 (JNK inhibitor). Thus, HO-1 released CO prevented ethanol-elicited hepatic oxidative damage and inflammatory stress through activating p38 MAPK pathway, suggesting a potential therapeutic role of gaseous signal molecule on ALD induced by naturally occurring phytochemicals. - Highlights: • CO alleviated ethanol-derived liver oxidative and inflammatory stress in mice. • CO eased ethanol and inflammatory factor-induced oxidative damage in hepatocytes. • The p38 MAPK is a key signaling mechanism for the protective function of CO in ALD.

  3. Femoral Reconstruction Using External Fixation

    PubMed Central

    Palatnik, Yevgeniy; Rozbruch, S. Robert

    2011-01-01

    Background. The use of an external fixator for the purpose of distraction osteogenesis has been applied to a wide range of orthopedic problems caused by such diverse etiologies as congenital disease, metabolic conditions, infections, traumatic injuries, and congenital short stature. The purpose of this study was to analyze our experience of utilizing this method in patients undergoing a variety of orthopedic procedures of the femur. Methods. We retrospectively reviewed our experience of using external fixation for femoral reconstruction. Three subgroups were defined based on the primary reconstruction goal lengthening, deformity correction, and repair of nonunion/bone defect. Factors such as leg length discrepancy (LLD), limb alignment, and external fixation time and complications were evaluated for the entire group and the 3 subgroups. Results. There was substantial improvement in the overall LLD, femoral length discrepancy, and limb alignment as measured by mechanical axis deviation (MAD) and lateral distal femoral angle (LDFA) for the entire group as well as the subgroups. Conclusions. The Ilizarov external fixator allows for decreased surgical exposure and preservation of blood supply to bone, avoidance of bone grafting and internal fixation, and simultaneous lengthening and deformity correction, making it a very useful technique for femoral reconstruction. PMID:21991425

  4. Tricarboxylic Acid Cycle and One-Carbon Metabolism Pathways Are Important in Edwardsiella ictaluri Virulence

    PubMed Central

    Dahal, Neeti; Abdelhamed, Hossam; Lu, Jingjun; Karsi, Attila; Lawrence, Mark L.

    2013-01-01

    Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of channel catfish (ESC). The disease causes considerable economic losses in the commercial catfish industry in the United States. Although antibiotics are used as feed additive, vaccination is a better alternative for prevention of the disease. Here we report the development and characterization of novel live attenuated E. ictaluri mutants. To accomplish this, several tricarboxylic acid cycle (sdhC, mdh, and frdA) and one-carbon metabolism genes (gcvP and glyA) were deleted in wild type E. ictaluri strain 93-146 by allelic exchange. Following bioluminescence tagging of the E. ictaluri ?sdhC, ?mdh, ?frdA, ?gcvP, and ?glyA mutants, their dissemination, attenuation, and vaccine efficacy were determined in catfish fingerlings by in vivo imaging technology. Immunogenicity of each mutant was also determined in catfish fingerlings. Results indicated that all of the E. ictaluri mutants were attenuated significantly in catfish compared to the parent strain as evidenced by 2,265-fold average reduction in bioluminescence signal from all the mutants at 144 h post-infection. Catfish immunized with the E. ictaluri ?sdhC, ?mdh, ?frdA, and ?glyA mutants had 100% relative percent survival (RPS), while E. ictaluri ?gcvP vaccinated catfish had 31.23% RPS after re-challenge with the wild type E. ictaluri. PMID:23762452

  5. Life in hot acid: Pathway analyses in extremely thermoacidophilic archaea

    PubMed Central

    Auernik, Kathryne S.; Cooper, Charlotte R.; Kelly, Robert M.

    2013-01-01

    SUMMARY The extremely thermoacidophilic archaea are a particularly intriguing group of microorganisms that must simultaneously cope with biologically extreme pHs (? 4) and temperatures (Topt ? 60°C) in their natural environments. Their expandi ng biotechnological significance relates to their role in biomining of base and precious metals and their unique mechanisms of survival in hot acid, at both the cellular and biomolecular levels. Recent developments, such as advances in understanding of heavy metal tolerance mechanisms, implementation of a genetic system, and discovery of a new carbon fixation pathway, have been facilitated by availability of genome sequence data and molecular genetic systems. As a result, new insights into the metabolic pathways and physiological features that define extreme thermoacidophily have been obtained, in some cases suggesting prospects for biotechnological opportunities. PMID:18760359

  6. Broken nylon iris fixation sutures.

    PubMed

    Cohan, B E; Pearch, A C; Schwartz, S

    1979-12-01

    Broken nylon iris sutures, used to fixate the Worst suture lens, occurred in 41 of a series of 215 eyes, a remarkably high frequency. The estimated average time to break was 27.8 months. Over three fourths of the borken sutures were discovered incidentally on a return visit. Complications related to the broken suture occurred in 21 eyes. The characteristic complication was corneal epithelial edema caused by intermittent touch of the endothelium by the broken suture; spontaneous lens dislocation was infrequent. Light and scanning electron microscopy revealed that biodegradation caused the suture break. Broken iris sutures can be avoided by fixation of the lens with a nonbiodegradable suture. PMID:517621

  7. NCI-Frederick PHL - Fixatives and Solutions

    Cancer.gov

    Services Price List Courier Services & Shipment Procedures Scheduling Contact Information Related Links Establishing an Account PHL Forms PHL Portal Fixatives and Solutions Routine fixatives: 10% Neutral Buffered Formalin (NBF) 37 - 40% Formaldehyde………………………………………1000mL distilled

  8. Influence of chemical and freezing fixation methods in the freeze-fracture of stratum corneum

    Microsoft Academic Search

    O López; C López-Iglesias; M Cócera; P Walther; J. L Parra; A de la Maza

    2004-01-01

    A comparison between two fixation techniques for freeze-fracture was established. Stratum corneum (SC) samples from pig epidermis were fixed using high-pressure freezing (HPF) and using plunging in propane freezing; the latter after chemical fixation. Then, frozen samples were freeze-fractured, coated with platinum–carbon, and visualized using a high-resolution low-temperature scanning electron microscope and a transmission electron microscope. Our results indicate that

  9. Nitrogen fixation in Clear Lake, California.II. Synoptic studies on the autumn Anabaena bloom

    Microsoft Academic Search

    ALEXANDER J. HORNE; J. E. DILLARD; D. K. FUJITA; C. R. GOLDMAN

    1972-01-01

    Nitrogen fixation at three stages of an autumnal bloom of Anabaena circinulis was mea- sured after almost simultaneous collection at up to 32 stations in Clear Lake and algal hetcrocysts, phytoplankton cell numbers, NO,-N, NIL-N, dissolved organic-N, POh-P, Fe, primary production, particulate carbon, and chlorophyll a were also measured. Nitrogen fixation was significantly and positively correlated to Anabaena heterocyst numbers

  10. Tests of prototype ITS-SSD Ladder and Fixators

    E-print Network

    Van den Brink, D J; CERN. Geneva; Nooren, G J L; Feofilov, G A; Igolkin, S N; Daudo, F; Giraudo, G; van den Broek, D J

    2000-01-01

    Abstract A prototype carbon fibre SSD ladder, produced in St.Petersburg, was equipped in Utrecht with mounting blocks, designed in Torino, for the fixation on the ITS cone. Instead of the cone, a specially designed jig was used. The mechanical properties were measured in order to find out whether the design and the production method are compliant with the requirements given in the TDR.

  11. Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre

    PubMed Central

    Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel MM

    2012-01-01

    Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N2-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N2-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200?m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of 15N-labeled ammonium and leucine in our incubation experiments. N2-fixation was detectable throughout the upper 200?m at most stations, with rates ranging from 0.001 to 0.19?nM?N?h?1. N2-fixation in the SPG may account for the production of 8–20% of global oceanic new nitrogen. Interestingly, comparable 15N2-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

  12. Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre.

    PubMed

    Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel M M

    2012-06-01

    Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N(2)-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N(2)-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200 m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of (15)N-labeled ammonium and leucine in our incubation experiments. N(2)-fixation was detectable throughout the upper 200 m at most stations, with rates ranging from 0.001 to 0.19 nM N h(-1). N(2)-fixation in the SPG may account for the production of 8-20% of global oceanic new nitrogen. Interestingly, comparable (15)N(2)-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

  13. Changes in North Atlantic nitrogen fixation controlled by ocean circulation.

    PubMed

    Straub, Marietta; Sigman, Daniel M; Ren, Haojia; Martínez-García, Alfredo; Meckler, A Nele; Hain, Mathis P; Haug, Gerald H

    2013-09-12

    In the ocean, the chemical forms of nitrogen that are readily available for biological use (known collectively as 'fixed' nitrogen) fuel the global phytoplankton productivity that exports carbon to the deep ocean. Accordingly, variation in the oceanic fixed nitrogen reservoir has been proposed as a cause of glacial-interglacial changes in atmospheric carbon dioxide concentration. Marine nitrogen fixation, which produces most of the ocean's fixed nitrogen, is thought to be affected by multiple factors, including ocean temperature and the availability of iron and phosphorus. Here we reconstruct changes in North Atlantic nitrogen fixation over the past 160,000?years from the shell-bound nitrogen isotope ratio ((15)N/(14)N) of planktonic foraminifera in Caribbean Sea sediments. The observed changes cannot be explained by reconstructed changes in temperature, the supply of (iron-bearing) dust or water column denitrification. We identify a strong, roughly 23,000-year cycle in nitrogen fixation and suggest that it is a response to orbitally driven changes in equatorial Atlantic upwelling, which imports 'excess' phosphorus (phosphorus in stoichiometric excess of fixed nitrogen) into the tropical North Atlantic surface. In addition, we find that nitrogen fixation was reduced during glacial stages 6 and 4, when North Atlantic Deep Water had shoaled to become glacial North Atlantic intermediate water, which isolated the Atlantic thermocline from excess phosphorus-rich mid-depth waters that today enter from the Southern Ocean. Although modern studies have yielded diverse views of the controls on nitrogen fixation, our palaeobiogeochemical data suggest that excess phosphorus is the master variable in the North Atlantic Ocean and indicate that the variations in its supply over the most recent glacial cycle were dominated by the response of regional ocean circulation to the orbital cycles. PMID:23965620

  14. Tissue fixation and the effect of molecular fixatives on downstream staining procedures

    PubMed Central

    Howat, William J.; Wilson, Beverley A.

    2014-01-01

    It is impossible to underplay the importance of fixation in histopathology. Whether the scientist is interested in the extraction of information on lipids, proteins, RNA or DNA, fixation is critical to this extraction. This review aims to give a brief overview of the current “state of play” in fixation and focus on the effect fixation, and particularly the effect of the newer brand of “molecular fixatives” have on morphology, histochemistry, immunohistochemistry and RNA/DNA analysis. A methodology incorporating the creation of a fixation tissue microarray for the study of the effect of fixation on histochemistry is detailed. PMID:24561827

  15. Allograft interference screw fixation in meniscus transplantation

    Microsoft Academic Search

    Jack Farr; R. Michael Meneghini; Brian J. Cole

    2004-01-01

    Allograft meniscus transplantation is indicated to restore proper knee biomechanics and prevent subsequent articular degeneration in patients with a meniscus-deficient knee. A variety of techniques for fixation of meniscal transplants exist, with some techniques using soft-tissue fixation of the meniscal horns and others using bony fixation. The authors present a technique of meniscus transplantation using a tibial slot with allograft

  16. N? fixation by subsurface populations of Trichodesmium : an important source of new nitrogen to the North Atlantic Ocean

    E-print Network

    Heithoff, Abigail

    2011-01-01

    Trichodesmium, a genus of diazotrophic cyanobacteria, is an important contributor to the marine nitrogen (N) and carbon (C) cycles. The extent to which Trichodesmium dinitrogen (N2) fixation contributes to the marine N ...

  17. Methacarn (methanol-Carnoy) fixation

    Microsoft Academic Search

    Holde Puchtler; Faye Sweat Waldrop; Susan N. Meloan; Mary S. Terry; H. M. Conner

    1970-01-01

    According to chemical data, methanol raises the shrinkage temperature of collagen significantly more than ethanol (86° C versus 70° C). Since increase of shrinkage temperature appears desirable in tissues to be embedded in paraffin, methanol was substituted for ethanol in Carnoy's fluid. This methanol-Carnoy mixture is referred to as methacarn solution. The fixation-embedding procedure was similar to that described in

  18. Closing in on complete pathways of biotin biosynthesis.

    PubMed

    Lin, Steven; Cronan, John E

    2011-06-01

    Biotin is an enzyme cofactor indispensable to metabolic fixation of carbon dioxide in all three domains of life. Although the catalytic and physiological roles of biotin have been well characterized, the biosynthesis of biotin remains to be fully elucidated. Studies in microbes suggest a two-stage biosynthetic pathway in which a pimelate moiety is synthesized and used to begin assembly of the biotin bicyclic ring structure. The enzymes involved in the bicyclic ring assembly have been studied extensively. In contrast the synthesis of pimelate, a seven carbon ?,?-dicarboxylate, has long been an enigma. Support for two different routes of pimelate synthesis has recently been obtained in Escherichia coli and Bacillus subtilis. The E. coli BioC-BioH pathway employs a methylation and demethylation strategy to allow elongation of a temporarily disguised malonate moiety to a pimelate moiety by the fatty acid synthetic enzymes whereas the B. subtilis BioI-BioW pathway utilizes oxidative cleavage of fatty acyl chains. Both pathways produce the pimelate thioester precursor essential for the first step in assembly of the fused rings of biotin. The enzymatic mechanisms and biochemical strategies of these pimelate synthesis models will be discussed in this review. PMID:21437340

  19. Determination of pathways of glycogen synthesis and the dilution of the three-carbon pool with (U- sup 13 C)glucose

    SciTech Connect

    Katz, J.; Wals, P.A. (Cedars-Sinai Medical Center, Los Angeles, CA (United States)); Lee, W.N.P. (Los Angeles Research and Education Inst., Torrance, CA (United States))

    1991-03-15

    Rats were infused with glucose at 30 mg/min, containing 18% enriched (U-{sup 13}C)glucose and (1-{sup 14}C)- and (3-{sup 3}H)glucose and liver glycogen were determined by gas chromatography/mass spectroscopy. The contribution of the direct pathway to glycogen was calculated from the three tracers, and the values by all three were nearly identical, about 50%. The {sup 14}C specific activity in carbon 6 of glycogen glucose was about 6% that of carbon 1. The ({sup 3}H)glucose/(1-{sup 14}C)glucose ratio in glycogen was 80-90% that is blood glucose. The enrichment of {sup 13}C and the specific activity of {sup 14}C in glycogen formed by the indirect path were 20-25% of glycogen formed directly from glucose. The dilution is of two kinds: (1) an exchange of labeled carbon with unlabeled carbon in the tricarboxylic acid cycle and (2) dilution by unlabeled nonglucose carbon. Methods to calculate the two types of dilution are presented. In rate preinjected with glucagon, the dilution through the tricarboxylic acid cycle was unaffected but that by nonglucose carbon was decreased.

  20. Enhanced Dark CO2 Fixation by Preilluminated Chlorella pyrenoidosa and Anacystis nidulans 1

    PubMed Central

    Togasaki, Robert K.; Gibbs, Martin

    1967-01-01

    The products of short time photosynthesis and of enhanced dark 14CO2 fixation (illumination in helium prior to addition of 14CO2 in dark) by Chlorella pyrenoidosa and Anacystis nidulans were compared. Glycerate 3-phosphate, phosphoenolpyruvate, alanine, and aspartate accounted for the bulk of the 14C assimilated during enhanced dark fixation while hexose and pentose phosphates accounted for the largest fraction of isotope assimilated during photosynthesis. During the enhanced dark fixation period, glycerate 3-phosphate is carboxyl labeled and glucose 6-phosphate is predominantly labeled in carbon atom 4 with lesser amounts in the upper half of the C6 chain and traces in carbon atoms 5 and 6. Tracer spread throughout all the carbon atoms of photosynthetically synthesized glycerate 3-phosphate and glucose 6-phosphate. During the enhanced dark fixation period, there was a slow formation of sugar phosphates which subsequently continued at 5 times the initial rate long after the cessation of 14CO2 uptake. To explain the kinetics of changes in the labelling patterns and in the limited formation of the sugar phosphates during enhanced dark CO2 fixation, the suggestion is made that most of the reductant mediating these effects did not have its origin in the preillumination phase. It is concluded that a complete photosynthetic carbon reduction cycle operates to a limited extent, if at all, in the dark period subsequent to preillumination. PMID:16656608

  1. 11CO2 fixation: a renaissance in PET radiochemistry.

    PubMed

    Rotstein, Benjamin H; Liang, Steven H; Holland, Jason P; Collier, Thomas Lee; Hooker, Jacob M; Wilson, Alan A; Vasdev, Neil

    2013-06-25

    Carbon-11 labelled carbon dioxide is the cyclotron-generated feedstock reagent for most positron emission tomography (PET) tracers using this radionuclide. Most carbon-11 labels, however, are installed using derivative reagents generated from [(11)C]CO2. In recent years, [(11)C]CO2 has seen a revival in applications for the direct incorporation of carbon-11 into functional groups such as ureas, carbamates, oxazolidinones, carboxylic acids, esters, and amides. This review summarizes classical [(11)C]CO2 fixation strategies using organometallic reagents and then focuses on newly developed methods that employ strong organic bases to reversibly capture [(11)C]CO2 into solution, thereby enabling highly functionalized labelled compounds to be prepared. Labelled compounds and radiopharmaceuticals that have been translated to the clinic are highlighted. PMID:23673726

  2. The parageneses thermodynamic analysis of chemoautotrophic CO2 fixation archaic cycle components, their stability and self-organization in hydrothermal systems.

    PubMed

    Marakushev, Sergey A; Belonogova, Ol'ga V

    2009-04-21

    The parageneses physico-chemical analysis based on a method of thermodynamic potentials has been used to study the system of C-H-O organic compounds, which are, in particular, components of biomimetically built primordial cycles of carbon dioxide chemoautotrophic fixation. Thermodynamic data for aqueous organic compounds allowed one to construct the chemical potential diagrams and establish the areas of thermodynamic stability (facies) of components of CO2 fixation pathways in hydrothermal systems, in particular, a reductive citric cycle (RCC), 3-hydroxypropionate cycle (3-HPC) and acetyl-CoA pathway. An alternative deep source of carbon (hydrocarbons) proved by the data on endogenous emission of hydrocarbons in hydrothermal fields of oceanic ridges was suggested. The system was determined, which combines hydrocarbons, CO2 and components of RCC, 3-HPC and acetyl-CoA pathway with characteristic parageneses of methane and ethylene with acetate in two-component CH4-CO2 and C2H4-O2 subsystems, respectively. The thermodynamic analysis of a redox mode at various pressures and temperatures allowed one to uniquely determine hydrocarbon-organic system able to independently generate acetate and succinate at oxidation of deep hydrothermal hydrocarbon fluids emerging on sea surface. The limits for thermodynamic stability of CO2 archaic fixation (CAF) components responsible for generation and self-organization in hydrothermal environment was identified. The tentative integrated system of CAF was developed as a combined acetyl-CoA pathway, 3-HPC and RCC containing a succinate-fumarate core, capable of switching electron flow in forward or reverse direction depending on redox potential of geochemical environment that is governed by the (CH)2(COOH)2+H2=(CH2)2(COOH)2 reaction. This core is a "redox switch", which is sensitive to certain conditions of hydrothermal environment and defines electron flow direction. The redox geochemical mode caused by temperature, pressure, composition of a hydrothermal fluid and a mineralogical setting defines stability of CAF cycle components in paragenesis with hydrocarbons and possibility of cycle self-organization. PMID:19168083

  3. Determination of Methanogenic Pathways through Carbon Isotope (?(13)C) Analysis for the Two-Stage Anaerobic Digestion of High-Solids Substrates.

    PubMed

    Gehring, Tito; Klang, Johanna; Niedermayr, Andrea; Berzio, Stephan; Immenhauser, Adrian; Klocke, Michael; Wichern, Marc; Lübken, Manfred

    2015-04-01

    This study used carbon isotope (?(13)C)-based calculations to quantify the specific methanogenic pathways in a two-stage experimental biogas plant composed of three thermophilic leach bed reactors (51-56 °C) followed by a mesophilic (36.5 °C) anaerobic filter. Despite the continuous dominance of the acetoclastic Methanosaeta in the anaerobic filter, the methane (CH4) fraction derived from carbon dioxide reduction (CO2), fmc, varied significantly over the investigation period of 200 days. At organic loading rates (OLRs) below 6.0 gCOD L(-1)d(-1), the average fmc value was 33%, whereas at higher OLRs, with a maximum level of 17.0 gCOD L(-1)d(-1), the fmc values reached 47%. The experiments allowed for a clear differentiation of the isotope fractionation related to the formation and consumption of acetate in both stages of the plant. Our data indicate constant carbon isotope fractionation for acetate formation at different OLRs within the thermophilic leach bed reactors as well as a negligible contribution of homoacetogenesis. These results present the first quantification of methanogenic pathway (fmc values) dynamics for a continually operated mesophilic bioreactor and highlight the enormous potential of ?(13)C analysis for a more comprehensive understanding of the anaerobic degradation processes in CH4-producing biogas plants. PMID:25741999

  4. Investigations of potential microbial methanogenic and carbon monoxide utilization pathways in ultra-basic reducing springs associated with present-day continental serpentinization: the Tablelands, NL, CAN

    PubMed Central

    Morrill, Penny L.; Brazelton, William J.; Kohl, Lukas; Rietze, Amanda; Miles, Sarah M.; Kavanagh, Heidi; Schrenk, Matthew O.; Ziegler, Susan E.; Lang, Susan Q.

    2014-01-01

    Ultra-basic reducing springs at continental sites of serpentinization act as portals into the biogeochemistry of a subsurface environment with H2 and CH4 present. Very little, however, is known about the carbon substrate utilization, energy sources, and metabolic pathways of the microorganisms that live in this ultra-basic environment. The potential for microbial methanogenesis with bicarbonate, formate, acetate, and propionate precursors and carbon monoxide (CO) utilization pathways were tested in laboratory experiments by adding substrates to water and sediment from the Tablelands, NL, CAD, a site of present-day continental serpentinization. Microbial methanogenesis was not observed after bicarbonate, formate, acetate, or propionate addition. CO was consumed in the live experiments but not in the killed controls and the residual CO in the live experiments became enriched in 13C. The average isotopic enrichment factor resulting from this microbial utilization of CO was estimated to be 11.2 ± 0.2‰. Phospholipid fatty acid concentrations and ?13C values suggest limited incorporation of carbon from CO into microbial lipids. This indicates that in our experiments, CO was used primarily as an energy source, but not for biomass growth. Environmental DNA sequencing of spring fluids collected at the same time as the addition experiments yielded a large proportion of Hydrogenophaga-related sequences, which is consistent with previous metagenomic data indicating the potential for these taxa to utilize CO. PMID:25431571

  5. Fixational eye movements and binocular vision

    PubMed Central

    Otero-Millan, Jorge; Macknik, Stephen L.; Martinez-Conde, Susana

    2014-01-01

    During attempted visual fixation, small involuntary eye movements–called fixational eye movements–continuously change of our gaze’s position. Disagreement between the left and right eye positions during such motions can produce diplopia (double vision). Thus, the ability to properly coordinate the two eyes during gaze fixation is critical for stable perception. For the last 50 years, researchers have studied the binocular characteristics of fixational eye movements. Here we review classical and recent studies on the binocular coordination (i.e., degree of conjugacy) of each fixational eye movement type: microsaccades, drift and tremor, and its perceptual contribution to increasing or reducing binocular disparity. We also discuss how amblyopia and other visual pathologies affect the binocular coordination of fixational eye movements. PMID:25071480

  6. Overcoming fixation with repeated memory suppression.

    PubMed

    Angello, Genna; Storm, Benjamin C; Smith, Steven M

    2015-04-01

    Fixation (blocks to memories or ideas) can be alleviated not only by encouraging productive work towards a solution, but, as the present experiments show, by reducing counterproductive work. Two experiments examined relief from fixation in a word-fragment completion task. Blockers, orthographically similar negative primes (e.g., ANALOGY), blocked solutions to word fragments (e.g., A_L_ _GY) in both experiments. After priming, but before the fragment completion test, participants repeatedly suppressed half of the blockers using the Think/No-Think paradigm, which results in memory inhibition. Inhibiting blockers did not alleviate fixation in Experiment 1 when conscious recollection of negative primes was not encouraged on the fragment completion test. In Experiment 2, however, when participants were encouraged to remember negative primes at fragment completion, relief from fixation was observed. Repeated suppression may nullify fixation effects, and promote creative thinking, particularly when fixation is caused by conscious recollection of counterproductive information. PMID:24575886

  7. Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms

    PubMed Central

    Sulieman, Saad; Tran, Lam-Son Phan

    2014-01-01

    The special issue “Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms” aims to investigate the physiological and biochemical advances in the symbiotic process with an emphasis on nodule establishment, development and functioning. The original research articles included in this issue provide important information regarding novel aspects of nodule metabolism and various regulatory pathways, which could have important future implications. This issue also included one review article that highlights the importance of using legume trees in the production of renewable biofuels. PMID:25347276

  8. Nitrogen fixation in coniferous bark litter

    Microsoft Academic Search

    Assi Weber; Veronica Sundman

    1986-01-01

    Summary  Non-symbiotic heterotrophic N2 fixation in coniferous bark litter was investigated with the acetylene reduction assay under aerobic and anaerobic conditions. The litter studied was composed essentially of bark, of pH 5 and a C\\/N ratio of 101; the ratio of available C to available N, which governs N2 fixation, was considerably higher. The rate of N2 fixation was estimated as

  9. Pin loosening in external skeletal fixation

    E-print Network

    Vittal, Bamini

    1993-01-01

    styled after Journal of Biomechanica/ Engineering Kreus did not precisely document the incidence and details of complications. Towards the end of World War II, however, the high incidence of significant complications associated with external fixation... of external skeletal fixation. Following World War II, the Committee on Fracture and Trauma Surgery of the American Academy of Orthopedic Surgeons investigated the efficiency, practicality, and rightful place of external skeletal fixation. The Committee...

  10. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-01-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  11. Tibial rotational osteotomy with intramedullary nail fixation

    PubMed Central

    Stevens, Peter M.

    2009-01-01

    There are several theoretic advantages of using intramedullary rod fixation for tibial osteotomy fixation. We performed a retrospective review of patients who were treated with a mid-diaphyseal osteotomy of the tibia fixed with an intramedullary rod for isolated, symptomatic tibial torsion. Forty patients (59 tibias) were included in the study and were followed for a minimum of 12 months or until rod removal (average follow-up 22.6 months). Major complication rate was 8.5%, which is comparable to alternative methods of fixation. We believe that intramedullary rods are a safe alternative for fixation of tibial rotational osteotomy in patients with physeal closure. PMID:19941168

  12. Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle 1

    PubMed Central

    Vanlerberghe, Greg C.; Horsey, Anne K.; Weger, Harold G.; Turpin, David H.

    1989-01-01

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH4+ in the dark under anaerobic conditions. Addition of NH4+ to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO2 efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H14CO3? to anaerobic cells assimilating NH4+ results in the incorporation of radiolabel into the ?-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH4+ addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply ?-ketoglutarate for glutamate production. During dark aerobic NH4+ assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH4+ assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH4+ assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity. PMID:16667215

  13. Nonstatistical 13C Distribution during Carbon Transfer from Glucose to Ethanol during Fermentation Is Determined by the Catabolic Pathway Exploited.

    PubMed

    Bayle, Kevin; Akoka, Serge; Remaud, Gérald S; Robins, Richard J

    2015-02-13

    During the anaerobic fermentation of glucose to ethanol, the three micro-organisms Saccharomyces cerevisiae, Zymomonas mobilis, and Leuconostoc mesenteroides exploit, respectively, the Embden-Meyerhof-Parnas, the Entner-Doudoroff, and the reductive pentose phosphate pathways. Thus, the atoms incorporated into ethanol do not have the same affiliation to the atomic positions in glucose. The isotopic fractionation occurring in each pathway at both the methylene and methyl positions of ethanol has been investigated by isotopic quantitative (13)C NMR spectrometry with the aim of observing whether an isotope redistribution characteristic of the enzymes active in each pathway can be measured. First, it is found that each pathway has a unique isotope redistribution signature. Second, for the methylene group, a significant apparent kinetic isotope effect is only found in the reductive pentose phosphate pathway. Third, the apparent kinetic isotope effects related to the methyl group are more pronounced than for the methylene group. These findings can (i) be related to known kinetic isotope effects of some of the enzymes concerned and (ii) give indicators as to which steps in the pathways are likely to be influencing the final isotopic composition in the ethanol. PMID:25538251

  14. Nitrogen fixation method and apparatus

    DOEpatents

    Chen, H.L.

    1983-08-16

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O[sub 2]/cm promotes the formation of vibrationally excited N[sub 2]. Atomic oxygen interacts with vibrationally excited N[sub 2] at a much quicker rate than unexcited N[sub 2], greatly improving the rate at which NO is formed. 1 fig.

  15. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...2013-04-01 false External facial fracture fixation appliance. 878.3250...Devices § 878.3250 External facial fracture fixation appliance. (a) Identification. An external facial fracture fixation appliance is a...

  16. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...2014-04-01 false External facial fracture fixation appliance. 878.3250...Devices § 878.3250 External facial fracture fixation appliance. (a) Identification. An external facial fracture fixation appliance is a...

  17. Regulation of Carbon Flow by Nitrogen and Light in the Red Alga, Gelidium coulteri.

    PubMed

    Macler, B A

    1986-09-01

    The red alga Gelidium coulteri Harv. photosynthetically fixed [(14)C] bicarbonate at high rates under defined conditions in unialgal laboratory culture. The fixation rate and flow of photosynthate into various end products were dependent on the nitrogen status of the tissue. Plants fed luxury levels of nitrogen (approximately 340 micromolar) showed fixation rates several-fold higher than those seen for plants starved for nitrogen. The addition of NO(3) (-) or NH(4) (+) to such starved plants further inhibited fixation over at least the first several hours after addition. The majority of (14)C after incubations of 30 minutes to 8 hours was found in the compounds floridoside, agar and floridean starch. In addition, amino acids and intermediate compounds of the reductive pentose phosphate pathway, glycolytic pathway and tricarboxylic acid cycle were detected. Nitrogen affected the partitioning of labeled carbon into these compounds. Plants under luxury nitrogen conditions had higher floridoside levels and markedly lower amounts of agar and starch than found in plants limited for nitrogen. Amino acid, phycobiliprotein and chlorophyll levels were also significantly higher in nitrogen-enriched plants. Addition of NO(3) (-) to starved plants led to an increase in floridoside, tricarboxylic acid cycle intermediates and amino acids within 1 hour and inhibited carbon flow into agar and starch. Carbon fixation in the dark was only 1 to 7% of that seen in the light. Dark fixation of [(14)C]bicarbonate yielded label primarily in tricarboxylic acid cycle intermediates, amino acids and polysaccharides. Nitrogen stimulated amino acid synthesis at the expense of agar and starch. Floridoside was only a minor component in the dark. Pulse-chase experiments, designed to show carbon turnover, indicated a 2-fold increase in labeling of agar over 96 hours of chase in the light. No increases were seen in the dark. Low molecular weight pools, including floridoside, decreased 2- to 5-fold over this period under both light and dark conditions. Nitrogen status did not influence turnover. There was little or no organic carbon released into the culture medium over this period. The results are consistent with biosynthetic pathways to floridoside and agar that share the common intermediate UDP-d-galactose. It is hypothesized that synthesis of floridoside is regulated by nitrogen and light at the enzymic level. PMID:16664980

  18. Regulation of Carbon Flow by Nitrogen and Light in the Red Alga, Gelidium coulteri1

    PubMed Central

    Macler, Bruce A.

    1986-01-01

    The red alga Gelidium coulteri Harv. photosynthetically fixed [14C] bicarbonate at high rates under defined conditions in unialgal laboratory culture. The fixation rate and flow of photosynthate into various end products were dependent on the nitrogen status of the tissue. Plants fed luxury levels of nitrogen (approximately 340 micromolar) showed fixation rates several-fold higher than those seen for plants starved for nitrogen. The addition of NO3? or NH4+ to such starved plants further inhibited fixation over at least the first several hours after addition. The majority of 14C after incubations of 30 minutes to 8 hours was found in the compounds floridoside, agar and floridean starch. In addition, amino acids and intermediate compounds of the reductive pentose phosphate pathway, glycolytic pathway and tricarboxylic acid cycle were detected. Nitrogen affected the partitioning of labeled carbon into these compounds. Plants under luxury nitrogen conditions had higher floridoside levels and markedly lower amounts of agar and starch than found in plants limited for nitrogen. Amino acid, phycobiliprotein and chlorophyll levels were also significantly higher in nitrogen-enriched plants. Addition of NO3? to starved plants led to an increase in floridoside, tricarboxylic acid cycle intermediates and amino acids within 1 hour and inhibited carbon flow into agar and starch. Carbon fixation in the dark was only 1 to 7% of that seen in the light. Dark fixation of [14C]bicarbonate yielded label primarily in tricarboxylic acid cycle intermediates, amino acids and polysaccharides. Nitrogen stimulated amino acid synthesis at the expense of agar and starch. Floridoside was only a minor component in the dark. Pulse-chase experiments, designed to show carbon turnover, indicated a 2-fold increase in labeling of agar over 96 hours of chase in the light. No increases were seen in the dark. Low molecular weight pools, including floridoside, decreased 2- to 5-fold over this period under both light and dark conditions. Nitrogen status did not influence turnover. There was little or no organic carbon released into the culture medium over this period. The results are consistent with biosynthetic pathways to floridoside and agar that share the common intermediate UDP-d-galactose. It is hypothesized that synthesis of floridoside is regulated by nitrogen and light at the enzymic level. PMID:16664980

  19. COMPLEMENT FIXATION IN DISEASED TISSUES

    PubMed Central

    Burkholder, Peter M.

    1961-01-01

    An immunohistologic complement fixation test has been used in an effort to detect immune complexes in sections of kidney from rats injected with rabbit anti-rat kidney serum and in sections of biopsied kidneys from four humans with membranous glomerulonephritis. Sections of the rat and human kidneys were treated with fluorescein-conjugated anti-rabbit globulin or antihuman globulin respectively. Adjacent sections in each case were incubated first with fresh guinea pig serum and then in a second step were treated with fluorescein-conjugated antibodies against fixed guinea pig complement to detect sites of fixation of the complement. It was demonstrated that the sites of rabbit globulin in glomerular capillary walls of the rat kidneys and the sites of localized human globulin in thickened glomerular capillary walls and swollen glomerular endothelial cells of the human kidneys were the same sites in which guinea pig complement was fixed in vitro. It was concluded from these studies that rabbit nephrotoxic antibodies localize in rat glomeruli in complement-fixing antigen-antibody complexes. Furthermore, it was concluded that the deposits of human globulin in the glomeruli of the human kidneys behaved like antibody globulin in complement-fixing antigen-antibody complexes. The significance of demonstrating complement-fixing immune complexes in certain diseased tissues is discussed in regard to determination of the causative role of allergic reactions in disease. PMID:19867205

  20. Quantifying thermodynamic bottlenecks of metabolic pathways

    E-print Network

    Beimel, Amos

    : glucose => lactate Carbon fixation: CO2 => carbohydrate Carbon oxidation: carbohydrate => CO2 Why;Mathematical definition of OBE Solution for the following linear problem: maximize B cmin '° + RTST ln(c) definition of OBE Solution for the following linear problem: maximize

  1. Biological Dinitrogen Fixation (Acetylene Reduction) Associated with Florida Mangroves

    PubMed Central

    Zuberer, D. A.; Silver, W. S.

    1978-01-01

    Biological dinitrogen fixation in mangrove communities of the Tampa Bay region of South Florida was investigated using the acetylene reduction technique. Low rates of acetylene reduction (0.01 to 1.84 nmol of C2H4/g [wet weight] per h) were associated with plant-free sediments, while plant-associated sediments gave rise to slightly higher rates. Activity in sediments increased greatly upon the addition of various carbon sources, indicating an energy limitation for nitrogenase (C2H2) activity. In situ determinations of dinitrogen fixation in sediments also indicated low rates and exhibited a similar response to glucose amendment. Litter from the green macroalga, Ulva spp., mangrove leaves, and sea grass also gave rise to significant rates of acetylene reduction. Higher rates of nitrogenase activity (15 to 53 nmol of C2H4/g [wet weight] per h were associated with washed excised roots of three Florida mangrove species [Rhizophora mangle L., Avicennia germinans (L) Stern, and Laguncularia racemosa Gaertn.] as well as with isolated root systems of intact plants (11 to 58 ?g of N/g [dry weight] per h). Following a short lag period, root-associated activity was linear and did not exhibit a marked response to glucose amendment. It appears that dinitrogen-fixing bacteria in the mangrove rhizoplane are able to use root exudates and/or sloughed cell debris as energy sources for dinitrogen fixation. PMID:637550

  2. Elementary Flux Mode Analysis of Acetyl-CoA Pathway in Carboxydothermus hydrogenoformans Z-2901

    PubMed Central

    Chinnasamy Perumal, Rajadurai; Selvaraj, Ashok; Ramesh Kumar, Gopal

    2014-01-01

    Carboxydothermus hydrogenoformans is a carboxydotrophic hydrogenogenic bacterium species that produces hydrogen molecule by utilizing carbon monoxide (CO) or pyruvate as a carbon source. To investigate the underlying biochemical mechanism of hydrogen production, an elementary mode analysis of acetyl-CoA pathway was performed to determine the intermediate fluxes by combining linear programming (LP) method available in CellNetAnalyzer software. We hypothesized that addition of enzymes necessary for carbon monoxide fixation and pyruvate dissimilation would enhance the theoretical yield of hydrogen. An in silico gene knockout of pyk, pykC, and mdh genes of modeled acetyl-CoA pathway allows the maximum theoretical hydrogen yield of 47.62?mmol/gCDW/h for 1 mole of carbon monoxide (CO) uptake. The obtained hydrogen yield is comparatively two times greater than the previous experimental data. Therefore, it could be concluded that this elementary flux mode analysis is a crucial way to achieve efficient hydrogen production through acetyl-CoA pathway and act as a model for strain improvement. PMID:24822064

  3. Eighth international congress on nitrogen fixation. Final program

    SciTech Connect

    Not Available

    1990-12-31

    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  4. Biochemical Approaches to Improved Nitrogen Fixation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Improving symbiotic nitrogen fixation by legumes has emerged again as an important topic on the world scene due to the energy crisis and lack of access to nitrogen fertilizer in developing countries. We have taken a biochemical genomics approach to improving symbiotic nitrogen fixation in legumes. L...

  5. 3, 779801, 2006 Nitrogen fixation and

    E-print Network

    Boyer, Edmond

    BGD 3, 779­801, 2006 Nitrogen fixation and temperature E. Breitbarth et al. Title Page Abstract #12;BGD 3, 779­801, 2006 Nitrogen fixation and temperature E. Breitbarth et al. Title Page Abstract nitrogen cycle due to its significant input of atmospheric nitrogen into the ocean. Incorporating Tri

  6. Original article The economics of nitrogen fixation

    E-print Network

    Paris-Sud XI, Université de

    Original article The economics of nitrogen fixation Steven SCHILIZZI*, David J. PANNELL Agriculture the economic value of nitrogen fixation in a Mediterranean-type farming system in Western Australia, as well bioeconomic interactions at the paddock and whole-farm levels. The value of nitrogen thus depends on its

  7. The ecology and genomics of C02 fixation in oceanic river plumes

    SciTech Connect

    F. Robert Tabita

    2008-09-12

    The ocean/atmosphere interface is the major conduit for the entry of atmospheric CO2 into oceanic carbon pools that can lead to sequestration or recycled release. The surface layers of the temperate and tropical oceans are often too oligotrophic to result in significant primary production that might lead to carbon sequestration. However, nutrient-rich river plumes can alter the primary production schemes of oligotrophic ocean basins, resulting in increased phytoplankton biomass and carbon fixation. The ultimate goal of this proposal is to understand these carbon cycling processes in major river plumes from the molecular processes involved in biological DIC uptake to contribution to basin-wide production and potential sequestration. Our research efforts include a field component to answer the questions raised concerning DIC in plumes entering ocean basins and an intensive genomics approach to understanding these processes on the cellular level using genomic fragments obtained from plume biota. This project is actually composed of 3 separate PI-initiated projects, including projects at the University of South Florida (USF) College of Marine Science, the University of Puerto Rico, and The Ohio State University. This report concerns research conducted at The Ohio State University and studies performed in collaboration with USF. In order to understand what might occur in the field, two model sysytems were studied in the laboratory. Carbon fixation in the unicellular cyanobacterium Synechococcus sp Strain PCC 7002 took place mainly through the CBB pathway. Nitrogen nutrition in cyanobacteria is regulated by NtcA, a transcriptional regulatory protein. We show that the rubisco activity and gene (rbcL) expression were not affected when cells were exposed to prolonged periods of nitrogen stress, however cells appear to use intracellular nitrogen reserves during nitrogen starvation. Transcripts of the global transcriptional regulator NtcA are expressed under nitrogen starved and nitrogen replete (nitrate or ammonia) growth conditions, with slight decrease in transcription in the presence of ammonia. These results suggest that intracellular levels of NtcA do not directly affect carbon metabolism. Gene expression of the other nitrogen regulatory signal transducer, encoded by glnB was also studied. The glnB gene was highly transcribed in nitrogen-limited cells compared to nitrogen depleted growth conditions. Therefore in the cyanobacterium Synechococcus sp PCC 7002, nitrogen does not affect the metabolic potential and carbon fixation. The NtcA regulator behaved differently and studies indicate that the product of the ntcA gene (NtcA) has an indirect effect on ca rbon assimilation and the genes involved in the carbon concentrating mechanism of strain 7002. The product of the ccmM gene plays an important role in carboxysome assembly and inorganic carbon transport within the cell. We hypothesized that under nitrogen limiting conditions the transcriptional regulator NtcA binds at the region upstream of ccmM, near the transcription start site, and blocks the transcription of ccmM. This hypothesis was experimentally proven. In another study, with USF researchers, we performed experiments in situ on RubisCO espression. To determine the relationship between expression of the major gene in carbon fixation, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO2 in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30–32) stations were dominated by rbcL mRNA concentrations from heterokonts; i.e., diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, a-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34–36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO2. While Prochlorococcus cells did not exhibit a large difference between low and high pCO2

  8. Pd-catalyzed electrohydrogenation of carbon dioxide to formate: high mass activity at low overpotential and identification of the deactivation pathway.

    PubMed

    Min, Xiaoquan; Kanan, Matthew W

    2015-04-15

    Electrochemical reduction of CO2 to formate (HCO2(-)) powered by renewable electricity is a possible carbon-negative alternative to synthesizing formate from fossil fuels. This process is energetically inefficient because >1 V of overpotential is required for CO2 reduction to HCO2(-) on the metals currently used as cathodic catalysts. Pd reduces CO2 to HCO2(-) with no overpotential, but this activity has previously been limited to low synthesis rates and plagued by an unidentified deactivation pathway. Here we show that Pd nanoparticles dispersed on a carbon support reach high mass activities (50-80 mA HCO2(-) synthesis per mg Pd) when driven by less than 200 mV of overpotential in aqueous bicarbonate solutions. Electrokinetic measurements are consistent with a mechanism in which the rate-determining step is the addition of electrochemically generated surface adsorbed hydrogen to CO2 (i.e., electrohydrogenation). The electrodes deactivate over the course of several hours because of a minor pathway that forms CO. Activity is recovered, however, by removing CO with brief air exposure. PMID:25812119

  9. Carbon uptake in low dissolved inorganic carbon environments: the effect of limited carbon availability on photosynthetic organisms in thermal waters

    Microsoft Academic Search

    K. D. Myers; C. R. Omelon; P. Bennett

    2010-01-01

    Photosynthesis is the primary carbon fixation process in thermal waters below 70°C, but some hydrothermal waters have extremely low dissolved inorganic carbon (DIC), potentially limiting the growth of inorganic carbon fixing organisms such as algae and cyanobacteria. To address the issue of how carbon is assimilated by phototrophs in these environments, we conducted experiments to compare inorganic carbon uptake mechanisms

  10. Carbon and nitrogen cycling in thermally heated sediments

    NASA Astrophysics Data System (ADS)

    Meyer-Dombard, D. R.; Burton, M.; Vennelakanti, S.; Havig, J. R.; Shock, E.

    2009-12-01

    Hydrothermally heated sediment environments, such as are found in abundance throughout Yellowstone National Park, host fully functional microbial ecosystems. As with any ecosystem, both sources and sinks of carbon, nitrogen, and a myriad of other nutrients and energy-driving factors must be supplied. While we know microbial communities in hydrothermal environments can be surprisingly diverse, we know little about basic ecological functions such as carbon and nitrogen cycling. Previous work has shown that carbon cycling in one hot spring in Yellowstone National Park [“Bison Pool”] and its associated runoff channel functions as a complex system. Analysis of carbon and nitrogen isotopes in sediments and biofilms across a temperature and chemical gradient at this location revealed that the four best studied carbon fixation pathways [Calvin, reverse tricarboxylic acid, acetyl-CoA, 3-hydroxypropionate cycles] may all be functioning in this system, and nitrogen fixation varies across the chemosynthetic/photosynthetic ecotone [1]. Microcosm experiments using biofilms from this hot spring as inoculae with 13C labeled carbon substrates indicate heterotrophic growth [2]. In addition, metagenomic analysis of environmental DNA has indicated the presence of genes involved in carbon fixation [both phototrophic and autotrophic], and heterotrophy, as well as nitrogen fixation [3]. Studies from other Yellowstone locations have also found genetic evidence for carbon and nitrogen fixation [4, 5]. Of particular interest is the role of individuals in carbon and nitrogen cycling as environmental conditions suitable for chemosynthetic and photosynthetic growth vary. This study explores the diversity of cbbM/cbbL [Calvin cycle], aclB/oor/porA [rTCA cycle], nifH [nitrogen fixation], nirK [nitrite reduction] and amoA [ammonia oxidation] genes across a variety of Yellowstone environments. The transition of genetic diversity within sediments and biofilms is focused on the chemosynthetic/photosynthetic ecotone from a variety of hot springs spanning a range of pH and geochemical conditions. By sampling across this ecotone, changes in carbon and nitrogen fixation as a function of changing community structure become apparent. Environmental DNA was extracted from these samples, and the presence/absence of Bacteria and Archaea determined by PCR. In addition, PCR-directed screens reveal the presence or absence of the aforementioned functional genes. Further, comparison across a broad spectrum of environmental conditions supplies context for phylogenetic analysis of diversity. [1] Havig, J.R., 2009. Geochemistry of Hydrothermal Biofilms: Composition of Biofilms in Siliceous Sinter-Deposting Hot Springs. Doctoral Dissertation, Arizona State University. [2] Meyer-Dombard et al., 2007. Microbial Diversity and SIP Investigations of Streamer Biofilm Communities in Yellowstone. Goldschmidt Geochemical Conference. [3] Raymond et al., 2008. EOS Trans AGU. Abstract B14A-03. [4] Hall et al., 2008. AEM 74:4910-4922. [5] Steunou et al., 2006. PNAS 103:2398-2403.

  11. Fixation of CO2 in Clostridium cellulovorans analyzed by 13C-isotopomer-based target metabolomics

    PubMed Central

    2013-01-01

    Clostridium cellulovorans has been one of promising microorganisms to use biomass efficiently; however the basic metabolic pathways have not been completely known. We carried out 13C-isotopomer-based target metabolome analysis, or carbohydrate conversion process analysis, for more profound understanding of metabolic pathways of the bacterium. Our findings that pyruvate?+?oxaloacetate, fumarate, and malate inside and outside cells exhibited 13C incorporation suggest that C. cellulovorans exactly fixed CO2 and partly operated the TCA cycle in a reductive manner. Accompanied with CO2 fixation, the microorganism was also found to produce and secrete lactate. Overall, our study demonstrates that a part of C. cellulovorans metabolic pathways related to glycolysis and the TCA cycle are involved in CO2 fixation. PMID:24103325

  12. Methane Production Pathways in a California Rice Paddy: Isotopic Evidence for Substantial CO2 Reduction as Cause for Isotopically Light Emitted CH4 Carbon

    NASA Astrophysics Data System (ADS)

    Tyler, S. C.; McMillan, A. M.; Bearden, K.; Chidthaisong, A.; Macalady, J.

    2003-12-01

    We report measurements of ? 13C of emitted CH4 and sediment CH4 and CO2 during the 1999 rice-growing season near Maxwell, CA. Two treatments, one with rice straw incorporated from the previous season and one without rice straw were studied. The ? 13C value of emitted CH4 was consistently lighter isotopically (-67‰ to -83‰ throughout the season) in both straw incorporated and straw removed (burned) plots than in fields we have studied in Texas, Kenya, and Japan. Measured isotopic values of the production zone CH4 were compared to a two-point mixing curve representative of isotopic CH4 produced from either pure methyl-group fermentation or CO2 reduction pathways to partition the production pathways and to track seasonal changes in the production processes. Our sediment CH4 and CO2 isotope data indicate that fermentation was rarely the dominant methanogenic pathway - on the contrary CO2 reduction with H2 was more prevalent than fermentation methanogenesis throughout most of the season. The relatively isotopically light CH4 emitted by the paddy fields is also a product of oxidation and stem-transport processes which have isotopic effects of their own. These effects are discussed in context with the methanogenic isotope effects to provide a complete picture of the paddy field CH4 carbon isotope system.

  13. Biological Nitrogen Fixation in Sugar Cane: A Key to Energetically Viable Biofuel Production

    Microsoft Academic Search

    Robert M. Boddey

    1995-01-01

    The advantages of producing biofuels to replace fossil energy sources are derived from the fact that the energy accumulated in the biomass is captured directly from photosynthesis and is thus renewable, and that the cycle of carbon dioxide fixation by the crop, followed by burning of the fuel makes no overall contribution to atmospheric CO2 or, consequently, to global warming.

  14. Biological nitrogen fixation in sugar cane: A key to energetically viable biofuel production

    Microsoft Academic Search

    R. M. Boddey

    1995-01-01

    The advantages of producing biofuels to replace fossil energy sources are derived from the fact that the energy accumulated in the biomass in captured directly from photosynthesis and is thus renewable, and that the cycle of carbon dioxide fixation by the crop, followed by burning of the fuel makes no overall contribution to atmospheric COâ or, consequently, to global warming.

  15. Global N2 fixation and its response to global climate change and increasing CO2 level

    NASA Astrophysics Data System (ADS)

    Wang, Y.; Houlton, B. Z.; Field, C. B.; Vitousek, P. M.

    2007-12-01

    Biological nitrogen fixation is the largest nitrogen input to many natural terrestrial ecosystems, particularly tropical ecosystems, thereby influencing primary production, CO2 uptake, and responses to climate change. However, our understanding of biological nitrogen fixation is still very limited, and the dominant plant family capable of fixing N2 symbiotically, the Leguminasae, exhibits considerable geographic variation in the terrestrial biosphere. Based on the principles of resource optimization, we developed a new model to constrain our understanding of the geographic distribution of N fixation globally. Our model treats N fixation according to the C cost of fixing N, coupled with the N cost associated with acquiring P from the soil for plant growth. The model was used to estimate the rate of global symbiotic N2 fixation and the response of symbiotic N2 fixers to changes in climate and rising atmospheric CO2. We shall discuss global N limitation of terrestrial carbon uptake and its implications for climate-carbon cycle feedbacks from present to year 2100.

  16. Fluxes and 13C isotopic composition of dissolved carbon and pathways of methanogenesis in a fen soil exposed to experimental drought

    NASA Astrophysics Data System (ADS)

    Knorr, K.-H.; Glaser, B.; Blodau, C.

    2008-10-01

    Peatlands contain a carbon stock of global concern and significantly contribute to the global methane burden. The impact of drought and rewetting on carbon cycling in peatland ecosystems is thus currently debated. We studied the impact of experimental drought and rewetting on intact monoliths from a temperate fen over a period of ~300 days, using a permanently wet treatment and two treatments undergoing drought for 50 days. In one of the mesocosms, vegetation had been removed. Net production of CH4 was calculated from mass balances in the peat and emission using static chamber measurements. Results were compared to 13C isotope budgets of CO2 and CH4 and energy yields of acetoclastic and hydrogenotrophic methanogenesis. Drought retarded methane production after rewetting for days to weeks and promoted methanotrophic activity. Based on isotope and flux budgets, aerobic soil respiration contributed 32 96% in the wet treatment and 86 99% in the other treatments. Drying and rewetting did not shift methanogenic pathways according to ?13C ratios of CH4 and CO2. Although ?13C ratios indicated a prevalence of hydrogenotrophic methanogenesis, free energies of this process were small and often positive on the horizon scale. This suggests that methane was produced very locally. Fresh plant-derived carbon input apparently supported respiration in the rhizosphere and sustained methanogenesis in the unsaturated zone, according to a 13C-CO2 labelling experiment. The study documents that drying and rewetting in a rich fen soil may have little effect on methanogenic pathways, but result in rapid shifts between methanogenesis and methanotrophy. Such shifts may be promoted by roots and soil heterogeneity, as hydrogenotrophic methanogenesis occurred locally even when conditions were not conducive for this process in the bulk peat.

  17. The Contemporary Carbon Cycle

    Microsoft Academic Search

    R. A. Houghton

    2003-01-01

    The global carbon cycle refers to the exchanges of carbon within and between four major reservoirs: the atmosphere, the oceans, land, and fossil fuels. Carbon may be transferred from one reservoir to another in seconds (e.g., the fixation of atmospheric CO2 into sugar through photosynthesis) or over millennia (e.g., the accumulation of fossil carbon (coal, oil, gas) through deposition and

  18. Autotrophic Microbe Metagenomes and Metabolic Pathways Differentiate Adjacent Red Sea Brine Pools

    PubMed Central

    Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

    2013-01-01

    In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens. PMID:23624511

  19. Autotrophic microbe metagenomes and metabolic pathways differentiate adjacent Red Sea brine pools.

    PubMed

    Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

    2013-01-01

    In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens. PMID:23624511

  20. Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria

    PubMed Central

    Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M.; Pinhassi, Jarone

    2014-01-01

    Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light—but only in Ala—contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy. PMID:25136122

  1. Laboratory studies of carbon kinetic isotope effects on the production mechanism of particulate phenolic compounds formed by toluene photooxidation: a tool to constrain reaction pathways.

    PubMed

    Irei, Satoshi; Rudolph, Jochen; Huang, Lin; Auld, Janeen; Collin, Fabrice; Hastie, Donald

    2015-01-01

    In this study, we examined compound-specific stable carbon isotope ratios for phenolic compounds in secondary organic aerosol (SOA) formed by photooxidation of isotope-label-free toluene. SOA generated by photooxidation of toluene using a continuous-flow reactor and an 8 m(3) indoor smog chamber was collected on filters, which were extracted with acetonitrile for compound-specific analysis. Eight phenolic compounds were identified in the extracts using a gas chromatograph coupled with a mass spectrometer, and their compound-specific stable carbon isotope ratios were determined using a gas chromatograph coupled with a combustion furnace followed by an isotope ratio mass spectrometer. The majority of products, including methylnitrophenols and methylnitrocatechols, were isotopically depleted by 5-6‰ compared to the initial isotope ratio of toluene, whereas the isotope ratio for 4-nitrophenol remained identical to that of toluene. On the basis of the reaction mechanisms proposed in previous reports, stable carbon isotope ratios of these products were calculated. By comparing the observed isotope ratios with the predicted isotope ratios, we explored possible production pathways for the particulate phenolic compounds. PMID:25490235

  2. The role of formate metabolism in nitrogen fixation in Rhizobium Spp

    Microsoft Academic Search

    Sundaram S. Manian; Robert Gumbleton; Fergal O'Gara

    1982-01-01

    Formate metabolism supported nitrogen-fixation activity in free-living cultures of Rhizobium japonicum. However, formate0dependent nitrogense activity was observed only in the presence of carbon sources such as glutamate, ribose or aspartate which by themselves were unable to support nitrogenase activity. Formate-dependent nitrogenase activity was not detected in the presence of carbon sources such as malate, gluconate or glycerol which by themselves

  3. Fixation, counting, and manipulation of heterotrophic nanoflagellates.

    PubMed

    Bloem, J; Bär-Gilissen, M J; Cappenberg, T E

    1986-12-01

    Quantitative effects of several fixatives on heterotrophic nanoflagellates (HNAN) and phototrophic nanoflagellates (PNAN) were investigated by hemacytometer and epifluorescence counting techniques. Counts of Monas sp. cultures before and after fixation with unbuffered 0.3% glutaraldehyde and 5% formaldehyde showed no loss of cells during fixation, and cell concentrations remained constant for several weeks after fixation. Buffering of fixatives with borax caused severe losses, up to 100% within 2 h. Field samples from Lake Vechten showed no decline of HNAN and total nanoflagellate concentrations for at least 1 week after fixation with 5% formaldehyde and with 1% glutaraldehyde. With 1% glutaraldehyde, the chlorophyll autofluorescence of PNAN was much brighter than with 5% formaldehyde, although it was lost after a few days and thus limited the storage time of samples. However, when primulin-stained slides were prepared soon after fixation and stored at -30 degrees C, the loss of autofluorescence was prevented and PNAN and HNAN concentrations were stable for at least 16 weeks. Effects of filtration and centrifugation on HNAN were also studied. Filtration vacuum could not exceed 3 kPa since 10 kPa already caused losses of 15 to 20%. Similar losses were caused by centrifugation, even at low speed (500 x g). PMID:16347232

  4. HOPE-fixation of lung tissue allows retrospective proteome and phosphoproteome studies.

    PubMed

    Shevchuk, Olga; Abidi, Nada; Klawonn, Frank; Wissing, Josef; Nimtz, Manfred; Kugler, Christian; Steinert, Michael; Goldmann, Torsten; Jänsch, Lothar

    2014-11-01

    Hepes-glutamic acid buffer-mediated organic solvent protection effect (HOPE)-fixation has been introduced as an alternative to formalin fixation of clinical samples. Beyond preservation of morphological structures for histology, HOPE-fixation was demonstrated to be compatible with recent methods for RNA and DNA sequencing. However, the suitability of HOPE-fixed materials for the inspection of proteomes by mass spectrometry so far remained undefined. This is of particular interest, since proteins constitute a prime resource for drug research and can give valuable insights into the activity status of signaling pathways. In this study, we extracted proteins from human lung tissue and tested HOPE-treated and snap-frozen tissues comparatively by proteome and phosphoproteome analyses. High confident data from accurate mass spectrometry allowed the identification of 2603 proteins and 3036 phosphorylation sites. HOPE-fixation did not hinder the representative extraction of proteins, and investigating their biochemical properties, covered subcellular localizations, and cellular processes revealed no bias caused by the type of fixation. In conclusion, proteome as well as phosphoproteome data of HOPE lung samples were qualitatively equivalent to results obtained from snap-frozen tissues. Thus, HOPE-treated tissues match clinical demands in both histology and retrospective proteome analyses of patient samples by proteomics. PMID:24702127

  5. Aromatic pathways in carbathiaporphyrins.

    PubMed

    Valiev, Rashid R; Fliegl, Heike; Sundholm, Dage

    2015-02-19

    Magnetically induced current densities and current pathways have been calculated for carbaporphyrins and carbathiaporphyrins using the gauge including magnetically induced current (GIMIC) method. The aromatic character and current pathways are obtained from the calculated current density susceptibilities. The current-density calculations show that five of the studied carbaporphyrinoids are aromatic, two are antiaromatic, and one is nonaromatic. The analysis of the current pathways of the investigated molecules reveals some general trends for the current flow in carbaporphyrinoids. Insertion of a CH2 group into the all-carbon ring generally cuts or restricts the current flow, leading to a stronger current of the alternative pathway of the ring. No obvious trends regarding the current strengths and pathways of the thiophene and cyclopentadienyl rings were obtained. The present study shows that it is indeed difficult to predict the electron delocalization pathways of general carbaporphyrinoids. Thus, a careful analysis of the current density is necessary for determining their electron delocalization pathways. PMID:25658493

  6. Key role of symbiotic dinitrogen fixation in tropical forest secondary succession

    NASA Astrophysics Data System (ADS)

    Batterman, Sarah A.; Hedin, Lars O.; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J.; Hall, Jefferson S.

    2013-10-01

    Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000kg carbon per hectare) in the first 12years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2.

  7. Key role of symbiotic dinitrogen fixation in tropical forest secondary succession.

    PubMed

    Batterman, Sarah A; Hedin, Lars O; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J; Hall, Jefferson S

    2013-10-10

    Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000?kg carbon per hectare) in the first 12?years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2. PMID:24037375

  8. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

    2014-12-01

    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and Arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multiyear mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) buildup and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  9. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

    2014-08-01

    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multi-year mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) build-up and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  10. Malate-Mediated Carbon Catabolite Repression in Bacillus subtilis Involves the HPrK/CcpA Pathway ? §

    PubMed Central

    Meyer, Frederik M.; Jules, Matthieu; Mehne, Felix M. P.; Le Coq, Dominique; Landmann, Jens J.; Görke, Boris; Aymerich, Stéphane; Stülke, Jörg

    2011-01-01

    Most organisms can choose their preferred carbon source from a mixture of nutrients. This process is called carbon catabolite repression. The Gram-positive bacterium Bacillus subtilis uses glucose as the preferred source of carbon and energy. Glucose-mediated catabolite repression is caused by binding of the CcpA transcription factor to the promoter regions of catabolic operons. CcpA binds DNA upon interaction with its cofactors HPr(Ser-P) and Crh(Ser-P). The formation of the cofactors is catalyzed by the metabolite-activated HPr kinase/phosphorylase. Recently, it has been shown that malate is a second preferred carbon source for B. subtilis that also causes catabolite repression. In this work, we addressed the mechanism by which malate causes catabolite repression. Genetic analyses revealed that malate-dependent catabolite repression requires CcpA and its cofactors. Moreover, we demonstrate that HPr(Ser-P) is present in malate-grown cells and that CcpA and HPr interact in vivo in the presence of glucose or malate but not in the absence of a repressing carbon source. The formation of the cofactor HPr(Ser-P) could be attributed to the concentrations of ATP and fructose 1,6-bisphosphate in cells growing with malate. Both metabolites are available at concentrations that are sufficient to stimulate HPr kinase activity. The adaptation of cells to environmental changes requires dynamic metabolic and regulatory adjustments. The repression strength of target promoters was similar to that observed in steady-state growth conditions, although it took somewhat longer to reach the second steady-state of expression when cells were shifted to malate. PMID:22001508

  11. Artificial photosynthesis of. beta. -ketocarboxylic acids from carbon dioxide and ketones via enolate complexes of aluminum porphyrin

    SciTech Connect

    Hirai, Yasuhiro; Aida, Takuzo; Inoue, Shohei (Univ. of Tokyo (Japan))

    1989-04-12

    Photochemical fixation of carbon dioxide is of much interest in connection with biological photosynthesis by green plants as well as from the viewpoint of carbon resource utilization. One of the important steps in the assimilation of carbon dioxide is the carboxylation of a carbonyl compound into ketocarboxylic acid, where the reaction proceeds via an enolate species as reactive intermediate. For example, in four carbon (C{sub 4}) pathway and Crassulacean acid metabolism (CAM) processes, pyruvate is converted with the aid of ATP into phosphoenolpyruvate, which is subsequently carboxylated to give oxaloacetate by the action of pyruvate carboxylase. In relation to this interesting biological process, some artificial systems have been exploited for the synthesis of {beta}-ketocarboxylic acid derivatives from carbon dioxide and ketones using nucleophiles such as metal carbonates, thiazolates, phenolates, alkoxides, and strong organic as well as inorganic basis, which promote the enolization of ketones in the intermediate step. We wish to report here a novel, visible light-induced fixation of carbon dioxide with the enolate complex of aluminum porphyrin, giving {beta}-ketocarboxylic acid under mild conditions.

  12. Stability of external skeletal fixation clamps

    E-print Network

    Sandel, Mark Eugene

    1995-01-01

    External skeletal fixation is commonly used for treatment of many orthopedic diseases and injuries in both human and animal patients. It is mainly used for support of fractures during the healing process. Research on the loosening of transfixation...

  13. Transmucosal fixation of the fractured edentulous mandible.

    PubMed

    Wood, G A; Campbell, D F; Greene, L E

    2011-05-01

    Transmucosal fixation is a new strategy for the treatment of edentulous mandibular fractures using external fixation principles within the oral cavity. The component parts of this technique are not new. External fixation, locking plates and transmucosal implants represent the foundations of this technique; the authors' development has been to bring these established methods together as a transmucosal intra oral locking plate fixation technique. The first eight patients treated with this technique have achieved bony union, they have no long-term sensory deficit and all patients were able to eat a soft diet with minimal discomfort the day after surgery. The first five of eight patients on long-term review showed bony union confirmed radiographically. For the remainder and subsequent patients, radiographs have not been scheduled at review, in the absence of symptoms. PMID:21185150

  14. Fluxes and 13C isotopic composition of dissolved carbon and pathways of methanogenesis in a fen soil exposed to experimental drought

    NASA Astrophysics Data System (ADS)

    Knorr, K.-H.; Glaser, B.; Blodau, C.

    2008-04-01

    The impact of drought and rewetting on carbon cycling in peatland ecosystems is currently debated. We studied the impact of experimental drought and rewetting on intact monoliths from a temperate fen over a period of ~300 days, using a permanently wet treatment and two treatments undergoing drought for 50 days. In one of the mesocosms vegetation had been removed. Net production of CH4 was calculated from mass balances in the peat and emission using static chamber measurements and results compared to 13C isotope budgets of CO2 and CH4 and energy yields of acetoclastic and hydrogenotrophic methanogenesis. Drought retarded methane production after rewetting for days to weeks and promoted methanotrophic activity. Based on isotope and flux budgets, aerobic soil respiration contributed 32-96% in the wet and 86-99% in the other treatments. Drying and rewetting did not shift methanogenic pathways according to ? 13C ratios of CH4 and CO2. Although ?13C ratios indicated a prevalence of hydrogenotrophic methanogenesis, free energies of this process were small and often positive on the horizon scale, suggesting that methane was produced very locally. Fresh plant-derived carbon input apparently supported respiration in the rhizosphere and sustained methanogenesis in the unsaturated zone according to a 13C-CO2 labelling experiment. The study documents that drying and rewetting in a rich fen soil may have little effect on methanogenic pathways but result in rapid shifts between methanogenesis and methanotrophy. Such shifts may be promoted by roots and soil heterogeneity, as hydrogenotrophic methanogenesis occurred locally even when conditions were not conducive for this process in the bulk peat.

  15. Subduction-Zone Metamorphic Pathway for Deep Carbon Cycling: Evidence from the Italian Alps and the Tianshan

    NASA Astrophysics Data System (ADS)

    Bebout, G. E.; Collins, N.; Cook-Kollars, J.; Angiboust, S.; Agard, P.; Scambelluri, M.; John, T.; Kump, L. R.

    2013-12-01

    Depending on the magnitude of the poorly constrained C flux in ultramafic rocks, on a global basis, sediments and altered oceanic crust (AOC) together deliver 70-95% of the C currently entering subduction zones. We are investigating extents of retention and metamorphic release of C in deeply subducted AOC and carbonate-rich sediment represented by HP/UHP meta-ophiolitic and metasedimentary rocks in the Italian Alps and in the Tianshan. Study of metapelite devolatilization in the same W. Alps suite (Bebout et al., 2013, Chem. Geol.) provides a geochemical framework for study of C behavior along prograde P-T paths similar to those experienced in forearcs of most modern subduction margins. Study of veins in the Tianshan affords examination of C mobility in UHP fluids, in later stages as metabasaltic rocks were fragmented in the subduction channel. Our results for sediments and AOC indicate impressive retention of oxidized C (carbonate) and reduced C (variably metamorphosed organic matter) to depths approaching those beneath arc volcanic fronts. In metasedimentary rocks, extensive isotopic exchange between the oxidized and reduced C resulted in shifts in both reservoirs toward upper mantle compositions. Much of the carbonate in metabasalts has C and O isotopic compositions overlapping with those for carbonate in AOC, with some HP/UHP metamorphic veins showing greater influence of organic C signatures from metasedimentary rocks. Calculations of prograde devolatilization histories using Perple-X demonstrate that, in most forearcs, very little decarbonation occurs in the more carbonate-rich rocks unless they are flushed by H2O-rich fluids from an external source, for example, from the hydrated ultramafic section of subducting slabs (cf. Gorman et al., 2006; G3) or from more nearby rocks experiencing dehydration (e.g., metapelites). A comparison of the most recently published thermal models for modern subduction zones (van Keken et al., 2011, JGR) with calculated and experimentally determined phase relations indicates that significant C loss during devolatilization (and partial melting) should occur as subducting sections traverse depths beneath arcs. The extent of C mobility due to carbonate dissolution remains uncertain. On a global basis, imbalance between subducted C input and C return flux by magmatism (excluding ultramafic inputs, ~40×20% of subducted C return via arcs and ~80×20% by all magmatism; Bebout, 2013, Treat. Geochem.) indicates net modern C return to the mantle, perhaps a reversal of Archean net outgassing (despite more rapid subduction). Global C cycle models predict that relatively small (and geologically plausible) change in the subduction/volcanic C flux could significantly affect atmospheric CO2 levels and thus global climate.

  16. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion

    PubMed Central

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

    2013-01-01

    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C?C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

  17. Diel nitrogen fixation pattern of Trichodesmium: the interactive control of light and Ni

    PubMed Central

    Rodriguez, Irene B.; Ho, Tung-Yuan

    2014-01-01

    Trichodesmium, a nonheterocystous cyanobacterium widely abundant in the surface water of the tropical and subtropical ocean, fixes dinitrogen under high light conditions while concurrently undergoing photosynthesis. The new production considerably influences the cycling of nitrogen and carbon in the ocean. Here, we investigated how light intensity and nickel (Ni) availability interplay to control daily rates and diel patterns of N2 fixation in Trichodesmium. We found that increasing Ni concentration increased N2 fixation rates by up to 30-fold in the high light treatment. Cultures subjected to high Ni and light levels fixed nitrogen throughout most of the 24 H light:dark regime with the highest rate coinciding with the end of the 12 H light period. Our study demonstrates the importance of Ni on nitrogen fixation rates for Trichodesmium under high light conditions. PMID:24658259

  18. Tendon and Ligament Fixation to Bone

    Microsoft Academic Search

    Christopher M. Hill; Yuehuei H. An; Frank A. Young

    For the successful transplantation or transposition of ligaments and tendons, fixation techniques are very important. As most\\u000a postsurgical rehabilitation protocols emphasize immediate full range of motion and early return to function, fixation must\\u000a provide adequate strength and stiffness during the early postoperative period. Table 1 lists mechanical properties (failure\\u000a load, ultimate strength, stiffness, and elastic modulus) of ligament, tendon, or

  19. Fixation of Ejaculated Spermatozoa for Electron Microscopy

    Microsoft Academic Search

    Mario Stefanini; Cesare De Martino; Luciano Zamboni

    1967-01-01

    EJACULATED spermatozoa cannot be preserved satisfactorily by conventional fixation procedures for electron microscopy. Osmium tetroxide (OsO4) fixation of crude ejaculate consistently produces a variety of artefacts such as separation of the plasma membrane from the acrosome, widening of nuclear vacuoles, erosion of the acrosome, and swelling of mitochondria1-3. These alterations could be the consequence of the rapid destruction of the

  20. The lateral fixation screw in implant dentistry.

    PubMed

    Sethi, A; Sochor, P

    2000-03-01

    This clinical report presents a means of retaining implant supported superstructures using lateral fixation screws (Novadent). 244 lateral fixation screws have been used for the retention of a variety of restorations including single teeth, short span and full arch bridgework as well as overdenture bars. Over a period of observation of 4 years, the authors have found the restorations to have effective retention, ease of retrievability, good aesthetics and occlusal contours. PMID:11307389

  1. Carbon ion beam triggers both caspase-dependent and caspase-independent pathway of apoptosis in HeLa and status of PARP-1 controls intensity of apoptosis.

    PubMed

    Ghorai, Atanu; Sarma, Asitikantha; Bhattacharyya, Nitai P; Ghosh, Utpal

    2015-04-01

    High linear energy transfer (LET) carbon ion beam (CIB) is becoming very promising tool for various cancer treatments and is more efficient than conventional low LET gamma or X-rays to kill malignant or radio-resistant cells, although detailed mechanism of cell death is still unknown. Poly (ADP-ribose) polymerase-1 (PARP-1) is a key player in DNA repair and its inhibitors are well-known as radio-sensitizer for low LET radiation. The objective of our study was to find mechanism(s) of induction of apoptosis by CIB and role of PARP-1 in CIB-induced apoptosis. We observed overall higher apoptosis in PARP-1 knocked down HeLa cells (HsiI) compared with negative control H-vector cells after irradiation with CIB (0-4 Gy). CIB activated both intrinsic and extrinsic pathways of apoptosis via caspase-9 and caspase-8 activation respectively, followed by caspase-3 activation, apoptotic body, nucleosomal ladder formation and sub-G1 accumulation. Apoptosis inducing factor translocation into nucleus in H-vector but not in HsiI cells after CIB irradiation contributed caspase-independent apoptosis. Higher p53 expression was observed in HsiI cells compared with H-vector after exposure with CIB. Notably, we observed about 37 % fall of mitochondrial membrane potential, activation of caspase-9 and caspase-3 and mild activation of caspase-8 without any detectable apoptotic body formation in un-irradiated HsiI cells. We conclude that reduction of PARP-1 expression activates apoptotic signals via intrinsic and extrinsic pathways in un-irradiated cells. CIB irradiation further intensified both intrinsic and extrinsic pathways of apoptosis synergistically along with up-regulation of p53 in HsiI cells resulting overall higher apoptosis in HsiI than H-vector. PMID:25670618

  2. Gaze shifts and fixations dominate gaze behavior of walking cats.

    PubMed

    Rivers, T J; Sirota, M G; Guttentag, A I; Ogorodnikov, D A; Shah, N A; Beloozerova, I N

    2014-09-01

    Vision is important for locomotion in complex environments. How it is used to guide stepping is not well understood. We used an eye search coil technique combined with an active marker-based head recording system to characterize the gaze patterns of cats walking over terrains of different complexity: (1) on a flat surface in the dark when no visual information was available, (2) on the flat surface in light when visual information was available but not required for successful walking, (3) along the highly structured but regular and familiar surface of a horizontal ladder, a task for which visual guidance of stepping was required, and (4) along a pathway cluttered with many small stones, an irregularly structured surface that was new each day. Three cats walked in a 2.5-m corridor, and 958 passages were analyzed. Gaze activity during the time when the gaze was directed at the walking surface was subdivided into four behaviors based on speed of gaze movement along the surface: gaze shift (fast movement), gaze fixation (no movement), constant gaze (movement at the body's speed), and slow gaze (the remainder). We found that gaze shifts and fixations dominated the cats' gaze behavior during all locomotor tasks, jointly occupying 62-84% of the time when the gaze was directed at the surface. As visual complexity of the surface and demand on visual guidance of stepping increased, cats spent more time looking at the surface, looked closer to them, and switched between gaze behaviors more often. During both visually guided locomotor tasks, gaze behaviors predominantly followed a repeated cycle of forward gaze shift followed by fixation. We call this behavior "gaze stepping". Each gaze shift took gaze to a site approximately 75-80cm in front of the cat, which the cat reached in 0.7-1.2s and 1.1-1.6 strides. Constant gaze occupied only 5-21% of the time cats spent looking at the walking surface. PMID:24973656

  3. Maxwellian Eye Fixation during Natural Scene Perception

    PubMed Central

    Duchesne, Jean; Bouvier, Vincent; Guillemé, Julien; Coubard, Olivier A.

    2012-01-01

    When we explore a visual scene, our eyes make saccades to jump rapidly from one area to another and fixate regions of interest to extract useful information. While the role of fixation eye movements in vision has been widely studied, their random nature has been a hitherto neglected issue. Here we conducted two experiments to examine the Maxwellian nature of eye movements during fixation. In Experiment 1, eight participants were asked to perform free viewing of natural scenes displayed on a computer screen while their eye movements were recorded. For each participant, the probability density function (PDF) of eye movement amplitude during fixation obeyed the law established by Maxwell for describing molecule velocity in gas. Only the mean amplitude of eye movements varied with expertise, which was lower in experts than novice participants. In Experiment 2, two participants underwent fixed time, free viewing of natural scenes and of their scrambled version while their eye movements were recorded. Again, the PDF of eye movement amplitude during fixation obeyed Maxwell's law for each participant and for each scene condition (normal or scrambled). The results suggest that eye fixation during natural scene perception describes a random motion regardless of top-down or of bottom-up processes. PMID:23226987

  4. Contribution of dinitrogen fixation to bacterial and primary productivity in the Gulf of Aqaba (Red Sea)

    NASA Astrophysics Data System (ADS)

    Rahav, E.; Herut, B.; Mulholland, M. R.; Voß, B.; Stazic, D.; Steglich, C.; Hess, W. R.; Berman-Frank, I.

    2013-06-01

    We evaluated the seasonal contribution of heterotrophic and autotrophic diazotrophy to the total dinitrogen (N2) fixation in a representative pelagic station in the northern Gulf of Aqaba in early spring when the water column was mixed and during summer under full thermal stratification. N2 fixation rates were low during the mixed period (˜ 0.1 nmol N L-1 d-1) and were significantly coupled with both primary and bacterial productivity. During the stratified period N2 fixation rates were four-fold higher (˜ 0.4 nmol N L-1 d-1) and were significantly correlated solely with bacterial productivity. Furthermore, while experimental enrichment of seawater by phosphorus (P) enhanced bacterial productivity and N2 fixation rates during both seasons primary productivity was stimulated by P only in the early spring. Metatranscriptomic analyses from the stratified period identified the major diazotrophic contributors as related to heterotrophic prokaryotes from the Euryarchaeota and Desulfobacterales (Deltaproteobacteria) or Chlorobiales (Chlorobia). Moreover, during this season, experimental amendments to seawater applying a combination of the photosynthetic inhibitor 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and a mixture of amino acids increased both bacterial productivity and N2 fixation rates. Our findings from the northern Gulf of Aqaba indicate a~shift in the diazotrophic community from phototrophic and heterotrophic populations, including small blooms of the cyanobacterium Trichodesmium, in winter/early spring, to predominantly heterotrophic diazotrophs in summer that may be both P and carbon limited as the additions of P and amino acids illustrated.

  5. Cost of external fixation vs external fixation then nailing in bone infection

    PubMed Central

    Emara, Khaled Mohamed; Diab, Ramy Ahmed; Ghafar, Khaled Abd EL

    2015-01-01

    AIM: To study the cost benefit of external fixation vs external fixation then nailing in treatment of bone infection by segment transfer. METHODS: Out of 71 patients with infected nonunion tibia treated between 2003 and 2006, 50 patients fitted the inclusion criteria (26 patients were treated by external fixation only, and 24 patients were treated by external fixation early removal after segment transfer and replacement by internal fixation). Cost of inpatient treatment, total cost of inpatient and outpatient treatment till full healing, and the weeks of absence from school or work were calculated and compared between both groups. RESULTS: The cost of hospital stay and surgery in the group of external fixation only was 22.6 ± 3.3 while the cost of hospital stay and surgery in the group of early external fixation removal and replacement by intramedullary nail was 26.0 ± 3.2. The difference was statistically significant regarding the cost of hospital stay and surgery in favor of the group of external fixation only. The total cost of medical care (surgery, hospital stay, treatment outside the hospital including medications, dressing, physical therapy, outpatient laboratory work, etc.) in group of external fixation only was 63.3 ± 15.1, and total absence from work was 38.6 ± 6.6 wk. While the group of early removal of external fixation and replacement by IM nail, total cost of medical care was 38.3 ± 6.4 and total absence from work or school was 22.7 ± 4.1. The difference was statistically significant regarding the total cost and absence from work in favor of the group of early removal and replacement by IM nail. CONCLUSION: Early removal of external fixation and replacement by intramedullary nail in treatment of infected nonunion showed more cost effectiveness. Orthopaedic society needs to show the cost effectiveness of different procedures to the community, insurance, and health authorities. PMID:25621219

  6. Proteomic Analysis of Carbon Concentrating Chemolithotrophic Bacteria Serratia sp. for Sequestration of Carbon Dioxide

    PubMed Central

    Bharti, Randhir K.; Srivastava, Shaili; Thakur, Indu Shekhar

    2014-01-01

    A chemolithotrophic bacterium enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was identified as Serratia sp. by 16S rRNA sequencing. Carbon dioxide sequestering capacity of bacterium was detected by carbonic anhydrase enzyme and ribulose-1, 5- bisphosphate carboxylase/oxygenase (RuBisCO). The purified carbonic anhydrase showed molecular weight of 29 kDa. Molecular weight of RuBisCO was 550 kDa as determined by fast protein liquid chromatography (FPLC), however, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) showed presence of two subunits whose molecular weights were 56 and 14 kDa. The Western blot analysis of the crude protein and purified sample cross reacted with RuBisCO large-subunit polypeptides antibodies showed strong band pattern at molecular weight around 56 kDa regions. Whole cell soluble proteins of Serratia sp. grown under autotrophic and heterotrophic conditions were resolved by two-dimensional gel electrophoresis and MALDI-TOF/MS for differential expression of proteins. In proteomic analysis of 63 protein spots, 48 spots were significantly up-regulated in the autotrophically grown cells; seven enzymes showed its utilization in autotrophic carbon fixation pathways and other metabolic activities of bacterium including lipid metabolisms indicated sequestration potency of carbon dioxide and production of biomaterials. PMID:24619032

  7. Diazotrophy in the Deep: Measuring Rates and Identifying Biological Mediators of N2 fixation in Deep-Sea Sediments

    NASA Astrophysics Data System (ADS)

    Dekas, A. E.; Fike, D. A.; Chadwick, G.; Connon, S. A.; Orphan, V. J.

    2013-12-01

    Biological N2 fixation (the conversion of N2 to NH3) is the largest natural source of bioavailable nitrogen to the biosphere, and dictates the rate of community productivity in many nitrogen-limited environments. Deep-sea sediments are traditionally not thought to host N2 fixation, however evidence from a metagenomics dataset targeting deep-sea methanotrophic archaea (ANME) suggested their ability to fix N2 (Pernthaler, et al., PNAS 2008). Using stable isotope labeling experiments and FISH-NanoSIMS, a technique which allows the visualization of isotopic composition within phylogenetically identified cells on the nanometer scale, we demonstrated that the ANME are capable of N2 fixation (Dekas et al., Science 2009). In the present work, we use FISH-NanoSIMS and bulk Isotope Ratio Mass Spectrometry (IRMS) to show that the ANME are the most significant source of new nitrogen at a Costa Rican methane seep. This suggests that the ANME may play a significant role in N2 fixation in methane seeps worldwide. We expand our investigation of deep-sea diazotrophy to include diverse habitats, including sulfide- and carbon-rich whalefalls, and observe that N2 fixation is widespread in sediments on the seafloor. Outside of methane seeps, N2 fixation appears to be mediated by a diversity of anaerobic microbes potentially including methanogens and sulfate reducing bacteria. Interestingly, deep-sea N2 fixation often occurs in the presence of high levels of NH4+. Our observations challenge long-held hypotheses about where and when N2 fixation occurs, and suggest a bigger role for N2 fixation on the seafloor - and potentially the deep-biosphere - than previously realized.

  8. [Visual fixation features after treatment of exudative age macular degeneration].

    PubMed

    Surguch, V K; Surnina, Z V; Sizova, M V

    2011-01-01

    Changes of visual fixation in patients with choroidal neovascularitation (CNV) associated with age macular degeneration (AMD) after bevacizumab are studied. 45 patients (45 eyes) with active CNV treated with intravitreal bevacizumab were enrolled into the study. Visual fixation was studied before and 3-6 months after treatment using original method that included fundus foto and fluorescein angiography. Fixation relative to fovea and lesion was evaluated. Foveal fixation beyond lesion was found in 9%, foveal fixation within lesion--in 47%, extrafoveal fixation beyond lesion--in 18%, extrafoveal fixation within lesion--in 26% of patients. Changes of fixation localization after treatment was found in 24% patients. Examination of visual fixation may be useful for prognosis of anti-VEGF treatment efficacy in patients with CNV. PMID:21721271

  9. The importance of regulation of nitrogen fixation

    NASA Astrophysics Data System (ADS)

    Menge, D. N.

    2012-12-01

    I am not a proponent of including more detail in models simply because it makes them more realistic. More complexity increases the difficulty of model interpretation, so it only makes sense to include complexity if its benefit exceeds its costs. Biological nitrogen (N) fixation (BNF) is one process for which I feel the benefits of including greater complexity far outweigh the costs. I don't think that just because I work on BNF; I work on BNF because I think that. BNF, a microbial process carried out by free-living and symbiotic microbes, is the dominant N input to many ecosystems, the primary mechanism by which N deficiency can feed back to N inputs, and a main mechanism by which N surplus can develop. The dynamics of BNF, therefore, have huge implications for the rate of carbon uptake and the extent of CO2 fertilization, as well as N export to waterways and N2O emissions to the atmosphere. Unfortunately, there are serious deficiencies in our understanding of BNF. One main deficiency in our understanding is the extent to which various symbiotic N fixing organisms respond to imbalanced nutrition. Theory suggests that these responses, which I will call "strategies," have fundamental consequences for N fixer niches and ecosystem-level N and C cycling. Organisms that fix N regardless of whether they need it, a strategy that I will call "obligate," occupy post-disturbance niches and rapidly lead to N surplus. On the contrary, organisms that only fix as much N as they need, a "facultative" strategy, can occupy a wider range of successional niches, do not produce surplus N, and respond more rapidly to increased atmospheric CO2. In this talk I will show new results showing that consideration of these strategies could on its own explain the latitudinal distribution of symbiotic N fixing trees in North America. Specifically, the transition in N-fixing tree abundance from ~10% of basal area south of 35° latitude to ~1% of basal area north of 35° latitude that we observe from systematic forest inventory data can be explained by a concomitant switch from predominantly facultative N-fixing trees to predominantly obligate N-fixing trees. This transition in the dominant N-fixing strategy would have important consequences for the rate at which CO2 fertilization can occur and the extent of N surplus in different biomes. These theoretical and forest inventory results suggest that greater knowledge of BNF strategies would greatly increase our understanding of the distribution of N fixers and ecosystem responses to global change. I will finish the talk with a brief literature synthesis that attempts to draw generalizations about BNF strategies. With the limited data available, actinorhizal symbioses in temperate environments appear to be obligate but rhizobial symbioses appear to employ different strategies in different environments. From these results it is unclear whether the strategy is more strongly influenced by the microbes, the plants, or the environments in which the symbiosis has evolved; answering this question would point toward the best ways to incorporate N fixation into global ecosystem models.

  10. Carbon isotope discrimination varies genetically in c(4) species.

    PubMed

    Hubick, K T; Hammer, G L; Farquhar, G D; Wade, L J; von Caemmerer, S; Henderson, S A

    1990-02-01

    Carbon-isotope discrimination (Delta) is used to distinguish between different photosynthetic pathways. It has also been shown that variation in Delta occurs among varieties of C(3) species, but not as yet, in C(4) species. We now report that Delta also varies among genotypes of sorghum (Sorghum bicolor Moench), a C(4) species. The discrimination in leaves of field-grown plants of 12 diverse genotypes of sorghum was measured and compared with their grain yields. Discrimination varied significantly among genotypes, and there was a significant negative correlation between grain yield and Delta. The variation in Delta may be caused by genetic differences in either leakiness of the bundle-sheath cells or by differences in the ratio of assimilation rate to stomatal conductance. At the leaf level, the former should be related to light-use efficiency of carbon fixation and the latter should be related to transpiration efficiency. Both could relate to the yield of the crop. PMID:16667310

  11. Biological construction of single-walled carbon nanotube electron transfer pathways in dye-sensitized solar cells.

    PubMed

    Inoue, Ippei; Watanabe, Kiyoshi; Yamauchi, Hirofumi; Ishikawa, Yasuaki; Yasueda, Hisashi; Uraoka, Yukiharu; Yamashita, Ichiro

    2014-10-01

    We designed and mass-produced a versatile protein supramolecule that can be used to manufacture a highly efficient dye-sensitized solar cell (DSSC). Twelve single-walled carbon-nanotube (SWNT)-binding and titanium-mineralizing peptides were genetically integrated on a cage-shaped dodecamer protein (CDT1). A process involving simple mixing of highly conductive SWNTs with CDT1 followed by TiO2 biomineralization produces a high surface-area/weight TiO2 -(anatase)-coated intact SWNT nanocomposite under environmentally friendly conditions. A DSSC with a TiO2 photoelectrode containing 0.2?wt?% of the SWNT-TiO2 nanocomposite shows a current density improvement by 80% and a doubling of the photoelectric conversion efficiency. The SWNT-TiO2 nanocomposite transfers photon-generated electrons from dye molecules adsorbed on the TiO2 to the anode electrode swiftly. PMID:25111295

  12. Epithelial-mesenchymal transition involved in pulmonary fibrosis induced by multi-walled carbon nanotubes via TGF-beta/Smad signaling pathway.

    PubMed

    Chen, Tian; Nie, Haiyu; Gao, Xin; Yang, Jinglin; Pu, Ji; Chen, Zhangjian; Cui, Xiaoxing; Wang, Yun; Wang, Haifang; Jia, Guang

    2014-04-21

    Multi-walled carbon nanotubes (MWCNT) are a typical nanomaterial with a wide spectrum of commercial applications. Inhalation exposure to MWCNT has been linked with lung fibrosis and mesothelioma-like lesions commonly seen with asbestos. In this study, we examined the pulmonary fibrosis response to different length of MWCNT including short MWCNT (S-MWCNT, length=350-700nm) and long MWCNT (L-MWCNT, length=5-15?m) and investigated whether the epithelial-mesenchymal transition (EMT) occurred during MWCNT-induced pulmonary fibrosis. C57Bl/6J male mice were intratracheally instilled with S-MWCNT or L-WCNT by a single dose of 60?g per mouse, and the progress of pulmonary fibrosis was evaluated at 7, 28 and 56 days post-exposure. The in vivo data showed that only L-MWCNT increased collagen deposition and pulmonary fibrosis significantly, and approximately 20% of pro-surfactant protein-C positive epithelial cells transdifferentiated to fibroblasts at 56 days, suggesting the occurrence of EMT. In order to understand the mechanism, we used human pulmonary epithelial cell line A549 to investigate the role of TGF-?/p-Smad2 signaling pathway in EMT. Our results showed that L-MWCNT downregulated E-cadherin and upregulated ?-smooth muscle actin (?-SMA) protein expression in A549 cells. Taken together, both in vivo and in vitro study demonstrated that respiratory exposure to MWCNT induced length dependent pulmonary fibrosis and epithelial-derived fibroblasts via TGF-?/Smad pathway. PMID:24530353

  13. Nitrite fixation by humic substances: Nitrogen-15 nuclear magnetic resonance evidence for potential intermediates in chemodenitrification

    USGS Publications Warehouse

    Thorn, K.A.; Mikita, M.A.

    2000-01-01

    Studies have suggested that NO2/-, produced during nitrification and denitrification, can become incorporated into soil organic matter and, in one of the processes associated with chemodenitrification, react with organic matter to form trace N gases, including N2O. To gain an understanding of the nitrosation chemistry on a molecular level, soil and aquatic humic substances were reacted with 15N-labeled NaNO2, and analyzed by liquid phase 15N and 13C nuclear magnetic resonance (NMR). The International Humic Substances Society (IHSS) Pahokee peat and peat humic acid were also reacted with Na15NO2 and analyzed by solid-state 15N NMR. In Suwannee River, Armadale, and Laurentian fulvic acids, phenolic rings and activated methylene groups underwent nitrosation to form nitrosophenols (quinone monoximes) and ketoximes, respectively. The oximes underwent Beckmann rearrangements to 2??amides, and Beckmann fragmentations to nitriles. The nitriles in turn underwent hydrolysis to 1??amides. Peaks tentatively identified as imine, indophenol, or azoxybenzene nitrogens were clearly present in spectra of samples nitrosated at pH 6 but diminished at pH 3. The 15N NMR spectrum of the peat humic acid exhibited peaks corresponding with N-nitroso groups in addition to nitrosophenols, ketoximes, and secondary Beckmann reaction products. Formation of N-nitroso groups was more significant in the whole peat compared with the peat humic acid. Carbon-13 NMR analyses also indicated the occurrence of nitrosative demethoxylation in peat and soil humic acids. Reaction of 15N-NH3 fixated fulvic acid with unlabeled NO2/- resulted in nitrosative deamination of aminohydroquinone N, suggesting a previously unrecognized pathway for production of N2 gas in soils fertilized with NH3.Studies have suggested that NO2-, produced during nitrification and denitrification, can become incorporated into soil organic matter and, in one of the processes associated with chemodenitrification, react with organic matter to form trace N gases, including N2O. To gain an understanding of the nitrosation chemistry on a molecular level, soil and aquatic humic substances were reacted with 15N-labeled NaNO2, and analyzed by liquid phase 15N and 13C nuclear magnetic resonance (NMR). The International Humic Substances Society (IHSS) Pahokee peat and peat humic acid were also reacted with Na15NO2 and analyzed by solid-state 15N NMR. In Suwannee River, Armadale, and Laurentian fulvic acids, phenolic rings and activated methylene groups underwent nitrosation to form nitrosophenols (quinone monoximes) and ketoximes, respectively. The oximes underwent Beckmann rearrangements to 2?? amides, and Beckmann fragmentations to nitriles. The nitriles in turn underwent hydrolysis to 1?? amides. Peaks tentatively identified as imine, indophenol, or azoxybenzene nitrogens were dearly present in spectra of samples nitrosated at pH 6 but diminished at pH 3. The 15N NMR spectrum of the peat humic acid exhibited peaks corresponding with N-nitroso groups in addition to nitrosophenols, ketoximes, and secondary Beckmann reaction products. Formation of N-nitroso groups was more significant in the whole peat compared with the peat humic acid. Carbon-13 NMR analyses also indicated the occurrence of nitrosative demethoxylation in peat and soil humic acids. Reaction of 15N-NH3 fixated fulvic acids with unlabeled NO2- resulted in nitrosative deamination of aminohydroquinone N, suggesting a previously unrecognized pathway for production of N2 gas in soils fertilized with NH3.

  14. Rapid Two-Temperature Formalin Fixation

    PubMed Central

    Roberts, Esteban; Borlee, Grace; Otter, Michael; Baird, Geoffrey S.

    2013-01-01

    Formalin fixation is a mainstay of modern histopathologic analysis, yet the practice is poorly standardized and a significant potential source of preanalytical errors. Concerns of workflow and turnaround time drive interest in developing shorter fixation protocols, but rapid protocols can lead to poor histomorphology or inadequate downstream assay results. Additionally, assays such as immunohistochemistry for phosphorylated epitopes have historically been challenging in the context of formalin-fixed tissue, indicating that there may be room for improvement in this process that is fundamental to the practice of anatomic pathology. With these issues in mind, we studied basic formalin biochemistry to develop a novel formalin fixation protocol that involves a pre-incubation in subambient temperature formalin prior to a brief exposure to heated formalin. This new protocol is more rapid than standard protocols yet preserves histomorphology and yields tissue that is compatible with an expanded set of downstream clinical and research assays, including immunohistochemistry for phosphorylated epitopes. PMID:23349806

  15. Biometric recognition via fixation density maps

    NASA Astrophysics Data System (ADS)

    Rigas, Ioannis; Komogortsev, Oleg V.

    2014-05-01

    This work introduces and evaluates a novel eye movement-driven biometric approach that employs eye fixation density maps for person identification. The proposed feature offers a dynamic representation of the biometric identity, storing rich information regarding the behavioral and physical eye movement characteristics of the individuals. The innate ability of fixation density maps to capture the spatial layout of the eye movements in conjunction with their probabilistic nature makes them a particularly suitable option as an eye movement biometrical trait in cases when free-viewing stimuli is presented. In order to demonstrate the effectiveness of the proposed approach, the method is evaluated on three different datasets containing a wide gamut of stimuli types, such as static images, video and text segments. The obtained results indicate a minimum EER (Equal Error Rate) of 18.3 %, revealing the perspectives on the utilization of fixation density maps as an enhancing biometrical cue during identification scenarios in dynamic visual environments.

  16. Evolution of mesh fixation for hernia repair.

    PubMed

    Webb, David; Stoikes, Nathaniel; Voeller, Guy

    2014-11-01

    Hernia repair remains one of the most common surgical procedures performed around the world. Over the past several decades, in response to various mesh-related complications and coinciding with the influx of laparoscopy into the field of general surgery, numerous advancements have been made in regards to the technology of mesh products being used in hernia repair today. Along these same lines, devices used for mesh fixation have evolved at a similar pace. The goal of this chapter is to review the various materials and methods of mesh fixation being utilized in both ventral and inguinal hernia repair today. PMID:25398127

  17. Investigation of the medical applications of the unique biocarbons developed by NASA. [compatibility of percutaneous prosthetic carbon devices

    NASA Technical Reports Server (NTRS)

    Mooney, V.

    1973-01-01

    The biocompatibility of percutaneous endoskeletal fixation devices made from carbon compounds, and their applications are considered. The clinical application of these carbons to solve human problems is demonstrated and the nature of myoelectric simulation by carbon implants is studied.

  18. New insights in the use of carbon isotopes as tracers of DOC sources and water pathways in headwater catchments

    NASA Astrophysics Data System (ADS)

    Lambert, Thibault; Pierson-Wickmann, Anne-Catherine; Gruau, Gérard; Petitjean, Patrice; Thibault, Jean-Noël; Jeanneau, Laurent

    2013-04-01

    Despite the significant importance of dissolved organic carbon (DOC) in aquatics ecosystems, the processes controlling DOC delivery to stream waters at the catchment scale are still poorly understood, in particular with regards to the relative importance of riparian versus upland soils as DOC sources. In this respect, the stable carbon isotopic composition of DOC (?13CDOC) appears to be a promising tool as different ?13CDOC values are anticipated between wetland and upland soil DOC, because of differences in soil oxygenation, soil humidity and soil organic matter degradation scheme However, care must be exercised because of the possible occurrence of seasonal variations in the ?13CDOC values of both riparian and upland DOC , and because also of the possible mixing of DOC coming from spatially distinct sources. The markedly different isotopic patterns obtained during high resolution monitoring ( 2 ? units), while others showed no, or much more restricted isotopic variations. A comparison of these results with previously published data revealed that this temporal variability of intra-storm ?13CDOC values is the exact transposition of the temporal variability of ?13CDOC values that was found in the riparian soil waters of this catchment during the same period. The latter variability has been shown to arise from the combined effect of changes in the production mechanisms and ultimate sources of riparian DOC and of the lateral input in the riparian domains of an isotopically heavier DOC component coming from more upland areas. Overall, results from this study confirm that upland domains may be significant contributors of stream DOC flux in headwater catchments. They also show that upland soils behave as a size-limited reservoir with respect to DOC production, whereas more highly productive soils in the wetland domains act as a near-infinite reservoir. Through this study, we show that the isotopic composition of DOC is an extremely powerful tool for tracing DOC sources and DOC transport mechanisms in headwater catchments, demonstrating in the meantime that the use of this tool requires that the temporal and spatial variability of the isotopic signatures of all potential DOC sources in the catchment is known accurately. Providing that this condition is fulfilled, the isotopic tool can allow up to quantify the proportions of DOC - and of corresponding water flows - coming from different contributing areas which may be of great importance for better understanding and better modeling of DOC transfer and water routing through the landscape.

  19. DOC sources and DOC transport pathways in a small headwater catchment as revealed by carbon isotope fluctuation during storm events

    NASA Astrophysics Data System (ADS)

    Lambert, T.; Pierson-Wickmann, A.-C.; Gruau, G.; Jaffrezic, A.; Petitjean, P.; Thibault, J. N.; Jeanneau, L.

    2014-06-01

    Monitoring the isotopic composition (?13CDOC) of dissolved organic carbon (DOC) during flood events can be helpful for locating DOC sources in catchments and quantifying their relative contribution to stream DOC flux. High-resolution (< hourly basis) ?13CDOC data were obtained during six successive storm events occurring during the high-flow period in a small headwater catchment in western France. Intra-storm ?13CDOC values exhibit a marked temporal variability, with some storms showing large variations (> 2 ‰), and others yielding a very restricted range of values (< 1 ‰). Comparison of these results with previously published data shows that the range of intra-storm ?13CDOC values closely reflects the temporal and spatial variation in ?13CDOC observed in the riparian soils of this catchment during the same period. Using ?13CDOC data in conjunction with hydrometric monitoring and an end-member mixing approach (EMMA), we show that (i) > 80% of the stream DOC flux flows through the most superficial soil horizons of the riparian domain and (ii) the riparian soil DOC flux is comprised of DOC coming ultimately from both riparian and upland domains. Based on its ?13C fingerprint, we find that the upland DOC contribution decreases from ca.~30% of the stream DOC flux at the beginning of the high-flow period to < 10% later in this period. Overall, upland domains contribute significantly to stream DOC export, but act as a size-limited reservoir, whereas soils in the wetland domains act as a near-infinite reservoir. Through this study, we show that ?13CDOC provides a powerful tool for tracing DOC sources and DOC transport mechanisms in headwater catchments, having a high-resolution assessment of temporal and spatial variability.

  20. 21 CFR 888.3020 - Intramedullary fixation rod.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3020 Intramedullary fixation rod. (a) Identification. An intramedullary fixation rod...

  1. 21 CFR 888.3020 - Intramedullary fixation rod.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3020 Intramedullary fixation rod. (a) Identification. An intramedullary fixation rod...

  2. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  3. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  4. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  5. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  6. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  7. RNA Processing and Modification Protein, Carbon Catabolite Repression 4 (Ccr4), Arrests the Cell Cycle through p21-dependent and p53-independent Pathway*

    PubMed Central

    Yi, Xia; Hong, Mei; Gui, Bin; Chen, Zhe; Li, Lei; Xie, Guojia; Liang, Jing; Wang, Xiaocheng; Shang, Yongfeng

    2012-01-01

    Ccr4d is a new member of the Ccr4 (carbon catabolite repression 4) family of proteins that are implicated in the regulation of mRNA stability and translation through mRNA deadenylation. However, Ccr4d is not believed to be involved in mRNA deadenylation. Thus, its biological function and mechanistic activity remain to be determined. Here, we report that Ccr4d is broadly expressed in various normal tissues, and the expression of Ccr4d is markedly down-regulated during cell cycle progression. We showed that Ccr4d inhibits cell proliferation and induces cell cycle arrest at G1 phase. Our experiments further revealed that Ccr4d regulates the expression of p21 in a p53-independent manner. Mechanistic studies indicated that Ccr4d strongly bound to the 3?-UTR of p21 mRNA, leading to the stabilization of p21 mRNA. Interestingly, we found that the expression of Ccr4d is down-regulated in various tumor tissues. Collectively, our data indicate that Ccr4d functions as an anti-proliferating protein through the induction of cell cycle arrest via a p21-dependent and p53-independent pathway and suggest that Ccr4d might have an important role in carcinogenesis. PMID:22547059

  8. The Global Carbon Metabolism Regulator Crc Is a Component of a Signal Transduction Pathway Required for Biofilm Development by Pseudomonas aeruginosa

    PubMed Central

    O'Toole, George A.; Gibbs, Karine A.; Hager, Paul W.; Phibbs, Paul V.; Kolter, Roberto

    2000-01-01

    The transition from a planktonic (free-swimming) existence to growth attached to a surface in a biofilm occurs in response to environmental factors, including the availability of nutrients. We show that the catabolite repression control (Crc) protein, which plays a role in the regulation of carbon metabolism, is necessary for biofilm formation in Pseudomonas aeruginosa. Using phase-contrast microscopy, we found that a crc mutant only makes a dispersed monolayer of cells on a plastic surface but does not develop the dense monolayer punctuated by microcolonies typical of the wild-type strain. This is a phenotype identical to that observed in mutants defective in type IV pilus biogenesis. Consistent with this observation, crc mutants are defective in type IV pilus-mediated twitching motility. We show that this defect in type IV pilus function is due (at least in part) to a decrease in pilA (pilin) transcription. We propose that nutritional cues are integrated by Crc as part of a signal transduction pathway that regulates biofilm development. PMID:10629189

  9. Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change

    PubMed Central

    Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

    2014-01-01

    Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of “new” nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review. PMID:24967086

  10. Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change.

    PubMed

    Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

    2014-05-01

    Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of "new" nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review. PMID:24967086

  11. Skin damage probabilities using fixation materials in high-energy photon beams

    Microsoft Academic Search

    Jesper Carl; Anne Vestergaard

    2000-01-01

    Introduction: Patient fixation, such as thermoplastic masks, carbon-fibre support plates and polystyrene bead vacuum cradles, is used to reproduce patient positioning in radiotherapy. Consequently low-density materials may be introduced in high-energy photon beams. The aim of the this study was to measure the increase in skin dose when low-density materials are present and calculate the radiobiological consequences in terms of

  12. A mechanistic, globally-applicable model of plant nitrogen uptake, retranslocation and fixation

    NASA Astrophysics Data System (ADS)

    Fisher, J. B.; Tan, S.; Malhi, Y.; Fisher, R. A.; Sitch, S.; Huntingford, C.

    2008-12-01

    Nitrogen is one of the nutrients that can most limit plant growth, and nitrogen availability may be a controlling factor on biosphere responses to climate change. We developed a plant nitrogen assimilation model based on a) advective transport through the transpiration stream, b) retranslocation whereby carbon is expended to resorb nitrogen from leaves, c) active uptake whereby carbon is expended to acquire soil nitrogen, and d) biological nitrogen fixation whereby carbon is expended for symbiotic nitrogen fixers. The model relies on 9 inputs: 1) net primary productivity (NPP), 2) plant C:N ratio, 3) available soil nitrogen, 4) root biomass, 5) transpiration rate, 6) saturated soil depth,7) leaf nitrogen before senescence, 8) soil temperature, and 9) ability to fix nitrogen. A carbon cost of retranslocation is estimated based on leaf nitrogen and compared to an active uptake carbon cost based on root biomass and available soil nitrogen; for nitrogen fixers both costs are compared to a carbon cost of fixation dependent on soil temperature. The NPP is then allocated to optimize growth while maintaining the C:N ratio. The model outputs are total plant nitrogen uptake, remaining NPP available for growth, carbon respired to the soil and updated available soil nitrogen content. We test and validate the model (called FUN: Fixation and Uptake of Nitrogen) against data from the UK, Germany and Peru, and run the model under simplified scenarios of primary succession and climate change. FUN is suitable for incorporation into a land surface scheme of a General Circulation Model and will be coupled with a soil model and dynamic global vegetation model as part of a land surface model (JULES).

  13. Radiation characteristics of Botryococcus braunii, Chlorococcum littorale, and Chlorella sp. used for CO 2 fixation and biofuel production

    Microsoft Academic Search

    Halil Berberoglu; Pedro S. Gomez; Laurent Pilon

    2009-01-01

    This paper reports experimental measurements of the radiation characteristics of green algae used for carbon dioxide fixation via photosynthesis. The generated biomass can be used to produce not only biofuels but also feed for animal and food supplements for human consumptions. Particular attention was paid to three widely used species namely Botryococcus braunii, Chlorella sp., and Chlorococcum littorale. Their extinction

  14. Nitrogen fixation and respiration by root nodules of Alnus rubra Bong.: Effects of temperature and oxygen concentration

    Microsoft Academic Search

    Lawrence J. Winship; John D. Tjepkema

    1985-01-01

    Using a root nodule cuvette and a continuous flow gas exchange system, we simultaneously measured the rates of carbon dioxide evolution, oxygen uptake and acetylene reduction by nodules ofAlnus rubra. This system allowed us to measure the respiration rates of single nodules and to determine the effects of oxygen concentration and temperature on the energy cost of nitrogen fixation. Energy

  15. Carbon Monoxide Abrogates Ischemic Insult to Neuronal Cells via the Soluble Guanylate Cyclase-cGMP Pathway

    PubMed Central

    Schallner, Nils; Romão, Carlos C.; Biermann, Julia; Lagrèze, Wolf A.; Otterbein, Leo E.; Buerkle, Hartmut; Loop, Torsten; Goebel, Ulrich

    2013-01-01

    Purpose Carbon monoxide (CO) is an accepted cytoprotective molecule. The extent and mechanisms of protection in neuronal systems have not been well studied. We hypothesized that delivery of CO via a novel releasing molecule (CORM) would impart neuroprotection in vivo against ischemia-reperfusion injury (IRI)-induced apoptosis of retinal ganglion cells (RGC) and in vitro of neuronal SH-SY5Y-cells via activation of soluble guanylate-cyclase (sGC). Methods To mimic ischemic respiratory arrest, SH-SY5Y-cells were incubated with rotenone (100 nmol/L, 4 h) ± CORM ALF186 (10–100 µmol/L) or inactivated ALF186 lacking the potential of releasing CO. Apoptosis and reactive oxygen species (ROS) production were analyzed using flow-cytometry (Annexin V, mitochondrial membrane potential, CM-H2DCFDA) and Western blot (Caspase-3). The impact of ALF186± respiratory arrest on cell signaling was assessed by measuring expression of nitric oxide synthase (NOS) and soluble guanylate-cyclase (sGC) and by analyzing cellular cGMP levels. The effect of ALF186 (10 mg/kg iv) on retinal IRI in Sprague-Dawley rats was assessed by measuring densities of fluorogold-labeled RGC after IRI and by analysis of apoptosis-related genes in retinal tissue. Results ALF186 but not inactivated ALF186 inhibited rotenone-induced apoptosis (Annexin V positive cells: 25±2% rotenone vs. 14±1% ALF186+rotenone, p<0.001; relative mitochondrial membrane potential: 17±4% rotenone vs. 55±3% ALF186+rotenone, p<0.05). ALF186 increased cellular cGMP levels (33±5 nmol/L vs. 23±3 nmol/L; p<0.05) and sGC expression. sGC-inhibition attenuated ALF186-mediated protection (relative mitochondrial membrane potential: 55±3% ALF186+rotenone vs. 20±1% ODQ+ALF186+rotenone, p<0.05). ALF186 protected RGC in vivo (IRI 1255±327 RGC/mm2 vs. ALF186+IRI 2036±83; p<0.05) while sGC inhibition abolished the protective effects of ALF186 (ALF186+IRI 2036±83 RGC/mm2 vs. NS-2028+ALF186+IRI 1263±170, p<0.05). Conclusions The CORM ALF186 inhibits IRI-induced neuronal cell death via activation of sGC and may be a useful treatment option for acute ischemic insults to the retina and the brain. PMID:23593279

  16. Water flow pathway and the organic carbon discharge during rain storm events in a coniferous forested head watershed, Tokyo, central Japan

    NASA Astrophysics Data System (ADS)

    Moriizumi, Mihoko; Terajima, Tomomi

    2010-05-01

    The current intense discussion of the green house effect, that has been one of the main focuses on the carbon cycle in environmental systems of the earth, seems to be weakened the importance related to the effect of carbonic materials on substance movement in the aquatic environments; though it has just begun to be referred recently. Because dissolved organic carbon (DOC) in stream flows believes to play a main role of the carbon cycle in the fresh water environment, seasonal changes in DOC discharge were investigated in catchments with various scale and land use, especially in forested catchments which are one of the important sources of DOC. In order to understand the fundamental characteristics of the discharge of dissolved organic materials, stream flows, DOC, and fulvic acid like materials (FA) included in stream flows were measured in a coniferous forested head watershed. The watershed is located at the southeast edge of the Kanto mountain and is 40 km west of Tokyo with the elevation from 720 to 820 m and mean slope gradient of 38 degrees. Geology of the watershed is underlain by the sequence of mud and sand stones in Jurassic and the soil in the watershed is Cambisol (Inceptisols). The watershed composes of a dense cypress and cedar forest of 45 years old with poor understory vegetation. Observations were carried out for 6 rain storms of which the total precipitations ranged between 16.2 and 117.4 mm. The magnitude of the storms was classified into small, middle, and big events on the basis of the total precipitation of around 20, 40, and more than 70 mm. Stream flows were collected during the storm events by 1 hour interval and were passed through the 0.45 ?m filters, and then the DOC concentrations in the flows were measured with a total organic carbon analyzer. The relative concentrations of fulvic acid (FA) in the flows were monitored with three dimensional excitations emission matrix fluorescence spectroscopy, because fulvic acid shows distinctive fluorescence peaks at around the excitation wave length of 340 nm and emission wave length of 440 nm. The timing of the peaks in DOC and FA occurred simultaneously or within 30 minutes prior to those in the stream flows. The relationship between DOC and stream flow showed linear correlations with various gradients in each event. However, the relationship between FA and stream flow showed the linear correlations only for the small and middle events and clockwise hysteresis relations occurred in the big storm events. The relationship between DOC and FA showed the linear correlations both for the extracted water of the shallow soil and for stream base flow composed mostly of groundwater discharge. However, the relationship in the storm flow closely distributed at that in the extracted water of the shallow soil. This thing reveals that DOC and FA were mainly flashed out from the shallow soil during the rain storm events. The quick rising and recession of the fulvic acid was likely provided by quick rain water discharge through the surface or near surface of the slope. However, the overland flow were rare in the watershed during the rain storms. This indicates that the rapid shallow subsurface flow, passed mainly through preferential flow pathways at the slope surface within the loose litter and root-permeated zone, was the main cause of the difference in discharge regimes between DOC and FA. The shallow subsurface flow may have flushed the FA in the near-surface of the soil, and then the relatively predominant discharge of DOC must have been caused during the big rain storm event.

  17. Unfixing Design Fixation: From Cause to Computer Simulation

    ERIC Educational Resources Information Center

    Dong, Andy; Sarkar, Somwrita

    2011-01-01

    This paper argues that design fixation, in part, entails fixation at the level of meta-representation, the representation of the relation between a representation and its reference. In this paper, we present a mathematical model that mimics the idea of how fixation can occur at the meta-representation level. In this model, new abstract concepts…

  18. FLOODING STRESS Dinitrogen Fixation by Winter Chickpea Across Scales in

    E-print Network

    van Kessel, Chris

    FLOODING STRESS Dinitrogen Fixation by Winter Chickpea Across Scales in Waterlogged Soil a single tillage management system, however, considerable variation in N2 fixation by Keywords chickpea fixation by rain-fed chickpea (Cicer arietinum L.) at the field- and micro-scales (0.15 m spacing) after

  19. Nitrogen control of nitrogen fixation in free-living diazotrophs

    E-print Network

    Merrick, Mike

    Chapter 9 Nitrogen control of nitrogen fixation in free-living diazotrophs M. J. MERRICK Department of nitrogen fixation is found distributed amongst a taxonomically very diverse range of microorganisms the efficiency of nitrogen fixation some common themes are now becoming clear. The physiological issues

  20. Molecular Basis of Microbial One-Carbon Metabolism 2008 Gordon Research Conference (July 20-25, 2008)

    SciTech Connect

    Stephen W. Ragsdale

    2009-08-12

    One-carbon (C-1) compounds play a central role in microbial metabolism. C-1 compounds include methane, carbon monoxide, CO2, and methanol as well as coenzyme-bound one-carbon compounds (methyl-B12, CH3-H4folate, etc). Such compounds are of broad global importance because several C-1 compounds (e.g., CH4) are important energy sources, some (e.g., CO2 and CH4) are potent greenhouse gases, and others (e.g., CH2Cl2) are xenobiotics. They are central in pathways of energy metabolism and carbon fixation by microbes and many are of industrial interest. Research on the pathways of one-carbon metabolism has added greatly to our understanding of evolution, structural biology, enzyme mechanisms, gene regulation, ecology, and applied biology. The 2008 meeting will include recent important findings in the following areas: (a) genomics, metagenomics, and proteomic studies that have expanded our understanding of autotrophy and C-1 metabolism and the evolution of these pathways; (b) redox regulation of carbon cycles and the interrelationship between the carbon cycle and other biogeochemical cycles (sulfur, nitrogen, oxygen); (c) novel pathways for carbon assimilation; (d) biotechnology related to C-1 metabolism; (e) novel enzyme mechanisms including channeling of C-1 intermediates during metabolism; and (f) the relationship between metal homeostasis and the global carbon cycle. The conference has a diverse and gender-balanced slate of speakers and session leaders. The wide variety of disciplines brought to the study of C-1 metabolism make the field an excellent one in which to train young researchers.

  1. Large D/H variations in bacterial lipids reflect central metabolic pathways

    PubMed Central

    Zhang, Xinning; Gillespie, Aimee L.; Sessions, Alex L.

    2009-01-01

    Large hydrogen-isotopic (D/H) fractionations between lipids and growth water have been observed in most organisms studied to date. These fractionations are generally attributed to isotope effects in the biosynthesis of lipids, and are frequently assumed to be approximately constant for the purpose of reconstructing climatic variables. Here, we report D/H fractionations between lipids and water in 4 cultured members of the phylum Proteobacteria, and show that they can vary by up to 500‰ in a single organism. The variation cannot be attributed to lipid biosynthesis as there is no significant change in these pathways between cultures, nor can it be attributed to changing substrate D/H ratios. More importantly, lipid/water D/H fractionations vary systematically with metabolism: chemoautotrophic growth (approximately ?200 to ?400‰), photoautotrophic growth (?150 to ?250‰), heterotrophic growth on sugars (0 to ?150‰), and heterotrophic growth on TCA-cycle precursors and intermediates (?50 to +200‰) all yield different fractionations. We hypothesize that the D/H ratios of lipids are controlled largely by those of NADPH used for biosynthesis, rather than by isotope effects within the lipid biosynthetic pathway itself. Our results suggest that different central metabolic pathways yield NADPH—and indirectly lipids—with characteristic isotopic compositions. If so, lipid ?D values could become an important biogeochemical tool for linking lipids to energy metabolism, and would yield information that is highly complementary to that provided by 13C about pathways of carbon fixation. PMID:19617564

  2. Nitrogen fixation : the microbial world the nitrogen cycle and nitrogen fixation

    NSDL National Science Digital Library

    Jim Deacon

    2007-01-01

    A nicely organized, reader friendly webpage. Provides a table of natural and synthetic nitrogen fixation processes. Includes photographs of plants, roots and nitrogen fixing bacteria nodules. A graphic representation of the nitrogen cycle is included.

  3. Biological nitrogen fixation in Louisiana sugarcane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nitrogen (N) is a major input for sugarcane with crops in Louisiana receiving between 90 and 180 kg/ha with the cost of N increasing 75% in the last decade. Biological N fixation (BNF) may be a viable alternative to fertilizer N. The process relies on endophytic bacteria (bacteria that live among th...

  4. Hydroxyapatite Coating Of Threaded Pins Enhances Fixation

    Microsoft Academic Search

    G. Magyar; S. Toksvig-Larsen; A. Moroni

    1997-01-01

    We measured the insertion and extraction torque forces in a randomised study of 76 external fixation screws in 19 patients treated by hemicallotasis for osteoarthritis of the medial side of the knee. The patients were randomised to have either standard tapered screws (Orthofix 6\\/5 mm) or the same screws with hydroxyapatite (HA) coating. One patient had two standard and two

  5. Cochlear implant fixation using resorbable mesh.

    PubMed

    Lundy, Larry; Karatayli-Ozgursoy, Selmin

    2011-07-01

    In this article we describe a new method of cochlear implant receiver-stimulator fixation using a resorbable poly (D,L) lactic acid mesh. We conducted a retrospective case review at a tertiary referral center; 10 pediatric and 4 adult patients had undergone cochlear implantation during the period from February to October 2008. Resorbable poly (D,L) lactic acid mesh and pins were used for fixation of the cochlear implant receiver stimulator. The receiver stimulator was assessed for stability/migration, and the scalp flap/incision were evaluated for allergic reactions, infections, and healing problems. With an average follow-up of 17.2 months, no patients had migration of the receiver stimulator, and there was no evidence of infection, wound dehiscence, or allergic reaction. Early results indicate that fixation of a cochlear implant receiver stimulator using resorbable mesh is well tolerated and provides good stability without device migration. Resorbable mesh fixation of the receiver stimulator is a reasonable alternative technique for cochlear implantation. PMID:21792798

  6. WHITE LUPIN NITROGEN FIXATION UNDER PHOSPHORUS DEFICIENCY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White lupin is highly adapted to growth in a low P environment. The objective of the present study was to evaluate whether white lupin grown under P-stress has adaptations in nodulation and N2 fixation that facilitate continued functioning. Nodulated plants were grown in silica sand supplied with N-...

  7. Lateral mass screw fixation in children

    PubMed Central

    Proctor, Mark; Hresko, Timothy

    2010-01-01

    Purpose The safety and feasibility of posterior screw fixation of the cervical spine in children has not been well documented in the orthopedic literature. We performed a retrospective review of our experience using posterior cervical screw fixation in children. Methods The medical records and radiologic records of 36 children at a mean age of 10 years (range 3–16 years) were reviewed. Diagnoses included: ten instability, 11 deformity, seven trauma, five tumor, and three congenital abnormalities. Operative reports and postoperative computed tomography (CT) scans were reviewed to determine the technical feasibility of screw placement, any screw-related complications, and to assess for correct screw position. In this series, there were no neurologic complications, no vertebral artery injuries, and no screw-related complications. Results Thirty patients (141 screws) had screws evaluated postoperatively and were shown to be completely contained on postoperative CT scans. There were no revisions due to screw failure or dislodgement. There were no vascular or neurologic complications. Conclusions Posterior screw fixation in the pediatric population may be done safely and greatly enhances fixation strength for a variety of disorders requiring instrumentation and fusion. PMID:21629379

  8. Tacks: a new technique for craniofacial fixation.

    PubMed

    Cohen, S R; Holmes, R E; Amis, P; Fitchner, H; Shusterman, E M

    2001-11-01

    Biodegradable fixation in craniofacial surgery provides secure fixation while eliminating much of the concern over intracranial migration of metallic plates and screws. One limitation of present biodegradable systems, however, is the need for tapping the drill hole before screw insertion. Herein, a new method of rigid, biodegradable fixation with tacks (Macrapore, Inc., San Diego, CA) is described. The tacks are made of a 70:30 ratio of the L and DL form of polylactic acid (L,DL-PLA). Degradation times range from 18 to 36 months. Newer prototypes are nearly developed for more rapid dissolution times. From April 1999 to February 2000, tack fixation has been applied in 100 patients (51 males, 49 females aged 3 months to 61 years). Indications for operation were craniosynostosis (n = 33); craniofacial trauma or post-traumatic deformities (n = 11); cleft lip and palate (n = 13); craniofacial syndromes (n = 18); other diagnoses (n = 11). Patients underwent fronto-orbital advancement with cranial reshaping; monobloc osteotomy, open reduction-internal fixation of fractures; hypertelorbitism repair; cranioplasty; stabilization of grafts; major cranial reconstruction; zygomatic advancement; alveolar cleft repair; and iliac bone graft donor site protection. Tacks were also used for temporalis muscle and lateral canthal suspension. Follow-up ranged from 16 to 28 months. Complications occurred in 7 patients, 4 of whom had infections and during debridement had biodegradable implants removed. None of the complications appeared to be related to the use of tacks. The tacks are carried in a specially designed holder and may be placed by hand or with the light tap of a mallet on the tack driver. An automatic driver has been developed. Overall, the performance of the tacks has been excellent. They are easily handled by the nursing personnel and rapidly inserted by the surgeon. Stability appears to be excellent. At this time, it is probably preferable to employ tap and screws for orthognathic surgery or other osteotomies with substantial load bearing. PMID:11711829

  9. MECHANICAL ADVANTAGES OF A TRUSS-STRUCTURE-BASED FRACTURE FIXATION SYSTEM – A NOVEL FRACTURE FIXATION DEVICE "PINFIX" –

    PubMed Central

    ARAI, TETSUYA; YAMAMOTO, MICHIRO; IWATSUKI, KATSUYUKI; NATSUME, TADAHIRO; SHINOHARA, TAKAAKI; TATEBE, MASAHIRO; KURIMOTO, SHIGERU; OTA, HIDEYUKI; KATO, SHUICHI; HIRATA, HITOSHI

    2013-01-01

    ABSTRACT A small, light, ball-joint device called PinFix, which can instantly convert a simple percutaneous cross pin fracture fixation system into a rigid external fracture fixation system based on truss structure, was developed. The purpose of this study was to compare the mechanical load and breaking strength of this truss-structure-based fixation system to that of the conventionally used external cantilever structure-based fixation system. Three types of mechanical loading tests, axial, bending, and torsion, were performed on an artificial fractured bone treated with either three-dimensional PinFix fixation, two-dimensional PinFix fixation, or conventional external fixation. The three- and two-dimensional PinFix fixations showed significantly more stiffness than conventional fixation on all three loading tests. Finite element analysis was next performed to calculate the stress distribution of the parts in PinFix and in the conventional fixator. The applied stress to the rod and connectors of PinFix was much less than that of the conventional external fixator. These results reflected the physical characteristic of truss structure in which applied load is converted to pure tension or compression forces along the members of the PinFix. In conclusion, PinFix is a simple fracture fixation system that has a truss-structure with a high rigidity. PMID:24640174

  10. Renewable Hydrogen Carrier Carbohydrate: Constructing the Carbon-Neutral Carbohydrate Economy

    SciTech Connect

    Zhang, Y.-H. Percival [Virginia Polytechnic Institute and State University (Virginia Tech); Mielenz, Jonathan R [ORNL

    2011-01-01

    Abstract The hydrogen economy presents an appealing energy future but its implementation must solve numerous problems ranging from low-cost sustainable production, high-density storage, costly infrastructure, to eliminating safety concern. The use of renewable carbohydrate as a high-density hydrogen carrier and energy source for hydrogen production is possible due to emerging cell-free synthetic biology technology called cell-free synthetic pathway biotransformation (SyPaB). Assembly of numerous enzymes and co-enzymes in vitro can create complicated set of biological reactions or pathways that microorganisms cannot complete, for example, C6H10O5 (aq) + 7 H2O (l) 12 H2 (g) + 6 CO2 (g) (PLoS One 2007, 2:e456). Thanks to 100% selectivity of enzymes, modest reaction conditions, and high-purity of generated hydrogen, carbohydrate is a promising hydrogen carrier for end users. Gravimetric density of carbohydrate is 14.8 H2 mass% if water can be recycled from PEM fuel cells or 8.33% H2 mass% without water recycling. Renewable carbohydrate can be isolated from plant biomass or would be produced from a combination of solar electricity/hydrogen and carbon dioxide fixation mediated by high-efficiency artificial photosynthesis mediated by SyPaB. The construction of this carbon-neutral carbohydrate economy would address numerous sustainability challenges, such as electricity and hydrogen storage, CO2 fixation and long-term storage, water conservation, transportation fuel production, plus feed and food production.

  11. Molecular basis of a microbe-mediated enhancement of symbiotic N/sub 2/-fixation. [Rhizobium meliloti; Pseudomonas syringae pv. tabaci

    SciTech Connect

    Unkefer, P.J.; Knight, T.J.

    1987-04-01

    Improvement of biological nitrogen fixation represents a potential source of both increased food production and decreased dependence on costly chemical fertilizer. They report the results of an investigation of the molecular basis of a unique, microbial-mediated mechanism for increased growth and nitrogen fixation rates in alfalfa. Inoculation of alfalfa plants with both Rhizobium meliloti and Pseudomonas syringae pv tabaci provides increased growth and N/sub 2/-fixation rates of alfalfa. Tabaci produces tabtoxinine-..beta..-lactam (T..beta..L), an exocellular product and glutamine synthetase (GS) inhibitor. The association of this pathogen with nodulating alfalfa plants appears to alter the normal regulation of nitrogen fixation such that nitrogenase activity is stimulated and GS activity is inhibited. Studies of the soluble amino acids in these nodules and the activities of the ammonia assimilatory enzymes indicate alternative pathways of ammonia assimilation are being employed.

  12. ORV Arthroscopic Reduction and Internal Fixation of Tibial Eminence Fractures

    PubMed Central

    Myer, Daniel M.; Purnell, Gregory J.; Caldwell, Paul E.; Pearson, Sara E.

    2013-01-01

    Tibial eminence fractures are an uncommon but well-described avulsion of the anterior cruciate ligament. Treatment principles are based on the amount and pattern of fracture displacement. Management has evolved from closed reduction and immobilization to arthroscopic reduction and internal fixation followed by early rehabilitation. Various fixation methods have evolved, ranging from arthroscopic reduction and percutaneous screw fixation to arthroscopic suture repair. We present a technique for arthroscopic reduction and internal fixation using a cannulated drill bit and high-strength suture. This technique facilitates anatomic reduction with uncomplicated tunnel placement and suture passing in an effort to allow strong fixation and early rehabilitation. PMID:24400179

  13. Microarray and bioinformatic analyses suggest models for carbon metabolism in the autotroph Acidithiobacillus ferrooxidans

    SciTech Connect

    C. Appia-ayme; R. Quatrini; Y. Denis; F. Denizot; S. Silver; F. Roberto; F. Veloso; J. Valdes; J. P. Cardenas; M. Esparza; O. Orellana; E. Jedlicki; V. Bonnefoy; D. Holmes

    2006-09-01

    Acidithiobacillus ferrooxidans is a chemolithoautotrophic bacterium that uses iron or sulfur as an energy and electron source. Bioinformatic analysis was used to identify putative genes and potential metabolic pathways involved in CO2 fixation, 2P-glycolate detoxification, carboxysome formation and glycogen utilization in At. ferrooxidans. Microarray transcript profiling was carried out to compare the relative expression of the predicted genes of these pathways when the microorganism was grown in the presence of iron versus sulfur. Several gene expression patterns were confirmed by real-time PCR. Genes for each of the above predicted pathways were found to be organized into discrete clusters. Clusters exhibited differential gene expression depending on the presence of iron or sulfur in the medium. Concordance of gene expression within each cluster, suggested that they are operons Most notably, clusters of genes predicted to be involved in CO2 fixation, carboxysome formation, 2P-glycolate detoxification and glycogen biosynthesis were up-regulated in sulfur medium, whereas genes involved in glycogen utilization were preferentially expressed in iron medium. These results can be explained in terms of models of gene regulation that suggest how A. ferrooxidans can adjust its central carbon management to respond to changing environmental conditions.

  14. Heterogeneous electro-Fenton using modified iron-carbon as catalyst for 2,4-dichlorophenol degradation: Influence factors, mechanism and degradation pathway.

    PubMed

    Zhang, Chao; Zhou, Minghua; Ren, Gengbo; Yu, Xinmin; Ma, Liang; Yang, Jie; Yu, Fangke

    2015-03-01

    Modified iron-carbon with polytetra?uoroethylene (PTFE) was firstly investigated as heterogeneous electro-Fenton (EF) catalyst for 2,4-dichlorophenol (2,4-DCP) degradation in near neutral pH condition. The catalyst was characterized by scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS) and X-ray diffraction (XRD), and the effects of some important operating parameters such as current intensity and pH on the 2,4-DCP degradation were investigated. After the catalyst modification with 20% PTFE, the degradation performance maintained well with much lower iron leaching, and at current intensity 100 mA, initial pH 6.7, catalyst loading 6 g/L, the degradation efficiency of 2,4-DCP could exceed 95% within 120 min treatment. Two-stage pseudo first-order kinetics of 2,4-DCP degradation was observed, including a slow anodic oxidation stage (first-stage) and much faster heterogeneous EF oxidation (second-stage), in which the automatic drop of pH in the first-stage initiated the Fe(2+) release from micro-electrolysis and thus benefited to the subsequent EF reaction. Aromatic intermediates such as 3,5-dichlorocatechol, 4,6-dichlororesorcinol and 2-chlorohydroquinone were detected by GC-MS. Oxalic acid, acetic acid, formic acid and Cl(-) were quanti?ed by ion chromatograph. Based on these analysis as well as the detection of H2O2 and OH, a possible mechanism and degradation pathway for 2,4-DCP were proposed. This work demonstrated that such a heterogeneous EF using cheap modified Fe-C catalyst was promising for organic wastewater treatment in initial neutral pH condition. PMID:25559487

  15. Southwick Osteotomy Stabilised with External Fixator

    PubMed Central

    Grubor, Predrag; Mitkovic, Milorad; Grubor, Milan

    2014-01-01

    ABSTRACT Introduction: Epiphysiolysis of the femoral head is the most common accident occurring towards the end of pre-puberty and puberty growth. Case report: The author describes the experience in the treatment of chronic epiphysiolysis in two patients treated by Southwick osteotomy. The site is accessed by way of a 15-cm long lateral skin incision and the trochanteric region is reached through the layers. The osteotomy angles prepared beforehand on a thin aluminium model are used to mark the Southwick osteotomy site on the anterior and lateral sides at the level of the lesser trochanter. Before performing the trochanteric osteotomy, two Mitkovi? convergent pins type M20 are applied distally and proximally, above the planned osteotomy site. A tenotomy of the iliopsas muscle is performed, and then the previously marked bone triangle is redissected up to three quarters of the width of the femur. The distal part of the femur is rotated inwards, so that the patella is turned towards the ceiling. The osteotomised fragments of the femur are adapted, repositioned and fixated by installing an external fixator on the previously placed pins. Two more pins are placed, one proximally and one distally, with a view to adequately stabilising the femur. The patient was mobile from day two after the surgery. If, after the surgery, the lead surgeon realises that there is a requirement to make a correction of 5, 10 and 15 degrees of the valgus, varus, anteversion or retroversion deformity, the correction shall be performed without surgically opening the patient, using the fixator pins. Conclusion: After performing a Southwick osteotomy it is easier to adapt, reposition and fixate the osteotomised fragments of the femur using a fixator type M20. Adequate stability allows regaining mobility quickly, which in turn is the best prevention of chondrolysis of the hip. It is possible to make post-operative valgus, varus, anteversion and retroversion corrections of 5, 10 and 15 degrees without performing a surgery. Once the osteotomy is healed, the fixator type M20 is removed without any additional surgery. PMID:25568571

  16. Influence of light, temperature and salinity on dissolved organic carbon exudation rates in Zostera marina L.

    EPA Science Inventory

    Seagrass carbon budgets provide valuable insight on the minimum requirements needed to maintain this valuable resource. Carbon budgets are a balance between C fixation, storage and loss rates, most of which are well characterized. However, relatively few measurements of dissolv...

  17. Nitrogen fixation in distinct microbial niches within a chemoautotrophy-driven cave ecosystem.

    PubMed

    Desai, Mahesh S; Assig, Karoline; Dattagupta, Sharmishtha

    2013-12-01

    Microbial sulfur and carbon cycles in ecosystems driven by chemoautotrophy-present at deep-sea hydrothermal vents, cold seeps and sulfidic caves-have been studied to some extent, yet little is known about nitrogen fixation in these systems. Using a comprehensive approach comprising of (15)N2 isotope labeling, acetylene reduction assay and nitrogenase gene expression analyses, we investigated nitrogen fixation in the sulfide-rich, chemoautotrophy-based Frasassi cave ecosystem (Italy). Nitrogen fixation was examined in three different microbial niches within the cave waters: (1) symbiotic bacterial community of Niphargus amphipods, (2) Beggiatoa-dominated biofilms, which occur at the sulfide-oxygen interface, and (3) sulfidic sediment. We found evidence for nitrogen fixation in all the three niches, and the nitrogenase gene (homologs of nifH) expression data clearly show niche differentiation of diazotrophic Proteobacteria within the water streams. The nifH transcript originated from the symbiotic community of Niphargus amphipods might belong to the Thiothrix ectosymbionts. Two abundantly expressed nifH genes in the Beggiatoa-dominated biofilms are closely related to those from Beggiatoa- and Desulfovibrio-related bacteria. These two diazotrophs were consistently found in Beggiatoa-dominated biofilms collected at various time points, thus illustrating species-specific associations of the diazotrophs in biofilm formation, and micron-scale niche partitioning of sulfur-oxidizing and sulfate-reducing bacteria driven by steep redox gradients within the biofilm. Finally, putative heterotrophs (Geobacter, Azoarcus and Desulfovibrio related) were the active diazotrophs in the sulfidic sediment. Our study is the first to shed light on nitrogen fixation in permanently dark caves and suggests that diazotrophy may be widespread in chemosynthetic communities. PMID:23924780

  18. Nitrogen fixation in distinct microbial niches within a chemoautotrophy-driven cave ecosystem

    PubMed Central

    Desai, Mahesh S; Assig, Karoline; Dattagupta, Sharmishtha

    2013-01-01

    Microbial sulfur and carbon cycles in ecosystems driven by chemoautotrophy—present at deep-sea hydrothermal vents, cold seeps and sulfidic caves—have been studied to some extent, yet little is known about nitrogen fixation in these systems. Using a comprehensive approach comprising of 15N2 isotope labeling, acetylene reduction assay and nitrogenase gene expression analyses, we investigated nitrogen fixation in the sulfide-rich, chemoautotrophy-based Frasassi cave ecosystem (Italy). Nitrogen fixation was examined in three different microbial niches within the cave waters: (1) symbiotic bacterial community of Niphargus amphipods, (2) Beggiatoa-dominated biofilms, which occur at the sulfide–oxygen interface, and (3) sulfidic sediment. We found evidence for nitrogen fixation in all the three niches, and the nitrogenase gene (homologs of nifH) expression data clearly show niche differentiation of diazotrophic Proteobacteria within the water streams. The nifH transcript originated from the symbiotic community of Niphargus amphipods might belong to the Thiothrix ectosymbionts. Two abundantly expressed nifH genes in the Beggiatoa-dominated biofilms are closely related to those from Beggiatoa- and Desulfovibrio-related bacteria. These two diazotrophs were consistently found in Beggiatoa-dominated biofilms collected at various time points, thus illustrating species-specific associations of the diazotrophs in biofilm formation, and micron-scale niche partitioning of sulfur-oxidizing and sulfate-reducing bacteria driven by steep redox gradients within the biofilm. Finally, putative heterotrophs (Geobacter, Azoarcus and Desulfovibrio related) were the active diazotrophs in the sulfidic sediment. Our study is the first to shed light on nitrogen fixation in permanently dark caves and suggests that diazotrophy may be widespread in chemosynthetic communities. PMID:23924780

  19. Nitrogen fixation in endophytic and associative symbiosis

    Microsoft Academic Search

    E. K. James

    2000-01-01

    N-balance, 15N isotope dilution and 15N natural abundance studies provide strong evidence that some tropical grasses, especially sugar cane (Saccharum spp.), wetland rice (Oryza sativa) and kallar grass (Leptochloa fusca) can obtain at least part of their N-needs from biological nitrogen (N2) fixation. However, these studies have not provided conclusive evidence that these plants are engaged in symbiotic partnerships with

  20. Aramid-epoxy composite internal fixation plates: a pilot study.

    PubMed

    Cochran, G V; Palmieri, V R; Zickel, R E

    1994-09-01

    Mechanical tests were conducted on an aramid-epoxy composite laminate in vitro and in vivo to determine its suitability for internal fixation plates. This material, fashioned into blank test coupons the size of the standard 4-hole AO-ASIF plates, had a tensile modulus of elasticity significantly lower than bone. In three-point bending, blank test coupons exhibited a low yield strength that would limit utility in significant load-bearing situations, but changes in the layer configuration of the composite could be expected to improve this characteristic. Under destructive loads, these specimens appeared to be less subject to catastrophic failure than carbon fibre composites. Using 4-hole test coupons fastened to a plastic tube simulating bone, four-point bending tests showed that strain-shielding was significantly reduced by aramid composite relative to carbon fibre composite or metal plates. Finally, in-vivo tests on canine femora demonstrated that aramid composite plates were well tolerated and caused less strain shielding during weightbearing, but significant differences in cortical atrophy and porosity beneath steel versus aramid plates were not apparent. Although the plates were relatively flexible, they could not be preformed during surgery like a metal plate. PMID:23916301

  1. Elevated temperature alters carbon cycling in a model microbial community

    NASA Astrophysics Data System (ADS)

    Mosier, A.; Li, Z.; Thomas, B. C.; Hettich, R. L.; Pan, C.; Banfield, J. F.

    2013-12-01

    Earth's climate is regulated by biogeochemical carbon exchanges between the land, oceans and atmosphere that are chiefly driven by microorganisms. Microbial communities are therefore indispensible to the study of carbon cycling and its impacts on the global climate system. In spite of the critical role of microbial communities in carbon cycling processes, microbial activity is currently minimally represented or altogether absent from most Earth System Models. Method development and hypothesis-driven experimentation on tractable model ecosystems of reduced complexity, as presented here, are essential for building molecularly resolved, benchmarked carbon-climate models. Here, we use chemoautotropic acid mine drainage biofilms as a model community to determine how elevated temperature, a key parameter of global climate change, regulates the flow of carbon through microbial-based ecosystems. This study represents the first community proteomics analysis using tandem mass tags (TMT), which enable accurate, precise, and reproducible quantification of proteins. We compare protein expression levels of biofilms growing over a narrow temperature range expected to occur with predicted climate changes. We show that elevated temperature leads to up-regulation of proteins involved in amino acid metabolism and protein modification, and down-regulation of proteins involved in growth and reproduction. Closely related bacterial genotypes differ in their response to temperature: Elevated temperature represses carbon fixation by two Leptospirillum genotypes, whereas carbon fixation is significantly up-regulated at higher temperature by a third closely related genotypic group. Leptospirillum group III bacteria are more susceptible to viral stress at elevated temperature, which may lead to greater carbon turnover in the microbial food web through the release of viral lysate. Overall, this proteogenomics approach revealed the effects of climate change on carbon cycling pathways and other microbial activities. When scaled to more complex ecosystems and integrated into Earth System Models, this approach could significantly improve predictions of global carbon-climate feedbacks. Experiments such as these are a critical first step designed at understanding climate change impacts in order to better predict ecosystem adaptations, assess the viability of mitigation strategies, and inform relevant policy decisions.

  2. Robust biological nitrogen fixation in a model grass-bacterial association.

    PubMed

    Pankievicz, Vânia C S; do Amaral, Fernanda P; Santos, Karina F D N; Agtuca, Beverly; Xu, Youwen; Schueller, Michael J; Arisi, Ana Carolina M; Steffens, Maria B R; de Souza, Emanuel M; Pedrosa, Fábio O; Stacey, Gary; Ferrieri, Richard A

    2015-03-01

    Nitrogen-fixing rhizobacteria can promote plant growth; however, it is controversial whether biological nitrogen fixation (BNF) from associative interaction contributes to growth promotion. The roots of Setaria viridis, a model C4 grass, were effectively colonized by bacterial inoculants resulting in a significant enhancement of growth. Nitrogen-13 tracer studies provided direct evidence for tracer uptake by the host plant and incorporation into protein. Indeed, plants showed robust growth under nitrogen-limiting conditions when inoculated with an ammonium-excreting strain of Azospirillum brasilense. (11) C-labeling experiments showed that patterns in central carbon metabolism and resource allocation exhibited by nitrogen-starved plants were largely reversed by bacterial inoculation, such that they resembled plants grown under nitrogen-sufficient conditions. Adoption of S. viridis as a model should promote research into the mechanisms of associative nitrogen fixation with the ultimate goal of greater adoption of BNF for sustainable crop production. PMID:25645593

  3. Carbon Dioxide Fixation by Algal Cultivation Using Wastewater Nutrients

    Microsoft Academic Search

    Sun Bok Lee; Jong Moon Park

    1997-01-01

    Chlorella vulgaris was cultivated in wastewater discharged from a steel- making plant with the aim of developing an economically feasible system to remove ammonia from wastewater and from Ñue gas simultaneously. Since CO 2 no phosphorus compounds existed in wastewater, external phosphate (15É3È 46É 0gm ~3) was added to the wastewater. After adaptation to 5% (v\\/v) the CO 2 ,

  4. Regulation of photosynthetic carbon fixation on the ocean margins

    SciTech Connect

    Paul, J.H.; Tabita, F.R.

    1994-05-03

    The goals of our DOE OMP project are to (1) understand regulation of ribulose bisphosphate carboxylase (RubisCO) in phytoplankton cultures in response to light regime; (2) determine regulation of RubisCO in response to light during nutrient limitation in these cultures; (3) to determine mechanisms of RubisCO regulation in natural populations of phytoplankton on the ocean margins in the Gulf of Mexico and (4) to measure regulation of RubisCO in phytoplankton of the Hatteras System. Two goals are laboratory-based, and two are ship-based.

  5. Open Reduction Internal Fixation of Distal Clavicle Fracture With Supplementary Button Coracoclavicular Fixation

    PubMed Central

    Hanflik, Andrew; Hanypsiak, Bryan T.; Greenspoon, Joshua; Friedman, Darren J.

    2014-01-01

    Distal clavicle fractures are common, and no standard treatment exists. Many different surgical modalities exist. This report describes an open reduction internal fixation technique that achieves both plate and coracoclavicular stabilization using a button device. A precontoured superior-lateral plate is secured to the clavicle. A 3.2-mm spade-tipped drill bit is drilled across the clavicle and coracoid, passing through 4 cortices. The button is loaded onto an insertion device, passed across the 4 cortices, and captured on the undersurface of the coracoid under fluoroscopic guidance. This construct is linked to the distal clavicle plate by heavy sutures using a second button that sits in the plate. The lateral locking holes are then filled to finalize fixation. This technique provides for a simplified way to achieve coracoclavicular stabilization when using a plate for fixation of distal clavicle fractures. PMID:25473604

  6. Closed reduction and fixation of locked symphysis pubis using tubular external fixator: a case report.

    PubMed

    Hal?c?, Mehmet; Karaman, ?brahim; Kafadar, ?brahim Halil; Argün, Ali Saltuk

    2013-01-01

    Locked symphysis pubis is a kind of pelvic injury in which one pubic bone is jammed in the back of the other or opposite the obturator foramen following lateral compression forces. In this article, we present a 31-year-old female case of locked symphysis pubis which was treated by closed reduction using tubular external fixator. We believe that tubular external fixators are useful devices to perform closed reduction maneuvers for locked pelvic injuries and also help to reduce the need for open reduction and internal implant usage. PMID:23692202

  7. Carbon Cycle Diagram

    NSDL National Science Digital Library

    This diagram illustrates some of the most abundant stores of carbon and identifies some of the pathways in the carbon cycle along which carbon is transferred from one form to another. Long-term sinks of carbon are labelled in black; shorter-term fluxes are labelled in purple. Amounts are in billions of tons.

  8. Hybrid Fixation of Tibial Eminence Fractures in Skeletally Immature Patients

    PubMed Central

    Gans, Itai; Babatunde, Oladapo M.; Ganley, Theodore J.

    2013-01-01

    Tibial eminence fractures most commonly occur in children and adolescents. When treating displaced fractures of the tibial eminence, some surgeons prefer screw fixation whereas others prefer suture fixation. The ultimate goal is to limit morbidity through early return to range of motion and activity. In this technical note, we describe 2 hybrid fixation techniques for fixing tibial eminence fractures, one for type III and the other for type IV fractures. The first technique (variation A) is used to treat type III fractures and combines use of both a bioabsorbable compression screw and suture for fixation. The second technique (variation B) is used to treat type IV fractures and combines use of both a bioabsorbable compression screw and shoulder anchor fixation. We have found that these methods provide efficient, secure, and reliable fixation using standard techniques common to arthroscopic surgery. In addition, the growth plates are spared in children and adolescents, and the need for reoperation to remove hardware is eliminated. PMID:24265991

  9. Elemental carbon and polycyclic aromatic compounds in a 150-year sediment core from lake qinghai, tibetan plateau, china: influence of regional and local sources and transport pathways.

    PubMed

    Han, Y M; Wei, C; Bandowe, B A M; Wilcke, W; Cao, J J; Xu, B Q; Gao, S P; Tie, X X; Li, G H; Jin, Z D; An, Z S

    2015-04-01

    Elemental carbon (EC) and polycyclic aromatic compounds (PACs) are potential proxies for the reconstruction of change in human activities and the origin of air masses in historic times. In this study, the historic deposition of char and soot (the two subtypes of EC) and PACs in a 150-year sediment core from different topographic subbasins of Lake Qinghai on the Qinghai Tibetan Plateau (QTP) were reconstructed. The objective was to explore how the variations in the concentrations of EC and PACs, in the ratios of char to soot and of oxygenated polycyclic aromatic hydrocarbons (OPAHs) to parent PAHs, and in the composition of the PAC mixtures reflect historical changes in climate and human activity and the origin of air masses arriving at the QTP. The deposition fluxes of soot in the different subbasins were similar, averaging 0.18 (range of 0.15-0.25) and 0.16 (0.13-0.23) g m(-2) year(-1), respectively, but they varied for char (averaging 0.11 and 0.22 g m(-2) year(-1), respectively), suggesting ubiquitous atmospheric deposition of soot and local river inputs of char. The different vertical distributions of the char/soot ratios in the different subbasins can be interpreted in terms of the different transport mechanisms of char and soot. An abrupt increase in soot concentrations since 1980 coincides with results from the QTP ice cores that were interpreted to be indicative of soot transport from South Asia. Similar concentration patterns of PAHs with soot and 9,10-anthraquinone/anthracene (9,10-AQ/ANT) ratios all >2.0 suggest regional PAC sources. Increasing PAH/soot ratios and decreasing 9,10-AQ/ANT ratios since the beginning of the 1970s indicate increasing local emissions. The historical trends of these diagnostic ratios indicate an increase in the fossil-fuel contribution since the beginning of the 1970s. The increase of perylene concentrations with increasing core depth and the ratio of perylene to its penta-aromatic isomers indicate that perylene originates mainly from in situ biogenic diagenesis. We demonstrate that the concentrations of EC, char, soot, and PACs in sediments can be used to reconstruct local, regional, and remote sources and transport pathways of pollutants to the QTP. PMID:25732352

  10. Using an Explicit Emission Tagging Method in Global Modeling of Source-Receptor Relationships for Black Carbon in the Arctic: Variations, Sources and Transport Pathways

    SciTech Connect

    Wang, Hailong; Rasch, Philip J.; Easter, Richard C.; Singh, Balwinder; Zhang, Rudong; Ma, Po-Lun; Qian, Yun; Ghan, Steven J.; Beagley, Nathaniel

    2014-11-27

    We introduce an explicit emission tagging technique in the Community Atmosphere Model to quantify source-region-resolved characteristics of black carbon (BC), focusing on the Arctic. Explicit tagging of BC source regions without perturbing the emissions makes it straightforward to establish source-receptor relationships and transport pathways, providing a physically consistent and computationally efficient approach to produce a detailed characterization of the destiny of regional BC emissions and the potential for mitigation actions. Our analysis shows that the contributions of major source regions to the global BC burden are not proportional to the respective emissions due to strong region-dependent removal rates and lifetimes, while the contributions to BC direct radiative forcing show a near-linear dependence on their respective contributions to the burden. Distant sources contribute to BC in remote regions mostly in the mid- and upper troposphere, having much less impact on lower-level concentrations (and deposition) than on burden. Arctic BC concentrations, deposition and source contributions all have strong seasonal variations. Eastern Asia contributes the most to the wintertime Arctic burden. Northern Europe emissions are more important to both surface concentration and deposition in winter than in summer. The largest contribution to Arctic BC in the summer is from Northern Asia. Although local emissions contribute less than 10% to the annual mean BC burden and deposition within the Arctic, the per-emission efficiency is much higher than for major non-Arctic sources. The interannual variability (1996-2005) due to meteorology is small in annual mean BC burden and radiative forcing but is significant in yearly seasonal means over the Arctic. When a slow aging treatment of BC is introduced, the increase of BC lifetime and burden is source-dependent. Global BC forcing-per-burden efficiency also increases primarily due to changes in BC vertical distributions. The relative contribution from major non-Arctic sources to the Arctic BC burden increases only slightly, although the contribution of Arctic local sources is reduced by a factor of 2 due to the slow aging treatment.

  11. Evidence of Coexistence of C3 and C4 Photosynthetic Pathways in a Green-Tide-Forming Alga, Ulva prolifera

    PubMed Central

    Zhang, Xiaowen; Xu, Dong; Mou, Shanli; Cao, Shaona; Zheng, Zhou; Miao, Jinlai; Ye, Naihao

    2012-01-01

    Ulva prolifera, a typical green-tide-forming alga, can accumulate a large biomass in a relatively short time period, suggesting that photosynthesis in this organism, particularly its carbon fixation pathway, must be very efficient. Green algae are known to generally perform C3 photosynthesis, but recent metabolic labeling and genome sequencing data suggest that they may also perform C4 photosynthesis, so C4 photosynthesis might be more wide-spread than previously anticipated. Both C3 and C4 photosynthesis genes were found in U. prolifera by transcriptome sequencing. We also discovered the key enzymes of C4 metabolism based on functional analysis, such as pyruvate orthophosphate dikinase (PPDK), phosphoenolpyruvate carboxylase (PEPC), and phosphoenolpyruvate carboxykinase (PCK). To investigate whether the alga operates a C4-like pathway, the expression of rbcL and PPDK and their enzyme activities were measured under various forms and intensities of stress (differing levels of salinity, light intensity, and temperature). The expression of rbcL and PPDK and their enzyme activities were higher under adverse circumstances. However, under conditions of desiccation, the expression of rbcL and ribulose-1, 5-biphosphate carboxylase (RuBPCase) activity was lower, whereas that of PPDK was higher. These results suggest that elevated PPDK activity may alter carbon metabolism and lead to a partial operation of C4-type carbon metabolism in U. prolifera, probably contributing to its wide distribution and massive, repeated blooms in the Yellow Sea. PMID:22616009

  12. Autotrophy of green non-sulphur bacteria in hot spring microbial mats: biological explanations for isotopically heavy organic carbon in the geological record

    NASA Technical Reports Server (NTRS)

    van der Meer, M. T.; Schouten, S.; de Leeuw, J. W.; Ward, D. M.

    2000-01-01

    Inferences about the evidence of life recorded in organic compounds within the Earth's ancient rocks have depended on 13C contents low enough to be characteristic of biological debris produced by the well-known CO2 fixation pathway, the Calvin cycle. 'Atypically' high values have been attributed to isotopic alteration of sedimentary organic carbon by thermal metamorphism. We examined the possibility that organic carbon characterized by a relatively high 13C content could have arisen biologically from recently discovered autotrophic pathways. We focused on the green non-sulphur bacterium Chloroflexus aurantiacus that uses the 3-hydroxypropionate pathway for inorganic carbon fixation and is geologically significant as it forms modern mat communities analogous to stromatolites. Organic matter in mats constructed by Chloroflexus spp. alone had relatively high 13C contents (-14.9%) and lipids diagnostic of Chloroflexus that were also isotopically heavy (-8.9% to -18.5%). Organic matter in mats constructed by Chloroflexus in conjunction with cyanobacteria had a more typical Calvin cycle signature (-23.5%). However, lipids diagnostic of Chloroflexus were isotopically enriched (-15.1% to -24.1%) relative to lipids typical of cyanobacteria (-33.9% to -36.3%). This suggests that, in mats formed by both cyanobacteria and Chloroflexus, autotrophy must have a greater effect on Chloroflexus carbon metabolism than the photoheterotrophic consumption of cyanobacterial photosynthate. Chloroflexus cell components were also selectively preserved. Hence, Chloroflexus autotrophy and selective preservation of its products constitute one purely biological mechanism by which isotopically heavy organic carbon could have been introduced into important Precambrian geological features.

  13. Arren Bar-Even The Weizmann Institute of Science

    E-print Network

    Beimel, Amos

    are abundant), carbon fixation becomes a growth limiting factor. Calvin-Cycle limited by low catalysis rate://www.genome.jp/kegg/pathway/map/map01100.html Carbon dioxide A carbon Fixation Cycle 13 #12;Finding alternatives to the Calvin-Benson Cycle-Benson Cycle Evaluating the synthetic carbon fixation cycles Promising carbon fixation cycles How can we

  14. Processing and evaluation of long fiber thermoplastic composite plates for internal fixation

    NASA Astrophysics Data System (ADS)

    Warren, Paul B.

    The metallic plates used in internal fracture fixation may have up to ten times the elastic modulus of normal bone tissue, causing stress shielding-induced osteopenia in healed bone that can lead to re-fracture after plate removal and prolonged and painful recovery. Thermoplastic polymer matrix composites reinforced with long carbon fiber are promising alternative materials for internal fixation plates because they may be produced with relative ease and be tailored to have specific mechanical properties, alleviating the stress shielding problem. Long carbon fiber-reinforced polyetheretherketone (LCF PEEK) plates were produced using the extrusion / compression molding process. Static flexural testing determined that LCF PEEK plates with rectangular cross-section had an average flexural modulus of 12 GPa, or 23% of the flexural modulus of a stainless steel plate. The LCF PEEK plates also experienced negligible (14.7%, 14.5%, and 16.7%) reductions in modulus after fatigue testing at applied moments of 2.5, 3.0, and 3.5 N•m, respectively, over 106 load cycles. Aging the plates in 0.9% NaCl solution for four and eight weeks caused 0.34% and 0.28% increases in plate mass, respectively. No significant decrease of flexural properties due to aging was detected. Differential scanning calorimetry (DSC) revealed the PEEK matrix of the plates to be 24.5% crystalline, which is lower than typical PEEK crystallinity values of 30-35%. Scanning electron microscopy (SEM) revealed three times as many fiber pullout areas in LCF PEEK fracture surfaces as in fracture surfaces of long carbon fiber-reinforced polyphenylenesulfide (LCF PPS), another plate material tested. DSC and SEM data suggest that improvements in processing conditions and fiber/matrix bonding, along with higher carbon fiber fractions, would enhance LCF PEEK plate performance. LCF PEEK remains a promising alternative to stainless steel for internal fixation plates.

  15. Nitrogen fixation in subarctic streams influenced by beaver (Castor canadensis)

    Microsoft Academic Search

    Margaret M. Francis; Robert J. Naimant; Jerry M. Melillo

    1985-01-01

    Nitrogen fixation was measured in four subarctic streams substantially modified by beaver (Castor canadensis) in Quebec. Acetylene-ethylene (C2H2 ? C2H4) reduction techniques were used during the 1982 ice-free period (May–October) to estimate nitrogen fixation by microorganisms colonizing wood and sediment. Mean seasonal fixation rates were low and patchy, ranging from zero to 2.3 × 10-3 µmol C2H4 · cm-2 ·

  16. Ecosystem controls on nitrogen fixation in boreal feather moss communities

    Microsoft Academic Search

    Thomas H. DeLuca; Olle Zackrisson; Francesco Gentili; Anita Sellstedt; Marie-Charlotte Nilsson

    2007-01-01

    N fixation in feather moss carpets is maximized in late secondary successional boreal forests; however, there is limited understanding\\u000a of the ecosystem factors that drive cyanobacterial N fixation in feather mosses with successional stage. We conducted a reciprocal\\u000a transplant experiment to assess factors in both early and late succession that control N fixation in feather moss carpets\\u000a dominated by Pleurozium

  17. Arthroscopic reduction and internal fixation of acetabular fractures.

    PubMed

    Kim, Hyangkyoung; Baek, Ji-Hoon; Park, Sang-Min; Ha, Yong-Chan

    2014-04-01

    Arthroscopic reduction and screw fixation of acetabular fractures have not been reported. In this case report, arthroscopic treatment for acetabular fracture is reported for two patients. A 49-year-old man diagnosed with acetabular posterior wall fracture was treated by arthroscopic reduction and fixation using two screws. A 20-year-old woman who diagnosed with anterior column fracture was fixed using a screw using the arthroscopic technique prior to open reduction and internal fixation in the iliac bone fracture. Arthroscopic reduction and fixation in some case of acetabular fracture could be good indication with additional advantages of joint debridement and loose body removal. PMID:24306124

  18. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3050 Spinal interlaminal fixation orthosis. (a) Identification. A spinal...

  19. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3050 Spinal interlaminal fixation orthosis. (a) Identification. A spinal...

  20. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3050 Spinal interlaminal fixation orthosis. (a) Identification. A spinal...

  1. Mechanistical studies on the formation and destruction of carbon monoxide (CO), carbon dioxide (CO2), and carbon trioxide (CO3)

    E-print Network

    Kaiser, Ralf I.

    Mechanistical studies on the formation and destruction of carbon monoxide (CO), carbon dioxide (CO2 monoxide (CO), carbon dioxide (CO2), and molecular oxygen (O2) with varying carbon-to-oxygen ratios from 1 and destruction pathways of carbon monoxide (CO), carbon dioxide (CO2), and carbon trioxide (CO3

  2. Atlantoaxial Rotatory Fixation in Adults Patient

    PubMed Central

    Jeon, Sei Woong; Moon, Seung Myung; Choi, Sun Kil

    2009-01-01

    Atlantoaxial rotatory fixation (AARF) in adult is a rare disorder that occurs followed by a trauma. The patients were presented with painful torticollis and a typical 'cock robin' position of the head. The clinical diagnosis is generally difficult and often made in the late stage. In some cases, an irreducible or chronic fixation develops. We reported a case of AARF in adult patient which was treated by immobilization with conservative treatment. A 25-year-old female was presented with a posterior neck pain and limitation of motion of cervical spine after a traffic accident. She had no neurological deficit but suffered from severe defect on the scalp and multiple thoracic compression fractures. Plain radiographs demonstrated torticollis, lateral shift of odontoid process to one side and widening of one side of C1-C2 joint space. Immobilization with a Holter traction were performed and analgesics and muscle relaxants were given. Posterior neck pain and limitation of the cervical spine's motion were resolved. Plain cervical radiographs taken at one month after the injury showed that torticollis disappeared and the dens were in the midline position. The authors reported a case of type I post-traumatic AARF that was successfully treated by immobilization alone. PMID:19444353

  3. Nitrogen fixation and hydrogen metabolism in cyanobacteria.

    PubMed

    Bothe, Hermann; Schmitz, Oliver; Yates, M Geoffrey; Newton, William E

    2010-12-01

    This review summarizes recent aspects of (di)nitrogen fixation and (di)hydrogen metabolism, with emphasis on cyanobacteria. These organisms possess several types of the enzyme complexes catalyzing N(2) fixation and/or H(2) formation or oxidation, namely, two Mo nitrogenases, a V nitrogenase, and two hydrogenases. The two cyanobacterial Ni hydrogenases are differentiated as either uptake or bidirectional hydrogenases. The different forms of both the nitrogenases and hydrogenases are encoded by different sets of genes, and their organization on the chromosome can vary from one cyanobacterium to another. Factors regulating the expression of these genes are emerging from recent studies. New ideas on the potential physiological and ecological roles of nitrogenases and hydrogenases are presented. There is a renewed interest in exploiting cyanobacteria in solar energy conversion programs to generate H(2) as a source of combustible energy. To enhance the rates of H(2) production, the emphasis perhaps needs not to be on more efficient hydrogenases and nitrogenases or on the transfer of foreign enzymes into cyanobacteria. A likely better strategy is to exploit the use of radiant solar energy by the photosynthetic electron transport system to enhance the rates of H(2) formation and so improve the chances of utilizing cyanobacteria as a source for the generation of clean energy. PMID:21119016

  4. Nitrogen Fixation and Hydrogen Metabolism in Cyanobacteria

    PubMed Central

    Bothe, Hermann; Schmitz, Oliver; Yates, M. Geoffrey; Newton, William E.

    2010-01-01

    Summary: This review summarizes recent aspects of (di)nitrogen fixation and (di)hydrogen metabolism, with emphasis on cyanobacteria. These organisms possess several types of the enzyme complexes catalyzing N2 fixation and/or H2 formation or oxidation, namely, two Mo nitrogenases, a V nitrogenase, and two hydrogenases. The two cyanobacterial Ni hydrogenases are differentiated as either uptake or bidirectional hydrogenases. The different forms of both the nitrogenases and hydrogenases are encoded by different sets of genes, and their organization on the chromosome can vary from one cyanobacterium to another. Factors regulating the expression of these genes are emerging from recent studies. New ideas on the potential physiological and ecological roles of nitrogenases and hydrogenases are presented. There is a renewed interest in exploiting cyanobacteria in solar energy conversion programs to generate H2 as a source of combustible energy. To enhance the rates of H2 production, the emphasis perhaps needs not to be on more efficient hydrogenases and nitrogenases or on the transfer of foreign enzymes into cyanobacteria. A likely better strategy is to exploit the use of radiant solar energy by the photosynthetic electron transport system to enhance the rates of H2 formation and so improve the chances of utilizing cyanobacteria as a source for the generation of clean energy. PMID:21119016

  5. Surgical anatomy for pelvic external fixation.

    PubMed

    Solomon, L B; Pohl, A P; Chehade, M J; Malcolm, A M; Howie, D W; Henneberg, M

    2008-10-01

    Pelvic external fixators have a high rate of reported complications, most of which relate to pin placement. In this descriptive study, we analyzed the morphology of the ilium in cadaveric specimens and compared these with the measures obtained from normal human pelvic computer tomograph scans, and how these related to each of the three basic configurations of pin positioning for the external fixation of a pelvis: anterosuperior (Slätis type), anteroinferior (supra-acetabular), and subcristal. The irregular shape and size of the iliac wing and the abdominal wall overlying the pin's insertion site could hinder accurate placement of anterosuperior pins. Potential disadvantages of the use of anteroinferior pins was found related to the deep location of the anterior inferior iliac spine, interference with the hip flexion area, risk of hip joint penetration, and the variable obliquity of the ilium. As subcristal pins are positioned between two superficial bony landmarks of the iliac crest, our findings suggest that they are more likely to have a correct placement and avoid complications. PMID:18773474

  6. Effects of Boron Nutrition and Water Stress on Nitrogen Fixation, Seed ?15N and ?13C Dynamics, and Seed Composition in Soybean Cultivars Differing in Maturities

    PubMed Central

    Bellaloui, Nacer; Mengistu, Alemu

    2015-01-01

    Therefore, the objective of the current research was to investigate the effects of foliar B nutrition on seed protein, oil, fatty acids, and sugars under water stress conditions. A repeated greenhouse experiment was conducted using different maturity group (MG) cultivars. Plants were well-watered with no foliar B (W ? B), well-watered with foliar B (W + B), water-stressed with no foliar B (WS ? B), and water-stressed with foliar B (WS + B). Foliar B was applied at rate of 0.45?kg·ha?1 and was applied twice at flowering and at seed-fill stages. The results showed that seed protein, sucrose, fructose, and glucose were higher in W + B treatment than in W ? B, WS + B, and WS ? B. The increase in protein in W + B resulted in lower seed oil, and the increase of oleic in WS ? B or WS + B resulted in lower linolenic acid. Foliar B resulted in higher nitrogen fixation and water stress resulted in seed ?15N and ?13C alteration. Increased stachyose indicated possible physiological and metabolic changes in carbon and nitrogen pathways and their sources under water stress. This research is beneficial to growers for fertilizer management and seed quality and to breeders to use 15N/14N and 13C/12C ratios and stachyose to select for drought tolerance soybean. PMID:25667936

  7. Effects of boron nutrition and water stress on nitrogen fixation, seed ?15N and ?13C dynamics, and seed composition in soybean cultivars differing in maturities.

    PubMed

    Bellaloui, Nacer; Mengistu, Alemu

    2015-01-01

    Therefore, the objective of the current research was to investigate the effects of foliar B nutrition on seed protein, oil, fatty acids, and sugars under water stress conditions. A repeated greenhouse experiment was conducted using different maturity group (MG) cultivars. Plants were well-watered with no foliar B (W - B), well-watered with foliar B (W + B), water-stressed with no foliar B (WS - B), and water-stressed with foliar B (WS + B). Foliar B was applied at rate of 0.45 kg · ha(-1) and was applied twice at flowering and at seed-fill stages. The results showed that seed protein, sucrose, fructose, and glucose were higher in W + B treatment than in W - B, WS + B, and WS - B. The increase in protein in W + B resulted in lower seed oil, and the increase of oleic in WS - B or WS + B resulted in lower linolenic acid. Foliar B resulted in higher nitrogen fixation and water stress resulted in seed ? (15)N and ? (13)C alteration. Increased stachyose indicated possible physiological and metabolic changes in carbon and nitrogen pathways and their sources under water stress. This research is beneficial to growers for fertilizer management and seed quality and to breeders to use (15)N/(14)N and (13)C/(12)C ratios and stachyose to select for drought tolerance soybean. PMID:25667936

  8. Monitoring in vivo load transmission through an external fixator.

    PubMed

    Grasa, J; Gómez-Benito, M J; González-Torres, L A; Asiaín, D; Quero, F; García-Aznar, J M

    2010-03-01

    This work presents a portable non-invasive external fixator to assess and monitor fracture healing in real time. To evaluate the potential of this fixator, a transverse osteotomy was performed in the tibia of six adult sheep (mean age 3+/-0.5 years and weight 63+/-5 kg). The fractures were stabilized by a specially designed unilateral external fixator, which was instrumented by means of a set of strain gauges. Strains in the external surface of the fixator were monitored during all the healing process. A wireless, remote monitoring of the implant was developed through a specially designed external telemetric device. The strain gauges were arranged in two different half-bridge Wheatstone configurations, allowing easy post-processing of the signal. Thus, bending loads were measured in two planes of the external fixator acting as a load cell. The load through the fixator was evaluated for the gait cycle during all the healing process. Full weight bearing of the injured leg was observed from the beginning. The load transmission mechanism in the fixator was quite similar in all operated tibias and radiographic images showed a successful healing in all animals. Although the fixator has only been tested in an animal model, after further testing this system may have clinical potential. PMID:20052616

  9. CRISP: A Computational Model of Fixation Durations in Scene Viewing

    ERIC Educational Resources Information Center

    Nuthmann, Antje; Smith, Tim J.; Engbert, Ralf; Henderson, John M.

    2010-01-01

    Eye-movement control during scene viewing can be represented as a series of individual decisions about where and when to move the eyes. While substantial behavioral and computational research has been devoted to investigating the placement of fixations in scenes, relatively little is known about the mechanisms that control fixation durations.…

  10. Ancestral recombination-selection graph and fixation probability

    E-print Network

    Leclercq, Remi

    Ancestral recombination-selection graph and fixation probability Application to the Hill;Ancestral recombination-selection graph and fixation probability Application to the Hill-Robertson effect;Recombination #12;Recombination T Negative linkage disequilibrium D Recombination T Negative linkage

  11. Microbial community shifts influence patterns in tropical forest nitrogen fixation.

    PubMed

    Reed, Sasha C; Townsend, Alan R; Cleveland, Cory C; Nemergut, Diana R

    2010-10-01

    The role of biodiversity in ecosystem function receives substantial attention, yet despite the diversity and functional relevance of microorganisms, relationships between microbial community structure and ecosystem processes remain largely unknown. We used tropical rain forest fertilization plots to directly compare the relative abundance, composition and diversity of free-living nitrogen (N)-fixer communities to in situ leaf litter N fixation rates. N fixation rates varied greatly within the landscape, and 'hotspots' of high N fixation activity were observed in both control and phosphorus (P)-fertilized plots. Compared with zones of average activity, the N fixation 'hotspots' in unfertilized plots were characterized by marked differences in N-fixer community composition and had substantially higher overall diversity. P additions increased the efficiency of N-fixer communities, resulting in elevated rates of fixation per nifH gene. Furthermore, P fertilization increased N fixation rates and N-fixer abundance, eliminated a highly novel group of N-fixers, and increased N-fixer diversity. Yet the relationships between diversity and function were not simple, and coupling rate measurements to indicators of community structure revealed a biological dynamism not apparent from process measurements alone. Taken together, these data suggest that the rain forest litter layer maintains high N fixation rates and unique N-fixing organisms and that, as observed in plant community ecology, structural shifts in N-fixing communities may partially explain significant differences in system-scale N fixation rates. PMID:20454976

  12. Asymmetrical control of fixation durations in scene viewing.

    PubMed

    Calen Walshe, R; Nuthmann, Antje

    2014-07-01

    In two experiments we investigated the control of fixation durations in naturalistic scene viewing. Empirical evidence from the scene onset delay paradigm and numerical simulations of such data with the CRISP model [Psychological Review 117 (2010) 382-405] have suggested that processing related difficulties may lead to prolonged fixation durations. Here, we ask whether processing related facilitation may lead to comparable decreases to fixation durations. Research in visual search and reading have reported only uni-directional shifts. To address the question of unidirectional (slow down) as opposed to bidirectional (slow down and speed up) adjustment of fixation durations in the context of scene viewing, we used a saccade-contingent display change method to either reduce or increase the luminance of the scene during prespecified critical fixations. Degrading the stimulus by shifting luminance down resulted in an immediate increase to fixation durations. However, clarifying the stimulus by shifting luminance upwards did not result in a comparable decrease to fixation durations. These results suggest that the control of fixation durations in scene viewing is asymmetric, as has been reported for visual search and reading. PMID:24726565

  13. The Two Phases of the Coalescent and Fixation Processes Introduction

    E-print Network

    Campbell, Russell Bruce

    traces back the current population to a common ancestor and the fixation process which follows recent common ancestor, and several generations will first achieve fixation for one of their genes in the same generation. If the original individual is the most recent common ancestor of the present

  14. Overcoming Organizational Fixation: Creating and Sustaining an Innovation Culture

    ERIC Educational Resources Information Center

    Stempfle, Joachim

    2011-01-01

    Fixation on established paradigms and practices can severely limit the capability of organizations to change, thereby jeopardizing the ability of organizations to keep up with changes in their environment and new technological developments. Overcoming organizational fixation is therefore a requirement for any organization that strives to achieve…

  15. A new adhesive technique for internal fixation in midfacial surgery

    Microsoft Academic Search

    Kira Endres; Rudolf Marx; Joachim Tinschert; Dieter Christian Wirtz; Christian Stoll; Dieter Riediger; Ralf Smeets

    2008-01-01

    BACKGROUND: The current surgical therapy of midfacial fractures involves internal fixation in which bone fragments are fixed in their anatomical positions with osteosynthesis plates and corresponding screws until bone healing is complete. This often causes new fractures to fragile bones while drilling pilot holes or trying to insert screws. The adhesive fixation of osteosynthesis plates using PMMA bone cement could

  16. Monocular fixation with the optic nerve head: a case report

    E-print Network

    Peli, Eli

    perimeter for documentation of eccentric fixation in strabismus. Keywords: blind spot, eccentric fixation In early acquired strabismus, the visual system typically develops sensory adaptations to avoid). These phenomena are usually reported, when they occur in central retina, by patients who develop strabismus

  17. Sacroiliac screw fixation: A mini review of surgical technique.

    PubMed

    Alvis-Miranda, Hernando Raphael; Farid-Escorcia, Hector; Alcalá-Cerra, Gabriel; Castellar-Leones, Sandra Milena; Moscote-Salazar, Luis Rafael

    2014-07-01

    The sacral percutaneous fixation has many advantages but can be associated with a significant exposure to X-ray radiation. Currently, sacroiliac screw fixation represents the only minimally invasive technique to stabilize the posterior pelvic ring. It is a technique that should be used by experienced surgeons. We present a practical review of important aspects of this technique. PMID:25336831

  18. FIXATION OF FISH TISSUES. IN: THE LABORATORY FISH.

    EPA Science Inventory

    This chapter deals with the fixation of fish tissues and whole fish. Traditionally, fixation has been applied to animal tissues mainly for histological or pathological studies. Development of new molecular and immunologic tools now allows tissue and cellular localization of nucle...

  19. ORIGINAL PAPER Biological nitrogen fixation by common beans

    E-print Network

    Lehmann, Johannes

    ORIGINAL PAPER Biological nitrogen fixation by common beans (Phaseolus vulgaris L.) increases biological N2 fixation (BNF) by common beans (Phaseolus vulgaris L.) through bio-char additions (charcoal- tox cropped to a potentially nodulating bean variety (CIAT BAT 477) in comparison to its non

  20. Characteristics of Fixational Eye Movements in People With Macular Disease

    PubMed Central

    Kumar, Girish; Chung, Susana T. L.

    2014-01-01

    Purpose. Fixation stability is known to be poor for people with macular disease and has been suggested as a contributing factor for the poor visual performance of these individuals. In this study, we examined the characteristics of the different components of fixational eye movements and determined the component that plays a major role in limiting fixation stability in people with macular disease. Methods. Sixteen observers with macular disease and 14 older adults with normal vision (control observers) monocularly fixated a small cross presented using a Rodenstock scanning laser ophthalmoscope, for trials of 30 seconds. The retinal image and the position of the cross on the retina were recorded digitally. Eye movements were extracted from the recorded videos at a sampling rate of 540 Hz using a cross-correlation technique. A velocity criterion of 8°/s was used to differentiate between slow drifts and microsaccades. Results. Observers with macular disease demonstrated higher fixation instability, larger amplitudes of slow drifts and microsaccades, and lower drift velocities, when compared with older adults with normal vision. The velocity and the rate of microsaccades were comparable between the two groups of observers. Multiple linear regression analysis showed that the amplitude of microsaccades, and to a smaller extent, the amplitude of slow drifts, play a major role in limiting fixation stability. Conclusions. Fixation stability in people with macular disease is primarily limited by the amplitude of microsaccades, implying that rehabilitative strategies targeted at reducing the amplitude of microsaccades should improve fixation stability, and may lead to improved visual functions. PMID:25074769

  1. Pentose pathway in human liver

    SciTech Connect

    Magnusson, I.; Chandramouli, V.; Schumann, W.C.; Kumaran, K.; Wahren, J.; Landau, B.R. (Karolinska Institute at Huddinge Hospital, Stockholm (Sweden))

    1988-07-01

    (1-{sup 14}C)Ribose and (1-{sup 14}C)glucose were given to normal subjects along with glucose loads (1 g per kg of body weight) after administration of diflunisal and acetaminophen, drugs that are excreted in urine as glucuronides. Distributions of {sup 14}C were determined in the carbons of the excreted glucoronides and in the glucose from blood samples drawn from hepatic veins before and after glucagon administration. Eighty percent or more of the {sup 14}C from (1-{sup 14}C)ribose incorporated into the glucuronic acid moiety of the glucuronides was in carbons 1 and 3, with less than 8% in carbon 2. In glucuronic acid from glucuronide excreted when (2-{sup 14}C)glucose was given, 3.5-8.1% of the {sup 14}C was in carbon 1, 2.5-4.3% in carbon 3, and more than 70% in carbon 2. These distributions are in accord with the glucuronides sampling the glucose unit of the glucose 6-phosphate pool that is a component of the pentose pathway and is intermediate in glycogen formation. It is concluded that the glucuronic acid conjugates of the drugs can serve as a noninvasive means of sampling hepatic glucose 6-phosphate. In human liver, as in animal liver, the classical pentose pathway functions, not the L-type pathway, and only a small percentage of the glucose is metabolized via the pathway.

  2. Pentose pathway in human liver.

    PubMed Central

    Magnusson, I; Chandramouli, V; Schumann, W C; Kumaran, K; Wahren, J; Landau, B R

    1988-01-01

    [1-14C]Ribose and [2-14C]glucose were given to normal subjects along with glucose loads (1 g per kg of body weight) after administration of diflunisal and acetaminophen, drugs that are excreted in urine as glucuronides. Distributions of 14C were determined in the carbons of the excreted glucuronides and in the glucose from blood samples drawn from hepatic veins before and after glucagon administration. Eighty percent or more of the 14C from [1-14C]ribose incorporated into the glucuronic acid moiety of the glucuronides was in carbons 1 and 3, with less than 8% in carbon 2. In glucuronic acid from glucuronide excreted when [2-14C]glucose was given, 3.5-8.1% of the 14C was in carbon 1, 2.5-4.3% in carbon 3, and more than 70% in carbon 2. These distributions are in accord with the glucuronides sampling the glucose unit of the glucose 6-phosphate pool that is a component of the pentose pathway and is intermediate in glycogen formation. It is concluded that the glucuronic acid conjugates of the drugs can serve as a noninvasive means of sampling hepatic glucose 6-phosphate. In human liver, as in animal liver, the classical pentose pathway functions, not the L-type pathway, and only a small percentage of the glucose is metabolized via the pathway. PMID:3133657

  3. Growth condition study of algae function in ecosystem for CO2 bio-fixation.

    PubMed

    Tsai, David Dah-Wei; Ramaraj, Rameshprabu; Chen, Paris Honglay

    2012-02-01

    Algae niche play a crucial role on carbon cycle and have great potential for CO(2) sequestration. This study was to investigate the CO(2) bio-fixation by the high rate pond (HRP) to mimic the algae function of nature. All the reactors can keep CO(2) consumption efficiencies over 100%. The statistical analyses proved HRPs were close to the natural system from all the growth conditions. The HRP could show the "natural optimization as nature" to perform as well as the artificial reactor of continuously stirred tank reactor (CSTR). In the nutrition study, the carbon mass balance indicated CO(2) was the main carbon source. Accordingly, the HRPs can keep a neutral pH range to provide dissolved oxygen (DO), to promote total nitrogen (TN)/total phosphorous (TP) removal efficiencies and to demonstrate self-purification process. Furthermore, the observations of different nitrogen species in the reactors demonstrated that the major nitrogen source was decided by pH. This finding logically explained the complex nitrogen uptake by algae in nature. Consequently, this study took advantage of HRP to explore the processes of efficient CO(2) uptake with the corresponding growth condition in the ecosystem. Those results contributed the further understanding of the role of CO(2) bio-fixation in nature and demonstrated HRP could be a potential ecological engineering alternative. PMID:22196805

  4. Pathway Analysis

    Cancer.gov

    Surprising failures of new cancer treatments have made it clear that we do not know enough about how molecules in RAS signaling pathways interact with each other. For example, in the context of mutant KRAS, inhibitors of BRAF increase signaling through ERK. RAS Initiative scientists at the FNLCR are expanding our knowledge of signaling through RAS pathways using in silico and wet lab methods.

  5. Increasing subtropical North Pacific Ocean nitrogen fixation since the Little Ice Age.

    PubMed

    Sherwood, Owen A; Guilderson, Thomas P; Batista, Fabian C; Schiff, John T; McCarthy, Matthew D

    2014-01-01

    The North Pacific subtropical gyre (NPSG) plays a major part in the export of carbon and other nutrients to the deep ocean. Primary production in the NPSG has increased in recent decades despite a reduction in nutrient supply to surface waters. It is thought that this apparent paradox can be explained by a shift in plankton community structure from mostly eukaryotes to mostly nitrogen-fixing prokaryotes. It remains uncertain, however, whether the plankton community domain shift can be linked to cyclical climate variability or a long-term global warming trend. Here we analyse records of bulk and amino-acid-specific (15)N/(14)N isotopic ratios (?(15)N) preserved in the skeletons of long-lived deep-sea proteinaceous corals collected from the Hawaiian archipelago; these isotopic records serve as a proxy for the source of nitrogen-supported export production through time. We find that the recent increase in nitrogen fixation is the continuation of a much larger, centennial-scale trend. After a millennium of relatively minor fluctuation, ?(15)N decreases between 1850 and the present. The total shift in ?(15)N of -2 per mil over this period is comparable to the total change in global mean sedimentary ?(15)N across the Pleistocene-Holocene transition, but it is happening an order of magnitude faster. We use a steady-state model and find that the isotopic mass balance between nitrate and nitrogen fixation implies a 17 to 27 per cent increase in nitrogen fixation over this time period. A comparison with independent records suggests that the increase in nitrogen fixation might be linked to Northern Hemisphere climate change since the end of the Little Ice Age. PMID:24336216

  6. Increasing subtropical North Pacific Ocean nitrogen fixation since the Little Ice Age

    NASA Astrophysics Data System (ADS)

    Sherwood, Owen A.; Guilderson, Thomas P.; Batista, Fabian C.; Schiff, John T.; McCarthy, Matthew D.

    2014-01-01

    The North Pacific subtropical gyre (NPSG) plays a major part in the export of carbon and other nutrients to the deep ocean. Primary production in the NPSG has increased in recent decades despite a reduction in nutrient supply to surface waters. It is thought that this apparent paradox can be explained by a shift in plankton community structure from mostly eukaryotes to mostly nitrogen-fixing prokaryotes. It remains uncertain, however, whether the plankton community domain shift can be linked to cyclical climate variability or a long-term global warming trend. Here we analyse records of bulk and amino-acid-specific 15N/14N isotopic ratios (?15N) preserved in the skeletons of long-lived deep-sea proteinaceous corals collected from the Hawaiian archipelago; these isotopic records serve as a proxy for the source of nitrogen-supported export production through time. We find that the recent increase in nitrogen fixation is the continuation of a much larger, centennial-scale trend. After a millennium of relatively minor fluctuation, ?15N decreases between 1850 and the present. The total shift in ?15N of -2 per mil over this period is comparable to the total change in global mean sedimentary ?15N across the Pleistocene-Holocene transition, but it is happening an order of magnitude faster. We use a steady-state model and find that the isotopic mass balance between nitrate and nitrogen fixation implies a 17 to 27 per cent increase in nitrogen fixation over this time period. A comparison with independent records suggests that the increase in nitrogen fixation might be linked to Northern Hemisphere climate change since the end of the Little Ice Age.

  7. A steady-state tracing kinetic analysis of oxidative coupling of methane over Li[sup +]-doped TiO[sub 2]: Mechanistic aspects of the carbon and oxygen reaction pathways to form CO[sub 2

    SciTech Connect

    Efstathiou, A.M.; Verykios, X.E. (Univ. of Patras (Greece)); Lacombe, S.; Mirodatos, C. (Institut de Recherches sur la Catalyse, Villeurbanne (France))

    1994-08-01

    A steady-state tracing kinetic study of the oxidative coupling of methane reaction at 800[degrees]C over Li[sup +]-doped TiO[sub 2] catalyst was performed. In particular, the carbon and oxygen reaction pathways which lead to the formation of CO[sub 2] have been probed using [sup 13]CH[sub 4] and [sup 18]O[sub 2] isotope gases under reaction conditions. The results obtained indicate that there is practically no reversibly adsorbed CH[sub 4] on the catalyst surface, while there is a very small reservoir of carbon-containing intermediate species which eventually lead to CO[sub 2](0.1 [mu]mol/g). A large reservoir of oxygen species, participating in the formation of CO[sub 2] (at least 12.0 [mu]mol/g), was detected, while subsurface lattice oxygen species also participate in the oxygen reaction pathway to form CO[sub 2]. In addition, large amounts of inactive carbonaceous species (17.0 [mu]mol/g) accumulate on the catalyst surface after 1 h on stream. These species do not participate in the reaction route to form CO[sub 2] (spectator species). 23 refs., 7 figs.

  8. Spatial Patterns of Fixation-Switch Behavior in Strabismic Monkeys

    PubMed Central

    Agaoglu, Mehmet N.; LeSage, Stephanie K.; Joshi, Anand C.; Das, Vallabh E.

    2014-01-01

    Purpose. Patients with strabismus perceptually suppress information from one eye to avoid double vision. Mechanisms of visual suppression likely lead to fixation-switch behavior wherein the subject acquires targets with a specific eye depending on target location in space. The purpose of this study was to investigate spatial patterns of fixation-switch behavior in strabismic monkeys. Methods. Eye movements were acquired in three exotropic and one esotropic monkey in a binocular viewing saccade task. Spatial patterns of fixation were analyzed by calculating incidence of using either eye to fixate targets presented at various gaze locations. Results. Broadly, spatial fixation patterns and fixation-switch behavior followed expectations if a portion of the temporal retina was suppressed in exotropia and a portion of the nasal retina was suppressed in esotropia. Fixation-switch occurred for horizontal target locations that were approximately greater than halfway between the lines of sight of the foveating and strabismic eyes. Surprisingly, the border between right eye and left eye fixation zones was not sharply defined and there was a significant extent (>10°) over which the monkeys could acquire a target with either eye. Conclusions. We propose that spatial fixation patterns in strabismus can be accounted for in a decision framework wherein the oculomotor system has access to retinal error information from each eye and the brain chooses between them to prepare a saccade. For target locations approximately midway between the two foveae, strength of retinal error representations from each eye is almost equal, leading to trial-to-trial variability in choice of fixating eye. PMID:24508786

  9. Evaluation of Streck Tissue Fixative, a Nonformalin Fixative for Preservation of Stool Samples and Subsequent Parasitologic Examination

    Microsoft Academic Search

    EVA K. NACE; FRANK J. STEURER; MARK L. EBERHARD

    1999-01-01

    We undertook a study to evaluate Streck tissue fixative (STF) as a substitute for formalin and polyvinyl alcohol (PVA) in fecal preservation. A comparison of formalin, PVA, (mercuric chloride based), and STF was done by aliquoting fecal samples into each fixative. Stool specimens were collected in Haiti, and parasites included Cyclospora cayetanensis, Giardia intestinalis, Entamoeba coli, Iodamoeba butschlii, Endolimax nana,

  10. Legumes, N2 fixation and the H2 cycle

    NASA Astrophysics Data System (ADS)

    Layzell, D. B.

    2004-12-01

    Legume plants such as soybean or pea can form symbiotic, N2 fixing associations with bacteria that exist in root nodules. For every N2 fixed, 1 to 3 H2 are produced as a by-product of the nitrogenase reaction. Therefore, a typical N2 fixing legume crop produces about 200,000 L H2 gas (at STP) per hectare per crop season. This paper will summarize our current understanding of the processes leading to H2 production in legumes, the magnitude of H2 production associated with global cropping systems, and the implications for its production and oxidation on both the legumes and the soils in which they grow. Specific points may include: ˜ In symbioses lacking uptake hydrogenase (HUP) activity (thought to be the majority of crop legumes), the H2 diffuses into the soil where it is oxidized by soil microbes that grow up around the legume nodules. The kinetic properties of these microbes are very different (higher Km and Vmax) from that of microbes in soils exposed to normal air (ca. 0.5 ppm H2); ˜ Laboratory studies indicate that 60% of the reducing power from H2 is coupled to O2 uptake, whereas 40% is coupled to autotrophic CO2 fixation. The latter process should increase soil carbon stocks by about 25 kg C/ha/yr; ˜ At the site of the nitrogenase enzyme, H2 production is autocatalytic such that the higher the H2 concentration, the more H2 is produced and the less N2 fixed. The variable O2 diffusion barrier in legumes can act to restrict H2 diffusion from the nodule, thereby increasing the relative magnitude of H2 production versus N2 fixation; ˜ Studies to understand why legume symbioses make such an energy investment in H2 production have led to the discovery that H2 treated soils have improved fertility, supporting the growth and yield of legume and non-legume crops. This observation may account for the benefits of legumes when used in rotation with cereal crops, a phenomenon that has been used by farmers for over 2000 years, but which has remained unexplained. An attempt will be made to position these results and insights in the context of the impact that a future H2 economy will have on the H2 cycle.

  11. Surgical treatment of zygomatic bone fracture using two points fixation versus three point fixation-a randomised prospective clinical trial

    PubMed Central

    2012-01-01

    Background The zygoma plays an important role in the facial contour for both cosmetic and functional reasons; therefore zygomatic bone injuries should be properly diagnosed and adequately treated. Comparison of various surgical approaches and their complications can only be done objectively using outcome measurements which in turn require protocol management and long-term follow up. The preference for open reduction and internal fixation of zygomatic fractures at three points has continued to grow in response to observations of inadequate results from two point and one point fixation techniques. The objectives of this study were to compare the efficacy of zygomatic bone after treatment with ORIF using 2 point fixation and ORIF using 3 point fixation and compare the outcome of two procedures. Methods 100 patients were randomly divided equally into two groups. In group A, 50 patients were treated by ORIF using two point fixation by miniplates and in group B, 50 patients were treated by ORIF using three point fixation by miniplates. They were evaluated for their complications during and after surgery with their advantages and disadvantages and the difference between the two groups was observed. Results A total of 100 fractures were sustained. We found that postoperative complication like decreased malar height and vertical dystopia was more common in those patients who were treated by two point fixation than those who were treated with three point fixation. Conclusions Based on this study open reduction and internal fixation using three point fixation by miniplates is the best available method for the treatment zygomatic bone fractures. PMID:22497773

  12. Oxygen relations of nitrogen fixation in cyanobacteria.

    PubMed Central

    Fay, P

    1992-01-01

    The enigmatic coexistence of O2-sensitive nitrogenase and O2-evolving photosynthesis in diazotrophic cyanobacteria has fascinated researchers for over two decades. Research efforts in the past 10 years have revealed a range of O2 sensitivity of nitrogenase in different strains of cyanobacteria and a variety of adaptations for the protection of nitrogenase from damage by both atmospheric and photosynthetic sources of O2. The most complex and apparently most efficient mechanisms for the protection of nitrogenase are incorporated in the heterocysts, the N2-fixing cells of cyanobacteria. Genetic studies indicate that the controls of heterocyst development and nitrogenase synthesis are closely interrelated and that the expression of N2 fixation (nif) genes is regulated by pO2. Images PMID:1620069

  13. Making a living while starving in the dark: metagenomic insights into the energy dynamics of a carbonate cave

    PubMed Central

    Ortiz, Marianyoly; Legatzki, Antje; Neilson, Julia W; Fryslie, Brandon; Nelson, William M; Wing, Rod A; Soderlund, Carol A; Pryor, Barry M; Maier, Raina M

    2014-01-01

    Carbonate caves represent subterranean ecosystems that are largely devoid of phototrophic primary production. In semiarid and arid regions, allochthonous organic carbon inputs entering caves with vadose-zone drip water are minimal, creating highly oligotrophic conditions; however, past research indicates that carbonate speleothem surfaces in these caves support diverse, predominantly heterotrophic prokaryotic communities. The current study applied a metagenomic approach to elucidate the community structure and potential energy dynamics of microbial communities, colonizing speleothem surfaces in Kartchner Caverns, a carbonate cave in semiarid, southeastern Arizona, USA. Manual inspection of a speleothem metagenome revealed a community genetically adapted to low-nutrient conditions with indications that a nitrogen-based primary production strategy is probable, including contributions from both Archaea and Bacteria. Genes for all six known CO2-fixation pathways were detected in the metagenome and RuBisCo genes representative of the Calvin–Benson–Bassham cycle were over-represented in Kartchner speleothem metagenomes relative to bulk soil, rhizosphere soil and deep-ocean communities. Intriguingly, quantitative PCR found Archaea to be significantly more abundant in the cave communities than in soils above the cave. MEtaGenome ANalyzer (MEGAN) analysis of speleothem metagenome sequence reads found Thaumarchaeota to be the third most abundant phylum in the community, and identified taxonomic associations to this phylum for indicator genes representative of multiple CO2-fixation pathways. The results revealed that this oligotrophic subterranean environment supports a unique chemoautotrophic microbial community with potentially novel nutrient cycling strategies. These strategies may provide key insights into other ecosystems dominated by oligotrophy, including aphotic subsurface soils or aquifers and photic systems such as arid deserts. PMID:24030597

  14. Making a living while starving in the dark: metagenomic insights into the energy dynamics of a carbonate cave.

    PubMed

    Ortiz, Marianyoly; Legatzki, Antje; Neilson, Julia W; Fryslie, Brandon; Nelson, William M; Wing, Rod A; Soderlund, Carol A; Pryor, Barry M; Maier, Raina M

    2014-02-01

    Carbonate caves represent subterranean ecosystems that are largely devoid of phototrophic primary production. In semiarid and arid regions, allochthonous organic carbon inputs entering caves with vadose-zone drip water are minimal, creating highly oligotrophic conditions; however, past research indicates that carbonate speleothem surfaces in these caves support diverse, predominantly heterotrophic prokaryotic communities. The current study applied a metagenomic approach to elucidate the community structure and potential energy dynamics of microbial communities, colonizing speleothem surfaces in Kartchner Caverns, a carbonate cave in semiarid, southeastern Arizona, USA. Manual inspection of a speleothem metagenome revealed a community genetically adapted to low-nutrient conditions with indications that a nitrogen-based primary production strategy is probable, including contributions from both Archaea and Bacteria. Genes for all six known CO2-fixation pathways were detected in the metagenome and RuBisCo genes representative of the Calvin-Benson-Bassham cycle were over-represented in Kartchner speleothem metagenomes relative to bulk soil, rhizosphere soil and deep-ocean communities. Intriguingly, quantitative PCR found Archaea to be significantly more abundant in the cave communities than in soils above the cave. MEtaGenome ANalyzer (MEGAN) analysis of speleothem metagenome sequence reads found Thaumarchaeota to be the third most abundant phylum in the community, and identified taxonomic associations to this phylum for indicator genes representative of multiple CO2-fixation pathways. The results revealed that this oligotrophic subterranean environment supports a unique chemoautotrophic microbial community with potentially novel nutrient cycling strategies. These strategies may provide key insights into other ecosystems dominated by oligotrophy, including aphotic subsurface soils or aquifers and photic systems such as arid deserts. PMID:24030597

  15. Monitoring CO[subscript 2] Fixation Using GC-MS Detection of a [superscript 13]C-Label

    ERIC Educational Resources Information Center

    Hammond, Daniel G.; Bridgham, April; Reichert, Kara; Magers, Martin

    2010-01-01

    Much of our understanding of metabolic pathways has resulted from the use of chemical and isotopic labels. In this experiment, a heavy isotope of carbon, [superscript 13]C, is used to label the product of the well-known RuBisCO enzymatic reaction. This is a key reaction in photosynthesis that converts inorganic carbon to organic carbon; a process…

  16. CT- and fluoroscopy-guided percutaneous screw fixation of a "carrot-stick" spinal fracture in an elderly man with ankylosing spondylitis.

    PubMed

    Huwart, Laurent; Amoretti, Nicolas

    2013-12-01

    We present a case of percutaneous fixation of a "carrot-stick" spinal fracture in an elderly patient with ankylosing spondylitis (AS). A surgical stabilization was not possible in this 83-year-old man with comorbidities. Under local anesthesia, percutaneous screw fixation of a transdiscal shear fracture at the level T10-T11 was performed using computed tomography (CT) and fluoroscopy guidance. Two 4.0-mm Asnis III cannulated screws were placed to fix facet joints using transfacet pedicle pathway. The procedure time was 30 min. Using the visual analog scale (VAS), pain decreased from 10, preoperatively, to 1 after the procedure. Radiographic fusion was observed at a 3-month post-procedural CT scan. CT- and fluoroscopy-guided percutaneous screw fixation of spinal fractures could potentially be an alternative to surgery in elderly AS patients with poor performance status. PMID:23842576

  17. Rejuvenation and aging of carbon in rivers: Sources, exports and interactions among fractions in the Amazon and other systems

    Microsoft Academic Search

    E. Mayorga; A. Aufdenkampe; C. Masiello; A. Krusche; P. Quay; J. Richey; S. Seitzinger

    2007-01-01

    Carbon in all its forms plays a key role in riverine ecosystems. Organic carbon (OC) sustains heterotrophic activity that produces CO2 and interacts with minerals through sorptive processes. Dissolved inorganic carbon (DIC) serves as a source for carbon fixation by autotrophs and as a key control on geochemical reactions. Organic and inorganic carbon are subject to interconversion through biologically mediated

  18. Mechanical performance of the standard Orthofix external fixator.

    PubMed

    Chao, E Y; Hein, T J

    1988-07-01

    Static and fatigue tests of the standard Orthofix unilateral external fixator (Orthofix SRL, Verona, Italy) were performed. Under similar fixation configurations, the Orthofix device offered higher bending stiffness in both directions, equal torsional stiffness, and lower axial stiffness when compared to the Hoffmann-Vidal quadrilateral frame with full pins. The bending resistance of the Orthofix ball joint was found to be proportional to its locking cam tightening torque. After applying 2 million loading cycles to the bone ends fixed by the device, the overall stiffness characteristics of the frame did not change significantly. Repetitive manual tightening and loosening of the ball joint caused abrasive wear on the cam and bushing surfaces. The locking position of the cam migrated for a mean of 45 degrees. After 50 cycles of tightening and bending to failure, the ball joint locking strength was reduced by 20% to 25%, but the stiffness did not change. Wear and stripping of the seat of the fixator body locking screw and the pin fixation screw threads were also noted. Based on the test results, the standard Orthofix device could be re-used, but certain fixator components must be inspected and replaced. The ball joint locking cam and fixation screws required periodic tightening during clinical application to prevent loss of frame stiffness under repetitive loading. Modifications of the fixator design are recommended to improve its mechanical performance. PMID:3405906

  19. Bioabsorbable expansion bolt fixation in anterior cruciate ligament reconstruction.

    PubMed

    Piltz, S; Steinbauer, T; Meyer, L; Plitz, W; Andress, H J; Lob, G

    2004-01-01

    The current study evaluated initial fixation strength of a bioabsorbable expansion bolt compared with interference screw fixation in anterior cruciate ligament reconstruction using a bone-patellar tendon-bone graft. Thirty calf tibial plateaus with adjacent patella and extensor ligaments were used. Bioabsorbable poly-L-lactide interference screws were used for graft fixation in Group I, titanium screws in Group II, and bioabsorbable poly-DL-lactide expansion bolts were used in Group III. The mean force-to-failure (+/- standard deviation) in the three groups was 487 +/- 205 N, 713 +/- 218 N, and 594 +/- 224 N, respectively. The differences between Groups I and II were significant. No statistical differences were found regarding stiffness. Graft damage was significantly less in Group III compared with screw fixation. The fixation concept of an expansion bolt shows similar fixation strength and less graft damage compared with the established interference screw fixation. Because of the total absence of torque forces in contrast to bioabsorbable screws, the risk of implant breakage is minimized. PMID:15043122

  20. Photosynthetic pathway diversity in a seasonal pool community

    USGS Publications Warehouse

    Keeley, J.E.

    1999-01-01

    1. Photosynthetic pathway diversity was evaluated for the dominant species in a seasonally aquatic community in the south-western USA using 14C pulse-chase techniques. 2. Under submerged conditions, only about half of the species were clearly C3, three of the 15 dominants were CAM, one species was C4 and three were potentially assimilating carbon with both C3 and C4 fixation. 3. During the brief terrestrial stage in the life history of these amphibious plants, both the CAM and the C3 + C4 species switched to C3, whereas the C4 species did not switch. 4. Numerous variations were apparent; for example, the C4 species, while exhibiting a biochemical pathway indistinguishable from terrestrial C4 plants, lacked Kranz anatomy in the aquatic foliage. Also, despite well-developed CAM in several species, others exhibited low-level diel changes in acidity, apparently not indicative of CAM. 5. Species with C4 or CAM CO2 concentrating mechanisms lacked the capacity for bicarbonate uptake, an alternative CO2 concentrating mechanism found in certain C3 species in this community. 6. Rubisco/PEPC in aquatic foliage was higher in C3 species than in C4, CAM or putative C3 + C4 species. In the terrestrial phase, as expected, the switch from CAM or C3 + C4 to strictly C3 assimilation was associated with a substantial increase in Rubisco/PEPC. Quite unexpected, however, was the substantial increase in this ratio in terrestrial C3 foliage. It is hypothesized that submerged C3 plants utilize PEPC for recycling of respiratory CO2 and/or C4 phototrophism under field conditions of limited CO2 and O2 saturation, and this is lost in the terrestrial foliage.

  1. ICT Pathways

    NSDL National Science Digital Library

    This page, from the Mid-Pacific Information and Communications Technology Center, provides a useful diagram for ICT educators that highlights employment pathways for students pursuing this career track. Users may click on the diagram to view a larger version.

  2. Climbing Nitrogenase: Towards a Mechanism of Enzymatic Nitrogen Fixation

    PubMed Central

    Dean, Dennis R.; Seefeldt, Lance C.

    2009-01-01

    Conspectus “Nitrogen fixation”—the reduction of dinitrogen (N2) to two ammonia (NH3) molecules—by the Mo-dependent nitrogenase is essential for all life. Despite four decades of research, a daunting number of unanswered questions about the mechanism of nitrogenase make it the ‘Everest of enzymes’. This Account describes our efforts to climb one “face” of this mountain by meeting two interdependent challenges central to determining the mechanism of biological N2 reduction. The first challenge is to determine the reaction pathway: the composition and structure of each of the substrate-derived moieties bound to the catalytic FeMocofactor (FeMo-co) of the molybdenum-iron (MoFe) protein of nitrogenase. To overcome this challenge, we need to discriminate between the two classes of potential reaction pathways: 1) a “distal” (D) pathway, in which H atoms add sequentially at a single N or 2) an “alternating” (A) pathway, in which H atoms add alternately to the two N atoms of N2. Secondly, we need to characterize the dynamics of conversion among intermediates within the accepted Lowe-Thorneley kinetic scheme for N2 reduction. That goal requires us to experimentally determine both the number of electrons/protons delivered to the MoFe protein and their “inventory”—a partition into those residing on each of the reaction components and released as H2 or NH3. The principal obstacle to this “climb” has been the inability to generate N2 reduction intermediates for characterization. A combination of genetic, biochemical, and spectroscopic approaches recently overcame this obstacle. These experiments identified one of the four-iron Fe-S faces of the active-site FeMo-cofactor as the specific site of reactivity, indicated that the sidechain of residue ?70V controls access to this face, and supported the involvement of the sidechain of residue ?195H in proton delivery. We can now freeze-quench trap N2 reduction pathway intermediates and use ENDOR/ESEEM spectroscopies to characterize them. However, even successful trapping of a N2 reduction intermediate occurs without synchronous electron delivery to the MoFe protein. As a result, the number of electrons and protons, n, delivered to MoFe during its formation is unknown. To determine n and the electron inventory, we initially employed ENDOR spectroscopy to analyze the substrate moiety bound to the FeMo-co and 57Fe within the cofactor. Difficulties in using that approach led us to devise a robust kinetic protocol for determining n of a trapped intermediate. This Account describes strategies that we have formulated to bring this “face” of the nitrogenase mechanism into view and afford approaches to its climb. Although the summit remains distant, we look forward to continued progress in the ascent. PMID:19267458

  3. Biological Nitrogen Fixation In Tropical Dry Forests Of Costa Rica

    NASA Astrophysics Data System (ADS)

    Gei, M. G.; Powers, J. S.

    2012-12-01

    Evidence suggests that tropical dry forests (TDF) are not nitrogen (N) deficient. This evidence includes: high losses of gaseous nitrogen during the rainy season, high ecosystem soil N stocks and high N concentrations in leaves and litterfall. Its been commonly hypothesized that biological nitrogen fixation is responsible for the high availability of N in tropical soils. However, the magnitude of this flux has rarely if ever been measured in tropical dry forests. Because of the high cost of fixing N and the ubiquity of N fixing legume trees in the TDF, at the individual tree level symbiotic fixation should be a strategy down-regulated by the plant. Our main goal was to determine the rates of and controls over symbiotic N fixation. We hypothesized that legume tree species employ a facultative strategy of nitrogen fixation and that this process responds to changes in light availability, soil moisture and nutrient supply. We tested this hypothesis both on naturally established trees in a forest and under controlled conditions in a shade house by estimating the quantities of N fixed annually using the 15N natural abundance method, counting nodules, and quantifying (field) or manipulating (shade house) the variation in important environmental variables (soil nutrients, soil moisture, and light). We found that in both in our shade house experiment and in the forest, nodulation varied among different legume species. For both settings, the 15N natural abundance approach successfully detected differences in nitrogen fixation among species. The legume species that we studied were able to regulate fixation depending on the environmental conditions. They showed to have different strategies of nitrogen fixation that follow a gradient of facultative to obligate fixation. Our data suggest that there exists a continuum of nitrogen fixation strategies among species. Any efforts to define tropical legume trees as a functional group need to incorporate this variation.

  4. External fixation for displaced 2-part proximal humeral fractures.

    PubMed

    Benetos, Ioannis S; Karampinas, Panayiotis K; Mavrogenis, Andreas F; Romoudis, Pavlos; Pneumaticos, Spiros G; Vlamis, John

    2012-12-01

    Studies have reported conflicting results regarding external fixation for displaced proximal humeral fractures. Compared with open reduction and internal fixation, external fixation for displaced proximal humeral fractures avoids dissection and soft tissue stripping and leads to higher union rates, a lower incidence of avascular necrosis, less scaring of the scapulohumeral interface, and faster rehabilitation. Some authors have reported good or excellent results and minimum complications compared with open reduction and internal fixation; however, others have reported that external fixation does not ensure acceptable reduction and fracture stability, especially in patients with osteoporosis.This article describes 18 patients with displaced 2-part fractures of the surgical neck of the humerus treated with closed reduction and external fixation using the Tension Guide Fixator (Gexfix SA, Carouge, Switzerland) external fixation system between 2010 and 2011. The patients included 14 women and 4 men with a mean age of 39 years. Mean follow-up was 18 months (range, 15-24 months). Fracture union; function using the Constant score, University of California Los Angeles score, Oxford score, and Quick Disabilities of the Arm, Shoulder and Hand shoulder score; and complications were evaluated. All patients experienced fracture union at a mean of 11 weeks (range, 9-13 weeks). The Tension Guide Fixator was removed without anesthesia at the outpatient clinic at a mean of 6 weeks (range, 4-8 weeks) with no loss of reduction or secondary displacement after removal. At 1-year follow-up, mean Constant and University of California Los Angeles scores were excellent, mean Oxford score showed satisfactory joint function, and mean Quick Disabilities of the Arm, Shoulder and Hand score showed minimal pain with no disability. PMID:23218629

  5. Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca.

    PubMed

    Temme, Karsten; Zhao, Dehua; Voigt, Christopher A

    2012-05-01

    Bacterial genes associated with a single trait are often grouped in a contiguous unit of the genome known as a gene cluster. It is difficult to genetically manipulate many gene clusters because of complex, redundant, and integrated host regulation. We have developed a systematic approach to completely specify the genetics of a gene cluster by rebuilding it from the bottom up using only synthetic, well-characterized parts. This process removes all native regulation, including that which is undiscovered. First, all noncoding DNA, regulatory proteins, and nonessential genes are removed. The codons of essential genes are changed to create a DNA sequence as divergent as possible from the wild-type (WT) gene. Recoded genes are computationally scanned to eliminate internal regulation. They are organized into operons and placed under the control of synthetic parts (promoters, ribosome binding sites, and terminators) that are functionally separated by spacer parts. Finally, a controller consisting of genetic sensors and circuits regulates the conditions and dynamics of gene expression. We applied this approach to an agriculturally relevant gene cluster from Klebsiella oxytoca encoding the nitrogen fixation pathway for converting atmospheric N(2) to ammonia. The native gene cluster consists of 20 genes in seven operons and is encoded in 23.5 kb of DNA. We constructed a "refactored" gene cluster that shares little DNA sequence identity with WT and for which the function of every genetic part is defined. This work demonstrates the potential for synthetic biology tools to rewrite the genetics encoding complex biological functions to facilitate access, engineering, and transferability. PMID:22509035

  6. Nitrogen fixation in the Gulf of California and the Eastern Tropical North Pacific

    NASA Astrophysics Data System (ADS)

    White, Angelicque E.; Foster, Rachel A.; Benitez-Nelson, Claudia R.; Masqué, Pere; Verdeny, Elisabet; Popp, Brian N.; Arthur, Karen E.; Prahl, Fredrick G.

    2013-02-01

    Di-nitrogen (N2) fixation plays a well-recognized role in the enhancement of primary production and arguably particle export in oligotrophic regions of the subtropical and tropical oceans. However, recent evidence suggests that N2 fixation may also be significant in regions of the surface ocean proximate to or overlying zones of intense subsurface denitrification. In this study, we present results from a series of research cruises in the Gulf of California (GoCal) and adjacent waters of the Eastern Tropical North Pacific (ETNP). Measurements include microscopy, genomic analyses, incubations, stable isotopic measurements, and sediment traps coupled with 238U:234Th disequilibria. Combined, these results suggest that N2 fixing microorganisms are present and active throughout the region, with larger sized Richelia and Trichodesmium spp. recorded within the warmer waters at the entrance to and within the GoCal, and smaller, unicellular diazotrophs observed in the cooler waters of the northern ETNP. N2 fixation rates in the summer varied from 15-70 ?mol N m-2 d-1, with episodic blooms contributing as much as 795 ?mol N m-2 d-1. While the estimated contribution of N2 fixation to particle export was highly variable, blooms of diatom-Richelia symbioses accounted for as much as ?44% of the measured summer carbon flux at 100 m. Alternately, evaluation of the N isotopic composition of sinking material and the magnitude of measured N2 fixation rates indicate negligible to small enhancements of new production when blooms of either colonial Trichodesmium spp. or unicellular diazotrophs were encountered. Consistent with previous research, we also found that while fluxes of C to sediment traps are similar in winter and summer months, the efficiency of C export (export/surface productivity) in the GoCal region is elevated during summer relative to the more productive diatom-dominated winter phase of the seasonal cycle. The episodic and variable nature of N2 fixation recorded in this region make it unlikely that new production via diazotrophic activity is solely responsible for the observed patterns of C transport efficiency; rather, we hypothesize that eolian inputs and/or efficient transport of picocyanobacterial biomass via grazing or aggregation may further explain the enhanced export efficiency observed in the GoCal summer. In sum, diazotrophy typically supports <10%, but as much as 44% of export production. The high variability of direct measurements of N2 fixation implies that other mechanisms contribute to the seasonal invariance of C flux in this region. If this region is indicative of other oxygen minima zones with active diazotrophs, our results indicate that export-mediated feedback mechanisms between N2 fixation and denitrification are not as strong as previously hypothesized.

  7. The knee: internal fixation techniques for osteochondritis dissecans.

    PubMed

    Grimm, Nathan L; Ewing, Christopher K; Ganley, Theodore J

    2014-04-01

    For the athlete with a newly diagnosed osteochondritis dissecans of the knee, the first step in formulating a treatment plan is determining the stability of the lesion. When the lesion is found to be unstable but salvageable, several methods for fixation are available. Fixation of osteochondritis dissecans in the athletic population has been described and each has its own advantages and disadvantages. Determining the most appropriate method for fixation depends on several variables and should include the athlete's level of play, sport, and overall goals. PMID:24698046

  8. Distal tibial metaphyseal fractures: the role of fibular fixation

    Microsoft Academic Search

    R. Varsalona; G. T. Liu

    2006-01-01

    Distal tibial extra-articular fractures are often a\\u000a result of complex high-energy trauma, which commonly\\u000a involves associated fibular fractures and soft tissue injury.\\u000a The goal of tibial fixation is to maximise fracture stability\\u000a without increasing soft tissue morbidity from surgical\\u000a intervention. The role of adjunctive fibular fixation in distal\\u000a tibial metaphyseal fractures has been controversial;\\u000a although fibular fixation has been shown

  9. CO(2) uptake and fixation by a thermoacidophilic microbial community attached to precipitated sulfur in a geothermal spring.

    PubMed

    Boyd, Eric S; Leavitt, William D; Geesey, Gill G

    2009-07-01

    Carbon fixation at temperatures above 73 degrees C, the upper limit for photosynthesis, is carried out by chemosynthetic thermophiles. Yellowstone National Park (YNP), Wyoming possesses many thermal features that, while too hot for photosynthesis, presumably support chemosynthetic-based carbon fixation. To our knowledge, in situ rates of chemosynthetic reactions at these high temperatures in YNP or other high-temperature terrestrial geothermal springs have not yet been reported. A microbial community attached to precipitated elemental sulfur (S(o) floc) at the source of Dragon Spring (73 degrees C, pH 3.1) in Norris Geyser Basin, YNP, exhibited a maximum rate of CO(2) uptake of 21.3 +/- 11.9 microg of C 10(7) cells(-1) h(-1). When extrapolated over the estimated total quantity of S(o) floc at the spring's source, the S(o) floc-associated microbial community accounted for the uptake of 121 mg of C h(-1) at this site. On a per-cell basis, the rate was higher than that calculated for a photosynthetic mat microbial community dominated by Synechococcus spp. in alkaline springs at comparable temperatures. A portion of the carbon taken up as CO(2) by the S(o) floc-associated biomass was recovered in the cellular nucleic acid pool, demonstrating that uptake was coupled to fixation. The most abundant sequences in a 16S rRNA clone library of the S(o) floc-associated community were related to chemolithoautotrophic Hydrogenobaculum strains previously isolated from springs in the Norris Geyser Basin. These microorganisms likely contributed to the uptake and fixation of CO(2) in this geothermal habitat. PMID:19429558

  10. CO2 Uptake and Fixation by a Thermoacidophilic Microbial Community Attached to Precipitated Sulfur in a Geothermal Spring? †

    PubMed Central

    Boyd, Eric S.; Leavitt, William D.; Geesey, Gill G.

    2009-01-01

    Carbon fixation at temperatures above 73°C, the upper limit for photosynthesis, is carried out by chemosynthetic thermophiles. Yellowstone National Park (YNP), Wyoming possesses many thermal features that, while too hot for photosynthesis, presumably support chemosynthetic-based carbon fixation. To our knowledge, in situ rates of chemosynthetic reactions at these high temperatures in YNP or other high-temperature terrestrial geothermal springs have not yet been reported. A microbial community attached to precipitated elemental sulfur (So floc) at the source of Dragon Spring (73°C, pH 3.1) in Norris Geyser Basin, YNP, exhibited a maximum rate of CO2 uptake of 21.3 ± 11.9 ?g of C 107 cells?1 h?1. When extrapolated over the estimated total quantity of So floc at the spring's source, the So floc-associated microbial community accounted for the uptake of 121 mg of C h?1 at this site. On a per-cell basis, the rate was higher than that calculated for a photosynthetic mat microbial community dominated by Synechococcus spp. in alkaline springs at comparable temperatures. A portion of the carbon taken up as CO2 by the So floc-associated biomass was recovered in the cellular nucleic acid pool, demonstrating that uptake was coupled to fixation. The most abundant sequences in a 16S rRNA clone library of the So floc-associated community were related to chemolithoautotrophic Hydrogenobaculum strains previously isolated from springs in the Norris Geyser Basin. These microorganisms likely contributed to the uptake and fixation of CO2 in this geothermal habitat. PMID:19429558

  11. Enhanced N2-fixation and NH4+ recycling during oceanic anoxic event 2 in the proto-North Atlantic

    NASA Astrophysics Data System (ADS)

    Ruvalcaba Baroni, I.; Tsandev, I.; Slomp, C. P.

    2014-10-01

    from sediment core records and model studies suggests that increased nutrient supply played a key role in the initiation of the Cenomanian-Turonian oceanic anoxic event 2 (OAE2; 94 Ma). However, the relative roles of nitrogen (N) and phosphorus (P) availability in controlling primary productivity during the event are not fully understood. Here we expand an existing multibox model of the coupled cycles of P, carbon, and oxygen in the proto-North Atlantic by adding the marine N cycle. With the updated version of the model, we test the hypothesis that enhanced availability of P can fuel N2-fixation, increase primary productivity and drive large parts of the proto-North Atlantic to anoxia during OAE2. In a sensitivity analysis, we demonstrate that N dynamics in the proto-North Atlantic respond strongly to variations in oxygen and P supply from the Pacific Ocean and to changes in circulation. The implemented N cycle weakly modifies the carbon cycle, implying that P was the major nutrient controlling primary productivity during OAE2. Our model suggests that both N2-fixation and upwelling of recycled NH4+ were enhanced during OAE2 and that N2-fixation was the major source of N in the proto-North Atlantic. Denitrification was more important in the water column than in sediments, with high rates in the open ocean and in the Western Interior. High P inputs in the proto-North Atlantic led to widespread N2-fixation, which more than compensated for the loss of N through denitrification. As a consequence, rates of primary productivity and organic carbon burial were high.

  12. Dissolution of steelmaking slags in acetic acid for precipitated calcium carbonate production

    Microsoft Academic Search

    Sebastian Teir; Sanni Eloneva; Carl-Johan Fogelholm; Ron Zevenhoven

    2007-01-01

    A promising option for long-term storage of CO2 is to fixate carbon dioxide as magnesium- and calcium carbonates. Slags from iron and steel works are potential raw materials for carbonation due to their high contents of calcium silicates. Precipitated calcium carbonate (PCC) is used as filler and coating materials in paper. If slag could be used instead of limestone for

  13. Iron deficiency increases growth and nitrogen-fixation rates of phosphorus-deficient marine cyanobacteria.

    PubMed

    Garcia, Nathan S; Fu, Feixue; Sedwick, Peter N; Hutchins, David A

    2015-01-01

    Marine dinitrogen (N2)-fixing cyanobacteria have large impacts on global biogeochemistry as they fix carbon dioxide (CO2) and fertilize oligotrophic ocean waters with new nitrogen. Iron (Fe) and phosphorus (P) are the two most important limiting nutrients for marine biological N2 fixation, and their availabilities vary between major ocean basins and regions. A long-standing question concerns the ability of two globally dominant N2-fixing cyanobacteria, unicellular Crocosphaera and filamentous Trichodesmium, to maintain relatively high N2-fixation rates in these regimes where both Fe and P are typically scarce. We show that under P-deficient conditions, cultures of these two cyanobacteria are able to grow and fix N2 faster when Fe deficient than when Fe replete. In addition, growth affinities relative to P increase while minimum concentrations of P that support growth decrease at low Fe concentrations. In Crocosphaera, this effect is accompanied by a reduction in cell sizes and elemental quotas. Relatively high growth rates of these two biogeochemically critical cyanobacteria in low-P, low-Fe environments such as those that characterize much of the oligotrophic ocean challenge the common assumption that low Fe levels can have only negative effects on marine primary producers. The closely interdependent influence of Fe and P on N2-fixing cyanobacteria suggests that even subtle shifts in their supply ratio in the past, present and future oceans could have large consequences for global carbon and nitrogen cycles. PMID:24972068

  14. Biomechanical evaluation of maxillary Lefort ? fracture with bioabsorbable osteosynthesis internal fixation.

    PubMed

    Wu, Wei; Zhou, Jiang; Xu, Chong-Tao; Zhang, Jie; Jin, Yan-Jiao; Sun, Geng-Lin

    2014-12-01

    The aim of this study was to apply biomechanical analysis model to evaluate the effects of bioabsorbable internal fixation devices on maxillary Lefort ? fracture. CT scan technology and the finite element software (ansys) were used to establish three-dimensional finite element models of five resorbable internal fixation devices in maxillary Lefort ? fractures. We used the model to calculate the stress of the upper jaw and internal fixation. We further analyzed the stability of fixation under four occlusions. The fixation using two bioabsorbable plates was not stable. The zygomaticomaxillary pillars fixation is more stable than other fixations. The stability of fracture fixation was influenced with the molar occlusion. The current study developed a functional three-dimensional finite element model of bioabsorbable internal fixation and compared the stability of five fixation methods for maxillary Lefort ? fractures. The results would facilitate the application of bioabsorbable materials in dental clinic. PMID:25146129

  15. Cemented versus cementless fixation in total knee arthroplasty

    PubMed Central

    MATASSI, FABRIZIO; CARULLI, CHRISTIAN; CIVININI, ROBERTO; INNOCENTI, MASSIMO

    2013-01-01

    The question of whether to use cemented or cement-less fixation for a total knee arthroplasty (TKA) is still debated. Discouraging preliminary results of cement-less TKAs have determined the worldwide use of cemented implants. However, with the development of biotechnologies and new biomaterials with high osteoconductive properties, biological fixation is now becoming an attractive option for improving the longevity of TKAs, especially in young patients. There is no evidence in the current literature to support the use of one method of fixation. The extensive clinical experience with cemented implants gathered over the years justifies their widespread use. New randomized clinical trials are necessary to compare cementless fixation based on the new ingrowth surfaces with standard cemented implants. PMID:25606521

  16. Infra-Red Process for Colour Fixation on Fabrics

    E-print Network

    Biau, D.; Raymond, D. J.

    1983-01-01

    advantages: energy direct transmission, emitter and product spectral coupling, possible selectivity. That is the case in the Textile Industry, where experiments showed that infra-red process heating could be efficient for color fixation on fabrics. Shorter...

  17. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES GENERAL AND PLASTIC SURGERY DEVICES Prosthetic Devices § 878.3250 External facial fracture fixation appliance. (a) Identification. An external...

  18. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES GENERAL AND PLASTIC SURGERY DEVICES Prosthetic Devices § 878.3250 External facial fracture fixation appliance. (a) Identification. An external...

  19. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES GENERAL AND PLASTIC SURGERY DEVICES Prosthetic Devices § 878.3250 External facial fracture fixation appliance. (a) Identification. An external...

  20. Technical tips: dualplate fixation technique for comminuted proximal humerus fractures.

    PubMed

    Choi, Sungwook; Kang, Hyunseong; Bang, Hyeongsig

    2014-08-01

    The authors report dualplate fixation technique for providing stable fixation in comminuted proximal humerus fractures. This technique has been used for proximal humerus fractures with metaphyseal comminution and provides excellent anatomical reduction and neck shaft angle (NSA). The recently locking plate is clinically more widely used due to its small size, low rigidity, high elasticity, and biomechanical properties such as fixed initial angle and rotational stability. However, in severely comminuted complex type proximal metaphyseal humerus fractures, the use of locking plate alone does not provide stable fixation, leading to complications such as varus collapse, anterior-posterior angulation, screw cutout, nonunion, malunion, and metal failure. Therefore, a more robust and enhanced fixation method, the dual plating technique using the locking compression plate (Proximal Humeral Internal Locking System and Variable Angle Locking Compression Plate) was developed. PMID:24813097

  1. Dinitrogen fixation and dissolved organic nitrogen fueled primary production and particulate export during the VAHINE mesocosms experiment (New Caledonia lagoon)

    NASA Astrophysics Data System (ADS)

    Berthelot, H.; Moutin, T.; L'Helguen, S.; Leblanc, K.; Hélias, S.; Grosso, O.; Leblond, N.; Charrière, B.; Bonnet, S.

    2015-03-01

    In the oligotrophic ocean characterized by nitrate (NO3-) depletion in surface waters, dinitrogen (N2) fixation and dissolved organic nitrogen (DON) can represent significant nitrogen (N) sources for the ecosystem. Here we deployed in New Caledonia large in situ mesocosms in order to investigate (1) the contribution of N2 fixation and DON use to primary production (PP) and particle export and (2) the fate of the freshly produced particulate organic N (PON) i.e. whether it is preferentially accumulated and recycled in the water column or exported out of the system. The mesocosms were fertilized with phosphate (P) in order to prevent P-limitation and promote N2 fixation. The diazotrophic community was dominated by diatoms-diazotrophs associations (DDAs) during the first part of the experiment for 10 days (P1) followed by the unicellular N2-fixing cyanobacteria UCYN-C the 9 last days (P2) of the experiment. N2 fixation rates averaged 9.8 ± 4.0 and 27.7 ± 8.6 nM d-1 during P1 and P2, respectively. NO3- concentrations (< 40 nM) in the mesocosms were a negligible source of N indicating that N2 fixation was the main driver of new production all along the experiment. The contribution of v fixation to PP was not significantly different (p > 0.05) during P1 (9.0 ± 3.3%) and P2 (12.6 ± 6.1%). However, the e ratio that quantifies the efficiency of a system to export particulate organic carbon (POCexport) compared to PP (e ratio = POCexport/PP) was significantly higher (p < 0.05) during P2 (39.7 ± 24.9%) than during P1 (23.9 ± 20.2%) indicating that the production sustained by UCYN-C was more efficient at promoting C export than the production sustained by DDAs. During P1, PON was stable and the total amount of N provided by N2 fixation (0.10 ± 0.02 ?M) was not significantly different (p > 0.05) from the total amount of PON exported (0.10 ± 0.04 ?M), suggesting a rapid and probably direct export of the recently fixed N2 by the DDAs. During P2, both PON concentrations and PON export increased in the mesocosms by a factor 1.5-2. Unlike in P1, this PON production was not totally explained by the new N provided by N2 fixation. The use of DON, whose concentrations decreased significantly (p < 0.05) from 5.3 ± 0.5 ?M to 4.4 ± 0.5 ?M, appeared to be the missing N source. The DON consumption of about 0.9 ?M during P2 is even higher than the total amount of new N brought by N2 fixation (about 0.25 ?M) during the same period. These results suggest that while DDAs mainly rely on N2 fixation for their N requirement, both N2 fixation and DON can be significant N-sources for primary production and particulate export following UCYN-C blooms in the New Caledonia lagoon and by extension in the N-limited Ocean where similar events are likely to occur.

  2. Gastric Band Port Site Fixation: Which Method Is Best?

    PubMed Central

    Owers, Corinne E.; Barkley, Sarah M.

    2015-01-01

    Laparoscopic adjustable gastric banding is a popular and successful bariatric surgical technique. Although short-term complications are few in number, long-term complications are more common. One such complication is flippage of the gastric band port. This study compares three popular methods of port fixation and demonstrates that fixation with nonabsorbable mesh helps to prevent port flippage when compared to other techniques, reducing the need for repositioning operations. PMID:25694826

  3. Fixation Stability and Scotoma Mapping for Patients with Low Vision

    PubMed Central

    Elsner, Ann E.; Petrig, Benno L.; Papay, Joel A.; Kollbaum, Elli J.; Clark, Christopher A.; Muller, Matthew S.

    2013-01-01

    Purpose To develop a simplified device that performs fundus perimetry techniques, such as fixation mapping and kinetic perimetry. Methods We added visual stimulation to a near infrared retinal imager, the Laser Scanning Digital Camera (LSDC). This device uses slit scanning illumination combined with a 2 dimensional CMOS detector, with continuous viewing of the retina. The CMOS read-out was synchronized with the slit scanning, thereby serving as a confocal aperture to reduce stray light in retinal images. Series of retinal images of 36 deg were automatically aligned to provide data for fixation maps and quantification of fixation stability. The LSDC and alignment techniques also provided fundus viewing with retinal location correction for scotoma mapping. Results First, fixation mapping was readily performed in patients with central scotoma or amblyopia. The automatic alignment algorithm allowed quantification of fixation stability in patients with macular pathologies that did not cause scotoma. Second, fixation stability was rapidly and quantitatively assessed by the automatic registration of a series of retina images. There was no significant difference in the fixation stability with automatic vs. manual alignment. Kinetic perimetry demonstrated that fundus imaging helped reduce the variability of perimetric data by identifying and preventing false positives due to eye motion. We found that the size of the blind spot was significantly larger for dark targets on brighter backgrounds than when the contrast was reversed (p < 0.045). This is consistent with incremental targets being detected partially or wholly due to scattered light falling on more sensitive retinal locations. Conclusions Fundus perimetry with the LSDC allows for a wide range of fixation and perimetry tasks. PMID:23334309

  4. Biological N Fixation Rates in a Tropical Dry Forest Ecosystem

    NASA Astrophysics Data System (ADS)

    Santiago, L. S.; Dawson, T. E.

    2005-12-01

    Because tropical legumes are usually the dominant family in forests of the Neotropics and Africa, they represent the greatest potential terrestrial cover of N-fixing species globally. Tropical dry forests therefore may have the greatest rates of biological N-fixation of any ecosystem type. Our objective was to determine the number of legume species that fix N along a successional gradient (10, 20, and 30 years) using a combination of nodule excavation, nodule incubations, and N isotopic composition of foliage. We also quantified non-symbiotic N-fixation by free-living fixers in litter and soil. We found that 21 out of 23 legume species were nodulated. Calculations of percent N from fixation, based on N isotopic composition, ranged from 1-78 percent for individual species. At the stand level, estimates of symbiotic N-fixation was 13.9, 23.1, and 27.8 kg N/ha/yr in 10, 20, and 30 year old forest, respectively. Total non-symbiotic N-fixation, based on acetylne reduction incubations of leaf litter, fine woody debris and surface soil, was 7.5 kg N/ha/yr during the dry season and 17.1 kg N/ha/yr during the wet season. Total ecosystem estimates were 38.5, 47.7, and 52.4 kg N/ha/yr in 10, 20, and 30 year old forest, respectively. Overall, we found that non-symbiotic N-fixation was a greater proportion of total biological N-fixation than has been reported in other tropical dry forests and savanas, but our total biological N-fixation values were similar.

  5. Iris-Fixated Intraocular Lenses for Ametropia and Aphakia

    PubMed Central

    Simões, Pedro S; Ferreira, Tiago B

    2014-01-01

    Implantation of intraocular lens with Iris-fixation is a safe, efficient and predictable surgical procedure, which empowers the refractive surgeon with singular capabilities. Among their advantages are the reversibility, preservation of accommodation and a broad spectrum of ametropic correction. This lens also appears to be a valid option, with a favorable complication rate, for the treatment of aphakic eyes without capsular support. This article is a review of iris-fixated intraocular lenses and considers their principal indications, complications, and outcomes.

  6. Biomechanical Study of Acetabular Tridimensional Memoryalloy Fixation System

    NASA Astrophysics Data System (ADS)

    Liu, Xin-Wei; Xu, Shuo-Gui; Zhang, Yun-Tong; Zhang, Chun-Cai

    2011-07-01

    We developed the acetabular tridimensional memoryalloy fixation system (ATMFS), which is made of NiTi shape memory alloy, according to the specific mechanical properties of biological memory material, NiTi shape memory alloy and measured distribution of contact area and pressure between the acetabulum and the femoral head of cadaveric pelvis. Seven formalin-preserved cadaveric pelves were used for this investigation. Pressure-sensitive film was used to measure contact area and pressure within the anterior, superior, and posterior regions of the acetabulum. The pelves were loaded under the following four conditions: (1) intact; (2) following a creation posterior wall fracture defect; (3) following reduction and standard internal fixation with reconstruction plate; and (4) following reduction and internal fixation with a new shape memory alloy device named ATMFS. A posterior wall fracture was created along an arc of 40° to 90° about the acetabulur rim. Creation of a posterior wall defect resulted in increased load in the superior acetabulum (1485 N) as compared to the intact condition (748 N, P = 0.009). Following reduction and internal fixation, the load distributed to the superior acetabulum (1545 N) was not statistically different from the defect condition. Following the fixation with ATMFS, the load seen at the superior region of the actabulum (964 N) was familiar with fixation with reconstruction plate and was not different from intact state ( P = 0.45). These data indicate that the use of ATMFS as a fracture internal fixation device resulted a partial restoration of joint loading parameters toward the intact state. ATMFS fixation may result in a clinical benefit.

  7. Micromotion analysis of the fixation of total knee tibial component

    Microsoft Academic Search

    M. Tissakht; H. Eskandari; A. M. Ahmed

    1995-01-01

    Immediate post-operative stability is critical for the long-term success of biological implant fixations. Excessive motion at the bone-prosthesis interface is known to inhibit bone ingrowth and thereby cause failure of the fixation. In the present study, relative displacements between the host bone and the tibial component of total knee implants were evaluated, and the effect of the method on the

  8. Fixation, transformation, and mobilization of arsenic in sediments

    Microsoft Academic Search

    James M. Brannon; William H. Patrick

    1987-01-01

    Fixation, speciation, and mobilization of sediment arsenic (As) during sediment-water interactions were studied. Emphasis was placed on transformation and fixation of As(V) in anaerobic sediment, long-term (6 months) release of naturally occurring and added As, and sediment properties affecting the mobilization of As(V), As(III), and organic As. Arsenic added to sediment became associated with relatively immobile iron and aluminum compounds.

  9. Anterior subcutaneous internal fixation for treatment of unstable pelvic fractures

    PubMed Central

    2014-01-01

    Background Fractures of the pelvic ring including disruption of the posterior elements in high-energy trauma have both high morbidity and mortality rates. For some injury pattern part of the initial resuscitation includes either external fixation or plate fixation to close the pelvic ring and decrease blood loss. In certain situations – especially when associated with abdominal trauma and the need to perform laparotomies – both techniques may put the patient at risk of either pintract or deep plate infections. We describe an operative approach to percutaneously close and stabilize the pelvic ring using spinal implants as an internal fixator and report the results in a small series of patients treated with this technique during the resuscitation phase. Findings Four patients were treated by subcutaneous placement of an internal fixator. Screw fixation was carried out by minimally invasive placement of two supra-acetabular iliac screws. Afterwards, a subcutaneous transfixation rod was inserted and attached to the screws after reduction of the pelvic ring. All patients were allowed to fully weight-bear. No losses of reduction or deep infections occurred. Fracture healing was uneventful in all cases. Conclusion Minimally invasive fixation is an alternative technique to stabilize the pelvic ring. The clinical results illustrate that this technique is able to achieve good results in terms of maintenance of reduction the pelvic ring. Also, abdominal surgeries no longer put the patient at risk of infected pins or plates. PMID:24606833

  10. Histomorphometric comparison after fixation with formaldehyde or glyoxal

    PubMed Central

    Wang, YN; Lee, K; Pai, S; Ledoux, WR

    2014-01-01

    Formaldehyde has long been the fixative of choice for histological examination of tissue. The use of alternatives to formaldehyde has grown, however, owing to the serious hazards associated with its use. Companies have striven to maintain the morphological characteristics of formaldehyde-fixed tissue when developing alternatives. Glyoxal-based fixatives now are among the most popular formaldehyde alternatives. Although there are many studies that compare staining quality and immunoreactivity, there have been no studies that quantify possible structural differences. Histomorphometric analysis commonly is used to evaluate diseased tissue. We compared fixation with formaldehyde and glyoxal with regard to the histomorphological properties of plantar foot tissue using a combination of stereological methods and quantitative morphology. We measured skin thickness, interdigitation index, elastic septa thickness, and adipocyte area and diameter. No significant differences were observed between formaldehyde and glyoxal fixation for any feature measured. The glyoxal-based fixative used therefore is a suitable fixative for structural evaluation of plantar soft tissue. Measurements obtained from the glyoxal-fixed tissue can be combined with data obtained from formalin-fixed for analysis. PMID:20854226

  11. The biomechanics of wire fixation in the Ilizarov system.

    PubMed

    Mullins, M M; Davidson, A W; Goodier, David; Barry, M

    2003-02-01

    The purpose of this study was to establish the optimal fixation of tensioned wires to the frame construct in the Ilizarov system. The usual torque to which the fixation bolts were tightened in clinical practice was established by serial testing of orthopaedic surgeons' work in our unit. The force required to produce wire slippage from the different types of wire fixation bolts, tightened to a predetermined torque, was measured using a testing rig. Analysis of the usual torque to which bolts were tightened in clinical practice, revealed values in the range of 5-10Nm. The load required to cause failure of the tensioned wire varied considerably depending on the bolt configuration used and the applied torque. In clinical practice, wires are tensioned using a dynamometer to a variety of loads, depending on the clinical situation, up to 1275N. In applying multiple wires across a single ring, as is normal practice, these loads may be increased still further. The total load transmitted by single wires in weightbearing may be up to 2000N. Utilising the results of our work has enabled us to choose, where practically possible, the optimal bolt configuration for wire fixation. In addition, this work has revealed that in order to withstand the loads seen in clinical practice, wire fixation bolts should be tightened to at least 10Nm. Post-operatively, we now tighten all our wire fixation bolts to 10Nm, using a calibrated torque wrench. PMID:12565025

  12. Suture Bridge Fixation of a Femoral Condyle Traumatic Osteochondral Defect

    PubMed Central

    Bowers, Andrea L.

    2008-01-01

    Internal fixation of a traumatic osteochondral defect presents a challenge in terms of obtaining anatomic reduction, fixation, and adequate compression for healing. Fixation with countersunk intraarticular screws, Herbert screws, bioabsorbable screws and pins, mini-cancellous screws, and glue tissue adhesive have been reported with varying results. We present an alternative fixation method used in two patients for femoral condylar defects that achieved anatomic reduction with compression via a cruciate-shaped suture bridge construct tied down over a bony bridge. This fixation method allowed early passive range of motion and permitted high-quality MRI for followup of fracture healing and articular cartilage integrity. Arthroscopic examination of one of two patients at 6 months followup showed the gross appearance of a healed, anatomically reduced fracture. With 1 year followup for one patient and 2 years for the other, the patients have resumed activity as tolerated with full, painless range of motion at the knee. Longer-term outcomes are unknown. However, the suture bridge is an alternative means of fixation with encouraging early results for treatment of traumatic osteochondral fragments in the knee. Level of Evidence: Level IV, therapeutic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18584263

  13. Biodegradable interlocking nails for fracture fixation.

    PubMed

    van der Elst, M; Bramer, J A; Klein, C P; de Lange, E S; Patka, P; Haarman, H J

    1998-12-01

    Serious problems such as stress shielding, allergic reactions, and corrosion are associated with the use of metallic fracture fixation devices in fractured long bones. Metal implants often are removed during a second retrieval operation after fracture healing has completed. A biocompatible implant that degrades slowly during implantation would obviate the need for a second operation and save the patient from considerable physical, psychologic, and financial discomfort. The biodegradable implant must provide the fractured limb sufficient support for a certain time, allowing early loading. A gradual transfer of load from the biodegradable implant to the bone would result in a better product of bone healing and avoid stress shielding. In an animal model using adult sheep, two types of biodegradable polymer interlocking nails were tested in comparison with a stainless steel interlocking nail. Fracture healing, mechanical properties of the bones, degradation behavior in vivo and in vitro, and tissue response were monitored during a 2 1/2-year followup study. To detect shifts in acid base relations caused by the release of acid compounds, pH measurements were performed. Fracture healing was unimpaired, and the mechanical test results of all three groups were excellent. Histologic analysis showed a mild inflammatory response, but no pH shifts were observed. The results of this study justify additional research on these promising materials. PMID:9917717

  14. GLUTARALDEHYDE FIXATION OF ISOLATED EUCARYOTIC NUCLEI

    PubMed Central

    Olins, Donald E.; Wright, Everline B.

    1973-01-01

    Isolated chicken erythrocyte nuclei have been incubated with dilute concentrations of the bifunctional cross-linking agent glutaraldehyde (0–20 mM) in order to stabilize histone-histone interactions within the native nucleus. The kinetics of the disappearance of acid-soluble histones, free amino groups, and of individual histones have been observed to be pseudo first-order. Apparent first-order rate constants for the disappearance of individual histones correlate with the lysine mole percent of that fraction and follow the ranking, kapp: F1 > F2C > F2B ? F2A2, F2A1, F3. Histone polymers were observed to form very rapidly during the fixation reaction. Partial fractionation and amino acid analyses of these polymers support the view that they are composed principally of cross-linked (F2C)n molecules (where n = 2 to ?8). The rate of glutaraldehyde reaction with free amino groups in histones is drastically reduced in solvents that promote chromatin decondensation (i.e., low ionic strengths in the absence of divalent cations) whereas the formation of cross-linked F2C polymers is less severely reduced. It is proposed that some F2C histones exist in close proximity within the isolated erythrocyte nucleus. PMID:4217800

  15. [Anatomical and radiological aspects in lumbopelvic fixation].

    PubMed

    Gothner, M; Dudda, M; Schildhauer, T A

    2013-11-01

    Spinal and pelvic surgery (as in neuromuscular scoliosis or unilateral highly unstable vertical sacral fractures or unstable H- or U-shaped sacral fractures) relies on lumbopelvic fixation. This technique belongs to the standard procedures for lumbosacral injuries in orthopedic surgery. Preoperatively, a CT scan with 1 mm slices is essential to detect anatomical variants and cortical narrow nesses. For optimal insertion of pedicel screws, knowledge of the pedicle diameter and length is necessary and screws should be placed convergent to each other taking into consideration the pedicle length and angle. For placement of the iliac screws exact knowledge of the anatomy is essential to avoid cortical wall perforation and neurovascular injuries. The safest screw path was determined as the bony canal between the posterior superior iliac spine (PSIS) and the anterior inferior iliac spine (AIIS). Intraoperatively, standard fluoroscopic views allow safe placement of the screws. The aim of the following manuscript is to illustrate anatomical and morphological aspects of the spine and pelvis as well as to describe important bony landmarks and optimal intraoperative C-arm views for optimal screw insertion. PMID:24233082

  16. Fluctuation driven fixation of cooperative behavior.

    PubMed

    Houchmandzadeh, Bahram

    2015-01-01

    Cooperative behaviors are defined as the production of common goods benefitting all members of the community at the producer's cost. They could seem to be in contradiction with natural selection, as non-cooperators have an increased fitness compared to cooperators. Understanding the emergence of cooperation has necessitated the development of concepts and models (inclusive fitness, multilevel selection, etc.) attributing deterministic advantages to this behavior. In contrast to these models, we show here that cooperative behaviors can emerge by taking into account only the stochastic nature of evolutionary dynamics: when cooperative behaviors increase the population size, they also increase the genetic drift against non-cooperators. Using the Wright-Fisher models of population genetics, we compute exactly this increased genetic drift and its consequences on the fixation probability of both types of individuals. This computation leads to a simple criterion: cooperative behavior dominates when the relative increase in population size caused by cooperators is higher than the selection pressure against them. This is a purely stochastic effect with no deterministic interpretation. PMID:25451769

  17. Photorespiration and nitrate assimilation: a major intersection between plant carbon and nitrogen.

    PubMed

    Bloom, Arnold J

    2015-02-01

    C3 carbon fixation has a bad reputation, primarily because it is associated with photorespiration, a biochemical pathway thought to waste a substantial amount of the carbohydrate produced in a plant. This review presents evidence collected over nearly a century that (1) Rubisco when associated with Mn(2+) generates additional reductant during photorespiration, (2) this reductant participates in the assimilation of nitrate into protein, and (3) this nitrate assimilation facilitates the use of a nitrogen source that other organisms tend to avoid. This phenomenon explains the continued dominance of C3 plants during the past 23 million years of low CO2 atmospheres as well as the decline in plant protein concentrations as atmospheric CO2 rises. PMID:25366830

  18. A re-investigation of the path of carbon in photosynthesis utilizing GC\\/MS methodology. Unequivocal verification of the participation of octulose phosphates in the pathway

    Microsoft Academic Search

    Ian L. Flanigan; John K. MacLeod; John F. Williams

    2006-01-01

    A GC\\/EIMS\\/SIM methodology has been developed to re-examine the path of carbon in photosynthesis. Exposing isolated spinach\\u000a chloroplasts to 13CO2 on a solid support for a defined period followed by quenching and work-up provided a mixture of labelled sugar phosphates.\\u000a After enzymatic dephosphorylation and derivatization, the Mox-TMS sugars were analysed using the above method. The purpose\\u000a of the study was

  19. Diurnal rhythm of a unicellular diazotrophic cyanobacterium under mixotrophic conditions and elevated carbon dioxide.

    PubMed

    Gaudana, Sandeep B; Alagesan, Swathi; Chetty, Madhu; Wangikar, Pramod P

    2013-11-01

    Mixotrophic cultivation of cyanobacteria in wastewaters with flue gas sparging has the potential to simultaneously sequester carbon content from gaseous and aqueous streams and convert to biomass and biofuels. Therefore, it was of interest to study the effect of mixotrophy and elevated CO2 on metabolism, morphology and rhythm of gene expression under diurnal cycles. We chose a diazotrophic unicellular cyanobacterium Cyanothece sp. ATCC 51142 as a model, which is a known hydrogen producer with robust circadian rhythm. Cyanothece 51142 grows faster with nitrate and/or an additional carbon source in the growth medium and at 3 % CO2. Intracellular glycogen contents undergo diurnal oscillations with greater accumulation under mixotrophy. While glycogen is exhausted by midnight under autotrophic conditions, significant amounts remain unutilized accompanied by a prolonged upregulation of nifH gene under mixotrophy. This possibly supports nitrogen fixation for longer periods thereby leading to better growth. To gain insights into the influence of mixotrophy and elevated CO2 on circadian rhythm, transcription of core clock genes kaiA, kaiB1 and kaiC1, the input pathway, cikA, output pathway, rpaA and representatives of key metabolic pathways was analyzed. Clock genes' transcripts were lower under mixotrophy suggesting a dampening effect exerted by an external carbon source such as glycerol. Nevertheless, the genes of the clock and important metabolic pathways show diurnal oscillations in expression under mixotrophic and autotrophic growth at ambient and elevated CO2, respectively. Taken together, the results indicate segregation of light and dark associated reactions even under mixotrophy and provide important insights for further applications. PMID:23881383

  20. SUMMARY FOR POLICYMAKERS Modeling Optimal Transition Pathways to a Low

    E-print Network

    California at Davis, University of

    SUMMARY FOR POLICYMAKERS Modeling Optimal Transition Pathways to a Low Carbon Economy in California and trade, the low carbon fuel standard, GHG regulations for cars and trucks). These policies represent). Meeting the 80% reduction target is possible with additional availability of low-carbon carbon energy

  1. Use of an aiming device in posterior atlantoaxial transarticular screw fixation. Technical note.

    PubMed

    Neo, Masasi; Matsushita, Mutsumi; Yasuda, Tadashi; Sakamoto, Takeshi; Nakamura, Takashi

    2002-07-01

    Posterior atlantoaxial transarticular screw fixation is an excellent procedure associated with high fusion rates. There is, however, the potential risk of vertebral artery (VA) injury. The authors designed a special aiming device that allows a cannulated screw to be inserted accurately in the most posterior part of the C1-2 joint via the most posterior and medial part of the isthmus of C-2; this screw pathway most safely avoids VA injury. The instruments include an aiming device and a flexible screw-inserting system. The tip of the aiming device is placed on the ridge of the C-2 isthmus just posterior to the atlantoaxial joint. The guide wire should then pass 1 mm below the device tip. The system consists of flexible guide wires, a drill, a tap, and a screwdriver, and the screw is inserted easily via a posterior approach in which the patient's back is not obstructive. Ten patients with atlantoaxial subluxation or osteoarthritis underwent surgery in which the device was used. In all cases, the screws were inserted safely without causing VA injury, although preoperative computerized tomography (CT) reconstructions revealed a high-risk high-riding unilateral VA in three patients. Postoperative CT reconstructions demonstrated that all screws but one were inserted as planned, and successfully cleared the vertebral groove. In conclusion, this newly designed device is practical and useful for the accurate insertion of screws, thus avoiding VA injury during atlantoaxial transarticular screw fixation. PMID:12120635

  2. Fixating on metals: new insights into the role of metals in nodulation and symbiotic nitrogen fixation

    PubMed Central

    González-Guerrero, Manuel; Matthiadis, Anna; Sáez, Áez;ngela; Long, Terri A.

    2014-01-01

    Symbiotic nitrogen fixation is one of the most promising and immediate alternatives to the overuse of polluting nitrogen fertilizers for improving plant nutrition. At the core of this process are a number of metalloproteins that catalyze and provide energy for the conversion of atmospheric nitrogen to ammonia, eliminate free radicals produced by this process, and create the microaerobic conditions required by these reactions. In legumes, metal cofactors are provided to endosymbiotic rhizobia within root nodule cortical cells. However, low metal bioavailability is prevalent in most soils types, resulting in widespread plant metal deficiency and decreased nitrogen fixation capabilities. As a result, renewed efforts have been undertaken to identify the mechanisms governing metal delivery from soil to the rhizobia, and to determine how metals are used in the nodule and how they are recycled once the nodule is no longer functional. This effort is being aided by improved legume molecular biology tools (genome projects, mutant collections, and transformation methods), in addition to state-of-the-art metal visualization systems. PMID:24592271

  3. iTRAQ-based quantitative proteomics analysis of Brassica napus leaves reveals pathways associated with chlorophyll deficiency.

    PubMed

    Chu, Pu; Yan, Gui Xia; Yang, Qing; Zhai, Li Na; Zhang, Cheng; Zhang, Feng Qi; Guan, Rong Zhan

    2015-01-15

    Photosynthesis, the primary source of plant biomass, is important for plant growth and crop yield. Chlorophyll is highly abundant in plant leaves and plays essential roles in photosynthesis. We recently isolated a chlorophyll-deficient mutant (cde1) from ethyl methanesulfonate (EMS) mutagenized Brassica napus. Herein, quantitative proteomics analysis using the iTRAQ approach was conducted to investigate cde1-induced changes in the proteome. We identified 5069 proteins from B. napus leaves, of which 443 showed differential accumulations between the cde1 mutant and its corresponding wild-type. The differentially accumulated proteins were found to be involved in photosynthesis, porphyrin and chlorophyll metabolism, biosynthesis of secondary metabolites, carbon fixation, spliceosome, mRNA surveillance and RNA degradation. Our results suggest that decreased abundance of chlorophyll biosynthetic enzymes and photosynthetic proteins, impaired carbon fixation efficiency and disturbed redox homeostasis might account for the reduced chlorophyll contents, impaired photosynthetic capacity and increased lipid peroxidation in this mutant. Epigenetics was implicated in the regulation of gene expression in cde1, as proteins involved in DNA/RNA/histone methylation and methylation-dependent chromatin silencing were up-accumulated in the mutant. Biological significance Photosynthesis produces more than 90% of plant biomass and is an important factor influencing potential crop yield. The pigment chlorophyll plays essential roles in light harvesting and energy transfer during photosynthesis. Mutants deficient in chlorophyll synthesis have been used extensively to investigate the chlorophyll metabolism, development and photosynthesis. However, limited information is available with regard to the changes of protein profiles upon chlorophyll deficiency. Here, a combined physiological, histological, proteomics and molecular analysis revealed several important pathways associated with chlorophyll deficiency. This work provides new insights into the regulation of chlorophyll biosynthesis and photosynthesis in higher plants and these findings may be applied to genetic engineering for high photosynthetic efficiency in crops. PMID:25317966

  4. Improving CO2 fixation efficiency by optimizing Chlorella PY-ZU1 culture conditions in sequential bioreactors.

    PubMed

    Cheng, Jun; Huang, Yun; Feng, Jia; Sun, Jing; Zhou, Junhu; Cen, Kefa

    2013-09-01

    To fix CO2 emissions efficiently from flue gas of coal-fired power plants, the culture medium, light intensity and bioreactors were comprehensively optimized in the process of CO2 fixation by Chlorella PY-ZU1. To make up for relative insufficiency of nutrients (except for the carbon source) resulting from continuous bubbling of 15% CO2, three chemicals were added into the culture to optimize the molar ratios of nitrogen to carbon, phosphorus to carbon, and magnesium to carbon in culture from 0.17 to 0.69, from 0.093 to 0.096, and from 0.018 to 0.030, respectively. Such adjustments led to a 1.25-fold increase in biomass (from 2.41 to 5.42 g L(-1)). By enhancing light intensity from 4500 to 6000 lux, the peak growth rate of Chlorella PY-ZU1 increased by 99% and reached to 0.95 g L(-1) day(-1). Use of a multi-stage sequential bioreactor notably improved the peak CO2 fixation efficiency to 85.6%. PMID:23891832

  5. Hydrothermal energy transfer and contribution to autotrophic CO2 fixation down sediment core in Central Indian Basin

    NASA Astrophysics Data System (ADS)

    Das, Anindita; LokaBharathi P., A.

    2014-05-01

    Hydrothermal Energy Transfer is not only restricted to active vents sites but also to the passive ones. These passive sources could include the sub-seafloor hydrothermal fluid flux derived from distant sources like erupting vents or from deep-mantle. The contribution from such fluxes in stimulating autotrophic carbon fixation could be measurable. In this paper an attempt is made to measure the autotrophic CO2 fixation down a siliceous sediment core (Core 20, 75?30'E, 12?S) adjoining Trace of Rodrigues Triple Junction in the Central Indian Basin (CIB) with a fluid flux influence at 15-20 cms bsf (below sea-floor) which is quite distinct from the pelagic influence on the overlying 0-15 cms bsf. This work assumes that NH4+and S2- are major e-donors/reductants to fuel C-Fixation. The down-core carbon fixation varied from 0.032-0.122?mol C g-1day-1 with the larger peak at 15-20 cms bsf. This coincides with the dips in pore-water concentrations of NH4+ and S2-. Therefore the corresponding standard free energy change (?G?') down-core varied from -97 at 4-6 cms bsf to -375 J ?mol-1 C fixed m-3 day-1 at 12-14 cms bsf in case of NH4+. In case of S2- the values varied from -42 at 4-6 cms bsf to -162 J ?mol-1 m-3 day-1at 12-14 cms bsf. Integrated down-core estimate of ?G?' is calculated to be -26.97 J ?mol-1 C fixation m-2 day-1 during CO2 fixation using NH4+ and -11.7 J ?mol-1 C fixation m-2 day-1 using S2-. This fluid-flow influenced layer appears physically as a brown-green transition zone in the core at a depth of 15-20 cm bsf. Interestingly similar observations have been made in >15 such cores around the present test core. These observations suggest that this spreading bed at this depth could be due to the upward fluid flow that then spreads laterally. This spread could perhaps be more than the area that the current observations permit. So the Hydrothermal Energy Transfer is equivalent to -11.70 to -26.97 J ?mol-1 C fixation m-2 day-1and corresponds to 88 ?mol of CO2 fixation m-2day-1 through NH4+ and S2- respectively. Given the assumption that this diffuse process is not limited to the availability of light or focused vent flow the contribution may perhaps be much larger than projected as the reach in space and time could be much higher than the present projection.

  6. Comparison of rigid and semirigid fixation for advancement genioplasty.

    PubMed

    Shaik, Mahaboob; Koteswar Rao, N; Kiran Kumar, N; Prasanthi, G

    2013-09-01

    To compare the skeletal stability of rigid versus semirigid fixation for advancement genioplasty by the assessment of vertical and horizontal measurements pre-operatively and post-operatively on lateral cephalometric radiographs. The study comprised of patients who underwent standard advancement genioplasty by inferior osteotomy of the chin with broadest musculoperiosteal pedicle with either rigid fixation or wire fixation. The displacements of vertical and horizontal measurements resulting following surgery was derived by calculating the difference between preoperative, immediate post-operative and 1 year post-operatively on lateral cephalometric radiographs. Preoperative measurements were marked as T1, immediate post-operative as T2, 1 year follow up post-operative as T3. In the semirigid group a mean horizontal advancement of 5.97 mm was accompanied by a relapse of 1.623 mm during a period of minimum 1 year. The mean superior repositioning of menton was 0.7 mm. This was accompanied by a relapse of 0.325 mm during a period of 1 year. In the rigid group a mean horizontal advancement of 4.815 mm was accompanied by a relapse of 0.2 mm during a period of 1 year. The mean superior repositioning of menton was 0.975 mm. This was accompanied by a relapse of 0.1 mm during a period of 1 year. This study confirms the findings of several previous studies that contribute data specific towards the use of rigid fixation in advancement genioplasty. In our study we also observed that, in cases where large advancements are necessary, wire fixation may offer insufficient means of fixation particularly if the movement is complex and asymmetrical, in which case rigid fixation devices are more helpful. PMID:24431852

  7. Identifying the missing steps of the autotrophic 3-hydroxypropionate CO2 fixation cycle in Chloroflexus aurantiacus

    PubMed Central

    Zarzycki, Jan; Brecht, Volker; Müller, Michael; Fuchs, Georg

    2009-01-01

    The phototrophic bacterium Chloroflexus aurantiacus uses a yet unsolved 3-hydroxypropionate cycle for autotrophic CO2 fixation. It starts from acetyl-CoA, with acetyl-CoA and propionyl-CoA carboxylases acting as carboxylating enzymes. In a first cycle, (S)-malyl-CoA is formed from acetyl-CoA and 2 molecules of bicarbonate. (S)-Malyl-CoA cleavage releases the CO2 fixation product glyoxylate and regenerates the starting molecule acetyl-CoA. Here we complete the missing steps devoted to glyoxylate assimilation. In a second cycle, glyoxylate is combined with propionyl-CoA, an intermediate of the first cycle, to form ?-methylmalyl-CoA. This condensation is followed by dehydration to mesaconyl-C1-CoA. An unprecedented CoA transferase catalyzes the intramolecular transfer of the CoA moiety to the C4 carboxyl group of mesaconate. Mesaconyl-C4-CoA then is hydrated by an enoyl-CoA hydratase to (S)-citramalyl-CoA. (S)-Citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by a tri-functional lyase, which previously cleaved (S)-malyl-CoA and formed ?-methylmalyl-CoA. Thus, the enigmatic disproportionation of glyoxylate and propionyl-CoA into acetyl-CoA and pyruvate is solved in an elegant and economic way requiring only 3 additional enzymes. The whole bicyclic pathway results in pyruvate formation from 3 molecules of bicarbonate and involves 19 steps but only 13 enzymes. Elements of the 3-hydroxypropionate cycle may be used for the assimilation of small organic molecules. The 3-hydroxypropionate cycle is compared with the Calvin–Benson–Bassham cycle and other autotrophic pathways. PMID:19955419

  8. An integrative approach to energy, carbon, and redox metabolism in the cyanobacterium Synechocystis sp. PCC 6803

    SciTech Connect

    Vermaas, Willem F.J.

    2006-03-14

    The broader goal of this project was to merge knowledge from genomic, metabolic, ultrastructural and other perspectives to understand how cyanobacteria live, adapt and are regulated. This understanding aids in metabolic engineering and synthetic biology efforts using this group of organisms that contribute greatly to global photosynthetic CO2 fixation and that are closely related to the ancestors of chloroplasts. This project focused on photosynthesis and respiration in the cyanobacterium Synechocystis sp. PCC 6803, which is spontaneously transformable and has a known genome sequence. Modification of these fundamental processes in this organism can lead to improved carbon sequestration and hydrogen production, as well as to generation of high-quality biomass. In our GTL-supported studies at Arizona State University we focus on cell structure and cell physiology in Synechocystis, with particular emphasis on thylakoid membrane formation and on metabolism related to photosynthesis and respiration. Results on (a) thylakoid membrane biogenesis, (b) fluxes through central carbon utilization pathways, and (c) distribution mechanisms between carbon storage compounds are presented. Together, these results help pave the way for metabolic engineering efforts that are likely to result in improved solar-powered carbon sequestration and bioenergy conversion. Fueled by the very encouraging results obtained in this project, we already have attracted interest from major companies in the use of cyanobacteria for biofuel production.

  9. Functional outcome of arthroscopic assisted fixation of distal radius fractures

    PubMed Central

    Khanchandani, Prakash; Badia, Alejandro

    2013-01-01

    Background: Many studies in literature have supported the role of wrist arthroscopy as an adjunct to the stable fixation of unstable intraarticular distal radial fractures. This article focuses on the surgical technique, indications, advantages, and results using wrist arthroscopy to assess articular reduction and evaluates the treatment of carpal ligament injuries and triangular fibrocartilage complex (TFCC) injuries in conjunction with the stable fixation of distal radial fractures. Materials and Methods: We retrospectively evaluated 27 patients (16 males and 11 females), who underwent stable fixation of intraarticular distal radial fractures with arthroscopic evaluation of the articular reduction and repair of associated carpal injuries. As per the AO classification, they were 9 C 1, 12 C2, 2 C3, 3 B 1, and 1 B2 fractures. The final results were evaluated by modified Mayo wrist scoring system. The average age was 41 years (range: 18-68 years). The average followup was of 26 months (range 24-52 months). Results: Five patients needed modification of the reduction and fixation after arthroscopic joint evaluation. Associated ligament lesions found during the wrist arthroscopy were TFCC tears (n=17), scapholunate ligament injury (n=8), and luno-triquetral ligament injury (n=1). Five patients had combined injuries i.e. included TFCC tear, scapholunate and/or lunotriquetral ligament tear. There were 20 excellent, 3 good, and 4 fair results using this score. Conclusion: The radiocarpal and mid carpal arthroscopy is a useful adjunct to stable fixation of distal radial fractures. PMID:23798761

  10. Immunohistochemistry of Colorectal Cancer Biomarker Phosphorylation Requires Controlled Tissue Fixation

    PubMed Central

    Bauer, Daniel R.; Grogan, Thomas M.; Baird, Geoffrey S.

    2014-01-01

    Phosphorylated signaling molecules are biomarkers of cancer pathophysiology and resistance to therapy, but because phosphoprotein analytes are often labile, poorly controlled clinical laboratory practices could prevent translation of research findings in this area from the bench to the bedside. We therefore compared multiple biomarker and phosphoprotein immunohistochemistry (IHC) results in 23 clinical colorectal carcinoma samples after either a novel, rapid tissue fixation protocol or a standard tissue fixation protocol employed by clinical laboratories, and we also investigated the effect of a defined post-operative “cold” ischemia period on these IHC results. We found that a one-hour cold ischemia interval, allowed by ASCO/CAP guidelines