Science.gov

Sample records for carbon fixation pathways

  1. Improving carbon fixation pathways

    SciTech Connect

    Ducat, DC; Silver, PA

    2012-08-01

    A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that novel pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials.

  2. Design and analysis of synthetic carbon fixation pathways

    PubMed Central

    Bar-Even, Arren; Noor, Elad; Lewis, Nathan E.; Milo, Ron

    2010-01-01

    Carbon fixation is the process by which CO2 is incorporated into organic compounds. In modern agriculture in which water, light, and nutrients can be abundant, carbon fixation could become a significant growth-limiting factor. Hence, increasing the fixation rate is of major importance in the road toward sustainability in food and energy production. There have been recent attempts to improve the rate and specificity of Rubisco, the carboxylating enzyme operating in the Calvin–Benson cycle; however, they have achieved only limited success. Nature employs several alternative carbon fixation pathways, which prompted us to ask whether more efficient novel synthetic cycles could be devised. Using the entire repertoire of approximately 5,000 metabolic enzymes known to occur in nature, we computationally identified alternative carbon fixation pathways that combine existing metabolic building blocks from various organisms. We compared the natural and synthetic pathways based on physicochemical criteria that include kinetics, energetics, and topology. Our study suggests that some of the proposed synthetic pathways could have significant quantitative advantages over their natural counterparts, such as the overall kinetic rate. One such cycle, which is predicted to be two to three times faster than the Calvin–Benson cycle, employs the most effective carboxylating enzyme, phosphoenolpyruvate carboxylase, using the core of the naturally evolved C4 cycle. Although implementing such alternative cycles presents daunting challenges related to expression levels, activity, stability, localization, and regulation, we believe our findings suggest exciting avenues of exploration in the grand challenge of enhancing food and renewable fuel production via metabolic engineering and synthetic biology. PMID:20410460

  3. An ancient pathway combining carbon dioxide fixation with the generation and utilization of a sodium ion gradient for ATP synthesis.

    PubMed

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K; Gottschalk, Gerhard; Müller, Volker

    2012-01-01

    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  4. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

    PubMed Central

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker

    2012-01-01

    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  5. Widespread Occurrence of Two Carbon Fixation Pathways in Tubeworm Endosymbionts: Lessons from Hydrothermal Vent Associated Tubeworms from the Mediterranean Sea

    PubMed Central

    Thiel, Vera; Hügler, Michael; Blümel, Martina; Baumann, Heike I.; Gärtner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schönberg, Dieter; Petersen, Sven; Cowart, Dominique A.; Fisher, Charles R.; Imhoff, Johannes F.

    2012-01-01

    Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL – the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat. PMID:23248622

  6. Widespread occurrence of two carbon fixation pathways in tubeworm endosymbionts: lessons from hydrothermal vent associated tubeworms from the mediterranean sea.

    PubMed

    Thiel, Vera; Hügler, Michael; Blümel, Martina; Baumann, Heike I; Gärtner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schönberg, Dieter; Petersen, Sven; Cowart, Dominique A; Fisher, Charles R; Imhoff, Johannes F

    2012-01-01

    Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL - the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat. PMID:23248622

  7. CARBON DIOXIDE FIXATION.

    SciTech Connect

    FUJITA,E.

    2000-01-12

    Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO{sub 2} conversion. Recent achievements in the efficiency of solar energy conversion and in catalysis suggest that this approach holds a great deal of promise for contributing to future needs for fuels and chemicals.

  8. Potential role of multiple carbon fixation pathways during lipid accumulation in Phaeodactylum tricornutum

    PubMed Central

    2012-01-01

    Background Phaeodactylum tricornutum is a unicellular diatom in the class Bacillariophyceae. The full genome has been sequenced (<30 Mb), and approximately 20 to 30% triacylglyceride (TAG) accumulation on a dry cell basis has been reported under different growth conditions. To elucidate P. tricornutum gene expression profiles during nutrient-deprivation and lipid-accumulation, cell cultures were grown with a nitrate to phosphate ratio of 20:1 (N:P) and whole-genome transcripts were monitored over time via RNA-sequence determination. Results The specific Nile Red (NR) fluorescence (NR fluorescence per cell) increased over time; however, the increase in NR fluorescence was initiated before external nitrate was completely exhausted. Exogenous phosphate was depleted before nitrate, and these results indicated that the depletion of exogenous phosphate might be an early trigger for lipid accumulation that is magnified upon nitrate depletion. As expected, many of the genes associated with nitrate and phosphate utilization were up-expressed. The diatom-specific cyclins cyc7 and cyc10 were down-expressed during the nutrient-deplete state, and cyclin B1 was up-expressed during lipid-accumulation after growth cessation. While many of the genes associated with the C3 pathway for photosynthetic carbon reduction were not significantly altered, genes involved in a putative C4 pathway for photosynthetic carbon assimilation were up-expressed as the cells depleted nitrate, phosphate, and exogenous dissolved inorganic carbon (DIC) levels. P. tricornutum has multiple, putative carbonic anhydrases, but only two were significantly up-expressed (2-fold and 4-fold) at the last time point when exogenous DIC levels had increased after the cessation of growth. Alternative pathways that could utilize HCO3- were also suggested by the gene expression profiles (e.g., putative propionyl-CoA and methylmalonyl-CoA decarboxylases). Conclusions The results indicate that P. tricornutum continued carbon dioxide reduction when population growth was arrested and different carbon-concentrating mechanisms were used dependent upon exogenous DIC levels. Based upon overall low gene expression levels for fatty acid synthesis, the results also suggest that the build-up of precursors to the acetyl-CoA carboxylases may play a more significant role in TAG synthesis rather than the actual enzyme levels of acetyl-CoA carboxylases per se. The presented insights into the types and timing of cellular responses to inorganic carbon will help maximize photoautotrophic carbon flow to lipid accumulation. PMID:22672912

  9. Photosynthesis of Grass Species Differing in Carbon Dioxide Fixation Pathways 1

    PubMed Central

    Bouton, Joseph H.; Brown, R. Harold; Bolton, Jacqueline K.; Campagnoli, Raymond P.

    1981-01-01

    Panicum species of the Laxa group were investigated in a series of published reports and were found to possess C4, C3, and intermediate photosynthetic characteristics. Taxonomic and other relationships among these plants, however, are not clear. It was the objective of this investigation to document chromosome number, metaphase I chromosome behavior, and mode of reproduction, including abnormalities in the embryo sac, for these species. Chromosome counts showed a basic number (x) of 10 and ploidy levels of diploid (2n = 2x = 20), tetraploid (2n = 4x = 40), and hexaploid (2n = 6x = 60) in this group of Panicum. One diploid and one tetraploid accession of the C4 species, Panicum prionitis Griseb., were obtained. Of the intermediate species, Panicum milioides Nees ex Trin. was diploid, Panicum schenckii Hack. was hexaploid, and Panicum decipiens Nees, ex Trin. was found to possess two ploidy levels, one accession being diploid and the other accession being hexaploid. All the C3 species, which included two accessions of Panicum laxum Sw., three accessions of Panicum hylaeicum Mez., and one accession of Panicum rivulare Trin., were tetraploid. Meiosis was regular with primarily bivalent pairing at metaphase I in all species except the tetraploid accession of P. prionitis which possessed from 4 to 10 tetravalents. Stainable pollen was high in all species, ranging from 70 to 99%. Embryo sac analyses showed a single sac in all plants except the tetraploid accession of P. prionitis, which was found to possess an additional sac at anthesis. An additional sac was also observed in some ovaries of the P. schenckii accession. Self-pollinated seed set was high in all accessions except the diploid accession of P. prionitis and one accession of P. laxum where no seed was set under bagged conditions. This information establishes, within the limits of this collection, a base for future studies on genetic, taxonomic, photosynthetic, and evolutionary relationships among these plants. Possession of the same basic chromosome number, regular meiotic pairing, a high degree of stainable pollen, and good seed set in most of the plants studied indicate possible success in making hybrids for a genetic study of photosynthetic pathways in Panicum. Images PMID:16661689

  10. Diurnal variations in pathways of photosynthetic carbon fixation in a freshwater cyanobacterium

    NASA Astrophysics Data System (ADS)

    Labiosa, R. G.; Arrigo, K. R.; Grossman, A.; Reddy, T. E.; Shrager, J.

    2003-04-01

    Understanding phytoplankton photosynthesis is critical to several fields including ecology and global biogeochemistry. The efficiency with which phytoplankton fix carbon depends upon the ambient light field, which is in turn dependent upon sun angle and the depth of mixing in the water column. In this pilot project, Synechocystis PCC 6803 was chosen as a model organism with which to study the molecular and physiological responses of phytoplankton to diurnal changes in light levels. Advantages of using this organism include that its genome has been sequenced, allowing the use of microarray technology, that it is readily grown as single colonies on plates and in liquid cultures, and that it is easy to manipulate genetically (generate and complement mutants). Axenic cultures of Synechocystis were grown under precisely controlled conditions in a "cyclodyne", a chemostat in which the light intensity cycles to mimic diurnal changes in light level, where the light consisted of sinusoidal daylight (400 μ mol photons m-2 s-1 at noon) followed by 12 hours of darkness for several weeks. After one week to allow the cells to acclimate to the light conditions, the cultures were sampled and extracted for RNA analysis every two hours over the course of several days. At these time points, absorption spectra, light scattering and chlorophyll a concentrations were determined. Initial results from Northern Blot hybridizations (examining RNA levels for individual genes) indicate that, the transcripts encoding photosynthetic proteins (i.e., PsbA2, PsaA and CpcB, in photosystem II, photosystem I, and phycobilisomes, respectively) are highest during the light. Initial results show that in the middle of the night, the psbA2 transcripts are 2-fold less while the psaA and cpcB are greater than 4-fold less than in the middle of the day. For the most part, the transcripts encoding photosynthetic proteins track the light cycle, although with different trends at daybreak and after night falls. Some increase more rapidly following daybreak than others and decrease at different rates after night fall. Early results from microarrays containing the full genome of the organism show that almost all genes display higher transcript abundances during the day (including photosynthetic genes), with a few notable exceptions, and a few others display higher transcript abundance at night than during the day.

  11. Evidence of Carbon Fixation Pathway in a Bacterium from Candidate Phylum SBR1093 Revealed with Genomic Analysis

    PubMed Central

    Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

    2014-01-01

    Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30∼50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30∼80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere. PMID:25310003

  12. Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway

    SciTech Connect

    Hawkins, AB; Adams, MWW; Kelly, RM

    2014-03-25

    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73 degrees C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA beta-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula.

  13. Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway

    PubMed Central

    Hawkins, Aaron B.; Adams, Michael W. W.

    2014-01-01

    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA ?-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula. PMID:24532060

  14. Conversion of 4-hydroxybutyrate to acetyl coenzyme A and its anapleurosis in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate carbon fixation pathway.

    PubMed

    Hawkins, Aaron B; Adams, Michael W W; Kelly, Robert M

    2014-04-01

    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA ?-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula. PMID:24532060

  15. Beyond the Calvin Cycle: Autotrophic Carbon Fixation in the Ocean

    NASA Astrophysics Data System (ADS)

    Hügler, Michael; Sievert, Stefan M.

    2011-01-01

    Organisms capable of autotrophic metabolism assimilate inorganic carbon into organic carbon. They form an integral part of ecosystems by making an otherwise unavailable form of carbon available to other organisms, a central component of the global carbon cycle. For many years, the doctrine prevailed that the Calvin-Benson-Bassham (CBB) cycle is the only biochemical autotrophic CO2 fixation pathway of significance in the ocean. However, ecological, biochemical, and genomic studies carried out over the last decade have not only elucidated new pathways but also shown that autotrophic carbon fixation via pathways other than the CBB cycle can be significant. This has ramifications for our understanding of the carbon cycle and energy flow in the ocean. Here, we review the recent discoveries in the field of autotrophic carbon fixation, including the biochemistry and evolution of the different pathways, as well as their ecological relevance in various oceanic ecosystems.

  16. De Novo Transcriptome Analysis of an Aerial Microalga Trentepohlia jolithus: Pathway Description and Gene Discovery for Carbon Fixation and Carotenoid Biosynthesis

    PubMed Central

    Li, Qianqian; Liu, Jianguo; Zhang, Litao; Liu, Qian

    2014-01-01

    Background Algae in the order Trentepohliales have a broad geographic distribution and are generally characterized by the presence of abundant β-carotene. The many monographs published to date have mainly focused on their morphology, taxonomy, phylogeny, distribution and reproduction; molecular studies of this order are still rare. High-throughput RNA sequencing (RNA-Seq) technology provides a powerful and efficient method for transcript analysis and gene discovery in Trentepohlia jolithus. Methods/Principal Findings Illumina HiSeq 2000 sequencing generated 55,007,830 Illumina PE raw reads, which were assembled into 41,328 assembled unigenes. Based on NR annotation, 53.28% of the unigenes (22,018) could be assigned to gene ontology classes with 54 subcategories and 161,451 functional terms. A total of 26,217 (63.44%) assembled unigenes were mapped to 128 KEGG pathways. Furthermore, a set of 5,798 SSRs in 5,206 unigenes and 131,478 putative SNPs were identified. Moreover, the fact that all of the C4 photosynthesis genes exist in T. jolithus suggests a complex carbon acquisition and fixation system. Similarities and differences between T. jolithus and other algae in carotenoid biosynthesis are also described in depth. Conclusions/Significance This is the first broad transcriptome survey for T. jolithus, increasing the amount of molecular data available for the class Ulvophyceae. As well as providing resources for functional genomics studies, the functional genes and putative pathways identified here will contribute to a better understanding of carbon fixation and fatty acid and carotenoid biosynthesis in T. jolithus. PMID:25254555

  17. Enzyme Regulation& Catalysis in Carbon Fixation Metabolism

    SciTech Connect

    Henry M. Miziorko

    2004-12-14

    The overall long term goal of this program is the elucidation of molecular events in carbon assimilation. It has become axiomatic that control of flux through metabolic pathways is effectively imposed at irreversible reactions situated early in those pathways. The current focal point of this project is phosphoribulokinase (PRK), which catalyzes formation of the carbon dioxide acceptor, ribulose 1,5-bisphosphate. This reaction represents an early irreversible step unique to Calvin’s reductive pentose phosphate pathway. Predictably, the PRK reaction represents an important control point in carbon fixation, regulated by a light dependent thiol/disulfide exchange in eukaryotes and by allosteric effectors in prokaryotes. Characterization of naturally occurring mutants as well as gene knockout experiments substantiate the importance of PRK to in vivo control of carbon assimilation in both prokaryotes and eukaryotes. Thus, given the potential impact of enhancement or inhibition of PRK activity on energy (biomass/biofuel) production, elucidation of the molecular events that account for PRK activity is a significant scientific goal.

  18. Efficient CO2 Fixation Pathways: Energy Plant: High Efficiency Photosynthetic Organisms

    SciTech Connect

    2012-01-01

    PETRO Project: UCLA is redesigning the carbon fixation pathways of plants to make them more efficient at capturing the energy in sunlight. Carbon fixation is the key process that plants use to convert carbon dioxide (CO2) from the atmosphere into higher energy molecules (such as sugars) using energy from the sun. UCLA is addressing the inefficiency of the process through an alternative biochemical pathway that uses 50% less energy than the pathway used by all land plants. In addition, instead of producing sugars, UCLA’s designer pathway will produce pyruvate, the precursor of choice for a wide variety of liquid fuels. Theoretically, the new biochemical pathway will allow a plant to capture 200% as much CO2 using the same amount of light. The pathways will first be tested on model photosynthetic organisms and later incorporated into other plants, thus dramatically improving the productivity of both food and fuel crops.

  19. Carbon fixation by basalt-hosted microbial communities

    PubMed Central

    Orcutt, Beth N.; Sylvan, Jason B.; Rogers, Daniel R.; Delaney, Jennifer; Lee, Raymond W.; Girguis, Peter R.

    2015-01-01

    Oceanic crust is a massive potential habitat for microbial life on Earth, yet our understanding of this ecosystem is limited due to difficulty in access. In particular, measurements of rates of microbial activity are sparse. We used stable carbon isotope incubations of crustal samples, coupled with functional gene analyses, to examine the potential for carbon fixation on oceanic crust. Both seafloor-exposed and subseafloor basalts were recovered from different mid-ocean ridge and hot spot environments (i.e., the Juan de Fuca Ridge, the Mid-Atlantic Ridge, and the Loihi Seamount) and incubated with 13C-labeled bicarbonate. Seafloor-exposed basalts revealed incorporation of 13C-label into organic matter over time, though the degree of incorporation was heterogeneous. The incorporation of 13C into biomass was inconclusive in subseafloor basalts. Translating these measurements into potential rates of carbon fixation indicated that 0.1–10 nmol C g-1rock d-1 could be fixed by seafloor-exposed rocks. When scaled to the global production of oceanic crust, this suggests carbon fixation rates of 109–1012 g C year-1, which matches earlier predictions based on thermodynamic calculations. Functional gene analyses indicate that the Calvin cycle is likely the dominant biochemical mechanism for carbon fixation in basalt-hosted biofilms, although the reductive acetyl-CoA pathway and reverse TCA cycle likely play some role in net carbon fixation. These results provide empirical evidence for autotrophy in oceanic crust, suggesting that basalt-hosted autotrophy could be a significant contributor of organic matter in this remote and vast environment. PMID:26441854

  20. Carbon fixation by basalt-hosted microbial communities.

    PubMed

    Orcutt, Beth N; Sylvan, Jason B; Rogers, Daniel R; Delaney, Jennifer; Lee, Raymond W; Girguis, Peter R

    2015-01-01

    Oceanic crust is a massive potential habitat for microbial life on Earth, yet our understanding of this ecosystem is limited due to difficulty in access. In particular, measurements of rates of microbial activity are sparse. We used stable carbon isotope incubations of crustal samples, coupled with functional gene analyses, to examine the potential for carbon fixation on oceanic crust. Both seafloor-exposed and subseafloor basalts were recovered from different mid-ocean ridge and hot spot environments (i.e., the Juan de Fuca Ridge, the Mid-Atlantic Ridge, and the Loihi Seamount) and incubated with (13)C-labeled bicarbonate. Seafloor-exposed basalts revealed incorporation of (13)C-label into organic matter over time, though the degree of incorporation was heterogeneous. The incorporation of (13)C into biomass was inconclusive in subseafloor basalts. Translating these measurements into potential rates of carbon fixation indicated that 0.1-10 nmol C g(-1) rock d(-1) could be fixed by seafloor-exposed rocks. When scaled to the global production of oceanic crust, this suggests carbon fixation rates of 10(9)-10(12) g C year(-1), which matches earlier predictions based on thermodynamic calculations. Functional gene analyses indicate that the Calvin cycle is likely the dominant biochemical mechanism for carbon fixation in basalt-hosted biofilms, although the reductive acetyl-CoA pathway and reverse TCA cycle likely play some role in net carbon fixation. These results provide empirical evidence for autotrophy in oceanic crust, suggesting that basalt-hosted autotrophy could be a significant contributor of organic matter in this remote and vast environment. PMID:26441854

  1. Channeling of carbon monoxide during anaerobic carbon dioxide fixation.

    PubMed

    Seravalli, J; Ragsdale, S W

    2000-02-15

    Carbon monoxide is an intermediate in carbon dioxide fixation by diverse microbes that inhabit anaerobic environments including the human colon. These organisms fix CO(2) by the Wood-Ljungdahl pathway of acetyl-CoA biosynthesis. The bifunctional CO dehydrogenase/acetyl-CoA synthase (CODH/ACS) catalyzes several key steps in this pathway. CO(2) is reduced to CO at a nickel iron-sulfur cluster called cluster C located in the CODH subunit. Then, CO is condensed with a methyl group and coenzyme A at cluster A, another nickel iron-sulfur cluster in the ACS subunit. Spectroscopic studies indicate that clusters A and C are at least 10-15 A apart. To gain a better understanding of how CO production and utilization are coordinated, we have studied an isotopic exchange reaction between labeled CO(2) and the carbonyl group of acetyl-CoA with the CODH/ACS from Clostridium thermoaceticum. When solution CO is provided at saturating levels, only CO(2)-derived CO is incorporated into the carbonyl group of acetyl-CoA. Furthermore, when high levels of hemoglobin or myoglobin are added to remove CO from solution, there is only partial inhibition of the incorporation of CO(2)-derived CO into acetyl-CoA. These results provide strong evidence for the existence of a CO channel between cluster C in the CODH subunit and cluster A in the ACS subunit. The existence of such a channel would tightly couple CO production and utilization and help explain why high levels of this toxic gas do not escape into the environment. Instead, microbes sequester this energy-rich carbon source for metabolic reactions. PMID:10684606

  2. Carbon fixation in oceanic crust: Does it happen, and is it important?

    NASA Astrophysics Data System (ADS)

    Orcutt, B.; Sylvan, J. B.; Rogers, D.; Lee, R.; Girguis, P. R.; Carr, S. A.; Jungbluth, S.; Rappe, M. S.

    2014-12-01

    The carbon sources supporting a deep biosphere in igneous oceanic crust, and furthermore the balance of heterotrophy and autotrophy, are poorly understood. When the large reservoir size of oceanic crust is considered, carbon transformations in this environment have the potential to significantly impact the global carbon cycle. Furthermore, igneous oceanic crust is the most massive potential habitat for life on Earth, so understanding the carbon sources for this potential biosphere are important for understanding life on Earth. Geochemical evidence suggests that warm and anoxic upper basement is net heterotrophic, but the balance of these processes in cooler and potentially oxic oceanic crust are poorly known. Here, we present data from stable carbon isotope tracer incubations to examine carbon fixation in basalts collected from the Loihi Seamount, the Juan de Fuca Ridge, and the western flank of the Mid-Atlantic Ridge, to provide a first order constraint on the rates of carbon fixation on basalts. These data will be compared to recently available assessments of carbon cycling rates in fluids from upper basement to synthesize our current state of understanding of the potential for carbon fixation and respiration in oceanic crust. Moreover, we will present new genomic data of carbon fixation genes observed in the basalt enrichments as well as from the subsurface of the Juan de Fuca Ridge flank, enabling identification of the microbes and metabolic pathways involved in carbon fixation in these systems.

  3. Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation.

    PubMed

    Könneke, Martin; Schubert, Daniel M; Brown, Philip C; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J; Stahl, David A; Berg, Ivan A

    2014-06-01

    Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

  4. Phosphoribulokinase mediates nitrogenase-induced carbon dioxide fixation gene repression in Rhodobacter sphaeroides.

    PubMed

    Farmer, Ryan M; Tabita, F Robert

    2015-11-01

    In many organisms there is a balance between carbon and nitrogen metabolism. These observations extend to the nitrogen-fixing, nonsulfur purple bacteria, which have the classic family of P(II) regulators that coordinate signals of carbon and nitrogen status to regulate nitrogen metabolism. Curiously, these organisms also possess a reverse mechanism to regulate carbon metabolism based on cellular nitrogen status. In this work, studies in Rhodobacter sphaeroides firmly established that the activity of the enzyme that catalyses nitrogen fixation, nitrogenase, induces a signal that leads to repression of genes encoding enzymes of the Calvin-Benson-Bassham (CBB) CO2 fixation pathway. Additionally, genetic and metabolomic experiments revealed that NADH-activated phosphoribulokinase is an intermediate in the signalling pathway. Thus, nitrogenase activity appears to be linked to cbb gene repression through phosphoribulokinase. PMID:26306848

  5. A global two component signal transduction system that integrates the control of photosynthesis, carbon dioxide assimilation, and nitrogen fixation

    PubMed Central

    Joshi, Hemalata M.; Tabita, F. Robert

    1996-01-01

    Photosynthesis, biological nitrogen fixation, and carbon dioxide assimilation are three fundamental biological processes catalyzed by photosynthetic bacteria. In the present study, it is shown that mutant strains of the nonsulfur purple photosynthetic bacteria Rhodospirillum rubrum and Rhodobacter sphaeroides, containing a blockage in the primary CO2 assimilatory pathway, derepress the synthesis of components of the nitrogen fixation enzyme complex and abrogate normal control mechanisms. The absence of the Calvin–Benson–Bassham (CBB) reductive pentose phosphate CO2 fixation pathway removes an important route for the dissipation of excess reducing power. Thus, the mutant strains develop alternative means to remove these reducing equivalents, resulting in the synthesis of large amounts of nitrogenase even in the presence of ammonia. This response is under the control of a global two-component signal transduction system previously found to regulate photosystem biosynthesis and the transcription of genes required for CO2 fixation through the CBB pathway and alternative routes. In addition, this two-component system directly controls the ability of these bacteria to grow under nitrogen-fixing conditions. These results indicate that there is a molecular link between the CBB and nitrogen fixation process, allowing the cell to overcome powerful control mechanisms to remove excess reducing power generated by photosynthesis and carbon metabolism. Furthermore, these results suggest that the two-component system integrates the expression of genes required for the three processes of photosynthesis, nitrogen fixation, and carbon dioxide fixation. PMID:8962083

  6. A carbon sink pathway increases carbon productivity in cyanobacteria.

    PubMed

    Oliver, John W K; Atsumi, Shota

    2015-05-01

    The burning of fossil reserves, and subsequent release of carbon into the atmosphere is depleting the supply of carbon-based molecules used for synthetic materials including plastics, oils, medicines, and glues. To provide for future society, innovations are needed for the conversion of waste carbon (CO2) into organic carbon useful for materials. Chemical production directly from photosynthesis is a nascent technology, with great promise for capture of CO2 using sunlight. To improve low yields, it has been proposed that photosynthetic capacity can be increased by a relaxation of bottlenecks inherent to growth. The limits of carbon partitioning away from growth within the cell and the effect of partitioning on carbon fixation are not well known. Here we show that expressing genes in a pathway between carbon fixation and pyruvate increases partitioning to 2,3-butanediol (23BD) and leads to a 1.8-fold increase in total carbon yield in the cyanobacterium Synechococcus elongatus PCC 7942. Specific 2,3-butanediol production increases 2.4-fold. As partitioning increases beyond 30%, it leads to a steep decline in total carbon yield. The data suggests a local maximum for carbon partitioning from the Calvin Benson cycle that is scalable with light intensity. PMID:25777135

  7. Acetogenesis and the Wood-Ljungdahl Pathway of CO2 Fixation

    PubMed Central

    Ragsdale, Stephen W.; Pierce, Elizabeth

    2008-01-01

    I. Summary Conceptually, the simplest way to synthesize an organic molecule is to construct it one carbon at a time. The Wood-Ljungdahl pathway of CO2 fixation involves this type of stepwise process. The biochemical events that underlie the condensation of two one-carbon units to form the two-carbon compound, acetate, have intrigued chemists, biochemists, and microbiologists for many decades. We begin this review with a description of the biology of acetogenesis. Then, we provide a short history of the important discoveries that have led to the identification of the key components and steps of this usual mechanism of CO and CO2 fixation. In this historical perspective, we have included reflections that hopefully will sketch the landscape of the controversies, hypotheses, and opinions that led to the key experiments and discoveries. We then describe the properties of the genes and enzymes involved in the pathway and conclude with a section describing some major questions that remain unanswered. PMID:18801467

  8. Model of carbon fixation in microbial mats from 3,500 Myr ago to the present

    NASA Technical Reports Server (NTRS)

    Rothschild, Lynn J.; Mancinelli, Rocco L.

    1990-01-01

    Using modern microbial mats as analogs for ancient stromatolites, it is shown that the rate of carbon fixation is higher at the greater levels of atmospheric CO2 that were probably present in the past. It is suggested that carbon fixation in microbial mats was not carbon-limited during the early Precambrian, but became carbon-limited as the supply of inorganic carbon decreased. Carbon limitation led to a lower rate of carbon fixation, especially towards the end of the Precambrian.

  9. Carbon Dioxide Fixation in Soybean Roots and Nodules

    PubMed Central

    Coker, George T.; Schubert, Karel R.

    1981-01-01

    These studies demonstrate that soybean (Merr) roots and nodules possess an active system for fixing CO2. The maximum rates of CO2 fixation observed for roots and nodules of intact plants were 120 and 110 nanomoles CO2 fixed per milligram dry weight per hour, respectively. Results of labeling studies suggest a primary role for phosphoenolpyruvate carboxylase in CO2 assimilation in these tissues. After pulse-labeling with 14CO2 for 2 minutes, 70% of the total radioactivity was lost within 18 minutes via respiration and/or translocation out of nodules. During the vegetative stages of growth of soybeans grown symbiotically, CO2 fixation in nodules increased at the onset of N2 fixation but declined to a lower level prior to the decrease in N2 fixation. This decrease coincided with a decrease in the transport of amino acids, especially asparagine, and an increase in the export of ureides. These findings are consistent with a dual role for CO2 fixation, providing substrates for energy-yielding metabolism and supplying carbon skeletons for NH4+ assimilation and amino acid biosynthesis. PMID:16661737

  10. Optimization of inorganic carbon sources to improve the carbon fixation efficiency of the non-photosynthetic microbial community with different electron donors.

    PubMed

    Wang, Ya-nan; Wang, Lei; Shan, Yi-na; Hu, Jiajun; Tsang, Yiufai; Hu, Yu; Fu, Xiaohua; Le, Yiquan

    2015-01-01

    As the non-photosynthetic microbial community (NPMC) isolated from seawaters utilized inorganic carbon sources for carbon fixation, the concentrations and ratios of Na2CO3, NaHCO3, and CO2 were optimized by response surface methodology design. With H2 as the electron donor, the optimal carbon sources were 270?mg/L Na2CO3, 580?mg/L NaHCO3, and 120?mg/L CO2. The carbon fixation efficiency in response to total organic carbon (TOC) was up to 30.59?mg/L with optimal carbon sources, which was about 50% higher than that obtained with CO2 as the sole carbon source. The mixture of inorganic carbon sources developed a buffer system to prevent acidification or alkalization of the medium caused by CO2 or Na2CO3, respectively. Furthermore, CO2 and HCO3(-), the starting points of carbon fixation in the pathways of Calvin-Benson-Bassham and 3-hydroxypropionate cycles, were provided by the carbon source structure to facilitate carbon fixation by NPMC. However, in the presence of mixed electron donors composed of 1.25% Na2S, 0.50% Na2S2O3, and 0.457% NaNO2, the carbon source structure did not exhibit significant improvement in the carbon fixation efficiency, when compared with that achieved with CO2 as the sole carbon source. The positive effect of mixed electron donors on inorganic carbon fixation was much higher than that of the carbon source structure. Nevertheless, the carbon source structure could be used as an alternative to CO2 when using NPMC to fix carbon in industrial processes. PMID:25367398

  11. Abundance and Distribution of Diagnostic Carbon Fixation Genes in a Deep-Sea Hydrothermal Gradient Ecosystem

    NASA Astrophysics Data System (ADS)

    Blumenfeld, H. N.; Kelley, D. S.; Girguis, P. R.; Schrenk, M. O.

    2010-12-01

    The walls of deep-sea hydrothermal vent chimneys sustain steep thermal and chemical gradients resulting from the mixing of hot (350°C+) hydrothermal fluids with cold, oxygenated seawater. The chemical disequilibrium generated from this process has the potential to drive numerous chemolithoautotrophic metabolisms, many of which have been demonstrated to be operative in microbial pure cultures. In addition to the well-known Calvin Cycle, at least five additional pathways have been discovered including the Reverse Tricarboxylic Acid Cycle (rTCA), the Reductive Acetyl-CoA pathway, and the 3-hydroxyproprionate pathway. Most of the newly discovered pathways have been found in thermophilic and hyperthermophilic Bacteria and Archaea, which are the well represented in microbial diversity studies of hydrothermal chimney walls. However, to date, little is known about the environmental controls that impact various carbon fixation pathways. The overlap of limited microbial diversity with distinct habitat conditions in hydrothermal chimney walls provides an ideal setting to explore these relationships. Hydrothermal chimney walls from multiple structures recovered from the Juan de Fuca Ridge in the northeastern Pacific were sub-sampled and analyzed using PCR-based assays. Earlier work showed elevated microbial abundances in the outer portions of mature chimney walls, with varying ratios of Archaea to Bacteria from the outer to inner portions of the chimneys. Common phylotypes identified in these regions included Epsilonproteobacteria, Gammaproteobacteria, and Desulfurococcales. Total genomic DNA was extracted from mineralogically distinct niches within these structures and queried for genes coding key regulatory enzymes for each of the well studied carbon fixation pathways. Preliminary results show the occurrence of genes representing rTCA cycle (aclB) and methyl coenzyme A reductase (mcrA) - a proxy for the Reductive Acetyl-CoA Pathway within interior portion of mature hydrothermal chimneys. Ongoing analyses are aimed at quantifying the abundances of these diagnostic carbon fixation genes within the hydrothermal chimney gradients. These data are being compared to a broad array of contextual data to provide insight into the environmental and biological controls that may impact the distribution of the various carbon fixation pathways. Application of genomic approaches to the hydrothermal chimney ecosystem will provide insight into the microbial ecology of such structures and refine our ability to measure autotrophy in hydrothermal habitats sustained by chemical energy.

  12. Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park

    SciTech Connect

    Jennings, Ryan; Whitmore, Laura M.; Moran, James J.; Kreuzer, Helen W.; Inskeep, William P.

    2014-05-01

    The fixation of inorganic carbon (as carbon dioxide) has been documented in all three domains of life and results in the biosynthesis of a diverse suite of organic compounds that support the growth of heterotrophic organisms. The primary aim of this study was to assess the importance of carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of one of the dominant Fe(II)-oxidizing organisms (Metallosphaera yellowstonensis strain MK1) present in situ. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon fixation pathway were identified in pure-cultures of M. yellowstonensis strain MK1. Metagenome sequencing from the same environments also revealed genes for the 3-HP/4-HB pathway belonging to M. yellowstonensis populations, as well as genes for a complete reductive TCA cycle from Hydrogenobaculum spp. (Aquificales). Stable isotope (13CO2) labeling was used to measure the fixation of CO2 by M. yellowstonensis strain MK1, and in ex situ assays containing live Fe(III)-oxide microbial mats. Results showed that M. yellowstonensis strain MK1 fixes CO2 via the 3-HP/4-HB pathway with a fractionation factor of ~ 2.5 ‰. Direct analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C and microbial mat C showed that mat C is comprised of both DIC and non-DIC sources. The estimated contribution of DIC carbon to biomass C (> ~ 35%) is reasonably consistent with the relative abundance of known chemolithoautotrophs and corresponding CO2 fixation pathways detected in metagenome sequence. The significance of DIC as a major source of carbon for Fe-oxide mat communities provides a foundation for examining microbial interactions in these systems that are dependent on the activity of autotrophic organisms such as Hydrogenobaculum and Metallosphaera spp.

  13. Phytoplankton plasticity drives large variability in carbon fixation efficiency

    NASA Astrophysics Data System (ADS)

    Ayata, Sakina-Dorothée.; Lévy, Marina; Aumont, Olivier; Resplandy, Laure; Tagliabue, Alessandro; Sciandra, Antoine; Bernard, Olivier

    2014-12-01

    Phytoplankton C:N stoichiometry is highly flexible due to physiological plasticity, which could lead to high variations in carbon fixation efficiency (carbon consumption relative to nitrogen). However, the magnitude, as well as the spatial and temporal scales of variability, remains poorly constrained. We used a high-resolution biogeochemical model resolving various scales from small to high, spatially and temporally, in order to quantify and better understand this variability. We find that phytoplankton C:N ratio is highly variable at all spatial and temporal scales (5-12 molC/molN), from mesoscale to regional scale, and is mainly driven by nitrogen supply. Carbon fixation efficiency varies accordingly at all scales (±30%), with higher values under oligotrophic conditions and lower values under eutrophic conditions. Hence, phytoplankton plasticity may act as a buffer by attenuating carbon sequestration variability. Our results have implications for in situ estimations of C:N ratios and for future predictions under high CO2 world.

  14. Isocyanate- and phosgene-free routes to polyfunctional cyclic carbonates and green polyurethanes by fixation of carbon dioxide.

    PubMed

    Blattmann, Hannes; Fleischer, Maria; Bähr, Moritz; Mülhaupt, Rolf

    2014-07-01

    The catalytic chemical fixation of carbon dioxide by carbonation of oxiranes, oxetanes, and polyols represents a very versatile green chemistry route to environmentally benign di- and polyfunctional cyclic carbonates as intermediates for the formation of non-isocyanate poly-urethane (NIPU). Two synthetic pathways lead to NIPU thermoplastics and thermosets: i) polycondensation of diacarbamates or acyclic dicarbonates with diols or diamines, respectively, and ii) polyaddition by ring-opening polymerization of di- and polyfunctional cyclic carbonates with di- and polyamines. The absence of hazardous and highly moisture-sensitive isocyanates as intermediates eliminates the need for special safety precautions, drying and handling procedures. Incorporated into polymer backbones and side chains, carbonate groups enable facile tailoring of a great variety of urethane-functional polymers. As compared with conventional polyurethanes, ring-opening polymerization of polyfunctional cyclic carbonates affords polyhydroxyurethanes with unconventional architectures including NIPUs containing carbohydrate segments. NIPU/epoxy hybrid coatings can be applied on wet surfaces and exhibit improved adhesion, thermal stability and wear resistance. Combining chemical with biological carbon dioxide fixation affords 100% bio-based NIPUs derived from plant oils, terpenes, carbohydrates, and bio polyols. Biocompatible and biodegradable NIPU as well as NIPU biocomposites hold great promise for biomedical applications. PMID:24979310

  15. Molecular Regulation of Photosynthetic Carbon Dioxide Fixation in Nonsulfur Purple Bacteria

    SciTech Connect

    Tabita, Fred Robert

    2015-12-01

    The overall objective of this project is to determine the mechanism by which a transcriptional activator protein affects CO2 fixation (cbb) gene expression in nonsulfur purple photosynthetic bacteria, with special emphasis to Rhodobacter sphaeroides and with comparison to Rhodopseudomonas palustris. These studies culminated in several publications which indicated that additional regulators interact with the master regulator CbbR in both R. sphaeroides and R. palustris. In addition, the interactive control of the carbon and nitrogen assimilatory pathways was studied and unique regulatory signals were discovered.

  16. A "footprint" of plant carbon fixation cycle functions during the development of a heterotrophic fungus.

    PubMed

    Lyu, Xueliang; Shen, Cuicui; Xie, Jiatao; Fu, Yanping; Jiang, Daohong; Hu, Zijin; Tang, Lihua; Tang, Liguang; Ding, Feng; Li, Kunfei; Wu, Song; Hu, Yanping; Luo, Lilian; Li, Yuanhao; Wang, Qihua; Li, Guoqing; Cheng, Jiasen

    2015-01-01

    Carbon fixation pathway of plants (CFPP) in photosynthesis converts solar energy to biomass, bio-products and biofuel. Intriguingly, a large number of heterotrophic fungi also possess enzymes functionally associated with CFPP, raising the questions about their roles in fungal development and in evolution. Here, we report on the presence of 17 CFPP associated enzymes (ten in Calvin-Benson-Basham reductive pentose phosphate pathway and seven in C4-dicarboxylic acid cycle) in the genome of Sclerotinia sclerotiorum, a heterotrophic phytopathogenic fungus, and only two unique enzymes: ribulose-1, 5-bisphosphate carboxylase-oxygenase (Rubisco) and phosphoribulokinase (PRK) were absent. This data suggested an incomplete CFPP-like pathway (CLP) in fungi. Functional profile analysis demonstrated that the activity of the incomplete CLP was dramatically regulated during different developmental stages of S. sclerotiorum. Subsequent experiments confirmed that many of them were essential to the virulence and/or sclerotial formation. Most of the CLP associated genes are conserved in fungi. Phylogenetic analysis showed that many of them have undergone gene duplication, gene acquisition or loss and functional diversification in evolutionary history. These findings showed an evolutionary links in the carbon fixation processes of autotrophs and heterotrophs and implicated the functions of related genes were in course of continuous change in different organisms in evolution. PMID:26263551

  17. Bioengineering of carbon fixation, biofuels, and biochemicals in cyanobacteria and plants.

    PubMed

    Rosgaard, Lisa; de Porcellinis, Alice Jara; Jacobsen, Jacob H; Frigaard, Niels-Ulrik; Sakuragi, Yumiko

    2012-11-30

    Development of sustainable energy is a pivotal step towards solutions for today's global challenges, including mitigating the progression of climate change and reducing dependence on fossil fuels. Biofuels derived from agricultural crops have already been commercialized. However the impacts on environmental sustainability and food supply have raised ethical questions about the current practices. Cyanobacteria have attracted interest as an alternative means for sustainable energy productions. Being aquatic photoautotrophs they can be cultivated in non-arable lands and do not compete for land for food production. Their rich genetic resources offer means to engineer metabolic pathways for synthesis of valuable bio-based products. Currently the major obstacle in industrial-scale exploitation of cyanobacteria as the economically sustainable production hosts is low yields. Much effort has been made to improve the carbon fixation and manipulating the carbon allocation in cyanobacteria and their evolutionary photosynthetic relatives, algae and plants. This review aims at providing an overview of the recent progress in the bioengineering of carbon fixation and allocation in cyanobacteria; wherever relevant, the progress made in plants and algae is also discussed as an inspiration for future application in cyanobacteria. PMID:22677697

  18. Recovering of carbon fixation in a eucalyptus site after felling

    NASA Astrophysics Data System (ADS)

    Rodrigues, A. M.; Pita, G. P. A.; Mateus, A.; Santos Pereira, J.

    2009-04-01

    Espirra site (38°38'N,8°36'W) is located in a 300ha Eucalyptus globulus plantation, with a Mediterranean type climate with a mean annual precipitation of 709mm and a mean annual air temperature of 15.9°C. The plantation was established in 1986 with about 1100 trees ha-1. A 33m observation tower was installed in 2002, with an ultrasonic Gill anemometer R2, an open path analyzer IRGA LI-7500 and a microclimate unit at its top. A harvesting of trees was made at the end of the 2nd rotation period, from November to December 2006. During the last four years of the second rotation the coppice were 20m height. Harvesting was planned in order to initiate a new 12 year productive cycle. In October 2008 a first thinning was made in three fourths of emerging stems from stumps. At this stage the forest trees had a mean height of 6m. For the 2002-2006 period, mean annual values of carbon net ecosystem exchange (NEE), gross production(GPP) and ecosystem respiration(Reco) were -533.3 gCm-2, 1628.6 gCm-2 and 1095.2 gCm-2. Seasonal patterns of carbon fixation for the five years showed a decrease in July-August periods due to highest air temperatures, atmospheric water vapour deficits and stomata partial closure to prevent water transpiration losses. For the period 2002-2006, the dry year of 2005 with a precipitation of about 390 mm, corresponded to the smaller carbon fixation of 390 gCm-2. Similarly, values of Reco, GPP and estimated leaf area index (less than three) were also minimal in 2005. Water use efficiency, WUE (ratio GPP/precipitation) was maximum in summer periods and in driest years, reaching values of about 12g/L-1. Recovery of carbon sink capacity, after the felling, begun after August 2007. The 2007 and 2008 annual NEE values were respectively 105.8 gCm-2 and -35.78 gCm-2. This negative value of NEE for 2008 is indicative of a carbon sink recovery. Annual Reco values for 2007 and 2008 were respectively 1059.03 gCm-2 and 1148.21 gCm-2. For GPP the annual values of 2007 and 2008 were respectively 953.24 gCm-2 and 1148.10 gCm-2. After the felling, stems rapidly grew and monthly GPP increased from 32 gCm-2 to 114 gCm-2 from January to October 2007. In November and December 2007, GPP decreased as a consequence of less solar radiation and frost in the young plants. In 2008 monthly GPP increased again till September. In the last three months of 2008, GPP diminished as a consequence of lack of water loss by evapotranspiration and the thinning. The results showed a chronological tendency for carbon fixation of the eucalyptus site according to physiological status of plants, concerning age and physical environmental factors.

  19. Photosynthetic Carbon Fixation in Guard Cell Protoplasts of Vicia faba L. 1

    PubMed Central

    Gotow, Kiyoshi; Taylor, Scott; Zeiger, Eduardo

    1988-01-01

    Photosynthetic carbon fixation in guard cells was reexamined in experiments with highly purified guard cell protoplasts from Vicia faba L. irradiated with red light. The fate of 14CO2 (4.8 microcuries of NaHCO3; final concentration: 100 micromolar) supplied to these preparations was investigated with two-dimensional paper, and thin layer chromatography. Rates of CO2 fixation were 5- to 8-fold higher in the light than in darkness. Separation of acid-stable products into water-insoluble, neutral, and anionic fractions showed that more radioactivity was incorporated into the neutral fraction in the light than in the dark. In the dark, malate and aspartate comprised 90% of the radiolabel found in the anionic fraction, whereas in the light, radioactivity was also found in 3-phosphoglyceric acid (PGA), sugar monophosphates, sugar diphosphates, and triose phosphates. Phosphorylated compounds contained up to 60% of the label in the light-treated anionic fraction. Phosphatase treatment and rechromatography of labeled sugar diphosphate showed the presence of ribulose, a specific metabolite of the photosynthetic carbon reduction pathway (PCRP). In time-course experiments, labeled PGA was detected within 5 seconds. With time, the percentage of label in PGA decreased and that in sugar monophosphate increased. We conclude that PGA is a primary carboxylation product of the PCRP in guard cells and that the activity of the PCRP, and phosphoenolpyruvate-carboxylase is metabolically regulated. PMID:16665973

  20. CbbR, the Master Regulator for Microbial Carbon Dioxide Fixation

    PubMed Central

    Dangel, Andrew W.

    2015-01-01

    Biological carbon dioxide fixation is an essential and crucial process catalyzed by both prokaryotic and eukaryotic organisms to allow ubiquitous atmospheric CO2 to be reduced to usable forms of organic carbon. This process, especially the Calvin-Bassham-Benson (CBB) pathway of CO2 fixation, provides the bulk of organic carbon found on earth. The enzyme ribulose 1,5-bisphosphate (RuBP) carboxylase/oxygenase (RubisCO) performs the key and rate-limiting step whereby CO2 is reduced and incorporated into a precursor organic metabolite. This is a highly regulated process in diverse organisms, with the expression of genes that comprise the CBB pathway (the cbb genes), including RubisCO, specifically controlled by the master transcriptional regulator protein CbbR. Many organisms have two or more cbb operons that either are regulated by a single CbbR or employ a specific CbbR for each cbb operon. CbbR family members are versatile and accommodate and bind many different effector metabolites that influence CbbR's ability to control cbb transcription. Moreover, two members of the CbbR family are further posttranslationally modified via interactions with other transcriptional regulator proteins from two-component regulatory systems, thus augmenting CbbR-dependent control and optimizing expression of specific cbb operons. In addition to interactions with small effector metabolites and other regulator proteins, CbbR proteins may be selected that are constitutively active and, in some instances, elevate the level of cbb expression relative to wild-type CbbR. Optimizing CbbR-dependent control is an important consideration for potentially using microbes to convert CO2 to useful bioproducts. PMID:26324454

  1. CbbR, the Master Regulator for Microbial Carbon Dioxide Fixation.

    PubMed

    Dangel, Andrew W; Tabita, F Robert

    2015-11-01

    Biological carbon dioxide fixation is an essential and crucial process catalyzed by both prokaryotic and eukaryotic organisms to allow ubiquitous atmospheric CO2 to be reduced to usable forms of organic carbon. This process, especially the Calvin-Bassham-Benson (CBB) pathway of CO2 fixation, provides the bulk of organic carbon found on earth. The enzyme ribulose 1,5-bisphosphate (RuBP) carboxylase/oxygenase (RubisCO) performs the key and rate-limiting step whereby CO2 is reduced and incorporated into a precursor organic metabolite. This is a highly regulated process in diverse organisms, with the expression of genes that comprise the CBB pathway (the cbb genes), including RubisCO, specifically controlled by the master transcriptional regulator protein CbbR. Many organisms have two or more cbb operons that either are regulated by a single CbbR or employ a specific CbbR for each cbb operon. CbbR family members are versatile and accommodate and bind many different effector metabolites that influence CbbR's ability to control cbb transcription. Moreover, two members of the CbbR family are further posttranslationally modified via interactions with other transcriptional regulator proteins from two-component regulatory systems, thus augmenting CbbR-dependent control and optimizing expression of specific cbb operons. In addition to interactions with small effector metabolites and other regulator proteins, CbbR proteins may be selected that are constitutively active and, in some instances, elevate the level of cbb expression relative to wild-type CbbR. Optimizing CbbR-dependent control is an important consideration for potentially using microbes to convert CO2 to useful bioproducts. PMID:26324454

  2. Carbon dioxide fixation and lipid storage by Scenedesmus obtusiusculus.

    PubMed

    Toledo-Cervantes, Alma; Morales, Marcia; Novelo, Eberto; Revah, Sergio

    2013-02-01

    An indigenous microalga was isolated from the springs in Cuatro Ciénegas, México. It was morphologically identified as Scenedesmus obtusiusculus and cultivated in bubble-column photobioreactors in batch operation mode. This microalga grows at 10% of carbon dioxide (CO(2)) showing a maximum CO(2) fixation rate of 970gm(-3)d(-1). The microalga, without any nutrient limitation, contained 20% of nonpolar lipids with a biomass productivity of 500gm(-3)d(-1) and a maximum biomass concentration of around 6,000gm(-3) at 5% CO(2) and irradiance of 134μmolm(-2)s(-1). Furthermore, it was observed that the microalga stored 55.7% of nonpolar lipids when 5% CO(2) was fed at 0.8vvm and 54.7μmolm(-2)s(-1) under nitrogen starvation. The lipid profile included C16:0, C18:0, C18:1n9t, C18:1n9c, C18:3n6 with a productivity of 200g lipid m(-3)d(-1). Therefore, the microalga may have biotechnological potential producing lipids for biodiesel. PMID:23334023

  3. A Simple Demonstration of Carbon Dioxide Fixation and Acid Production in CAM Plants

    ERIC Educational Resources Information Center

    Walker, John R. L.; McWha, James A.

    1976-01-01

    Described is an experiment investigating carbon dioxide fixation in the dark and the diurnal rhythm of acid production in plants exhibiting Crassulacean Acid Metabolism. Included are suggestions for four further investigations. (SL)

  4. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge

    NASA Astrophysics Data System (ADS)

    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide

    2015-10-01

    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2-0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology.

  5. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge.

    PubMed

    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide

    2015-01-01

    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2-0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology. PMID:26439402

  6. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge

    PubMed Central

    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide

    2015-01-01

    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2−0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology. PMID:26439402

  7. Carbon Dioxide Fixation by Metallosphaera yellowstonensis and Acidothermophilic Iron-Oxidizing Microbial Communities from Yellowstone National Park

    PubMed Central

    Jennings, Ryan M.; Whitmore, Laura M.; Moran, James J.

    2014-01-01

    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope (13CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ∼2.5‰. Analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  8. Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park.

    PubMed

    Jennings, Ryan M; Whitmore, Laura M; Moran, James J; Kreuzer, Helen W; Inskeep, William P

    2014-05-01

    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope ((13)CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ∼2.5‰. Analysis of the (13)C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  9. Model of carbon fixation in microbial mats from 3,500 Myr ago to the present.

    PubMed

    Rothschild, L J; Mancinelli, R L

    1990-06-21

    Biological carbon fixation is an important part of global carbon cycling and ecology. Fixation that took place 3,500 million years ago is recorded in the laminated sedimentary rock structures known as stromatolites, which are fossilized remains of microbial mat communities. Stromatolites are the most abundant type of fossil found in the Proterozoic (2,500 to 590 Myr ago), but they then declined, possibly because of predation and competition. Using modern microbial mats as analogues for ancient stromatolites, we show that the rate of carbon fixation is higher at the greater levels of atmospheric CO2 that were probably present in the past. We suggest that carbon fixation in microbial mats was not carbon-limited during the early Precambrian, but became carbon-limited as the supply of inorganic carbon decreased. Carbon limitation led to a lower rate of carbon fixation, especially towards the end of the Precambrian. Thus, another reason for the decline of the stromatolites could have been a decrease in available CO2. PMID:11536465

  10. Fixation of atmospheric carbon dioxide by a cadmium(II) macrocyclic complex.

    PubMed

    Janzen, Daron E; Botros, Maikel E; VanDerveer, Donald G; Grant, Gregory J

    2007-12-01

    A crystal structure showing an unusual trinuclear Cd(II) cluster bridged in mu3 fashion by a carbonate ligand is reported. The carbonate ion is formed by fixation of atmospheric carbon dioxide from the corresponding cadmium mononuclear complex containing an aza crown ether. PMID:18271488

  11. Computational protein design enables a novel one-carbon assimilation pathway

    PubMed Central

    Siegel, Justin B.; Smith, Amanda Lee; Poust, Sean; Wargacki, Adam J.; Bar-Even, Arren; Louw, Catherine; Shen, Betty W.; Eiben, Christopher B.; Tran, Huu M.; Noor, Elad; Gallaher, Jasmine L.; Bale, Jacob; Yoshikuni, Yasuo; Gelb, Michael H.; Keasling, Jay D.; Stoddard, Barry L.; Lidstrom, Mary E.; Baker, David

    2015-01-01

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway. PMID:25775555

  12. Computational protein design enables a novel one-carbon assimilation pathway.

    PubMed

    Siegel, Justin B; Smith, Amanda Lee; Poust, Sean; Wargacki, Adam J; Bar-Even, Arren; Louw, Catherine; Shen, Betty W; Eiben, Christopher B; Tran, Huu M; Noor, Elad; Gallaher, Jasmine L; Bale, Jacob; Yoshikuni, Yasuo; Gelb, Michael H; Keasling, Jay D; Stoddard, Barry L; Lidstrom, Mary E; Baker, David

    2015-03-24

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway. PMID:25775555

  13. Computational protein design enables a novel one-carbon assimilation pathway

    SciTech Connect

    Siegel, JB; Smith, AL; Poust, S; Wargacki, AJ; Bar-Even, A; Louw, C; Shen, BW; Eiben, CB; Tran, HM; Noor, E; Gallaher, JL; Bale, J; Yoshikuni, Y; Gelb, MH; Keasling, JD; Stoddard, BL; Lidstrom, ME; Baker, D

    2015-03-09

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway.

  14. Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

    SciTech Connect

    Feist, AM; Nagarajan, H; Rotaru, AE; Tremblay, PL; Zhang, T; Nevin, KP; Lovley, DR; Zengler, K

    2014-04-24

    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. Author Summary The ability of microorganisms to exchange electrons directly with their environment has large implications for our knowledge of industrial and environmental processes. For decades, it has been known that microbes can use electrodes as electron acceptors in microbial fuel cell settings. Geobacter metallireducens has been one of the model organisms for characterizing microbe-electrode interactions as well as environmental processes such as bioremediation. Here, we significantly expand the knowledge of metabolism and energetics of this model organism by employing constraint-based metabolic modeling. Through this analysis, we build the metabolic pathways necessary for carbon fixation, a desirable property for industrial chemical production. We further discover a novel growth condition which enables the characterization of autotrophic (i.e., carbon-fixing) metabolism in Geobacter. Importantly, our systems-level modeling approach helped elucidate the key metabolic pathways and the energetic cost associated with extracellular electron transfer. This model can be applied to characterize and engineer the metabolism and electron transfer capabilities of Geobacter for biotechnological applications.

  15. Dark inorganic carbon fixation sustains the functioning of benthic deep-sea ecosystems

    NASA Astrophysics Data System (ADS)

    Molari, Massimiliano; Manini, Elena; Dell'Anno, Antonio

    2013-01-01

    studies have provided evidence that dark inorganic carbon fixation is an important process for the functioning of the ocean interior. However, its quantitative relevance and ecological significance in benthic deep-sea ecosystems remain unknown. We investigated the rates of inorganic carbon fixation together with prokaryotic abundance, biomass, assemblage composition, and heterotrophic carbon production in surface sediments of different benthic deep-sea systems along the Iberian margin (northeastern Atlantic Ocean) and in the Mediterranean Sea. Inorganic carbon fixation rates in these surface deep-sea sediments did not show clear depth-related patterns, and, on average, they accounted for 19% of the total heterotrophic biomass production. The incorporation rates of inorganic carbon were significantly related to the abundance of total Archaea (as determined by catalyzed reporter deposition fluorescence in situ hybridization) and completely inhibited using an inhibitor of archaeal metabolism, N1-guanyl-1,7-diaminoheptane. This suggests a major role of the archaeal assemblages in inorganic carbon fixation. We also show that benthic archaeal assemblages contribute approximately 25% of the total 3H-leucine incorporation. Inorganic carbon fixation in surface deep-sea sediments appears to be dependent not only upon chemosynthetic processes but also on heterotrophic/mixotrophic metabolism, as suggested by estimates of the chemolithotrophic energy requirements and the enhanced inorganic carbon fixation due to the increase in the availability of organic trophic resources. Overall, our data suggest that archaeal assemblages of surface deep-sea sediments are responsible for the high rates of inorganic carbon incorporation and thereby sustain the functioning of the food webs as well as influence the carbon cycling of benthic deep-sea ecosystems.

  16. Community structure and soil pH determine chemoautotrophic carbon dioxide fixation in drained paddy soils.

    PubMed

    Long, Xi-En; Yao, Huaiying; Wang, Juan; Huang, Ying; Singh, Brajesh K; Zhu, Yong-Guan

    2015-06-16

    Previous studies suggested that microbial photosynthesis plays a potential role in paddy fields, but little is known about chemoautotrophic carbon fixers in drained paddy soils. We conducted a microcosm study using soil samples from five paddy fields to determine the environmental factors and quantify key functional microbial taxa involved in chemoautotrophic carbon fixation. We used stable isotope probing in combination with phospholipid fatty acid (PLFA) and molecular approaches. The amount of microbial (13)CO2 fixation was determined by quantification of (13)C-enriched fatty acid methyl esters and ranged from 21.28 to 72.48 ng of (13)C (g of dry soil)(-1), and the corresponding ratio (labeled PLFA-C:total PLFA-C) ranged from 0.06 to 0.49%. The amount of incorporationof (13)CO2 into PLFAs significantly increased with soil pH except at pH 7.8. PLFA and high-throughput sequencing results indicated a dominant role of Gram-negative bacteria or proteobacteria in (13)CO2 fixation. Correlation analysis indicated a significant association between microbial community structure and carbon fixation. We provide direct evidence of chemoautotrophic C fixation in soils with statistical evidence of microbial community structure regulation of inorganic carbon fixation in the paddy soil ecosystem. PMID:25989872

  17. Carbon and energy fixation of great duckweed Spirodela polyrhiza growing in swine wastewater.

    PubMed

    Wang, Wenguo; Yang, Chuang; Tang, Xiaoyu; Zhu, Qili; Pan, Ke; Cai, Denggao; Hu, Qichun; Ma, Danwei

    2015-10-01

    The ability to fix carbon and energy in swine wastewater of duckweeds was investigated using Spirodela polyrhiza as the model species. Cultures of S. polyrhiza were grown in dilutions of both original swine wastewater (OSW) and anaerobic digestion effluent (ADE) based on total ammonia nitrogen (TAN). Results showed that elevated concentrations of TAN caused decreased growth, carbon fixation, and energy production rates, particularly just after the first rise in two types of swine wastewater. Also, OSW was more suitable for S. polyrhiza cultivation than ADE. Maximum carbon and energy fixation were achieved at OSW-TAN concentrations of 12.08 and 13.07 mg L(-1), respectively. Photosynthetic activity of S. polyrhiza could be inhibited by both nutrient stress (in high-concentration wastewater) and nutrient limitation (in low-concentration wastewater), affecting its growth and ability for carbon-energy fixation. PMID:26036587

  18. A “footprint” of plant carbon fixation cycle functions during the development of a heterotrophic fungus

    PubMed Central

    Lyu, Xueliang; Shen, Cuicui; Xie, Jiatao; Fu, Yanping; Jiang, Daohong; Hu, Zijin; Tang, Lihua; Tang, Liguang; Ding, Feng; Li, Kunfei; Wu, Song; Hu, Yanping; Luo, Lilian; Li, Yuanhao; Wang, Qihua; Li, Guoqing; Cheng, Jiasen

    2015-01-01

    Carbon fixation pathway of plants (CFPP) in photosynthesis converts solar energy to biomass, bio-products and biofuel. Intriguingly, a large number of heterotrophic fungi also possess enzymes functionally associated with CFPP, raising the questions about their roles in fungal development and in evolution. Here, we report on the presence of 17 CFPP associated enzymes (ten in Calvin-Benson-Basham reductive pentose phosphate pathway and seven in C4-dicarboxylic acid cycle) in the genome of Sclerotinia sclerotiorum, a heterotrophic phytopathogenic fungus, and only two unique enzymes: ribulose-1, 5-bisphosphate carboxylase-oxygenase (Rubisco) and phosphoribulokinase (PRK) were absent. This data suggested an incomplete CFPP-like pathway (CLP) in fungi. Functional profile analysis demonstrated that the activity of the incomplete CLP was dramatically regulated during different developmental stages of S. sclerotiorum. Subsequent experiments confirmed that many of them were essential to the virulence and/or sclerotial formation. Most of the CLP associated genes are conserved in fungi. Phylogenetic analysis showed that many of them have undergone gene duplication, gene acquisition or loss and functional diversification in evolutionary history. These findings showed an evolutionary links in the carbon fixation processes of autotrophs and heterotrophs and implicated the functions of related genes were in course of continuous change in different organisms in evolution. PMID:26263551

  19. [Regulation of alternative CO[sub 2] fixation pathways in procaryotic and eucaryotic photosynthetic organisms

    SciTech Connect

    Not Available

    1992-01-01

    The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.

  20. Effects of model structural uncertainty on carbon cycle projections: biological nitrogen fixation as a case study

    NASA Astrophysics Data System (ADS)

    Wieder, William R.; Cleveland, Cory C.; Lawrence, David M.; Bonan, Gordon B.

    2015-04-01

    Uncertainties in terrestrial carbon (C) cycle projections increase uncertainty of potential climate feedbacks. Efforts to improve model performance often include increased representation of biogeochemical processes, such as coupled carbon-nitrogen (N) cycles. In doing so, models are becoming more complex, generating structural uncertainties in model form that reflect incomplete knowledge of how to represent underlying processes. Here, we explore structural uncertainties associated with biological nitrogen fixation (BNF) and quantify their effects on C cycle projections. We find that alternative plausible structures to represent BNF result in nearly equivalent terrestrial C fluxes and pools through the twentieth century, but the strength of the terrestrial C sink varies by nearly a third (50 Pg C) by the end of the twenty-first century under a business-as-usual climate change scenario representative concentration pathway 8.5. These results indicate that actual uncertainty in future C cycle projections may be larger than previously estimated, and this uncertainty will limit C cycle projections until model structures can be evaluated and refined.

  1. Microbial carbon and nitrogen fixation on the surface of glaciers and ice sheets

    NASA Astrophysics Data System (ADS)

    Telling, J.; Anesio, A. M.; Stibal, M.; Hawkings, J.; Bellas, C. M.; Tranter, M.; Wadham, J. L.; Cook, J.; Hodson, A. J.; Yallop, M.; Barker, G.; Butler, C. E.; Fountain, A. G.; Nylen, T.; Irvine-Fynn, T. D.; Sole, A. J.; Nienow, P. W.

    2012-12-01

    Studying the microbial sequestration of atmospheric carbon dioxide (via net autochthonous production) and nitrogen (via nitrogen fixation) into organic matter on the surface of glaciers and ice sheets is important for three main reasons. First, they can provide essential nutrients for supporting microbial ecosystems in these cold, typically nutrient-poor environments. Second, nutrients formed in the supraglacial environment may be important for sustaining hydrologically connected subglacial and downstream (e.g. fjords, near-shore marine) ecosystems. Third, organic matter produced or transformed by microbial activity can alter the albedo of ice, either directly by the production of dark pigments, or indirectly through the trapping and agglutination of dark mineral via the production of exopolysaccharides. Here, we present recent results of microbial carbon and nitrogen fixation in surface sediment (cryoconite) on Arctic and Antarctic glaciers and the Greenland Ice Sheet ablation zone. Results suggest that the fixation and recycling of autochthonous carbon in cryoconite on glaciers and ice sheets can support a significant fraction of the total microbial activity in the supraglacial environment during the ablation season. Nitrogen fixation can be important as a nitrogen source for microbial communities on both Arctic and Antarctic glaciers during the main ablation season. Nitrogen fixation could feasibly exceed precipitation as a source of nitrogen to microbial communities in debris rich zones on the margins of the Greenland Ice Sheet, aiding the colonization and subsequent 'greening' of subglacial and moraine derived debris.

  2. A model for diurnal patterns of carbon fixation in a Precambrian microbial mat based on a modern analog

    NASA Technical Reports Server (NTRS)

    Rothschild, L. J.

    1991-01-01

    Microbial mat communities are one of the first and most prevalent biological communities known from the Precambrian fossil record. These fossil mat communities are found as laminated sedimentary rock structures called stromatolites. Using a modern microbial mat as an analog for Precambrian stromatolites, a study of carbon fixation during a diurnal cycle under ambient conditions was undertaken. The rate of carbon fixation depends primarily on the availability of light (consistent with photosynthetic carbon fixation) and inorganic carbon, and not nitrogen or phosphorus. Atmospheric PCO2 is thought to have decreased from 10 bars at 4 Ga (10(9) years before present) to approximately 10(-4) bars today, implying a change in the availability of inorganic carbon for carbon fixation. Experimental manipulation of levels of inorganic carbon to levels that may have been available to Precambrian mat communities resulted in increased levels of carbon fixation during daylight hours. Combining these data with models of daylength during the Precambrian, models are derived for diurnal patterns of photosynthetic carbon fixation in a Precambrian microbial mat community. The models suggest that, even in the face of shorter daylengths during the Precambrian, total daily carbon fixation has been declining over geological time, with most of the decrease having occurred during the Precambrian.

  3. A model for diurnal patterns of carbon fixation in a Precambrian microbial mat based on a modern analog.

    PubMed

    Rothschild, L J

    1991-01-01

    Microbial mat communities are one of the first and most prevalent biological communities known from the Precambrian fossil record. These fossil mat communities are found as laminated sedimentary rock structures called stromatolites. Using a modern microbial mat as an analog for Precambrian stromatolites, a study of carbon fixation during a diurnal cycle under ambient conditions was undertaken. The rate of carbon fixation depends primarily on the availability of light (consistent with photosynthetic carbon fixation) and inorganic carbon, and not nitrogen or phosphorus. Atmospheric PCO2 is thought to have decreased from 10 bars at 4 Ga (10(9) years before present) to approximately 10(-4) bars today, implying a change in the availability of inorganic carbon for carbon fixation. Experimental manipulation of levels of inorganic carbon to levels that may have been available to Precambrian mat communities resulted in increased levels of carbon fixation during daylight hours. Combining these data with models of daylength during the Precambrian, models are derived for diurnal patterns of photosynthetic carbon fixation in a Precambrian microbial mat community. The models suggest that, even in the face of shorter daylengths during the Precambrian, total daily carbon fixation has been declining over geological time, with most of the decrease having occurred during the Precambrian. PMID:1854911

  4. Carbon dioxide fixation and respiration relationships observed during closure experiments in Biosphere 2

    NASA Astrophysics Data System (ADS)

    Nelson, Mark; Dempster, William; Allen, John P.

    Biosphere 2 enclosed several ecosystems - ones analogous to rainforest, tropical savannah, thornscrub, desert, marsh and coral reef - and a diverse agro-ecology, with dozens of food crops, in virtual material isolation from Earth's environment. This permits a detailed examination of fixation and respiration from the continuous record of carbon dioxide concentration from sensors inside the facility. Unlike the Earth, all the ecosystems were active during sunlight hours, while phyto and soil respiration dominated nighttime hours. This resulted in fluctuations of as much as 600-700 ppm CO2 daily during days of high sunlight input. We examine the relationships between daytime fixation as driven by photosynthesis to nighttime respiration and also fixation and respiration as related to carbon dioxide concentration. Since carbon dioxide concentrations varied from near Earth ambient levels to over 3000 ppm (during low-light winter months), the response of the plant communities and impact on phytorespiration and soil respiration may be of relevance to the global climate change research community. An investigation of these dynamics will also allow the testing of models predicting the response of community metabolism to variations in sunlight and degree of previous net carbon fixation.

  5. Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

    PubMed Central

    Feist, Adam M.; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P.; Lovley, Derek R.; Zengler, Karsten

    2014-01-01

    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. PMID:24762737

  6. Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean.

    PubMed

    Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M

    2013-12-01

    Bacteria and archaea in the dark ocean (>200 m) comprise 0.3-1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

  7. Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean

    PubMed Central

    Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M

    2013-01-01

    Bacteria and archaea in the dark ocean (>200 m) comprise 0.3–1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

  8. Photosynthesis in Grass Species Differing in Carbon Dioxide Fixation Pathways

    PubMed Central

    Morgan, Jack A.; Brown, R. Harold

    1979-01-01

    Thirty-three grass species were examined in two experiments in an attempt to locate plants with photosynthetic responses to O2, CO2 compensation concentrations, and leaf anatomy intermediate to those of C3 and C4 species. Species examined included seven from the Laxa group in the Panicum genus, one of which, P. milioides Nees ex Trin., has been reported earlier to have intermediate characteristics. The species with O2-sensitive photosynthesis typical of C3 plants showed more than 37% increase in apparent photosynthesis at 2% O2 compared to 21% O2 at 25 C and 335 microliters per liter CO2, whereas in Panicum milioides, P. schenckii Hack., and P. decipiens Nees ex Trin., members of the Laxa group of Panicum, increases ranged from 25 to 30%. The remainder of the species did not respond to O2. Species with O2 responses characteristic of C3 plants exhibited CO2 compensation concentrations of 44 microliters per liter or higher at 21% O2 and 25 to 27.5 C and species characterized as O2-insensitive had values of microliters per liter or less. The CO2 compensation concentration (Г) values of P. milioides, P. schenckii, and P. decipiens ranged from 10.3 to 23.3 microliters per liter. Other species of the Laxa group of Panicum exhibited O2 response and Г values of either C3 (P. laxum Sw., P. hylaeicum Mez., and P. rivulare Trin.) or C4 (P. prionitis Griseb.) plants. Leaves of species with O2 response and CO2 compensation values typical of C3 plants had poorly developed or nearly empty bundle sheath cells, and much larger distances and mesophyll cell numbers between veins than did the O2-insensitive ones. Vein spacings in P. milioides, P. schenckii, and P. decipiens ranged from 0.18 to 0.28 millimeter and mesophyll cell number between veins from 5.2 to 7.8. While these vein spacings are closer than those of most C3 grasses, two O2-sensitive species of Dactylis had vein spacings similar to these Panicums and veins in Glyceria striata, another O2-sensitive plant, were separated by only four mesophyll cells and 0.12 millimeter. Bundle sheath cells of the three intermediate Panicums contained greater quantities of organelles than are typical for C3 grasses. Images PMID:16660944

  9. Carbon sequestration in soybean crop soils: the role of hydrogen-coupled CO2 fixation

    NASA Astrophysics Data System (ADS)

    Graham, A.; Layzell, D. B.; Scott, N. A.; Cen, Y.; Kyser, T. K.

    2011-12-01

    Conversion of native vegetation to agricultural land in order to support the world's growing population is a key factor contributing to global climate change. However, the extent to which agricultural activities contribute to greenhouse gas emissions compared to carbon storage is difficult to ascertain, especially for legume crops, such as soybeans. Soybean establishment often leads to an increase in N2O emissions because N-fixation leads to increased soil available N during decomposition of the low C:N legume biomass. However, soybean establishment may also reduce net greenhouse gas emissions by increasing soil fertility, plant growth, and soil carbon storage. The mechanism behind increased carbon storage, however, remains unclear. One explanation points to hydrogen coupled CO2 fixation; the process by which nitrogen fixation releases H2 into the soil system, thereby promoting chemoautotrophic carbon fixation by soil microbes. We used 13CO2 as a tracer to track the amount and fate of carbon fixed by hydrogen coupled CO2 fixation during one-year field and laboratory incubations. The objectives of the research are to 1) quantify rates of 13CO2 fixation in soil collected from a field used for long-term soybean production 2) examine the impact of H2 gas concentration on rates of 13CO2 fixation, and 3) measure changes in δ13C signature over time in 3 soil fractions: microbial biomass, light fraction, and acid stable fraction. If this newly-fixed carbon is incorporated into the acid-stable soil C fraction, it has a good chance of contributing to long-term soil C sequestration under soybean production. Soil was collected in the field both adjacent to root nodules (nodule soil) and >3cm away (root soil) and labelled with 13CO2 (1% v/v) in the presence and absence of H2 gas. After a two week labelling period, δ13C signatures already revealed differences in the four treatments of bulk soil: -17.1 for root, -17.6 for nodule, -14.2 for root + H2, and -6.1 for nodule + H2. Labelled soil was then placed in nylon mesh bags and buried in the field at a depth of 15cm in a soybean field at the Central Experiment Farm in Ottawa, Ontario. Samples will be removed at intervals of 1,2,3,6,9,12, and 15 months, and the δ13C of three soil fractions will be examined to reveal changes in carbon storage over time. Our results will provide insights into the fate of carbon fixed during hydrogen coupled CO2 fixation, and demonstrate whether this CO2 fixation can contribute to the long-term greenhouse gas balance of soybean production systems.

  10. Light Modulates the Biosynthesis and Organization of Cyanobacterial Carbon Fixation Machinery through Photosynthetic Electron Flow.

    PubMed

    Sun, Yaqi; Casella, Selene; Fang, Yi; Huang, Fang; Faulkner, Matthew; Barrett, Steve; Liu, Lu-Ning

    2016-05-01

    Cyanobacteria have evolved effective adaptive mechanisms to improve photosynthesis and CO2 fixation. The central CO2-fixing machinery is the carboxysome, which is composed of an icosahedral proteinaceous shell encapsulating the key carbon fixation enzyme, Rubisco, in the interior. Controlled biosynthesis and ordered organization of carboxysomes are vital to the CO2-fixing activity of cyanobacterial cells. However, little is known about how carboxysome biosynthesis and spatial positioning are physiologically regulated to adjust to dynamic changes in the environment. Here, we used fluorescence tagging and live-cell confocal fluorescence imaging to explore the biosynthesis and subcellular localization of β-carboxysomes within a model cyanobacterium, Synechococcus elongatus PCC7942, in response to light variation. We demonstrated that β-carboxysome biosynthesis is accelerated in response to increasing light intensity, thereby enhancing the carbon fixation activity of the cell. Inhibition of photosynthetic electron flow impairs the accumulation of carboxysomes, indicating a close coordination between β-carboxysome biogenesis and photosynthetic electron transport. Likewise, the spatial organization of carboxysomes in the cell correlates with the redox state of photosynthetic electron transport chain. This study provides essential knowledge for us to modulate the β-carboxysome biosynthesis and function in cyanobacteria. In translational terms, the knowledge is instrumental for design and synthetic engineering of functional carboxysomes into higher plants to improve photosynthesis performance and CO2 fixation. PMID:26956667

  11. The effect of nutrients on carbon and nitrogen fixation by the UCYN-A-haptophyte symbiosis.

    PubMed

    Krupke, Andreas; Mohr, Wiebke; LaRoche, Julie; Fuchs, Bernhard M; Amann, Rudolf I; Kuypers, Marcel M M

    2015-07-01

    Symbiotic relationships between phytoplankton and N2-fixing microorganisms play a crucial role in marine ecosystems. The abundant and widespread unicellular cyanobacteria group A (UCYN-A) has recently been found to live symbiotically with a haptophyte. Here, we investigated the effect of nitrogen (N), phosphorus (P), iron (Fe) and Saharan dust additions on nitrogen (N2) fixation and primary production by the UCYN-A-haptophyte association in the subtropical eastern North Atlantic Ocean using nifH expression analysis and stable isotope incubations combined with single-cell measurements. N2 fixation by UCYN-A was stimulated by the addition of Fe and Saharan dust, although this was not reflected in the nifH expression. CO2 fixation by the haptophyte was stimulated by the addition of ammonium nitrate as well as Fe and Saharan dust. Intriguingly, the single-cell analysis using nanometer scale secondary ion mass spectrometry indicates that the increased CO2 fixation by the haptophyte in treatments without added fixed N is likely an indirect result of the positive effect of Fe and/or P on UCYN-A N2 fixation and the transfer of N2-derived N to the haptophyte. Our results reveal a direct linkage between the marine carbon and nitrogen cycles that is fuelled by the atmospheric deposition of dust. The comparison of single-cell rates suggests a tight coupling of nitrogen and carbon transfer that stays balanced even under changing nutrient regimes. However, it appears that the transfer of carbon from the haptophyte to UCYN-A requires a transfer of nitrogen from UCYN-A. This tight coupling indicates an obligate symbiosis of this globally important diazotrophic association. PMID:25535939

  12. Metal-complex/semiconductor hybrids for carbon dioxide fixation

    NASA Astrophysics Data System (ADS)

    Maeda, Kazuhiko; Kuriki, Ryo; Sekizawa, Keita; Ishitani, Osamu

    2015-09-01

    A hybrid photocatalyst consisting of a catalytic Ru complex and polymeric carbon nitride (band gap, 2.7 eV) was capable of reducing CO2 into HCOOH with ~80% selectivity under visible light (? > 420 nm) in the presence of a suitable electron donor. Introduction of mesoporosity into the graphitic carbon nitride structure to increase the specific surface area was essential to enhancing the activity. However, higher surface area (in other words, lower crystallinity) that originated from excessively introduced mesopores had a negative impact on activity. Promoting electron injection from carbon nitride to the catalytic Ru unit as well as strengthening the electronic interactions between the two units improved the activity. Under the optimal condition, a turnover number (TON, with respect to the Ru complex used) greater than 1000 and an apparent quantum yield of 5.7% (at 400 nm) were obtained, which are the greatest among heterogeneous photocatalysts for visible-light CO2 reduction ever reported.

  13. Slow carboxylation of Rubisco constrains the rate of carbon fixation during Antarctic phytoplankton blooms.

    PubMed

    Young, Jodi N; Goldman, Johanna A L; Kranz, Sven A; Tortell, Philippe D; Morel, Francois M M

    2015-01-01

    High-latitude oceans are areas of high primary production despite temperatures that are often well below the thermal optima of enzymes, including the key Calvin Cycle enzyme, Ribulose 1,5 bisphosphate carboxylase oxygenase (Rubisco). We measured carbon fixation rates, protein content and Rubisco abundance and catalytic rates during an intense diatom bloom in the Western Antarctic Peninsula (WAP) and in laboratory cultures of a psychrophilic diatom (Fragilariopsis cylindrus). At -1°C, the Rubisco turnover rate, kcat (c) , was 0.4 C s(-1) per site and the half saturation constant for CO2 was 15 μM (vs c. 3 C s(-1) per site and 50 μM at 20°C). To achieve high carboxylation rates, psychrophilic diatoms increased Rubisco abundance to c. 8% of biomass (vs c. 0.6% at 20°C), along with their total protein content, resulting in a low carbon : nitrogen ratio of c. 5. In psychrophilic diatoms, Rubisco must be almost fully active and near CO2 saturation to achieve carbon fixation rates observed in the WAP. Correspondingly, total protein concentrations were close to the highest ever measured in phytoplankton and likely near the maximum possible. We hypothesize that this high protein concentration, like that of Rubisco, is necessitated by slow enzyme rates, and that carbon fixation rates in the WAP are near a theoretical maximum. PMID:25283055

  14. Autotrophic Carbon Dioxide Fixation via the Calvin-Benson-Bassham Cycle by the Denitrifying Methanotroph “Candidatus Methylomirabilis oxyfera”

    PubMed Central

    Kool, Dorien M.; Jetten, Mike S. M.; Sinninghe Damsté, Jaap S.; Ettwig, Katharina F.

    2014-01-01

    Methane is an important greenhouse gas and the most abundant hydrocarbon in the Earth's atmosphere. Methanotrophic microorganisms can use methane as their sole energy source and play a crucial role in the mitigation of methane emissions in the environment. “Candidatus Methylomirabilis oxyfera” is a recently described intra-aerobic methanotroph that is assumed to use nitric oxide to generate internal oxygen to oxidize methane via the conventional aerobic pathway, including the monooxygenase reaction. Previous genome analysis has suggested that, like the verrucomicrobial methanotrophs, “Ca. Methylomirabilis oxyfera” encodes and transcribes genes for the Calvin-Benson-Bassham (CBB) cycle for carbon assimilation. Here we provide multiple independent lines of evidence for autotrophic carbon dioxide fixation by “Ca. Methylomirabilis oxyfera” via the CBB cycle. The activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO), a key enzyme of the CBB cycle, in cell extracts from an “Ca. Methylomirabilis oxyfera” enrichment culture was shown to account for up to 10% of the total methane oxidation activity. Labeling studies with whole cells in batch incubations supplied with either 13CH4 or [13C]bicarbonate revealed that “Ca. Methylomirabilis oxyfera” biomass and lipids became significantly more enriched in 13C after incubation with 13C-labeled bicarbonate (and unlabeled methane) than after incubation with 13C-labeled methane (and unlabeled bicarbonate), providing evidence for autotrophic carbon dioxide fixation. Besides this experimental approach, detailed genomic and transcriptomic analysis demonstrated an operational CBB cycle in “Ca. Methylomirabilis oxyfera.” Altogether, these results show that the CBB cycle is active and plays a major role in carbon assimilation by “Ca. Methylomirabilis oxyfera” bacteria. Our results suggest that autotrophy might be more widespread among methanotrophs than was previously assumed and implies that a methanotrophic community in the environment is not necessarily revealed by 13C-depleted lipids. PMID:24509918

  15. Unravelling Carbon Fixation under Nutrient limited Conditions - a Water Column Perspective

    NASA Astrophysics Data System (ADS)

    Thomas, Helmuth; Craig, Susanne; Shadwick, Elizabeth H.; Li, William K.; Greenan, Blair J. W.

    2014-05-01

    Phytoplankton plays a critical role in the uptake of atmospheric carbon dioxide (CO2) by the ocean, and is comprised of a spectrum of cell sizes that are strongly regulated by oceanographic conditions. Elevated CO2 fixation relative to nutrient availability, also called carbon overconsumption, has been observed in various mid to high latitude systems, such as the Baltic and North Seas, the North Atlantic Ocean, the Canadian Arctic Archipelago or the Scotian Shelf. We shed light on this phenomenon relying on an extensive data set of water column observations of the CO2 system and phytoplankton cell counts from the Scotian Shelf, a temperate shelf sea. We show that in the summertime, the population of numerically abundant small cells, which favour warmer, nutrient poor conditions, accounts for approximately 20% of annual carbon uptake. At the broader scale, the neglection of this "non-Redfieldian" contribution typically leads to an underestimation of net community production by approximately 20% to 50%. These small cells are not well represented by chlorophyll a - the ubiquitously used proxy of phytoplankton biomass - but rather, are strongly correlated with surface water temperature. Given the persistent near-zero nutrient concentrations during the summer, it appears that small cells drive carbon overconsumption, and suggest that their role in carbon fixation will become increasingly important in a warming, increasingly stratified ocean.

  16. Chemoautotrophic carbon fixation rates and active bacterial communities in intertidal marine sediments.

    PubMed

    Boschker, Henricus T S; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W C; Moodley, Leon

    2014-01-01

    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, The Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m(-2) d(-1). Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)(-1), which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  17. Chemoautotrophic Carbon Fixation Rates and Active Bacterial Communities in Intertidal Marine Sediments

    PubMed Central

    Boschker, Henricus T. S.; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W. C.; Moodley, Leon

    2014-01-01

    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, the Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m−2 d−1. Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)−1, which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  18. Irreversibly increased nitrogen fixation in Trichodesmium experimentally adapted to elevated carbon dioxide

    NASA Astrophysics Data System (ADS)

    Hutchins, David A.; Walworth, Nathan G.; Webb, Eric A.; Saito, Mak A.; Moran, Dawn; McIlvin, Matthew R.; Gale, Jasmine; Fu, Fei-Xue

    2015-09-01

    Nitrogen fixation rates of the globally distributed, biogeochemically important marine cyanobacterium Trichodesmium increase under high carbon dioxide (CO2) levels in short-term studies due to physiological plasticity. However, its long-term adaptive responses to ongoing anthropogenic CO2 increases are unknown. Here we show that experimental evolution under extended selection at projected future elevated CO2 levels results in irreversible, large increases in nitrogen fixation and growth rates, even after being moved back to lower present day CO2 levels for hundreds of generations. This represents an unprecedented microbial evolutionary response, as reproductive fitness increases acquired in the selection environment are maintained after returning to the ancestral environment. Constitutive rate increases are accompanied by irreversible shifts in diel nitrogen fixation patterns, and increased activity of a potentially regulatory DNA methyltransferase enzyme. High CO2-selected cell lines also exhibit increased phosphorus-limited growth rates, suggesting a potential advantage for this keystone organism in a more nutrient-limited, acidified future ocean.

  19. Irreversibly increased nitrogen fixation in Trichodesmium experimentally adapted to elevated carbon dioxide

    PubMed Central

    Hutchins, David A.; Walworth, Nathan G.; Webb, Eric A.; Saito, Mak A.; Moran, Dawn; McIlvin, Matthew R.; Gale, Jasmine; Fu, Fei-Xue

    2015-01-01

    Nitrogen fixation rates of the globally distributed, biogeochemically important marine cyanobacterium Trichodesmium increase under high carbon dioxide (CO2) levels in short-term studies due to physiological plasticity. However, its long-term adaptive responses to ongoing anthropogenic CO2 increases are unknown. Here we show that experimental evolution under extended selection at projected future elevated CO2 levels results in irreversible, large increases in nitrogen fixation and growth rates, even after being moved back to lower present day CO2 levels for hundreds of generations. This represents an unprecedented microbial evolutionary response, as reproductive fitness increases acquired in the selection environment are maintained after returning to the ancestral environment. Constitutive rate increases are accompanied by irreversible shifts in diel nitrogen fixation patterns, and increased activity of a potentially regulatory DNA methyltransferase enzyme. High CO2-selected cell lines also exhibit increased phosphorus-limited growth rates, suggesting a potential advantage for this keystone organism in a more nutrient-limited, acidified future ocean. PMID:26327191

  20. Comparative Shotgun Proteomic Analysis of Wastewater-Cultured Microalgae: Nitrogen Sensing and Carbon Fixation for Growth and Nutrient Removal in Chlamydomonas reinhardtii.

    PubMed

    Patel, Anil K; Huang, Eric L; Low-Décarie, Etienne; Lefsrud, Mark G

    2015-08-01

    Chlamydomonas reinhardtii was batch-cultured for 12 days under continuous illumination to investigate nitrogen uptake and metabolic responses to wastewater processing. Our approach compared two conditions: (1) artificial wastewater containing nitrate and ammonia and (2) nutrient-sufficient control containing nitrate as sole form of nitrogen. Treatments did not differ in final biomass; however, comparison of group proteomes revealed significant differences. Label-free shotgun proteomic analysis identified 2358 proteins, of which 92 were significantly differentially abundant. Wastewater cells showed higher relative abundances of photosynthetic antenna proteins, enzymes related to carbon fixation, and biosynthesis of amino acids and secondary metabolites. Control cells showed higher abundances of enzymes and proteins related to nitrogen metabolism and assimilation, synthesis and utilization of starch, amino acid recycling, evidence of oxidative stress, and little lipid biosynthesis. This study of the eukaryotic microalgal proteome response to nitrogen source, availability, and switching highlights tightly controlled pathways essential to the maintenance of culture health and productivity in concert with light absorption and carbon assimilation. Enriched pathways in artificial wastewater, notably, photosynthetic carbon fixation and biosynthesis of plant hormones, and those in nitrate only control, most notably, nitrogen, amino acid, and starch metabolism, represent potential targets for genetic improvement requiring targeted elucidation. PMID:25997359

  1. Carboxysomal carbonic anhydrases: Structure and role in microbial CO2 fixation

    SciTech Connect

    Cannon, Gordon C.; Heinhorst, Sabine; Kerfeld, Cheryl A.

    2010-06-23

    Cyanobacteria and some chemoautotrophic bacteria are able to grow in environments with limiting CO2 concentrations by employing a CO2-concentrating mechanism (CCM) that allows them to accumulate inorganic carbon in their cytoplasm to concentrations several orders of magnitude higher than that on the outside. The final step of this process takes place in polyhedral protein microcompartments known as carboxysomes, which contain the majority of the CO2-fixing enzyme, RubisCO. The efficiency of CO2 fixation by the sequestered RubisCO is enhanced by co-localization with a specialized carbonic anhydrase that catalyzes dehydration of the cytoplasmic bicarbonate and ensures saturation of RubisCO with its substrate, CO2. There are two genetically distinct carboxysome types that differ in their protein composition and in the carbonic anhydrase(s) they employ. Here we review the existing information concerning the genomics, structure and enzymology of these uniquely adapted carbonic anhydrases, which are of fundamental importance in the global carbon cycle.

  2. [Regulation of alternative CO{sub 2} fixation pathways in procaryotic and eucaryotic photosynthetic organisms]. Progress report

    SciTech Connect

    Not Available

    1992-12-31

    The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.

  3. PH-NEUTRAL CONCRETE FOR ATTACHED MICROALGAE AND ENHANCED CARBON DIOXIDE FIXATION - PHASE I

    SciTech Connect

    Kerry M. Dooley; F. Carl Knopf; Robert P. Gambrell

    1999-05-31

    The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SC-CO {sub 2})-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resistance) cement-based products. SC-CO{sub 2} can rapidly convert the calcium hydroxide in cured cement to calcium carbonate, which increases the density and unconfined compressive strength in the treated region. In cured concrete, this treated region is typically a several-mm thick layer (generally <{approx}5mm, unless treatment time is excessive). However, we have found that by treating the entire cement matrix with SC-CO{sub 2} as part of the curing process, we can carbonate it rapidly, regardless of the thickness. By ''rapidly'' we mean simultaneous carbonation/curing in < 5 ks even for large cement forms, compared to typical carbonation times of several days or even years at low pressures. Carbonation changes the pH in the treated region from {approx}13 to {approx}8, almost exactly compatible with seawater. Therefore the leaching rates from these cements is reduced. These cement improvements are directed to the development of strong but thin artificial reefs, to which can be attached microalgae used for the enhanced fixation of CO{sub 2}. It is shown below that attached microalgae, as algal beds or reefs, are more efficient for CO{sub 2} fixation by a factor of 20, compared to the open ocean on an area basis. We have performed preliminary tests of the pH-neutral cements of our invention for attachment of microalgae populations. We have found pH-neutral materials which attach microalgae readily. These include silica-enriched (pozzolanic) cements, blast-furnace slags and fly ash, which are also silica-rich. We have already developed technology to simultaneously foam, carbonate and cure the cements; this foaming process further increases cement surface areas for microalgae attachment, in some cases to >10 m{sup 2}/g internal surface area. This project involves a team of researchers with backgrounds in cement technology, supercritical fluid technology, materials science, oceanography, and wetland biogeochemistry.

  4. Predicting the Electron Requirement for Carbon Fixation in Seas and Oceans

    PubMed Central

    Lawrenz, Evelyn; Silsbe, Greg; Capuzzo, Elisa; Ylöstalo, Pasi; Forster, Rodney M.; Simis, Stefan G. H.; Prášil, Ondřej; Kromkamp, Jacco C.; Hickman, Anna E.; Moore, C. Mark; Forget, Marie-Hélèn; Geider, Richard J.; Suggett, David J.

    2013-01-01

    Marine phytoplankton account for about 50% of all global net primary productivity (NPP). Active fluorometry, mainly Fast Repetition Rate fluorometry (FRRf), has been advocated as means of providing high resolution estimates of NPP. However, not measuring CO2-fixation directly, FRRf instead provides photosynthetic quantum efficiency estimates from which electron transfer rates (ETR) and ultimately CO2-fixation rates can be derived. Consequently, conversions of ETRs to CO2-fixation requires knowledge of the electron requirement for carbon fixation (Φe,C, ETR/CO2 uptake rate) and its dependence on environmental gradients. Such knowledge is critical for large scale implementation of active fluorescence to better characterise CO2-uptake. Here we examine the variability of experimentally determined Φe,C values in relation to key environmental variables with the aim of developing new working algorithms for the calculation of Φe,C from environmental variables. Coincident FRRf and 14C-uptake and environmental data from 14 studies covering 12 marine regions were analysed via a meta-analytical, non-parametric, multivariate approach. Combining all studies, Φe,C varied between 1.15 and 54.2 mol e− (mol C)−1 with a mean of 10.9±6.91 mol e− mol C)−1. Although variability of Φe,C was related to environmental gradients at global scales, region-specific analyses provided far improved predictive capability. However, use of regional Φe,C algorithms requires objective means of defining regions of interest, which remains challenging. Considering individual studies and specific small-scale regions, temperature, nutrient and light availability were correlated with Φe,C albeit to varying degrees and depending on the study/region and the composition of the extant phytoplankton community. At the level of large biogeographic regions and distinct water masses, Φe,C was related to nutrient availability, chlorophyll, as well as temperature and/or salinity in most regions, while light availability was also important in Baltic Sea and shelf waters. The novel Φe,C algorithms provide a major step forward for widespread fluorometry-based NPP estimates and highlight the need for further studying the natural variability of Φe,C to verify and develop algorithms with improved accuracy. PMID:23516441

  5. Predicting the electron requirement for carbon fixation in seas and oceans.

    PubMed

    Lawrenz, Evelyn; Silsbe, Greg; Capuzzo, Elisa; Ylöstalo, Pasi; Forster, Rodney M; Simis, Stefan G H; Prášil, Ondřej; Kromkamp, Jacco C; Hickman, Anna E; Moore, C Mark; Forget, Marie-Hélèn; Geider, Richard J; Suggett, David J

    2013-01-01

    Marine phytoplankton account for about 50% of all global net primary productivity (NPP). Active fluorometry, mainly Fast Repetition Rate fluorometry (FRRf), has been advocated as means of providing high resolution estimates of NPP. However, not measuring CO2-fixation directly, FRRf instead provides photosynthetic quantum efficiency estimates from which electron transfer rates (ETR) and ultimately CO2-fixation rates can be derived. Consequently, conversions of ETRs to CO2-fixation requires knowledge of the electron requirement for carbon fixation (Φe,C, ETR/CO2 uptake rate) and its dependence on environmental gradients. Such knowledge is critical for large scale implementation of active fluorescence to better characterise CO2-uptake. Here we examine the variability of experimentally determined Φe,C values in relation to key environmental variables with the aim of developing new working algorithms for the calculation of Φe,C from environmental variables. Coincident FRRf and (14)C-uptake and environmental data from 14 studies covering 12 marine regions were analysed via a meta-analytical, non-parametric, multivariate approach. Combining all studies, Φe,C varied between 1.15 and 54.2 mol e(-) (mol C)(-1) with a mean of 10.9 ± 6.91 mol e(-) mol C)(-1). Although variability of Φe,C was related to environmental gradients at global scales, region-specific analyses provided far improved predictive capability. However, use of regional Φ e,C algorithms requires objective means of defining regions of interest, which remains challenging. Considering individual studies and specific small-scale regions, temperature, nutrient and light availability were correlated with Φ e,C albeit to varying degrees and depending on the study/region and the composition of the extant phytoplankton community. At the level of large biogeographic regions and distinct water masses, Φ e,C was related to nutrient availability, chlorophyll, as well as temperature and/or salinity in most regions, while light availability was also important in Baltic Sea and shelf waters. The novel Φ e,C algorithms provide a major step forward for widespread fluorometry-based NPP estimates and highlight the need for further studying the natural variability of Φe,C to verify and develop algorithms with improved accuracy. PMID:23516441

  6. Inhibitory effect of hypergravity on photosynthetic carbon dioxide fixation in Euglena gracilis.

    PubMed

    Ortiz, W; Wignarajah, K; Smith, J D

    2000-08-01

    Photosynthesis, the conversion of light energy into chemical energy, is a critical biological process, whereby plants synthesize carbohydrates from light, carbon dioxide (CO2) and water. The influence of gravity on this biological process, however, is not well understood. Thus, centrifugation was used to alter the gravity environment of Euglena gracilis grown on nutritive agar plates illuminated with red and blue light emitting diodes. The results showed that hypergravity (up to 10xg) had an inhibitory effect on photosynthetic CO2 fixation. Chlorophyll accumulation per cell was essentially unaffected by treatment; however, Chl a/Chl b ratios decreased in hypergravity when compared to 1xg controls. Photosynthesis in Euglena appears to have limited tolerance for even moderate changes in gravitational acceleration. PMID:11543574

  7. Improved analysis of C4 and C3 photosynthesis via refined in vitro assays of their carbon fixation biochemistry.

    PubMed

    Sharwood, Robert E; Sonawane, Balasaheb V; Ghannoum, Oula; Whitney, Spencer M

    2016-05-01

    Plants operating C3 and C4 photosynthetic pathways exhibit differences in leaf anatomy and photosynthetic carbon fixation biochemistry. Fully understanding this underpinning biochemical variation is requisite to identifying solutions for improving photosynthetic efficiency and growth. Here we refine assay methods for accurately measuring the carboxylase and decarboxylase activities in C3 and C4 plant soluble protein. We show that differences in plant extract preparation and assay conditions are required to measure NADP-malic enzyme and phosphoenolpyruvate carboxylase (pH 8, Mg(2+), 22 °C) and phosphoenolpyruvate carboxykinase (pH 7, >2mM Mn(2+), no Mg(2+)) maximal activities accurately. We validate how the omission of MgCl2 during leaf protein extraction, lengthy (>1min) centrifugation times, and the use of non-pure ribulose-1,5-bisphosphate (RuBP) significantly underestimate Rubisco activation status. We show how Rubisco activation status varies with leaf ontogeny and is generally lower in mature C4 monocot leaves (45-60% activation) relative to C3 monocots (55-90% activation). Consistent with their >3-fold lower Rubisco contents, full Rubisco activation in soluble protein from C4 leaves (<5min) was faster than in C3 plant samples (<10min), with addition of Rubisco activase not required for full activation. We conclude that Rubisco inactivation in illuminated leaves primarily stems from RuBP binding to non-carbamylated enzyme, a state readily reversible by dilution during cellular protein extraction. PMID:27122573

  8. Improved analysis of C4 and C3 photosynthesis via refined in vitro assays of their carbon fixation biochemistry

    PubMed Central

    Sharwood, Robert E.; Sonawane, Balasaheb V.; Ghannoum, Oula; Whitney, Spencer M.

    2016-01-01

    Plants operating C3 and C4 photosynthetic pathways exhibit differences in leaf anatomy and photosynthetic carbon fixation biochemistry. Fully understanding this underpinning biochemical variation is requisite to identifying solutions for improving photosynthetic efficiency and growth. Here we refine assay methods for accurately measuring the carboxylase and decarboxylase activities in C3 and C4 plant soluble protein. We show that differences in plant extract preparation and assay conditions are required to measure NADP-malic enzyme and phosphoenolpyruvate carboxylase (pH 8, Mg2+, 22 °C) and phosphoenolpyruvate carboxykinase (pH 7, >2mM Mn2+, no Mg2+) maximal activities accurately. We validate how the omission of MgCl2 during leaf protein extraction, lengthy (>1min) centrifugation times, and the use of non-pure ribulose-1,5-bisphosphate (RuBP) significantly underestimate Rubisco activation status. We show how Rubisco activation status varies with leaf ontogeny and is generally lower in mature C4 monocot leaves (45–60% activation) relative to C3 monocots (55–90% activation). Consistent with their >3-fold lower Rubisco contents, full Rubisco activation in soluble protein from C4 leaves (<5min) was faster than in C3 plant samples (<10min), with addition of Rubisco activase not required for full activation. We conclude that Rubisco inactivation in illuminated leaves primarily stems from RuBP binding to non-carbamylated enzyme, a state readily reversible by dilution during cellular protein extraction. PMID:27122573

  9. Creation of active sites by impregnation of carbon fibers: application to the fixation of hydrogen sulfide.

    PubMed

    Meljac, Laure; Perier-Camby, Laurent; Thomas, Gérard

    2004-06-01

    Activated carbon fibers, which exhibit high specific area and numerous active surface sites, constitute very powerful adsorbents and are widely used in filtration to eliminate pollutants from liquid or gaseous effluents. The fibers studied in this work are devoted to the filtration of gaseous effluent containing very small amounts (few vpm) of hydrogen sulfide. Preliminary experiments evidenced that these fibers weakly adsorb hydrogen sulfide. To improve their fixation capacity toward H(2)S the activated fibers are impregnated in an aqueous solution of potassium hydroxide. The impregnation treatment usually takes place before activation but in this work it occurs at room temperature after activation of the fibers. A further thermal treatment is performed to increase the efficiency of the system. The overall treatment leads to the creation of basic sites showing a great activity for H(2)S gas in the presence of water vapor. The mechanism has been established by a series of characterizations before, during, and after the different operation units. The KOH deposited after impregnation is carbonated into KHCO(3) at room temperature and then decomposed into K(2)CO(3) during the thermal treatment. K(2)CO(3) and H(2)S dissolve in a liquid aqueous solution formed on the fiber surface. Then carbonate ions and H(2)S molecules react together almost completely to yield HS(-) species. As a consequence the sorption capacities of hydrogen sulfide on the impregnated fibers are much higher, even for small hydrogen sulfide volume fractions. PMID:15120288

  10. Assessing methanotrophy and carbon fixation for biofuel production by Methanosarcina acetivorans

    DOE PAGESBeta

    Nazem-Bokaee, Hadi; Gopalakrishnan, Saratram; Ferry, James G.; Wood, Thomas K.; Maranas, Costas D.

    2016-01-17

    Methanosarcina acetivorans is a model archaeon with renewed interest due to its unique reversible methane production pathways. However, the mechanism and relevant pathways implicated in (co)utilizing novel carbon substrates in this organism are still not fully understood. This paper provides a comprehensive inventory of thermodynamically feasible routes for anaerobic methane oxidation, co-reactant utilization, and maximum carbon yields of major biofuel candidates by M. acetivorans. Here, an updated genome-scale metabolic model of M. acetivorans is introduced (iMAC868 containing 868 genes, 845 reactions, and 718 metabolites) by integrating information from two previously reconstructed metabolic models (i.e., iVS941 and iMB745), modifying 17 reactions,more » adding 24 new reactions, and revising 64 gene-proteinreaction associations based on newly available information. The new model establishes improved predictions of growth yields on native substrates and is capable of correctly predicting the knockout outcomes for 27 out of 28 gene deletion mutants. By tracing a bifurcated electron flow mechanism, the iMAC868 model predicts thermodynamically feasible (co)utilization pathway of methane and bicarbonate using various terminal electron acceptors through the reversal of the aceticlastic pathway. In conclusion, this effort paves the way in informing the search for thermodynamically feasible ways of (co)utilizing novel carbon substrates in the domain Archaea.« less

  11. Genomic signatures of fifth autotrophic carbon assimilation pathway in bathypelagic Crenarchaeota.

    PubMed

    La Cono, Violetta; Smedile, Francesco; Ferrer, Manuel; Golyshin, Peter N; Giuliano, Laura; Yakimov, Michail M

    2010-09-01

    Marine Crenarchaeota, ubiquitous and abundant organisms in the oceans worldwide, remain metabolically uncharacterized, largely due to their low cultivability. Identification of candidate genes for bicarbonate fixation pathway in the Cenarchaeum symbiosum A was an initial step in understanding the physiology and ecology of marine Crenarchaeota. Recent cultivation and genome sequencing of obligate chemoautotrophic Nitrosopumilus maritimus SCM1 were a major breakthrough towards understanding of their functioning and provide a valuable model for experimental validation of genomic data. Here we present the identification of multiple key components of 3-hydroxipropionate/4-hydroxybutyrate cycle, the fifth pathway in carbon fixation, found in data sets of environmental sequences representing uncultivated superficial and bathypelagic Crenarchaeota from Sargasso sea (GOS data set) and KM3 (Mediterranean Sea) and ALOHA (Atlantic ocean) stations. These organisms are likely to use acetyl-CoA/propionyl-CoA carboxylase(s) as CO₂-fixing enzyme(s) to form succinyl-CoA, from which one molecule of acetyl-CoA is regenerated via 4-hydroxybutyrate cleavage and another acetyl-CoA to be the pathway product. The genetic distinctiveness and matching sympatric abundance imply that marine crenarchaeal genotypes from the three different geographic sites share similar ecophysiological properties, and therefore may represent fundamental units of marine ecosystem functioning. To couple results of sequence comparison with the dark ocean primary production, dissolved inorganic carbon fixation rates were measured at KM3 Station (3000 m depth, Eastern Mediterranean Sea), i.e. at the same site and depth used for metagenomic library construction. PMID:21255356

  12. High cell-specific rates of nitrogen and carbon fixation by the cyanobacterium Aphanizomenon sp. at low temperatures in the Baltic Sea.

    PubMed

    Svedén, Jennie B; Adam, Birgit; Walve, Jakob; Nahar, Nurun; Musat, Niculina; Lavik, Gaute; Whitehouse, Martin J; Kuypers, Marcel M M; Ploug, Helle

    2015-12-01

    Aphanizomenon is a widespread genus of nitrogen (N2)-fixing cyanobacteria in lakes and estuaries, accounting for a large fraction of the summer N2-fixation in the Baltic Sea. However, information about its cell-specific carbon (C)- and N2-fixation rates in the early growth season has not previously been reported. We combined various methods to study N2-fixation, photosynthesis and respiration in field-sampled Baltic Sea Aphanizomenon sp. during early summer at 10°C. Stable isotope incubations at in situ light intensities during 24 h combined with cell-specific secondary ion mass spectrometry showed an average net N2-fixation rate of 55 fmol N cell(-1) day(-1). Dark net N2-fixation rates over a course of 12 h were 20% of those measured in light. C-fixation, but not N2-fixation, was inhibited by high ambient light intensities during daytime. Consequently, the C:N fixation ratio varied substantially over the diel cycle. C- and N2-fixation rates were comparable to those reported for Aphanizomenon sp. in August at 19°C, using the same methods. High respiration rates (23% of gross photosynthesis) were measured with (14)C-incubations and O2-microsensors, and presumably reflect the energy needed for high N2-fixation rates. Hence, Aphanizomenon sp. is an important contributor to N2-fixation at low in situ temperatures in the early growth season. PMID:26511856

  13. Carbon and nitrogen fixation differ between successional stages of biological soil crusts in the Colorado Plateau and Chihuahuan Desert

    USGS Publications Warehouse

    Housman, D.C.; Powers, H.H.; Collins, A.D.; Belnap, J.

    2006-01-01

    Biological soil crusts (cyanobacteria, mosses and lichens collectively) perform essential ecosystem services, including carbon (C) and nitrogen (N) fixation. Climate and land-use change are converting later successional soil crusts to early successional soil crusts with lower C and N fixation rates. To quantify the effect of such conversions on C and N dynamics in desert ecosystems we seasonally measured diurnal fixation rates in different biological soil crusts. We classified plots on the Colorado Plateau (Canyonlands) and Chihuahuan Desert (Jornada) as early (Microcoleus) or later successional (Nostoc/Scytonema or Placidium/Collema) and measured photosynthesis (Pn), nitrogenase activity (NA), and chlorophyll fluorescence (Fv/Fm) on metabolically active (moist) soil crusts. Later successional crusts typically had greater Pn, averaging 1.2-1.3-fold higher daily C fixation in Canyonlands and 2.4-2.8-fold higher in the Jornada. Later successional crusts also had greater NA, averaging 1.3-7.5-fold higher daily N fixation in Canyonlands and 1.3-25.0-fold higher in the Jornada. Mean daily Fv/Fm was also greater in later successional Canyonlands crusts during winter, and Jornada crusts during all seasons except summer. Together these findings indicate conversion of soil crusts back to early successional stages results in large reductions of C and N inputs into these ecosystems.

  14. Hydrogen-based carbon fixation in the earliest known photosynthetic organisms

    NASA Astrophysics Data System (ADS)

    Tice, Michael M.; Lowe, Donald R.

    2006-01-01

    Thin carbonaceous laminations preserved in shallow-water facies of the 3416 Ma Buck Reef Chert, South Africa, have been interpreted to represent some of the oldest-known mats constructed by photosynthetic microbes. Preservation of these mats within a unit containing facies deposited at water depths ranging from 0 m to >200 m provides an opportunity to explore the electron donors employed in early microbial photosynthesis. The presence of siderite (FeCO3) as a primary sediment, lack of hematite (Fe2O3), and lack of cerium anomalies throughout the Buck Reef Chert imply that the entire water column was anoxic despite the presence of photosynthetic organisms. Authigenic uranium (Ua = U Th/3) correlates inversely with siderite abundance, suggesting that variations in carbonate rather than oxygen activity controlled uranium mobility. The inferred lack of oxygen and ferric minerals and the presence of dissolved Fe2+ in the water column imply that H2O, Fe2+, and H2S could not have served as primary electron donors for carbon fixation. It is most likely that Buck Reef Chert bacteria utilized H2 as the primary reductant for photosynthesis.

  15. Induction of Photosynthetic Carbon Fixation in Anoxia Relies on Hydrogenase Activity and Proton-Gradient Regulation-Like1-Mediated Cyclic Electron Flow in Chlamydomonas reinhardtii.

    PubMed

    Godaux, Damien; Bailleul, Benjamin; Berne, Nicolas; Cardol, Pierre

    2015-06-01

    The model green microalga Chlamydomonas reinhardtii is frequently subject to periods of dark and anoxia in its natural environment. Here, by resorting to mutants defective in the maturation of the chloroplastic oxygen-sensitive hydrogenases or in Proton-Gradient Regulation-Like1 (PGRL1)-dependent cyclic electron flow around photosystem I (PSI-CEF), we demonstrate the sequential contribution of these alternative electron flows (AEFs) in the reactivation of photosynthetic carbon fixation during a shift from dark anoxia to light. At light onset, hydrogenase activity sustains a linear electron flow from photosystem II, which is followed by a transient PSI-CEF in the wild type. By promoting ATP synthesis without net generation of photosynthetic reductants, the two AEF are critical for restoration of the capacity for carbon dioxide fixation in the light. Our data also suggest that the decrease in hydrogen evolution with time of illumination might be due to competition for reduced ferredoxins between ferredoxin-NADP(+) oxidoreductase and hydrogenases, rather than due to the sensitivity of hydrogenase activity to oxygen. Finally, the absence of the two alternative pathways in a double mutant pgrl1 hydrogenase maturation factor G-2 is detrimental for photosynthesis and growth and cannot be compensated by any other AEF or anoxic metabolic responses. This highlights the role of hydrogenase activity and PSI-CEF in the ecological success of microalgae in low-oxygen environments. PMID:25931521

  16. Light Modulates the Biosynthesis and Organization of Cyanobacterial Carbon Fixation Machinery through Photosynthetic Electron Flow1[OPEN

    PubMed Central

    Sun, Yaqi; Casella, Selene

    2016-01-01

    Cyanobacteria have evolved effective adaptive mechanisms to improve photosynthesis and CO2 fixation. The central CO2-fixing machinery is the carboxysome, which is composed of an icosahedral proteinaceous shell encapsulating the key carbon fixation enzyme, Rubisco, in the interior. Controlled biosynthesis and ordered organization of carboxysomes are vital to the CO2-fixing activity of cyanobacterial cells. However, little is known about how carboxysome biosynthesis and spatial positioning are physiologically regulated to adjust to dynamic changes in the environment. Here, we used fluorescence tagging and live-cell confocal fluorescence imaging to explore the biosynthesis and subcellular localization of β-carboxysomes within a model cyanobacterium, Synechococcus elongatus PCC7942, in response to light variation. We demonstrated that β-carboxysome biosynthesis is accelerated in response to increasing light intensity, thereby enhancing the carbon fixation activity of the cell. Inhibition of photosynthetic electron flow impairs the accumulation of carboxysomes, indicating a close coordination between β-carboxysome biogenesis and photosynthetic electron transport. Likewise, the spatial organization of carboxysomes in the cell correlates with the redox state of photosynthetic electron transport chain. This study provides essential knowledge for us to modulate the β-carboxysome biosynthesis and function in cyanobacteria. In translational terms, the knowledge is instrumental for design and synthetic engineering of functional carboxysomes into higher plants to improve photosynthesis performance and CO2 fixation. PMID:26956667

  17. Carbon-Fixation Rates and Associated Microbial Communities Residing in Arid and Ephemerally Wet Antarctic Dry Valley Soils

    PubMed Central

    Niederberger, Thomas D.; Sohm, Jill A.; Gunderson, Troy; Tirindelli, Joëlle; Capone, Douglas G.; Carpenter, Edward J.; Cary, S. Craig

    2015-01-01

    Carbon-fixation is a critical process in severely oligotrophic Antarctic Dry Valley (DV) soils and may represent the major source of carbon in these arid environments. However, rates of C-fixation in DVs are currently unknown and the microorganisms responsible for these activities unidentified. In this study, C-fixation rates measured in the bulk arid soils (<5% moisture) ranged from below detection limits to ∼12 nmol C/cc/h. Rates in ephemerally wet soils ranged from ∼20 to 750 nmol C/cc/h, equating to turnover rates of ∼7–140 days, with lower rates in stream-associated soils as compared to lake-associated soils. Sequencing of the large subunit of RuBisCO (cbbL) in these soils identified green-type sequences dominated by the 1B cyanobacterial phylotype in both arid and wet soils including the RNA fraction of the wet soil. Red-type cbbL genes were dominated by 1C actinobacterial phylotypes in arid soils, with wetted soils containing nearly equal proportions of 1C (actinobacterial and proteobacterial signatures) and 1D (algal) phylotypes. Complementary 16S rRNA and 18S rRNA gene sequencing also revealed distinct differences in community structure between biotopes. This study is the first of its kind to examine C-fixation rates in DV soils and the microorganisms potentially responsible for these activities. PMID:26696969

  18. Establishment of microbial eukaryotic enrichment cultures from a chemically stratified antarctic lake and assessment of carbon fixation potential.

    PubMed

    Dolhi, Jenna M; Ketchum, Nicholas; Morgan-Kiss, Rachael M

    2012-01-01

    Lake Bonney is one of numerous permanently ice-covered lakes located in the McMurdo Dry Valleys, Antarctica. The perennial ice cover maintains a chemically stratified water column and unlike other inland bodies of water, largely prevents external input of carbon and nutrients from streams. Biota are exposed to numerous environmental stresses, including year-round severe nutrient deficiency, low temperatures, extreme shade, hypersalinity, and 24-hour darkness during the winter (1). These extreme environmental conditions limit the biota in Lake Bonney almost exclusively to microorganisms (2). Single-celled microbial eukaryotes (called "protists") are important players in global biogeochemical cycling (3) and play important ecological roles in the cycling of carbon in the dry valley lakes, occupying both primary and tertiary roles in the aquatic food web. In the dry valley aquatic food web, protists that fix inorganic carbon (autotrophy) are the major producers of organic carbon for organotrophic organisms (4, 2). Phagotrophic or heterotrophic protists capable of ingesting bacteria and smaller protists act as the top predators in the food web (5). Last, an unknown proportion of the protist population is capable of combined mixotrophic metabolism (6, 7). Mixotrophy in protists involves the ability to combine photosynthetic capability with phagotrophic ingestion of prey microorganisms. This form of mixotrophy differs from mixotrophic metabolism in bacterial species, which generally involves uptake dissolved carbon molecules. There are currently very few protist isolates from permanently ice-capped polar lakes, and studies of protist diversity and ecology in this extreme environment have been limited (8, 4, 9, 10, 5). A better understanding of protist metabolic versatility in the simple dry valley lake food web will aid in the development of models for the role of protists in the global carbon cycle. We employed an enrichment culture approach to isolate potentially phototrophic and mixotrophic protists from Lake Bonney. Sampling depths in the water column were chosen based on the location of primary production maxima and protist phylogenetic diversity (4, 11), as well as variability in major abiotic factors affecting protist trophic modes: shallow sampling depths are limited for major nutrients, while deeper sampling depths are limited by light availability. In addition, lake water samples were supplemented with multiple types of growth media to promote the growth of a variety of phototrophic organisms. RubisCO catalyzes the rate limiting step in the Calvin Benson Bassham (CBB) cycle, the major pathway by which autotrophic organisms fix inorganic carbon and provide organic carbon for higher trophic levels in aquatic and terrestrial food webs (12). In this study, we applied a radioisotope assay modified for filtered samples (13) to monitor maximum carboxylase activity as a proxy for carbon fixation potential and metabolic versatility in the Lake Bonney enrichment cultures. PMID:22546995

  19. Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

    PubMed Central

    Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

    2013-01-01

    Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae. PMID:23585853

  20. Fixation stability dictates the differentiation pathway of periosteal progenitor cells in fracture repair.

    PubMed

    Hagiwara, Yusuke; Dyment, Nathaniel A; Jiang, Xi; Jiang Ping, Huang; Ackert-Bicknell, Cheryl; Adams, Douglas J; Rowe, David W

    2015-07-01

    This study compared fracture repair stabilized by intramedullary pin (IMP) or external fixation (EF) in GFP reporter mice. A modified IMP was used as control while EF utilized six needles inserted transversely through the tibia and into a segment of a syringe barrel. X-rays taken at days 0, 14, and 35 showed that IMP resulted in significant three-dimensional deformity with a large callus while EF showed minimal deformity and callus formation. Cryohistological analysis of IMP at day 14 confirmed a large ColX-RFPchry+ callus surrounded by woven bone (Col3.6-GFPcyan) and TRAP+ osteoclasts with mature bone (hOC-GFPtpz) at the base. By day 35, cartilaginous components had been resorbed and an outer cortical shell (OCS) showed evidence of inward modeling. In contrast, the EF at day 14 showed no evidence of cartilage formation. Instead, periosteal-derived osteoblasts (Col3.6-GFPcyan) entered the fracture cleft and formed woven bone that spanned the marrow space. By day 35, mature bone had formed that was contiguous with the opposing cortical bone. Fracture site stability greatly affects the cellular response during repair and must be considered in the preclinical models that test therapies for improving fracture healing. PMID:25639792

  1. Rates of fixation by lightning of carbon and nitrogen in possible primitive atmospheres.

    PubMed

    Chameides, W L; Walker, J C

    1981-12-01

    A thermochemical-hydrodynamic model of the production of trace species by electrical discharges has been used to estimate the rates of fixation of C and N by lightning in the primitive atmosphere. Calculations for various possible mixtures of CH4, CO2, CO, N2, H2, and H2O reveal that the prime species produced were probably HCN and NO and that the key parameter determining the rates of fixation was the ratio of C atoms to O atoms in the atmosphere. Atmospheres with C more abundant than O have large HCN fixation rates, in excess of 10(17) molecules J-1, but small NO yields. However, when O is more abundant than C, the NO fixation rate approaches 10(17) molecules J-1 while the HCN yield is small. The implications for the evolution of life are discussed. PMID:6276836

  2. Co-optimization of diesel fuel biodegradation and N{sub 2} fixation through the addition of particulate organic carbon

    SciTech Connect

    Piehler, M.; Swistak, J.; Paerl, H.

    1995-12-31

    Petroleum hydrocarbon pollution in the marine environment is widespread and current bioremedial techniques are often not cost effective for small spills. The formulation of simple and inexpensive bioremedial methods could help reduce the impacts of frequent low volume spills in areas like marinas and ports. Particulate organic carbon (POC) was added to diesel fuel amended samples from inshore marine waters in the form of corn-slash (post-harvest leaves and stems), with and without inorganic nutrients (nitrate and phosphate). Biodegradation of diesel fuel ({sup 14}C hexadecane mineralization) and N{sub 2} fixation were measured in response to the additions, The addition of POC was necessary for N{sub 2} fixation and diesel fuel biodegradation to co-occur. The effects of diesel fuel and inorganic nutrient additions on N{sub 2} fixation rates were not consistent, with both inhibitory and stimulatory responses to each addition observed. The highest observed diesel fuel biodegradation levels were in response to treatments that included inorganic nutrients. The addition of POC alone increased diesel fuel degradation levels above that observed in the control. In an attempt to determine the effect of the POC on the microbial community, the corn particles were observed microscopically using scanning electron microscopy and light microscopy with tetrazolium salt additions. The corn particles were found to have abundant attached bacterial communities and microscale oxygen concentration gradients occurring on individual particles. The formation of oxygen replete microzones may be essential for the co-occurrence of aerobic diesel fuel biodegradation and oxygen inhibited N2 fixation. Mesocosm experiments are currently underway to further examine the structure and function of this primarily heterotrophic system and to explore the potential contribution of N{sub 2} fixation to the N requirements of diesel fuel biodegradation.

  3. Phytoplankton Productivity in an Arctic Fjord (West Greenland): Estimating Electron Requirements for Carbon Fixation and Oxygen Production

    PubMed Central

    Hancke, Kasper; Dalsgaard, Tage; Sejr, Mikael Kristian; Markager, Stiig; Glud, Ronnie Nøhr

    2015-01-01

    Accurate quantification of pelagic primary production is essential for quantifying the marine carbon turnover and the energy supply to the food web. Knowing the electron requirement (Κ) for carbon (C) fixation (ΚC) and oxygen (O2) production (ΚO2), variable fluorescence has the potential to quantify primary production in microalgae, and hereby increasing spatial and temporal resolution of measurements compared to traditional methods. Here we quantify ΚC and ΚO2 through measures of Pulse Amplitude Modulated (PAM) fluorometry, C fixation and O2 production in an Arctic fjord (Godthåbsfjorden, W Greenland). Through short- (2h) and long-term (24h) experiments, rates of electron transfer (ETRPSII), C fixation and/or O2 production were quantified and compared. Absolute rates of ETR were derived by accounting for Photosystem II light absorption and spectral light composition. Two-hour incubations revealed a linear relationship between ETRPSII and gross 14C fixation (R2 = 0.81) during light-limited photosynthesis, giving a ΚC of 7.6 ± 0.6 (mean ± S.E.) mol é (mol C)−1. Diel net rates also demonstrated a linear relationship between ETRPSII and C fixation giving a ΚC of 11.2 ± 1.3 mol é (mol C)−1 (R2 = 0.86). For net O2 production the electron requirement was lower than for net C fixation giving 6.5 ± 0.9 mol é (mol O2)−1 (R2 = 0.94). This, however, still is an electron requirement 1.6 times higher than the theoretical minimum for O2 production [i.e. 4 mol é (mol O2)−1]. The discrepancy is explained by respiratory activity and non-photochemical electron requirements and the variability is discussed. In conclusion, the bio-optical method and derived electron requirement support conversion of ETR to units of C or O2, paving the road for improved spatial and temporal resolution of primary production estimates. PMID:26218096

  4. Microcystin content of Microcystis aeruginosa is modulated by nitrogen uptake rate relative to specific growth rate or carbon fixation rate.

    TOXLINE Toxicology Bibliographic Information

    Downing TG; Meyer C; Gehringer MM; van de Venter M

    2005-06-01

    Modulation of microcystin production has been extensively studied in both batch and continuous cultures. Positive correlations with medium nitrogen, medium phosphorous, light intensity, inorganic carbon availability, and growth rate have been reported. Negative correlations have been reported between microcystin content and medium phosphorous. The only reported quantitative relationship between any variable and microcystin production was that of growth rate. Microcystis aeruginosa PCC7806 was therefore cultured under continuous culture conditions in a bubble-lift reactor at a growth rate of 0.01 h(-1) in modified BG11 (constant phosphate concentration of 0.195 mM and varying nitrate from 0.125 to 18 mM) and sampled at steady states for analysis of cell number, microcystin content, cellular N and P, residual medium nutrient concentration, and carbon fixation rate. Cellular microcystin quotas showed significant positive correlation with both nitrate uptake and cellular nitrogen content and were negatively correlated with carbon fixation rate, phosphate uptake, and cellular phosphorous. Thus, the ratio of nitrate uptake to phosphate uptake, cellular N to cellular P, and nitrate uptake to carbon fixation were positively correlated to cellular microcystin. Microcystin quotas increased 10-fold from the lowest to the highest steady-state values. Cellular microcystin content therefore is controlled to a significant extent by variables other than growth rate, as was previously reported, with nitrogen the most significant modulator. Batch culture in BG11 under identical conditions yielded increased microcystin when nitrogen uptake exceeded relative growth rate, confirming the importance of nitrogen uptake in the modulation of microcystin content for a specific growth rate.

  5. Enhancing Carbon Fixation by Metabolic Engineering: A Model System of Complex Network Modulation

    SciTech Connect

    Dr. Gregory Stephanopoulos

    2008-04-10

    In the first two years of this research we focused on the development of a DNA microarray for transcriptional studies in the photosynthetic organism Synechocystis and the elucidation of the metabolic pathway for biopolymer synthesis in this organism. In addition we also advanced the molecular biological tools for metabolic engineering of biopolymer synthesis in Synechocystis and initiated a series of physiological studies for the elucidation of the carbon fixing pathways and basic central carbon metabolism of these organisms. During the last two-year period we focused our attention on the continuation and completion of the last task, namely, the development of tools for basic investigations of the physiology of these cells through, primarily, the determination of their metabolic fluxes. The reason for this decision lies in the importance of fluxes as key indicators of physiology and the high level of information content they carry in terms of identifying rate limiting steps in a metabolic pathway. While flux determination is a well-advanced subject for heterotrophic organisms, for the case of autotrophic bacteria, like Synechocystis, some special challenges had to be overcome. These challenges stem mostly from the fact that if one uses {sup 13}C labeled CO{sub 2} for flux determination, the {sup 13}C label will mark, at steady state, all carbon atoms of all cellular metabolites, thus eliminating the necessary differentiation required for flux determination. This peculiarity of autotrophic organisms makes it imperative to carry out flux determination under transient conditions, something that had not been accomplished before. We are pleased to report that we have solved this problem and we are now able to determine fluxes in photosynthetic organisms from stable isotope labeling experiments followed by measurements of label enrichment in cellular metabolites using Gas Chromatography-Mass Spectrometry. We have conducted extensive simulations to test the method and also are presently validating it experimentally using data generated in collaboration with a research group at Purdue University. As result of these studies we can now determine, for the first time, fluxes in photosynthetic organisms and, eventually, in plants.

  6. Diurnal variation in the coupling of photosynthetic electron transport and carbon fixation in iron-limited phytoplankton in the NE subarctic Pacific

    NASA Astrophysics Data System (ADS)

    Schuback, Nina; Flecken, Mirkko; Maldonado, Maria T.; Tortell, Philippe D.

    2016-02-01

    Active chlorophyll a fluorescence approaches, including fast repetition rate fluorometry (FRRF), have the potential to provide estimates of phytoplankton primary productivity at an unprecedented spatial and temporal resolution. FRRF-derived productivity rates are based on estimates of charge separation in reaction center II (ETRRCII), which must be converted into ecologically relevant units of carbon fixation. Understanding sources of variability in the coupling of ETRRCII and carbon fixation provides physiological insight into phytoplankton photosynthesis and is critical for the application of FRRF as a primary productivity measurement tool. In the present study, we simultaneously measured phytoplankton carbon fixation and ETRRCII in the iron-limited NE subarctic Pacific over the course of a diurnal cycle. We show that rates of ETRRCII are closely tied to the diurnal cycle in light availability, whereas rates of carbon fixation appear to be influenced by endogenous changes in metabolic energy allocation under iron-limited conditions. Unsynchronized diurnal oscillations of the two rates led to 3.5-fold changes in the conversion factor between ETRRCII and carbon fixation (Kc / nPSII). Consequently, diurnal variability in phytoplankton carbon fixation cannot be adequately captured with FRRF approaches if a constant conversion factor is applied. Utilizing several auxiliary photophysiological measurements, we observed that a high conversion factor is associated with conditions of excess light and correlates with the increased expression of non-photochemical quenching (NPQ) in the pigment antenna, as derived from FRRF measurements. The observed correlation between NPQ and Kc / nPSII requires further validation but has the potential to improve estimates of phytoplankton carbon fixation rates from FRRF measurements alone.

  7. Diurnal variation in the coupling of photosynthetic electron transport and carbon fixation in iron-limited phytoplankton in the NE subarctic Pacific

    NASA Astrophysics Data System (ADS)

    Schuback, N.; Flecken, M.; Maldonado, M. T.; Tortell, P. D.

    2015-10-01

    Active chlorophyll a fluorescence approaches, including fast repetition rate fluorometry (FRRF), have the potential to provide estimates of phytoplankton primary productivity at unprecedented spatial and temporal resolution. FRRF-derived productivity rates are based on estimates of charge separation at PSII (ETRRCII), which must be converted into ecologically relevant units of carbon fixation. Understanding sources of variability in the coupling of ETRRCII and carbon fixation provides physiological insight into phytoplankton photosynthesis, and is critical for the application of FRRF as a primary productivity measurement tool. In the present study, we simultaneously measured phytoplankton carbon fixation and ETRRCII in the iron-limited NE subarctic Pacific, over the course of a diurnal cycle. We show that rates of ETRRCII are closely tied to the diurnal cycle in light availability, whereas rates of carbon fixation appear to be influenced by endogenous changes in metabolic energy allocation under iron-limited conditions. Unsynchronized diurnal oscillations of the two rates led to 3.5 fold changes in the conversion factor coupling ETRRCII and carbon fixation (Φe:C / nPSII). Consequently, diurnal variability in phytoplankton carbon fixation cannot be adequately captured with FRRF approaches if a constant conversion factor is applied. Utilizing several auxiliary photophysiological measurements, we observed that a high conversion factor is associated with conditions of excess light, and correlates with the expression of non-photochemical quenching (NPQ) in the pigment antenna, as derived from FRRF measurements. The observed correlation between NPQ and the conversion factor Φe:C / nPSII has the potential to improve estimates of phytoplankton carbon fixation rates from FRRF measurements alone.

  8. Simultaneous Quantification of Active Carbon- and Nitrogen-Fixing Communities and Estimation of Fixation Rates Using Fluorescence In Situ Hybridization and Flow Cytometry

    PubMed Central

    Shepard, Alicia K.; Raes, Eric J.; Waite, Anya M.; Quigg, Antonietta

    2014-01-01

    Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and 14C/15N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

  9. Simultaneous quantification of active carbon- and nitrogen-fixing communities and estimation of fixation rates using fluorescence in situ hybridization and flow cytometry.

    PubMed

    McInnes, Allison S; Shepard, Alicia K; Raes, Eric J; Waite, Anya M; Quigg, Antonietta

    2014-11-01

    Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and (14)C/(15)N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

  10. Preferential remineralization of dissolved organic phosphorus and non-Redfield DOM dynamics in the global ocean: Impacts on marine productivity, nitrogen fixation, and carbon export

    NASA Astrophysics Data System (ADS)

    Letscher, Robert T.; Moore, J. Keith

    2015-03-01

    Selective removal of nitrogen (N) and phosphorus (P) from the marine dissolved organic matter (DOM) pool has been reported in several regional studies. Because DOM is an important advective/mixing pathway of carbon (C) export from the ocean surface layer and its non-Redfieldian stoichiometry would affect estimates of marine export production per unit N and P, we investigated the stoichiometry of marine DOM and its remineralization globally using a compiled DOM data set. Marine DOM is enriched in C and N compared to Redfield stoichiometry, averaging 317:39:1 and 810:48:1 for C:N:P within the degradable and total bulk pools, respectively. Dissolved organic phosphorus (DOP) is found to be preferentially remineralized about twice as rapidly with respect to the enriched C:N stoichiometry of marine DOM. Biogeochemical simulations with the Biogeochemical Elemental Cycling model using Redfield and variable DOM stoichiometry corroborate the need for non-Redfield dynamics to match the observed DOM stoichiometry. From our model simulations, preferential DOP remineralization is found to increase the strength of the biological pump by ~9% versus the case of Redfield DOM cycling. Global net primary productivity increases ~10% including an increase in marine nitrogen fixation of ~26% when preferential DOP remineralization and direct utilization of DOP by phytoplankton are included. The largest increases in marine nitrogen fixation, net primary productivity, and carbon export are observed within the western subtropical gyres, suggesting the lateral transfer of P in the form of DOP from the productive eastern and poleward gyre margins may be important for sustaining these processes downstream in the subtropical gyres.

  11. Engineering the Cyanobacterial Carbon Concentrating Mechanism for Enhanced CO2 Capture and Fixation

    SciTech Connect

    Sandh, Gustaf; Cai, Fei; Shih, Patrick; Kinney, James; Axen, Seth; Salmeen, Annette; Zarzycki, Jan; Sutter, Markus; Kerfeld, Cheryl

    2011-06-02

    In cyanobacteria CO2 fixation is localized in a special proteinaceous organelle, the carboxysome. The CO2 fixation enzymes are encapsulated by a selectively permeable protein shell. By structurally and functionally characterizing subunits of the carboxysome shell and the encapsulated proteins, we hope to understand what regulates the shape, assembly and permeability of the shell, as well as the targeting mechanism and organization of the encapsulated proteins. This knowledge will be used to enhance CO2 fixation in both cyanobacteria and plants through synthetic biology. The same strategy can also serve as a template for the production of modular synthetic bacterial organelles. Our research is conducted using a variety of techniques such as genomic sequencing and analysis, transcriptional regulation, DNA synthesis, synthetic biology, protein crystallization, Small Angle X-ray Scattering (SAXS), protein-protein interaction assays and phenotypic characterization using various types of cellular imaging, e.g. fluorescence microscopy, Transmission Electron Microscopy (TEM), and Soft X-ray Tomography (SXT).

  12. Carbon Cycling in Anabaena sp. PCC 7120. Sucrose Synthesis in the Heterocysts and Possible Role in Nitrogen Fixation1[OA

    PubMed Central

    Cumino, Andrea C.; Marcozzi, Clarisa; Barreiro, Roberto; Salerno, Graciela L.

    2007-01-01

    Nitrogen (N) available to plants mostly originates from N2 fixation carried out by prokaryotes. Certain cyanobacterial species contribute to this energetically expensive process related to carbon (C) metabolism. Several filamentous strains differentiate heterocysts, specialized N2-fixing cells. To understand how C and N metabolism are regulated in photodiazotrophically grown organisms, we investigated the role of sucrose (Suc) biosynthesis in N2 fixation in Anabaena sp. PCC 7120 (also known as Nostoc sp. PCC 7120). The presence of two Suc-phosphate synthases (SPS), SPS-A and SPS-B, directly involved in Suc synthesis with different glucosyl donor specificity, seems to be important in the N2-fixing filament. Measurement of enzyme activity and polypeptide levels plus reverse transcription-polymerase chain reaction experiments showed that total SPS expression is greater in cells grown in N2 versus combined N conditions. Only SPS-B, however, was seen to be active in the heterocyst, as confirmed by analysis of green fluorescent protein reporters. SPS-B gene expression is likely controlled at the transcriptional initiation level, probably in relation to a global N regulator. Metabolic control analysis indicated that the metabolism of glycogen and Suc is likely interconnected in N2-fixing filaments. These findings suggest that N2 fixation may be spatially compatible with Suc synthesis and support the role of the disaccharide as an intermediate in the reduced C flux in heterocyst-forming cyanobacteria. PMID:17237189

  13. Biomass production, nutrient cycling, and carbon fixation by Salicornia brachiata Roxb.: A promising halophyte for coastal saline soil rehabilitation.

    PubMed

    Rathore, Aditya P; Chaudhary, Doongar R; Jha, Bhavanath

    2016-08-01

    In order to increase our understanding of the interaction of soil-halophyte (Salicornia brachiata) relations and phytoremediation, we investigated the aboveground biomass, carbon fixation, and nutrient composition (N, P, K, Na, Ca, and Mg) of S. brachiata using six sampling sites with varying characteristics over one growing season in intertidal marshes. Simultaneously, soil characteristics and nutrient concentrations were also estimated. There was a significant variation in soil characteristics and nutrient contents spatially (except pH) as well as temporally. Nutrient contents in aboveground biomass of S. brachiata were also significantly differed spatially (except C and Cl) as well as temporally. Aboveground biomass of S. brachiata ranged from 2.51 to 6.07 t/ha at maturity and it was positively correlated with soil electrical conductivity and available Na, whereas negatively with soil pH. The K/Na ratio in plant was below one, showing tolerance to salinity. The aboveground C fixation values ranged from 0.77 to 1.93 C t/ha at all six sampling sites. This study provides new understandings into nutrient cycling-C fixation potential of highly salt-tolerant halophyte S. brachiata growing on intertidal soils of India. S. brachiata have a potential for amelioration of the salinity due to higher Na bioaccumulation factor. PMID:26852782

  14. Pathways of anthropogenic carbon subduction in the global ocean

    NASA Astrophysics Data System (ADS)

    Bopp, L.; Lévy, M.; Resplandy, L.; Sallée, J. B.

    2015-08-01

    The oceanic uptake of anthropogenic carbon is tightly coupled to carbon subduction, i.e., the physical carbon transfer from the well-ventilated surface ocean to its interior. Despite their importance, pathways of anthropogenic carbon subduction are poorly understood. Here we use an ocean carbon cycle model to quantify the mechanisms controlling this subduction. Over the last decade, 90% of the oceanic anthropogenic carbon is subducted at the base of the seasonally varying mixed layer. Vertical diffusion is the primary mechanism of this subduction (contributing 65% of total subduction), despite very low local fluxes. In contrast, advection drives the spatial patterns of subduction, with high positive and negative local fluxes. Our results suggest that vertical diffusion could have a leading role in anthropogenic carbon subduction, which highlights the need for an accurate estimate of vertical diffusion intensity in the upper ocean to further constrain estimates of the future evolution of carbon uptake.

  15. Will Elevated Carbon Dioxide Concentration Amplify the Benefits of Nitrogen Fixation in Legumes?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Current evidence suggests there are three key features of the response of legumes to elevated [CO2]: (1) unlike other non-leguminous C3 plants, only legumes have the potential to maximize the benefit of elevated [CO2] by matching stimulated photosynthesis with increased N2 fixation; (2) this potenti...

  16. Ammonia fixation by humic substances: A nitrogen-15 and carbon-13 NMR study

    USGS Publications Warehouse

    Thorn, K.A.; Mikita, M.A.

    1992-01-01

    The process of ammonia fixation has been studied in three well characterized and structurally diverse fulvic and humic acid samples. The Suwannee River fulvic acid, and the IHSS peat and leonardite humic acids, were reacted with 15N-labelled ammonium hydroxide, and analyzed by liquid phase 15N NMR spectrometry. Elemental analyses and liquid phase 13C NMR spectra also were recorded on the samples before and after reaction with ammonium hydroxide. The largest increase in percent nitrogen occurred with the Suwannee River fulvic acid, which had a nitrogen content of 0.88% before fixation and 3.17% after fixation. The 15N NMR spectra revealed that ammonia reacted similarly with all three samples, indicating that the functional groups which react with ammonia exist in structural configurations common to all three samples. The majority of nitrogcn incorporated into the samples appears to be in the form of indole and pyrrole nitrogen, followed by pyridine, pyrazine, amide and aminohydroquinone nitrogen. Chemical changes in the individual samples upon fixation could not be discerned from the 13C NMR spectra.

  17. Fluorinated Alcohols as Activators for the Solvent-Free Chemical Fixation of Carbon Dioxide into Epoxides.

    PubMed

    Gennen, Sandro; Alves, Margot; Méreau, Raphaël; Tassaing, Thierry; Gilbert, Bernard; Detrembleur, Christophe; Jerome, Christine; Grignard, Bruno

    2015-06-01

    The addition of fluorinated alcohols to onium salts provides highly efficient organocatalysts for the chemical fixation of CO2 into epoxides under mild experimental conditions. The combination of online kinetic studies, NMR titrations and DFT calculations allows understanding this synergistic effect that provides an active organocatalyst for CO2 /epoxides coupling. PMID:25951520

  18. Single cell protein production of Euglena gracilis and carbon dioxide fixation in an innovative photo-bioreactor.

    PubMed

    Chae, S R; Hwang, E J; Shin, H S

    2006-01-01

    The biological fixation using microalgae has been known as an effective and economical carbon dioxide reduction technology. Carbon dioxide (CO2) fixation by microalgae has been shown to be effective and economical. Among various algae, a species Euglena gracilis was selected as it has advantages such as high protein content and high digestibility for animal feed. A kinetic model was studied in order to determine the relationship between specific growth rate and light intensity. The half-saturation constant for light intensity in the Monod model was 178.7 micromol photons/m2/s. The most favorable initial pH, temperature, and CO2 concentration were found to be 3.5, 27 degrees C, and 5-10% (vol/vol), respectively. Light intensity and hydraulic retention time were tested for effects on cell yield in a laboratory-scale photo-bioreactor of 100l working volume followed by semi-continuous and continuous culture. Subsequently, an innovative pilot-scale photo-bioreactor that used sunlight and flue gas was developed to increase production of this bioresource. The proposed pilot-scale reactor showed improved cell yield compared with the laboratory-scale reactor. PMID:16171688

  19. Light microenvironment and single-cell gradients of carbon fixation in tissues of symbiont-bearing corals.

    PubMed

    Wangpraseurt, Daniel; Pernice, Mathieu; Guagliardo, Paul; Kilburn, Matt R; Clode, Peta L; Polerecky, Lubos; Kühl, Michael

    2016-03-01

    Recent coral optics studies have revealed the presence of steep light gradients and optical microniches in tissues of symbiont-bearing corals. Yet, it is unknown whether such resource stratification allows for physiological differences of Symbiodinium within coral tissues. Using a combination of stable isotope labelling and nanoscale secondary ion mass spectrometry, we investigated in hospite carbon fixation of individual Symbiodinium as a function of the local O2 and light microenvironment within the coral host determined with microsensors. We found that net carbon fixation rates of individual Symbiodinium cells differed on average about sixfold between upper and lower tissue layers of single coral polyps, whereas the light and O2 microenvironments differed ~15- and 2.5-fold, respectively, indicating differences in light utilisation efficiency along the light microgradient within the coral tissue. Our study suggests that the structure of coral tissues might be conceptually similar to photosynthetic biofilms, where steep physico-chemical gradients define form and function of the local microbial community. PMID:26241503

  20. CO2 Fixation, Lipid Production, and Power Generation by a Novel Air-Lift-Type Microbial Carbon Capture Cell System.

    PubMed

    Hu, Xia; Liu, Baojun; Zhou, Jiti; Jin, Ruofei; Qiao, Sen; Liu, Guangfei

    2015-09-01

    An air-lift-type microbial carbon capture cell (ALMCC) was constructed for the first time by using an air-lift-type photobioreactor as the cathode chamber. The performance of ALMCC in fixing high concentration of CO2, producing energy (power and biodiesel), and removing COD together with nutrients was investigated and compared with the traditional microbial carbon capture cell (MCC) and air-lift-type photobioreactor (ALP). The ALMCC system produced a maximum power density of 972.5 mW·m(-3) and removed 86.69% of COD, 70.52% of ammonium nitrogen, and 69.24% of phosphorus, which indicate that ALMCC performed better than MCC in terms of power generation and wastewater treatment efficiency. Besides, ALMCC demonstrated 9.98- and 1.88-fold increases over ALP and MCC in the CO2 fixation rate, respectively. Similarly, the ALMCC significantly presented a higher lipid productivity compared to those control reactors. More importantly, the preliminary analysis of energy balance suggested that the net energy of the ALMCC system was significantly superior to other systems and could theoretically produce enough energy to cover its consumption. In this work, the established ALMCC system simultaneously achieved the high level of CO2 fixation, energy recycle, and municipal wastewater treatment effectively and efficiently. PMID:26270956

  1. Carbon Dioxide Fixation in Roots and Nodules of Alnus glutinosa1

    PubMed Central

    McClure, Peter R.; Coker, George T.; Schubert, Karel R.

    1983-01-01

    Detached roots and nodules of the N2-fixing species, Albus glutinosa (European black alder), actively assimilate CO2. The maximum rates of dark CO2 fixation observed for detached nodules and roots were 15 and 3 micromoles CO2 fixed per gram dry weight per hour, respectively. The net incorporation of CO2 in these tissues was catalyzed by phosphoenolpyruvate carboxylase which produces organic acids, some of which are used in the synthesis of the amino acids, aspartate, glutamate, and citrulline and by carbamyl phosphate synthetase. The latter accounts for approximately 30 to 40% of the CO2 fixed and provides carbamyl phosphate for the synthesis of citrulline. Results of labeling studies suggest that there are multiple pools of malate present in nodules. The major pool is apparently metabolically inactive and of unknown function while the smaller pool is rapidly utilized in the synthesis of amino acids. Dark CO2 fixation and N2 fixation in nodules decreased after treatment of nodulated plants with nitrate while the percentage of the total 14C incorporated into organic acids increased. Phosphoenolpyruvate carboxylase and carbamyl phosphate synthetase play key roles in the synthesis of amino acids including citrulline and in the metabolism of N2-fixing nodules and roots of alder. PMID:16662882

  2. Phosphoketolase Pathway Engineering for Carbon-Efficient Biocatalysis

    SciTech Connect

    Henard, Calvin Andrew; Freed, Emily Frances; Guarnieri, Michael Thomas

    2015-09-08

    Recent advances in metabolic engineering have facilitated the development of microbial biocatalysts capable of producing an array of bio-products, ranging from fuels to drug molecules. These bio-products are commonly generated through an acetyl-CoA intermediate, which serves as a key precursor in the biological conversion of carbon substrates. Moreover, conventional biocatalytic upgrading strategies proceeding through this route are limited by low carbon efficiencies, in large part due to carbon losses associated with pyruvate decarboxylation to acetyl-CoA. Bypass of pyruvate decarboxylation offers a means to dramatically enhance carbon yields and, in turn, bioprocess economics. Here, we discuss recent advances and prospects for employing the phosphoketolase pathway for direct biosynthesis of acetyl-CoA from carbon substrates, and phosphoketolase-based metabolic engineering strategies for carbon efficient biocatalysis.

  3. Phosphoketolase pathway engineering for carbon-efficient biocatalysis.

    PubMed

    Henard, Calvin Andrew; Freed, Emily Frances; Guarnieri, Michael Thomas

    2015-12-01

    Recent advances in metabolic engineering have facilitated the development of microbial biocatalysts capable of producing an array of bio-products, ranging from fuels to drug molecules. These bio-products are commonly generated through an acetyl-CoA intermediate, which serves as a key precursor in the biological conversion of carbon substrates. Conventional biocatalytic upgrading strategies proceeding through this route are limited by low carbon efficiencies, in large part due to carbon losses associated with pyruvate decarboxylation to acetyl-CoA. Bypass of pyruvate decarboxylation offers a means to dramatically enhance carbon yields and, in turn, bioprocess economics. Herein, we discuss recent advances and prospects for employing the phosphoketolase pathway for direct biosynthesis of acetyl-CoA from carbon substrates, and phosphoketolase-based metabolic engineering strategies for carbon efficient biocatalysis. PMID:26360872

  4. 13C Metabolic Flux Analysis Identifies an Unusual Route for Pyruvate Dissimilation in Mycobacteria which Requires Isocitrate Lyase and Carbon Dioxide Fixation

    PubMed Central

    Beste, Dany J. V.; Bonde, Bhushan; Hawkins, Nathaniel; Ward, Jane L.; Beale, Michael H.; Noack, Stephan; Nöh, Katharina; Kruger, Nicholas J.; Ratcliffe, R. George; McFadden, Johnjoe

    2011-01-01

    Mycobacterium tuberculosis requires the enzyme isocitrate lyase (ICL) for growth and virulence in vivo. The demonstration that M. tuberculosis also requires ICL for survival during nutrient starvation and has a role during steady state growth in a glycerol limited chemostat indicates a function for this enzyme which extends beyond fat metabolism. As isocitrate lyase is a potential drug target elucidating the role of this enzyme is of importance; however, the role of isocitrate lyase has never been investigated at the level of in vivo fluxes. Here we show that deletion of one of the two icl genes impairs the replication of Mycobacterium bovis BCG at slow growth rate in a carbon limited chemostat. In order to further understand the role of isocitrate lyase in the central metabolism of mycobacteria the effect of growth rate on the in vivo fluxes was studied for the first time using 13C-metabolic flux analysis (MFA). Tracer experiments were performed with steady state chemostat cultures of BCG or M. tuberculosis supplied with 13C labeled glycerol or sodium bicarbonate. Through measurements of the 13C isotopomer labeling patterns in protein-derived amino acids and enzymatic activity assays we have identified the activity of a novel pathway for pyruvate dissimilation. We named this the GAS pathway because it utilizes the Glyoxylate shunt and Anapleurotic reactions for oxidation of pyruvate, and Succinyl CoA synthetase for the generation of succinyl CoA combined with a very low flux through the succinate – oxaloacetate segment of the tricarboxylic acid cycle. We confirm that M. tuberculosis can fix carbon from CO2 into biomass. As the human host is abundant in CO2 this finding requires further investigation in vivo as CO2 fixation may provide a point of vulnerability that could be targeted with novel drugs. This study also provides a platform for further studies into the metabolism of M. tuberculosis using 13C-MFA. PMID:21814509

  5. Crop yield and CO2 fixation monitoring over Asia by a photosynthetic-sterility model comparing with MODIS and carbon amounts in grain yields

    NASA Astrophysics Data System (ADS)

    Kaneko, Daijiro; Yang, Peng; Kumakura, Toshiro

    2009-08-01

    The authors have developed a photosynthesis crop model for grain production under the background of climate change and Asian economic growth in developing countries. This paper presents an application of the model to grain fields of paddy rice, winter wheat, and maize in China and Southeast Asia. The carbon hydrate in grains has the same chemical formula as that of cellulose in grain vegetation. The partitioning of carbon in grain plants can validate fixation amounts of computed carbon using a satellite-based photosynthesis model. The model estimates the photosynthesis fixation of rice reasonably in Japan and China. Results were validated through examination of carbon in grains, but the model tends to underestimate results for winter wheat and maize. This study also provides daily distributions of the PSN, which is the CO2 fixation in Asian areas combined with a land-cover distribution classified from MODIS data, NDVI from SPOT VEGETATION, and meteorological re-analysis data by European Centre for Medium-Range Forecasts (ECMWF). The mean CO2 and carbon fixation rates in paddy areas were 25.92 (t CO2/ha) and 5.28 (t/ha) in Japan, respectively. The method is based on routine observation data, enabling automated monitoring of crop yields.

  6. Activity of carbon dioxide fixation by anthers and leaves of cereal grains

    SciTech Connect

    Kirichenko, E.B.; Chernyad'ev, I.I.; Doman, N.G.; Talibullina, K.K.; Voronkova, T.V.

    1986-05-01

    This paper gives a comparative evaluation of the photosynthetic activity of anthers and flag leaves in winter wheat, rye, and triticale. The content of chlorophylls in anthers and leaves was determined. The activity of /sup 14/CO/sub 2/ fixation by anthers and leaf disks was determined by the radiometric method in a chamber floating on mercury under standard exposure conditions (0.1% concentration of /sup 14/CO/sub 2/, illumination of 15,000 1x, temperature of 23 C). Analyses were conducted in three replications and the results of typical biological experiments are cited. Data show that chlorophyll is actively synthesized in the anthers of cereal grains.

  7. Can the carbon fiber rods for the Hoffmann II external fixation system be reused?

    PubMed

    Robbins, Justin; Gerlinger, Tad L; Ward, John A

    2012-12-01

    The Hoffman II External Fixator is the external fixation system used by the United States Army during Operation Iraqi Freedom (OIF) and Operation Enduring Freedom (OEF). To our knowledge, there have been no studies comparing the bending strength or stiffness of new to used or reprocessed rods. The purpose of our study was to determine if there was any difference in bending strength or stiffness of these rods. Used rods were obtained from soldiers serving in OIF/OEF. The bending strength and stiffness of these rods was determined using 4-point bending. The location of rod failure was noted. Testing conditions simulated those utilized by the manufacturer for release of new rods. There was no statistically significant difference in bending strength. There was a 6% difference in bending stiffness between new and used rods. Thirteen total used/refurbished rods broke at locations of previous clamping, the remainder breaking at one of the loading points on the testing jig. The difference in bending stiffness among new, reprocessed, and used rods was only 6%. The clinical significance of this is unknown. There was no difference amongst the groups in bending strength. Rods recovered from soldiers serving in OIF/OEF appear to be safe for reuse. PMID:23431524

  8. Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L

    SciTech Connect

    Singal, H.R.; Sheoran, I.S.; Singh, R.

    1987-04-01

    Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwall and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.

  9. Multicomponent self-assembly of a pentanuclear Ir-Zn heterometal-organic polyhedron for carbon dioxide fixation and sulfite sequestration.

    PubMed

    Li, Xuezhao; Wu, Jinguo; He, Cheng; Zhang, Rong; Duan, Chunying

    2016-04-14

    By incorporating a fac-tris(4-(2-pyridinyl)phenylamine)iridium as the backbone of the tripodal ligand to constrain the coordination geometry of Zn(ii) ions, a pentanuclear Ir-Zn heterometal-organic luminescent polyhedron was obtained via a subcomponent self-assembly for carbon dioxide fixation and sulfite sequestration. PMID:26932204

  10. Pathways of human development and carbon emissions embodied in trade

    NASA Astrophysics Data System (ADS)

    Steinberger, Julia K.; Timmons Roberts, J.; Peters, Glen P.; Baiocchi, Giovanni

    2012-02-01

    It has long been assumed that human development depends on economic growth, that national economic expansion in turn requires greater energy use and, therefore, increased greenhouse-gas emissions. These interdependences are the topic of current research. Scarcely explored, however, is the impact of international trade: although some nations develop socio-economically and import high-embodied-carbon products, it is likely that carbon-exporting countries gain significantly fewer benefits. Here, we use new consumption-based measures of national carbon emissions to explore how the relationship between human development and carbon changes when we adjust national emission rates for trade. Without such adjustment of emissions, some nations seem to be getting far better development `bang' for the carbon `buck' than others, who are showing scant gains for disproportionate shares of global emissions. Adjusting for the transfer of emissions through trade explains many of these outliers, but shows that further socio-economic benefits are accruing to carbon-importing rather than carbon-exporting countries. We also find that high life expectancies are compatible with low carbon emissions but high incomes are not. Finally, we see that, despite strong international trends, there is no deterministic industrial development trajectory: there is great diversity in pathways, and national histories do not necessarily follow the global trends.

  11. Hybrid Amine-Functionalized Graphene Oxide as a Robust Bifunctional Catalyst for Atmospheric Pressure Fixation of Carbon Dioxide using Cyclic Carbonates.

    PubMed

    Saptal, Vitthal B; Sasaki, Takehiko; Harada, Kei; Nishio-Hamane, Daisuke; Bhanage, Bhalchandra M

    2016-03-21

    An environmentally-benign carbocatalyst based on amine-functionalized graphene oxide (AP-GO) was synthesized and characterized. This catalyst shows superior activity for the chemical fixation of CO2 into cyclic carbonates at the atmospheric pressure. The developed carbocatalyst exhibits superior activity owing to its large surface area with abundant hydrogen bonding donor (HBD) capability and the presence of well-defined amine functional groups. The presence of various HBD and amine functional groups on the graphene oxide (GO) surface yields a synergistic effect for the activation of starting materials. Additionally, this catalyst shows high catalytic activity to synthesize carbonates at 70 °C and at 1 MPa CO2 pressure. The developed AP-GO could be easily recovered and used repetitively in up to seven recycle runs with unchanged catalyst activity. PMID:26840889

  12. Carbon dioxide fixation by microalgae photosynthesis using actual flue gas discharged from a boiler

    SciTech Connect

    Matsumoto, Hiroyo; Shioji, Norio; Hamasaki, Akihiro

    1995-12-31

    To mitigate CO{sub 2} discharged from thermal power plants, studies on CO{sub 2} fixation by the photosynthesis of microalgae using actual exhaust gas have been carried out. The results are as follows: (1) A method is proposed for evaluating the maximum photosynthesis rate in the raceway cultivator using only the algal physical properties; (2) Outdoor cultivation tests taking actual flue gas were performed with no trouble or break throughout 1 yr using the strain collected in the test; (3) The produced microalgae is effective as solid fuel; and (4) The feasibility studies of this system were performed. The system required large land area, but the area is smaller than that required for other biomass systems, such as tree farms.

  13. Antioxidant pathways are up-regulated during biological nitrogen fixation to prevent ROS-induced nitrogenase inhibition in Gluconacetobacter diazotrophicus

    PubMed Central

    Oliveira, Jose Henrique M.; Nogueira, Eduardo M.; Guedes, Helma V.; Oliveira, Pedro L.; Câmara, Fernando; Baldani, Jose I.; Martins, Orlando B.

    2010-01-01

    Gluconacetobacter diazotrophicus, an endophyte isolated from sugarcane, is a strict aerobe that fixates N2. This process is catalyzed by nitrogenase and requires copious amounts of ATP. Nitrogenase activity is extremely sensitive to inhibition by oxygen and reactive oxygen species (ROS). However, the elevated oxidative metabolic rates required to sustain biological nitrogen fixation (BNF) may favor an increased production of ROS. Here, we explored this paradox and observed that ROS levels are, in fact, decreased in nitrogen-fixing cells due to the up-regulation of transcript levels of six ROS-detoxifying genes. A cluster analyses based on common expression patterns revealed the existence of a stable cluster with 99.8% similarity made up of the genes encoding the α-subunit of nitrogenase Mo–Fe protein (nifD), superoxide dismutase (sodA) and catalase type E (katE). Finally, nitrogenase activity was inhibited in a dose-dependent manner by paraquat, a redox cycler that increases cellular ROS levels. Our data revealed that ROS can strongly inhibit nitrogenase activity, and G. diazotrophicus alters its redox metabolism during BNF by increasing antioxidant transcript levels resulting in a lower ROS generation. We suggest that careful controlled ROS production during this critical phase is an adaptive mechanism to allow nitrogen fixation. PMID:20697694

  14. Carbon mineralization pathways and bioturbation in coastal Brazilian sediments.

    PubMed

    Quintana, Cintia O; Shimabukuro, Maurício; Pereira, Camila O; Alves, Betina G R; Moraes, Paula C; Valdemarsen, Thomas; Kristensen, Erik; Sumida, Paulo Y G

    2015-01-01

    Carbon mineralization processes and their dependence on environmental conditions (e.g. through macrobenthic bioturbation) have been widely studied in temperate coastal sediments, but almost nothing is known about these processes in subtropical coastal sediments. This study investigated pathways of organic carbon mineralization and associated effects of macrobenthic bioturbation in winter and summer (September 2012 and February 2014) at the SE Brazilian coast. Iron reduction (FeR) was responsible for 73-81% of total microbial carbon mineralization in September 2012 and 32-61% in February 2014. Similar high rates of FeR have only been documented a few times in coastal sediments and can be sustained by the presence of large bioturbators. Denitrification accounted for 5-27% of total microbial carbon mineralization while no SO4(2-) reduction was detected in any season. Redox profiles suggested that conditions were less reduced in February 2014 than in September 2012, probably associated with low reactivity of the organic matter, higher rates of aerobic respiration and bioirrigation by the higher density of small-macrofauna. Bioturbation by small macrofauna may maintain the sediment oxidized in summer, while large-sized species stimulate the reoxidation of reduced compounds throughout the year. Therefore, bioturbation seems to have an important role modulating the pathways of carbon mineralization in the area. PMID:26525137

  15. Carbon mineralization pathways and bioturbation in coastal Brazilian sediments

    PubMed Central

    Quintana, Cintia O.; Shimabukuro, Maurício; Pereira, Camila O.; Alves, Betina G. R.; Moraes, Paula C.; Valdemarsen, Thomas; Kristensen, Erik; Sumida, Paulo Y. G.

    2015-01-01

    Carbon mineralization processes and their dependence on environmental conditions (e.g. through macrobenthic bioturbation) have been widely studied in temperate coastal sediments, but almost nothing is known about these processes in subtropical coastal sediments. This study investigated pathways of organic carbon mineralization and associated effects of macrobenthic bioturbation in winter and summer (September 2012 and February 2014) at the SE Brazilian coast. Iron reduction (FeR) was responsible for 73–81% of total microbial carbon mineralization in September 2012 and 32–61% in February 2014. Similar high rates of FeR have only been documented a few times in coastal sediments and can be sustained by the presence of large bioturbators. Denitrification accounted for 5–27% of total microbial carbon mineralization while no SO42− reduction was detected in any season. Redox profiles suggested that conditions were less reduced in February 2014 than in September 2012, probably associated with low reactivity of the organic matter, higher rates of aerobic respiration and bioirrigation by the higher density of small-macrofauna. Bioturbation by small macrofauna may maintain the sediment oxidized in summer, while large-sized species stimulate the reoxidation of reduced compounds throughout the year. Therefore, bioturbation seems to have an important role modulating the pathways of carbon mineralization in the area. PMID:26525137

  16. Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use

    SciTech Connect

    Kleiner, Manuel; Wentrop, C.; Lott, C.; Teeling, Hanno; Wetzel, Silke; Young, Jacque C; Chang, Y.; Shah, Manesh B; Verberkmoes, Nathan C; Zarzycki, Jan; Fuchs, Georg; Markert, Stephanie; Hempel, Kristina

    2012-01-01

    Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such as sulfide and CO2. Remarkably little is known about the physiological strategies that enable chemosynthetic symbioses to colonize oligotrophic environments. In this study, we used metaproteomics and metabolomics to investigate the intricate network of metabolic interactions in the chemosynthetic association between Olavius algarvensis, a gutless marine worm, and its bacterial symbionts. We propose novel pathways for coping with energy and nutrient limitation, some of which may be widespread in both free-living and symbiotic bacteria. These include (i) a pathway for symbiont assimilation of the host waste products acetate, propionate, succinate and malate, (ii) the potential use of carbon monoxide as an energy source, a substrate previously not known to play a role in marine invertebrate symbioses, (iii) the potential use of hydrogen as an energy source, (iv) the strong expression of high affinity uptake transporters, and (v) novel energy efficient steps in CO2 fixation and sulfate reduction. The high expression of proteins involved in pathways for energy and carbon uptake and conservation in the O. algarvensis symbiosis indicates that the oligotrophic nature of its environment exerted a strong selective pressure in shaping these associations.

  17. Role of Intracellular Carbon Metabolism Pathways in Shigella flexneri Virulence

    PubMed Central

    Waligora, E. A.; Fisher, C. R.; Hanovice, N. J.; Rodou, A.; Wyckoff, E. E.

    2014-01-01

    Shigella flexneri, which replicates in the cytoplasm of intestinal epithelial cells, can use the Embden-Meyerhof-Parnas, Entner-Doudoroff, or pentose phosphate pathway for glycolytic carbon metabolism. To determine which of these pathways is used by intracellular S. flexneri, mutants were constructed and tested in a plaque assay for the ability to invade, replicate intracellularly, and spread to adjacent epithelial cells. Mutants blocked in the Embden-Meyerhof-Parnas pathway (pfkAB and pykAF mutants) invaded the cells but formed very small plaques. Loss of the Entner-Doudoroff pathway gene eda resulted in small plaques, but the double eda edd mutant formed normal-size plaques. This suggested that the plaque defect of the eda mutant was due to buildup of the toxic intermediate 2-keto-3-deoxy-6-phosphogluconic acid rather than a specific requirement for this pathway. Loss of the pentose phosphate pathway had no effect on plaque formation, indicating that it is not critical for intracellular S. flexneri. Supplementation of the epithelial cell culture medium with pyruvate allowed the glycolysis mutants to form larger plaques than those observed with unsupplemented medium, consistent with data from phenotypic microarrays (Biolog) indicating that pyruvate metabolism was not disrupted in these mutants. Interestingly, the wild-type S. flexneri also formed larger plaques in the presence of supplemental pyruvate or glucose, with pyruvate yielding the largest plaques. Analysis of the metabolites in the cultured cells showed increased intracellular levels of the added compound. Pyruvate increased the growth rate of S. flexneri in vitro, suggesting that it may be a preferred carbon source inside host cells. PMID:24733092

  18. Dissolved inorganic carbon uptake in Thiomicrospira crunogena XCL-2 is Δp- and ATP-sensitive and enhances RubisCO-mediated carbon fixation.

    PubMed

    Menning, Kristy J; Menon, Balaraj B; Fox, Gordon; Scott, Kathleen M

    2016-03-01

    The gammaproteobacterium Thiomicrospira crunogena XCL-2 is an aerobic sulfur-oxidizing hydrothermal vent chemolithoautotroph that has a CO2 concentrating mechanism (CCM), which generates intracellular dissolved inorganic carbon (DIC) concentrations much higher than extracellular, thereby providing substrate for carbon fixation at sufficient rate. This CCM presumably requires at least one active DIC transporter to generate the elevated intracellular concentrations of DIC measured in this organism. In this study, the half-saturation constant (K CO2) for purified carboxysomal RubisCO was measured (276 ± 18 µM) which was much greater than the K CO2 of whole cells (1.03 µM), highlighting the degree to which the CCM facilitates CO2 fixation under low CO2 conditions. To clarify the bioenergetics powering active DIC uptake, cells were incubated in the presence of inhibitors targeting ATP synthesis (DCCD) or proton potential (CCCP). Incubations with each of these inhibitors resulted in diminished intracellular ATP, DIC, and fixed carbon, despite an absence of an inhibitory effect on proton potential in the DCCD-incubated cells. Electron transport complexes NADH dehydrogenase and the bc 1 complex were found to be insensitive to DCCD, suggesting that ATP synthase was the primary target of DCCD. Given the correlation of DIC uptake to the intracellular ATP concentration, the ABC transporter genes were targeted by qRT-PCR, but were not upregulated under low-DIC conditions. As the T. crunogena genome does not include orthologs of any genes encoding known DIC uptake systems, these data suggest that a novel, yet to be identified, ATP- and proton potential-dependent DIC transporter is active in this bacterium. This transporter serves to facilitate growth by T. crunogena and other Thiomicrospiras in the many habitats where they are found. PMID:26581415

  19. Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities

    PubMed Central

    Kellermann, Matthias Y.; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe

    2012-01-01

    The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope–probing experiments with and without methane. The relative incorporation of 13C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both 13C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs. PMID:23129626

  20. Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities.

    PubMed

    Kellermann, Matthias Y; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe

    2012-11-20

    The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope-probing experiments with and without methane. The relative incorporation of (13)C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both (13)C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs. PMID:23129626

  1. Carbon and nitrogen fixation and metabolite exchange in and between individual cells of Anabaena oscillarioides.

    PubMed

    Popa, Radu; Weber, Peter K; Pett-Ridge, Jennifer; Finzi, Juliette A; Fallon, Stewart J; Hutcheon, Ian D; Nealson, Kenneth H; Capone, Douglas G

    2007-08-01

    Filamentous nitrogen fixing cyanobacteria are key players in global nutrient cycling, but the relationship between CO2- and N2-fixation and intercellular exchange of these elements remains poorly understood in many genera. Using high-resolution nanometer-scale secondary ion mass spectrometry (NanoSIMS) in conjunction with enriched H13CO3- and 15N2 incubations of Anabaena oscillarioides, we imaged the cellular distributions of C, N and P and 13C and 15N enrichments at multiple time points during a diurnal cycle as proxies for C and N assimilation. The temporal and spatial distributions of the newly fixed C and N were highly heterogeneous at both the intra- and inter-cellular scale, and indicative of regions performing active assimilation and biosynthesis. Subcellular components such as the neck region of heterocycts, cell division septae and putative cyanophycin granules were clearly identifiable by their elemental composition. Newly fixed nitrogen was rapidly exported from heterocysts and was evenly allocated among vegetative cells, with the exception of the most remote vegetative cells between heterocysts, which were N limited based on lower 15N enrichment. Preexisting functional heterocysts had the lowest levels of 13C and 15N enrichment, while heterocysts that were inferred to have differentiated during the experiment had higher levels of enrichment. This innovative approach, combining stable isotope labeling and NanoSIMS elemental and isotopic imaging, allows characterization of cellular development (division, heterocyst differentiation), changes in individual cell composition and cellular roles in metabolite exchange. PMID:18043646

  2. Significance of non-sinking particulate organic carbon and dark CO2 fixation to heterotrophic carbon demand in the mesopelagic northeast Atlantic

    NASA Astrophysics Data System (ADS)

    Baltar, Federico; Arístegui, Javier; Sintes, Eva; Gasol, Josep M.; Reinthaler, Thomas; Herndl, Gerhard J.

    2010-05-01

    It is generally assumed that sinking particulate organic carbon (POC) constitutes the main source of organic carbon supply to the deep ocean's food webs. However, a major discrepancy between the rates of sinking POC supply (collected with sediment traps) and the prokaryotic organic carbon demand (the total amount of carbon required to sustain the heterotrophic metabolism of the prokaryotes; i.e., production plus respiration, PCD) of deep-water communities has been consistently reported for the dark realm of the global ocean. While the amount of sinking POC flux declines exponentially with depth, the concentration of suspended, buoyant non-sinking POC (nsPOC; obtained with oceanographic bottles) exhibits only small variations with depth in the (sub)tropical Northeast Atlantic. Based on available data for the North Atlantic we show here that the sinking POC flux would contribute only 4-12% of the PCD in the mesopelagic realm (depending on the primary production rate in surface waters). The amount of nsPOC potentially available to heterotrophic prokaryotes in the mesopelagic realm can be partly replenished by dark dissolved inorganic carbon fixation contributing between 12% to 72% to the PCD daily. Taken together, there is evidence that the mesopelagic microheterotrophic biota is more dependent on the nsPOC pool than on the sinking POC supply. Hence, the enigmatic major mismatch between the organic carbon demand of the deep-water heterotrophic microbiota and the POC supply rates might be substantially smaller by including the potentially available nsPOC and its autochthonous production in oceanic carbon cycling models.

  3. Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation.

    PubMed

    Karl, David M; Church, Matthew J; Dore, John E; Letelier, Ricardo M; Mahaffey, Claire

    2012-02-01

    The atmospheric and deep sea reservoirs of carbon dioxide are linked via physical, chemical, and biological processes. The last of these include photosynthesis, particle settling, and organic matter remineralization, and are collectively termed the "biological carbon pump." Herein, we present results from a 13-y (1992-2004) sediment trap experiment conducted in the permanently oligotrophic North Pacific Subtropical Gyre that document a large, rapid, and predictable summertime (July 15-August 15) pulse in particulate matter export to the deep sea (4,000 m). Peak daily fluxes of particulate matter during the summer export pulse (SEP) average 408, 283, 24.1, 1.1, and 67.5 μmol·m(-2)·d(-1) for total carbon, organic carbon, nitrogen, phosphorus (PP), and biogenic silica, respectively. The SEP is approximately threefold greater than mean wintertime particle fluxes and fuels more efficient carbon sequestration because of low remineralization during downward transit that leads to elevated total carbon/PP and organic carbon/PP particle stoichiometry (371:1 and 250:1, respectively). Our long-term observations suggest that seasonal changes in the microbial assemblage, namely, summertime increases in the biomass and productivity of symbiotic nitrogen-fixing cyanobacteria in association with diatoms, are the main cause of the prominent SEP. The recurrent SEP is enigmatic because it is focused in time despite the absence of any obvious predictable stimulus or habitat condition. We hypothesize that changes in day length (photoperiodism) may be an important environmental cue to initiate aggregation and subsequent export of organic matter to the deep sea. PMID:22308450

  4. Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation

    PubMed Central

    Karl, David M.; Church, Matthew J.; Dore, John E.; Letelier, Ricardo M.; Mahaffey, Claire

    2012-01-01

    The atmospheric and deep sea reservoirs of carbon dioxide are linked via physical, chemical, and biological processes. The last of these include photosynthesis, particle settling, and organic matter remineralization, and are collectively termed the biological carbon pump. Herein, we present results from a 13-y (19922004) sediment trap experiment conducted in the permanently oligotrophic North Pacific Subtropical Gyre that document a large, rapid, and predictable summertime (July 15August 15) pulse in particulate matter export to the deep sea (4,000 m). Peak daily fluxes of particulate matter during the summer export pulse (SEP) average 408, 283, 24.1, 1.1, and 67.5 ?molm?2d?1 for total carbon, organic carbon, nitrogen, phosphorus (PP), and biogenic silica, respectively. The SEP is approximately threefold greater than mean wintertime particle fluxes and fuels more efficient carbon sequestration because of low remineralization during downward transit that leads to elevated total carbon/PP and organic carbon/PP particle stoichiometry (371:1 and 250:1, respectively). Our long-term observations suggest that seasonal changes in the microbial assemblage, namely, summertime increases in the biomass and productivity of symbiotic nitrogen-fixing cyanobacteria in association with diatoms, are the main cause of the prominent SEP. The recurrent SEP is enigmatic because it is focused in time despite the absence of any obvious predictable stimulus or habitat condition. We hypothesize that changes in day length (photoperiodism) may be an important environmental cue to initiate aggregation and subsequent export of organic matter to the deep sea. PMID:22308450

  5. Nitrogen fixation on early Mars and other terrestrial planets: experimental demonstration of abiotic fixation reactions to nitrite and nitrate.

    PubMed

    Summers, David P; Khare, Bishun

    2007-04-01

    Understanding the abiotic fixation of nitrogen is critical to understanding planetary evolution and the potential origin of life on terrestrial planets. Nitrogen, an essential biochemical element, is certainly necessary for life as we know it to arise. The loss of atmospheric nitrogen can result in an incapacity to sustain liquid water and impact planetary habitability and hydrological processes that shape the surface. However, our current understanding of how such fixation may occur is almost entirely theoretical. This work experimentally examines the chemistry, in both gas and aqueous phases, that would occur from the formation of NO and CO by the shock heating of a model carbon dioxide/nitrogen atmosphere such as is currently thought to exist on early terrestrial planets. The results show that two pathways exist for the abiotic fixation of nitrogen from the atmosphere into the crust: one via HNO and another via NO(2). Fixation via HNO, which requires liquid water, could represent fixation on a planet with liquid water (and hence would also be a source of nitrogen for the origin of life). The pathway via NO(2) does not require liquid water and shows that fixation could occur even when liquid water has been lost from a planet's surface (for example, continuing to remove nitrogen through NO(2) reaction with ice, adsorbed water, etc.). PMID:17480164

  6. Nitrogen-Dependent Carbon Fixation by Picoplankton In Culture and in the Mississippi River

    SciTech Connect

    Aubrey Smith; Marguerite W. Coomes; Thomas E. Smith

    2005-04-30

    The pepc gene, which encodes phosphoenolpyruvate carboxylase (PEPC), of the marine cyanobacterium Synechococcus PCC 7002, was isolated and sequenced. PEPC is an anaplerotic enzyme, but it may also contribute to overall CO2 fixation through β-carboxylation reactions. A consensus sequence generated by aligning the pepc genes of Anabaena variabilis, Anacystis nidulans and Synechocystis PCC 6803 was used to design two sets of primers that were used to amplify segments of Synechococcus PCC 7002 pepc. In order to isolate the gene, the sequence of the PCR product was used to search for the pepc nucleotide sequence from the publicly available genome of Synechococcus PCC 7002. At the time, the genome for this organism had not been completed although sequences of a significant number of its fragments are available in public databases. Thus, the major challenge was to find the pepc gene among those fragments and to complete gaps as necessary. Even though the search did not yield the complete gene, PCR primers were designed to amplify a DNA fragment using a high fidelity thermostable DNA polymerase. An open reading frame (ORF) consisting of 2988 base pairs coding for 995 amino acids was found in the 3066 bp PCR product. The pepc gene had a GC content of 52% and the deduced protein had a calculated molecular mass of 114,049 Da. The amino acid sequence was closely related to that of PEPC from other cyanobacteria, exhibiting 59-61% identity. The sequence differed significantly from plant and E. coli PEPC with only 30% homology. However, comparing the Synechococcus PCC 7002 sequence to the recently resolved E. coli PEPC revealed that most of the essential domains and amino acids involved in PEPC activity were shared by both proteins. The recombinant Synechococcus PCC 7002 PEPC was expressed in E. coli.

  7. Regulation of photosynthetic carbon fixation on the ocean margins. Final report

    SciTech Connect

    Paul, J.H.

    1997-06-01

    The US Department of Energy is concerned with the fate of energy-related materials, including carbon dioxide, in the marine environment. Using laboratory studies, as well as field studies, an attempt was made to understand the molecular regulation of photosynthetic carbon reduction. The objectives were: to determine the mechanism of regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBPCase) in phytoplankton in response to changes in light fields; and to determine regulation of (RuBPCase) in response to light under nutrient deprivation.

  8. Carbonate hydroxyapatite functionalization: a comparative study towards (bio)molecules fixation

    PubMed Central

    Russo, Laura; Taraballi, Francesca; Lupo, Cristina; Poveda, Ana; Jiménez-Barbero, Jesús; Sandri, Monica; Tampieri, Anna; Nicotra, Francesco; Cipolla, Laura

    2014-01-01

    Different methods for the functionalization of carbonate hydroxyapatite granules with free amine groups by reaction with (3-aminopropyl)triethoxysilane (APTES) have been compared in order to improve the potential for tethering of bioactive molecules to bioceramics. The combined use of tetraethoxyorthosilicate and APTES with acid catalysis resulted in an evident increase in amine surface grafting. PMID:24501671

  9. Soybean Photosynthetic Rate and Carbon Fixation at Early and Late Planting Dates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Early planting (late April to early May) is recommended for increasing soybean yield but a full understanding of the physiological response is lacking. This study was conducted to determine whether carbon dioxide exchange rate (CER) could explain this yield difference. A study with five (2007) and s...

  10. Pathways of organic carbon oxidation in three continental margin sediments

    NASA Technical Reports Server (NTRS)

    Canfield, D. E.; Jorgensen, B. B.; Fossing, H.; Glud, R.; Gundersen, J.; Ramsing, N. B.; Thamdrup, B.; Hansen, J. W.; Nielsen, L. P.; Hall, P. O.

    1993-01-01

    We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and Mn reduction) has probably been well underestimated.

  11. Carbon dioxide fixation and sulfate sequestration by a supramolecular trigonal bipyramid.

    PubMed

    Browne, Colm; Ramsay, William J; Ronson, Tanya K; Medley-Hallam, John; Nitschke, Jonathan R

    2015-09-14

    The subcomponent self-assembly of a bent dialdehyde ligand and different cationic and anionic templates led to the formation of two new metallosupramolecular architectures: a Fe(II) 4 L6 molecular rectangle was isolated following reaction of the ligand with iron(II) tetrafluoroborate, and a M5 L6 trigonal bipyramidal structure was constructed from either zinc(II) tetrafluoroborate or cadmium(II) trifluoromethanesulfonate. The spatially constrained arrangement of the three equatorial metal ions in the M5 L6 structures was found to induce small-molecule transformations. Atmospheric carbon dioxide was fixed as carbonate and bound to the equatorial metal centers in both the Zn5 L6 and Cd5 L6 assemblies, and sulfur dioxide was hydrated and bound as the sulfite dianion in the Zn5 L6 structure. Subsequent in situ oxidation of the sulfite dianion resulted in a sulfate dianion bound within the supramolecular pocket. PMID:26235039

  12. Improving high carbon dioxide tolerance and carbon dioxide fixation capability of Chlorella sp. by adaptive laboratory evolution.

    PubMed

    Li, Dengjin; Wang, Liang; Zhao, Quanyu; Wei, Wei; Sun, Yuhan

    2015-06-01

    CO2 capture by microalgae is a promising method to reduce greenhouse gas emissions. It is critical to construct a highly efficient way to obtain a microalgal strain tolerant to high CO2 concentrations with high CO2 fixation capability. In this study, two evolved Chlorella sp. strains, AE10 and AE20 were obtained after 31 cycles of adaptive laboratory evolution (ALE) under 10% and 20% CO2, respectively. Both of them grew rapidly in 30% CO2 and the maximal biomass concentration of AE10 was 3.68±0.08g/L, which was 1.22 and 2.94 times to those of AE20 and original strain, respectively. The chlorophyll contents of AE10 and AE20 were significantly higher than those of the original one under 1-30% CO2. The influences of ALE process on biochemical compositions of Chlorella cells were also investigated. This study proved that ALE was an effective approach to improve high CO2 tolerance of Chlorella sp. PMID:25776894

  13. Chemolithotrophic nitrite oxidation by Nitrobacter: coupling with carbon dioxide fixation for growth and influence of metal ions and inorganic compounds of sulfur

    SciTech Connect

    Tsai, Y.L.

    1986-01-01

    The growth of Nitrobacter winogradskyi was completely inhibited by 0.1 mM persulfate, 0.5 mM tetrathionate, or by 5 mM each of dithionite, metabisulfite, or trithionate. The oxygen uptake activity of washed N. agilis cell suspensions was not influenced by persulfate or tetrathionate. Carbon dioxide fixation was insensitive to tetrathionate and in fact an enhancement by tetrathionate was observed. Persulfate inhibited the fixation of carbon dioxide only at a high concentration. The oxygen uptake activity of washed ell suspensions of N. agilis was tested in the presence of copper, nickel, aluminum, uranyl, and molybdate ions. Copper ion was slightly stimulatory at 0.17 M and strongly inhibitory at 17 mM. Molybdate ion showed either slight enhancement or no inhibition at all test concentrations. With the other test ions inhibition of oxygen uptake was observed.

  14. Coupling of Carbon Dioxide Fixation to the Oxyhydrogen Reaction in the Isolated Chloroplast of Chlamydomonas reinhardtii1

    PubMed Central

    Chen, Changguo; Gibbs, Martin

    1992-01-01

    The oxyhydrogen reaction (the reduction of O2 to water by H2) in the presence of CO2 was studied in the isolated Chlamydomonas reinhardtii chloroplast by monitoring the rate of 14CO2 incorporation into acid-stable products in the dark. The endogenous rate of CO2 uptake (50-125 nmol/mg chlorophyll per h) was increased about 3- to 4-fold by ATP and additionally when combined with glucose, ribose-5-phosphate, and glycerate-3-phosphate. The rate was diminished 50 to 75%, respectively, when H2 was replaced by N2 or by air. Decrease in CO2 uptake by dl-glyceraldehyde was taken to indicate that the regenerative phase and complete Calvin cycle turnover were involved. Diminution of CO2 incorporation by rotenone, antimycin A, and 2,5-dibromo-3-methyl-6-isopropanol-p-benzoquinone was attributed to an inhibition of the oxyhydrogen reaction, resulting in an elevated NADPH/NADP ratio. If so, then the diminished CO2 uptake could have been by “product inhibition” of the carbon metabolic network. Our data are consistent with the proposal (H. Gaffron [1942] J Gen Physiol 26: 241-267) that CO2 fixation coupled to the oxyhydrogen reaction is dependent to some extent on exchloroplastic metabolism. This support is primarily ATP provided by mitochondrial respiration. PMID:16653129

  15. Carbon nanopipettes characterize calcium release pathways in breast cancer cells

    NASA Astrophysics Data System (ADS)

    Schrlau, Michael G.; Brailoiu, Eugen; Patel, Sandip; Gogotsi, Yury; Dun, Nae J.; Bau, Haim H.

    2008-08-01

    Carbon-based nanoprobes are attractive for minimally invasive cell interrogation but their application in cell physiology has thus far been limited. We have developed carbon nanopipettes (CNPs) with nanoscopic tips and used them to inject calcium-mobilizing messengers into cells without compromising cell viability. We identify pathways sensitive to cyclic adenosine diphosphate ribose (cADPr) and nicotinic acid adenine dinucleotide phosphate (NAADP) in breast carcinoma cells. Our findings demonstrate the superior utility of CNPs for intracellular delivery of impermeant molecules and, more generally, for cell physiology studies. The CNPs do not appear to cause any lasting damage to cells. Their advantages over commonly used glass pipettes include smaller size, breakage and clogging resistance, and potential for multifunctionality such as in concurrent injection and electrical measurements.

  16. Urea Uptake and Carbon Fixation by Marine Pelagic Bacteria and Archaea during the Arctic Summer and Winter Seasons

    PubMed Central

    Connelly, Tara L.; Baer, Steven E.; Cooper, Joshua T.; Bronk, Deborah A.

    2014-01-01

    How Arctic climate change might translate into alterations of biogeochemical cycles of carbon (C) and nitrogen (N) with respect to inorganic and organic N utilization is not well understood. This study combined 15N uptake rate measurements for ammonium, nitrate, and urea with 15N- and 13C-based DNA stable-isotope probing (SIP). The objective was to identify active bacterial and archeal plankton and their role in N and C uptake during the Arctic summer and winter seasons. We hypothesized that bacteria and archaea would successfully compete for nitrate and urea during the Arctic winter but not during the summer, when phytoplankton dominate the uptake of these nitrogen sources. Samples were collected at a coastal station near Barrow, AK, during August and January. During both seasons, ammonium uptake rates were greater than those for nitrate or urea, and nitrate uptake rates remained lower than those for ammonium or urea. SIP experiments indicated a strong seasonal shift of bacterial and archaeal N utilization from ammonium during the summer to urea during the winter but did not support a similar seasonal pattern of nitrate utilization. Analysis of 16S rRNA gene sequences obtained from each SIP fraction implicated marine group I Crenarchaeota (MGIC) as well as Betaproteobacteria, Firmicutes, SAR11, and SAR324 in N uptake from urea during the winter. Similarly, 13C SIP data suggested dark carbon fixation for MGIC, as well as for several proteobacterial lineages and the Firmicutes. These data are consistent with urea-fueled nitrification by polar archaea and bacteria, which may be advantageous under dark conditions. PMID:25063662

  17. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco.

    PubMed

    Simkin, Andrew J; McAusland, Lorna; Headland, Lauren R; Lawson, Tracy; Raines, Christine A

    2015-07-01

    Over the next 40 years it has been estimated that a 50% increase in the yield of grain crops such as wheat and rice will be required to meet the food and fuel demands of the increasing world population. Transgenic tobacco plants have been generated with altered combinations of sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and the cyanobacterial putative-inorganic carbon transporter B, ictB, of which have all been identified as targets to improve photosynthesis based on empirical studies. It is shown here that increasing the levels of the three proteins individually significantly increases the rate of photosynthetic carbon assimilation, leaf area, and biomass yield. Furthermore, the daily integrated measurements of photosynthesis showed that mature plants fixed between 12-19% more CO2 than the equivalent wild-type plants. Further enhancement of photosynthesis and yield was observed when sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and ictB were over-expressed together in the same plant. These results demonstrate the potential for the manipulation of photosynthesis, using multigene-stacking approaches, to increase crop yields. PMID:25956882

  18. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco

    PubMed Central

    Simkin, Andrew J.; McAusland, Lorna; Headland, Lauren R.; Lawson, Tracy; Raines, Christine A.

    2015-01-01

    Over the next 40 years it has been estimated that a 50% increase in the yield of grain crops such as wheat and rice will be required to meet the food and fuel demands of the increasing world population. Transgenic tobacco plants have been generated with altered combinations of sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and the cyanobacterial putative-inorganic carbon transporter B, ictB, of which have all been identified as targets to improve photosynthesis based on empirical studies. It is shown here that increasing the levels of the three proteins individually significantly increases the rate of photosynthetic carbon assimilation, leaf area, and biomass yield. Furthermore, the daily integrated measurements of photosynthesis showed that mature plants fixed between 12–19% more CO2 than the equivalent wild-type plants. Further enhancement of photosynthesis and yield was observed when sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and ictB were over-expressed together in the same plant. These results demonstrate the potential for the manipulation of photosynthesis, using multigene-stacking approaches, to increase crop yields. PMID:25956882

  19. Experimental and computational insights into carbon dioxide fixation by RZnOH species.

    PubMed

    Sokołowski, Kamil; Bury, Wojciech; Tulewicz, Adam; Cieślak, Anna M; Justyniak, Iwona; Kubicki, Dominik; Krajewska, Elżbieta; Milet, Anne; Moszyński, Robert; Lewiński, Janusz

    2015-03-27

    Organozinc hydroxides, RZnOH, possessing the proton-reactive alkylzinc group and the CO2 -reactive Zn-OH group, represent an intriguing group of organometallic precursors for the synthesis of novel zinc carbonates. Comprehensive experimental and computational investigations on 1) solution and solid-state behavior of tBuZnOH (1) species in the presence of Lewis bases, namely, THF and 4-methylpyridine; 2) step-by-step sequence of the reaction between 1 and CO2; and 3) the effect of a donor ligand and/or an excess of tBu2Zn as an external proton acceptor on the reaction course are reported. DFT calculations for the insertion of carbon dioxide into the dinuclear alkylzinc hydroxide 12 are fully consistent with (1)H NMR spectroscopy studies and indicate that this process is a multistep reaction, in which the insertion of CO2 seems to be the rate-determining step. Moreover, DFT studies show that the mechanism of the rearrangement between key intermediates, that is, the primary alkylzinc bicarbonate with a proximal position of hydrogen and the secondary alkylzinc bicarbonate with a distal position of hydrogen, most likely proceeds through internal rotation of the dinuclear bicarbonate. PMID:25693575

  20. Biochemistry and control of the reductive tricarboxylic acid pathway of CO2 fixation and physiological role of the RubisCO-like protein

    SciTech Connect

    Tabita, F Robert

    2008-12-04

    During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris. 1. Reductive TCA pathway of CO2 assimilation Many diverse microorganisms use the reductive TCA (RTCA) pathway for CO2 assimilation. Included are photoautotrophic and chemoautotrophic organisms that occupy important niches in various ecosystems. Inasmuch as the biochemistry and regulation of the RTCA pathway has been virtually neglected, especially in comparison to the Calvin-Benson-Bassham (CBB) reductive pentose pathway of CO2 fixation, we sought to develop a system that would allow for detailed biochemical analysis of the RTCA enzymes and associated proteins, along with the genes that encode these proteins. We have focused on the green sulfur photosynthetic bacterium Chlorobium tepidum, a fast growing moderate thermophile originally isolated by Professor Mike Madigan and colleagues. Because of its rapid growth and relative ease to produce massive cell amounts via high-density fermentator vessels, C. tepidum has become the organism of choice for investigators interested in studying all aspects of the physiology and biochemistry of green sulfur bacteria. Moreover, this organism possesses a very convenient natural transformation system that allows routine genetic transfer and the generation of knockout mutations via homologous recombination at specific genetic loci. The first such mutations were generated in our laboratory [Hanson & Tabita, PNAS USA, 98 (2001), 4397-4402], such that these protocols have now become relatively routine. Moreover, the genome of C. tepidum was recently sequenced. Thus, all the tools are in place for productive analysis of key processes catalyzed by this organism, in particular for analysis of the RTCA pathway and the rather unique RubisCO-like protein (RLP) that we first discovered during the last grant period of this project [Hanson & Tabita, 2001]. We have concentrated on the enzymology of the key proteins of this pathway, in particular pyruvate synthase (PS), -ketoglutarate synthase (KGS), and ATP-citrate lyase (ACL). In addition, we have also focused on key electron transfer proteins that must provide needed reducing equivalents to PS and KGS, including two separate ferredoxins that were shown to be abundantly produced by this organism. 2. Physiological/biochemical/genetic studies on the RubisCO-like Protein (RLP) During the prior grant period we identified what we believe is an evolutional precursor to bona fide RubisCO in C. tepidum, the RubisCO-like protein (RLP) [Hanson & Tabita, 2001]. Typical bioinformatics software incorrectly indicates that RLP is RubisCO, however our previous experience with RubisCO enabled us to establish that C. tepidum RLP has substitutions in 9 out of the 19 residues known to be important for RubisCO-catalyzed CO2 fixation. After purifying recombinant RLP, we showed that the RLP is not a bona fide RubisCO that catalyzes RuBP-dependent CO2 fixation, but appears to function in some aspect of the oxidation of reduced sulfur compounds by this organism. More recent studies [Hanson & Tabita, Photosynth. Res. 78 (2003) 231-248] during the past grant period have established that this effect is related to some aspect of thiosulfate oxidation in the reduced sulfur compound oxidation pathway, as sulfide oxidation was not affected. When we first discovered the RLP, we noted that RLP homologs were also found in other organisms, including heterotrophic bacteria and at least one archaeon [Hanson & Tabita, 2001, 2003]. Finally, as long-time Rubiscologists we have always been intrigued with how the active site of RubisCO might have evolved for its key functional role in metabolizing CO2 and O2 [Tabita, Photosynth. Res. 60 (1999) 1-28; Tabita et al. Microbiol. Mol. Biol. Rev. 71 (2007) 576-599]. This was borne out by the recent elucidation of the structure of RLP via a collaborative with our group and the laboratory of Prof. David Eisenberg at UCLA [Li, Sawaya, Tabita & Eisenberg, Structure 13 (2005) 779-789]. Finally, in another collaborative effort with Prof. John Gerlt’s group at the Univeristy of Illinois, we have shown that the RLP from Rhodospirillum rubrum catalyzes an unusual double isomerase reaction [Imker, Singh, Warlick, Tabita, and Gerlt, Biochemistry (2008) 11171-11173.] and is most likely involved in a completely novel pathway of sulfur salvage [Singh and Tabita, manuscript in preparation; Singh, J., Ph. D. Dissertation, The Ohio State University, 2008].

  1. Effects of dissolved inorganic carbon and nutrient levels on carbon fixation and properties of Thermosynechococcus sp. in a continuous system.

    PubMed

    Su, Chih Ming; Hsueh, Hsin Ta; Chen, Hsing Hui; Chu, Hsin

    2012-07-01

    The concept of CO(2) chemo-absorption by sodium hydroxide in a wet scrubber followed by microalgae cultivation was used as a means to reduce the major greenhouse gas. A thermophilic and alkaline tolerable cyanobacterium named Thermosynechococcus CL-1 (TCL-1) was cultivated in continuous system, with a carbonate-bicarbonate buffer as carbon source. The effects of dissolved inorganic carbon (DIC(in)) and nutrient levels in influent on cell mass productivity, DIC removal efficiency, and alkaline solution regeneration by TCL-1 were investigated. The results show the highest cell mass productivity reaches 1.7 g L(-1)d(-1) under the highest DIC and nutrients level. Conversely, the best regeneration of alkaline solution proceeds from pH 9.5 to 11.3 under the lowest level. In addition, the highest ΔDIC (DIC consumption) and DIC removal efficiency are 42 mM and 43% at 113.2 and 57 mM DIC(in), respectively. PMID:22560699

  2. Will elevated carbon dioxide concentration amplify the benefits of nitrogen fixation in legumes?

    SciTech Connect

    Rogers, A.; Ainsworth, E. A.; Leakey, A. D. B.

    2009-11-01

    Growth at elevated [CO{sub 2}] stimulates photosynthesis and increases carbon (C) supply in all C3 species. A sustained and maximal stimulation in productivity at elevated [CO{sub 2}] requires an enhanced nutrient supply to match the increase in C acquisition. The ability of legumes to exchange C for nitrogen (N) with their N{sub 2}-fixing symbionts has led to the hypothesis that legumes will have a competitive advantage over nonleguminous species when grown at elevated [CO{sub 2}]. On balance, evidence suggests that in managed systems, legumes are more responsive to elevated [CO{sub 2}] than other plants (e.g. Ainsworth and Long, 2005); however, in natural ecosystems, nutrient availability can limit the response of legumes to elevated [CO{sub 2}] (Hungate et al., 2004; van Groenigen et al., 2006). Here, we consider these observations, outline the mechanisms that underlie them, and examine recent work that advances our understanding of how legumes respond to growth at elevated [CO{sub 2}]. First we highlight the global importance of legumes and provide a brief overview of the symbiotic relationship.

  3. How sensitive are estimates of carbon fixation in agricultural models to input data?

    PubMed Central

    2012-01-01

    Background Process based vegetation models are central to understand the hydrological and carbon cycle. To achieve useful results at regional to global scales, such models require various input data from a wide range of earth observations. Since the geographical extent of these datasets varies from local to global scale, data quality and validity is of major interest when they are chosen for use. It is important to assess the effect of different input datasets in terms of quality to model outputs. In this article, we reflect on both: the uncertainty in input data and the reliability of model results. For our case study analysis we selected the Marchfeld region in Austria. We used independent meteorological datasets from the Central Institute for Meteorology and Geodynamics and the European Centre for Medium-Range Weather Forecasts (ECMWF). Land cover / land use information was taken from the GLC2000 and the CORINE 2000 products. Results For our case study analysis we selected two different process based models: the Environmental Policy Integrated Climate (EPIC) and the Biosphere Energy Transfer Hydrology (BETHY/DLR) model. Both process models show a congruent pattern to changes in input data. The annual variability of NPP reaches 36% for BETHY/DLR and 39% for EPIC when changing major input datasets. However, EPIC is less sensitive to meteorological input data than BETHY/DLR. The ECMWF maximum temperatures show a systematic pattern. Temperatures above 20°C are overestimated, whereas temperatures below 20°C are underestimated, resulting in an overall underestimation of NPP in both models. Besides, BETHY/DLR is sensitive to the choice and accuracy of the land cover product. Discussion This study shows that the impact of input data uncertainty on modelling results need to be assessed: whenever the models are applied under new conditions, local data should be used for both input and result comparison. PMID:22296931

  4. Biomechanical properties of a structurally optimized carbon-fibre/epoxy intramedullary nail for femoral shaft fracture fixation.

    PubMed

    Samiezadeh, Saeid; Fawaz, Zouheir; Bougherara, Habiba

    2016-03-01

    Intramedullary nails are the golden treatment option for diaphyseal fractures. However, their high stiffness can shield the surrounding bone from the natural physiologic load resulting in subsequent bone loss. Their stiff structure can also delay union by reducing compressive loads at the fracture site, thereby inhibiting secondary bone healing. Composite intramedullary nails have recently been introduced to address these drawbacks. The purpose of this study is to evaluate the mechanical properties of a previously developed composite IM nail made of carbon-fibre/epoxy whose structure was optimized based on fracture healing requirements using the selective stress shielding approach. Following manufacturing, the cross-section of the composite nail was examined under an optical microscope to find the porosity of the structure. Mechanical properties of the proposed composite intramedullary nail were determined using standard tension, compression, bending, and torsion tests. The failed specimens were then examined to obtain the modes of failure. The material showed high strength in tension (403.9±7.8MPa), compression (316.9±10.9MPa), bending (405.3±8.1MPa), and torsion (328.5±7.3MPa). Comparing the flexural modulus (41.1±0.9GPa) with the compressive modulus (10.0±0.2GPa) yielded that the material was significantly more flexible in compression than in bending. This customized flexibility along with the high torsional stiffness of the nail (70.7±2.0Nm(2)) has made it ideal as a fracture fixation device since this unique structure can stabilize the fracture while allowing for compression of fracture ends. Negligible moisture absorption (~0.5%) and low porosity of the laminate structure (< 3%) are other advantages of the proposed structure. The findings suggested that the carbon-fibre/epoxy intramedullary nail is flexible axially while being relatively rigid in bending and torsion and is strong enough in all types of physiologic loading, making it a potential candidate for use as an alternative to the conventional titanium-alloy intramedullary nails. PMID:26703226

  5. The R3-carbon allotrope: a pathway towards glassy carbon under high pressure

    PubMed Central

    Jiang, Xue; Århammar, Cecilia; Liu, Peng; Zhao, Jijun; Ahuja, Rajeev

    2013-01-01

    Pressure-induced bond type switching and phase transformation in glassy carbon (GC) has been simulated by means of Density Functional Theory (DFT) calculations and the Stochastic Quenching method (SQ) in a wide range of pressures (0–79 GPa). Under pressure, the GC experiences a hardening transition from sp- and sp2-type to sp3-type bonding, in agreement with previous experimental results. Moreover, a new crystalline carbon allotrope possessing R3 symmetry (R3-carbon) is predicted using the stochastic SQ method. The results indicate that R3-carbon can be regarded as an allotrope similar to that of amorphous GC. A very small difference in the heat of formation and the coherence of the radial and angular distribution functions of GC and the R3-carbon structure imply that small perturbations to this crystalline carbon allotrope may provide another possible amorphization pathway of carbon besides that of quenching the liquid melt or gas by ultra-fast cooling. PMID:23698738

  6. Pathways of Carbon and Energy Metabolism of the Epibiotic Community Associated with the Deep-Sea Hydrothermal Vent Shrimp Rimicaris exoculata

    PubMed Central

    Hgler, Michael; Petersen, Jillian M.; Dubilier, Nicole; Imhoff, Johannes F.; Sievert, Stefan M.

    2011-01-01

    Background The shrimp Rimicaris exoculata dominates the faunal biomass at many deep-sea hydrothermal vent sites at the Mid-Atlantic Ridge. In its enlarged gill chamber it harbors a specialized epibiotic bacterial community for which a nutritional role has been proposed. Methodology/Principal Findings We analyzed specimens from the Snake Pit hydrothermal vent field on the Mid-Atlantic Ridge by complementing a 16S rRNA gene survey with the analysis of genes involved in carbon, sulfur and hydrogen metabolism. In addition to Epsilon- and Gammaproteobacteria, the epibiotic community unexpectedly also consists of Deltaproteobacteria of a single phylotype, closely related to the genus Desulfocapsa. The association of these phylogenetic groups with the shrimp was confirmed by fluorescence in situ hybridization. Based on functional gene analyses, we hypothesize that the Gamma- and Epsilonproteobacteria are capable of autotrophic growth by oxidizing reduced sulfur compounds, and that the Deltaproteobacteria are also involved in sulfur metabolism. In addition, the detection of proteobacterial hydrogenases indicates the potential for hydrogen oxidation in these communities. Interestingly, the frequency of these phylotypes in 16S rRNA gene clone libraries from the mouthparts differ from that of the inner lining of the gill chamber, indicating potential functional compartmentalization. Conclusions Our data show the specific association of autotrophic bacteria with Rimicaris exoculata from the Snake Pit hydrothermal vent field, and suggest that autotrophic carbon fixation is contributing to the productivity of the epibiotic community with the reductive tricarboxylic acid cycle as one important carbon fixation pathway. This has not been considered in previous studies of carbon fixation and stable carbon isotope composition of the shrimp and its epibionts. Furthermore, the co-occurrence of sulfur-oxidizing and sulfur-reducing epibionts raises the possibility that both may be involved in the syntrophic exchange of sulfur compounds, which could increase the overall efficiency of this epibiotic community. PMID:21249205

  7. Relationship of photosynthetic carbon fixation with environmental changes in the Jiulong River estuary of the South China Sea, with special reference to the effects of solar UV radiation.

    PubMed

    Li, Gang; Gao, Kunshan; Yuan, Dongxing; Zheng, Ying; Yang, Guiyuan

    2011-08-01

    Phytoplankton cells in estuary waters usually experience drastic changes in chemical and physical environments due to mixing of fresh and seawaters. In order to see their photosynthetic performance in such dynamic waters, we measured the photosynthetic carbon fixation by natural phytoplankton assemblages in the Jiulong River estuary of the South China Sea during April 24-26 and July 24-26 of 2008, and investigated its relationship with environmental changes in the presence or the absence of UV radiation. Phytoplankton biomass (Chl a) decreased sharply from the river-mouth to seawards (17.3-2.1 μg L(-1)), with the dominant species changed from chlorophytes to diatoms. The photosynthetic rate based on Chl a at noon time under PAR-alone increased from 1.9 μg C (μg Chl a)(-1) L(-1) in low salinity zone (SSS<10) to 12.4 μg C (μg Chl a)(-1) L(-1) in turbidity front (SSS within 10-20), and then decreased to 2.1 μg C (μg Chl a)(-1) L(-1) in mixohaline zone (SSS>20); accordingly, the carbon fixation per volume of seawater increased from 12.8 to 149 μg C L(-1) h(-1), and decreased to 14.3 μg C L(-1) h(-1). Solar UVR caused the inhibition of carbon fixation in surface water of all the investigated zones, by 39% in turbidity area and 7-10% in freshwater or mixohaline zones. In the turbidity zone, higher availability of CO2 could have enhanced the photosynthetic performance; while osmotic stress might be responsible for the higher sensitivity of phytoplankton assemblages to solar UV radiation. PMID:21714975

  8. Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata

    PubMed Central

    Ponsard, Julie; Cambon-Bonavita, Marie-Anne; Zbinden, Magali; Lepoint, Gilles; Joassin, André; Corbari, Laure; Shillito, Bruce; Durand, Lucile; Cueff-Gauchard, Valérie; Compère, Philippe

    2013-01-01

    The shrimp Rimicaris exoculata dominates several hydrothermal vent ecosystems of the Mid-Atlantic Ridge and is thought to be a primary consumer harbouring a chemoautotrophic bacterial community in its gill chamber. The aim of the present study was to test current hypotheses concerning the epibiont's chemoautotrophy, and the mutualistic character of this association. In-vivo experiments were carried out in a pressurised aquarium with isotope-labelled inorganic carbon (NaH13CO3 and NaH14CO3) in the presence of two different electron donors (Na2S2O3 and Fe2+) and with radiolabelled organic compounds (14C-acetate and 3H-lysine) chosen as potential bacterial substrates and/or metabolic by-products in experiments mimicking transfer of small biomolecules from epibionts to host. The bacterial epibionts were found to assimilate inorganic carbon by chemoautotrophy, but many of them (thick filaments of epsilonproteobacteria) appeared versatile and able to switch between electron donors, including organic compounds (heterotrophic acetate and lysine uptake). At least some of them (thin filamentous gammaproteobacteria) also seem capable of internal energy storage that could supply chemosynthetic metabolism for hours under conditions of electron donor deprivation. As direct nutritional transfer from bacteria to host was detected, the association appears as true mutualism. Import of soluble bacterial products occurs by permeation across the gill chamber integument, rather than via the digestive tract. This first demonstration of such capabilities in a decapod crustacean supports the previously discarded hypothesis of transtegumental absorption of dissolved organic matter or carbon as a common nutritional pathway. PMID:22914596

  9. Regulation of multiple carbon monoxide consumption pathways in anaerobic bacteria.

    PubMed

    Techtmann, Stephen M; Colman, Albert S; Murphy, Michael B; Schackwitz, Wendy S; Goodwin, Lynne A; Robb, Frank T

    2011-01-01

    Carbon monoxide (CO), well known as a toxic gas, is increasingly recognized as a key metabolite and signaling molecule. Microbial utilization of CO is quite common, evidenced by the rapid escalation in description of new species of CO-utilizing bacteria and archaea. Carbon monoxide dehydrogenase (CODH), the protein complex that enables anaerobic CO-utilization, has been well-characterized from an increasing number of microorganisms, however the regulation of multiple CO-related gene clusters in single isolates remains unexplored. Many species are extraordinarily resistant to high CO concentrations, thriving under pure CO at more than one atmosphere. We hypothesized that, in strains that can grow exclusively on CO, both carbon acquisition via the CODH/acetyl CoA synthase complex and energy conservation via a CODH-linked hydrogenase must be differentially regulated in response to the availability of CO. The CO-sensing transcriptional activator, CooA is present in most CO-oxidizing bacteria. Here we present a genomic and phylogenetic survey of CODH operons and cooA genes found in CooA-containing bacteria. Two distinct groups of CooA homologs were found: one clade (CooA-1) is found in the majority of CooA-containing bacteria, whereas the other clade (CooA-2) is found only in genomes that encode multiple CODH clusters, suggesting that the CooA-2 might be important for cross-regulation of competing CODH operons. Recombinant CooA-1 and CooA-2 regulators from the prototypical CO-utilizing bacterium Carboxydothermus hydrogenoformans were purified, and promoter binding analyses revealed that CooA-1 specifically regulates the hydrogenase-linked CODH, whereas CooA-2 is able to regulate both the hydrogenase-linked CODH and the CODH/ACS operons. These studies point to the ability of dual CooA homologs to partition CO into divergent CO-utilizing pathways resulting in efficient consumption of a single limiting growth substrate available across a wide range of concentrations. PMID:21808633

  10. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway.

    PubMed

    Guo, Yinsheng; Wang, Wei; Dong, Yu; Zhang, Zhen; Zhou, Yijun; Chen, Guoyuan

    2014-08-01

    Carbon disulfide (CS2), one of the most important volatile organic chemicals, was shown to have serious impairment to male reproductive system. But the underline mechanism is still unclear. In the present study, we aim to investigate the male germ cell apoptosis induced by CS2 exposure alone and by co-administration with cyclosporin A (CsA), which is the inhibitor of membrane permeability transition pore (MPTP). It was shown that CS2 exposure impaired ultrastructure of germ cells, increased the numbers of apoptotic germ cells, accumulated intracellular level of calcium, elevated ROS level, and increased activities of complexes of respiratory chain. Meanwhile, exposure to CS2 dramatically decreased the mitochondrial transmembrane potential (ΔΨm) and levels of ATP and MPTP opening. Exposure to CS2 can also cause a significantly dose-dependent increase in the expression levels of Bax, Cytc, Caspase-9, and Caspase-3, but decreased the expression level of Bcl-2. Moreover, co-administration of CsA with CS2 can reverse or alleviate the above apoptotic damage effects of CS2 on testicular germ cells. Taken together, our findings suggested that CS2 can cause damage to testicular germ cells via mitochondrial apoptotic pathway, and MPTP play a crucial role in this process. PMID:24582363

  11. Advances in mechanisms and signaling pathways of carbon nanotube toxicity

    PubMed Central

    Dong, Jie; Ma, Qiang

    2015-01-01

    Carbon nanotubes (CNT) have been developed into new materials with a variety of industrial and commercial applications. In contrast, the physicochemical properties of CNT at the nanoscale render them the potency to generate toxic effects. Indeed, the potential health impacts of CNT have drawn a great deal of attention in recent years, owing to their identified toxicological and pathological consequences including cytotoxicity, inflammation, fibrosis, genotoxicity, tumorigenesis, and immunotoxicity. Understanding the mechanisms by which CNT induce toxicity and pathology is thus urgently needed for accurate risk assessment of CNT exposure in humans, and for safe and responsible development and commercialization of nanotechnology. Here, we summarize and discuss recent advances in this area with a focus on the molecular interactions between CNT and mammalian systems, and the signaling pathways important for the development of CNT toxicity such as the NF-κB, NLRP3 inflammasome, TGF-β1, MAPK, and p53 signaling cascades. With the current mechanistic evidence summarized in this review, we expect to provide new insights into CNT toxicology at the molecular level and offer new clues to the prevention of health effects resulting from CNT exposure. Moreover, we disclose questions and issues that remain in this rapidly advancing field of nanotoxicology, which would facilitate ascertaining future research directions. PMID:25676622

  12. Simulation of permeability evolution of leakage pathway in carbonate-rich caprocks in carbon sequestration

    NASA Astrophysics Data System (ADS)

    Guo, B.; Fitts, J. P.; Dobossy, M. E.; Peters, C. A.

    2013-12-01

    Geologic carbon sequestration in deep saline aquifers is a promising strategy for mitigating climate change. A major concern is the possibility of brine and CO2 migration through the caprock such as through fractures and faults. In this work, we examine the extent to which mineral dissolution will substantially alter the porosity and permeability of caprock leakage pathways as CO2-acidified brine flows through them. Three models were developed. Firstly, a reactive transport model, Permeability Evolution of Leakage pathway (PEL), was developed to simulate permeability evolution of a leakage pathway during the injection period, and assumes calcite is the only reactive mineral. The system domain is a 100 m long by 0.2 m diameter cylindrical flow path with fixed boundaries containing a rock matrix with an initial porosity of 30% and initial permeability of 1×10-13 m2. One example result is for an initial calcite volume fraction (CVF) of 0.20, in which all the calcite is dissolved after 50 years and the permeability reaches 3.2×10-13 m2. For smaller values of CVF, the permeability reaches its final value earlier but the increase in permeability is minimal. For a large value of CVF such as 0.50, the permeability could eventually reach 1×10-12 m2, but the large amount of dissolved calcium buffers the solution and slows the reaction. After 50 years the permeability change is negligible. Thus, there is a non-monotonic relationship between the amount of calcite in the rock and the resulting permeability change because of the competing dynamics of calcite dissolution and alkalinity build-up. In the second model, PEL was coupled to an existing basin-scale multiphase flow model, Princeton's Estimating Leakage Semi-Analytical (ELSA) model. The new model, ELSA-PEL, estimates the brine and CO2 leakage rates during the injection period under conditions of permeability evolution. The scenario considered in this work is for 50 years of CO2 injection into the Mt. Simon formation in the Michigan basin at an injection rate of 1 Mt/y. As an example, for a CVF value of 5%, the brine leakage rate after fifty years for a leakage pathway 1,000 m distance from the injection well is 0.88 kg/s, which is 2.4% larger than if there were no geochemical evolution of the permeability. In a sensitivity analysis with regard to the distance between the leakage pathway and the injection well, it was found that the cumulative leakage first increases with the distance and the relationship reverses after a certain distance. When the leakage pathway is farther away, the pressure increment drops leading to less acid brine flow; meanwhile, the time before the CO2 plume reaches the pathway is longer and this lengthens the reaction time with brine. Thirdly, we explored the role that SO2 would play if it were present as a co-injectant in carbon sequestration. The reaction considered is SO2 hydrolysis to form sulfurous acid. We expect the sulfurous acid will erode the calcite faster than carbonic acid because it is a stronger acid. Contrary to intuition, the simulation results showed a decrease in permeability due to CaSO3 precipitation in replacement of CaCO3, as CaSO3 has a larger molar volume.

  13. Cytochrome c terminal oxidase pathways of Azotobacter vinelandii: analysis of cytochrome c4 and c5 mutants and up-regulation of cytochrome c-dependent pathways with N2 fixation.

    PubMed Central

    Rey, L; Maier, R J

    1997-01-01

    The Azotobacter vinelandii cytochrome c5 gene (termed cycB) was cloned and sequenced. Mutants in this c-type cytochrome as well as cytochrome c4 mutants (mutations in cycA) and double mutants in both of the c-type respiratory pathways were characterized. Spectral and heme staining experiments on membranes from the mutants were consistent with the anticipated characteristics of all the gene-directed mutants. Membranes of the individual cytochrome c4 or c5 mutants had normal respiratory rates with physiological substrates but respiration significantly lower than the wild-type rate with ascorbate-N,N,N',N',-tetramethyl-p-phenylenediamine (TMPD) as a reductant. The growth rates of the individual cytochrome c4 or c5 mutants were not markedly different from that of the wild-type strain, but the cycA cycB double-mutant strain was noticeably growth retarded at and below 7.5% O2 on both N-containing and N-free media. The double-mutant strain was unable to grow on agar plates at O2 tensions of 2.5% or less on N-free medium. As the wild-type growth was unaffected by varying the O2 tension, the results indicate that the role of the cytochrome c-dependent pathways is to provide respiration at intermediate (5 to 10%) and low (below 5%) O2 tensions. The two c-type cytochrome genes are transcriptionally up-regulated with N2 fixation; N starvation caused 2.8-fold and 7- to 10-fold increases in the promoter activities of cycA and cycB, respectively, but these activities were affected little by the O2 level supplied to the cultures. PMID:9371471

  14. Two-dimensional isobutyl acetate production pathways to improve carbon yield

    PubMed Central

    Tashiro, Yohei; Desai, Shuchi H.; Atsumi, Shota

    2015-01-01

    For an economically competitive biological process, achieving high carbon yield of a target chemical is crucial. In biochemical production, pyruvate and acetyl-CoA are primary building blocks. When sugar is used as the sole biosynthetic substrate, acetyl-CoA is commonly generated by pyruvate decarboxylation. However, pyruvate decarboxylation during acetyl-CoA formation limits the theoretical maximum carbon yield (TMCY) by releasing carbon, and in some cases also leads to redox imbalance. To avoid these problems, we describe here the construction of a metabolic pathway that simultaneously utilizes glucose and acetate. Acetate is utilized to produce acetyl-CoA without carbon loss or redox imbalance. We demonstrate the utility of this approach for isobutyl acetate (IBA) production, wherein IBA production with glucose and acetate achieves a higher carbon yield than with either sole carbon source. These results highlight the potential for this multiple carbon source approach to improve the TMCY and balance redox in biosynthetic pathways. PMID:26108471

  15. Carbon Assimilation Pathways, Water Relationships and Plant Ecology.

    ERIC Educational Resources Information Center

    Etherington, John R.

    1988-01-01

    Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

  16. Methanotrophy induces nitrogen fixation during peatland development

    PubMed Central

    Larmola, Tuula; Leppänen, Sanna M.; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja

    2014-01-01

    Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

  17. Methanotrophy induces nitrogen fixation during peatland development.

    PubMed

    Larmola, Tuula; Leppänen, Sanna M; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja

    2014-01-14

    Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

  18. Carbon Balance of a Mannitol Fermentation and the Biosynthetic Pathway

    PubMed Central

    Lee, Wei Hwa

    1967-01-01

    The carbon balance was determined for a fermentation in which mannitol is produced from glucose by an Aspergillus species. The products found were: cells (17% of carbon input), CO2 (26%), mannitol (35%), glycerol (10%), erythritol (2.5%), glycogen (1%), and unidentified compounds (8%). Thus, 92% of the carbon input was accounted for. Cell-free enzyme studies showed that mannitol was synthesized via the reduction of fructose-6-phosphate and not by the direct reduction of fructose. If the cell yield from glucose was assumed to be 50% and the theoretical conversion efficiency from glucose to polyols was 90%, as calculated from the energy balance, then 34% of the glucose carbon was used for growth and 53% was used for polyol formation. PMID:4294822

  19. Emerging patterns of marine nitrogen fixation.

    PubMed

    Sohm, Jill A; Webb, Eric A; Capone, Douglas G

    2011-07-01

    Biological N(2) fixation is an important part of the marine nitrogen cycle as it provides a source of new nitrogen that can support biological carbon export and sequestration. Research in the past decade has focused on determining the patterns of distribution and abundance of diazotrophs, defining the environmental features leading to these patterns and characterizing the factors that constrain marine N(2) fixation overall. In this Review, we describe how variations in the deposition of iron from dust to different ocean basins affects the limiting nutrient for N(2) fixation and the distribution of different diazotrophic species. However, many questions remain about marine N(2) fixation, including the role of temperature, fixed nitrogen species, CO(2) and physical forcing in controlling N(2) fixation, as well as the potential for heterotrophic N(2) fixation. PMID:21677685

  20. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    NASA Astrophysics Data System (ADS)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.

    2011-07-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. In addition, a concomitant flux of carbonate formed in wood tissues contributes to the carbonate flux and is identified as a direct consequence of wood feeding by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter, and an oxalate pool is formed on the forest ground. Then, wood rotting agents (mainly termites, saprophytic fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition, some of these agents are themselves producers of oxalate (e.g. fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can then start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with δ13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as defined by ecological theory.

  1. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    NASA Astrophysics Data System (ADS)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.

    2011-02-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the theoretical acidic conditions of these soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. Regarding the carbonate flux, another direct consequence of wood feeding is a concomitant flux of carbonate formed in wood tissues, which is not consumed by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter. Therefore, an oxalate pool is formed on the forest ground. Then, wood rotting gents (mainly termites, fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition some of these gents are themselves producers of oxalate (fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with δ13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as define by the ecological theory.

  2. Latarjet Fixation

    PubMed Central

    Alvi, Hasham M.; Monroe, Emily J.; Muriuki, Muturi; Verma, Rajat N.; Marra, Guido; Saltzman, Matthew D.

    2016-01-01

    Background: Attritional bone loss in patients with recurrent anterior instability has successfully been treated with a bone block procedure such as the Latarjet. It has not been previously demonstrated whether cortical or cancellous screws are superior when used for this procedure. Purpose: To assess the strength of stainless steel cortical screws versus stainless steel cannulated cancellous screws in the Latarjet procedure. Study Design: Controlled laboratory study. Methods: Ten fresh-frozen matched-pair shoulder specimens were randomized into 2 separate fixation groups: (1) 3.5-mm stainless steel cortical screws and (2) 4.0-mm stainless steel partially threaded cannulated cancellous screws. Shoulder specimens were dissected free of all soft tissue and a 25% glenoid defect was created. The coracoid process was osteomized, placed at the site of the glenoid defect, and fixed in place with 2 parallel screws. Results: All 10 specimens failed by screw cutout. Nine of 10 specimens failed by progressive displacement with an increased number of cycles. One specimen in the 4.0-mm screw group failed by catastrophic failure on initiation of the testing protocol. The 3.5-mm screws had a mean of 274 cycles (SD, ±171 cycles; range, 10-443 cycles) to failure. The 4.0-mm screws had a mean of 135 cycles (SD, ±141 cycles; range, 0-284 cycles) to failure. There was no statistically significant difference between the 2 types of screws for cycles required to cause failure (P = .144). Conclusion: There was no statistically significant difference in energy or cycles to failure when comparing the stainless steel cortical screws versus partially threaded cannulated cancellous screws. Clinical Relevance: Latarjet may be performed using cortical or cancellous screws without a clear advantage of either option. PMID:27158630

  3. Carbon dioxide concentration dictates alternative methanogenic pathways in oil reservoirs.

    PubMed

    Mayumi, Daisuke; Dolfing, Jan; Sakata, Susumu; Maeda, Haruo; Miyagawa, Yoshihiro; Ikarashi, Masayuki; Tamaki, Hideyuki; Takeuchi, Mio; Nakatsu, Cindy H; Kamagata, Yoichi

    2013-01-01

    Deep subsurface formations (for example, high-temperature oil reservoirs) are candidate sites for carbon capture and storage technology. However, very little is known about how the subsurface microbial community would respond to an increase in CO2 pressure resulting from carbon capture and storage. Here we construct microcosms mimicking reservoir conditions (55 °C, 5 MPa) using high-temperature oil reservoir samples. Methanogenesis occurs under both high and low CO2 conditions in the microcosms. However, the increase in CO2 pressure accelerates the rate of methanogenesis to more than twice than that under low CO2 conditions. Isotope tracer and molecular analyses show that high CO2 conditions invoke acetoclastic methanogenesis in place of syntrophic acetate oxidation coupled with hydrogenotrophic methanogenesis that typically occurs in this environment (low CO2 conditions). Our results present a possibility of carbon capture and storage for enhanced microbial energy production in deep subsurface environments that can mitigate global warming and energy depletion. PMID:23759740

  4. High-Gravity Carbonation Process for Enhancing CO2 Fixation and Utilization Exemplified by the Steelmaking Industry.

    PubMed

    Pan, Shu-Yuan; Chen, Yi-Hung; Chen, Chun-Da; Shen, Ai-Lin; Lin, Michael; Chiang, Pen-Chi

    2015-10-20

    The high-gravity carbonation process for CO2 mineralization and product utilization as a green cement was evaluated using field operation data from the steelmaking industry. The effect of key operating factors, including rotation speed, liquid-to-solid ratio, gas flow rate, and slurry flow rate, on CO2 removal efficiency was studied. The results indicated that a maximal CO2 removal of 97.3% was achieved using basic oxygen furnace slag at a gas-to-slurry ratio of 40, with a capture capacity of 165 kg of CO2 per day. In addition, the product with different carbonation conversions (i.e., 0%, 17%, and 48%) was used as supplementary cementitious materials in blended cement at various substitution ratios (i.e., 0%, 10%, and 20%). The performance of the blended cement mortar, including physicochemical properties, morphology, mineralogy, compressive strength, and autoclave soundness, was evaluated. The results indicated that the mortar with a high carbonation conversion of slag exhibited a higher mechanical strength in the early stage than pure portland cement mortar, suggesting its suitability for use as a high early strength cement. It also possessed superior soundness compared to the mortar using fresh slag. Furthermore, the optimal operating conditions of the high-gravity carbonation were determined by response surface models for maximizing CO2 removal efficiency and minimizing energy consumption. PMID:26397167

  5. Catalytic wet air oxidation of phenol with functionalized carbon materials as catalysts: reaction mechanism and pathway.

    PubMed

    Wang, Jianbing; Fu, Wantao; He, Xuwen; Yang, Shaoxia; Zhu, Wanpeng

    2014-08-01

    The development of highly active carbon material catalysts in catalytic wet air oxidation (CWAO) has attracted a great deal of attention. In this study different carbon material catalysts (multi-walled carbon nanotubes, carbon fibers and graphite) were developed to enhance the CWAO of phenol in aqueous solution. The functionalized carbon materials exhibited excellent catalytic activity in the CWAO of phenol. After 60 min reaction, the removal of phenol was nearly 100% over the functionalized multi-walled carbon, while it was only 14% over the purified multi-walled carbon under the same reaction conditions. Carboxylic acid groups introduced on the surface of the functionalized carbon materials play an important role in the catalytic activity in CWAO. They can promote the production of free radicals, which act as strong oxidants in CWAO. Based on the analysis of the intermediates produced in the CWAO reactions, a new reaction pathway for the CWAO of phenol was proposed in this study. There are some differences between the proposed reaction pathway and that reported in the literature. First, maleic acid is transformed directly into malonic acid. Second, acetic acid is oxidized into an unknown intermediate, which is then oxidized into CO2 and H2O. Finally, formic acid and oxalic acid can mutually interconvert when conditions are favorable. PMID:25108731

  6. Pathways and Bioenergetics of Anaerobic Carbon Monoxide Fermentation

    PubMed Central

    Diender, Martijn; Stams, Alfons J. M.; Sousa, Diana Z.

    2015-01-01

    Carbon monoxide can act as a substrate for different modes of fermentative anaerobic metabolism. The trait of utilizing CO is spread among a diverse group of microorganisms, including members of bacteria as well as archaea. Over the last decade this metabolism has gained interest due to the potential of converting CO-rich gas, such as synthesis gas, into bio-based products. Three main types of fermentative CO metabolism can be distinguished: hydrogenogenesis, methanogenesis, and acetogenesis, generating hydrogen, methane and acetate, respectively. Here, we review the current knowledge on these three variants of microbial CO metabolism with an emphasis on the potential enzymatic routes and bio-energetics involved. PMID:26635746

  7. Non-riverine pathways of terrigenous carbon to the ocean

    NASA Astrophysics Data System (ADS)

    Dittmar, T.

    2007-12-01

    The extent and nature of non-riverine fluxes of carbon from land to ocean are poorly understood. Tidal pumping from highly productive coastal environments, atmospheric deposition and submarine groundwater discharge can be significant transport mechanisms for carbon to the ocean. Evidence is mounting that tidally-induced porewater fluxes ("outwelling") of dissolved organic matter (DOM) from mangroves and salt marshes alone may be similar in magnitude as the global riverine flux of DOM. Tidal pumping of dissolved inorganic carbon (DIC) might exceed organic carbon fluxes by far, but the existing knowledge on DIC outwelling is too scarce for a first global estimate. Results from two case studies on the biogeochemistry of DOM outwelling are presented, from the mangroves in Northern Brazil and the salt marshes in the Northern Gulf of Mexico. Ongoing research in the Northern Gulf of Mexico indicates that outwelling and groundwater inputs probably exceed riverine DOM fluxes in this region. Similar observations were made in Northern Brazil. There, the fate of mangrove-derived DOM could be traced from its source in the mangrove sediments to the outer North Brazil shelf by using a combination of isotopic and molecular approaches. Reversed-phase liquid chromatography / mass spectrometry (LC/MS) provided a multifaceted array of information that mirrors the molecular complexity of DOM. Statistical analyses on these data revealed significant differences between mangrove and open-ocean DOM which successively disappeared by irradiating the samples with natural sunlight. Nuclear magnetic resonance analyses yielded concurrent results. Ultrahigh-resolution Fourier transform-ion cyclotron resonance mass spectrometry (FT-ICR MS) is the only technique capable of resolving and identifying individual elemental compositions in these complex mixtures. We applied this technique for characterizing mangrove-derived DOM and to assess the molecular changes that occur in the initial stages of outwelling. The different approaches concordantly show the presence of photodegraded mangrove DOM on the North Brazil shelf. During transport offshore, sunlight efficiently destroyed aromatic molecules, removing about one third of mangrove-derived DOM. The remainder was refractory and may thus be distributed over the oceans.

  8. Biological carbon fixation: A study of Isochrysis sp. growth under actual coal-fired power plant's flue gas

    NASA Astrophysics Data System (ADS)

    >Liyana Yahya, Muhammad Nazry Chik, Mohd Asyraf Mohd Azmir Pang,

    2013-06-01

    Preliminary study on the growth of marine microalgae Isochrysis sp. was carried out using actual flue gas from a coal-fired power station. The species was cultured using a 2×10-L customized bubble column photobioreactor skid under specified culture conditions. With an initial culture density of 0.459 Abs (optical density at 560 nm wavelength), the species was found able to survive - observed by increases in optical densities, number of cells and weights - in the presence of actual coal-fired flue gas containing on average 4.08 % O2, 200.21 mg/m3 SO2, 212.29 mg/m3 NOx, 4.73 % CO2 and 50.72 mg/m3 CO. Results thus add value to the potential and capability of microalgae, especially for Isochrysis sp., to be the biological carbon fixer in neutralizing carbon emissions from power plants.

  9. Diversity of freshwater Epsilonproteobacteria and dark inorganic carbon fixation in the sulphidic redoxcline of a meromictic karstic lake.

    PubMed

    Noguerola, Imma; Picazo, Antonio; Llirós, Marc; Camacho, Antonio; Borrego, Carles M

    2015-07-01

    Sulfidic redoxclines are a suitable niche for the growth and activity of different chemo- and photolithotrophic sulphide-oxidizing microbial groups such as the Epsilonproteobacteria and the green sulfur bacteria (GSB). We have investigated the diversity, abundance and contribution to inorganic carbon uptake of Epsilonproteobacteria in a meromictic basin of Lake Banyoles. CARD-FISH counts revealed that Epsilonproteobacteria were prevalent at the redoxcline in winter (maximum abundance of 2 × 10(6) cells mL(-1), ≈60% of total cells) but they were nearly absent in summer, when GSB bloomed. This seasonal trend was supported by 16S rRNA gene pyrotag datasets, which revealed that the epsilonproteobacterial community was mainly composed of a member of the genus Arcobacter. In situ incubations using NaH(14)CO3 and MAR-CARD-FISH observations showed that this population assimilated CO2 in the dark, likely being mainly responsible for the autotrophic activity at the redoxcline in winter. Clone libraries targeting the aclB gene provided additional evidence of the potential capacity of these epsilonproteobacteria to fix carbon via rTCA cycle. Our data reinforce the key role of Epsilonproteobacteria in linking carbon and sulphur cycles, extend their influence to freshwater karstic lakes and raise questions about the actual contribution of chemolithotrophy at their redoxcline and euxinic water compartments. PMID:26195601

  10. NifA- and CooA-coordinated cowN expression sustains nitrogen fixation by Rhodobacter capsulatus in the presence of carbon monoxide.

    PubMed

    Hoffmann, Marie-Christine; Pfänder, Yvonne; Fehringer, Maria; Narberhaus, Franz; Masepohl, Bernd

    2014-10-01

    Rhodobacter capsulatus fixes atmospheric dinitrogen via two nitrogenases, Mo- and Fe-nitrogenase, which operate under different conditions. Here, we describe the functions in nitrogen fixation and regulation of the rcc00574 (cooA) and rcc00575 (cowN) genes, which are located upstream of the structural genes of Mo-nitrogenase, nifHDK. Disruption of cooA or cowN specifically impaired Mo-nitrogenase-dependent growth at carbon monoxide (CO) concentrations still tolerated by the wild type. The cooA gene was shown to belong to the Mo-nitrogenase regulon, which is exclusively expressed when ammonium is limiting. Its expression was activated by NifA1 and NifA2, the transcriptional activators of nifHDK. AnfA, the transcriptional activator of Fe-nitrogenase genes, repressed cooA, thereby counteracting NifA activation. CooA activated cowN expression in response to increasing CO concentrations. Base substitutions in the presumed CooA binding site located upstream of the cowN transcription start site abolished cowN expression, indicating that cowN regulation by CooA is direct. In conclusion, a transcription factor-based network controls cowN expression to protect Mo-nitrogenase (but not Fe-nitrogenase) under appropriate conditions. PMID:25070737

  11. Toxicity of polychlorinated biphenyls (PCBs) to Euglena gracilis: cell population growth, carbon fixation, chlorophyll level, oxygen consumption, and protein and nucleic acid synthesis.

    PubMed

    Ewald, W G; French, J E; Champ, M A

    1976-07-01

    Populations of Euglena gracilis in exponential growth under light were exposed to 2.5, 5.0, 7.5, and 10 ppm of Aroclor 1221. The ID50/48 of Aroclor 1221 was estimated to be 4.4 ppm, while Aroclor 1232 tested at 20, 35, 50, and 100 ppm resulted in an id50/48 of 55 ppm. With Aroclor 1242, no inhibition of growth was observed with up to 100 ppm exposure. Cell cultures exposed to 4.4 ppm of Aroclor 1221 for 48 hrs had a significantly reduced rate of carbon fixation and reduced levels of chlorophyll after correction for cell density. Oxygen consumption was not affected at the ID50 level of the Aroclor. Uptake of [3H]-leucine in treated cultures was twice that of controls, and [3H]-uridine uptake was significantly lower. Uptake of [3H]-thymidine, and incorporation of [3H]-leucine, [3H]-thymidine, and [3H]-uridine were not significantly different in treated and control cultures. Thes results suggest that at the ID50 level, polychlorinated biphenyls (PCBs) reduce cell population growth in Euglena gracilis by inhibition of photosynthesis and/or chlorophyll production. PMID:822906

  12. NifA- and CooA-Coordinated cowN Expression Sustains Nitrogen Fixation by Rhodobacter capsulatus in the Presence of Carbon Monoxide

    PubMed Central

    Hoffmann, Marie-Christine; Pfänder, Yvonne; Fehringer, Maria; Narberhaus, Franz

    2014-01-01

    Rhodobacter capsulatus fixes atmospheric dinitrogen via two nitrogenases, Mo- and Fe-nitrogenase, which operate under different conditions. Here, we describe the functions in nitrogen fixation and regulation of the rcc00574 (cooA) and rcc00575 (cowN) genes, which are located upstream of the structural genes of Mo-nitrogenase, nifHDK. Disruption of cooA or cowN specifically impaired Mo-nitrogenase-dependent growth at carbon monoxide (CO) concentrations still tolerated by the wild type. The cooA gene was shown to belong to the Mo-nitrogenase regulon, which is exclusively expressed when ammonium is limiting. Its expression was activated by NifA1 and NifA2, the transcriptional activators of nifHDK. AnfA, the transcriptional activator of Fe-nitrogenase genes, repressed cooA, thereby counteracting NifA activation. CooA activated cowN expression in response to increasing CO concentrations. Base substitutions in the presumed CooA binding site located upstream of the cowN transcription start site abolished cowN expression, indicating that cowN regulation by CooA is direct. In conclusion, a transcription factor-based network controls cowN expression to protect Mo-nitrogenase (but not Fe-nitrogenase) under appropriate conditions. PMID:25070737

  13. Chemical mechanism of the high solubility pathway for the carbon dioxide free production of iron.

    PubMed

    Licht, Stuart; Wu, Hongjun; Zhang, Zhonghai; Ayub, Hina

    2011-03-21

    We determine the fundamental iron oxide high solubility mechanism that drives a new electrolytic pathway to iron production, and eliminates a major CO(2) emission source, for example it is produced using wind and solar energy, in a molten carbonate electrolyte, at a high rate and a low electrolysis energy. PMID:21301745

  14. Phytoplankton carbon fixation gene (RuBisCO) transcripts and air-sea CO(2) flux in the Mississippi River plume.

    PubMed

    John, David E; Wang, Zhaohui A; Liu, Xuewu; Byrne, Robert H; Corredor, Jorge E; López, José M; Cabrera, Alvaro; Bronk, Deborah A; Tabita, F Robert; Paul, John H

    2007-10-01

    River plumes deliver large quantities of nutrients to oligotrophic oceans, often resulting in significant CO(2) drawdown. To determine the relationship between expression of the major gene in carbon fixation (large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, RuBisCO) and CO(2) dynamics, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO(2) in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30-32) stations were dominated by rbcL mRNA concentrations from heterokonts, such as diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, alpha-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34-36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO(2). While Prochlorococcus cells did not exhibit a large difference between low and high pCO(2) water, Prochlorococcus rbcL RNA concentrations had a strong positive correlation to pCO(2), suggesting a very low level of RuBisCO RNA transcription among Prochlorococcus in the plume waters, possibly due to their relatively poor carbon concentrating mechanisms (CCMs). These results provide molecular evidence that diatom/pelagophyte productivity is largely responsible for the large CO(2) drawdown occurring in the MRP, based on the co-occurrence of elevated RuBisCO gene transcript concentrations from this group and reduced seawater pCO(2) levels. This may partly be due to efficient CCMs that enable heterokont eukaryotes such as diatoms to continue fixing CO(2) in the face of strong CO(2) drawdown. Our work represents the first attempt to relate in situ microbial gene expression to contemporaneous CO(2) flux measurements in the ocean. PMID:18043653

  15. Soil temperature and water content drive microbial carbon fixation in grassland of permafrost area on the Tibetan plateau

    NASA Astrophysics Data System (ADS)

    Kong, W.; Guo, G.; Liu, J.

    2014-12-01

    Soil microbial communities underpin terrestrial biogeochemical cycles and are greatly influenced by global warming and global-warming-induced dryness. However, the response of soil microbial community function to global change remains largely uncertain, particularly in the ecologically vulnerable Tibetan plateau permafrost area with large carbon storage. With the concept of space for time substitution, we investigated the responses of soil CO2-fixing microbial community and its enzyme activity to climate change along an elevation gradient (4400-5100 m) of alpine grassland on the central Tibetan plateau. The elevation gradient in a south-facing hill slope leads to variation in climate and soil physicochemical parameters. The autotrophic microbial communities were characterized by quantitative PCR (qPCR), terminal restriction fragment length polymorphism analysis (T-RFLP) and cloning/sequencing targeting the CO2-fixing gene (RubisCO). The results demonstrated that the autotrophic microbial community abundance, structure and its enzyme activity were mainly driven by soil temperature and water content. Soil temperature increase and water decrease dramatically reduced the abundance of the outnumbered form IC RubisCO-containing microbes, and significantly changed the structure of form IC, IAB and ID RubisCO-containing microbial community. Structural equation model revealed that the RubisCO enzyme was directly derived from RubisCO-containing microbes and its activity was significantly reduced by soil temperature increase and water content decrease. Thus our results provide a novel positive feedback loop of climate warming and warming-induced dryness by that soil microbial carbon fixing potential will reduce by 3.77%-8.86% with the soil temperature increase of 1.94oC and water content decrease of 60%-70%. This positive feedback could be capable of amplifying the climate change given the significant contribution of soil microbial CO2-fixing up to 4.9% of total soil organic carbon.

  16. Carbon dioxide fixation by an unprecedented hydroxo lead-chromium carbonyl complex: synthesis, reactivity, and theoretical calculations.

    PubMed

    Hsu, Miao-Hsing; Chen, Rung-Tsang; Sheu, Wen-Shyan; Shieh, Minghuey

    2006-08-21

    The novel hydroxo-bridged dimeric lead-chromium carbonyl complex [Et4N]2[{PbCr2(CO)10}2(mu-OH)2] ([Et4N]2[1]) was synthesized from the reaction of PbCl2 and Cr(CO)6 followed by metathesis with [Et4N]Br in a KOH/MeOH solution. The X-ray crystallographic structure shows that dianion 1 consists of two Pb{Cr(CO)5}2 units bridged by two hydroxo fragments in which the Pb atoms are further coordinated with two Cr(CO)5 groups, resulting in a distorted tetrahedral geometry. A CO2 molecule can insert itself into dianion 1 to form two new carbonate complexes, [Et(4)N]2[{PbCr2(CO)10}(CO3)] ([Et4N]2[2]) and [Et4N]2[{PbCr2(CO)10}2(CO3)] ([Et4N]2[3]), depending on the reaction conditions. In addition, complex 2 can be transformed into 3 in CH2Cl2 solution at an elevated temperature. While the carbonate group in dianion 2 is bonded to one Pb atom, which is coordinated with two Cr(CO)5 fragments, the carbonate group in 3 bridges the two Pb centers in a mu-1kappa2OO':2kappa2OO' fashion in which each Pb atom is further bonded to two Cr(CO)5 moieties. Complexes 2 and 3 can be converted back the hydroxo complex 1 under appropriate conditions. All three unprecedented lead-chromium compounds, 1-3, were fully characterized by spectroscopic methods and single-crystal X-ray diffraction analyses. The nature and formation of complexes 1-3 were also examined by molecular orbital calculations using the B3LYP method of the density functional theory. PMID:16903730

  17. Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor

    SciTech Connect

    Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A; Beste, Ariana; Naskar, Amit K

    2013-01-01

    Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. We observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.

  18. Influences of N sub 2 fixation on partitioning of fixed carbon between carbohydrate and protein in soybean leaves

    SciTech Connect

    de Veau, E.J.; Robinson, J.M.; Warmbrodt, R.D. )

    1990-05-01

    The partitioning of fixed carbon between leaf non-structural carbohydrate (sucrose and starch) and soluble protein was examined in soybeans grown under three different nitrogen (N) availability growth regimes. One group (Nod{sup +}/+) was inoculated with Bradyrhizobium and watered daily with a nutrient solution containing 6 mM NH{sub 4}NO{sub 3} and was considered to have the highest N availability. A third group (Nod{sup {minus}}) was not infected with Bradyrhizobium but was watered daily with a nutrient solution containing 6 mM NH{sub 4}NO{sub 3}, and had the intermediate N availability. Nod{sup +}/{minus} had the highest foliar carbohydrate and the lowest protein contents of the three groups of plants. The other two plants had high foliar protein content and lower foliar carbohydrate content. This inverse relationship between foliar protein and carbohydrate content suggests that when N availability is high more fixed carbon is diverted to the synthesis of protein. It was also found that Nod{sup +}/{minus}, which had the lowest amount of foliar protein, sequestered more storage protein in their paraveinal mesophyll than the other groups. This might be a mechanism by which Nod{sup +}/{minus} conserves an adequate amount of foliar protein to support pod filling.

  19. Pathways of Carbon Assimilation and Ammonia Oxidation Suggested by Environmental Genomic Analyses of Marine Crenarchaeota

    PubMed Central

    Hallam, Steven J; Mincer, Tracy J; Schleper, Christa; Preston, Christina M; Roberts, Katie; Richardson, Paul M

    2006-01-01

    Marine Crenarchaeota represent an abundant component of oceanic microbiota with potential to significantly influence biogeochemical cycling in marine ecosystems. Prior studies using specific archaeal lipid biomarkers and isotopic analyses indicated that planktonic Crenarchaeota have the capacity for autotrophic growth, and more recent cultivation studies support an ammonia-based chemolithoautotrophic energy metabolism. We report here analysis of fosmid sequences derived from the uncultivated marine crenarchaeote, Cenarchaeum symbiosum, focused on the reconstruction of carbon and energy metabolism. Genes predicted to encode multiple components of a modified 3-hydroxypropionate cycle of autotrophic carbon assimilation were identified, consistent with utilization of carbon dioxide as a carbon source. Additionally, genes predicted to encode a near complete oxidative tricarboxylic acid cycle were also identified, consistent with the consumption of organic carbon and in the production of intermediates for amino acid and cofactor biosynthesis. Therefore, C. symbiosum has the potential to function either as a strict autotroph, or as a mixotroph utilizing both carbon dioxide and organic material as carbon sources. From the standpoint of energy metabolism, genes predicted to encode ammonia monooxygenase subunits, ammonia permease, urease, and urea transporters were identified, consistent with the use of reduced nitrogen compounds as energy sources fueling autotrophic metabolism. Homologues of these genes, recovered from ocean waters worldwide, demonstrate the conservation and ubiquity of crenarchaeal pathways for carbon assimilation and ammonia oxidation. These findings further substantiate the likely global metabolic importance of Crenarchaeota with respect to key steps in the biogeochemical transformation of carbon and nitrogen in marine ecosystems. PMID:16533068

  20. Incomplete Wood-Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi.

    PubMed

    Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L; Feng, Xueyang; Men, Yujie; Conrad, Mark E; Tang, Yinjie J; Alvarez-Cohen, Lisa

    2014-04-29

    The acetyl-CoA "Wood-Ljungdahl" pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood-Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood-Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

  1. Incomplete Wood–Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi

    PubMed Central

    Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L.; Feng, Xueyang; Men, Yujie; Conrad, Mark E.; Tang, Yinjie J.; Alvarez-Cohen, Lisa

    2014-01-01

    The acetyl-CoA “Wood–Ljungdahl” pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood–Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood–Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

  2. Fixation strength of taper connection at head-neck junction in retrieved carbon fiber-reinforced PEEK hip stems.

    PubMed

    Nakahara, Ichiro; Takao, Masaki; Bandoh, Shunichi; Sugano, Nobuhiko

    2014-12-01

    Carbon fiber-reinforced polyetheretherketone (CFR-PEEK) hip prostheses possess numerous advantages over metal prostheses; however, the security of the taper connection between the CFR-PEEK stem and the modular femoral head in vivo has not been verified. Therefore, we mechanically examined the taper connection of retrieved in vivo loaded CFR-PEEK stems in comparison with in vivo loaded titanium alloy stems. CFR-PEEK and titanium alloy femoral stems with a 12/14 taper trunnion were implanted in ovine hips. A 22-mm ceramic head was intraoperatively impacted to the stem. Retrieved specimens were obtained following weight-bearing conditions for up to 39 postoperative weeks and taper junction pull-off tests were conducted. Postoperative retrieved CFR-PEEK stem pull-off strength was significantly greater than that at time zero. Postoperative retrieved CFR-PEEK stem pull-off strength was also significantly higher than that of postoperative retrieved titanium alloy stem. Microscopic findings of the taper surface revealed no obvious damage in the retrieved CFR-PEEK stems, whereas fretting and corrosion were observed in the retrieved titanium alloy stems. The present findings suggest that the taper connection between the ceramic head and the 12/14 CFR-PEEK stem trunnion is more secure than that between the ceramic head and the titanium alloy trunnion. PMID:25190272

  3. Integrated carbon dioxide/sludge gasification using waste heat from hot slags: syngas production and sulfur dioxide fixation.

    PubMed

    Sun, Yongqi; Zhang, Zuotai; Liu, Lili; Wang, Xidong

    2015-04-01

    The integrated CO2/sludge gasification using the waste heat in hot slags, was explored with the aim of syngas production, waste heat recovery and sewage sludge disposal. The results demonstrated that hot slags presented multiple roles on sludge gasification, i.e., not only a good heat carrier (500-950 °C) but also an effective desulfurizer (800-900 °C). The total gas yields increased from 0.022 kg/kgsludge at 500 °C to 0.422 kg/kgsludge at 900 °C; meanwhile, the SO2 concentration at 900 °C remarkably reduced from 164 ppm to 114 ppm by blast furnace slags (BFS) and 93 ppm by steel slags (SS), respectively. A three-stage reaction was clarified including volatile release, char transformation and fixed carbon using Gaussian fittings and the kinetic model was analyzed. Accordingly, a decline process using the integrated method was designed and the optimum slag/sludge ratio was deduced. These deciphered results appealed potential ways of reasonable disposal of sewage sludge and efficient recovery of waste heat from hot slags. PMID:25647028

  4. Dinitrogen fixation in aphotic oxygenated marine environments

    PubMed Central

    Rahav, Eyal; Bar-Zeev, Edo; Ohayon, Sarah; Elifantz, Hila; Belkin, Natalia; Herut, Barak; Mulholland, Margaret R.; Berman-Frank, Ilana

    2013-01-01

    We measured N2 fixation rates from oceanic zones that have traditionally been ignored as sources of biological N2 fixation; the aphotic, fully oxygenated, nitrate (NO−3)-rich, waters of the oligotrophic Levantine Basin (LB) and the Gulf of Aqaba (GA). N2 fixation rates measured from pelagic aphotic waters to depths up to 720 m, during the mixed and stratified periods, ranged from 0.01 nmol N L−1 d−1 to 0.38 nmol N L−1 d−1. N2 fixation rates correlated significantly with bacterial productivity and heterotrophic diazotrophs were identified from aphotic as well as photic depths. Dissolved free amino acid amendments to whole water from the GA enhanced bacterial productivity by 2–3.5 fold and N2 fixation rates by ~2-fold in samples collected from aphotic depths while in amendments to water from photic depths bacterial productivity increased 2–6 fold while N2 fixation rates increased by a factor of 2 to 4 illustrating that both BP and heterotrophic N2 fixation were carbon limited. Experimental manipulations of aphotic waters from the LB demonstrated a significant positive correlation between transparent exopolymeric particle (TEP) concentrations and N2 fixation rates. This suggests that sinking organic material and high carbon (C): nitrogen (N) micro-environments (such as TEP-based aggregates or marine snow) could support high heterotrophic N2 fixation rates in oxygenated surface waters and in the aphotic zones. Indeed, our calculations show that aphotic N2 fixation accounted for 37 to 75% of the total daily integrated N2 fixation rates at both locations in the Mediterranean and Red Seas with rates equal or greater to those measured from the photic layers. Moreover, our results indicate that that while N2 fixation may be limited in the surface waters, aphotic, pelagic N2 fixation may contribute significantly to new N inputs in other oligotrophic basins, yet it is currently not included in regional or global N budgets. PMID:23986748

  5. Lung macrophages "digest" carbon nanotubes using a superoxide/peroxynitrite oxidative pathway.

    PubMed

    Kagan, Valerian E; Kapralov, Alexandr A; St Croix, Claudette M; Watkins, Simon C; Kisin, Elena R; Kotchey, Gregg P; Balasubramanian, Krishnakumar; Vlasova, Irina I; Yu, Jaesok; Kim, Kang; Seo, Wanji; Mallampalli, Rama K; Star, Alexander; Shvedova, Anna A

    2014-06-24

    In contrast to short-lived neutrophils, macrophages display persistent presence in the lung of animals after pulmonary exposure to carbon nanotubes. While effective in the clearance of bacterial pathogens and injured host cells, the ability of macrophages to "digest" carbonaceous nanoparticles has not been documented. Here, we used chemical, biochemical, and cell and animal models and demonstrated oxidative biodegradation of oxidatively functionalized single-walled carbon nanotubes via superoxide/NO* → peroxynitrite-driven oxidative pathways of activated macrophages facilitating clearance of nanoparticles from the lung. PMID:24871084

  6. Carbon isotope fractionation by sulfate-reducing bacteria using different pathways for the oxidation of acetate.

    PubMed

    Goevert, Dennis; Conrad, Ralf

    2008-11-01

    Acetate is a key intermediate in the anaerobic degradation of organic matter. In anoxic environments, available acetate is a competitive substrate for sulfate-reducing bacteria (SRB) and methane-producing archaea. Little is known about the fractionation of carbon isotopes by sulfate reducers. Therefore, we determined carbon isotope compositions in cultures of three acetate-utilizing SRB, Desulfobacter postgatei, Desulfobacter hydrogenophilus, and Desulfobacca acetoxidans. We found that these species showed strong differences in their isotope enrichment factors (epsilon) of acetate. During the consumption of acetate and sulfate, acetate was enriched in 13C by 19.3% per hundred in Desulfobacca acetoxidans. By contrast, both D. postgatei and D. hydrogenophilus showed a slight depletion of 13C resulting in epsilon(ac)-values of 1.8 and 1.5% per hundred, respectively. We suggest that the different isotope fractionation is due to the different metabolic pathways for acetate oxidation. The strongly fractionating Desulfobacca acetoxidans uses the acetyl-CoA/carbon monoxide dehydrogenase pathway, which is also used by acetoclastic methanogens that show a similar fractionation of acetate (epsilon(ac) = -21 to -27% per hundred). In contrast, Desulfobacter spp. oxidize acetate to CO2 via the tricarboxylic acid (TCA) cycle and apparently did not discriminate against 13C. Our results suggestthat carbon isotope fractionation in environments with sulfate reduction will strongly depend on the composition of the sulfate-reducing bacterial community oxidizing acetate. PMID:19031865

  7. Carbon Metabolic Pathways in Phototrophic Bacteria and Their Broader Evolutionary Implications

    PubMed Central

    Tang, Kuo-Hsiang; Tang, Yinjie J.; Blankenship, Robert Eugene

    2011-01-01

    Photosynthesis is the biological process that converts solar energy to biomass, bio-products, and biofuel. It is the only major natural solar energy storage mechanism on Earth. To satisfy the increased demand for sustainable energy sources and identify the mechanism of photosynthetic carbon assimilation, which is one of the bottlenecks in photosynthesis, it is essential to understand the process of solar energy storage and associated carbon metabolism in photosynthetic organisms. Researchers have employed physiological studies, microbiological chemistry, enzyme assays, genome sequencing, transcriptomics, and 13C-based metabolomics/fluxomics to investigate central carbon metabolism and enzymes that operate in phototrophs. In this report, we review diverse CO2 assimilation pathways, acetate assimilation, carbohydrate catabolism, the tricarboxylic acid cycle and some key, and/or unconventional enzymes in central carbon metabolism of phototrophic microorganisms. We also discuss the reducing equivalent flow during photoautotrophic and photoheterotrophic growth, evolutionary links in the central carbon metabolic network, and correlations between photosynthetic and non-photosynthetic organisms. Considering the metabolic versatility in these fascinating and diverse photosynthetic bacteria, many essential questions in their central carbon metabolism still remain to be addressed. PMID:21866228

  8. Methanotrophy Induces Nitrogen Fixation in Boreal Mosses

    NASA Astrophysics Data System (ADS)

    Tiirola, M. A.

    2014-12-01

    Many methanotrophic bacterial groups fix nitrogen in laboratory conditions. Furthermore, nitrogen (N) is a limiting nutrient in many environments where methane concentrations are highest. Despite these facts, methane-induced N fixation has previously been overlooked, possibly due to methodological problems. To study the possible link between methanotrophy and diazotrophy in terrestrial and aquatic habitats, we measured the co-occurrence of these two processes in boreal forest, peatland and stream mosses using a stable isotope labeling approach (15 N2 and 13 CH4 double labeling) and sequencing of the nifH gene marker. N fixation associated with forest mosses was dependent on the annual N deposition, whereas methane stimulate N fixation neither in high (>3 kg N ha -1 yr -1) nor low deposition areas, which was in accordance with the nifH gene sequencing showing that forest mosses (Pleurozium schreberi and Hylocomium splendens ) carried mainly cyanobacterial N fixers. On the other extreme, in stream mosses (Fontinalis sp.) methane was actively oxidized throughout the year, whereas N fixation showed seasonal fluctuation. The co-occurrence of the two processes in single cell level was proven by co-localizing both N and methane-carbon fixation with the secondary ion mass spectrometry (SIMS) approach. Methanotrophy and diazotrophy was also studied in peatlands of different primary successional stages in the land-uplift coast of Bothnian Bay, in the Siikajoki chronosequence, where N accumulation rates in peat profiles indicate significant N fixation. Based on experimental evidence it was counted that methane-induced N fixation explained over one-third of the new N input in the younger peatland successional stages, where the highest N fixation rates and highest methane oxidation activities co-occurred in the water-submerged Sphagnum moss vegetation. The linkage between methanotrophic carbon cycling and N fixation may therefore constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. It is still an open issue whether methanotrophy induces N fixation directly or by enhancing phototrophic or heterotrophic N fixation.

  9. Fixation: A Bibliography.

    ERIC Educational Resources Information Center

    Pedrini, D. T.; Pedrini, Bonnie C.

    Fixation and regression were considered complementary by Freud. You tend to regress to a point of fixation. They are both opposed to progression. In the general area, Anna Freud has written (The Ego and the Mechanisms of Defence. London: Hogarth and the Psycho-Analytic Institute, 1937), Sears has evaluated (Survey of Objective Studies of…

  10. Controlling Central Carbon Metabolism for Improved Pathway Yields in Saccharomyces cerevisiae.

    PubMed

    Tan, Sue Zanne; Manchester, Shawn; Prather, Kristala L J

    2016-02-19

    Engineering control of metabolic pathways is important to improving product titers and yields. Traditional methods such as overexpressing pathway enzymes and deleting competing ones are restricted by the interdependence of metabolic reactions and the finite nature of cellular resources. Here, we developed a metabolite valve that controls glycolytic flux through central carbon metabolism in Saccharomyces cerevisiae. In a Hexokinase 2 and Glucokinase 1 deleted strain (hxk2?glk1?), glucose flux was diverted away from glycolysis and into a model pathway, gluconate, by controlling the transcription of Hexokinase 1 with the tetracycline transactivator protein (tTA). A maximum 10-fold decrease in hexokinase activity resulted in a 50-fold increase in gluconate yields, from 0.7% to 36% mol/mol of glucose. The reduction in glucose flux resulted in a significant decrease in ethanol byproduction that extended to semianaerobic conditions, as shown in the production of isobutanol. This proof-of-concept is one of the first demonstrations in S. cerevisiae of dynamic redirection of glucose from glycolysis and into a heterologous pathway. PMID:26544022

  11. Stable carbon isotope fractionations of the hyperthermophilic crenarchaeon Metallosphaera sedula.

    PubMed

    van der Meer, M T; Schouten, S; Rijpstra, W I; Fuchs, G; Sinninghe Damsté, J S

    2001-03-01

    The stable carbon isotopic compositions of the inorganic carbon source, bulk cell material, and isoprenoid lipids of the hyperthermophilic crenarchaeon Metallosphaera sedula, which uses a 3-hydroxypropionate-like pathway for autotrophic carbon fixation, have been measured. Bulk cell material was approximately 3 per thousand enriched in 13C relative to the dissolved inorganic carbon, and 2 per thousand depleted in 13C relative to isoprenoid membrane lipids. The isotope data suggested that M. sedula uses mainly bicarbonate rather than CO(2) as inorganic carbon source, which is in accordance with a 3-hydroxypropionate-like carbon fixation pathway. To the best of our knowledge this is the first report of 13C fractionation effects of such a hyperthermophilic crenarchaeon. PMID:11257550

  12. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.

    2015-04-01

    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic compounds is critical for understanding deep subsurface ecosystems and the origin of organic compounds on Mars and other planets.

  13. Cyanobacterial production of 1,3-propanediol directly from carbon dioxide using a synthetic metabolic pathway.

    PubMed

    Hirokawa, Yasutaka; Maki, Yuki; Tatsuke, Tsuneyuki; Hanai, Taizo

    2016-03-01

    Production of chemicals directly from carbon dioxide using light energy is an attractive option for a sustainable future. The 1,3-propanediol (1,3-PDO) production directly from carbon dioxide was achieved by engineered Synechococcus elongatus PCC 7942 with a synthetic metabolic pathway. Glycerol dehydratase catalyzing the conversion of glycerol to 3-hydroxypropionaldehyde in a coenzyme B12-dependent manner worked in S. elongatus PCC 7942 without addition of vitamin B12, suggesting that the intrinsic pseudovitamin B12 served as a substitute of coenzyme B12. The highest titers of 1,3-PDO (3.79±0.23mM; 288±17.7mg/L) and glycerol (12.62±1.55mM; 1.16±0.14g/L), precursor of 1,3-PDO, were reached after 14 days of culture under optimized conditions in this study. PMID:26769097

  14. First Comparative Analysis of the Community Structures and Carbon Metabolic Pathways of the Bacteria Associated with Alvinocaris longirostris in a Hydrothermal Vent of Okinawa Trough.

    PubMed

    Sun, Qing-Lei; Zeng, Zhi-Gang; Chen, Shuai; Sun, Li

    2016-01-01

    Alvinocaris longirostris is a species of shrimp existing in the hydrothermal fields of Okinawa Trough. To date the structure and function of the microbial community associated with A. longirostris are essentially unknown. In this study, by employment of the techniques of high through-put sequencing and clone library construction and analysis, we compared for the first time the community structures and metabolic profiles of microbes associated with the gill and gut of A. longirostris in a hydrothermal field of Okinawa Trough. Fourteen phyla were detected in the gill and gut communities, of which 11 phyla were shared by both tissues. Proteobacteria made up a substantial proportion in both tissues, while Firmicutes was abundant only in gut. Although gill and gut communities were similar in bacterial diversities, the bacterial community structures in these two tissues were significantly different. Further, we discovered for the first time the existence in the gill and gut communities of A. longirostris the genes (cbbM and aclB) encoding the key enzymes of Calvin-Benson-Bassham (CBB) cycle and the reductive tricarboxylic acid (rTCA) cycle, and that both cbbM and aclB were significantly more abundant in gill than in gut. Taken together, these results provide the first evidence that at least two carbon fixation pathways are present in both the gill and the gut communities of A. longirostris, and that the communities in different tissues likely differ in autotrophic productivity. PMID:27111851

  15. First Comparative Analysis of the Community Structures and Carbon Metabolic Pathways of the Bacteria Associated with Alvinocaris longirostris in a Hydrothermal Vent of Okinawa Trough

    PubMed Central

    Sun, Qing-lei; Zeng, Zhi-gang; Chen, Shuai; Sun, Li

    2016-01-01

    Alvinocaris longirostris is a species of shrimp existing in the hydrothermal fields of Okinawa Trough. To date the structure and function of the microbial community associated with A. longirostris are essentially unknown. In this study, by employment of the techniques of high through-put sequencing and clone library construction and analysis, we compared for the first time the community structures and metabolic profiles of microbes associated with the gill and gut of A. longirostris in a hydrothermal field of Okinawa Trough. Fourteen phyla were detected in the gill and gut communities, of which 11 phyla were shared by both tissues. Proteobacteria made up a substantial proportion in both tissues, while Firmicutes was abundant only in gut. Although gill and gut communities were similar in bacterial diversities, the bacterial community structures in these two tissues were significantly different. Further, we discovered for the first time the existence in the gill and gut communities of A. longirostris the genes (cbbM and aclB) encoding the key enzymes of Calvin-Benson-Bassham (CBB) cycle and the reductive tricarboxylic acid (rTCA) cycle, and that both cbbM and aclB were significantly more abundant in gill than in gut. Taken together, these results provide the first evidence that at least two carbon fixation pathways are present in both the gill and the gut communities of A. longirostris, and that the communities in different tissues likely differ in autotrophic productivity. PMID:27111851

  16. Method for isolation of auxotrophs in the methanogenic archaebacteria: role of the acetyl-CoA pathway of autotrophic CO2 fixation in Methanococcus maripaludis.

    PubMed Central

    Ladapo, J; Whitman, W B

    1990-01-01

    A procedure was developed for the enrichment of auxotrophs in the antibiotic-insensitive archaebacterium Methanococcus. After mutagenesis with ethyl methanesulfonate, growing cells were selectively killed upon exposure to the base analogs 6-azauracil and 8-azahypoxanthine for 48 hr. Using this method, eight independent acetate autotrophs of Methanococcus maripaludis were isolated. Six of the auxotrophs had an absolute growth requirement for acetate and contained 1-16% of the wild-type levels of CO dehydrogenase. Three of these six also contained 14-29% of the wild-type levels of pyruvate oxidoreductase and 12-30% of the wild-type levels of pyruvate synthase. Two spontaneous revertants of these latter auxotrophs regained the ability to grow normally in the absence of acetate and wild-type levels of CO dehydrogenase, acetyl-CoA synthase, pyruvate oxidoreductase, and pyruvate synthase. Likewise, a spontaneous revertant of an auxotroph with reduced levels of CO dehydrogenase and wild-type levels of pyruvate oxidoreductase regained the ability to grow normally in the absence of acetate and wild-type levels of CO dehydrogenase and acetyl-CoA synthase. Two additional auxotrophs grew poorly in the absence of acetate but contained wild-type levels of CO dehydrogenase and pyruvate oxidoreductase. These results provide direct genetic evidence for the Ljungdahl-Wood pathway [Ljungdahl, L. G. (1986) Annu. Rev. Microbiol. 40, 415-450; Wood, H. G., Ragsdale, S. W. & Pezacka, E. (1986) Trends Biochem. Sci. 11, 14-18] of autotrophic acetyl-CoA biosynthesis in the methanogenic archaebacteria. Moreover, it suggests that the acetyl-CoA and pyruvate synthases may share a common protein or coenzyme component, be linked genetically, or be regulated by a common system. PMID:11607093

  17. Tight coupling of root-associated nitrogen fixation and plant photosynthesis in the salt marsh Spartina alterniflora and carbon dioxide enhancement of Nitrogenase activity

    SciTech Connect

    Whiting, G.J.; Gandy, E.L.; Yoch, D.C.

    1986-07-01

    The coupling of root-associated nitrogen fixation and plant photosynthesis was examined in the salt marsh grass Spartina alterniflora. In both field experiments and hydroponic assay chambers, nitrogen fixation associated with the roots was rapidly enhanced by stimulating plant photosynthesis. A kinetic analysis of acetylene reduction activity (ARA) showed that a five-to-sixfold stimulation occurred within 10 to 60 min after the plant leaves were exposed to light or increase CO/sub 2/ concentrations (with the light held constant). In field experiments, CO/sub 2/ enrichment increased plant-associated ARA by 27%. Further evidence of the dependence of ARA on plant photosynthate was obtained when activity in excised roots was shown to decrease after young greenhouse plants were placed in the dark. Seasonal variation in the ARA of excised plant roots from field cores appears to be related to the annual cycle of net photosynthesis in S. alterniflora.

  18. A Central Role for Carbon-Overflow Pathways in the Modulation of Bacterial Cell Death

    PubMed Central

    Thomas, Vinai Chittezham; Sadykov, Marat R.; Chaudhari, Sujata S.; Jones, Joselyn; Endres, Jennifer L.; Widhelm, Todd J.; Ahn, Jong-Sam; Jawa, Randeep S.; Zimmerman, Matthew C.; Bayles, Kenneth W.

    2014-01-01

    Similar to developmental programs in eukaryotes, the death of a subpopulation of cells is thought to benefit bacterial biofilm development. However mechanisms that mediate a tight control over cell death are not clearly understood at the population level. Here we reveal that CidR dependent pyruvate oxidase (CidC) and α-acetolactate synthase/decarboxylase (AlsSD) overflow metabolic pathways, which are active during staphylococcal biofilm development, modulate cell death to achieve optimal biofilm biomass. Whereas acetate derived from CidC activity potentiates cell death in cells by a mechanism dependent on intracellular acidification and respiratory inhibition, AlsSD activity effectively counters CidC action by diverting carbon flux towards neutral rather than acidic byproducts and consuming intracellular protons in the process. Furthermore, the physiological features that accompany metabolic activation of cell death bears remarkable similarities to hallmarks of eukaryotic programmed cell death, including the generation of reactive oxygen species and DNA damage. Finally, we demonstrate that the metabolic modulation of cell death not only affects biofilm development but also biofilm-dependent disease outcomes. Given the ubiquity of such carbon overflow pathways in diverse bacterial species, we propose that the metabolic control of cell death may be a fundamental feature of prokaryotic development. PMID:24945831

  19. Carbon black and titanium dioxide nanoparticles elicit distinct apoptotic pathways in bronchial epithelial cells

    PubMed Central

    2010-01-01

    Background Increasing environmental and occupational exposures to nanoparticles (NPs) warrant deeper insight into the toxicological mechanisms induced by these materials. The present study was designed to characterize the cell death induced by carbon black (CB) and titanium dioxide (TiO2) NPs in bronchial epithelial cells (16HBE14o- cell line and primary cells) and to investigate the implicated molecular pathways. Results Detailed time course studies revealed that both CB (13 nm) and TiO2(15 nm) NP exposed cells exhibit typical morphological (decreased cell size, membrane blebbing, peripheral chromatin condensation, apoptotic body formation) and biochemical (caspase activation and DNA fragmentation) features of apoptotic cell death. A decrease in mitochondrial membrane potential, activation of Bax and release of cytochrome c from mitochondria were only observed in case of CB NPs whereas lipid peroxidation, lysosomal membrane destabilization and cathepsin B release were observed during the apoptotic process induced by TiO2 NPs. Furthermore, ROS production was observed after exposure to CB and TiO2 but hydrogen peroxide (H2O2) production was only involved in apoptosis induction by CB NPs. Conclusions Both CB and TiO2 NPs induce apoptotic cell death in bronchial epithelial cells. CB NPs induce apoptosis by a ROS dependent mitochondrial pathway whereas TiO2 NPs induce cell death through lysosomal membrane destabilization and lipid peroxidation. Although the final outcome is similar (apoptosis), the molecular pathways activated by NPs differ depending upon the chemical nature of the NPs. PMID:20398356

  20. Methylamine Utilization via the N-Methylglutamate Pathway in Methylobacterium extorquens PA1 Involves a Novel Flow of Carbon through C1 Assimilation and Dissimilation Pathways

    PubMed Central

    Nayak, Dipti D.

    2014-01-01

    Methylotrophs grow on reduced single-carbon compounds like methylamine as the sole source of carbon and energy. In Methylobacterium extorquens AM1, the best-studied aerobic methylotroph, a periplasmic methylamine dehydrogenase that catalyzes the primary oxidation of methylamine to formaldehyde has been examined in great detail. However, recent metagenomic data from natural ecosystems are revealing the abundance and importance of lesser-known routes, such as the N-methylglutamate pathway, for methylamine oxidation. In this study, we used M. extorquens PA1, a strain that is closely related to M. extorquens AM1 but is lacking methylamine dehydrogenase, to dissect the genetics and physiology of the ecologically relevant N-methylglutamate pathway for methylamine oxidation. Phenotypic analyses of mutants with null mutations in genes encoding enzymes of the N-methylglutamate pathway suggested that γ-glutamylmethylamide synthetase is essential for growth on methylamine as a carbon source but not as a nitrogen source. Furthermore, analysis of M. extorquens PA1 mutants with defects in methylotrophy-specific dissimilatory and assimilatory modules suggested that methylamine use via the N-methylglutamate pathway requires the tetrahydromethanopterin (H4MPT)-dependent formaldehyde oxidation pathway but not a complete tetrahydrofolate (H4F)-dependent formate assimilation pathway. Additionally, we present genetic evidence that formaldehyde-activating enzyme (FAE) homologs might be involved in methylotrophy. Null mutants of FAE and homologs revealed that FAE and FAE2 influence the growth rate and FAE3 influences the yield during the growth of M. extorquens PA1 on methylamine. PMID:25225269

  1. Carbon and chlorine isotope analysis to identify abiotic degradation pathways of 1,1,1-trichloroethane.

    PubMed

    Palau, Jordi; Shouakar-Stash, Orfan; Hunkeler, Daniel

    2014-12-16

    This study investigates dual C-Cl isotope fractionation during 1,1,1-TCA transformation by heat-activated persulfate (PS), hydrolysis/dehydrohalogenation (HY/DH) and Fe(0). Compound-specific chlorine isotope analysis of 1,1,1-TCA was performed for the first time, and transformation-associated isotope fractionation ε bulk C and ε bulk Cl values were -4.0 ± 0.2‰ and no chlorine isotope fractionation with PS, -1.6 ± 0.2‰ and -4.7 ± 0.1‰ for HY/DH, -7.8 ± 0.4‰ and -5.2 ± 0.2‰ with Fe(0). Distinctly different dual isotope slopes (Δδ13C/Δδ37Cl): ∞ with PS, 0.33 ± 0.04 for HY/DH and 1.5 ± 0.1 with Fe(0) highlight the potential of this approach to identify abiotic degradation pathways of 1,1,1-TCA in the field. The trend observed with PS agreed with a C-H bond oxidation mechanism in the first reaction step. For HY/DH and Fe(0) pathways, different slopes were obtained although both pathways involve cleavage of a C-Cl bond in their initial reaction step. In contrast to the expected larger primary carbon isotope effects relative to chlorine for C-Cl bond cleavage, ε bulk C < ε bulk Cl was observed for HY/DH and in a similar range for reduction by Fe(0), suggesting the contribution of secondary chlorine isotope effects. Therefore, different magnitude of secondary chlorine isotope effects could at least be partly responsible for the distinct slopes between HY/DH and Fe(0) pathways. Following this dual isotope approach, abiotic transformation processes can unambiguously be identified and quantified. PMID:25379605

  2. New Pathways and Metrics for Enhanced, Reversible Hydrogen Storage in Boron-Doped Carbon Nanospaces

    SciTech Connect

    Pfeifer, Peter; Wexler, Carlos; Hawthorne, M. Frederick; Lee, Mark W.; Jalistegi, Satish S.

    2014-08-14

    This project, since its start in 2007—entitled “Networks of boron-doped carbon nanopores for low-pressure reversible hydrogen storage” (2007-10) and “New pathways and metrics for enhanced, reversible hydrogen storage in boron-doped carbon nanospaces” (2010-13)—is in support of the DOE's National Hydrogen Storage Project, as part of the DOE Hydrogen and Fuel Cells Program’s comprehensive efforts to enable the widespread commercialization of hydrogen and fuel cell technologies in diverse sectors of the economy. Hydrogen storage is widely recognized as a critical enabling technology for the successful commercialization and market acceptance of hydrogen powered vehicles. Storing sufficient hydrogen on board a wide range of vehicle platforms, at energy densities comparable to gasoline, without compromising passenger or cargo space, remains an outstanding technical challenge. Of the main three thrust areas in 2007—metal hydrides, chemical hydrogen storage, and sorption-based hydrogen storage—sorption-based storage, i.e., storage of molecular hydrogen by adsorption on high-surface-area materials (carbons, metal-organic frameworks, and other porous organic networks), has emerged as the most promising path toward achieving the 2017 DOE storage targets of 0.055 kg H2/kg system (“5.5 wt%”) and 0.040 kg H2/liter system. The objective of the project is to develop high-surface-area carbon materials that are boron-doped by incorporation of boron into the carbon lattice at the outset, i.e., during the synthesis of the material. The rationale for boron-doping is the prediction that boron atoms in carbon will raise the binding energy of hydro- gen from 4-5 kJ/mol on the undoped surface to 10-14 kJ/mol on a doped surface, and accordingly the hydro- gen storage capacity of the material. The mechanism for the increase in binding energy is electron donation from H2 to electron-deficient B atoms, in the form of sp2 boron-carbon bonds. Our team is proud to have demonstrated the predicted increase in binding energy experimentally, currently at ~10 kJ/mol. The synthetic route for incorporation of boron at the outset is to create appropriately designed copoly- mers, with a boron-free and a boron-carrying monomer, followed by pyrolysis of the polymer, yielding a bo- ron-substituted carbon scaffold in which boron atoms are bonded to carbon atoms by synthesis. This is in contrast to a second route (funded by DE-FG36-08GO18142) in which first high-surface area carbon is cre- ated and doped by surface vapor deposition of boron, with incorporation of the boron into the lattice the final step of the fabrication. The challenge in the first route is to create high surface areas without compromising sp2 boron-carbon bonds. The challenge in the second route is to create sp2 boron-carbon bonds without com- promising high surface areas.

  3. 13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose

    PubMed Central

    Jouhten, Paula; Pitkänen, Esa; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Maaheimo, Hannu

    2009-01-01

    Background The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions and the utilization of the respirative pathway has not been investigated on the level of in vivo fluxes. Results The biosynthetic pathways of amino acids in T. reesei supported by genome-level evidence were reconstructed with computational carbon path analysis. The pathway reconstructions were a prerequisite for analysis of in vivo fluxes. The distribution of in vivo fluxes in both wild type strain and cre1, a key regulator of carbon catabolite repression, deletion strain were quantitatively studied by performing 13C-labeling on both repressive carbon source glucose and non-repressive carbon source sorbitol. In addition, the 13C-labeling on sorbitol was performed both in the presence and absence of sophorose that induces the expression of cellulase genes. Carbon path analyses and the 13C-labeling patterns of proteinogenic amino acids indicated high similarity between biosynthetic pathways of amino acids in T. reesei and yeast Saccharomyces cerevisiae. In contrast to S. cerevisiae, however, mitochondrial rather than cytosolic biosynthesis of Asp was observed under all studied conditions. The relative anaplerotic flux to the TCA cycle was low and thus characteristic to respiratory metabolism in both strains and independent of the carbon source. Only minor differences were observed in the flux distributions of the wild type and cre1 deletion strain. Furthermore, the induction of the hydrolytic gene expression did not show altered flux distributions and did not affect the relative amino acid requirements or relative anabolic and respirative activities of the TCA cycle. Conclusion High similarity between the biosynthetic pathways of amino acids in T. reesei and yeast S. cerevisiae was concluded. In vivo flux distributions confirmed that T. reesei uses primarily the respirative pathway also when growing on the repressive carbon source glucose in contrast to Saccharomyces cerevisiae, which substantially diminishes the respirative pathway flux under glucose repression. PMID:19874611

  4. Comprehensive Evaluation of One-Carbon Metabolism Pathway Gene Variants and Renal Cell Cancer Risk

    PubMed Central

    Gibson, Todd M.; Brennan, Paul; Han, Summer; Karami, Sara; Zaridze, David; Janout, Vladimir; Kollarova, Helen; Bencko, Vladimir; Navratilova, Marie; Szeszenia-Dabrowska, Neonila; Mates, Dana; Slamova, Alena; Pfeiffer, Ruth M.; Stolzenberg-Solomon, Rachael Z.; Mayne, Susan T.; Yeager, Meredith; Chanock, Stephen; Rothman, Nat; Chow, Wong-Ho; Rosenberg, Philip S.; Boffetta, Paolo; Moore, Lee E.

    2011-01-01

    Introduction Folate and one-carbon metabolism are linked to cancer risk through their integral role in DNA synthesis and methylation. Variation in one-carbon metabolism genes, particularly MTHFR, has been associated with risk of a number of cancers in epidemiologic studies, but little is known regarding renal cancer. Methods Tag single nucleotide polymorphisms (SNPs) selected to produce high genomic coverage of 13 gene regions of one-carbon metabolism (ALDH1L1, BHMT, CBS, FOLR1, MTHFR, MTR, MTRR, SHMT1, SLC19A1, TYMS) and the closely associated glutathione synthesis pathway (CTH, GGH, GSS) were genotyped for 777 renal cell carcinoma (RCC) cases and 1,035 controls in the Central and Eastern European Renal Cancer case-control study. Associations of individual SNPs (n = 163) with RCC risk were calculated using unconditional logistic regression adjusted for age, sex and study center. Minimum p-value permutation (Min-P) tests were used to identify gene regions associated with risk, and haplotypes were evaluated within these genes. Results The strongest associations with RCC risk were observed for SLC19A1 (Pmin-P = 0.03) and MTHFR (Pmin-P = 0.13). A haplotype consisting of four SNPs in SLC19A1 (rs12483553, rs2838950, rs2838951, and rs17004785) was associated with a 37% increased risk (p = 0.02), and exploratory stratified analysis suggested the association was only significant among those in the lowest tertile of vegetable intake. Conclusions To our knowledge, this is the first study to comprehensively examine variation in one-carbon metabolism genes in relation to RCC risk. We identified a novel association with SLC19A1, which is important for transport of folate into cells. Replication in other populations is required to confirm these findings. PMID:22039442

  5. The Path of Carbon in Photosynthesis XIII. pH Effects in C{sup 14}O{sub 2} Fixation by Scenedesmus

    DOE R&D Accomplishments Database

    Ouellet, C.; Benson, A. A.

    1951-10-23

    The rates of photosynthesis and dark fixation of C{sup 14}O{sub 2} in Scenedesmus have been compared in dilute phosphate buffers of 1.6 to 11.4 pH; determination of C{sup 14} incorporation into the various products shows enhancement of uptake in an acid medium into sucrose, polysaccharides, alanine and serine, in an alkaline medium into malic asparctic acids. kinetic experiments at extreme pH values suggest that several paths are available for CO{sub 2} assimilation. A tentative correlation of the results with the pH optima of some enzymes and resultant effects upon concentrations of intermediates is presented.

  6. Gene-environment interactions and epigenetic pathways in autism: the importance of one-carbon metabolism.

    PubMed

    Schaevitz, Laura R; Berger-Sweeney, Joanne E

    2012-01-01

    Both genetic and epigenetic factors play important roles in the rate and severity of classic autism and autism spectrum disorders (ASDs). This review focuses on DNA methylation as a key epigenetic mechanism in autism. The critical role that one-carbon (C1) metabolism plays in establishing and maintaining DNA methylation patterns makes it a likely candidate pathway to regulate epigenetic processes in ASDs. This review is the first, to our knowledge, to examine how altering C1 metabolic function through genetic and environmental factors (focusing on diet) may lead to aberrant DNA methylation and increase susceptibility to ASDs. Additionally, the critical time windows for sensitivity to genetic and dietary factors both during the development of cortical networks implicated in ASDs and in regard to potential treatments are discussed. One thing is clear, if C1 metabolism plays a critical role in ASDs, it provides a potential avenue for treatment and perhaps, ultimately, prevention. PMID:23744970

  7. Exciton-exciton annihilation and relaxation pathways in semiconducting carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Chmeliov, Jevgenij; Narkeliunas, Jonas; Graham, Matt W.; Fleming, Graham R.; Valkunas, Leonas

    2016-01-01

    We present a thorough analysis of one- and two-color transient absorption measurements performed on single- and double-walled semiconducting carbon nanotubes. By combining the currently existing models describing exciton-exciton annihilation--the coherent and the diffusion-limited ones--we are able to simultaneously reproduce excitation kinetics following both E11 and E22 pump conditions. Our simulations revealed the fundamental photophysical behavior of one-dimensional coherent excitons and non-trivial excitation relaxation pathways. In particular, we found that after non-linear annihilation a doubly-excited exciton relaxes directly to its E11 state bypassing the intermediate E22 manifold, so that after excitation resonant with the E11 transition, the E22 state remains unpopulated. A quantitative explanation for the observed much faster excitation kinetics probed at E22 manifold, comparing to those probed at the E11 band, is also provided.

  8. Detection of potential leakage pathways from geological carbon storage by fluid pressure data assimilation

    NASA Astrophysics Data System (ADS)

    González-Nicolás, Ana; Baù, Domenico; Alzraiee, Ayman

    2015-12-01

    One of the main concerns of geological carbon storage (GCS) systems is the risk of leakage through "weak" permeable areas of the sealing formation or caprock. Since the fluid pressure pulse travels faster than the carbon dioxide (CO2) plume across the storage reservoir, the fluid overpressure transmitted into overlying permeable formations through caprock discontinuities is potentially detectable sooner than actual CO2 leakage occurs. In this work, an inverse modeling method based on fluid pressure measurements collected in strata above the target CO2 storage formation is proposed, which aims at identifying the presence, the location, and the extent of possible leakage pathways through the caprock. We combine a three-dimensional subsurface multiphase flow model with ensemble-based data assimilation algorithms to recognize potential caprock discontinuities that could undermine the long-term safety of GCS. The goal of this work is to examine and compare the capabilities of data assimilation algorithms such as the ensemble smoother (ES) and the restart ensemble Kalman filter (REnKF) to detect the presence of brine and/or CO2 leakage pathways, potentially in real-time during GCS operations. For the purpose of this study, changes in fluid pressure in the brine aquifer overlying to CO2 storage formation aquifer are hypothetically observed in monitoring boreholes, or provided by time-lapse seismic surveys. Caprock discontinuities are typically characterized locally by higher values of permeability, so that the permeability distribution tends to fit to a non-Gaussian bimodal process, which hardly complies with the requirements of the ES and REnKF algorithms. Here, issues related to the non-Gaussianity of the caprock permeability field are investigated by developing and applying a normal score transform procedure. Results suggest that the REnKF is more effective than the ES in characterizing caprock discontinuities.

  9. The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast

    SciTech Connect

    Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

    2007-08-08

    The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates.

  10. Role of Endoplasmic reticulum apoptotic pathway in testicular Sertoli cells injury induced by Carbon disulfide.

    PubMed

    Guo, Yinsheng; Ji, Jiajia; Wang, Wei; Dong, Yu; Zhang, Zhen; Zhou, Yijun; Chen, Guoyuan; Cheng, Jinquan

    2015-08-01

    The exposure of Carbon disulfide (CS2) is associated with germ cell injury and male infertility in animals and humans. However, the molecular mechanism is currently unknown. This study show here that CS2-induced Sertoli cells injury via Endoplasmic reticulum (ER) apoptotic pathway. SD male rats were exposed to doses of CS2 (0, 50, 250, 1250mgm(-3)) for 4weeks. After treatment, loose structures of seminiferous tubules and disordered cell arrangements were observed by light microscopy. Ultrastructural lesions, deformed chromatins and vacuoles formed from swollen ER were observed by electron microscopy. After primary culture of Sertoli cells, a dose-dependent increased apoptosis were found. The increased activity of Caspase 3, accumulation of intracellular Ca(2+), up-regulation of mRNA and protein expressions of ER apoptotic relative molecules (Calpain 2, Cleaved-Caspase 12, GRP78 and CHOP) were also found in this study. Altogether, our findings indicated that ER apoptotic pathway played an important role in CS2-induced Sertoli cell impairment. PMID:25816788

  11. Energy transfer pathways in semiconducting carbon nanotubes revealed using two-dimensional white-light spectroscopy

    NASA Astrophysics Data System (ADS)

    Mehlenbacher, Randy D.; McDonough, Thomas J.; Grechko, Maksim; Wu, Meng-Yin; Arnold, Michael S.; Zanni, Martin T.

    2015-04-01

    Thin film networks of highly purified semiconducting carbon nanotubes (CNTs) are being explored for energy harvesting and optoelectronic devices because of their exceptional transport and optical properties. The nanotubes in these films are in close contact, which permits energy to flow through the films, although the pathways and mechanisms for energy transfer are largely unknown. Here we use a broadband continuum to collect femtosecond two-dimensional white-light spectra. The continuum spans 500 to 1,300 nm, resolving energy transfer between all combinations of bandgap (S1) and higher (S2) transitions. We observe ultrafast energy redistribution on the S2 states, non-Förster energy transfer on the S1 states and anti-correlated energy levels. The two-dimensional spectra reveal competing pathways for energy transfer, with S2 excitons taking routes depending on the bandgap separation, whereas S1 excitons relax independent of the bandgap. These observations provide a basis for understanding and ultimately controlling the photophysics of energy flow in CNT-based devices.

  12. Energy transfer pathways in semiconducting carbon nanotubes revealed using two-dimensional white-light spectroscopy.

    PubMed

    Mehlenbacher, Randy D; McDonough, Thomas J; Grechko, Maksim; Wu, Meng-Yin; Arnold, Michael S; Zanni, Martin T

    2015-01-01

    Thin film networks of highly purified semiconducting carbon nanotubes (CNTs) are being explored for energy harvesting and optoelectronic devices because of their exceptional transport and optical properties. The nanotubes in these films are in close contact, which permits energy to flow through the films, although the pathways and mechanisms for energy transfer are largely unknown. Here we use a broadband continuum to collect femtosecond two-dimensional white-light spectra. The continuum spans 500 to 1,300 nm, resolving energy transfer between all combinations of bandgap (S1) and higher (S2) transitions. We observe ultrafast energy redistribution on the S2 states, non-Förster energy transfer on the S1 states and anti-correlated energy levels. The two-dimensional spectra reveal competing pathways for energy transfer, with S2 excitons taking routes depending on the bandgap separation, whereas S1 excitons relax independent of the bandgap. These observations provide a basis for understanding and ultimately controlling the photophysics of energy flow in CNT-based devices. PMID:25865487

  13. Amino Acid Biosynthesis Pathways in Diatoms

    PubMed Central

    Bromke, Mariusz A.

    2013-01-01

    Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

  14. Comparative genomic analysis of carbon and nitrogen assimilation mechanisms in three indigenous bioleaching bacteria: predictions and validations

    PubMed Central

    Levicán, Gloria; Ugalde, Juan A; Ehrenfeld, Nicole; Maass, Alejandro; Parada, Pilar

    2008-01-01

    Background Carbon and nitrogen fixation are essential pathways for autotrophic bacteria living in extreme environments. These bacteria can use carbon dioxide directly from the air as their sole carbon source and can use different sources of nitrogen such as ammonia, nitrate, nitrite, or even nitrogen from the air. To have a better understanding of how these processes occur and to determine how we can make them more efficient, a comparative genomic analysis of three bioleaching bacteria isolated from mine sites in Chile was performed. This study demonstrated that there are important differences in the carbon dioxide and nitrogen fixation mechanisms among bioleaching bacteria that coexist in mining environments. Results In this study, we probed that both Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans incorporate CO2 via the Calvin-Benson-Bassham cycle; however, the former bacterium has two copies of the Rubisco type I gene whereas the latter has only one copy. In contrast, we demonstrated that Leptospirillum ferriphilum utilizes the reductive tricarboxylic acid cycle for carbon fixation. Although all the species analyzed in our study can incorporate ammonia by an ammonia transporter, we demonstrated that Acidithiobacillus thiooxidans could also assimilate nitrate and nitrite but only Acidithiobacillus ferrooxidans could fix nitrogen directly from the air. Conclusion The current study utilized genomic and molecular evidence to verify carbon and nitrogen fixation mechanisms for three bioleaching bacteria and provided an analysis of the potential regulatory pathways and functional networks that control carbon and nitrogen fixation in these microorganisms. PMID:19055775

  15. Constraining pathways of microbial mediation for carbonate concretions of the Miocene Monterey Formation using carbonate-associated sulfate

    NASA Astrophysics Data System (ADS)

    Loyd, Sean J.; Berelson, William M.; Lyons, Timothy W.; Hammond, Douglas E.; Corsetti, Frank A.

    2012-02-01

    Carbonate concretions can form as a result of organic matter degradation within sediments. However, the ability to determine specific processes and timing relationships to particular concretions has remained elusive. Previously employed proxies (e.g., carbon and oxygen isotopes) cannot uniquely distinguish among diagenetic alkalinity sources generated by microbial oxidation of organic matter using oxygen, nitrate, metal oxides, and sulfate as electron acceptors, in addition to degradation by thermal decarboxylation. Here, we employ concentrations of carbonate-associated sulfate (CAS) and δ 34S CAS (along with more traditional approaches) to determine the specific nature of concretion authigenesis within the Miocene Monterey Formation. Integrated geochemical analyses reveal that at least three specific organo-diagenetic reaction pathways can be tied to concretion formation and that these reactions are largely sample-site specific. One calcitic concretion from the Phosphatic Shale Member at Naples Beach yields δ 34S CAS values near Miocene seawater sulfate (˜+22‰ VCDT), abundant CAS (ca. 1000 ppm), depleted δ 13C carb (˜-11‰ VPDB), and very low concentrations of Fe (ca. 700 ppm) and Mn (ca. 15 ppm)—characteristics most consistent with shallow formation in association with organic matter degradation by nitrate, iron-oxides and/or minor sulfate reduction. Cemented concretionary layers of the Phosphatic Shale Member at Shell Beach display elevated δ 34S CAS (up to ˜+37‰), CAS concentrations of ˜600 ppm, mildly depleted δ 13C carb (˜-6‰), moderate amounts of Mn (ca. 250 ppm), and relatively low Fe (ca. 1700 ppm), indicative of formation in sediments dominated by sulfate reduction. Finally, concretions within a siliceous host at Montaña de Oro and Naples Beach show minimal CAS concentrations, positive δ 13C values, and the highest concentrations of Fe (ca. 11,300 ppm) and Mn (ca. 440 ppm), consistent with formation in sediments experiencing methanogenesis in a highly reducing environment. This study highlights the promise in combining CAS analysis with more traditional techniques to differentiate among diagenetic reactions as preserved in the geologic record and shows potential for unraveling subsurface biospheric processes in ancient samples with a high degree of specificity.

  16. Temporal and Spatial Deployment of Carbon Dioxide Capture and Storage Technologies across the Representative Concentration Pathways

    SciTech Connect

    Dooley, James J.; Calvin, Katherine V.

    2011-04-18

    The Intergovernmental Panel on Climate Change’s (IPCC) Fifth Assessment (to be published in 2013-2014) will to a significant degree be built around four Representative Concentration Pathways (RCPs) that are intended to represent four scenarios of future development of greenhouse gas emissions, land use, and concentrations that span the widest range of potential future atmospheric radiative forcing. Under the very stringent climate policy implied by the 2.6 W/m2 overshoot scenario, all electricity is eventually generated from low carbon sources. However, carbon dioxide capture and storage (CCS) technologies never comprise more than 50% of total electricity generation in that very stringent scenario or in any of the other cases examined here. There are significant differences among the cases studied here in terms of how CCS technologies are used, with the most prominent being is the significant expansion of biomass+CCS as the stringency of the implied climate policy increases. Cumulative CO2 storage across the three cases that imply binding greenhouse gas constraints ranges by nearly an order of magnitude from 170GtCO2 (radiative forcing of 6.0W/m2 in 2100) to 1600GtCO2 (2.6W/m2 in 2100) over the course of this century. This potential demand for deep geologic CO2 storage is well within published estimates of total global CO2 storage capacity.

  17. A candidate gene study of one-carbon metabolism pathway genes and colorectal cancer risk.

    PubMed

    Martinelli, Marcella; Scapoli, Luca; Mattei, Gabriella; Ugolini, Giampaolo; Montroni, Isacco; Zattoni, Davide; Rosati, Giancarlo; Solmi, Rossella

    2013-03-28

    The risk of colorectal cancer (CRC) may be influenced by aberrant DNA methylation and altered nucleotide synthesis and repair, possibly caused by impaired dietary folate intake as well as by polymorphic variants in one-carbon metabolism genes. A case-control study using seventy-one CRC patients and eighty unrelated healthy controls was carried out to assess the genetic association of fifteen SNP and one insertion in nine genes belonging to the folate pathway. Polymorphism selection was based on literature data, and included those which have a known or suspected functional impact on cancer and missense polymorphisms that are most likely to alter protein function. Genotyping was performed by real-time PCR and PCR followed by restriction analysis. The likelihood ratio statistic indicated that most of the polymorphisms were not associated with the risk of CRC. However, an increased risk of CRC was observed for two variant alleles of SNP mapping on the transcobalamin 2 gene (TCN2): C776G (rs1801198) and c.1026-394T>G (rs7286680). Considering the crucial biological function played by one-carbon metabolism genes, further investigations with larger cohorts of CRC patients are needed in order to confirm our preliminary results. These preliminary results indicate that TCN2 polymorphisms can be a susceptibility factor for CRC. PMID:22794911

  18. Fixation produced by conflict.

    PubMed

    Karsh, E B

    1970-05-15

    All rats given a choice between a rewarded alternative and a conflict alternative (rewarded and punished) developed position fixations when the position of the alternatives was reversed. In contrast, all animals given one rewarded alternative and another nonrewarded (or punished and nonrewarded) alternative learned to choose the rewarded side during 25 successive reversals. PMID:5444066

  19. The Fixation of Nitrogen.

    ERIC Educational Resources Information Center

    Andrew, S. P. S.

    1978-01-01

    Discusses the fixation of atmospheric nitrogen in the form of ammonia as one of the foundations of modern chemical industry. The article describes ammonia production and synthesis, purifying the hydrogen-nitrogen mix, nitric acid production, and its commericial plant. (HM)

  20. Update: Biological Nitrogen Fixation.

    ERIC Educational Resources Information Center

    Wiseman, Alan; And Others

    1985-01-01

    Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,…

  1. Update: Biological Nitrogen Fixation.

    ERIC Educational Resources Information Center

    Wiseman, Alan; And Others

    1985-01-01

    Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,

  2. Biodegradable internal fixation.

    PubMed

    Strycker, M L

    1995-01-01

    The objective of this article was to assess the value of the use of biodegradable materials in internal fracture fixation according to the current literature. Research methods included a computerized Medline search and a hand check of references of identified articles. Also, a complete reference list was obtained from the manufacturer of Biofix (Bioscience Ltd., Tampere, Finland). The reviewers abstracted descriptive information about population, materials, complications, follow-up times in clinical trials and strength of fixation, complications, and population for animal experiments. Results indicated that sterile sinus formation is mostly associated with polyglycolic acid, with rates up to 25%, and to a lesser extent, polylactic acid. Volume of implanted material and vascularity of bone appeared to affect the rate of sinus formation. Absorbable fixation was equivalent to or better than steel fixation for functional outcome refracture rate, and in transepiphyseal femoral and humoral fractures. Polyglycolic acid and polylactic acid both became toxic between 10 days and 4 weeks of hydrolysis. Polyglycolic acid had the highest initial strength at 370 MPa compared with other polymers. PMID:7780399

  3. Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway

    PubMed Central

    Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian

    2013-01-01

    Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 ± 0.026 ng/mL for 1 mg/L, 0.21 ± 0.024 ng/mL for 5 mg/L, and 0.27 ± 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 ± 0.01 ng/mL for 1 mg/L, 0.12 ± 0.017 ng/mL for 5 mg/L, and 0.17 ± 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus. PMID:24039418

  4. Carbon catabolite repression regulates amino acid permeases in Saccharomyces cerevisiae via the TOR signaling pathway.

    PubMed

    Peter, George J; Düring, Louis; Ahmed, Aamir

    2006-03-01

    We have identified carbon catabolite repression (CCR) as a regulator of amino acid permeases in Saccharomyces cerevisiae, elucidated the permeases regulated by CCR, and identified the mechanisms involved in amino acid permease regulation by CCR. Transport of l-arginine and l-leucine was increased by approximately 10-25-fold in yeast grown in carbon sources alternate to glucose, indicating regulation by CCR. In wild type yeast the uptake (pmol/10(6) cells/h), in glucose versus galactose medium, of l-[(14)C]arginine was (0.24 +/- 0.04 versus 6.11 +/- 0.42) and l-[(14)C]leucine was (0.30 +/- 0.02 versus 3.60 +/- 0.50). The increase in amino acid uptake was maintained when galactose was replaced with glycerol. Deletion of gap1Delta and agp1Delta from the wild type strain did not alter CCR induced increase in l-leucine uptake; however, deletion of further amino acid permeases reduced the increase in l-leucine uptake in the following manner: 36% (gnp1Delta), 62% (bap2Delta), 83% (Delta(bap2-tat1)). Direct immunofluorescence showed large increases in the expression of Gnp1 and Bap2 proteins when grown in galactose compared with glucose medium. By extending the functional genomic approach to include major nutritional transducers of CCR in yeast, we concluded that SNF/MIG, GCN, or PSK pathways were not involved in the regulation of amino acid permeases by CCR. Strikingly, the deletion of TOR1, which regulates cellular response to changes in nitrogen availability, from the wild type strain abolished the CCR-induced amino acid uptake. Our results provide novel insights into the regulation of yeast amino acid permeases and signaling mechanisms involved in this regulation. PMID:16407266

  5. Oxidation state, bioavailability & biochemical pathway define the fate of carbon in soil

    NASA Astrophysics Data System (ADS)

    Kuzyakov, Yakov; Apostel, Carolin; Gunina, Anna; Herrmann, Anke M.; Dippold, Michaela

    2015-04-01

    Numerous experiments under laboratory and field conditions analyzed microbial utilization and mean residence time (MRT) of carbon (C) from plant and microbial residues as well as root exudates in soil. Most of these studies tested the effects of various environmental factors, such as temperature, soil moisture, texture etc. on these parameters. However, only a few studies compared the properties of the substances themselves and there is no conceptual framework based on biochemical pathways. We hypothesize that the fate of C from organic substances in soil strongly depends on the first step of their microbial utilization, specifically, on biochemical pathway and initial C oxidation state, as well as its bioavailability in soils, defined by its hydrophobicity and molecular weight. Here we introduce and evaluate a new conceptual framework based on the following parameters: 1) C oxidation state, 2) molecular weight and hydrophobicity, 3) initial biochemical pathway of a substance class in microbial cells. To assess these parameters, two databases were prepared based on the literature and own studies. The first database included only the studies with 14C or 13C position specific labeled sugars, amino acids, carboxylic acids, phenols and lipids in soil. This database allowed us to analyze microbial utilization and mineralization of organics to CO2 depending on their C oxidation state (OS) and on functional groups. Additionally, we calculated data on the bond electronegativity of all compounds investigated in these studies. The second data base included the results of 14C and 13C studies with uniformly labeled substances of various classes. This database considered the free enthalpie (Delta H) per C unit from a variety of substrates differing in their aromaticity, hydrophobicity/electronegativity and location of the substance on the van Krevelen diagram. In addition, we calculated the hydrophobicity from the electronegativity of the individual bonds and recorded their molecular weight in our databases. For both data bases the decomposition rates and the MRT of C remaining in soil were calculated by the double first-order kinetics and related to the four parameter groups. The first database showed high correlation of mineralization rates to CO2 with the C oxidation state and biochemical pathway. Carboxyl group (OS = +3) was split at first from the skeleton of nearly all substances. In contrast, the methyl group (OS = -3) was mineralized as the slowest and after incorporation into microbial cells remained the longest period in soil. This general pattern reflects a clear preferential oxidation of already highly oxidized, polar functional groups. The initial use of substances within glucolysis (e.g. sugars) lead to a higher portion of remaining C in soil compared to C introduced via citric acid cycle (e.g. carboxylic acids). Concerning substance groups, the mineralization rates were the fastest for amino acids and sugars and the slowest for of the lipids - corresponding to their molecular weight and hydropobicity. This corresponded well with localization of the substance classes on the van Krevelen diagram. Generally, high oxidation state of the initial substance and consequently its low free enthalpy content lead to faster decomposition. In contrast, low oxidation state (e.g. lipids, aromatics) corresponds to high hydrophobicity and so, slow uptake from soil solution and utilization within microbial cells. Consequently, the optimum for microbial biomass utilization in soil and use for anabolic processes is common for sugars that have the oxidation state close to 0, have medium energy content and are hydrophilic. We conclude that from the tested substance properties, the oxidation state and biochemical pathway explained well the initial fate of C in soil, i.e. its mineralization to CO2 and incorporation into microbial biomass. Because the first step and microbial cycling are crucial for its further transformations, the same criteria are pivotal for C stabilization in soil.

  6. The catalytic pathways of hydrohalogenation over metal-free nitrogen-doped carbon nanotubes.

    PubMed

    Zhou, Kai; Li, Bo; Zhang, Qiang; Huang, Jia-Qi; Tian, Gui-Li; Jia, Jin-Chao; Zhao, Meng-Qiang; Luo, Guo-Hua; Su, Dang Sheng; Wei, Fei

    2014-03-01

    Nitrogen-doped carbon nanotubes (N-CNTs) are found to be active as one novel heterogeneous catalyst for acetylene hydrochlorination reaction, possessing good activity (TOF=2.3×10(-3)  s(-1) ) and high selectivity (>98 %). Compared to toxic and energy-consuming conventional catalysts, such as HgCl2 , N-CNTs are more favorable in terms of sustainability, because of their thermo-stability, metal-free make up, and the wide availability of bulk CNT. Coupling X-ray photoelectron spectroscopy and density functional theory computations (DFT), the main active source and reaction pathway are shown. Good linearity between the quaternary nitrogen content and conversion is revealed. DFT study shows that the nitrogen doping enhanced the formation of the covalent bond between C2 H2 and NCNT compared with the undoped CNT, and therefore promoted the addition reaction of the C2 H2 and HCl into C2 H3 Cl. PMID:24458768

  7. Gate-Free Electrical Breakdown of Metallic Pathways in Single-Walled Carbon Nanotube Crossbar Networks.

    PubMed

    Li, Jinghua; Franklin, Aaron D; Liu, Jie

    2015-09-01

    Aligned single-walled carbon nanotubes (SWNTs) synthesized by the chemical vapor deposition (CVD) method have exceptional potential for next-generation nanoelectronics. However, the coexistence of semiconducting (s-) and metallic (m-) SWNTs remains a considerable challenge since the latter causes significant degradation in device performance. Here we demonstrate a facile and effective approach to selectively break all m-SWNTs by stacking two layers of horizontally aligned SWNTs to form crossbars and applying a voltage to the crossed SWNT arrays. The introduction of SWNT junctions amplifies the disparity in resistance between s- and m-pathways, leading to a complete deactivation of m-SWNTs while minimizing the degradation of the semiconducting counterparts. Unlike previous approaches that required an electrostatic gate to achieve selectivity in electrical breakdown, this junction process is gate-free and opens the way for straightforward integration of thin-film s-SWNT devices. Comparison to electrical breakdown in junction-less SWNT devices without gating shows that this junction-based breakdown method yields more than twice the average on-state current retention in the resultant s-SWNT arrays. Systematic studies show that the on/off ratio can reach as high as 1.4 × 10(6) with a correspondingly high retention of on-state current compared to the initial current value before breakdown. Overall, this method provides important insight into transport at SWNT junctions and a simple route for obtaining pure s-SWNT thin film devices for broad applications. PMID:26263184

  8. Mechanisms of lung fibrosis induced by carbon nanotubes: towards an Adverse Outcome Pathway (AOP).

    PubMed

    Vietti, Giulia; Lison, Dominique; van den Brule, Sybille

    2016-01-01

    Several experimental studies have shown that carbon nanotubes (CNT) can induce respiratory effects, including lung fibrosis. The cellular and molecular events through which these effects develop are, however, not clearly elucidated. The purpose of the present review was to analyze the key events involved in the lung fibrotic reaction induced by CNT and to assess their relationships. We thus address current knowledge and gaps with a view to draft an Adverse Outcome Pathway (AOP) concerning the fibrotic potential of CNT.As for many inhaled particles, CNT can indirectly activate fibroblasts through the release of pro-inflammatory (IL-1β) and pro-fibrotic (PDGF and TGF-β) mediators by inflammatory cells (macrophages and epithelial cells) via the induction of oxidative stress, inflammasome or NF-kB. We also highlight here direct effects of CNT on fibroblasts, which appear as a new mode of toxicity relatively specific for CNT. Direct effects of CNT on fibroblasts include the induction of fibroblast proliferation, differentiation and collagen production via ERK 1/2 or Smad signaling. We also point out the physico-chemical properties of CNT important for their toxicity and the relationship between in vitro and in vivo effects. This knowledge provides evidence to draft an AOP for the fibrogenic activity of CNT, which allows developing simple in vitro models contributing to predict the CNT effects in lung fibrosis, and risk assessment tools for regulatory decision. PMID:26926090

  9. Carbonic Anhydrase-8 Regulates Inflammatory Pain by Inhibiting the ITPR1-Cytosolic Free Calcium Pathway

    PubMed Central

    Zhuang, Gerald Z.; Keeler, Benjamin; Grant, Jeff; Bianchi, Laura; Fu, Eugene S.; Zhang, Yan Ping; Erasso, Diana M.; Cui, Jian-Guo; Wiltshire, Tim; Li, Qiongzhen; Hao, Shuanglin; Sarantopoulos, Konstantinos D.; Candiotti, Keith; Wishnek, Sarah M.; Smith, Shad B.; Maixner, William; Diatchenko, Luda; Martin, Eden R.; Levitt, Roy C.

    2015-01-01

    Calcium dysregulation is causally linked with various forms of neuropathology including seizure disorders, multiple sclerosis, Huntington’s disease, Alzheimer’s, spinal cerebellar ataxia (SCA) and chronic pain. Carbonic anhydrase-8 (Car8) is an allosteric inhibitor of inositol trisphosphate receptor-1 (ITPR1), which regulates intracellular calcium release fundamental to critical cellular functions including neuronal excitability, neurite outgrowth, neurotransmitter release, mitochondrial energy production and cell fate. In this report we test the hypothesis that Car8 regulation of ITPR1 and cytoplasmic free calcium release is critical to nociception and pain behaviors. We show Car8 null mutant mice (MT) exhibit mechanical allodynia and thermal hyperalgesia. Dorsal root ganglia (DRG) from MT also demonstrate increased steady-state ITPR1 phosphorylation (pITPR1) and cytoplasmic free calcium release. Overexpression of Car8 wildtype protein in MT nociceptors complements Car8 deficiency, down regulates pITPR1 and abolishes thermal and mechanical hypersensitivity. We also show that Car8 nociceptor overexpression alleviates chronic inflammatory pain. Finally, inflammation results in downregulation of DRG Car8 that is associated with increased pITPR1 expression relative to ITPR1, suggesting a possible mechanism of acute hypersensitivity. Our findings indicate Car8 regulates the ITPR1-cytosolic free calcium pathway that is critical to nociception, inflammatory pain and possibly other neuropathological states. Car8 and ITPR1 represent new therapeutic targets for chronic pain. PMID:25734498

  10. Integrated carboxylic carbon nanotube pathways with membranes for voltage-activated humidity detection and microclimate regulation.

    PubMed

    Pingitore, V; Miriello, D; Drioli, E; Gugliuzza, A

    2015-06-14

    This work describes some single walled carboxylic carbon nanotubes with outstanding transport properties when assembled in a 3D microarray working like a humidity membrane-sensor and an adjustable moisture regulator. Combined nano-assembly approaches are used to build up a better quality pathway through which assisted-charge and mass transport synchronically takes place. The structure-electrical response relationship is found, while controllable and tunable donor-acceptor interactions established at material interfaces are regarded as key factors for the accomplishment of charge transportation, enhanced electrical responses and adjustable moisture exchange. Raman and infrared spectroscopy provides indications about the fine structural and chemical features of the hybrid-composite membranes, resulting in perfect agreement with related morphology and electrical properties. Enhanced and modular electrical response to changes in the surrounding atmosphere is concerned with doping events, while assisted moisture regulation is discussed in relation to swelling and hopping actions. The electro-activated hybrid-composite membrane proposed in this work can be regarded as an attractive 'sense-to-act' precursor for smart long-distance monitoring systems with capability to adapt itself and provide local comfortable microenvironments. PMID:25939404

  11. Nitrogen fixation in peanut nodules during dark periods and detopped conditions with special reference to lipid bodies

    SciTech Connect

    Siddique, A.M.; Bal, A.K. )

    1991-03-01

    The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of {beta}-oxidation pathway and glyoxylate cycle is shown by the release of {sup 14}CO{sub 2} from {sup 14}C lineoleoyl coenzyme A by the nodule homogenate.

  12. Nitrogen Fixation in Peanut Nodules during Dark Periods and Detopped Conditions with Special Reference to Lipid Bodies 1

    PubMed Central

    Siddique, Abu-baker M.; Bal, Arya K.

    1991-01-01

    The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of β-oxidation pathway and, glyoxylate cycle is shown by the release of 14CO2 from 14C lineoleoyl coenzyme A by the nodule homogenate. Images Figure 2 Figure 4 PMID:16668069

  13. Carbon partitioning to the terpenoid biosynthetic pathway enables heterologous β-phellandrene production in Escherichia coli cultures.

    PubMed

    Formighieri, Cinzia; Melis, Anastasios

    2014-12-01

    Escherichia coli was used as a microbial system for the heterologous synthesis of β-phellandrene, a monoterpene of plant origin with several potential commercial applications. Expression of Lavandula angustifolia β-phellandrene synthase (PHLS), alone or in combination with Picea abies geranyl-diphosphate synthase in E. coli, resulted in no β-phellandrene accumulation, in sharp contrast to observations with PHLS-transformed cyanobacteria. Lack of β-phellandrene biosynthesis in E. coli was attributed to the limited endogenous carbon partitioning through the native 2-C-methylerythritol-4-phosphate (MEP) pathway. Heterologous co-expression of the mevalonic acid pathway, enhancing cellular carbon partitioning and flux toward the universal isoprenoid precursors, isopentenyl-diphosphate and dimethylallyl-diphosphate, was required to confer β-phellandrene production. Differences in endogenous carbon flux toward the synthesis of isoprenoids between photosynthetic (Synechocystis) and non-photosynthetic bacteria (E. coli) are discussed in terms of differences in the regulation of carbon partitioning through the MEP biosynthetic pathway in the two systems. PMID:25116411

  14. One-carbon metabolism in methanogenic bacteria: analysis of short-term fixation products of 14CO2 and 14CH3OH incorporated into whole cells.

    PubMed Central

    Daniels, L; Zeikus, J G

    1978-01-01

    Methanobacterium thermoautotrophicum, M. ruminantium, and Methanosarcina barkeri were labeled with 14CO2 (14CO2 + H14CO3- + 14CO32-) for from 2 to 45 s. Radioactivity was recovered in coenzyme M derivatives, alanine, aspartate, glutamate, and several unidentified compounds. The properties of one important structurally unidentified intermediate (yellow fluorescent compound) displayed UV absorbance maxima at pH 1 of 290 and 335 nm, no absorbance in the visible region, and a fluorescence maximum at 460 nm. Label did not appear in organic phosphates until after 1 min. 14CH3OH was converted by M. barkeri primarily into coenzyme M derivatives at 25 s. [2-14C]acetate was assimilated by M. thermoautotrophicum mainly into alanine and succinate during 2 to 240 s, but not into coenzyme M derivatives or yellow fluorescent compound. Cell-free extracts of M. thermoautotrophicum lacked ribulose 1,5-bisphosphate carboxylase activity. The data indicated the absence of the Calvin, serine, and hexulose phosphate paths of C1 assimilation in the methanogens examined and indicated that pyruvate was an early intermediate product of net CO2 fixation. The in vivo importance of coenzyme M derivatives in methanogenesis was demonstrated. Images PMID:101522

  15. An Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and Hypocotyl Elongation1[C][W][OA

    PubMed Central

    Lilley, Jodi L. Stewart; Gee, Christopher W.; Sairanen, Ilkka; Ljung, Karin; Nemhauser, Jennifer L.

    2012-01-01

    The local environment has a substantial impact on early seedling development. Applying excess carbon in the form of sucrose is known to alter both the timing and duration of seedling growth. Here, we show that sucrose changes growth patterns by increasing auxin levels and rootward auxin transport in Arabidopsis (Arabidopsis thaliana). Sucrose likely interacts with an endogenous carbon-sensing pathway via the PHYTOCHROME-INTERACTING FACTOR (PIF) family of transcription factors, as plants grown in elevated carbon dioxide showed the same PIF-dependent growth promotion. Overexpression of PIF5 was sufficient to suppress photosynthetic rate, enhance response to elevated carbon dioxide, and prolong seedling survival in nitrogen-limiting conditions. Thus, PIF transcription factors integrate growth with metabolic demands and thereby facilitate functional equilibrium during photomorphogenesis. PMID:23073695

  16. The Mechanics of External Fixation

    PubMed Central

    Rozbruch, S. Robert

    2006-01-01

    External fixation has evolved from being used primarily as a last resort fixation method to becoming a main stream technique used to treat a myriad of bone and soft tissue pathologies. Techniques in limb reconstruction continue to advance largely as a result of the use of these external devices. A thorough understanding of the biomechanical principles of external fixation is useful for all orthopedic surgeons as most will have to occasionally mount a fixator throughout their career. In this review, various types of external fixators and their common clinical applications are described with a focus on unilateral and circular frames. The biomechanical principles that govern bony and fixator stability are reviewed as well as the recommended techniques for applying external fixators to maximize stability. Additionally, we have illustrated methods for managing patients while they are in the external frames to facilitate function and shorten treatment duration. PMID:18751766

  17. External Fixation: Principles and Applications.

    PubMed

    Bible, Jesse E; Mir, Hassan R

    2015-11-01

    The modularity and ease of application of modern external fixation has expanded its potential use in the management of fractures and other musculoskeletal conditions. In fracture care, it can be used for provisional and definitive fixation. Short-term provisional applications include "damage control" and periarticular fracture fixation. The risk:benefit ratio of added stability needs to be assessed with each fixator. Soft-tissue management is critical during pin insertion to lessen the risk of loosening and infection. Although provisional fixation is safe for early conversion to definitive fixation, several factors affect the timing of definitive surgery, including the initial injury, external fixator stability, infection, and the physiologic state of the patient. PMID:26306568

  18. Abiotic Nitrogen Fixation on Terrestrial Planets

    NASA Astrophysics Data System (ADS)

    Summers, David P.; Khare, B.; Basa, R. C. B.; Rodoni, D.

    2009-09-01

    The abiotic fixation of nitrogen is critical to planetary evolution and the potential for life on terrestrial planets. A non-biological source of nitrogen, in a biochemically accessible form, is necessary for the origin and early evolution of life. Loss of nitrogen can result in atmospheric pressures too low for liquid water and will impact planetary habitability and hydrological processes. Shock heating of a non-reducing atmosphere produces NO and this has been well studied. Our understanding of the subsequent reactions was, in the past, theoretical. It was postulated that NO was photochemically converted to HNO which then, in surface waters, reacts to form nitrate and nitrite. This chemistry, including reactions in both the gas phase and the liquid phase, has now been studied experimentally. Our work has observed that there are multiple pathways for the fixation. One pathway observed is consistent with the theoretically predicted route via the formation of HNO. Interestingly, this pathway is coupled to photochemical formation of formaldehyde from CO through the formation of HCO. In the presence of liquid water, this pathway leads to the formation of nitrate and nitrite. In the presence of water vapor, but no liquid water, HNO appears to mostly dimerize to form N2O. A second pathway involves the formation of NO2 from CO2 and NO. This pathway becomes more dominant without water, but the reaction of NO2 with even adsorbed water can lead to the formation of nitric acid. Finally, with FeS suspended in liquid water, the direct reduction of NO to ammonia is observed. This last pathway represents the most efficient way to reduced nitrogen, with product yields well above 20% (nitrite/nitrate, from the first two pathways can also be reduced to ammonia thought the overall efficiency suffers). We wish to thank the NASA Astrobiology Institute for support.

  19. Soil Carbon Dynamics Along the Pathway From Diverse Microbial Carbon to Humus in a Temperate and Tropical Forest

    NASA Astrophysics Data System (ADS)

    Throckmorton, H. M.; Bird, J. A.; Firestone, M. K.; Horwath, W. R.

    2008-12-01

    This research investigates the importance of microbial biochemistry to humification pathways in two climatically different forest ecosystems; Blodgett forest (BF), a temperate forest in the Sierra Nevada and Luquillo forest (LF), a tropical forest in Puerto Rico. Non-living 13C enriched temperate and tropical microorganisms from four biochemically contrasting microbial groups (fungi, actinomycetes, bacteria gram (+), and bacteria gram (-)) were separately added to soil at both sites in a reciprocal transplant experiment. Decomposition rates were substantially greater at LF than BF for all microbial inputs. Although there were initial differences in microbial C turnover and recovery within the soil microbial biomass and dissolved organic carbon pools for unique microbial C inputs at both sites, over time treatment differences converge within each site and the quality of input microbial C becomes less important to C remaining and maintained within these soil C pools. Physical soil fractionation revealed important trends which illustrate the role of the soil mineral matrix to protect and stabilize C in soil. Results indicate different C turnover rates associated with the light, aggregate- occluded, and mineral-associated soil fractions at both sites. At BF input C recovered within the light and mineral-associated fractions decreased substantially over time (1 to 13 months), while C occluded within aggregates only slightly decreased. Similarly, LF soils exhibit only a slight decrease in aggregate-occluded C over time (0.5 to 3.5 months), while C recovered within the light fraction decreased substantially; however, unlike BF, LF soils exhibited only a slight decrease in C recovered within the mineral fraction. The distribution of total C among these physical soil pools differs substantially for either site, suggesting differences in the relative importance of the mineral matrix to protect and stabilize C. Preliminary compound-specific isotope analyses employing pyrolysis gas chromatography mass spectrometry and isotope ratio spectrometry (Py-GC-MS/IRMS) for temperate BF soils treated with 13C enriched temperate fungal residues indicates a substantial enrichment of low molecular weight (MW) compounds from microbial additions after 1 month in the field; however, after 5 months in the field the 13C enrichment shifts to higher MW compounds. These trends suggest higher MW compounds are formed through humification as synthesis or condensation products, which highlights the importance of monitoring biogeochemical transformations of unique sources of C over time. Future and ongoing work examines specific compounds associated with these high 13C enrichment values in an effort to understand the link between microbial C quality and humification products.

  20. A batch study on the bio-fixation of carbon dioxide in the absorbed solution from a chemical wet scrubber by hot spring and marine algae.

    PubMed

    Hsueh, H T; Chu, H; Yu, S T

    2007-01-01

    Carbon dioxide mass transfer is a key factor in cultivating micro-algae except for the light limitation of photosynthesis. It is a novel idea to enhance mass transfer with the cyclic procedure of absorbing CO(2) with a high performance alkaline abosorber such as a packed tower and regenerating the alkaline solution with algal photosynthesis. Hence, the algae with high affinity for alkaline condition must be purified. In this study, a hot spring alga (HSA) was purified from an alkaline hot spring (pH 9.3, 62 degrees C) in Taiwan and grows well over pH 11.5 and 50 degrees C. For performance of HSA, CO(2) removal efficiencies in the packed tower increase about 5-fold in a suitable growth condition compared to that without adding any potassium hydroxide. But ammonia solution was not a good choice for this system with regard to carbon dioxide removal efficiency because of its toxicity on HSA. In addition, HSA also exhibits a high growth rate under the controlled pHs from 7 to 11. Besides, a well mass balance of carbon and nitrogen made sure that less other byproducts formed in the procedure of carboxylation. For analysis of some metals in HSA, such as Mg, Mn, Fe, Zn, related to the photosynthesis increased by a rising cultivated pH and revealed that those metals might be accumulated under alkaline conditions but the growth rate was still limited by the ratio of bicarbonate (useful carbon source) and carbonate. Meanwhile, Nannochlopsis oculta (NAO) was also tested under different additional carbon sources. The results revealed that solutions of sodium/potassium carbonate are better carbon sources than ammonia carbonate/bicarbonate for the growth of NAO. However, pH 9.6 of growth limitation based on sodium was lower than one of HSA. The integrated system is, therefore, more feasible to treat CO(2) in the flue gases using the algae with higher alkaline affinity such as HSA in small volume bioreactors. PMID:16860839

  1. Novel posterior fixation keratoprosthesis

    NASA Astrophysics Data System (ADS)

    Lacombe, Emmanuel

    1992-08-01

    The keratoprosthesis is the last solution for corneally blind patients that cannot benefit from corneal transplants. Keratoprostheses that have been designed to be affixed anteriorly usually necessitate multi-step surgical procedures and are continuously subjected to the extrusion forces generated by the positive intraocular pressure; therefore, clinical results in patients prove inconsistent. We proposed a novel keratoprosthesis concept that utilizes posterior corneal fixation which `a priori' minimizes the risk of aqueous leakage and expulsion. This prosthesis is implanted in a single procedure thereby reducing the number of surgical complications normally associated with anterior fixation devices. In addition, its novel design makes this keratoprosthesis implantable in phakic eyes. With an average follow-up of 13 months (range 3 to 25 months), our results on 21 cases are encouraging. Half of the keratoprostheses were implanted in severe burn cases, with the remainder in cases of pseudo- pemphigus. Good visual results and cosmetic appearance were obtained in 14 of 21 eyes.

  2. A physiological perspective on fixational eye movements.

    PubMed

    Snodderly, D Max

    2016-01-01

    For a behavioral neuroscientist, fixational eye movements are a double-edged sword. On one edge, they make control of visual stimuli difficult, but on the other edge they provide insight into the ways the visual system acquires information from the environment. We have studied macaque monkeys as models for human visual systems. Fixational eye movements of monkeys are similar to those of humans but they are more often vertically biased and spatially more dispersed. Eye movements scatter stimuli from their intended retinal locations, increase variability of neuronal responses, inflate estimates of receptive field size, and decrease measures of response amplitude. They also bias against successful stimulation of extremely selective cells. Compensating for eye movements reduced these errors and revealed a fine-grained motion pathway from V1 feeding the cortical ventral stream. Compensation is a useful tool for the experimenter, but rather than compensating for eye movements, the brain utilizes them as part of its input. The saccades and drifts that occur during fixation selectively activate different types of V1 neurons. Cells that prefer slower speeds respond during the drift periods with maintained discharges and tend to have smaller receptive fields that are selective for sign of contrast. They are well suited to code small details of the image and to enable our fine detailed vision. Cells that prefer higher speeds fire transient bursts of spikes when the receptive field leaves, crosses, or lands on a stimulus, but only the most transient ones (about one-third of our sample) failed to respond during drifts. Voluntary and fixational saccades had very similar effects, including the presence of a biphasic extraretinal modulation that interacted with stimulus-driven responses. Saccades evoke synchronous bursts that can enhance visibility but these bursts may also participate in the visual masking that contributes to saccadic suppression. Study of the small eye movements of fixation may illuminate some of the big problems in vision. PMID:25536465

  3. Transport of dissolved organic carbon from soil to surface water: Identifying the transport pathways

    NASA Astrophysics Data System (ADS)

    Van Gaelen, Nele

    2013-04-01

    Over the last decades, increasing concentrations of dissolved organic carbon (DOC) have been found in surface waters. It has also become clear that land use is an important driver for DOC export. However, causal factors controlling this temporal and spatial variation are not clear. Efforts to model DOC export on a catchment scale are rare. In this research, we aim to determine the factors controlling variations in DOC concentration and quality in surface waters. Secondly, the importance of the different pathways (surface runoff, subsurface flow and groundwater flow) for the transport of dissolved organic matter from the soil to the surface water is investigated. Six headwater catchments (100 - 400 ha) were selected in Belgium, representing three different types of land use, namely forest, grassland and arable land. At the outlet of each catchment, a flow-proportional sampler has been collecting samples of base flow and peak discharge since January 2010. In addition, samples of groundwater, subsurface water and precipitation water were collected on a regular base in three of the catchments. Samples were analyzed for DOC, specific UV absorbance (SUVA) and dissolved silica (DSi). Elemental analysis was carried out using ICP-OES. Since 2012, precipitation water and a selection of river water samples was also analyzed for O and H isotopes. Overall, DOC concentrations were highest in forest catchments and lowest in grassland catchments. For all land use types, measured DOC concentrations were highest during peak discharge. The rise in DOC concentrations was associated with a change in DOC quality. During periods of greater discharge, higher SUVA values were measured, indicating DOC with higher aromaticity (humic and fulvic fractions) reaches the outlet. ICP and DSi results also showed a significant difference in geochemical composition of the river water if peak events are compared to base flow samples. During an event, Ca, Mg, Na, S and DSi concentrations were lowered, while K concentrations rose. Isotope analysis showed more heavy O an H isotopes during peak events than during baseflow. Results of the river water were combined with analysis of possible end-members in the catchments, using the groundwater, soil water and precipitation samples. An end-member-mixing-analysis (EMMA) gained more insight into the contributing pathways for the transport of organic matter from the soil to the surface water during base and peak flow. Furthermore, results from the different catchments were compared, and allowed to relate DOC transport to land use type. This is an important step towards a model describing DOC transport at the catchment scale.

  4. Carbon isotopes and the oldest record of life: potential and limits

    NASA Astrophysics Data System (ADS)

    Schidlowski, Manfred

    1997-07-01

    The currently available sedimentary carbon isotope record goes back to 3.85 Ga and conveys a remarkably consistent isotopic signal of biological carbon fixation based on the bias for light carbon ((superscript 12)C) exercised by common photosynthetic pathways. This holds particularly for the time segment < 3.5 Ga, whereas the older (Isua) record is blurred by a metamorphic overprint. In spite of the marked impairment of the oldest evidence by isotopic reequilibration between organic and carbonate carbon in the wake of the amphibolite-grade metamorphism suffered by the host rock, a coagent case can be built for the emergence of (photo)autotrophic carbon fixation and the start of a biogeochemical carbon cycle as from at least 3.85 Ga ago. This would imply that microbial (prokaryotic) ecosystems had been prolific on the Archaean Earth not long after the formation of the planet.

  5. Successional changes in soil nitrogen availability, non-symbiotic nitrogen fixation and carbon/nitrogen ratios in southern Chilean forest ecosystems.

    PubMed

    Pérez, Cecilia A; Carmona, Martín R; Aravena, Juan C; Armesto, Juan J

    2004-08-01

    Vast areas of southern Chile are now covered by second-growth forests because of fire and logging. To study successional patterns after moderate-intensity, anthropogenic fire disturbance, we assessed differences in soil properties and N fluxes across a chronosequence of seven successional stands (2-130 years old). We examined current predictions of successional theory concerning changes in the N cycle in forest ecosystems. Seasonal fluctuations of net N mineralization (N(min)) in surface soil and N availability (N(a); N(a)=NH4+-N+NO3--N) in upper and deep soil horizons were positively correlated with monthly precipitation. In accordance with theoretical predictions, stand age was positively, but weakly related to both N(a) ( r(2)=0.282, P<0.001) and total N (N(tot); r(2)=0.192, P<0.01), and negatively related to soil C/N ratios ( r(2)=0.187, P<0.01) in surface soils. A weak linear increase in soil N(min) (upper plus deep soil horizons) was found across the chronosequence ( r(2)=0.124, P<0.022). N(min) occurred at modest rates in early successional stands, suggesting that soil disturbance did not impair microbial processes. The relationship between N fixation (N(fix)) in the litter layer and stand age best fitted a quadratic model ( r(2)=0.228, P<0.01). In contrast to documented successional trends for most temperate, tropical and Mediterranean forests, non-symbiotic N(fix) in the litter layer is a steady N input to unpolluted southern temperate forests during mid and late succession, which may compensate for hydrological losses of organic N from old-growth ecosystems. PMID:15221437

  6. Understanding Nitrogen Fixation

    SciTech Connect

    Paul J. Chirik

    2012-05-25

    The purpose of our program is to explore fundamental chemistry relevant to the discovery of energy efficient methods for the conversion of atmospheric nitrogen (N{sub 2}) into more value-added nitrogen-containing organic molecules. Such transformations are key for domestic energy security and the reduction of fossil fuel dependencies. With DOE support, we have synthesized families of zirconium and hafnium dinitrogen complexes with elongated and activated N-N bonds that exhibit rich N{sub 2} functionalization chemistry. Having elucidated new methods for N-H bond formation from dihydrogen, C-H bonds and Broensted acids, we have since turned our attention to N-C bond construction. These reactions are particularly important for the synthesis of amines, heterocycles and hydrazines with a range of applications in the fine and commodity chemicals industries and as fuels. One recent highlight was the discovery of a new N{sub 2} cleavage reaction upon addition of carbon monoxide which resulted in the synthesis of an important fertilizer, oxamide, from the diatomics with the two strongest bonds in chemistry. Nitrogen-carbon bonds form the backbone of many important organic molecules, especially those used in the fertilizer and pharamaceutical industries. During the past year, we have continued our work in the synthesis of hydrazines of various substitution patterns, many of which are important precursors for heterocycles. In most instances, the direct functionalization of N{sub 2} offers a more efficient synthetic route than traditional organic methods. In addition, we have also discovered a unique CO-induced N{sub 2} bond cleavage reaction that simultaneously cleaves the N-N bond of the metal dinitrogen compound and assembles new C-C bond and two new N-C bonds. Treatment of the CO-functionalized core with weak Broensted acids liberated oxamide, H{sub 2}NC(O)C(O)NH{sub 2}, an important slow release fertilizer that is of interest to replace urea in many applications. The synthesis of ammonia, NH{sub 3}, from its elements, H{sub 2} and N{sub 2}, via the venerable Haber-Bosch process is one of the most significant technological achievements of the past century. Our research program seeks to discover new transition metal reagents and catalysts to disrupt the strong N {triple_bond} N bond in N{sub 2} and create new, fundamental chemical linkages for the construction of molecules with application as fuels, fertilizers and fine chemicals. With DOE support, our group has discovered a mild method for ammonia synthesis in solution as well as new methods for the construction of nitrogen-carbon bonds directly from N{sub 2}. Ideally these achievements will evolve into more efficient nitrogen fixation schemes that circumvent the high energy demands of industrial ammonia synthesis. Industrially, atmospheric nitrogen enters the synthetic cycle by the well-established Haber-Bosch process whereby N{sub 2} is hydrogenated to ammonia at high temperature and pressure. The commercialization of this reaction represents one of the greatest technological achievements of the 20th century as Haber-Bosch ammonia is responsible for supporting approximately 50% of the world's population and serves as the source of half of the nitrogen in the human body. The extreme reaction conditions required for an economical process have significant energy consequences, consuming 1% of the world's energy supply mostly in the form of pollution-intensive coal. Moreover, industrial H{sub 2} synthesis via the water gas shift reaction and the steam reforming of methane is fossil fuel intensive and produces CO{sub 2} as a byproduct. New synthetic methods that promote this thermodynamically favored transformation ({Delta}G{sup o} = -4.1 kcal/mol) under milder conditions or completely obviate it are therefore desirable. Most nitrogen-containing organic molecules are derived from ammonia (and hence rely on the Haber-Bosch and H{sub 2} synthesis processes) and direct synthesis from atmospheric nitrogen could, in principle, be more energy-efficient. This is particularly attractive given the interest in direct hydrazine fuel cells.

  7. Synthetic Pathway for Production of Five-Carbon Alcohols from Isopentenyl Diphosphate

    PubMed Central

    Chou, Howard H.

    2012-01-01

    Synthetic biological pathways could enhance the development of novel processes to produce chemicals from renewable resources. On the basis of models that describe the evolution of metabolic pathways and enzymes in nature, we developed a framework to rationally identify enzymes able to catalyze reactions on new substrates that overcomes one of the major bottlenecks in the assembly of a synthetic biological pathway. We verified the framework by implementing a pathway with two novel enzymatic reactions to convert isopentenyl diphosphate into 3-methyl-3-butenol, 3-methyl-2-butenol, and 3-methylbutanol. To overcome competition with native pathways that share the same substrate, we engineered two bifunctional enzymes that redirect metabolic flux toward the synthetic pathway. Taken together, our work demonstrates a new approach to the engineering of novel synthetic pathways in the cell. PMID:22941086

  8. [Advances on CO2 fixation by microalgae].

    PubMed

    Cheng, Li-Hua; Zhang, Lin; Chen, Huan-Lin; Gao, Cong-Jie

    2005-03-01

    The greenhouse effect, which is believed to occur primarily as a result of the accumulation of carbon dioxide in the atmosphere, has become one of the major environmental concerns and received worldwide attention. In this paper, algae species screening and cultivation for efficient CO2 fixation are reviewed. The related dissolved inorganic carbon (DIC) utilization form and CO2 concentration mechanism (CCM) in the process of CO2 fixation by microalgae are analyzed. Four objectives of the highly effective photobioreactor design and operation are discussed, and the advances on CO2 mitigation technology with integration of microalgae (enzyme) and membrane bioreactor are also briefly introduced. In response to elevated CO2 concentration, much attention needs to be paid to the construction of transgenic microalgae with higher performance in CO2 fixation based on the further ascertainment of the related mechanism, and the development of effective CO2 biofixation system integrated with other kinds of advanced technology, such as membrane immobilization and separation. PMID:16013471

  9. Elementary Flux Mode Analysis Revealed Cyclization Pathway as a Powerful Way for NADPH Regeneration of Central Carbon Metabolism

    PubMed Central

    Shen, Tie; Zheng, Meijuan; Zhou, Wenwei; Du, Honglin; Fan, Yadong; Wang, Yongkang; Zhang, Zhengdong; Xu, Shengsheng; Liu, Zhijie; Wen, Han; Xie, Xiaoyao

    2015-01-01

    NADPH regeneration capacity is attracting growing research attention due to its important role in resisting oxidative stress. Besides, NADPH availability has been regarded as a limiting factor in production of industrially valuable compounds. The central carbon metabolism carries the carbon skeleton flux supporting the operation of NADPH-regenerating enzyme and offers flexibility in coping with NADPH demand for varied intracellular environment. To acquire an insightful understanding of its NADPH regeneration capacity, the elementary mode method was employed to compute all elementary flux modes (EFMs) of a network representative of central carbon metabolism. Based on the metabolic flux distributions of these modes, a cluster analysis of EFMs with high NADPH regeneration rate was conducted using the self-organizing map clustering algorithm. The clustering results were used to study the relationship between the flux of total NADPH regeneration and the flux in each NADPH producing enzyme. The results identified several reaction combinations supporting high NADPH regeneration, which are proven to be feasible in cells via thermodynamic analysis and coincident with a great deal of previous experimental report. Meanwhile, the reaction combinations showed some common characteristics: there were one or two decarboxylation oxidation reactions in the combinations that produced NADPH and the combination constitution included certain gluconeogenesis pathways. These findings suggested cyclization pathways as a powerful way for NADPH regeneration capacity of bacterial central carbon metabolism. PMID:26086807

  10. Absorbable biologically based internal fixation.

    PubMed

    Ibrahim, Ahmed M S; Koolen, Pieter G L; Kim, Kuylhee; Perrone, Gabe S; Kaplan, David L; Lin, Samuel J

    2015-01-01

    Absorbable devices for use in internal fixation have advanced over the years to become reliable and cost-effective alternatives to metallic hardware. In the past, biodegradable fixation involved a laborious implantation process, and induced osteolysis and inflammatory reactions. Modern iterations exhibit increased strength, smoother resorption, and lower rates of reactivity. A newer generation manufactured from silk has emerged that may address existing limitations and provide a greater range of fixation applications. PMID:25440418

  11. A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime

    NASA Technical Reports Server (NTRS)

    Carr, Mary-Elena

    1998-01-01

    A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

  12. Nitrogen fixation apparatus

    DOEpatents

    Chen, Hao-Lin

    1984-01-01

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

  13. Gene Regulation of Carbon Fixation, Storage, and Utilization in the Diatom Phaeodactylum tricornutum Acclimated to Light/Dark Cycles1[C][W][OA

    PubMed Central

    Chauton, Matilde Skogen; Winge, Per; Brembu, Tore; Vadstein, Olav; Bones, Atle M.

    2013-01-01

    The regulation of carbon metabolism in the diatom Phaeodactylum tricornutum at the cell, metabolite, and gene expression levels in exponential fed-batch cultures is reported. Transcriptional profiles and cell chemistry sampled simultaneously at all time points provide a comprehensive data set on carbon incorporation, fate, and regulation. An increase in Nile Red fluorescence (a proxy for cellular neutral lipids) was observed throughout the light period, and water-soluble glucans increased rapidly in the light period. A near-linear decline in both glucans and lipids was observed during the dark period, and transcription profile data indicated that this decline was associated with the onset of mitosis. More than 4,500 transcripts that were differentially regulated during the light/dark cycle are identified, many of which were associated with carbohydrate and lipid metabolism. Genes not previously described in algae and their regulation in response to light were integrated in this analysis together with proposed roles in metabolic processes. Some very fast light-responding genes in, for example, fatty acid biosynthesis were identified and allocated to biosynthetic processes. Transcripts and cell chemistry data reflect the link between light energy availability and light energy-consuming metabolic processes. Our data confirm the spatial localization of processes in carbon metabolism to either plastids or mitochondria or to glycolysis/gluconeogenesis, which are localized to the cytosol, chloroplast, and mitochondria. Localization and diel expression pattern may be of help to determine the roles of different isoenzymes and the mining of genes involved in light responses and circadian rhythms. PMID:23209127

  14. A DFT study on the reaction pathways for carbon-carbon bond-forming reactions between propargylic alcohols and alkenes or ketones catalyzed by thiolate-bridged diruthenium complexes.

    PubMed

    Sakata, Ken; Miyake, Yoshihiro; Nishibayashi, Yoshiaki

    2009-01-01

    The reaction pathways of two types of the carbon-carbon bond-forming reactions catalyzed by thiolate-bridged diruthenium complexes have been investigated by density-functional-theory calculations. It is clarified that both carbon-carbon bond-forming reactions proceed through a ruthenium-allenylidene complex as a common reactive intermediate. The attack of pi electrons on propene or the vinyl alcohol on the ruthenium-allenylidene complex is the first step of the reaction pathways. The reaction pathways are different after the attack of nucleophiles on the ruthenium-alkynyl complex. In the reaction with propene, the carbon-carbon bond-forming reaction proceeds through a stepwise process, whereas in the reaction with vinyl alcohol, it proceeds through a concerted process. The interactions between the ruthenium-allenylidene complex and propene or vinyl alcohol have been investigated by applying a simple way of looking at orbital interactions. PMID:18844315

  15. Regulation of Development and Nitrogen Fixation in Anabaena

    SciTech Connect

    James W Golden

    2004-08-05

    The nitrogen-fixing filamentous cyanobacterium Anabaena sp. strain PCC 7120 is being used as a simple model of microbial development and pattern formation in a multicellular prokaryotic organism. Anabaena reduces atmospheric nitrogen to ammonia in highly specialized, terminally differentiated cells called heterocysts. Anabaena is an important model system because of the multicellular growth pattern, the suspected antiquity of heterocyst development, and the contribution of fixed nitrogen to the environment. We are especially interested in understanding the molecular signaling pathways and genetic regulation that control heterocyst development. In the presence of an external source of reduced nitrogen, the differentiation of heterocysts is inhibited. When Anabaena is grown on dinitrogen, a one-dimensional developmental pattern of single heterocysts separated by approximately ten vegetative cells is established to form a multicellular organism composed of two interdependent cell types. The goal of this project is to understand the signaling and regulatory pathways that commit a vegetative cell to terminally differentiate into a nitrogen-fixing heterocyst. Several genes identified by us and by others were chosen as entry points into the regulatory network. Our research, which was initially focused on transcriptional regulation by group 2 sigma factors, was expanded to include group 3 sigma factors and their regulators after the complete Anabaena genome sequence became available. Surprisingly, no individual sigma factor is essential for heterocyst development. We have used the isolation of extragenic suppressors to study genetic interactions between key regulatory genes such as patS, hetR, and hetC in signaling and developmental pathways. We identified a hetR R223W mutation as a bypass suppressor of patS overexpression. Strains containing the hetR R223W allele fail to respond to pattern formation signals and overexpression of this allele results in a lethal phenotype because all cells differentiate a few days after nitrogen step-down. Our continued analysis of these genes will provide a better understanding of how a simple prokaryotic organism can perform both photosynthetic carbon fixation and nitrogen fixation simultaneously by separating these processes in different cell types.

  16. Flexible fixation and fracture healing: do locked plating 'internal fixators' resemble external fixators?

    PubMed

    Schmal, Hagen; Strohm, Peter C; Jaeger, Martin; Südkamp, Norbert P

    2011-02-01

    External and internal fixators use bone screws that are locked to a plate or bar to prevent periosteal compression and associated impairment of blood supply. Both osteosynthesis techniques rely on secondary bone healing with callus formation with the exception of compression plating of simple, noncomminuted fractures. External fixation uses external bars for stabilization, whereas internal fixation is realized by subcutaneous placement of locking plates. Both of these "biologic" osteosynthesis methods allow a minimally invasive approach and do not compromise fracture hematoma and periosteal blood supply. Despite these similarities, differences between the two fixation methods prevail. Locked plating "internal fixators" allow a combination of biomechanical principles such as buttressing and dynamic compression. Periarticular locking plates are anatomically contoured to facilitate fixation of articular fractures. They allow for subchondral stabilization using small-diameter angular stable screws as well as buttressing of the joint and the metaphyseal component of a fracture. Biomechanically, they can be far stiffer than external fixators, because subcutaneous plates are located much closer to the bone surface than external fixator bars. External fixators have the advantage of being less expensive, highly flexible, and technically less demanding. They remain an integral part of orthopaedic surgery for emergent stabilization, for pediatric fractures, for definitive osteosynthesis in certain indications such as distal radius fractures, and for callus distraction. PMID:21248555

  17. Ammonia oxidation coupled to CO2 fixation by archaea and bacteria in an agricultural soil.

    PubMed

    Pratscher, Jennifer; Dumont, Marc G; Conrad, Ralf

    2011-03-01

    Ammonia oxidation is an essential part of the global nitrogen cycling and was long thought to be driven only by bacteria. Recent findings expanded this pathway also to the archaea. However, most questions concerning the metabolism of ammonia-oxidizing archaea, such as ammonia oxidation and potential CO(2) fixation, remain open, especially for terrestrial environments. Here, we investigated the activity of ammonia-oxidizing archaea and bacteria in an agricultural soil by comparison of RNA- and DNA-stable isotope probing (SIP). RNA-SIP demonstrated a highly dynamic and diverse community involved in CO(2) fixation and carbon assimilation coupled to ammonia oxidation. DNA-SIP showed growth of the ammonia-oxidizing bacteria but not of archaea. Furthermore, the analysis of labeled RNA found transcripts of the archaeal acetyl-CoA/propionyl-CoA carboxylase (accA/pccB) to be expressed and labeled. These findings strongly suggest that ammonia-oxidizing archaeal groups in soil autotrophically fix CO(2) using the 3-hydroxypropionate-4-hydroxybutyrate cycle, one of the two pathways recently identified for CO(2) fixation in Crenarchaeota. Catalyzed reporter deposition (CARD)-FISH targeting the gene encoding subunit A of ammonia monooxygenase (amoA) mRNA and 16S rRNA of archaea also revealed ammonia-oxidizing archaea to be numerically relevant among the archaea in this soil. Our results demonstrate a diverse and dynamic contribution of ammonia-oxidizing archaea in soil to nitrification and CO(2) assimilation and that their importance to the overall archaeal community might be larger than previously thought. PMID:21368116

  18. Allocate carbon for a reason: priorities are reflected in the ¹³C/¹²C ratios of plant lipids synthesized via three independent biosynthetic pathways.

    PubMed

    Zhou, Youping; Stuart-Williams, Hilary; Grice, Kliti; Kayler, Zachary E; Zavadlav, Saša; Vogts, Angela; Rommerskirchen, Florian; Farquhar, Graham D; Gessler, Arthur

    2015-03-01

    It has long been theorized that carbon allocation, in addition to the carbon source and to kinetic isotopic effects associated with a particular lipid biosynthetic pathway, plays an important role in shaping the carbon isotopic composition ((13)C/(12)C) of lipids (Park and Epstein, 1961). If the latter two factors are properly constrained, valuable information about carbon allocation during lipid biosynthesis can be obtained from carbon isotope measurements. Published work of Chikaraishi et al. (2004) showed that leaf lipids isotopic shifts from bulk leaf tissue Δδ(13)C(bk-lp) (defined as δ(13)C(bulkleaftissue)-δ(13)C(lipid)) are pathway dependent: the acetogenic (ACT) pathway synthesizing fatty lipids has the largest isotopic shift, the mevalonic acid (MVA) pathway synthesizing sterols the lowest and the phytol synthesizing 1-deoxy-D-xylulose 5-phosphate (DXP) pathway gives intermediate values. The differences in Δδ(13)C(bk-lp) between C3 and C4 plants Δδ(13)C(bk-lp,C4-C3) are also pathway-dependent: Δδ(13)C(ACT)(bk-lp,C4-C3) > Δδ(13)C(DXP(bk-lp,C4-C3) > Δδ(13)C(MVA)(bk-lp,C4-C3). These pathway-dependent differences have been interpreted as resulting from kinetic isotopic effect differences of key but unspecified biochemical reactions involved in lipids biosynthesis between C3 and C4 plants. After quantitatively considering isotopic shifts caused by (dark) respiration, export-of-carbon (to sink tissues) and photorespiration, we propose that the pathway-specific differences Δδ(13)C(bk-lp,C4-C3) can be successfully explained by C4-C3 carbon allocation (flux) differences with greatest flux into the ACT pathway and lowest into the MVA pathways (when flux is higher, isotopic shift relative to source is smaller). Highest carbon allocation to the ACT pathway appears to be tied to the most stringent role of water-loss-minimization by leaf waxes (composed mainly of fatty lipids) while the lowest carbon allocation to the MVA pathway can be largely explained by the fact that sterols act as regulatory hormones and membrane fluidity modulators in rather low concentrations. PMID:25576502

  19. Pathways and Mechanisms of OceanTracer Transport: Implications for Carbon Sequestration

    SciTech Connect

    Marshall, John; Follows, MIchael

    2006-11-06

    This funding enabled the following published manuscripts in which we have developed models of direct relevance to ocean carbon sequestration and of the oceanic iron cycle, its connection to the global carbon cycle, and the sensitivity of atmospheric carbon dioxide to the external source of iron. As part of this process we have developed the adjoint of the MIT ocean biogeochemistry model which has enabled us to perform rigorous and efficient sensitivity studies.

  20. Persistence of /sup 14/C labeled carbon in Larrea tridentata up to 40 months after photosynthetic fixation in the northern Mojave Desert

    SciTech Connect

    Wallace, A.; Romney, E.M.; Cha, J.W.

    1980-01-01

    Larrea tridentata (Sesse Moc. ex DC) Cov. exposed to /sup 14/CO/sub 2/ retained about 20 percent of its /sup 14/C after 16 and also after 26 months. In leaves, however, a lower specific activity was present at 26 months than at 16 months, and a smaller percentage of /sup 14/C in the plant occurred in leaves at 26 months than at 26 months (3 percent vs 10 percent). This indicates some, but little, reuse of carbon from the structural components of the plants. The strong tendency of the species to retain this carbon may be related to a survival mechanism. After 40 months the results were more erratic, with 11 percent of /sup 14/C remaining in plants and only 2 percent of the total remaining in the leaves. The specific activity of /sup 14/C in the organic debris fraction obtained with saturated salt flotation of roots after small and fine roots had been physically removed indicated that from 27 to 35 percent of the organic debris had the same specific activity as roots and probably could be considered as roots. This compares with the 45 percent value determined previously by a different technique. The below-ground to aboveground ratio for biomass of these plants was about 2.5:1. The below-ground to above-ground ratio for the /sup 14/C was about 0.5 at 16 months, 1.3 at 26 months, and 2.5 at 40 months. The estimates obtained in this study were used to correct our previous data for below-ground biomass. Accordingly,somewhere between 3000 and 5000 kg/ha roots are present in the Rock Valley area. An increase wth time of the below-ground to aboveground /sup 14/C ratio probably indicates loss of /sup 14/C from above-ground parts rather than additional transport to roots.

  1. Eighth international congress on nitrogen fixation

    SciTech Connect

    Not Available

    1990-01-01

    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  2. A Dynamic Pathway for Stone-Wales Bond Rotation on Carbon Nanotubes through Diamond-Like Bonds

    NASA Technical Reports Server (NTRS)

    Wei, Chen-Yu; Srivastava, Deepak; Cho, Kyeong-Jae; Menon, Madhu

    2003-01-01

    A new lower energy barrier with a two-step pathway of Stone-Wales (SW) ,ond rotation on carbon nanotubes (CNTs) is found through molecular dynamics (MD) simulations of CNTs under tension. The first step involves going over to a stable sp3-like metastable configuration with half rotated and partially tilted C-C bond. The second step involves going over to the fully rotated C-C bond with the formation of a SW defect in the nanotube. The energy barrier for this two-step dynamic pathway is significantly lower than the previously known static barrier for in-plane rotation of the C-C bond on a tensile strained (> 4%) CNT.

  3. Microbial fixation of CO2 in water bodies and in drylands to combat climate change, soil loss and desertification.

    PubMed

    Rossi, Federico; Olguín, Eugenia J; Diels, Ludo; De Philippis, Roberto

    2015-01-25

    The growing concern for the increase of the global warming effects due to anthropogenic activities raises the challenge of finding novel technological approaches to stabilize CO2 emissions in the atmosphere and counteract impinging interconnected issues such as desertification and loss of biodiversity. Biological-CO2 mitigation, triggered through biological fixation, is considered a promising and eco-sustainable method, mostly owing to its downstream benefits that can be exploited. Microorganisms such as cyanobacteria, green algae and some autotrophic bacteria could potentially fix CO2 more efficiently than higher plants, due to their faster growth. Some examples of the potential of biological-CO2 mitigation are reported and discussed in this paper. In arid and semiarid environments, soil carbon sequestration (CO2 fixation) by cyanobacteria and biological soil crusts is considered an eco-friendly and natural process to increase soil C content and a viable pathway to soil restoration after one disturbance event. Another way for biological-CO2 mitigation intensively studied in the last few years is related to the possibility to perform carbon dioxide sequestration using microalgae, obtaining at the same time bioproducts of industrial interest. Another possibility under study is the exploitation of specific chemotrophic bacteria, such as Ralstonia eutropha (or picketii) and related organisms, for CO2 fixation coupled with the production chemicals such as polyhydroxyalkanoates (PHAs). In spite of the potential of these processes, multiple factors still have to be optimized for maximum rate of CO2 fixation by these microorganisms. The optimization of culture conditions, including the optimal concentration of CO2 in the provided gas, the use of metabolic engineering and of dual purpose systems for the treatment of wastewater and production of biofuels and high value products within a biorefinery concept, the design of photobioreactors in the case of phototrophs are some of the issues that, among others, have to be addressed and tested for cost-effective CO2 sequestration. PMID:24355428

  4. Activation of locus coeruleus heme oxygenase-carbon monoxide pathway promoted an anxiolytic-like effect in rats

    PubMed Central

    Carvalho-Costa, P.G.; Branco, L.G.S.; Leite-Panissi, C.R.A.

    2016-01-01

    The heme oxygenase-carbon monoxide pathway has been shown to play an important role in many physiological processes and is capable of altering nociception modulation in the nervous system by stimulating soluble guanylate cyclase (sGC). In the central nervous system, the locus coeruleus (LC) is known to be a region that expresses the heme oxygenase enzyme (HO), which catalyzes the metabolism of heme to carbon monoxide (CO). Additionally, several lines of evidence have suggested that the LC can be involved in the modulation of emotional states such as fear and anxiety. The purpose of this investigation was to evaluate the activation of the heme oxygenase-carbon monoxide pathway in the LC in the modulation of anxiety by using the elevated plus maze test (EPM) and light-dark box test (LDB) in rats. Experiments were performed on adult male Wistar rats weighing 250-300 g (n=182). The results showed that the intra-LC microinjection of heme-lysinate (600 nmol), a substrate for the enzyme HO, increased the number of entries into the open arms and the percentage of time spent in open arms in the elevated plus maze test, indicating a decrease in anxiety. Additionally, in the LDB test, intra-LC administration of heme-lysinate promoted an increase on time spent in the light compartment of the box. The intracerebroventricular microinjection of guanylate cyclase, an sGC inhibitor followed by the intra-LC microinjection of the heme-lysinate blocked the anxiolytic-like reaction on the EPM test and LDB test. It can therefore be concluded that CO in the LC produced by the HO pathway and acting via cGMP plays an anxiolytic-like role in the LC of rats. PMID:27074170

  5. Mutations in alternative carbon utilization pathways in Candida albicans attenuate virulence and confer pleiotropic phenotypes.

    PubMed

    Ramírez, Melissa A; Lorenz, Michael C

    2007-02-01

    The interaction between Candida albicans and cells of the innate immune system is a key determinant of disease progression. Transcriptional profiling has revealed that C. albicans has a complex response to phagocytosis, much of which is similar to carbon starvation. This suggests that nutrient limitation is a significant stress in vivo, and we have shown that glyoxylate cycle mutants are less virulent in mice. To examine whether other aspects of carbon metabolism are important in vivo during an infection, we have constructed strains lacking FOX2 and FBP1, which encode key components of fatty acid beta-oxidation and gluconeogenesis, respectively. As expected, fox2Delta mutants failed to utilize several fatty acids as carbon sources. Surprisingly, however, these mutants also failed to grow in the presence of several other carbon sources, whose assimilation is independent of beta-oxidation, including ethanol and citric acid. Mutants lacking the glyoxylate enzyme ICL1 also had more severe carbon utilization phenotypes than were expected. These results suggest that the regulation of alternative carbon metabolism in C. albicans is significantly different from that in other fungi. In vivo, fox2Delta mutants show a moderate but significant reduction in virulence in a mouse model of disseminated candidiasis, while disruption of the glyoxylate cycle or gluconeogenesis confers a severe attenuation in this model. These data indicate that C. albicans often encounters carbon-poor conditions during growth in the host and that the ability to efficiently utilize multiple nonfermentable carbon sources is a virulence determinant. Consistent with this in vivo requirement, C. albicans uniquely regulates carbon metabolism in a more integrated manner than in Saccharomyces cerevisiae, such that defects in one part of the machinery have wider impacts than expected. These aspects of alternative carbon metabolism may then be useful as targets for therapeutic intervention. PMID:17158734

  6. Fixation by active accommodation

    NASA Astrophysics Data System (ADS)

    Pahlavan, Kourosh; Uhlin, Tomas; Eklundh, Jan-Olof

    1992-11-01

    The field of computer vision has long been interested in disparity as the cue for the correspondence between stereo images. The other cue to correspondence, blur, and the fact that vergence is a combination of the two processes, accommodative vergence and disparity vergence, have not been equally appreciated. Following the methodology of active vision that allows the observer to control all his visual parameters, it is quite natural to take advantage of the powerful combination of these two processes. In this article, we try to elucidate such an integration and briefly analyze the cooperation and competition between accommodative vergence and disparity vergence on one hand and disparity and blur stimuli on the other hand. The human fixation mechanism is used as a guide-line and some virtues of this mechanism are used to implement a model for vergence in isolation. Finally, some experimental results are reported.

  7. A unifying framework for dinitrogen fixation in the terrestrial biosphere.

    PubMed

    Houlton, Benjamin Z; Wang, Ying-Ping; Vitousek, Peter M; Field, Christopher B

    2008-07-17

    Dinitrogen (N(2)) fixation is widely recognized as an important process in controlling ecosystem responses to global environmental change, both today and in the past; however, significant discrepancies exist between theory and observations of patterns of N(2) fixation across major sectors of the land biosphere. A question remains as to why symbiotic N(2)-fixing plants are more abundant in vast areas of the tropics than in many of the mature forests that seem to be nitrogen-limited in the temperate and boreal zones. Here we present a unifying framework for terrestrial N(2) fixation that can explain the geographic occurrence of N(2) fixers across diverse biomes and at the global scale. By examining trade-offs inherent in plant carbon, nitrogen and phosphorus capture, we find a clear advantage to symbiotic N(2) fixers in phosphorus-limited tropical savannas and lowland tropical forests. The ability of N(2) fixers to invest nitrogen into phosphorus acquisition seems vital to sustained N(2) fixation in phosphorus-limited tropical ecosystems. In contrast, modern-day temperatures seem to constrain N(2) fixation rates and N(2)-fixing species from mature forests in the high latitudes. We propose that an analysis that couples biogeochemical cycling and biophysical mechanisms is sufficient to explain the principal geographical patterns of symbiotic N(2) fixation on land, thus providing a basis for predicting the response of nutrient-limited ecosystems to climate change and increasing atmospheric CO(2). PMID:18563086

  8. [External fixator: surgical technique, pinless fixator, change in procedure].

    PubMed

    Oberli, H; Frigg, R; Schenk, R

    1994-12-01

    External Fixation-Technique: The advantages of external over internal fixation are as follows: a) endosteal and periosteal blood supply is undisturbed, b) "low-tech" equipment may be used, c) secondary adjustments are possible and d) easy implant removal. These benefits however are outweighed by the main disadvantages of long term external fixation i.e. pin complications and delayed union of fractures. Better understanding of postoperative management and careful application of screws of improved design will lead to better results. Today's standard applications of external fixation for tibial fractures is a unilateral fixator, using Schanz screws. The pin-bone interface is the most critical site of all external fixation. By avoiding heat necrosis (low temperature drilling) and preventing micro motion at the pin-bone interface (by applying bending- or more recently radial-preload), pin complications such as infection and loosening can be reduced. Two Schanz screws are inserted into each main fragment and are connected with one short tube per fragment. The fracture is then reduced by using these tubes as handles. After reduction a third tube connects the first two by means of two tube-to-tube clamps. This type of fixation will easily allow for three dimensional secondary corrections of alignment. Approximately three weeks following the injury some motion at the fracture site will stimulate callus formation. This can be achieved by destabilisation, dynamisation or "active stimulation" of the fracture site [2]. Pinless fixator: The pinless external fixator holds the fragments firmly with pointed clamps that penetrate about one millimeter into cortical bone without entering and contaminating the medullary canal.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7875986

  9. Multifactor dimensionality reduction analysis to elucidate the cross-talk between one-carbon and xenobiotic metabolic pathways in multi-disease models.

    PubMed

    Naushad, Shaik Mohammad; Vijayalakshmi, Sana Venkata; Rupasree, Yedluri; Kumudini, Nadella; Sowganthika, Sampathkumar; Naidu, Janardhanan Venketlakshmi; Ramaiah, M Janaki; Rao, Dunna Nageswara; Kutala, Vijay Kumar

    2015-07-01

    Putatively functional polymorphisms of one-carbon and xenobiotic metabolic pathways influence susceptibility for wide spectrum of diseases. The current study was aimed to explore gene-gene interactions among these two metabolic pathways in four diseases i.e. breast cancer, systemic lupus erythematosus (SLE), coronary artery disease (CAD) and Parkinson's disease (PD). Multifactor dimensionality reduction analysis was carried out on four case-control datasets. Cross-talk was observed between one-carbon and xenobiotic pathways in breast cancer (RFC 80 G>A, COMT H108L and TYMS 5'-UTR 28 bp tandem repeat) and SLE (CYP1A1 m1, MTRR 66 A>G and GSTT1). Gene-gene interactions within one-carbon metabolic pathway were observed in CAD (GCPII 1561 C>T, SHMT 1420 C>T and MTHFR 677 C>T) and PD (cSHMT 1420 C>T, MTRR 66 A>G and RFC1 80 G>A). These interaction models showed good predictability of risk for PD (The area under the receiver operating characteristic curve (C) = 0.83) and SLE (C = 0.73); and moderate predictability of risk for breast cancer (C = 0.64) and CAD (C = 0.63). Cross-talk between one-carbon and xenobiotic pathways was observed in diseases with female preponderance. Gene-gene interactions within one-carbon metabolic pathway were observed in diseases with male preponderance. PMID:25648260

  10. Variation in moss-associated nitrogen fixation in boreal forest stands.

    PubMed

    Markham, John H

    2009-08-01

    Traditionally it has been thought that most boreal forest communities lack a significant input of biologically fixed nitrogen. Recent discoveries of nitrogen fixation by cyanobacteria associated with mosses have resulted in a re-evaluation of this view. While it is recognized that rates of nitrogen fixation in mosses can be highly variable, there is little understanding as to why this occurs. I monitored nitrogen fixation, using acetylene reduction, in wet lowland and dry upland boreal forest communities, in central Canada, over a growing season. At the peak of nitrogen fixation in mid summer, Sphagnum capillifolium had an 11 times higher rate of fixation than Pleurozium schreberi. Variation in canopy openness and precipitation had no effect on rates of fixation over the growing season. In P. schreberi fixation rates did not vary between sites. Temperature had a positive effect on fixation rates in both S. capillifolium and P. schreberi, but the effect was 4 times more pronounced in S. capillifolium. Seasonal rates of nitrogen fixation were estimated at 193 mg N m(-2) for S. capillifolium and 23 mg N m(-2) for P. schreberi. With moderate increases in climate warming, predicted increases in nitrogen fixation in S. capillifolium are sufficient to raise its decomposition rate. Increased temperatures may therefore act synergistically to change boreal systems from a sink to a source of carbon. PMID:19543750

  11. Exploring the Altered Dynamics of Mammalian Central Carbon Metabolic Pathway in Cancer Cells: A Classical Control Theoretic Approach

    PubMed Central

    Paul, Debjyoti; Dasgupta, Abhijit; De, Rajat K.

    2015-01-01

    Background In contrast with normal cells, most of the cancer cells depend on aerobic glycolysis for energy production in the form of adenosine triphosphate (ATP) bypassing mitochondrial oxidative phosphorylation. Moreover, compared to normal cells, cancer cells exhibit higher consumption of glucose with higher production of lactate. Again, higher rate of glycolysis provides the necessary glycolytic intermediary precursors for DNA, protein and lipid synthesis to maintain high active proliferation of the tumor cells. In this scenario, classical control theory based approach may be useful to explore the altered dynamics of the cancer cells. Since the dynamics of the cancer cells is different from that of the normal cells, understanding their dynamics may lead to development of novel therapeutic strategies. Method We have developed a model based on the state space equations of classical control theory along with an order reduction technique to mimic the actual dynamic behavior of mammalian central carbon metabolic (CCM) pathway in normal cells. Here, we have modified Michaelis Menten kinetic equation to incorporate feedback mechanism along with perturbations and cross talks associated with a metabolic pathway. Furthermore, we have perturbed the proposed model to reduce the mitochondrial oxidative phosphorylation. Thereafter, we have connected proportional-integral (PI) controller(s) with the model for tuning it to behave like the CCM pathway of a cancer cell. This methodology allows one to track the altered dynamics mediated by different enzymes. Results and Discussions The proposed model successfully mimics all the probable dynamics of the CCM pathway in normal cells. Moreover, experimental results demonstrate that in cancer cells, a coordination among enzymes catalyzing pentose phosphate pathway and intermediate glycolytic enzymes along with switching of pyruvate kinase (M2 isoform) plays an important role to maintain their altered dynamics. PMID:26367460

  12. Biomechanical Concepts for Fracture Fixation.

    PubMed

    Bottlang, Michael; Schemitsch, Christine E; Nauth, Aaron; Routt, Milton; Egol, Kenneth A; Cook, Gillian E; Schemitsch, Emil H

    2015-12-01

    Application of the correct fixation construct is critical for fracture healing and long-term stability; however, it is a complex issue with numerous significant factors. This review describes a number of common fracture types and evaluates their currently available fracture fixation constructs. In the setting of complex elbow instability, stable fixation or radial head replacement with an appropriately sized implant in conjunction with ligamentous repair is required to restore stability. For unstable sacral fractures with vertical or multiplanar instabilities, "standard" iliosacral screw fixation is not sufficient. Periprosthetic femur fractures, in particular Vancouver B1 fractures, have increased stability when using 90/90 fixation versus a single locking plate. Far cortical locking combines the concept of dynamization with locked plating to achieve superior healing of a distal femur fracture. Finally, there is no ideal construct for syndesmotic fracture stabilization; however, these fractures should be fixed using a device that allows for sufficient motion in the syndesmosis. In general, orthopaedic surgeons should select a fracture fixation construct that restores stability and promotes healing at the fracture site, while reducing the potential for fixation failure. PMID:26584263

  13. Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501

    PubMed Central

    Yan, Yongliang; Yang, Jian; Dou, Yuetan; Chen, Ming; Ping, Shuzhen; Peng, Junping; Lu, Wei; Zhang, Wei; Yao, Ziying; Li, Hongquan; Liu, Wei; He, Sheng; Geng, Lizhao; Zhang, Xiaobing; Yang, Fan; Yu, Haiying; Zhan, Yuhua; Li, Danhua; Lin, Zhanglin; Wang, Yiping; Elmerich, Claudine; Lin, Min; Jin, Qi

    2008-01-01

    The capacity to fix nitrogen is widely distributed in phyla of Bacteria and Archaea but has long been considered to be absent from the Pseudomonas genus. We report here the complete genome sequencing of nitrogen-fixing root-associated Pseudomonas stutzeri A1501. The genome consists of a single circular chromosome with 4,567,418 bp. Comparative genomics revealed that, among 4,146 protein-encoding genes, 1,977 have orthologs in each of the five other Pseudomonas representative species sequenced to date. The genome contains genes involved in broad utilization of carbon sources, nitrogen fixation, denitrification, degradation of aromatic compounds, biosynthesis of polyhydroxybutyrate, multiple pathways of protection against environmental stress, and other functions that presumably give A1501 an advantage in root colonization. Genetic information on synthesis, maturation, and functioning of nitrogenase is clustered in a 49-kb island, suggesting that this property was acquired by lateral gene transfer. New genes required for the nitrogen fixation process have been identified within the nif island. The genome sequence offers the genetic basis for further study of the evolution of the nitrogen fixation property and identification of rhizosphere competence traits required in the interaction with host plants; moreover, it opens up new perspectives for wider application of root-associated diazotrophs in sustainable agriculture. PMID:18495935

  14. Effects of Carbon Dioxide on Growth and Maltose Fermentation by Bacteroides amylophilus

    PubMed Central

    Caldwell, Daniel R.; Keeney, Mark; Van Soest, Peter J.

    1969-01-01

    The requirement of carbon dioxide for growth of Bacteroides amylophilus is quantitatively similar to that of certain other rumen bacteria. Carbon dioxide could be replaced by bicarbonate, but not by formate or certain amino acids. Label from 14CO2 was incorporated into the succinate produced during maltose fermentation by B. amylophilus, and during glucose fermentation by B. ruminicola, and during cellobiose fermentation by B. succinogenes. All of the incorporated label could be associated with the carboxyl function of the molecule. The depression in radioactivity per micromole of carbon in the succinate formed from the fermentation of uniformly labeled 14C-maltose by B. amylophilus was greater than would be expected if all of the succinate formed was produced via a direct CO2 fixation pathway(s) involving phosphoenolpyruvate or pyruvate; the radioactivity per micromole of carbon suggests that as much as 60% of the total succinate results from a pathway(s) involving direct CO2 fixation. Maltose fermentation by B. amylophilus was dependent upon CO2 concentration, but CO2 concentration could not be shown to influence either the fermentation end-product ratios or the proportion of total succinate formed attributable to CO2 fixation. PMID:5814705

  15. Mimicking a natural pathway for de novo biosynthesis: natural vanillin production from accessible carbon sources

    PubMed Central

    Ni, Jun; Tao, Fei; Du, Huaiqing; Xu, Ping

    2015-01-01

    Plant secondary metabolites have been attracting people’s attention for centuries, due to their potentials; however, their production is still difficult and costly. The rich diversity of microbes and microbial genome sequence data provide unprecedented gene resources that enable to develop efficient artificial pathways in microorganisms. Here, by mimicking a natural pathway of plants using microbial genes, a new metabolic route was developed in E. coli for the synthesis of vanillin, the most widely used flavoring agent. A series of factors were systematically investigated for raising production, including efficiency and suitability of genes, gene dosage, and culture media. The metabolically engineered strain produced 97.2 mg/L vanillin from l-tyrosine, 19.3 mg/L from glucose, 13.3 mg/L from xylose and 24.7 mg/L from glycerol. These results show that the metabolic route enables production of natural vanillin from low-cost substrates, suggesting that it is a good strategy to mimick natural pathways for artificial pathway design. PMID:26329726

  16. The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast

    NASA Astrophysics Data System (ADS)

    Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

    2008-01-01

    The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates. Using 7Be and 234Th XS, the sediment-mixing coefficient ( Db) was 4.3 ± 1.8 cm 2 y -1, a value that lies at the lower limit for marine environments, indicating that mixing was not important in these sediments at this time. Sediment accumulation rates ( Sa), estimated using 137Cs and 210Pb XS, were 0.16 ± 0.02 g cm -2 y -1. The supply rate of organic carbon to the sediment-water interface was 30 ± 3.9 mmol C m -2 d -1, of which ˜10% or 2.9 ± 0.44 mmol C m -2 d -1was lost from the system through burial below the 1-cm thick surface mixed layer. Measured fluxes of O 2 were 26 ± 3.8 mmol m -2 d -1 and equated to a carbon oxidation rate of 20 ± 3.3 mmol C m -2 d -1, which is an upper limit due to the potential for oxidation of additional reduced species. Using organic carbon gradients in the surface mixed layer, carbon oxidation was estimated at 2.6 ± 1.1 mmol C m -2 d -1. Independent estimates made using pore water concentration gradients of ammonium and C:N stoichiometry, equaled 2.8 ± 0.46 mmol C m -2 d -1. The flux of DOC out of the sediments (DOC efflux) was 5.6 ± 1.3 mmol C m -2 d -1. In general, while mass balance was achieved indicating the sediments were at steady state during this time, changes in environmental conditions within the bay and the surrounding area, mean this conclusion might not always hold. These results show that the majority of carbon oxidation occurred at the sediment-water interface, via O 2 reduction. This likely results from the high frequency of sediment resuspension events combined with the shallow sediment mixing zone, leaving anaerobic oxidants responsible for only ˜10-15% of the carbon oxidized in these sediments.

  17. Molecular Biology of Nitrogen Fixation

    ERIC Educational Resources Information Center

    Shanmugam, K. T.; Valentine, Raymond C.

    1975-01-01

    Reports that as a result of our increasing knowledge of the molecular biology of nitrogen fixation it might eventually be possible to increase the biological production of nitrogenous fertilizer from atmospheric nitrogen. (GS)

  18. Internal fixation: a historical review.

    PubMed

    Greenhagen, Robert M; Johnson, Adam R; Joseph, Alison

    2011-08-01

    Internal fixation has become a pillar of surgical specialties, yet the evolution of these devices has been relatively short. The first known description of medical management of a fracture was found in the Edwin Smith Papyrus of Ancient Egypt (circa 2600 bc). The first description of internal fixation in the medical literature was in the 18th century. The advancement of techniques and technology over the last 150 years has helped to preserve both life and function. The pace of advancement continues to accelerate as surgeons continue to seek new technology for osseous fixation. The authors present a thorough review of the history of internal fixation and the transformation into a multibillion dollar industry. PMID:21944395

  19. Trophic structure and pathways of biogenic carbon flow in the eastern North Water Polynya

    NASA Astrophysics Data System (ADS)

    Tremblay, Jean-Éric; Hattori, Hiroshi; Michel, Christine; Ringuette, Marc; Mei, Zhi-Ping; Lovejoy, Connie; Fortier, Louis; Hobson, Keith A.; Amiel, David; Cochran, Kirk

    2006-10-01

    In the eastern North Water, most of the estimated annual new and net production of carbon (C) occurred during the main diatom bloom in 1998. During the bloom, at least 30% of total and new phytoplankton production occurred as dissolved organic carbon (DOC) and was unavailable for short-term assimilation into the herbivorous food web or sinking export. Based on particle interceptor traps and 234Th deficits, 27% of the particulate primary production (PP) sank out of the upper 50 m, with only 7% and 1% of PP reaching the benthos at shallow (≈200 m) and deep (≈500 m) sites, respectively. Mass balance calculations and grazing estimates agree that ≈79% of PP was ingested by pelagic consumers between April and July. During this period, the vertical flux of biogenic silica (BioSi) at 50 m was equivalent to the total BioSi produced, indicating that all of the diatom production was removed from the euphotic zone as intact cells (direct sinking) or empty frustules (grazing or lysis). The estimated flux of empty frustules was consistent with rates of herbivory by the large, dominant copepods and appendicularians during incubations. Since the carbon demand of the dominant planktivorous bird, Alle alle, amounted to ≈2% of the biomass synthesized by its main prey, the large copepod Calanus hyperboreus, most of the secondary carbon production was available to pelagic carnivores. Stable isotopes indicated that the biomass of predatory amphipods, polar cod and marine mammals was derived from these herbivores, but corresponding carbon fluxes were not quantified. Our analysis shows that a large fraction of PP in the eastern North Water was ingested by consumers in the upper 50 m, leading to substantial carbon respiration and DOC accumulation in surface waters. An increasingly early and prolonged opening of the Artic Ocean is likely to promote the productivity of the herbivorous food web, but not the short-term efficiency of the particulate, biological CO 2 pump.

  20. Carbon-13 NMR studies and purification of gluconate pathway enzymes from Schizosaccharomyces pombe.

    PubMed

    Tsai, C S; Ye, H G; Shi, J L

    1995-01-10

    Evidence is presented to show that D-glucose in Schizosaccharomyces pombe can be metabolized via a new alternative route (gluconate pathway) in addition to the regular D-glucose 6-phosphate route. This gluconate pathway consists of two steps: oxidation of D-glucose to D-gluconate by NADP(+)-dependent glucose dehydrogenase and phosphorylation of D-gluconate to 6-phosphogluconate by gluconate kinase. The formation of D-gluconate and 6-phosphogluconate from D-glucose was monitored by 13C nuclear magnetic resonance spectroscopy using D-[1-13C]glucose and D-[U-13C]glucose. The operation of the gluconate pathway was further substantiated by the purification of its two member enzymes, glucose dehydrogenase and gluconate kinase, from the cell-free extract of the fission yeast. Glucose dehydrogenase has been purified (580-fold) to homogeneity by the combined procedures of ammonium sulfate fractionation, Sephadex gel filtration, cation-exchange chromatography, matrex gel chromatography, and agarose-NADP+ affinity chromatography. The purified enzyme is monomeric with a relative molecular weight of 6.65 x 10(4) Da. Gluconate kinase has been purified (410-fold) to near homogeneity by a combination of chromatographic procedures using Bio-gels, matrex gel, and agarose gels. The purified enzyme is monomeric with a relative molecular weight of 2.4 x 10(4) Da. The gluconate pathway presented here provides an alternative route for the D-glucose metabolism in Sch. pombe. Meanwhile, this paper documents another metabolic difference between the fission and budding yeasts. PMID:7840611

  1. Nitrogen reduction pathways in estuarine sediments: Influences of organic carbon and sulfide

    NASA Astrophysics Data System (ADS)

    Plummer, Patrick; Tobias, Craig; Cady, David

    2015-10-01

    Potential rates of sediment denitrification, anaerobic ammonium oxidation (anammox), and dissimilatory nitrate reduction to ammonium (DNRA) were mapped across the entire Niantic River Estuary, CT, USA, at 100-200 m scale resolution consisting of 60 stations. On the estuary scale, denitrification accounted for ~ 90% of the nitrogen reduction, followed by DNRA and anammox. However, the relative importance of these reactions to each other was not evenly distributed through the estuary. A Nitrogen Retention Index (NIRI) was calculated from the rate data (DNRA/(denitrification + anammox)) as a metric to assess the relative amounts of reactive nitrogen being recycled versus retained in the sediments following reduction. The distribution of rates and accompanying sediment geochemical analytes suggested variable controls on specific reactions, and on the NIRI, depending on position in the estuary and that these controls were linked to organic carbon abundance, organic carbon source, and pore water sulfide concentration. The relationship between NIRI and organic carbon abundance was dependent on organic carbon source. Sulfide proved the single best predictor of NIRI, accounting for 44% of its observed variance throughout the whole estuary. We suggest that as a single metric, sulfide may have utility as a proxy for gauging the distribution of denitrification, anammox, and DNRA.

  2. Fixation of mandibular fractures: a comparative analysis of rigid internal fixation and standard fixation techniques.

    PubMed

    Dodson, T B; Perrott, D H; Kaban, L B; Gordon, N C

    1990-04-01

    This study used a prospective design to compare standard therapy (closed or open reduction with 4 weeks of maxillomandibular fixation) to rigid internal fixation (RIF) for the treatment of mandibular fractures. Ninety-two patients with 143 fractures were evaluated and treated. There was no statistically significant difference in the treatment results between the two groups, despite a bias in the distribution of study variables that favored the standard therapy. PMID:2313443

  3. Genetic regulation of nitrogen fixation in rhizobia.

    PubMed Central

    Fischer, H M

    1994-01-01

    This review presents a comparison between the complex genetic regulatory networks that control nitrogen fixation in three representative rhizobial species, Rhizobium meliloti, Bradyrhizobium japonicum, and Azorhizobium caulinodans. Transcription of nitrogen fixation genes (nif and fix genes) in these bacteria is induced primarily by low-oxygen conditions. Low-oxygen sensing and transmission of this signal to the level of nif and fix gene expression involve at least five regulatory proteins, FixL, FixJ, FixK, NifA, and RpoN (sigma 54). The characteristic features of these proteins and their functions within species-specific regulatory pathways are described. Oxygen interferes with the activities of two transcriptional activators, FixJ and NifA. FixJ activity is modulated via phosphorylation-dephosphorylation by the cognate sensor hemoprotein FixL. In addition to the oxygen responsiveness of the NifA protein, synthesis of NifA is oxygen regulated at the level of transcription. This type of control includes FixLJ in R. meliloti and FixLJ-FixK in A. caulinodans or is brought about by autoregulation in B. japonicum. NifA, in concert with sigma 54 RNA polymerase, activates transcription from -24/-12-type promoters associated with nif and fix genes and additional genes that are not directly involved in nitrogen fixation. The FixK proteins constitute a subgroup of the Crp-Fnr family of bacterial regulators. Although the involvement of FixLJ and FixK in nifA regulation is remarkably different in the three rhizobial species discussed here, they constitute a regulatory cascade that uniformly controls the expression of genes (fixNOQP) encoding a distinct cytochrome oxidase complex probably required for bacterial respiration under low-oxygen conditions. In B. japonicum, the FixLJ-FixK cascade also controls genes for nitrate respiration and for one of two sigma 54 proteins. Images PMID:7968919

  4. Autotrophic CO2 Fixation by Chloroflexus aurantiacus: Study of Glyoxylate Formation and Assimilation via the 3-Hydroxypropionate Cycle

    PubMed Central

    Herter, Sylvia; Farfsing, Jan; Gad'On, Nasser; Rieder, Christoph; Eisenreich, Wolfgang; Bacher, Adelbert; Fuchs, Georg

    2001-01-01

    In the facultative autotrophic organism Chloroflexus aurantiacus, a phototrophic green nonsulfur bacterium, the Calvin cycle does not appear to be operative in autotrophic carbon assimilation. An alternative cyclic pathway, the 3-hydroxypropionate cycle, has been proposed. In this pathway, acetyl coenzyme A (acetyl-CoA) is assumed to be converted to malate, and two CO2 molecules are thereby fixed. Malyl-CoA is supposed to be cleaved to acetyl-CoA, the starting molecule, and glyoxylate, the carbon fixation product. Malyl-CoA cleavage is shown here to be catalyzed by malyl-CoA lyase; this enzyme activity is induced severalfold in autotrophically grown cells. Malate is converted to malyl-CoA via an inducible CoA transferase with succinyl-CoA as a CoA donor. Some enzyme activities involved in the conversion of malonyl-CoA via 3-hydroxypropionate to propionyl-CoA are also induced under autotrophic growth conditions. So far, no clue as to the first step in glyoxylate assimilation has been obtained. One possibility for the assimilation of glyoxylate involves the conversion of glyoxylate to glycine and the subsequent assimilation of glycine. However, such a pathway does not occur, as shown by labeling of whole cells with [1,2-13C2]glycine. Glycine carbon was incorporated only into glycine, serine, and compounds that contained C1 units derived therefrom and not into other cell compounds. PMID:11418572

  5. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    SciTech Connect

    John J. Kilbane III

    2003-12-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage pathway. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum.

  6. Pathways and transformations of dissolved methane and dissolved inorganic carbon in Arctic tundra soils: Evidence from analysis of stable isotopes

    NASA Astrophysics Data System (ADS)

    Throckmorton, H.; Perkins, G.; Muss, J. D.; Smith, L. J.; Conrad, M. E.; Torn, M. S.; Heikoop, J. M.; Newman, B. D.; Wilson, C. J.; Wullschleger, S. D.

    2014-12-01

    Arctic soils contain a large pool of terrestrial C and are of great interest because of their potential for releasing significant amounts of carbon dioxide (CO2) and methane (CH4) to the atmosphere. Few attempts have been made, however, to derive quantitative budgets of CO2 and CH4 budgets for high-latitude ecosystems. Therefore, this study used naturally occurring geochemical and isotopic tracers to estimate production pathways and transformations of dissolved inorganic carbon (DIC = Σ (total) dissolved CO2) and dissolved CH4 in soil pore waters from 17 locations (drainages) in Barrow, Alaska (USA) in July and September, 2013; and to approximate a complete balance of belowground C cycling at our sampling locations. Results suggest that CH4 was primarily derived from biogenic acetate fermentation, with a shift at 4 locations from July to September towards CO2 reduction as the dominant methanogenic pathway. A large majority of CH4 produced at the frost table methane was transferred directly to the atmosphere via plant roots and ebullition (94.0 ± 1.4% and 96.6 ± 5.0% in July and September). A considerable fraction of the remaining CH4 was oxidized to CO2 during upward diffusion in July and September, respectively. Methane oxidization produced <1% of CO2 relative to alternative production mechanisms in deep subsurface pore waters. The majority of subsurface CO2 was produced from anaerobic respiration, likely due to reduction of Fe oxides and humics (52 ± 6 to 100 ± 13%, on average) while CO2 produced from methanogenesis accounted for the remainder (0 ± 13% to 47 ± 6%, on average) for July and September, respectively. Dissolved CH4 and dissolved CO2 concentrations correlated with thaw depth, suggesting that Arctic ecosystems will likely produce and release a greater amount of greenhouse gasses under projected warming and deepening of active layer thaw depth under future climate change scenarios.

  7. Carbon Fluxes between Primary Metabolism and Phenolic Pathway in Plant Tissues under Stress

    PubMed Central

    Caretto, Sofia; Linsalata, Vito; Colella, Giovanni; Mita, Giovanni; Lattanzio, Vincenzo

    2015-01-01

    Higher plants synthesize an amazing diversity of phenolic secondary metabolites. Phenolics are defined secondary metabolites or natural products because, originally, they were considered not essential for plant growth and development. Plant phenolics, like other natural compounds, provide the plant with specific adaptations to changing environmental conditions and, therefore, they are essential for plant defense mechanisms. Plant defensive traits are costly for plants due to the energy drain from growth toward defensive metabolite production. Being limited with environmental resources, plants have to decide how allocate these resources to various competing functions. This decision brings about trade-offs, i.e., promoting some functions by neglecting others as an inverse relationship. Many studies have been carried out in order to link an evaluation of plant performance (in terms of growth rate) with levels of defense-related metabolites. Available results suggest that environmental stresses and stress-induced phenolics could be linked by a transduction pathway that involves: (i) the proline redox cycle; (ii) the stimulated oxidative pentose phosphate pathway; and, in turn, (iii) the reduced growth of plant tissues. PMID:26556338

  8. Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds

    SciTech Connect

    John J. Kilbane II

    2005-10-01

    The objective of the project is to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. The selective cleavage of the second C-N bond has been challenging, and efforts to overcome that challenge have been the focus of recent research in this project. Enrichment culture experiments succeeded in isolating bacterial cultures that can metabolize 2-aminobiphenyl, but no enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl has been identified. Aniline is very similar to the structure of 2-aminobiphenyl and aniline dioxygenase catalyzes the conversion of aniline to catechol and ammonia. For the remainder of the project the emphasis of research will be to simultaneously express the genes for carbazole dioxygenase and for aniline dioxygenase in the same bacterial host and then to select for derivative cultures capable of using carbazole as the sole source of nitrogen.

  9. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    SciTech Connect

    John J. Kilbane II

    2004-10-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project was focused on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate deaminase. The objective of the final phase of the project will be to develop derivative C-N bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments resulted in the isolation of microbial cultures that utilize aromatic amides as sole nitrogen sources, several amidase genes were cloned and were included in directed evolution experiments to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. During the second year of the project (October, 2003-September, 2004) enrichment culture experiments succeeded in isolating a mixed bacterial culture that can utilize 2-aminobiphenyl as a sole nitrogen source, directed evolution experiments were focused on the aniline dioxygenase enzyme that is capable of deaminating aniline, and expression vectors were constructed to enable the expression of genes encoding C-N bond cleaving enzymes in Rhodococcus hosts. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum. Aromatic compounds such as carbazole are representative of the difficult-to-treat organonitrogen compounds most commonly encountered in petroleum. There are two C-N bonds in carbazole and the construction of a metabolic pathway for the removal of nitrogen from carbazole will require enzymes capable cleaving both C-N bonds. A multi-component enzyme, carbazole dioxygenase, which can selectively cleave the first C-N bond has been identified and the genes that encode this enzyme have been cloned, sequenced, and are being expressed in Rhodococcus erythropolis, a bacterial culture that tolerates exposure to petroleum. An enzyme capable of selectively cleaving the second C-N bond in carbazole has not yet been identified, but enrichment culture experiments have recently succeeded in isolating a bacterial culture that is a likely candidate and may possess a suitable enzyme. Research in the near future will verify if a suitable enzyme for the cleavage of the second C-N bond in carbazole has indeed been found, then the genes encoding a suitable enzyme will be identified, cloned, and sequenced. Ultimately genes encoding enzymes for selective cleavage of both C-N bonds in carbazole will be assembled into a new metabolic pathway and the ability of the resulting bacterial culture to remove nitrogen from petroleum will be determined.

  10. Nitrogen fixation in boreal peatlands: the effects of increased N deposition on N2-fixation

    NASA Astrophysics Data System (ADS)

    Popma, J. M.; Wieder, R.; Lamers, L.; Vile, M. A.

    2013-12-01

    Boreal peatlands are of great importance to global carbon and nitrogen cycling. While covering only 3-4 % of the terrestrial surface, they account for 25-30 % of the world's soil C and 9-15 % of the world's soil N. In Western Canada atmospheric dry deposition rates are extremely low: approximately 1 kg N ha-1 yr-1. Though these systems have been functioning as net sinks over the past 11,000 years, natural and anthropogenic disturbances might compromise the historical balance of C and N. Biological N2-fixation has recently been shown to represent a very significant input of N into these systems, contributing to 62% of total N in Western Canada. Interactions between N deposition and biological N2-fixation are as yet, unknown, but the impact of elevated deposition of N-compounds from increased industrial expansion of oil sands mining to peatlands, is concerning. Given that nitrogenase, the enzyme responsible for catalyzing N2-fixation, is energetically costly when active, enhanced inputs of atmospheric N deposition could be a major determinant for enzyme activity and rates of biological N input to these bogs. Understanding interactions between N deposition and N2 fixation in boreal peatlands can aid in predicting the consequences of increased N deposition and setting critical loads. We conducted a field-fertilization experiment in a poor fen in Alberta, Canada, to determine the effects of enhanced N deposition on a dominant fen species Sphagnum angustifolium. The experiment consisted of seven N treatments: Control, 0, 5, 10, 15, 20 and 25 kg N ha-1 y1, n=3. N2-fixation was measured during summer 2012 and 2013 using the acetylene reduction assay (ARA). ARA rates were converted to rates of N2-fixation by calibrating ARA with paired 15N2-incubations. In both 2012 and 2013, with increasing N deposition from 0 kg N ha-1 yr-1 to 25 kg N ha-1 yr-1, rates of N2 fixation decreased, with highest rates in the 0 kg N ha-1 yr-1 treatment mosses (54.2 × 1.40; 48.58 × 7.12 kg N ha-1 yr-1, mean × std err for 2012 and 2013, respectively) followed by progressively lower rates with a low of 5.02 × 0.87 in 2012 and 8.94 × 3.09 in 2013 (mean × std err). As biological N2-fixation is an energetically costly process, up-regulating enzyme activity when N availability is low and down-regulating activity when N deposition is enhanced makes thermodynamic and evolutionary sense. N2-fixation shows to be one of the most early-warning indicators to the early response of boreal peatlands to increased N deposition, and can aid in setting critical loads to protect these historically pristine ecosystems.

  11. Delayed Turnover of Unphosphorylated Ssk1 during Carbon Stress Activates the Yeast Hog1 Map Kinase Pathway

    PubMed Central

    Vallejo, Milene Carmes; Mayinger, Peter

    2015-01-01

    In Saccharomyces cerevisiae, the Hog1 mitogen-activated protein kinase (MAPK) pathway coordinates the adaptation to osmotic stress and was recently reported to respond to acute changes in glucose levels. Similarly as in osmotic stress, glucose starvation leads to a transient accumulation of Hog1 in the nucleus. However, the kinetics and the mechanism of Hog1 activation are different for these stress conditions. During osmotic shock the activation of Hog1 can be transduced by either the Sho1 or the Sln1/Ypd1/Ssk1 branch. During glucose starvation the phosphorylation of Hog1 is slower and is completely dependent on Ssk1, but independent of Sho1. To characterize the mechanism of activation of Hog1 during carbon stress, we examined the turnover of Ssk1 protein levels upon glucose starvation in the presence of cycloheximide and monitored protein levels by western blotting. Our data demonstrate that unphosphorylated Ssk1 was quickly degraded during exponential growth and after osmotic stress but remained remarkably stable during glucose limitation. We conclude that glucose starvation induces a delay in the turnover of unphosphorylated Ssk1, which is sufficient to activate the Hog1 MAPK pathway. Although unphosphorylated Ssk1 is known to be degraded by the proteasome, its stabilization is apparently not due to changes in cellular localization or decrease in ubiquitination levels during glucose limitation. PMID:26340004

  12. Multi-Walled Carbon Nanotubes Promote Cementoblast Differentiation and Mineralization through the TGF-β/Smad Signaling Pathway

    PubMed Central

    Li, Lu; Zhu, Zhimin; Xiao, Weixiong; Li, Lei

    2015-01-01

    Excretion of cementum by cementoblasts on the root surface is a process indispensable for the formation of a functional periodontal ligament. This study investigated whether carboxyl group-functionalized multi-walled carbon nanotubes (MWCNT-COOH) could enhance differentiation and mineralization of mammalian cementoblasts (OCCM-30) and the possible signaling pathway involved in this process. Cementoblasts were incubated with various doses of MWCNT-COOH suspension. Cell viability was detected, and a scanning electron microscopy (SEM) observed both the nanomaterials and the growth of cells cultured with the materials. Alizarin red staining was used to investigate the formation of calcium deposits. Real-time PCR and western blot were used to detect cementoblast differentiation and the underlying mechanisms through the expression of the osteogenic genes and the downstream effectors of the TGF-β/Smad signaling. The results showed that 5 µg/mL MWCNT-COOH had the most obvious effects on promoting differentiation without significant toxicity. Alp, Ocn, Bsp, Opn, Col1 and Runx2 gene expression was up-regulated. Smad2 and Smad3 mRNA was up-regulated, while Smad7 was first down-regulated on Day 3 and later up-regulated on Day 7. The elevated levels of phospho-Smad2/3 were also confirmed by western blot. In sum, the MWCNT-COOH promoted cementoblast differentiation and mineralization, at least partially, through interactions with the TGF-β/Smad pathway. PMID:25648319

  13. Carbon nanotubes enhance intercalated disc assembly in cardiac myocytes via the β1-integrin-mediated signaling pathway.

    PubMed

    Sun, Hongyu; Lü, Shuanghong; Jiang, Xiao-Xia; Li, Xia; Li, Hong; Lin, Qiuxia; Mou, Yongchao; Zhao, Yuwei; Han, Yao; Zhou, Jin; Wang, Changyong

    2015-07-01

    Carbon nanotubes (CNTs) offer a new paradigm for constructing functional cardiac patches and repairing myocardial infarction (MI). However, little is known about how CNTs enhance the mechanical integrity and electrophysiological function of cardiac myocytes. To address this issue, we investigated the regularity and precise mechanism of the influence of CNTs on the assembly of intercalated disc (IDs). Here, single walled CNTs incorporated into collagen substrates were utilized as growth supports for neonatal cardiomyocytes, which enhanced cardiomyocyte adhesion and maturation. Furthermore, through the use of immunohistochemical staining, western blotting, transmission electron microscopy, and intracellular calcium transient measurement, we discovered that the addition of CNTs remarkably increased ID-related protein expression and enhanced ID assembly and functionality. On that basis, we further explored the underlying mechanism for how CNTs enhanced ID assembly through the use of immunohistochemical staining and western blotting. We found that the β1-integrin-mediated signaling pathway mediated CNT-induced upregulation of electrical and mechanical junction proteins. Notably, CNTs remarkably accelerated gap junction formation via activation of the β1-integrin-mediated FAK/ERK/GATA4 pathway. These findings provide valuable insight into the mechanistic effects that CNTs have on neonatal cardiomyocyte performance and will have a significant impact on the future of nanomedical research. PMID:25934454

  14. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    SciTech Connect

    Snyder-Talkington, Brandi N.; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R.; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L.

    2013-10-15

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 μg MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung inflammation and fibrosis were revealed. • Two functional, representative genes, ccl2 and vegfa, were validated in vitro.

  15. Femoral Reconstruction Using External Fixation

    PubMed Central

    Palatnik, Yevgeniy; Rozbruch, S. Robert

    2011-01-01

    Background. The use of an external fixator for the purpose of distraction osteogenesis has been applied to a wide range of orthopedic problems caused by such diverse etiologies as congenital disease, metabolic conditions, infections, traumatic injuries, and congenital short stature. The purpose of this study was to analyze our experience of utilizing this method in patients undergoing a variety of orthopedic procedures of the femur. Methods. We retrospectively reviewed our experience of using external fixation for femoral reconstruction. Three subgroups were defined based on the primary reconstruction goal lengthening, deformity correction, and repair of nonunion/bone defect. Factors such as leg length discrepancy (LLD), limb alignment, and external fixation time and complications were evaluated for the entire group and the 3 subgroups. Results. There was substantial improvement in the overall LLD, femoral length discrepancy, and limb alignment as measured by mechanical axis deviation (MAD) and lateral distal femoral angle (LDFA) for the entire group as well as the subgroups. Conclusions. The Ilizarov external fixator allows for decreased surgical exposure and preservation of blood supply to bone, avoidance of bone grafting and internal fixation, and simultaneous lengthening and deformity correction, making it a very useful technique for femoral reconstruction. PMID:21991425

  16. Evidence of a common pathway of carbon dioxide reduction to methane in methanogens.

    PubMed Central

    Jones, W J; Donnelly, M I; Wolfe, R S

    1985-01-01

    The roles of methanofuran and tetrahydromethanopterin as carriers of C1 moieties in the reduction of carbon dioxide to methane were studied in representatives of diverse groups of methanogens, confirming that these roles, first reported for Methanobacterium thermoautotrophicum, are common for methanogenesis in general. Extracts of the methanogens tested converted formyl-methanofuran and methyl-tetrahydromethanopterin to methane; the extractable cofactors derived from the same methanogens, with one exception, complemented a methanofuran- and tetrahydromethanopterin-deficient enzyme system from M. thermoautotrophicum. The amounts of extractable methanofuran and tetrahydromethanopterin were determined for each representative methanogen. PMID:3924891

  17. Pathway analysis using (13) C-glycerol and other carbon tracers reveals a bipartite metabolism of Legionella pneumophila.

    PubMed

    Häuslein, Ina; Manske, Christian; Goebel, Werner; Eisenreich, Wolfgang; Hilbi, Hubert

    2016-04-01

    Amino acids represent the prime carbon and energy source for Legionella pneumophila, a facultative intracellular pathogen, which can cause a life-threatening pneumonia termed Legionnaires' disease. Genome, transcriptome and proteome studies indicate that L. pneumophila also utilizes carbon substrates other than amino acids. We show here that glycerol promotes intracellular replication of L. pneumophila in amoeba or macrophages (but not extracellular growth) dependent on glycerol-3-phosphate dehydrogenase, GlpD. An L. pneumophila mutant strain lacking glpD was outcompeted by wild-type bacteria upon co-infection of amoeba, indicating an important role of glycerol during infection. Isotopologue profiling studies using (13) C-labelled substrates were performed in a novel minimal defined medium, MDM, comprising essential amino acids, proline and phenylalanine. In MDM, L. pneumophila utilized (13) C-labelled glycerol or glucose predominantly for gluconeogenesis and the pentose phosphate pathway, while the amino acid serine was used for energy generation via the citrate cycle. Similar results were obtained for L. pneumophila growing intracellularly in amoeba fed with (13) C-labelled glycerol, glucose or serine. Collectively, these results reveal a bipartite metabolism of L. pneumophila, where glycerol and carbohydrates like glucose are mainly fed into anabolic processes, while serine serves as major energy supply. PMID:26691313

  18. Transcript level coordination of carbon pathways during silicon starvation-induced lipid accumulation in the diatom Thalassiosira pseudonana.

    PubMed

    Smith, Sarah R; Glé, Corine; Abbriano, Raffaela M; Traller, Jesse C; Davis, Aubrey; Trentacoste, Emily; Vernet, Maria; Allen, Andrew E; Hildebrand, Mark

    2016-05-01

    Diatoms are one of the most productive and successful photosynthetic taxa on Earth and possess attributes such as rapid growth rates and production of lipids, making them candidate sources of renewable fuels. Despite their significance, few details of the mechanisms used to regulate growth and carbon metabolism are currently known, hindering metabolic engineering approaches to enhance productivity. To characterize the transcript level component of metabolic regulation, genome-wide changes in transcript abundance were documented in the model diatom Thalassiosira pseudonana on a time-course of silicon starvation. Growth, cell cycle progression, chloroplast replication, fatty acid composition, pigmentation, and photosynthetic parameters were characterized alongside lipid accumulation. Extensive coordination of large suites of genes was observed, highlighting the existence of clusters of coregulated genes as a key feature of global gene regulation in T. pseudonana. The identity of key enzymes for carbon metabolic pathway inputs (photosynthesis) and outputs (growth and storage) reveals these clusters are organized to synchronize these processes. Coordinated transcript level responses to silicon starvation are probably driven by signals linked to cell cycle progression and shifts in photophysiology. A mechanistic understanding of how this is accomplished will aid efforts to engineer metabolism for development of algal-derived biofuels. PMID:26844818

  19. Specific inhibitors for identifying pathways for methane production from carbon monoxide by a nonadapted anaerobic mixed culture.

    PubMed

    Navarro, Silvia Sancho; Cimpoia, Ruxandra; Bruant, Guillaume; Guiot, Serge R

    2014-06-01

    Specific inhibitors such as 2-bromoethanesulfonate (BES) and vancomycin were employed in activity batch tests to decipher metabolic pathways that are preferentially used by a mixed anaerobic consortium (sludge from an anaerobic digester) to transform carbon monoxide (CO) into methane (CH4). We first evaluated the inhibitory effect of both BES and vancomycin on the microbial community, as well as the efficiency and stability of vancomycin at 35 °C, over time. The activity tests with CO2-H2, CO, glucose, acetate, formate, propionate, butyrate, methanol, and ethanol showed that vancomycin does not inhibit some Gram-negative bacteria, and 50 mmol/L BES effectively blocks CH4 production in the sludge. However, when sludge was incubated with propionate, butyrate, methanol, or ethanol as the sole energy and carbon source, methanogenesis was only partially inhibited by BES. Separate tests showed that 0.07 mmol/L vancomycin is enough to maintain its inhibitory efficiency and stability in the population for at least 32 days at 35 °C. Using the inhibitors above, it was demonstrated that CO conversion to CH4 is an indirect, 2-step process, in which the CO is converted first to acetate and subsequently to CH4. PMID:24896194

  20. External fixation in child traumatology.

    PubMed

    Quintin, J; Evrard, H; Gouat, P; Cornil, C; Burny, F

    1984-03-01

    The authors present their experience of Hoffmann® external fixation in pediatric traumatology. Fractures of the lower limb are the most frequent (47 tibias, 13 femurs); a few fractures involved the upper extremity. The Hoffmann device constituted the complete treatment, using a light configuration frame in order to obtain elastic fixation and periosteal healing. Pin reactions are more frequent where the pin tract penetrates large soft tissue structures, as at the proximal femur. Only one refracture occurred after healing. Transient impairment of range of motion may be expected. Use of the Hoffmann fixator is recommended in children with open fractures or fractures associated with soft tissue lesions, in children with head injury with resultant increased motor tone, and in polytrauma patients to facilitate patient care and transport for reassessment and therapeutic procedures. PMID:24823079

  1. Biomechanical analysis of lumbosacral fixation.

    PubMed

    McCord, D H; Cunningham, B W; Shono, Y; Myers, J J; McAfee, P C

    1992-08-01

    Flexion testing was performed until failure on 66 lumbosacral bovine spinal segments comparing ten different lumbosacral instrumentation techniques. Maximum flexion moment at failure, flexural stiffness, and maximum angulation of the lumbosacral joint at failure were determined as well as strain measurements across the anterior aspect of the lumbosacral intervertebral disc using an extensometer. The maximum moment at failure was significantly greater for the only two devices that extended fixation into the ilium anterior to the projected image of the middle osteoligamentous column: ISOLA Galveston and ISOLA iliac screws (F = 12.2, P less than 0.001). The maximum stiffness at failure reinforced these findings (F = 23.7, P less than 0.001). A second subset of stability showed the advantages of S2 pedicle fixation by increasing the flexural lever arm (Cotrel-Dubousset butterfly plate, and Cotrel-Dubousset Chopin block, P less than 0.05). This exhaustive in vitro biomechanical study introduces the concept of a pivot point at the lumbosacral joint at the intersection of the middle osteoligamentous column (sagittal plane) and the lumbosacral intervertebral disc (transverse plane). A spinal surgeon can increase the stability of lumbosacral instrumentation by extending fixation through the anterior sacral cortex (Steffee plate group with pedicle screws that medially converge in a triangular fashion). A means of enhancing this fixation was to achieve more inferior purchase by extending the fixation down to the S2 pedicle (Cotrel-Dubousset Chopin and Cotrel-Dubousset butterfly groups). However, the best fixation was achieved by obtaining purchase between the iliac cortices down into the superior acetabular bone.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1523506

  2. The importance of nodule CO2 fixation for the efficiency of symbiotic nitrogen fixation in pea at vegetative growth and during pod formation

    PubMed Central

    Fischinger, Stephanie Anastasia; Schulze, Joachim

    2010-01-01

    Nodule CO2 fixation is of pivotal importance for N2 fixation. The process provides malate for bacteroids and oxaloacetate for nitrogen assimilation. The hypothesis of the present paper was that grain legume nodules would adapt to higher plant N demand and more restricted carbon availability at pod formation through increased nodule CO2 fixation and a more efficient N2 fixation. Growth, N2 fixation, and nodule composition during vegetative growth and at pod formation were studied in pea plants (Pisum sativum L.). In parallel experiments, 15N2 and 13CO2 uptake, as well as nodule hydrogen and CO2 release, was measured. Plants at pod formation showed higher growth rates and N2 fixation per plant when compared with vegetative growth. The specific activity of active nodules was about 25% higher at pod formation. The higher nodule activity was accompanied by higher amino acid concentration in nodules and xylem sap with a higher share of asparagine. Nodule 13CO2 fixation was increased at pod formation, both per plant and per 15N2 fixed unit. However, malate concentration in nodules was only 40% of that during vegetative growth and succinate was no longer detectable. The data indicate that increased N2 fixation at pod formation is connected with strongly increased nodule CO2 fixation. While the sugar concentration in nodules at pod formation was not altered, the concentration of organic acids, namely malate and succinate, was significantly lower. It is concluded that strategies to improve the capability of nodules to fix CO2 and form organic acids might prolong intensive N2 fixation into the later stages of pod formation and pod filling in grain legumes. PMID:20363863

  3. Percutaneous fixation of scaphoid fractures.

    PubMed

    Slade, J F; Jaskwhich, D

    2001-11-01

    The scaphoid proximal pole and waist fractures presented here were treated by a novel dorsal percutaneous technique with arthroscopic assistance. All fractures healed, with good final functional results and no complications. The advantages of the dorsal percutaneous approach to scaphoid fixation are: (1) the proximal-to-distal placement of the guide pin and screw allow for more precise placement along the central axis of the scaphoid, which decreases healing time and reduces risk of screw thread exposure. (2) The dorsal approach avoids injuring the vulnerable volar ligament anatomy. And (3) the insertion of the screw from the proximal to distal direction allows the more rigid fixation of proximal scaphoid fractures. Arthroscopy allows confirmation of fracture reduction and screw implantation as well as evaluation of concurrent ligament injuries not detected with standard imaging. Percutaneous K-wires act as joysticks to reduce and compress fracture fragments prior to fixation. The presented technique allows for early, rigid internal fixation with minimal associated morbidity. Patients successfully treated with this technique include those with stable and unstable acute fractures of the scaphoid at all locations, including the proximal pole. Nondisplaced fractures that present with delayed or fibrous union without evidence of avascular necrosis, cyst formation, or bony sclerosis may also be treated with this technique. This technique allows for faster rehabilitation and an earlier return to work or avocation without restriction once CT scan confirms a solid union. Some articles document extraordinary rapid healing by standard radiographs; however, we caution that scaphoid bone healing cannot accurately be determined without CT scan. Percutaneous, arthroscopically assisted internal fixation by a dorsal approach may be considered in all acute scaphoid fractures selected for surgical fixation. The dorsal guidewire permits dorsal and volar implantation of a cannulated screw along the central axis of the scaphoid. This technique permits the reduction of displaced fractures and the stable repair of fractures of the proximal pole. In addition, selected scaphoid fibrous union or delayed union may also be repaired, with realistic expectations of healing. The proven benefits of the percutaneous technique include decreased soft tissue trauma; arthroscopic visualization of the fracture, ensuring anatomic reduction; and stable fixation, allowing early physical rehabilitation. The theoretical benefits of the technique include decreased risk of interruption of the tenuous scaphoid blood supply. Percutaneous internal fixation of scaphoid fractures provides faster rehabilitation, earlier return to work, and quicker bony union in most patients. PMID:11775468

  4. Lumped pathway metabolic model of organic carbon accumulation and mobilization by the alga Chlamydomonas reinhardtii.

    PubMed

    Guest, Jeremy S; van Loosdrecht, Mark C M; Skerlos, Steven J; Love, Nancy G

    2013-04-01

    Phototrophic microorganisms have significant potential as bioenergy feedstocks, but the sustainability of large-scale cultivation will require the use of wastewater as a renewable resource. A key barrier to this advancement is a lack of bioprocess understanding that would enable the design and implementation of efficient and resilient mixed community, naturally lit cultivation systems. In this study, a lumped pathway metabolic model (denoted the phototrophic process model or PPM) was developed for mixed phototrophic communities subjected to day/night cycling. State variables included functional biomass (XCPO), stored carbohydrates (XCH), stored lipids (XLI), nitrate (SNO), phosphate (SP), and others. PPM metabolic reactions and stoichiometry were based on Chlamydomonas reinhardtii , but experiments for model calibration and validation were performed in flat panel photobioreactors (PBRs) originally inoculated with biomass from a phototrophic system at a wastewater treatment plant. PBRs were operated continuously as cyclostats to poise cells for intrinsic kinetic parameter estimation in batch studies, which included nutrient-available conditions in light and dark as well as nitrogen-starved and phosphorus-starved conditions in light. The model was calibrated and validated and was shown to be a reasonable predictor of growth, lipid and carbohydrate storage, and lipid and carbohydrate mobilization by a mixed microbial community. PMID:23452258

  5. Carbon isotopic composition of individual Precambrian microfossils.

    PubMed

    House, C H; Schopf, J W; McKeegan, K D; Coath, C D; Harrison, T M; Stetter, K O

    2000-08-01

    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment. PMID:11543502

  6. Carbon isotopic composition of individual Precambrian microfossils

    NASA Technical Reports Server (NTRS)

    House, C. H.; Schopf, J. W.; McKeegan, K. D.; Coath, C. D.; Harrison, T. M.; Stetter, K. O.

    2000-01-01

    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

  7. Hydrogen coupled CO2 fixation in legume cropping systems

    NASA Astrophysics Data System (ADS)

    Philpott, T.; Cen, Y.; Layzell, D. B.; Kyser, K.; Scott, N. A.

    2009-05-01

    Electron flow from oxidation of excess H2 released by root nodules was shown to contribute to microbial CO2 fixation in soybean crops. This discovery has important implications for carbon storage in soils used to grow legumes; however, further research is needed to understand the fate and turnover time of this H2-coupled CO2 fixation. Isotopic labeling of soil through incubation with 13CO2 was used to elucidate movement of sequestered carbon into soil carbon pools. Measurement of isotopic shifts was determined using Isotope Ratio Mass Spectrometry. Preliminary experiments have confirmed CO2 uptake through an isotopic shift (Δ13C -20.4 to -14.5 ‰) in 24 hour incubated soils labeled with 13CO2 (1% v/v, 99.5 Atom%) under elevated H2 concentration (6000 ppm). Other incubation experiments have confirmed the biotic nature of observed CO2 uptake by comparing isotopic shifts in oven dried and autoclaved soils to moist soil. Under an elevated H2 atmosphere, no significant isotopic shift was observed in dry and autoclaved soils whereas moist soil showed an isotopic shift of Δ13C -21.9 to 11.4 ‰ over 48 hours. Future experiments will involve longer incubations (7 days) and will be aimed at determining isotopic shifts within soil carbon pools. Samples will be incubated and fractionated into microbial biomass, light fraction carbon, and acid stable carbon and subsequent isotopic analysis will be carried out. This will help determine the distribution of H2- coupled fixed CO2 within soil carbon pools and the turnover time of sequestered carbon. This and further research may lead to modification of greenhouse gas coefficients for leguminous crops that includes a CO2 fixation component.

  8. N2 fixation in eddies of the eastern tropical South Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Löscher, C. R.; Bourbonnais, A.; Dekaezemacker, J.; Charoenpong, C. N.; Altabet, M. A.; Bange, H. W.; Czeschel, R.; Hoffmann, C.; Schmitz, R. A.

    2015-11-01

    Mesoscale eddies play a major role in controlling ocean biogeochemistry. By impacting nutrient availability and water column ventilation, they are of critical importance for oceanic primary production. In the eastern tropical South Pacific Ocean off Peru, where a large and persistent oxygen deficient zone is present, mesoscale processes have been reported to occur frequently. However, investigations on their biological activity are mostly based on model simulations, and direct measurements of carbon and dinitrogen (N2) fixation are scarce. We examined an open ocean cyclonic eddy and two anticyclonic mode water eddies: a coastal one and an open ocean one in the waters off Peru along a section at 16° S in austral summer 2012. Molecular data and bioassay incubations point towards a difference between the active diazotrophic communities present in the cyclonic eddy and the anticyclonic mode water eddies. In the cyclonic eddy, highest rates of N2 fixation were measured in surface waters but no N2 fixation signal was detected at intermediate water depths. In contrast, both anticyclonic mode water eddies showed pronounced maxima in N2 fixation below the euphotic zone as evidenced by rate measurements and geochemical data. N2 fixation and carbon (C) fixation were higher in the young coastal mode water eddy compared to the older offshore mode water eddy. A co-occurrence between N2 fixation and biogenic N2, an indicator for N loss, indicated a link between N loss and N2 fixation in the mode water eddies, which was not observed for the cyclonic eddy. The comparison of two consecutive surveys of the coastal mode water eddy in November and December 2012 revealed also a reduction of N2 and C fixation at intermediate depths along with a reduction in chlorophyll by half, mirroring an aging effect in this eddy. Our data indicate an important role for anticyclonic mode water eddies in stimulating N2 fixation and thus supplying N offshore.

  9. N2 fixation in eddies of the eastern tropical South Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Loscher, Carolin R.; Bourbonnais, Annie; Dekaezemacker, Julien; Charoenpong, Chawalit N.; Altabet, Mark A.; Bange, Hermann W.; Czeschel, Rena; Hoffmann, Chris; Schmitz, Ruth

    2016-05-01

    Mesoscale eddies play a major role in controlling ocean biogeochemistry. By impacting nutrient availability and water column ventilation, they are of critical importance for oceanic primary production. In the eastern tropical South Pacific Ocean off Peru, where a large and persistent oxygen-deficient zone is present, mesoscale processes have been reported to occur frequently. However, investigations into their biological activity are mostly based on model simulations, and direct measurements of carbon and dinitrogen (N2) fixation are scarce.We examined an open-ocean cyclonic eddy and two anticyclonic mode water eddies: a coastal one and an open-ocean one in the waters off Peru along a section at 16° S in austral summer 2012. Molecular data and bioassay incubations point towards a difference between the active diazotrophic communities present in the cyclonic eddy and the anticyclonic mode water eddies.In the cyclonic eddy, highest rates of N2 fixation were measured in surface waters but no N2 fixation signal was detected at intermediate water depths. In contrast, both anticyclonic mode water eddies showed pronounced maxima in N2 fixation below the euphotic zone as evidenced by rate measurements and geochemical data. N2 fixation and carbon (C) fixation were higher in the young coastal mode water eddy compared to the older offshore mode water eddy. A co-occurrence between N2 fixation and biogenic N2, an indicator for N loss, indicated a link between N loss and N2 fixation in the mode water eddies, which was not observed for the cyclonic eddy. The comparison of two consecutive surveys of the coastal mode water eddy in November 2012 and December 2012 also revealed a reduction in N2 and C fixation at intermediate depths along with a reduction in chlorophyll by half, mirroring an aging effect in this eddy. Our data indicate an important role for anticyclonic mode water eddies in stimulating N2 fixation and thus supplying N offshore.

  10. Missing nitrogen fixation in the Benguela region

    NASA Astrophysics Data System (ADS)

    Wasmund, Norbert; Struck, Ulrich; Hansen, Anja; Flohr, Anita; Nausch, Günther; Grüttmüller, Annett; Voss, Maren

    2015-12-01

    Opposing opinions on the importance of nitrogen fixation in the northern Benguela upwelling region provoked us to investigate the magnitude of nitrogen fixation in front of northern Namibia and southern Angola. Measurements of nitrogen fixation rates using the 15N method at 66 stations during seven cruises from 2008 to 2014 showed that, in general, the 15N content in the biomass did not increase after tracer incubation with 15N2, indicating that no nitrogen fixation occurred. Correspondingly, the filamentous nitrogen-fixing cyanobacterium Trichodesmium was almost not present. The abundant picocyanobacteria did obviously not perform nitrogen fixation to a significant degree. The artificial improvement of conditions for nitrogen fixation in mesocosm experiments, including phosphate and iron additions and a warmer temperature, failed to induce nitrogen fixation. A plausible explanation of these findings is a lack of conditioned cells for nitrogen fixation in the Benguela region.

  11. Tricarboxylic Acid Cycle and One-Carbon Metabolism Pathways Are Important in Edwardsiella ictaluri Virulence

    PubMed Central

    Dahal, Neeti; Abdelhamed, Hossam; Lu, Jingjun; Karsi, Attila; Lawrence, Mark L.

    2013-01-01

    Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of channel catfish (ESC). The disease causes considerable economic losses in the commercial catfish industry in the United States. Although antibiotics are used as feed additive, vaccination is a better alternative for prevention of the disease. Here we report the development and characterization of novel live attenuated E. ictaluri mutants. To accomplish this, several tricarboxylic acid cycle (sdhC, mdh, and frdA) and one-carbon metabolism genes (gcvP and glyA) were deleted in wild type E. ictaluri strain 93-146 by allelic exchange. Following bioluminescence tagging of the E. ictaluri ΔsdhC, Δmdh, ΔfrdA, ΔgcvP, and ΔglyA mutants, their dissemination, attenuation, and vaccine efficacy were determined in catfish fingerlings by in vivo imaging technology. Immunogenicity of each mutant was also determined in catfish fingerlings. Results indicated that all of the E. ictaluri mutants were attenuated significantly in catfish compared to the parent strain as evidenced by 2,265-fold average reduction in bioluminescence signal from all the mutants at 144 h post-infection. Catfish immunized with the E. ictaluri ΔsdhC, Δmdh, ΔfrdA, and ΔglyA mutants had 100% relative percent survival (RPS), while E. ictaluri ΔgcvP vaccinated catfish had 31.23% RPS after re-challenge with the wild type E. ictaluri. PMID:23762452

  12. Liquiritigenin Protects Rats from Carbon Tetrachloride Induced Hepatic Injury through PGC-1? Pathway

    PubMed Central

    Zhang, Yiping; He, Yuanqiao; Yu, Hongbo; Ma, Fuying; Wu, Jianguo; Zhang, Xiaoyu

    2015-01-01

    The lack of effective treatment for liver cirrhosis and hepatocellular carcinomas imposes serious challenges to the healthcare system. Here, we investigated the efficacy and mechanism of liquiritigenin involved in preventing or retarding the progression of liver diseases in a rat model with chronic carbon tetrachloride (CCl4) exposure. Sprague Dawley rats were given CCl4 and lliquiritigenin alone or simultaneously for 8 weeks before liver was harvested to check histological changes by Hematoxylin and Eosin (H&E) staining, apoptosis by TUNEL assay, ROS by dihydroethidium staining, antioxidant enzyme activities and malondialdehyde using specific kits, and gene expression by quantitative real-time PCR and western blot. Chronic CCl4 exposure caused profound changes in liver histology with extensive hepatocyte death (necrosis and apoptosis), fat accumulation, and infiltration of inflammatory cells, accompanied by depressed activities of antioxidant enzymes, increased oxidative stress, elevated expression of inflammation and fibrotic genes, and downregulation of PGC-1?, ND1, and Bcl-x in rat liver. All these changes were abolished or alleviated by lliquiritigenin. The results demonstrated that liquiritigenin is effective in protecting liver from injury or treating chronic liver diseases. The modulation of PGC-1? and its downstream genes might play a critical role in relieving CCl4-induced hepatic pathogenesis by liquiritigenin. PMID:26199636

  13. External fixation of Charcot arthropathy.

    PubMed

    Herbst, Steven A

    2004-09-01

    Deformity, instability, and ulceration are present in a high percentage of patients who have Charcot arthropathy. Traditional treatment of these conditions has consisted of debridement, antibiotics, and immobilization with limited weight bearing. These measures are followed by long-term use of various foot and ankle bracing devices, such as the CROW walker, double metal upright, and the lined clam shell AFO with accommodative footwear either incorporated or attached. Sometimes these conservative measures fail and surgery is indicated for foot and ankle deformities with: (1) unbraceable deformity; (2) recurrent ulceration secondary to deformity, instability, or both; and (3) Charcot arthropathy with pain that is unresponsive to conservative measures. Certain acute traumatic situations with impending deformity also may benefit from early surgical stabilization. High deep infection rates (25%) have been reported in surgical reconstruction of feet that have a history of ulceration. The high rates of infection with internal fixation techniques and improved external fixation devices have led surgeons to consider external fixation as a viable alternative for: (1) singlestage correction of a limb with recent or current ulceration; (2) revision or salvage of previously reconstructed limbs; and (3) acute treatment of insufficiency type fractures (impending Charcot arthropathy) in the diabetic who has severe peripheral neuropathy with or without adjuvant internal fixation. PMID:15324793

  14. Weakly Supervised Human Fixations Prediction.

    PubMed

    Zhang, Luming; Li, Xuelong; Nie, Liqiang; Yang, Yi; Xia, Yingjie

    2016-01-01

    Automatically predicting human eye fixations is a useful technique that can facilitate many multimedia applications, e.g., image retrieval, action recognition, and photo retargeting. Conventional approaches are frustrated by two drawbacks. First, psychophysical experiments show that an object-level interpretation of scenes influences eye movements significantly. Most of the existing saliency models rely on object detectors, and therefore, only a few prespecified categories can be discovered. Second, the relative displacement of objects influences their saliency remarkably, but current models cannot describe them explicitly. To solve these problems, this paper proposes weakly supervised fixations prediction, which leverages image labels to improve accuracy of human fixations prediction. The proposed model hierarchically discovers objects as well as their spatial configurations. Starting from the raw image pixels, we sample superpixels in an image, thereby seamless object descriptors termed object-level graphlets (oGLs) are generated by random walking on the superpixel mosaic. Then, a manifold embedding algorithm is proposed to encode image labels into oGLs, and the response map of each prespecified object is computed accordingly. On the basis of the object-level response map, we propose spatial-level graphlets (sGLs) to model the relative positions among objects. Afterward, eye tracking data is employed to integrate these sGLs for predicting human eye fixations. Thorough experiment results demonstrate the advantage of the proposed method over the state-of-the-art. PMID:26168451

  15. Carbon monoxide alleviates ethanol-induced oxidative damage and inflammatory stress through activating p38 MAPK pathway

    SciTech Connect

    Li, Yanyan; Gao, Chao; Shi, Yanru; Tang, Yuhan; Liu, Liang; Xiong, Ting; Du, Min; Xing, Mingyou; Liu, Liegang; Yao, Ping

    2013-11-15

    Stress-inducible protein heme oxygenase-1(HO-1) is well-appreciative to counteract oxidative damage and inflammatory stress involving the pathogenesis of alcoholic liver diseases (ALD). The potential role and signaling pathways of HO-1 metabolite carbon monoxide (CO), however, still remained unclear. To explore the precise mechanisms, ethanol-dosed adult male Balb/c mice (5.0 g/kg.bw.) or ethanol-incubated primary rat hepatocytes (100 mmol/L) were pretreated by tricarbonyldichlororuthenium (II) dimmer (CORM-2, 8 mg/kg for mice or 20 μmol/L for hepatocytes), as well as other pharmacological reagents. Our data showed that CO released from HO-1 induction by quercetin prevented ethanol-derived oxidative injury, which was abolished by CO scavenger hemoglobin. The protection was mimicked by CORM-2 with the attenuation of GSH depletion, SOD inactivation, MDA overproduction, and the leakage of AST, ALT or LDH in serum and culture medium induced by ethanol. Moreover, CORM-2 injection or incubation stimulated p38 phosphorylation and suppressed abnormal Tnfa and IL-6, accompanying the alleviation of redox imbalance induced by ethanol and aggravated by inflammatory factors. The protective role of CORM-2 was abolished by SB203580 (p38 inhibitor) but not by PD98059 (ERK inhibitor) or SP600125 (JNK inhibitor). Thus, HO-1 released CO prevented ethanol-elicited hepatic oxidative damage and inflammatory stress through activating p38 MAPK pathway, suggesting a potential therapeutic role of gaseous signal molecule on ALD induced by naturally occurring phytochemicals. - Highlights: • CO alleviated ethanol-derived liver oxidative and inflammatory stress in mice. • CO eased ethanol and inflammatory factor-induced oxidative damage in hepatocytes. • The p38 MAPK is a key signaling mechanism for the protective function of CO in ALD.

  16. Carbon monoxide alleviates ethanol-induced oxidative damage and inflammatory stress through activating p38 MAPK pathway.

    PubMed

    Li, Yanyan; Gao, Chao; Shi, Yanru; Tang, Yuhan; Liu, Liang; Xiong, Ting; Du, Min; Xing, Mingyou; Liu, Liegang; Yao, Ping

    2013-11-15

    Stress-inducible protein heme oxygenase-1(HO-1) is well-appreciative to counteract oxidative damage and inflammatory stress involving the pathogenesis of alcoholic liver diseases (ALD). The potential role and signaling pathways of HO-1 metabolite carbon monoxide (CO), however, still remained unclear. To explore the precise mechanisms, ethanol-dosed adult male Balb/c mice (5.0g/kg.bw.) or ethanol-incubated primary rat hepatocytes (100mmol/L) were pretreated by tricarbonyldichlororuthenium (II) dimmer (CORM-2, 8mg/kg for mice or 20μmol/L for hepatocytes), as well as other pharmacological reagents. Our data showed that CO released from HO-1 induction by quercetin prevented ethanol-derived oxidative injury, which was abolished by CO scavenger hemoglobin. The protection was mimicked by CORM-2 with the attenuation of GSH depletion, SOD inactivation, MDA overproduction, and the leakage of AST, ALT or LDH in serum and culture medium induced by ethanol. Moreover, CORM-2 injection or incubation stimulated p38 phosphorylation and suppressed abnormal Tnfa and IL-6, accompanying the alleviation of redox imbalance induced by ethanol and aggravated by inflammatory factors. The protective role of CORM-2 was abolished by SB203580 (p38 inhibitor) but not by PD98059 (ERK inhibitor) or SP600125 (JNK inhibitor). Thus, HO-1 released CO prevented ethanol-elicited hepatic oxidative damage and inflammatory stress through activating p38 MAPK pathway, suggesting a potential therapeutic role of gaseous signal molecule on ALD induced by naturally occurring phytochemicals. PMID:23994557

  17. System-based Identification of Toxicity Pathways Associated With Multi-Walled Carbon Nanotube-Induced Pathological Responses

    PubMed Central

    Snyder-Talkington, Brandi N.; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R.; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L.

    2014-01-01

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 µg MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and were used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. PMID:23845593

  18. Cognitive deficits induced by multi-walled carbon nanotubes via the autophagic pathway.

    PubMed

    Gao, Jing; Zhang, Xiaochen; Yu, Mei; Ren, Guogang; Yang, Zhuo

    2015-11-01

    Multi-walled carbon nanotubes (MWCNTs) have shown potential applications in many fields, especially in the field of biomedicine. Several studies have reported that MWCNTs induce apoptosis and oxidative damage in nerve cells during in vitro experiments. However, there are few studies focused on the neurotoxicity of MWCNTs used in vivo. Many studies have reported that autophagy, a cellular stress response to degrade damaged cell components, can be activated by diverse nanoparticles. In this study, we investigated the neurotoxic effects of MWCNTs on hippocampal synaptic plasticity and spatial cognition in rats. Then, we used an inhibitor of autophagy called chloroquine (CQ) to examine whether autophagy plays an important role in hippocampal synaptic plasticity, since this was damaged by MWCNTs. In this study, adult male Wister rats were randomly divided into three groups: a control group, a group treated with MWCNTs (2.5mg/kg/day) and a group treated with MWCNTs+CQ (20mg/kg/day). After two-weeks of intraperitoneal (i.p.) injections, rats were subjected to the Morris water maze (MWM) test, and the long-term potentiation (LTP) and other biochemical parameters were determined. Results showed that MWCNTs could induce cognitive deficits, histopathological alteration and changes of autophagy level (increased the ratio of LC3 II /LC3 I and the expression of Beclin-1). Furthermore, we found that CQ could suppress MWCNTs-induced autophagic flux and partly rescue the synapse deficits, which occurred with the down-regulation of NR2B (a subunit of NMDA receptor) and synaptophysin (SYP) in the hippocampus. Our results suggest that MWCNTs could induce cognitive deficits in vivo via the increased autophagic levels, and provide a potential strategy to avoid the adverse effects of MWCNTs. PMID:26327526

  19. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A fixation device is an AC-powered device intended for...

  20. Pathways and transformations of dissolved methane and dissolved inorganic carbon in Arctic tundra watersheds: Evidence from analysis of stable isotopes

    NASA Astrophysics Data System (ADS)

    Throckmorton, Heather M.; Heikoop, Jeffrey M.; Newman, Brent D.; Altmann, Garrett L.; Conrad, Mark S.; Muss, Jordan D.; Perkins, George B.; Smith, Lydia J.; Torn, Margaret S.; Wullschleger, Stan D.; Wilson, Cathy J.

    2015-11-01

    Arctic soils contain a large pool of terrestrial C and are of interest due to their potential for releasing significant carbon dioxide (CO2) and methane (CH4) to the atmosphere. Due to substantial landscape heterogeneity, predicting ecosystem-scale CH4 and CO2 production is challenging. This study assessed dissolved inorganic carbon (DIC = Σ (total) dissolved CO2) and CH4 in watershed drainages in Barrow, Alaska as critical convergent zones of regional geochemistry, substrates, and nutrients. In July and September of 2013, surface waters and saturated subsurface pore waters were collected from 17 drainages. Based on simultaneous DIC and CH4 cycling, we synthesized isotopic and geochemical methods to develop a subsurface CH4 and DIC balance by estimating mechanisms of CH4 and DIC production and transport pathways and oxidation of subsurface CH4. We observed a shift from acetoclastic (July) toward hydrogenotropic (September) methanogenesis at sites located toward the end of major freshwater drainages, adjacent to salty estuarine waters, suggesting an interesting landscape-scale effect on CH4 production mechanism. The majority of subsurface CH4 was transported upward by plant-mediated transport and ebullition, predominantly bypassing the potential for CH4 oxidation. Thus, surprisingly, CH4 oxidation only consumed approximately 2.51 ± 0.82% (July) and 0.79 ± 0.79% (September) of CH4 produced at the frost table, contributing to <0.1% of DIC production. DIC was primarily produced from respiration, with iron and organic matter serving as likely e- acceptors. This work highlights the importance of spatial and temporal variability of CH4 production at the watershed scale and suggests broad scale investigations are required to build better regional or pan-Arctic representations of CH4 and CO2 production.

  1. Comparative transcriptome analysis of the CO2 sensing pathway via differential expression of carbonic anhydrase in Cryptococcus neoformans.

    PubMed

    Kim, Min Su; Ko, Young-Joon; Maeng, Shinae; Floyd, Anna; Heitman, Joseph; Bahn, Yong-Sun

    2010-08-01

    Carbon dioxide (CO(2)) sensing and metabolism via carbonic anhydrases (CAs) play pivotal roles in survival and proliferation of pathogenic fungi infecting human hosts from natural environments due to the drastic difference in CO(2) levels. In Cryptococcus neoformans, which causes fatal fungal meningoencephalitis, the Can2 CA plays essential roles during both cellular growth in air and sexual differentiation of the pathogen. However the signaling networks downstream of Can2 are largely unknown. To address this question, the present study employed comparative transcriptome DNA microarray analysis of a C. neoformans strain in which CAN2 expression is artificially controlled by the CTR4 (copper transporter) promoter. The P(CTR4)CAN2 strain showed growth defects in a CO(2)-dependent manner when CAN2 was repressed but resumed normal growth when CAN2 was overexpressed. The Can2-dependent genes identified by the transcriptome analysis include FAS1 (fatty acid synthase 1) and GPB1 (G-protein beta subunit), supporting the roles of Can2 in fatty acid biosynthesis and sexual differentiation. Cas3, a capsular structure designer protein, was also discovered to be Can2-dependent and yet was not involved in CO(2)-mediated capsule induction. Most notably, a majority of Can2-dependent genes were environmental stress-regulated (ESR) genes. Supporting this, the CAN2 overexpression strain was hypersensitive to oxidative and genotoxic stress as well as antifungal drugs, such as polyene and azole drugs, potentially due to defective membrane integrity. Finally, an oxidative stress-responsive Atf1 transcription factor was also found to be Can2-dependent. Atf1 not only plays an important role in diverse stress responses, including thermotolerance and antifungal drug resistance, but also represses melanin and capsule production in C. neoformans. In conclusion, this study provides insights into the comprehensive signaling networks orchestrated by CA/CO(2)-sensing pathways in pathogenic fungi. PMID:20516494

  2. Changes in North Atlantic nitrogen fixation controlled by ocean circulation.

    PubMed

    Straub, Marietta; Sigman, Daniel M; Ren, Haojia; Martínez-García, Alfredo; Meckler, A Nele; Hain, Mathis P; Haug, Gerald H

    2013-09-12

    In the ocean, the chemical forms of nitrogen that are readily available for biological use (known collectively as 'fixed' nitrogen) fuel the global phytoplankton productivity that exports carbon to the deep ocean. Accordingly, variation in the oceanic fixed nitrogen reservoir has been proposed as a cause of glacial-interglacial changes in atmospheric carbon dioxide concentration. Marine nitrogen fixation, which produces most of the ocean's fixed nitrogen, is thought to be affected by multiple factors, including ocean temperature and the availability of iron and phosphorus. Here we reconstruct changes in North Atlantic nitrogen fixation over the past 160,000 years from the shell-bound nitrogen isotope ratio ((15)N/(14)N) of planktonic foraminifera in Caribbean Sea sediments. The observed changes cannot be explained by reconstructed changes in temperature, the supply of (iron-bearing) dust or water column denitrification. We identify a strong, roughly 23,000-year cycle in nitrogen fixation and suggest that it is a response to orbitally driven changes in equatorial Atlantic upwelling, which imports 'excess' phosphorus (phosphorus in stoichiometric excess of fixed nitrogen) into the tropical North Atlantic surface. In addition, we find that nitrogen fixation was reduced during glacial stages 6 and 4, when North Atlantic Deep Water had shoaled to become glacial North Atlantic intermediate water, which isolated the Atlantic thermocline from excess phosphorus-rich mid-depth waters that today enter from the Southern Ocean. Although modern studies have yielded diverse views of the controls on nitrogen fixation, our palaeobiogeochemical data suggest that excess phosphorus is the master variable in the North Atlantic Ocean and indicate that the variations in its supply over the most recent glacial cycle were dominated by the response of regional ocean circulation to the orbital cycles. PMID:23965620

  3. Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre

    PubMed Central

    Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel MM

    2012-01-01

    Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N2-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N2-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200 m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of 15N-labeled ammonium and leucine in our incubation experiments. N2-fixation was detectable throughout the upper 200 m at most stations, with rates ranging from 0.001 to 0.19 nM N h−1. N2-fixation in the SPG may account for the production of 8–20% of global oceanic new nitrogen. Interestingly, comparable 15N2-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of γ-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

  4. Levels of Daily Light Doses Under Changed Day-Night Cycles Regulate Temporal Segregation of Photosynthesis and N2 Fixation in the Cyanobacterium Trichodesmium erythraeum IMS101

    PubMed Central

    Cai, Xiaoni; Gao, Kunshan

    2015-01-01

    While the diazotrophic cyanobacterium Trichodesmium is known to display inverse diurnal performances of photosynthesis and N2 fixation, such a phenomenon has not been well documented under different day-night (L-D) cycles and different levels of light dose exposed to the cells. Here, we show differences in growth, N2 fixation and photosynthetic carbon fixation as well as photochemical performances of Trichodesmium IMS101 grown under 12L:12D, 8L:16D and 16L:8D L-D cycles at 70 μmol photons m-2 s-1 PAR (LL) and 350 μmol photons m-2 s-1 PAR (HL). The specific growth rate was the highest under LL and the lowest under HL under 16L:8D, and it increased under LL and decreased under HL with increased levels of daytime light doses exposed under the different light regimes, respectively. N2 fixation and photosynthetic carbon fixation were affected differentially by changes in the day-night regimes, with the former increasing directly under LL with increased daytime light doses and decreased under HL over growth-saturating light levels. Temporal segregation of N2 fixation from photosynthetic carbon fixation was evidenced under all day-night regimes, showing a time lag between the peak in N2 fixation and dip in carbon fixation. Elongation of light period led to higher N2 fixation rate under LL than under HL, while shortening the light exposure to 8 h delayed the N2 fixation peaking time (at the end of light period) and extended it to night period. Photosynthetic carbon fixation rates and transfer of light photons were always higher under HL than LL, regardless of the day-night cycles. Conclusively, diel performance of N2 fixation possesses functional plasticity, which was regulated by levels of light energy supplies either via changing light levels or length of light exposure. PMID:26258473

  5. Mechanical Comparison of Headless Screw Fixation and Locking Plate Fixation for Talar Neck Fractures.

    PubMed

    Karakasli, Ahmet; Hapa, Onur; Erduran, Mehmet; Dincer, Cemal; Cecen, Berivan; Havitcioglu, Hasan

    2015-01-01

    For talar neck fractures, open reduction and internal fixation have been thought to facilitate revascularization and prevent osteonecrosis. Newer screw systems allow for placement of cannulated headless screws, which provide compression by virtue of a variable pitch thread. The present study compared the biomechanical fixation strength of cannulated headless variable-pitch screw fixation and locking plate fixation. A reproducible talar neck fracture was created in 14 fresh cadaver talar necks. Talar head fixation was then performed using 2 cannulated headless variable-pitch 4-mm/5-mm diameter (4/5) screws (Acutrak; Acumed, Hillsboro, OR) and locking plate fixation. Headless variable-pitch screw fixation had lower failure displacement than did locking plate fixation. No statistically significant differences were found in failure stiffness, yield stiffness (p = .655), yield load (p = .142), or ultimate load between the 2 fixation techniques. Cannulated headless variable-pitch screw fixation resulted in better failure displacement than locking plate fixation in a cadaveric talus model and could be considered a viable option for talus fracture fixation. Headless, fully threaded, variable-pitch screw fixation has inherent advantages compared with locking plate fixation, because it might cause less damage to the articular surface and can compress the fracture for improved reduction. Additionally, plate fixation can increase the risk of avascular necrosis owing to the wider incision and dissection of soft tissues. PMID:25998471

  6. Inhibition of MAPK and NF-κB signaling pathways alleviate carbon tetrachloride (CCl4)-induced liver fibrosis in Toll-like receptor 5 (TLR5) deficiency mice.

    PubMed

    Shu, Ming; Huang, Dan-Dan; Hung, Zuo-An; Hu, Xiao-Rong; Zhang, Shun

    2016-02-26

    Current researches showed that TLR family plays an important role in liver fibrosis, yet the molecular mechanism by which this occurs is not fully explained. In this study, we investigated the role of TLR5 in carbon tetrachloride-induced liver fibrosis, and further examined wether TLR5 knockout attenuated tetrachloride-induced liver fibrosis by inhibiting hepatic stellate cells activation via modulating NF-κB and MAPK signaling pathways. Our results found that carbon tetrachloride induced liver function injury in WT mice with a inflammatory responses through the activation of NF-κB and MAPK signaling pathways, resulting in hepatic stellate cells activation. In contrast, TLR5 deficiency mice after carbon tetrachloride administration reduced NF-κB and MAPK signaling pathways activation, which down regulated hepatic stellate cells activation. In addition, alpha smooth muscle-actin as marker of hepatic stellate cells further indicated that TLR5 knockout mice have a lower collagen accumulation in liver tissue than WT mice after carbon tetrachloride administration, resulting in inhibition of NF-κB and MAPK signaling pathways activation. Moreover, in vitro experiment of hepatic stellate cells challenged with LPS or TGF-β, further indicated that NF-κB and MAPK were involved in liver fibrosis development, leading to α-SMA expression and inflammation infiltration. However, cells from TLR5(-)(/-) may weaken phosphorylation levels of signal pathways, finally suppress progress of collagen accumulation and inflammatory responses. These results suggest a new therapeutic approach or target to protect against fibrosis caused by chronic liver diseases. PMID:26845355

  7. N-acetylcysteine protects against liver injure induced by carbon tetrachloride via activation of the Nrf2/HO-1 pathway

    PubMed Central

    Cai, Zhaobin; Lou, Qi; Wang, Fugen; Li, Er; Sun, Jingjing; Fang, Hongying; Xi, Jianjun; Ju, Liping

    2015-01-01

    Chronic liver injury is an important clinical problem which eventually leads to cirrhosis, hepatocellular carcinoma and end-stage liver failure. It is well known that cell damage induced by reactive oxygen species (ROS) is an important mechanism of hepatocyte injure. N-acetylcysteine (NAC), a precursor of glutathione (GSH), is well-known role as the antidote to acetaminophen toxicity in clinic. NAC is now being utilized more widely in the clinical setting for non-acetaminophen (APAP) related causes of liver injure. However, the mechanisms underlying its beneficial effects are poorly defined. Thus, Aim of the present study was to investigate potential hepatic protective role of NAC and to delineate its mechanism of action against carbon tetrachloride (CCl4)-induced liver injury in models of rat. Our results showed that the alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities as well as malondialdehyde (MDA) contents decreased significantly in CCl4-induced rats with NAC treatment. GSH content and superoxide dismutase (SOD) activities remarkably increased in the NAC groups compared with those in CCl4-induced group. Treatment with NAC had been shown to an increase in nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) mRNA levels. In conclusion, these results suggested that NAC upregulated HO-1 through the activation of Nrf2 pathway and protected rat against CCl4-induced liver injure. The results of this study provided pharmacological evidence to support the clinical application of NAC. PMID:26339453

  8. Carbon Monoxide Signaling in Human Red Blood Cells: Evidence for Pentose Phosphate Pathway Activation and Protein Deglutathionylation

    PubMed Central

    Metere, Alessio; Iorio, Egidio; Scorza, Giuseppe; Camerini, Serena; Casella, Marialuisa; Crescenzi, Marco; Minetti, Maurizio

    2014-01-01

    Abstract Aims: The biochemistry underlying the physiological, adaptive, and toxic effects of carbon monoxide (CO) is linked to its affinity for reduced transition metals. We investigated CO signaling in the vasculature, where hemoglobin (Hb), the CO most important metal-containing carrier is highly concentrated inside red blood cells (RBCs). Results: By combining NMR, MS, and spectrophotometric techniques, we found that CO treatment of whole blood increases the concentration of reduced glutathione (GSH) in RBC cytosol, which is linked to a significant Hb deglutathionylation. In addition, this process (i) does not activate glycolytic metabolism, (ii) boosts the pentose phosphate pathway (PPP), (iii) increases glutathione reductase activity, and (iv) decreases oxidized glutathione concentration. Moreover, GSH concentration was partially decreased in the presence of 2-deoxyglucose and the PPP antagonist dehydroepiandrosterone. Our MS results show for the first time that, besides Cys93, Hb glutathionylation occurs also at Cys112 of the β-chain, providing a new potential GSH source hitherto unknown. Innovation: This work provides new insights on the signaling and antioxidant-boosting properties of CO in human blood, identifying Hb as a major source of GSH release and the PPP as a metabolic mechanism supporting Hb deglutathionylation. Conclusions: CO-dependent GSH increase is a new RBC process linking a redox-inactive molecule, CO, to GSH redox signaling. This mechanism may be involved in the adaptive responses aimed to counteract stress conditions in mammalian tissues. Antioxid. Redox Signal. 20, 403–416. PMID:23815439

  9. OVEREXPRESSION OF A NODULE-ENHANCED MALATE DEHYDROGENASE INCREASES NITROGEN FIXATION IN ALFALFA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Malate is crucial for symbiotic dinitrogen (N2) fixation, occurring in high concentrations in N2-fixing nodules as the major carbon source for bacteroid respiration. Malate also provides carbon skeletons for the assimilation of fixed nitrogen from ammonia into amino acids and is proposed to be invol...

  10. External fixation of wrist fractures.

    PubMed

    Schuind, F; Donkerwolcke, M; Burny, F

    1984-05-01

    One hundred and twenty-six wrist fractures treated by external fixation were reviewed, with an average followup of six months (range: one to 48 months). Most of the fractures were unstable. A radius-second metacarpal standard half-frame was used in 93.6%. Prolonged capsuloligamentous distraction of the wrist probably provides the best stabilization for comminuted and unstable wrist fractures. The versatility of the Hoffmann® External Fixator allows multiple attempts at reduction, possible secondary resumption of reduction, and release of distraction at the third week. In spite of instability and comminution of the fractures, roentgenographic results were satisfactory in 94.4%. In spite of 10.4% primary skin injury, no case of osteomyelitis was seen. PMID:24822978

  11. Evolution of the Hoffmann Fixators.

    PubMed

    Seligson, David

    2015-09-01

    Dr. Raoul Hoffmann of Geneva, Switzerland with the collaboration of Henri Jaquet developed the original Hoffmann external fixateur as a system for treating broken bones without necessarily opening a fracture site to reposition the bone ends. This system has evolved to a more flexible, modular concept with input from surgeons and engineers. In this chapter the modifications of the Hoffmann family of fixators are traced and the important steps in the development of the concept and the instrumentation emphasized. PMID:26458297

  12. Fixation strategies for retinal immunohistochemistry.

    PubMed

    Stradleigh, Tyler W; Ishida, Andrew T

    2015-09-01

    Immunohistochemical and ex vivo anatomical studies have provided many glimpses of the variety, distribution, and signaling components of vertebrate retinal neurons. The beauty of numerous images published to date, and the qualitative and quantitative information they provide, indicate that these approaches are fundamentally useful. However, obtaining these images entailed tissue handling and exposure to chemical solutions that differ from normal extracellular fluid in composition, temperature, and osmolarity. Because the differences are large enough to alter intercellular and intracellular signaling in neurons, and because retinae are susceptible to crush, shear, and fray, it is natural to wonder if immunohistochemical and anatomical methods disturb or damage the cells they are designed to examine. Tissue fixation is typically incorporated to guard against this damage and is therefore critically important to the quality and significance of the harvested data. Here, we describe mechanisms of fixation; advantages and disadvantages of using formaldehyde and glutaraldehyde as fixatives during immunohistochemistry; and modifications of widely used protocols that have recently been found to improve cell shape preservation and immunostaining patterns, especially in proximal retinal neurons. PMID:25892361

  13. Functional ecology of free-living nitrogen fixation: A contemporary perspective

    USGS Publications Warehouse

    Reed, Sasha C.; Cleveland, Cory C.; Townsend, Alan R.

    2011-01-01

    Nitrogen (N) availability is thought to frequently limit terrestrial ecosystem processes, and explicit consideration of N biogeochemistry, including biological N2 fixation, is central to understanding ecosystem responses to environmental change. Yet, the importance of free-living N2 fixation—a process that occurs on a wide variety of substrates, is nearly ubiquitous in terrestrial ecosystems, and may often represent the dominant pathway for acquiring newly available N—is often underappreciated. Here, we draw from studies that investigate free-living N2 fixation from functional, physiological, genetic, and ecological perspectives. We show that recent research and analytical advances have generated a wealth of new information that provides novel insight into the ecology of N2 fixation as well as raises new questions and priorities for future work. These priorities include a need to better integrate free-living N2 fixation into conceptual and analytical evaluations of the N cycle's role in a variety of global change scenarios.

  14. Analysis of Sensitive CO2 Pathways and Genes Related to Carbon Uptake and Accumulation in Chlamydomonas reinhardtii through Genomic Scale Modeling and Experimental Validation

    PubMed Central

    Winck, Flavia V.; Melo, David O. Páez; Riaño-Pachón, Diego M.; Martins, Marina C. M.; Caldana, Camila; Barrios, Andrés F. González

    2016-01-01

    The development of microalgae sustainable applications needs better understanding of microalgae biology. Moreover, how cells coordinate their metabolism toward biomass accumulation is not fully understood. In this present study, flux balance analysis (FBA) was performed to identify sensitive metabolic pathways of Chlamydomonas reinhardtii under varied CO2 inputs. The metabolic network model of Chlamydomonas was updated based on the genome annotation data and sensitivity analysis revealed CO2 sensitive reactions. Biological experiments were performed with cells cultivated at 0.04% (air), 2.5, 5, 8, and 10% CO2 concentration under controlled conditions and cell growth profiles and biomass content were measured. Pigments, lipids, proteins, and starch were further quantified for the reference low (0.04%) and high (10%) CO2 conditions. The expression level of candidate genes of sensitive reactions was measured and validated by quantitative real time PCR. The sensitive analysis revealed mitochondrial compartment as the major affected by changes on the CO2 concentrations and glycolysis/gluconeogenesis, glyoxylate, and dicarboxylate metabolism among the affected metabolic pathways. Genes coding for glycerate kinase (GLYK), glycine cleavage system, H-protein (GCSH), NAD-dependent malate dehydrogenase (MDH3), low-CO2 inducible protein A (LCIA), carbonic anhydrase 5 (CAH5), E1 component, alpha subunit (PDC3), dual function alcohol dehydrogenase/acetaldehyde dehydrogenase (ADH1), and phosphoglucomutase (GPM2), were defined, among other genes, as sensitive nodes in the metabolic network simulations. These genes were experimentally responsive to the changes in the carbon fluxes in the system. We performed metabolomics analysis using mass spectrometry validating the modulation of carbon dioxide responsive pathways and metabolites. The changes on CO2 levels mostly affected the metabolism of amino acids found in the photorespiration pathway. Our updated metabolic network was compared to previous model and it showed more consistent results once considering the experimental data. Possible roles of the sensitive pathways in the biomass metabolism are discussed. PMID:26904035

  15. Analysis of Sensitive CO2 Pathways and Genes Related to Carbon Uptake and Accumulation in Chlamydomonas reinhardtii through Genomic Scale Modeling and Experimental Validation.

    PubMed

    Winck, Flavia V; Melo, David O Páez; Riaño-Pachón, Diego M; Martins, Marina C M; Caldana, Camila; Barrios, Andrés F González

    2016-01-01

    The development of microalgae sustainable applications needs better understanding of microalgae biology. Moreover, how cells coordinate their metabolism toward biomass accumulation is not fully understood. In this present study, flux balance analysis (FBA) was performed to identify sensitive metabolic pathways of Chlamydomonas reinhardtii under varied CO2 inputs. The metabolic network model of Chlamydomonas was updated based on the genome annotation data and sensitivity analysis revealed CO2 sensitive reactions. Biological experiments were performed with cells cultivated at 0.04% (air), 2.5, 5, 8, and 10% CO2 concentration under controlled conditions and cell growth profiles and biomass content were measured. Pigments, lipids, proteins, and starch were further quantified for the reference low (0.04%) and high (10%) CO2 conditions. The expression level of candidate genes of sensitive reactions was measured and validated by quantitative real time PCR. The sensitive analysis revealed mitochondrial compartment as the major affected by changes on the CO2 concentrations and glycolysis/gluconeogenesis, glyoxylate, and dicarboxylate metabolism among the affected metabolic pathways. Genes coding for glycerate kinase (GLYK), glycine cleavage system, H-protein (GCSH), NAD-dependent malate dehydrogenase (MDH3), low-CO2 inducible protein A (LCIA), carbonic anhydrase 5 (CAH5), E1 component, alpha subunit (PDC3), dual function alcohol dehydrogenase/acetaldehyde dehydrogenase (ADH1), and phosphoglucomutase (GPM2), were defined, among other genes, as sensitive nodes in the metabolic network simulations. These genes were experimentally responsive to the changes in the carbon fluxes in the system. We performed metabolomics analysis using mass spectrometry validating the modulation of carbon dioxide responsive pathways and metabolites. The changes on CO2 levels mostly affected the metabolism of amino acids found in the photorespiration pathway. Our updated metabolic network was compared to previous model and it showed more consistent results once considering the experimental data. Possible roles of the sensitive pathways in the biomass metabolism are discussed. PMID:26904035

  16. External fixation: how to make it work.

    PubMed

    Ziran, Bruce H; Smith, Wade R; Anglen, Jeffrey O; Tornetta Iii, Paul

    2008-01-01

    The external fixator has been in use for more than a century. Wutzer (1789-1863) used pins and an interconnecting rod-and-clamp system. Parkhill (1897) and Lambotte (1900) used devices that were unilateral with four pins and a bar-clamp system. By 1960, Vidal and Hoffmann had popularized the use of an external fixator to treat open fractures and infected pseudarthroses. The complications associated with the use of external fixation in the late 20th century were predominantly caused by a lack of understanding of the principles of application, the principles of fracture healing with external fixation, and old technology. Its use was reserved for the most severe injuries and for cases complicated by infection. Thus, pin problems, nonunions, and malunions were common. Better technology and understanding have since allowed for greater versatility and better outcomes. Simultaneous with developments in the Western world, Ilizarov developed the principles of external fixation with use of ring and wire fixation. It was not until the late 1980s and early 1990s, when more interaction and exchange between the West and East (Russia) became possible, and with the help of Italians who embraced the philosophy of external fixation, that the use of external fixation was proven to be successful. Several variations of external fixation have been developed, and its use is now widespread. However, in the United States, all but a minority of surgeons still have substantial apprehension about the use of external fixation. PMID:18399569

  17. An oculomotor continuum from exploration to fixation

    PubMed Central

    Otero-Millan, Jorge; Macknik, Stephen L.; Langston, Rachel E.; Martinez-Conde, Susana

    2013-01-01

    During visual exploration, saccadic eye movements scan the scene for objects of interest. During attempted fixation, the eyes are relatively still but often produce microsaccades. Saccadic rates during exploration are higher than those of microsaccades during fixation, reinforcing the classic view that exploration and fixation are two distinct oculomotor behaviors. An alternative model is that fixation and exploration are not dichotomous, but are instead two extremes of a functional continuum. Here, we measured the eye movements of human observers as they either fixed their gaze on a small spot or scanned natural scenes of varying sizes. As scene size diminished, so did saccade rates, until they were continuous with microsaccadic rates during fixation. Other saccadic properties varied as function of image size as well, forming a continuum with microsaccadic parameters during fixation. This saccadic continuum extended to nonrestrictive, ecological viewing conditions that allowed all types of saccades and fixation positions. Eye movement simulations moreover showed that a single model of oculomotor behavior can explain the saccadic continuum from exploration to fixation, for images of all sizes. These findings challenge the view that exploration and fixation are dichotomous, suggesting instead that visual fixation is functionally equivalent to visual exploration on a spatially focused scale. PMID:23533278

  18. Tissue fixation and the effect of molecular fixatives on downstream staining procedures

    PubMed Central

    Howat, William J.; Wilson, Beverley A.

    2014-01-01

    It is impossible to underplay the importance of fixation in histopathology. Whether the scientist is interested in the extraction of information on lipids, proteins, RNA or DNA, fixation is critical to this extraction. This review aims to give a brief overview of the current “state of play” in fixation and focus on the effect fixation, and particularly the effect of the newer brand of “molecular fixatives” have on morphology, histochemistry, immunohistochemistry and RNA/DNA analysis. A methodology incorporating the creation of a fixation tissue microarray for the study of the effect of fixation on histochemistry is detailed. PMID:24561827

  19. Dissolved CO2 in small catchment streams of eastern Amazonia: A minor pathway of terrestrial carbon loss

    NASA Astrophysics Data System (ADS)

    Davidson, Eric A.; Figueiredo, Ricardo O.; Markewitz, Daniel; Aufdenkampe, Anthony K.

    2010-12-01

    Production of carbon dioxide (CO2) in soils can lead to supersaturation of dissolved free CO2 (pCO2) in groundwater, which later evades to the atmosphere as groundwater enters streams and rivers. This process could be a significant pathway for return of terrestrially fixed C to the atmosphere. We measured pCO2 monthly over two years at multiple stations along three streams from their headwaters in remnant mature forests through multiple land covers in Pará, Brazil. The pCO2 averaged 19,000 μatm in headwaters and decreased to about 4,500 μatm downstream. Similar values were measured in headwaters of two small pristine mature forest catchments. Two approaches were used to estimate groundwater pCO2 evasion: assuming that headwater pCO2 measurements reflected incoming groundwater pCO2 or that all entering stream water was in equilibrium with previously measured deep soil CO2. With these assumptions, losses from the terrestrial environment through aquatic evasion of pCO2 would be 0.02-0.15 Mg C ha-1 of land area yr-1, which is about 2-3 orders of magnitude lower than annual estimates of soil respiration and net primary productivity. However, downstream pCO2 values that appear to be in quasi-steady state indicate contributions from other C sources, such as aquatic primary production, soil erosion, dissolved organic matter, or litter inputs from streamside vegetation. Hence, lateral pCO2 loss from groundwater to streams is minor for most of the terrestrial ecosystems of this region, although C loss to streams could be significant for net terrestrial budgets in riparian ecosystems or areas experiencing erosion.

  20. Evolution of fracture and fault-controlled fluid pathways in carbonates of the Albanides fold-thrust belt

    USGS Publications Warehouse

    Graham, Wall B.R.; Girbacea, R.; Mesonjesi, A.; Aydin, A.

    2006-01-01

    The process of fracture and fault formation in carbonates of the Albanides fold-thrust belt has been systematically documented using hierarchical development of structural elements from hand sample, outcrop, and geologic-map scales. The function of fractures and faults in fluid migration was elucidated using calcite cement and bitumen in these structures as a paleoflow indicator. Two prefolding pressure-solution and vein assemblages were identified: an overburden assemblage and a remote tectonic stress assemblage. Sheared layer-parallel pressure-solution surfaces of the overburden assemblage define mechanical layers. Shearing of mechanical layers associated with folding resulted in the formation of a series of folding assemblage fractures at different orientations, depending on the slip direction of individual mechanical layers. Prefolding- and folding-related fracture assemblages together formed fragmentation zones in mechanical layers and are the sites of incipient fault localization. Further deformation along these sites was accommodated by rotation and translation of fragmented rock, which formed breccia and facilitated fault offset across multiple mechanical layers. Strike-slip faults formed by this process are organized in two sets in an apparent conjugate pattern. Calcite cement and bitumen that accumulated along fractures and faults are evidence of localized fluid flow along fault zones. By systematic identification of fractures and faults, their evolution, and their fluid and bitumen contents, along with subsurface core and well-log data, we identify northeast-southwest-trending strike-slip faults and the associated structures as dominant fluid pathways in the Albanides fold-thrust belt. Copyright ?? 2006. The American Association of Petroleum Geologists. All rights reserved.

  1. Gene Variants in the Folate-mediated One-carbon Metabolism (FOCM) Pathway as Risk Factors for Conotruncal Heart Defects

    PubMed Central

    Zhu, Huiping; Yang, Wei; Lu, Wei; Etheredge, Analee; Lammer, Edward J; Finnell, Richard; Carmichael, Suzan L.; Shaw, Gary

    2012-01-01

    We evaluated 35 variants among four folate-mediated one-carbon metabolism pathway genes, MTHFD1, SHMT1, MTHFR, and DHFR as risk factors for conotruncal heart defects. Cases with a diagnosis of single gene disorders or chromosomal aneusomies were excluded. Controls were randomly selected from area hospitals in proportion to their contribution to the total population of live-born infants. Odds Ratios (OR) and the 95% confidence intervals were computed for each genotype (homozygous variant or heterozygote, versus homozygous wildtype) and for increase of each less common allele (log-additive model). Interactions between each variant and three folate intake variables (maternal multivitamin use, maternal dietary folate intake, and combined maternal folate intake) were also evaluated under the log-additive model. In general, we did not identify notable associations. The A allele of MTHFD1 rs11627387 was associated with a 1.7-fold increase in conotruncal defects risk in both Hispanic mothers (OR=1.7, 95% CI=1.1∼2.5) and Hispanic infants (OR=1.7, 95% CI=1.2∼2.3). The T allele of MTHFR rs1801133 was associated with a 2.8-fold increase of risk among Hispanic women whose dietary folate intake was ≤ 25th centile. The C allele of MTHFR rs1801131 was associated with a two-fold increase of risk (OR=2.0, 95%CI=1.0∼3.9) only among those whose dietary folate intake was >25th centile. Our study suggested that MTHFD1 rs11627387 may be associated with risk of conotruncal defects through both maternal and offspring genotype effect among the Hispanics. Maternal functional variants in MTHFR gene may interact with dietary folate intake and modify the conotruncal defects risk in the offspring. PMID:22495907

  2. Fixational eye movements and binocular vision

    PubMed Central

    Otero-Millan, Jorge; Macknik, Stephen L.; Martinez-Conde, Susana

    2014-01-01

    During attempted visual fixation, small involuntary eye movements–called fixational eye movements–continuously change of our gaze’s position. Disagreement between the left and right eye positions during such motions can produce diplopia (double vision). Thus, the ability to properly coordinate the two eyes during gaze fixation is critical for stable perception. For the last 50 years, researchers have studied the binocular characteristics of fixational eye movements. Here we review classical and recent studies on the binocular coordination (i.e., degree of conjugacy) of each fixational eye movement type: microsaccades, drift and tremor, and its perceptual contribution to increasing or reducing binocular disparity. We also discuss how amblyopia and other visual pathologies affect the binocular coordination of fixational eye movements. PMID:25071480

  3. Overcoming fixation with repeated memory suppression.

    PubMed

    Angello, Genna; Storm, Benjamin C; Smith, Steven M

    2015-01-01

    Fixation (blocks to memories or ideas) can be alleviated not only by encouraging productive work towards a solution, but, as the present experiments show, by reducing counterproductive work. Two experiments examined relief from fixation in a word-fragment completion task. Blockers, orthographically similar negative primes (e.g., ANALOGY), blocked solutions to word fragments (e.g., A_L_ _GY) in both experiments. After priming, but before the fragment completion test, participants repeatedly suppressed half of the blockers using the Think/No-Think paradigm, which results in memory inhibition. Inhibiting blockers did not alleviate fixation in Experiment 1 when conscious recollection of negative primes was not encouraged on the fragment completion test. In Experiment 2, however, when participants were encouraged to remember negative primes at fragment completion, relief from fixation was observed. Repeated suppression may nullify fixation effects, and promote creative thinking, particularly when fixation is caused by conscious recollection of counterproductive information. PMID:24575886

  4. Determination of pathways of glycogen synthesis and the dilution of the three-carbon pool with (U- sup 13 C)glucose

    SciTech Connect

    Katz, J.; Wals, P.A. ); Lee, W.N.P. )

    1991-03-15

    Rats were infused with glucose at 30 mg/min, containing 18% enriched (U-{sup 13}C)glucose and (1-{sup 14}C)- and (3-{sup 3}H)glucose and liver glycogen were determined by gas chromatography/mass spectroscopy. The contribution of the direct pathway to glycogen was calculated from the three tracers, and the values by all three were nearly identical, about 50%. The {sup 14}C specific activity in carbon 6 of glycogen glucose was about 6% that of carbon 1. The ({sup 3}H)glucose/(1-{sup 14}C)glucose ratio in glycogen was 80-90% that is blood glucose. The enrichment of {sup 13}C and the specific activity of {sup 14}C in glycogen formed by the indirect path were 20-25% of glycogen formed directly from glucose. The dilution is of two kinds: (1) an exchange of labeled carbon with unlabeled carbon in the tricarboxylic acid cycle and (2) dilution by unlabeled nonglucose carbon. Methods to calculate the two types of dilution are presented. In rate preinjected with glucagon, the dilution through the tricarboxylic acid cycle was unaffected but that by nonglucose carbon was decreased.

  5. External fixation in contemporary fracture management

    PubMed Central

    McCoy, G F; Orr, J F; Templeton, J

    1987-01-01

    Important advances have been made within the last two decades in the field of fracture management. The development of the AO internal fixation system and the advances in cast bracing techniques are but two of the improvements worthy of mention. It is, however, in the field of external fixation of fractures that the greatest advances have been made. This paper traces the history of external fixation up to the present day and discusses, with examples, the application of external fixation in the management of complex limb fractures. ImagesFig 3Fig 4Fig 5Fig 6Fig 7Fig 8Fig 9 PMID:3328364

  6. Suppressive interactions underlying visually evoked fixational saccades.

    PubMed

    Wang, Helena X; Yuval-Greenberg, Shlomit; Heeger, David J

    2016-01-01

    Small saccades occur frequently during fixation, and are coupled to changes in visual stimulation and cognitive state. Neurophysiologically, fixational saccades reflect neural activity near the foveal region of a continuous visuomotor map. It is well known that competitive interactions between neurons within visuomotor maps contribute to target selection for large saccades. Here we asked how such interactions in visuomotor maps shape the rate and direction of small fixational saccades. We measured fixational saccades during periods of prolonged fixation while presenting pairs of visual stimuli (parafoveal: 0.8° eccentricity; peripheral: 5° eccentricity) of various contrasts. Fixational saccade direction was biased toward locations of parafoveal stimuli but not peripheral stimuli, ∼100-250ms following stimulus onset. The rate of fixational saccades toward parafoveal stimuli (congruent saccades) increased systematically with parafoveal stimulus contrast, and was suppressed by the simultaneous presentation of a peripheral stimulus. The suppression was best characterized as a combination of two processes: a subtractive suppression of the overall fixational saccade rate and a divisive suppression of the direction bias. These results reveal the nature of suppressive interactions within visuomotor maps and constrain models of the population code for fixational saccades. PMID:25645962

  7. Nitrogen fixation method and apparatus

    DOEpatents

    Chen, Hao-Lin

    1983-01-01

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

  8. Nitrogen fixation method and apparatus

    DOEpatents

    Chen, H.L.

    1983-08-16

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O[sub 2]/cm promotes the formation of vibrationally excited N[sub 2]. Atomic oxygen interacts with vibrationally excited N[sub 2] at a much quicker rate than unexcited N[sub 2], greatly improving the rate at which NO is formed. 1 fig.

  9. Do Fixation Cues Ensure Fixation Accuracy in Split-Fovea Studies of Word Recognition?

    ERIC Educational Resources Information Center

    Jordan, Timothy R.; Paterson, Kevin B.; Kurtev, Stoyan; Xu, Mengyun

    2009-01-01

    Many studies have claimed that hemispheric processing is split precisely at the foveal midline and so place great emphasis on the precise location at which words are fixated. These claims are based on experiments in which a variety of fixation procedures were used to ensure fixation accuracy but the effectiveness of these procedures is unclear. We…

  10. Polymorphism in one-carbon metabolism pathway affects survival of gastric cancer patients: Large and comprehensive study

    PubMed Central

    Huo, Xinying; Shen, Lili; Wang, Chun; Tang, Yongfei; Wu, Peng; He, Jason; Gong, Weida; He, Ming-Liang; Chen, Jinfei

    2015-01-01

    Although it has been shown that polymorphisms in one-carbon metabolism (OCM) pathway are associated with gastric cancer (GC), their interactions and contributions for patients’ survival are elusive. In this study, we investigated the effects of polymorphisms and their interactions on the survival of GC patients, including genes of Methylenetetrahydrofolate reductase (MTHFR 677C > T, 1298A > C), Methionine synthase reductase (MTRR 66A > G), Methionine synthase (MTR 2756A > G), and Thymidylate synthase (TS 3′-UTR ins6 > del6, 5′-UTR 2R > 3R). We recruited 919 GC patients from 1998 to 2006. The Kaplan–Meier plots, Cox regression analyses and the log-rank tests were carried out in this study. MTHFR 1298CC genotype showed protective effect (HR = 0.444, 95% CI = 0.210–0.940). MTRR 66 GA + GG genotypes decreased the risk of death (HR = 0.793, 95% CI = 0.651–0.967) in general, and in subgroups with more pronounced diffuse type, greater depth of invasion (T2/T3/T4), higher level lymph node metastasis (N1/N2/N3), advanced TNM stages (II/III level) and 5-Fu treatment. However, the improved survival disappeared when GC patients simultaneously had MTR 2756 GA + GG genotypes (HR = 1.063, 95% CI = 0.750–1.507). Although MTRR 66GA genotype was not associated with the survival of GC patients, patients with simultaneous MTRR 66GA and MTR 2756AA genotypes exhibited significant risk reduction of death (HR = 0.773, 95% CI = 0.609–0.981). MTHFR 1298 CA + CC combined with TS 5-UTR 2R3R + 3R3R genotypes (HR = 0.536, 95% CI = 0.315–0.913) also increased patient survival rates. Our results suggest that the MTRR 66A > G and MTHFR 1298A > C polymorphisms may be useful prognostic biomarkers for GC patients. PMID:25840420

  11. Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms

    PubMed Central

    Sulieman, Saad; Tran, Lam-Son Phan

    2014-01-01

    The special issue “Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms” aims to investigate the physiological and biochemical advances in the symbiotic process with an emphasis on nodule establishment, development and functioning. The original research articles included in this issue provide important information regarding novel aspects of nodule metabolism and various regulatory pathways, which could have important future implications. This issue also included one review article that highlights the importance of using legume trees in the production of renewable biofuels. PMID:25347276

  12. Plate fixation of olecranon osteotomies.

    PubMed

    Hewins, Edward A; Gofton, Wade T; Dubberly, Jamie; MacDermid, Joy C; Faber, Kenneth J; King, Graham J W

    2007-01-01

    The management of intra-articular distal humeral fractures remains a difficult surgical problem. Although an olecranon osteotomy provides excellent exposure for management of these fractures, a number of complications can occur after the creation and repair of the osteotomy including nonunion, malunion, hardware failure, and pain secondary to prominent hardware. In an effort to reduce the incidence of these complications, the senior authors now use contoured 3.5 mm reconstruction plates for the fixation of their apex-distal chevron olecranon osteotomies. Two surgeons at a single institution used this technique of exposure on a series of 17 consecutive patients with intra-articular distal humerus fractures between 1996 and 1999. In this series, all osteotomies united. There was one complication related specifically to the osteotomy: one of the screws in the plate penetrated the proximal radioulnar joint, interfering with forearm rotation; a second procedure was required to shorten the screw. Only one of the 17 patients requested plate removal during the 32 month (average) follow-up period. Plate fixation of olecranon osteotomies using a 3.5 mm reconstruction plate provides a construct with predictable healing and few complications. The overall results using this technique are comparable with other reported methods in the literature. PMID:17211271

  13. The Abiotic Fixation of Nitrogen on Terrestrial Planets: Experimental Results and Their Implications

    NASA Astrophysics Data System (ADS)

    Summers, D. P.; Khare, B.; Basa, R. C. B.; Rodoni, D.

    2010-04-01

    In the abiotic fixation of nitrogen under neutral atmospheres, after formation of NO, pathways through HNO and NO2 lead to nitrate/nitrite. Recent results also show the direct reduction of NO by FeS is the most efficient route to reduced nitrogen.

  14. Proteomic analysis of Bacillus thuringiensis ΔphaC mutant BMB171/PHB(-1) reveals that the PHB synthetic pathway warrants normal carbon metabolism.

    PubMed

    Chen, Deju; Xu, Dong; Li, Mingshun; He, Jin; Gong, Yuhua; Wu, Dandan; Sun, Ming; Yu, Ziniu

    2012-09-18

    A phaC knockout mutant from Bacillus thuringiensis (Bt) strain BMB171, named BMB171/PHB(-1), was constructed. A physiological and metabolic investigation and a proteomic analysis were conducted for both ΔphaC mutant and its parent strain. Grown in peptone medium with 5 gram glucose per liter as sole carbon source, BMB171/PHB(-1) produced various organic acids. Here the excreted pyruvate, citrate, lactate, acetate and glutamate were quantitatively analyzed. Deletion of phaC gene from the BMB171 strain resulted in 1) growth delay; 2) higher consumption of dioxigen but lower cell yield; 3) stagnation of pH movement; 4) overproduction of organic acids; 5) rapid descent of cell density in the stationary phase; and 6) a sporulation-deficient phenotype. Our proteomic study with qPCR reconfirmation reveals that the absence of PhaC led to a metabolic turmoil which showed repressed glycolysis, and over-expressed TCA cycle, various futile pathways and amino acid synthesis during vegetative growth. It is thus thought that B. thuringiensis BMB171 effectively regulated its carbon metabolism upon the presence of the functional PHB synthetic pathway. The presence of this pathway warrants a PHB-producing bacterium better surviving under different environmental conditions. PMID:22705120

  15. Determination of methanogenic pathways through carbon isotope (δ13C) analysis for the two-stage anaerobic digestion of high-solids substrates.

    PubMed

    Gehring, Tito; Klang, Johanna; Niedermayr, Andrea; Berzio, Stephan; Immenhauser, Adrian; Klocke, Michael; Wichern, Marc; Lübken, Manfred

    2015-04-01

    This study used carbon isotope (δ(13)C)-based calculations to quantify the specific methanogenic pathways in a two-stage experimental biogas plant composed of three thermophilic leach bed reactors (51-56 °C) followed by a mesophilic (36.5 °C) anaerobic filter. Despite the continuous dominance of the acetoclastic Methanosaeta in the anaerobic filter, the methane (CH4) fraction derived from carbon dioxide reduction (CO2), fmc, varied significantly over the investigation period of 200 days. At organic loading rates (OLRs) below 6.0 gCOD L(-1) d(-1), the average fmc value was 33%, whereas at higher OLRs, with a maximum level of 17.0 gCOD L(-1) d(-1), the fmc values reached 47%. The experiments allowed for a clear differentiation of the isotope fractionation related to the formation and consumption of acetate in both stages of the plant. Our data indicate constant carbon isotope fractionation for acetate formation at different OLRs within the thermophilic leach bed reactors as well as a negligible contribution of homoacetogenesis. These results present the first quantification of methanogenic pathway (fmc values) dynamics for a continually operated mesophilic bioreactor and highlight the enormous potential of δ(13)C analysis for a more comprehensive understanding of the anaerobic degradation processes in CH4-producing biogas plants. PMID:25741999

  16. Investigations of potential microbial methanogenic and carbon monoxide utilization pathways in ultra-basic reducing springs associated with present-day continental serpentinization: the Tablelands, NL, CAN

    PubMed Central

    Morrill, Penny L.; Brazelton, William J.; Kohl, Lukas; Rietze, Amanda; Miles, Sarah M.; Kavanagh, Heidi; Schrenk, Matthew O.; Ziegler, Susan E.; Lang, Susan Q.

    2014-01-01

    Ultra-basic reducing springs at continental sites of serpentinization act as portals into the biogeochemistry of a subsurface environment with H2 and CH4 present. Very little, however, is known about the carbon substrate utilization, energy sources, and metabolic pathways of the microorganisms that live in this ultra-basic environment. The potential for microbial methanogenesis with bicarbonate, formate, acetate, and propionate precursors and carbon monoxide (CO) utilization pathways were tested in laboratory experiments by adding substrates to water and sediment from the Tablelands, NL, CAD, a site of present-day continental serpentinization. Microbial methanogenesis was not observed after bicarbonate, formate, acetate, or propionate addition. CO was consumed in the live experiments but not in the killed controls and the residual CO in the live experiments became enriched in 13C. The average isotopic enrichment factor resulting from this microbial utilization of CO was estimated to be 11.2 ± 0.2‰. Phospholipid fatty acid concentrations and δ13C values suggest limited incorporation of carbon from CO into microbial lipids. This indicates that in our experiments, CO was used primarily as an energy source, but not for biomass growth. Environmental DNA sequencing of spring fluids collected at the same time as the addition experiments yielded a large proportion of Hydrogenophaga-related sequences, which is consistent with previous metagenomic data indicating the potential for these taxa to utilize CO. PMID:25431571

  17. PHYSIOLOGY OF NITROGEN FIXATION BY BACILLUS POLYMYXA

    PubMed Central

    Grau, F. H.; Wilson, P. W.

    1962-01-01

    Grau, F. H. (University of Wisconsin, Madison) and P. W. Wilson. Physiology of nitrogen fixation by Bacillus polymyxa. J. Bacteriol. 83:490496. 1962.Of 17 strains of Bacillus polymyxa tested for fixation of molecular nitrogen, 15 fixed considerable quantities (30 to 150 ?g N/ml). Two strains of the closely related B. macerans did not use N2, but possibly other members of this species may do so. Confirmation of fixation was obtained by showing incorporation of N15 into cell material. Both iron and molybdenum are specifically required for fixation; without the addition of these metals to the nitrogen-free medium, the growth rate and the total nitrogen fixed were reduced about 30 to 50%. No requirement for added molybdenum could be shown when ammonia was the nitrogen source, and the absence of iron caused only a slight decrease in growth. Washed-cell suspensions of B. polymyxa containing an active hydrogenase readily incorporated N15 into cell materials when provided with mannitol, glucose, or pyruvate but not when formate was the substrate. Hydrogen is a specific inhibitor of fixation, reducing both the rate and final amount of nitrogen fixed; it did not reduce growth on ammonia. Fixation was strictly anaerobic, 1% oxygen in the gas phase being sufficient to stop fixation. Arsenate is a powerful inhibitor of fixation of N2 by washed-cell suspensions of B. polymyxa, indicating that high-energy phosphate may be significant for this process. PMID:13901244

  18. Biochemical Approaches to Improved Nitrogen Fixation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Improving symbiotic nitrogen fixation by legumes has emerged again as an important topic on the world scene due to the energy crisis and lack of access to nitrogen fertilizer in developing countries. We have taken a biochemical genomics approach to improving symbiotic nitrogen fixation in legumes. L...

  19. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  20. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  1. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  2. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  3. Whole Animal Perfusion Fixation for Rodents

    PubMed Central

    Gage, Gregory J.; Kipke, Daryl R.; Shain, William

    2012-01-01

    The goal of fixation is to rapidly and uniformly preserve tissue in a life-like state. While placing tissue directly in fixative works well for small pieces of tissue, larger specimens like the intact brain pose a problem for immersion fixation because the fixative does not reach all regions of the tissue at the same rate 5,7. Often, changes in response to hypoxia begin before the tissue can be preserved 12. The advantage of directly perfusing fixative through the circulatory system is that the chemical can quickly reach every corner of the organism using the natural vascular network. In order to utilize the circulatory system most effectively, care must be taken to match physiological pressures 3. It is important to note that physiological pressures are dependent on the species used. Techniques for perfusion fixation vary depending on the tissue to be fixed and how the tissue will be processed following fixation. In this video, we describe a low-cost, rapid, controlled and uniform fixation procedure using 4% paraformaldehyde perfused via the vascular system: through the heart of the rat to obtain the best possible preservation of the brain for immunohistochemistry. The main advantage of this technique (vs. gravity-fed systems) is that the circulatory system is utilized most effectively. PMID:22871843

  4. The osmotic effects of electron microscope fixatives.

    PubMed

    Bone, Q; Denton, E J

    1971-06-01

    The reflecting cells on the scales of sprat and herring contain ordered arrays of guanine crystals. The spacing of the crystals within these cells determines the wave bands of the light which they reflect, hence volume changes in the reflecting cells can be observed as color changes directly. This property of the scales is used to show that (a) fixation with osmium tetroxide solutions destroys osmotic activity; (b) fixation with aldehyde solutions does not destroy osmotic activity and does not cause volume changes if the aldehydes are made up in salt or sucrose solutions whose osmolarities, discounting the aldehyde, are about 60% of those to which the cells are in equilibrium in life, and (c) after aldehyde fixation the cells are osmotically active but come to a given volume in salt and sucrose solutions of concentrations only 60% of those which give their volume before fixation. Various possible mechanisms underlying the change of osmotic equilibrium caused by aldehyde fixation are discussed. PMID:4103952

  5. THE OSMOTIC EFFECTS OF ELECTRON MICROSCOPE FIXATIVES

    PubMed Central

    Bone, Q.; Denton, E. J.

    1971-01-01

    The reflecting cells on the scales of sprat and herring contain ordered arrays of guanine crystals. The spacing of the crystals within these cells determines the wave bands of the light which they reflect, hence volume changes in the reflecting cells can be observed as color changes directly. This property of the scales is used to show that (a) fixation with osmium tetroxide solutions destroys osmotic activity; (b) fixation with aldehyde solutions does not destroy osmotic activity and does not cause volume changes if the aldehydes are made up in salt or sucrose solutions whose osmolarities, discounting the aldehyde, are about 60% of those to which the cells are in equilibrium in life, and (c) after aldehyde fixation the cells are osmotically active but come to a given volume in salt and sucrose solutions of concentrations only 60% of those which give their volume before fixation. Various possible mechanisms underlying the change of osmotic equilibrium caused by aldehyde fixation are discussed. PMID:4103952

  6. Eighth international congress on nitrogen fixation. Final program

    SciTech Connect

    Not Available

    1990-12-31

    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  7. A MicroRNA-Mediated Insulin Signaling Pathway Regulates the Toxicity of Multi-Walled Carbon Nanotubes in Nematode Caenorhabditis elegans

    NASA Astrophysics Data System (ADS)

    Zhao, Yunli; Yang, Junnian; Wang, Dayong

    2016-03-01

    The underlying mechanisms for functions of microRNAs (miRNAs) in regulating toxicity of nanomaterials are largely unclear. Using Illumina HiSeqTM 2000 sequencing technique, we obtained the dysregulated mRNA profiling in multi-walled carbon nanotubes (MWCNTs) exposed nematodes. Some dysregulated genes encode insulin signaling pathway. Genetic experiments confirmed the functions of these dysregulated genes in regulating MWCNTs toxicity. In the insulin signaling pathway, DAF-2/insulin receptor regulated MWCNTs toxicity by suppressing function of DAF-16/FOXO transcription factor. Moreover, we raised a miRNAs-mRNAs network involved in the control of MWCNTs toxicity. In this network, mir-355 might regulate MWCNTs toxicity by inhibiting functions of its targeted gene of daf-2, suggesting that mir-355 may regulate functions of the entire insulin signaling pathway by acting as an upregulator of DAF-2, the initiator of insulin signaling pathway, in MWCNTs exposed nematodes. Our results provides highlight on understanding the crucial role of miRNAs in regulating toxicity of nanomaterials in organisms.

  8. A MicroRNA-Mediated Insulin Signaling Pathway Regulates the Toxicity of Multi-Walled Carbon Nanotubes in Nematode Caenorhabditis elegans.

    PubMed

    Zhao, Yunli; Yang, Junnian; Wang, Dayong

    2016-01-01

    The underlying mechanisms for functions of microRNAs (miRNAs) in regulating toxicity of nanomaterials are largely unclear. Using Illumina HiSeq(TM) 2000 sequencing technique, we obtained the dysregulated mRNA profiling in multi-walled carbon nanotubes (MWCNTs) exposed nematodes. Some dysregulated genes encode insulin signaling pathway. Genetic experiments confirmed the functions of these dysregulated genes in regulating MWCNTs toxicity. In the insulin signaling pathway, DAF-2/insulin receptor regulated MWCNTs toxicity by suppressing function of DAF-16/FOXO transcription factor. Moreover, we raised a miRNAs-mRNAs network involved in the control of MWCNTs toxicity. In this network, mir-355 might regulate MWCNTs toxicity by inhibiting functions of its targeted gene of daf-2, suggesting that mir-355 may regulate functions of the entire insulin signaling pathway by acting as an upregulator of DAF-2, the initiator of insulin signaling pathway, in MWCNTs exposed nematodes. Our results provides highlight on understanding the crucial role of miRNAs in regulating toxicity of nanomaterials in organisms. PMID:26984256

  9. A MicroRNA-Mediated Insulin Signaling Pathway Regulates the Toxicity of Multi-Walled Carbon Nanotubes in Nematode Caenorhabditis elegans

    PubMed Central

    Zhao, Yunli; Yang, Junnian; Wang, Dayong

    2016-01-01

    The underlying mechanisms for functions of microRNAs (miRNAs) in regulating toxicity of nanomaterials are largely unclear. Using Illumina HiSeqTM 2000 sequencing technique, we obtained the dysregulated mRNA profiling in multi-walled carbon nanotubes (MWCNTs) exposed nematodes. Some dysregulated genes encode insulin signaling pathway. Genetic experiments confirmed the functions of these dysregulated genes in regulating MWCNTs toxicity. In the insulin signaling pathway, DAF-2/insulin receptor regulated MWCNTs toxicity by suppressing function of DAF-16/FOXO transcription factor. Moreover, we raised a miRNAs-mRNAs network involved in the control of MWCNTs toxicity. In this network, mir-355 might regulate MWCNTs toxicity by inhibiting functions of its targeted gene of daf-2, suggesting that mir-355 may regulate functions of the entire insulin signaling pathway by acting as an upregulator of DAF-2, the initiator of insulin signaling pathway, in MWCNTs exposed nematodes. Our results provides highlight on understanding the crucial role of miRNAs in regulating toxicity of nanomaterials in organisms. PMID:26984256

  10. Interrelated modules in cyanobacterial photosynthesis: the carbon-concentrating mechanism, photorespiration, and light perception.

    PubMed

    Montgomery, Beronda L; Lechno-Yossef, Sigal; Kerfeld, Cheryl A

    2016-05-01

    Here we consider the cyanobacterial carbon-concentrating mechanism (CCM) and photorespiration in the context of the regulation of light harvesting, using a conceptual framework borrowed from engineering: modularity. Broadly speaking, biological 'modules' are semi-autonomous functional units such as protein domains, operons, metabolic pathways, and (sub)cellular compartments. They are increasingly recognized as units of both evolution and engineering. Modules may be connected by metabolites, such as NADPH, ATP, and 2PG. While the Calvin-Benson-Bassham Cycle and photorespiratory salvage pathways can be considered as metabolic modules, the carboxysome, the core of the cyanobacterial CCM, is both a structural and a metabolic module. In photosynthetic organisms, which use light cues to adapt to the external environment and which tune the photosystems to provide the ATP and reducing power for carbon fixation, light-regulated modules are critical. The primary enzyme of carbon fixation, RuBisCO, uses CO2 as a substrate, which is accumulated via the CCM. However RuBisCO also has a secondary reaction in which it utilizes O2, a by-product of the photochemical modules, which leads to photorespiration. A complete understanding of the interplay among CCM and photorespiration is predicated on uncovering their connections to the light reactions and the regulatory factors and pathways that tune these modules to external cues. We probe this connection by investigating light inputs into the CCM and photorespiratory pathways in the chromatically acclimating cyanobacterium Fremyella diplosiphon. PMID:27117337

  11. Abnormal Fixational Eye Movements in Amblyopia

    PubMed Central

    Shaikh, Aasef G.; Otero-Millan, Jorge; Kumar, Priyanka; Ghasia, Fatema F.

    2016-01-01

    Purpose Fixational saccades shift the foveal image to counteract visual fading related to neural adaptation. Drifts are slow eye movements between two adjacent fixational saccades. We quantified fixational saccades and asked whether their changes could be attributed to pathologic drifts seen in amblyopia, one of the most common causes of blindness in childhood. Methods Thirty-six pediatric subjects with varying severity of amblyopia and eleven healthy age-matched controls held their gaze on a visual target. Eye movements were measured with high-resolution video-oculography during fellow eye-viewing and amblyopic eye-viewing conditions. Fixational saccades and drifts were analyzed in the amblyopic and fellow eye and compared with controls. Results We found an increase in the amplitude with decreased frequency of fixational saccades in children with amblyopia. These alterations in fixational eye movements correlated with the severity of their amblyopia. There was also an increase in eye position variance during drifts in amblyopes. There was no correlation between the eye position variance or the eye velocity during ocular drifts and the amplitude of subsequent fixational saccade. Our findings suggest that abnormalities in fixational saccades in amblyopia are independent of the ocular drift. Discussion This investigation of amblyopia in pediatric age group quantitatively characterizes the fixation instability. Impaired properties of fixational saccades could be the consequence of abnormal processing and reorganization of the visual system in amblyopia. Paucity in the visual feedback during amblyopic eye-viewing condition can attribute to the increased eye position variance and drift velocity. PMID:26930079

  12. The ecology and genomics of C02 fixation in oceanic river plumes

    SciTech Connect

    F. Robert Tabita

    2008-09-12

    The ocean/atmosphere interface is the major conduit for the entry of atmospheric CO2 into oceanic carbon pools that can lead to sequestration or recycled release. The surface layers of the temperate and tropical oceans are often too oligotrophic to result in significant primary production that might lead to carbon sequestration. However, nutrient-rich river plumes can alter the primary production schemes of oligotrophic ocean basins, resulting in increased phytoplankton biomass and carbon fixation. The ultimate goal of this proposal is to understand these carbon cycling processes in major river plumes from the molecular processes involved in biological DIC uptake to contribution to basin-wide production and potential sequestration. Our research efforts include a field component to answer the questions raised concerning DIC in plumes entering ocean basins and an intensive genomics approach to understanding these processes on the cellular level using genomic fragments obtained from plume biota. This project is actually composed of 3 separate PI-initiated projects, including projects at the University of South Florida (USF) College of Marine Science, the University of Puerto Rico, and The Ohio State University. This report concerns research conducted at The Ohio State University and studies performed in collaboration with USF. In order to understand what might occur in the field, two model sysytems were studied in the laboratory. Carbon fixation in the unicellular cyanobacterium Synechococcus sp Strain PCC 7002 took place mainly through the CBB pathway. Nitrogen nutrition in cyanobacteria is regulated by NtcA, a transcriptional regulatory protein. We show that the rubisco activity and gene (rbcL) expression were not affected when cells were exposed to prolonged periods of nitrogen stress, however cells appear to use intracellular nitrogen reserves during nitrogen starvation. Transcripts of the global transcriptional regulator NtcA are expressed under nitrogen starved and nitrogen replete (nitrate or ammonia) growth conditions, with slight decrease in transcription in the presence of ammonia. These results suggest that intracellular levels of NtcA do not directly affect carbon metabolism. Gene expression of the other nitrogen regulatory signal transducer, encoded by glnB was also studied. The glnB gene was highly transcribed in nitrogen-limited cells compared to nitrogen depleted growth conditions. Therefore in the cyanobacterium Synechococcus sp PCC 7002, nitrogen does not affect the metabolic potential and carbon fixation. The NtcA regulator behaved differently and studies indicate that the product of the ntcA gene (NtcA) has an indirect effect on ca rbon assimilation and the genes involved in the carbon concentrating mechanism of strain 7002. The product of the ccmM gene plays an important role in carboxysome assembly and inorganic carbon transport within the cell. We hypothesized that under nitrogen limiting conditions the transcriptional regulator NtcA binds at the region upstream of ccmM, near the transcription start site, and blocks the transcription of ccmM. This hypothesis was experimentally proven. In another study, with USF researchers, we performed experiments in situ on RubisCO espression. To determine the relationship between expression of the major gene in carbon fixation, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO2 in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30–32) stations were dominated by rbcL mRNA concentrations from heterokonts; i.e., diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, a-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34–36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO2. While Prochlorococcus cells did not exhibit a large difference between low and high pCO2 water, Prochlorococcus rbcL RNA concentrations had a strong positive correlation to pCO2, suggesting a very low level of RuBisCO RNA transcription among Prochlorococcus in the plume waters, possibly due to their relatively poor carbon concentrating mechanisms (CCMs). These results provide molecular evidence that diatom/pelagophyte productivity is largely responsible for the large CO2 drawdown occurring in the MRP, based on the cooccurrence of elevated RuBisCO gene transcript concentrations from this group and reduced seawater pCO2 levels. This may partly be due to efficient CCMs that enable heterokont eukaryotes such as diatoms to continue fixing CO2 in the face of strong CO2 drawdown. This work represents the first attempt to relate in situ microbial gene expression to contemporaneous CO2 flux measurements in the ocean.

  13. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-09-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  14. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-01-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  15. From chemolithoautotrophs to electrolithoautotrophs: CO2 fixation by Fe(II)-oxidizing bacteria coupled with direct uptake of electrons from solid electron sources

    PubMed Central

    Ishii, Takumi; Kawaichi, Satoshi; Nakagawa, Hirotaka; Hashimoto, Kazuhito; Nakamura, Ryuhei

    2015-01-01

    At deep-sea vent systems, hydrothermal emissions rich in reductive chemicals replace solar energy as fuels to support microbial carbon assimilation. Until recently, all the microbial components at vent systems have been assumed to be fostered by the primary production of chemolithoautotrophs; however, both the laboratory and on-site studies demonstrated electrical current generation at vent systems and have suggested that a portion of microbial carbon assimilation is stimulated by the direct uptake of electrons from electrically conductive minerals. Here we show that chemolithoautotrophic Fe(II)-oxidizing bacterium, Acidithiobacillus ferrooxidans, switches the electron source for carbon assimilation from diffusible Fe2+ ions to an electrode under the condition that electrical current is the only source of energy and electrons. Site-specific marking of a cytochrome aa3 complex (aa3 complex) and a cytochrome bc1 complex (bc1 complex) in viable cells demonstrated that the electrons taken directly from an electrode are used for O2 reduction via a down-hill pathway, which generates proton motive force that is used for pushing the electrons to NAD+ through a bc1 complex. Activation of carbon dioxide fixation by a direct electron uptake was also confirmed by the clear potential dependency of cell growth. These results reveal a previously unknown bioenergetic versatility of Fe(II)-oxidizing bacteria to use solid electron sources and will help with understanding carbon assimilation of microbial components living in electronically conductive chimney habitats. PMID:26500609

  16. Immaturity of Visual Fixations in Dyslexic Children.

    PubMed

    Tiadi, Aimé; Gérard, Christophe-Loïc; Peyre, Hugo; Bui-Quoc, Emmanuel; Bucci, Maria Pia

    2016-01-01

    To our knowledge, behavioral studies recording visual fixations abilities in dyslexic children are scarce. The object of this article is to explore further the visual fixation ability in dyslexics compared to chronological age-matched and reading age-matched non-dyslexic children. Fifty-five dyslexic children from 7 to 14 years old, 55 chronological age-matched non-dyslexic children and 55 reading age-matched non-dyslexic children participated to this study. Eye movements from both eyes were recorded horizontally and vertically by a video-oculography system (EyeBrain(®) T2). The fixation task consisted in fixating a white-filled circle appearing in the center of the screen for 30 s. Results showed that dyslexic children produced a significantly higher number of unwanted saccades than both groups of non-dyslexic children. Moreover, the number of unwanted saccades significantly decreased with age in both groups of non-dyslexic children, but not in dyslexics. Furthermore, dyslexics made more saccades during the last 15 s of fixation period with respect to both groups of non-dyslexic children. Such poor visual fixation capability in dyslexic children could be due to impaired attention abilities, as well as to an immaturity of the cortical areas controlling the fixation system. PMID:26924975

  17. Immaturity of Visual Fixations in Dyslexic Children

    PubMed Central

    Tiadi, Aimé; Gérard, Christophe-Loïc; Peyre, Hugo; Bui-Quoc, Emmanuel; Bucci, Maria Pia

    2016-01-01

    To our knowledge, behavioral studies recording visual fixations abilities in dyslexic children are scarce. The object of this article is to explore further the visual fixation ability in dyslexics compared to chronological age-matched and reading age-matched non-dyslexic children. Fifty-five dyslexic children from 7 to 14 years old, 55 chronological age-matched non-dyslexic children and 55 reading age-matched non-dyslexic children participated to this study. Eye movements from both eyes were recorded horizontally and vertically by a video-oculography system (EyeBrain® T2). The fixation task consisted in fixating a white-filled circle appearing in the center of the screen for 30 s. Results showed that dyslexic children produced a significantly higher number of unwanted saccades than both groups of non-dyslexic children. Moreover, the number of unwanted saccades significantly decreased with age in both groups of non-dyslexic children, but not in dyslexics. Furthermore, dyslexics made more saccades during the last 15 s of fixation period with respect to both groups of non-dyslexic children. Such poor visual fixation capability in dyslexic children could be due to impaired attention abilities, as well as to an immaturity of the cortical areas controlling the fixation system. PMID:26924975

  18. Kennedy Space Center Fixation Tube (KFT)

    NASA Technical Reports Server (NTRS)

    Richards, Stephanie E.; Levine, Howard G.; Romero, Vergel

    2016-01-01

    Experiments performed on the International Space Station (ISS) frequently require the experimental organisms to be preserved until they can be returned to earth for analysis in the appropriate laboratory facility. The Kennedy Fixation Tube (KFT) was developed to allow astronauts to apply fixative, chemical compounds that are often toxic, to biological samples without the use of a glovebox while maintaining three levels of containment (Fig. 1). KFTs have been used over 200 times on-orbit with no leaks of chemical fixative. The KFT is composed of the following elements: a polycarbonate main tube where the fixative is loaded preflight, the sample tube where the plant or other biological specimens is placed during operations, the expansion plug, actuator, and base plug that provides fixative containment (Fig. 2). The main tube is pre-filled with 25 mL of fixative solution prior to flight. When actuated, the specimen contained within the sample tube is immersed with approximately 22 mL (+/- 2 mL) of the fixative solution. The KFT has been demonstrated to maintain its containment at ambient temperatures, 4degC refrigeration and -100 C freezing conditions.

  19. Involvement of the heme oxygenase-carbon monoxide-cGMP pathway in the nociception induced by acute painful stimulus in rats.

    PubMed

    Carvalho, Priscila G; Branco, Luiz G S; Panissi, Christie Ramos Andrade Leite-

    2011-04-18

    Heme oxygenase-carbon monoxide-cGMP (HO-CO-cGMP) pathway has been reported to be involved in peripheral and spinal modulation of inflammatory pain. However, the involvement of this pathway in the modulation of acute painful stimulus in the absence of inflammation remains unknown. Thus, we evaluated the involvement of the HO-CO-cGMP pathway in nociception by means the of analgesia index (AI) in the tail flick test. Rats underwent surgery for implantation of unilateral guide cannula directed toward the lateral ventricle and after the recovery period (5-7 days) were subjected to the measures of baseline tail flick test. Animals were divided into groups to assess the effect of intracerebroventricular administration (i.c.v.) of the following compounds: ZnDPBG (HO inhibitor) or vehicle (Na(2)CO(3)), heme-lysinate (substrate overload) or vehicle (l-lysine), or the selective inhibitor of soluble guanilate cyclase ODQ or vehicle (DMSO 1%) following the administration of heme-lysinate or vehicle. Heme overload increased AI, indicating an antinociceptive role of the pathway. This response was attenuated by i.c.v. pretreatment with the HO inhibitor ZnDPBG. In addition, this effect was dependent on cGMP activity, since the pretreatment with ODQ blocked the increase in the AI. Because CO produces most of its actions via cGMP, these data strongly imply that CO is the HO product involved in the antinociceptive response. This modulation seems to be phasic rather than tonic, since i.c.v. treatment with ZnDPBG or ODQ did not alter the AI. Therefore, we provide evidence consistent with the notion that HO-CO-cGMP pathway plays a key phasic antinociceptive role modulating noninflammatory acute pain. PMID:21349250

  20. Distal Humerus Fractures: Open Reduction Internal Fixation.

    PubMed

    Mighell, Mark A; Stephens, Brent; Stone, Geoffrey P; Cottrell, Benjamin J

    2015-11-01

    Distal humerus fractures are challenging injuries for the upper extremity surgeon. However, recent techniques in open reduction internal fixation have been powerful tools in getting positive outcomes. To get such results, the surgeon must be aware of how to properly use these techniques in their respective practices. The method of fixation depends on the fracture, taking the degree of comminution and the restoration of the columns and articular surface into account. This article helps surgeons understand the concepts behind open reduction internal fixation of the distal humerus and makes them aware of pitfalls that may lead to negative results. PMID:26498548

  1. Diallyl disulfide attenuated carbon ion irradiation-induced apoptosis in mouse testis through changing the ratio of Tap73/?Np73 via mitochondrial pathway.

    PubMed

    Di, Cui-xia; Han, Lu; Zhang, Hong; Xu, Shuai; Mao, Ai-hong; Sun, Chao; Liu, Yang; Si, Jing; Li, Hong-yan; Zhou, Xin; Liu, Bing; Miao, Guo-ying

    2015-01-01

    Diallyl disulfide (DADS), a major organosulfur compound derived from garlic, has various biological properties, including anti-cancer effects. However, the protective mechanism of DADS against radiation-induced mouse testis cell apoptosis has not been elucidated. In this study, the magnitude of radiation effects evoked by carbon ion irradiation was marked by morphology changes, significant rise in apoptotic cells, activation expression of p53, up regulation the ratio of pro-apoptotic Tap73/anti-apoptotic ?Np73, as well as alterations of crucial mediator of the mitochondrial pathway. Interestingly, pretreatment with DADS attenuated carbon ion irradiation-induced morphology damages and apoptotic cells. Additionally, DADS elevated radiation-induced p53 and p21 expression, suggesting that p53 might be involved in the inhibition of cell cycle progression through up regulation of p21. Furthermore, administration with DADS prevented radiation-induced Tap73/?Np73 expression and consequently down regulated Bax/Bcl-2 ratio, cytochrome c release and caspase-3 expression, indicating that the balance between Tap73 and ?Np73 had potential to activate p53 responsive genes. Thus, our results showed that radio protection effect of DADS on mouse testis is mediated by blocking apoptosis through changing the ratio of Tap73/?Np73 via mitochondrial pathway, suggesting that DADS could be used as a potential radio protection agent for the testis against heavy-ion radiation. PMID:26526304

  2. Diallyl disulfide attenuated carbon ion irradiation-induced apoptosis in mouse testis through changing the ratio of Tap73/ΔNp73 via mitochondrial pathway

    PubMed Central

    Di, Cui-xia; Han, Lu; Zhang, Hong; Xu, Shuai; Mao, Ai-hong; Sun, Chao; Liu, Yang; Si, Jing; Li, Hong-yan; Zhou, Xin; Liu, Bing; Miao, Guo-ying

    2015-01-01

    Diallyl disulfide (DADS), a major organosulfur compound derived from garlic, has various biological properties, including anti-cancer effects. However, the protective mechanism of DADS against radiation-induced mouse testis cell apoptosis has not been elucidated. In this study, the magnitude of radiation effects evoked by carbon ion irradiation was marked by morphology changes, significant rise in apoptotic cells, activation expression of p53, up regulation the ratio of pro-apoptotic Tap73/anti-apoptotic ΔNp73, as well as alterations of crucial mediator of the mitochondrial pathway. Interestingly, pretreatment with DADS attenuated carbon ion irradiation-induced morphology damages and apoptotic cells. Additionally, DADS elevated radiation-induced p53 and p21 expression, suggesting that p53 might be involved in the inhibition of cell cycle progression through up regulation of p21. Furthermore, administration with DADS prevented radiation-induced Tap73/ΔNp73 expression and consequently down regulated Bax/Bcl-2 ratio, cytochrome c release and caspase-3 expression, indicating that the balance between Tap73 and ΔNp73 had potential to activate p53 responsive genes. Thus, our results showed that radio protection effect of DADS on mouse testis is mediated by blocking apoptosis through changing the ratio of Tap73/ΔNp73 via mitochondrial pathway, suggesting that DADS could be used as a potential radio protection agent for the testis against heavy-ion radiation. PMID:26526304

  3. Pd-catalyzed electrohydrogenation of carbon dioxide to formate: high mass activity at low overpotential and identification of the deactivation pathway.

    PubMed

    Min, Xiaoquan; Kanan, Matthew W

    2015-04-15

    Electrochemical reduction of CO2 to formate (HCO2(-)) powered by renewable electricity is a possible carbon-negative alternative to synthesizing formate from fossil fuels. This process is energetically inefficient because >1 V of overpotential is required for CO2 reduction to HCO2(-) on the metals currently used as cathodic catalysts. Pd reduces CO2 to HCO2(-) with no overpotential, but this activity has previously been limited to low synthesis rates and plagued by an unidentified deactivation pathway. Here we show that Pd nanoparticles dispersed on a carbon support reach high mass activities (50-80 mA HCO2(-) synthesis per mg Pd) when driven by less than 200 mV of overpotential in aqueous bicarbonate solutions. Electrokinetic measurements are consistent with a mechanism in which the rate-determining step is the addition of electrochemically generated surface adsorbed hydrogen to CO2 (i.e., electrohydrogenation). The electrodes deactivate over the course of several hours because of a minor pathway that forms CO. Activity is recovered, however, by removing CO with brief air exposure. PMID:25812119

  4. The peripheral antinociceptive effect induced by the heme oxygenase/carbon monoxide pathway is associated with ATP-sensitive K+ channels.

    PubMed

    Pereira de Ávila, Mara Aparecida; Giusti-Paiva, Alexandre; Giovani de Oliveira Nascimento, Carlos

    2014-03-01

    Carbon monoxide (CO), a product of the enzyme heme oxygenase (HO), has been recognized to act as an atypical neurotransmitter or neuromodulator in the nervous system, and several lines of evidence suggest that CO may play a role through multiple mechanisms in nociceptive processing. Therefore, the aim of our study was to assess the interaction between the HO/CO pathway and ATP-sensitive K+ channels in hypernociception in response to carrageenan. The electronic von Frey and Randall Selitto tests were applied before and after intraplantar carrageenan administration. The intraplantar hemin carrageenan administration (HO substrate) into the right hindpaw elicited an antinociceptive effect, which was determined to be local because it produced no effect when injected into the contralateral paw. The administration of a HO pathway inhibitor was capable of potentiating the hypersensitivity evoked by carrageenan. Among the three different HO products, CO appears to be the one that attenuated the nociceptive response, whereas biliverdin and iron (II) sulfate failed to cause any significant changes. This blockade of the carrageenan mechanical hyperalgesia induced by the hemin was antagonized by the administration of glybenclamide, and a combination of hemin and diazoxide decreased the hyperalgesic action of carrageenan. These results also suggest that an endogenous opioid system may not be involved because naloxone did not affect the hemin-induced antinociception in the carrageenan model. Our study provides evidence that the peripheral antinociceptive effect of the HO/CO pathway may result from the activation of ATP-sensitive K+ channels. PMID:24457122

  5. Direct and Indirect Costs of Dinitrogen Fixation in Crocosphaera watsonii WH8501 and Possible Implications for the Nitrogen Cycle

    PubMed Central

    Großkopf, Tobias; LaRoche, Julie

    2012-01-01

    The recent detection of heterotrophic nitrogen (N2) fixation in deep waters of the southern Californian and Peruvian OMZ questions our current understanding of marine N2 fixation as a process confined to oligotrophic surface waters of the oceans. In experiments with Crocosphaera watsonii WH8501, a marine unicellular diazotrophic (N2 fixing) cyanobacterium, we demonstrated that the presence of high nitrate concentrations (up to 800 μM) had no inhibitory effect on growth and N2 fixation over a period of 2 weeks. In contrast, the environmental oxygen concentration significantly influenced rates of N2 fixation and respiration, as well as carbon and nitrogen cellular content of C. watsonii over a 24-h period. Cells grown under lowered oxygen atmosphere (5%) had a higher nitrogenase activity and respired less carbon during the dark cycle than under normal oxygen atmosphere (20%). Respiratory oxygen drawdown during the dark period could be fully explained (104%) by energetic needs due to basal metabolism and N2 fixation at low oxygen, while at normal oxygen these two processes could only account for 40% of the measured respiration rate. Our results revealed that under normal oxygen concentration most of the energetic costs during N2 fixation (∼60%) are not derived from the process of N2 fixation per se but rather from the indirect costs incurred for the removal of intracellular oxygen or by the reversal of oxidative damage (e.g., nitrogenase de novo synthesis). Theoretical calculations suggest a slight energetic advantage of N2 fixation relative to assimilatory nitrate uptake, when oxygen supply is in balance with the oxygen requirement for cellular respiration (i.e., energy generation for basal metabolism and N2 fixation). Taken together our results imply the existence of a niche for diazotrophic organisms inside oxygen minimum zones, which are predicted to further expand in the future ocean. PMID:22833737

  6. The Path of Carbon in Photosynthesis

    DOE R&D Accomplishments Database

    Calvin, M.; Benson, A. A.

    1948-03-08

    The dark fixation of carbon dioxide by green algae has been investigated and found to be closely related to photosynthesis fixation. By illumination in the absence of carbon dioxide followed by treatment with radioactive carbon dioxide in the dark, the amount fixed has been increased ten to twenty fold. This rate of maximum fixation approaches photosynthesis maximum rates. The majority of the radioactive products formed under these conditions have been identified and isolated and the distribution of labeled carbon determined. From these results a tentative scheme for the mechanism of photosynthesis is set forth.

  7. Degradation Pathway of Bisphenol A: Does ipso Substitution Apply to Phenols Containing a Quaternary α-Carbon Structure in the para Position?▿ †

    PubMed Central

    Kolvenbach, B.; Schlaich, N.; Raoui, Z.; Prell, J.; Zühlke, S.; Schäffer, A.; Guengerich, F. P.; Corvini, P. F. X.

    2007-01-01

    The degradation of bisphenol A and nonylphenol involves the unusual rearrangement of stable carbon-carbon bonds. Some nonylphenol isomers and bisphenol A possess a quaternary α-carbon atom as a common structural feature. The degradation of nonylphenol in Sphingomonas sp. strain TTNP3 occurs via a type II ipso substitution with the presence of a quaternary α-carbon as a prerequisite. We report here a new degradation pathway of bisphenol A. Consequent to the hydroxylation at position C-4, according to a type II ipso substitution mechanism, the C-C bond between the phenolic moiety and the isopropyl group of bisphenol A is broken. Besides the formation of hydroquinone and 4-(2-hydroxypropan-2-yl)phenol as the main metabolites, further compounds resulting from molecular rearrangements consistent with a carbocationic intermediate were identified. Assays with resting cells or cell extracts of Sphingomonas sp. strain TTNP3 under an 18O2 atmosphere were performed. One atom of 18O2 was present in hydroquinone, resulting from the monooxygenation of bisphenol A and nonylphenol. The monooxygenase activity was dependent on both NADPH and flavin adenine dinucleotide. Various cytochrome P450 inhibitors had identical inhibition effects on the conversion of both xenobiotics. Using a mutant of Sphingomonas sp. strain TTNP3, which is defective for growth on nonylphenol, we demonstrated that the reaction is catalyzed by the same enzymatic system. In conclusion, the degradation of bisphenol A and nonylphenol is initiated by the same monooxygenase, which may also lead to ipso substitution in other xenobiotics containing phenol with a quaternary α-carbon. PMID:17557840

  8. Carbon and nitrogen cycling in thermally heated sediments

    NASA Astrophysics Data System (ADS)

    Meyer-Dombard, D. R.; Burton, M.; Vennelakanti, S.; Havig, J. R.; Shock, E.

    2009-12-01

    Hydrothermally heated sediment environments, such as are found in abundance throughout Yellowstone National Park, host fully functional microbial ecosystems. As with any ecosystem, both sources and sinks of carbon, nitrogen, and a myriad of other nutrients and energy-driving factors must be supplied. While we know microbial communities in hydrothermal environments can be surprisingly diverse, we know little about basic ecological functions such as carbon and nitrogen cycling. Previous work has shown that carbon cycling in one hot spring in Yellowstone National Park [“Bison Pool”] and its associated runoff channel functions as a complex system. Analysis of carbon and nitrogen isotopes in sediments and biofilms across a temperature and chemical gradient at this location revealed that the four best studied carbon fixation pathways [Calvin, reverse tricarboxylic acid, acetyl-CoA, 3-hydroxypropionate cycles] may all be functioning in this system, and nitrogen fixation varies across the chemosynthetic/photosynthetic ecotone [1]. Microcosm experiments using biofilms from this hot spring as inoculae with 13C labeled carbon substrates indicate heterotrophic growth [2]. In addition, metagenomic analysis of environmental DNA has indicated the presence of genes involved in carbon fixation [both phototrophic and autotrophic], and heterotrophy, as well as nitrogen fixation [3]. Studies from other Yellowstone locations have also found genetic evidence for carbon and nitrogen fixation [4, 5]. Of particular interest is the role of individuals in carbon and nitrogen cycling as environmental conditions suitable for chemosynthetic and photosynthetic growth vary. This study explores the diversity of cbbM/cbbL [Calvin cycle], aclB/oor/porA [rTCA cycle], nifH [nitrogen fixation], nirK [nitrite reduction] and amoA [ammonia oxidation] genes across a variety of Yellowstone environments. The transition of genetic diversity within sediments and biofilms is focused on the chemosynthetic/photosynthetic ecotone from a variety of hot springs spanning a range of pH and geochemical conditions. By sampling across this ecotone, changes in carbon and nitrogen fixation as a function of changing community structure become apparent. Environmental DNA was extracted from these samples, and the presence/absence of Bacteria and Archaea determined by PCR. In addition, PCR-directed screens reveal the presence or absence of the aforementioned functional genes. Further, comparison across a broad spectrum of environmental conditions supplies context for phylogenetic analysis of diversity. [1] Havig, J.R., 2009. Geochemistry of Hydrothermal Biofilms: Composition of Biofilms in Siliceous Sinter-Deposting Hot Springs. Doctoral Dissertation, Arizona State University. [2] Meyer-Dombard et al., 2007. Microbial Diversity and SIP Investigations of Streamer Biofilm Communities in Yellowstone. Goldschmidt Geochemical Conference. [3] Raymond et al., 2008. EOS Trans AGU. Abstract B14A-03. [4] Hall et al., 2008. AEM 74:4910-4922. [5] Steunou et al., 2006. PNAS 103:2398-2403.

  9. Nitrogen fixation on Arctic glaciers, Svalbard

    NASA Astrophysics Data System (ADS)

    Telling, Jon; Anesio, Alexandre M.; Tranter, Martyn; Irvine-Fynn, Tristram; Hodson, Andy; Butler, Catriona; Wadham, Jemma

    2011-09-01

    Glacier surfaces contain a wide diversity of microorganisms and can host a range of microbial activities. However, microbial nutrient cycling on glaciers is poorly understood. This study is the first to document nitrogen fixation (nitrogenase activity) on glaciers and demonstrate its importance in supporting microbial growth. Rates of nitrogen fixation (nitrogenase activity) in cryoconite holes on three valley glaciers in Svalbard ranged from <2.0 to 99.9 ?mol ethylene m-2 d-1 with rates inversely correlated to concentrations of available inorganic nitrogen. Annual inputs of nitrogen by nitrogen fixation on a glacier catchment scale are more than 2 orders of magnitude lower than the combined nitrogen inputs from snowmelt and rain. However, nitrogen fixation can be important for supporting microbial growth on the glaciers during the middle to late melt season after the snowline has retreated upslope.

  10. Carbon-Isotope Fractionations of Autotrophic Bacteria: Relevance to Primary Production and Microbial Evolution in Hot Springs and Hydrothermal Vents

    NASA Astrophysics Data System (ADS)

    Zhang, C. L.; Romanek, C. S.; Mills, G.

    2004-12-01

    Terrestrial hot springs and marine hydrothermal vents are often dominated by autotrophic microorganisms. Species of the Bacteria Domain in these environments are known to use different pathways for CO2 fixation. These may include the Calvin cycle, the Acetyl CoA pathway, the reverse TCA cycle, and the 3-HP pathway. Each cycle or pathway may be characterized by distinct patterns of carbon isotope fractionation. This presentation will summarize isotope fractionation patterns associated with known autotrophic bacteria and to use these patterns for interpreting natural isotopic variations. Examples will include hot springs from the Yellowstone National Park and Nevada desert, USA and Kamchatka, Russia, and hydrothermal vents from the East Pacific Rise. An attempt will be made to discuss isotopic variations within a particular pathway in the context of species evolution through horizontal gene transfer.

  11. Fixational eye movements predict visual sensitivity.

    PubMed

    Scholes, Chris; McGraw, Paul V; Nyström, Marcus; Roach, Neil W

    2015-10-22

    During steady fixation, observers make small fixational saccades at a rate of around 1-2 per second. Presentation of a visual stimulus triggers a biphasic modulation in fixational saccade rate-an initial inhibition followed by a period of elevated rate and a subsequent return to baseline. Here we show that, during passive viewing, this rate signature is highly sensitive to small changes in stimulus contrast. By training a linear support vector machine to classify trials in which a stimulus is either present or absent, we directly compared the contrast sensitivity of fixational eye movements with individuals' psychophysical judgements. Classification accuracy closely matched psychophysical performance, and predicted individuals' threshold estimates with less bias and overall error than those obtained using specific features of the signature. Performance of the classifier was robust to changes in the training set (novel subjects and/or contrasts) and good prediction accuracy was obtained with a practicable number of trials. Our results indicate a tight coupling between the sensitivity of visual perceptual judgements and fixational eye control mechanisms. This raises the possibility that fixational saccades could provide a novel and objective means of estimating visual contrast sensitivity without the need for observers to make any explicit judgement. PMID:26468244

  12. Laboratory studies of carbon kinetic isotope effects on the production mechanism of particulate phenolic compounds formed by toluene photooxidation: a tool to constrain reaction pathways.

    PubMed

    Irei, Satoshi; Rudolph, Jochen; Huang, Lin; Auld, Janeen; Collin, Fabrice; Hastie, Donald

    2015-01-01

    In this study, we examined compound-specific stable carbon isotope ratios for phenolic compounds in secondary organic aerosol (SOA) formed by photooxidation of isotope-label-free toluene. SOA generated by photooxidation of toluene using a continuous-flow reactor and an 8 m(3) indoor smog chamber was collected on filters, which were extracted with acetonitrile for compound-specific analysis. Eight phenolic compounds were identified in the extracts using a gas chromatograph coupled with a mass spectrometer, and their compound-specific stable carbon isotope ratios were determined using a gas chromatograph coupled with a combustion furnace followed by an isotope ratio mass spectrometer. The majority of products, including methylnitrophenols and methylnitrocatechols, were isotopically depleted by 5-6‰ compared to the initial isotope ratio of toluene, whereas the isotope ratio for 4-nitrophenol remained identical to that of toluene. On the basis of the reaction mechanisms proposed in previous reports, stable carbon isotope ratios of these products were calculated. By comparing the observed isotope ratios with the predicted isotope ratios, we explored possible production pathways for the particulate phenolic compounds. PMID:25490235

  13. Highly stable rice-straw-derived charcoal in 3700-year-old ancient paddy soil: evidence for an effective pathway toward carbon sequestration.

    PubMed

    Wu, Mengxiong; Yang, Min; Han, Xingguo; Zhong, Ting; Zheng, Yunfei; Ding, Pin; Wu, Weixiang

    2016-01-01

    Recalcitrant charcoal application is predicted to decelerate global warming through creating a long-term carbon sink in soil. Although many studies have showed high stability of charcoal derived from woody materials, few have focused on the dynamics of straw-derived charcoal in natural environment on a long timescale to evaluate its potential for agricultural carbon sequestration. Here, we examined straw-derived charcoal in an ancient paddy soil dated from ~3700 calendar year before present (cal. year BP). Analytical results showed that soil organic matter consisted of more than 25% of charcoal in charcoal-rich layer. Similarities in morphology and molecular structure between the ancient and the fresh rice-straw-derived charcoal indicated that ancient charcoal was derived from rice straw. The lower carbon content, higher oxygen content, and obvious carbonyl of the ancient charcoal compared with fresh rice straw charcoal implied that oxidation occurred in the scale of thousands years. However, the dominant aromatic C of ancient charcoal indicated that rice-straw-derived charcoal was highly stable in the buried paddy soil due to its intrinsic chemical structures and the physical protection of ancient paddy wetland. Therefore, it may suggest that straw charcoal application is a potential pathway for C sequestration considering its longevity. PMID:25850742

  14. Key role of symbiotic dinitrogen fixation in tropical forest secondary succession.

    PubMed

    Batterman, Sarah A; Hedin, Lars O; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J; Hall, Jefferson S

    2013-10-10

    Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000 kg carbon per hectare) in the first 12 years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2. PMID:24037375

  15. Key role of symbiotic dinitrogen fixation in tropical forest secondary succession

    NASA Astrophysics Data System (ADS)

    Batterman, Sarah A.; Hedin, Lars O.; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J.; Hall, Jefferson S.

    2013-10-01

    Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000kg carbon per hectare) in the first 12years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2.

  16. Collaborative regulation of CO2 transport and fixation during succinate production in Escherichia coli

    PubMed Central

    Zhu, Li-Wen; Zhang, Lei; Wei, Li-Na; Li, Hong-Mei; Yuan, Zhan-Peng; Chen, Tao; Tang, Ya-Ling; Liang, Xin-Hua; Tang, Ya-Jie

    2015-01-01

    In Escherichia coli, succinic acid is synthesized by CO2 fixation-based carboxylation of C3 metabolites. A two-step process is involved in CO2 integration: CO2 uptake into the cell and CO2 fixation by carboxylation enzymes. The phosphoenolpyruvate (PEP) carboxylase (PPC) and carboxykinase (PCK) are two important carboxylation enzymes within the succinate synthetic pathway, while SbtA and BicA are two important bicarbonate transporters. In this study, we employed a dual expression system, in which genes regulating both CO2 uptake and fixation were co-overexpressed, or overexpressed individually to improve succinate biosynthesis. Active CO2 uptake was observed by the expression of SbtA or/and BicA, but the succinate biosynthesis was decreased. The succinate production was significantly increased only when a CO2 fixation gene (ppc or pck) and a CO2 transport gene (sbtA or bicA) were co-expressed. Co-expression of pck and sbtA provided the best succinate production among all the strains. The highest succinate production of 73.4 g L−1 was 13.3%, 66.4% or 15.0% higher than that obtained with the expression of PCK, SbtA alone, or with empty plasmids, respectively. We believe that combined regulation of CO2 transport and fixation is critical for succinate production. Imbalanced gene expression may disturb the cellular metabolism and succinate production. PMID:26626308

  17. Collaborative regulation of CO2 transport and fixation during succinate production in Escherichia coli.

    PubMed

    Zhu, Li-Wen; Zhang, Lei; Wei, Li-Na; Li, Hong-Mei; Yuan, Zhan-Peng; Chen, Tao; Tang, Ya-Ling; Liang, Xin-Hua; Tang, Ya-Jie

    2015-01-01

    In Escherichia coli, succinic acid is synthesized by CO2 fixation-based carboxylation of C3 metabolites. A two-step process is involved in CO2 integration: CO2 uptake into the cell and CO2 fixation by carboxylation enzymes. The phosphoenolpyruvate (PEP) carboxylase (PPC) and carboxykinase (PCK) are two important carboxylation enzymes within the succinate synthetic pathway, while SbtA and BicA are two important bicarbonate transporters. In this study, we employed a dual expression system, in which genes regulating both CO2 uptake and fixation were co-overexpressed, or overexpressed individually to improve succinate biosynthesis. Active CO2 uptake was observed by the expression of SbtA or/and BicA, but the succinate biosynthesis was decreased. The succinate production was significantly increased only when a CO2 fixation gene (ppc or pck) and a CO2 transport gene (sbtA or bicA) were co-expressed. Co-expression of pck and sbtA provided the best succinate production among all the strains. The highest succinate production of 73.4 g L(-1) was 13.3%, 66.4% or 15.0% higher than that obtained with the expression of PCK, SbtA alone, or with empty plasmids, respectively. We believe that combined regulation of CO2 transport and fixation is critical for succinate production. Imbalanced gene expression may disturb the cellular metabolism and succinate production. PMID:26626308

  18. Elementary Flux Mode Analysis of Acetyl-CoA Pathway in Carboxydothermus hydrogenoformans Z-2901

    PubMed Central

    Chinnasamy Perumal, Rajadurai; Selvaraj, Ashok; Ramesh Kumar, Gopal

    2014-01-01

    Carboxydothermus hydrogenoformans is a carboxydotrophic hydrogenogenic bacterium species that produces hydrogen molecule by utilizing carbon monoxide (CO) or pyruvate as a carbon source. To investigate the underlying biochemical mechanism of hydrogen production, an elementary mode analysis of acetyl-CoA pathway was performed to determine the intermediate fluxes by combining linear programming (LP) method available in CellNetAnalyzer software. We hypothesized that addition of enzymes necessary for carbon monoxide fixation and pyruvate dissimilation would enhance the theoretical yield of hydrogen. An in silico gene knockout of pyk, pykC, and mdh genes of modeled acetyl-CoA pathway allows the maximum theoretical hydrogen yield of 47.62 mmol/gCDW/h for 1 mole of carbon monoxide (CO) uptake. The obtained hydrogen yield is comparatively two times greater than the previous experimental data. Therefore, it could be concluded that this elementary flux mode analysis is a crucial way to achieve efficient hydrogen production through acetyl-CoA pathway and act as a model for strain improvement. PMID:24822064

  19. Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}

    NASA Astrophysics Data System (ADS)

    Thomas, P. J.; Boller, A. J.; Zhao, Z.; Tabita, F. R.; Cavanaugh, C. M.; Scott, K. M.

    2006-12-01

    Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (δ13C = {[13C/12Csample/13C/12Cstandard] - 1} × 1000). Five different forms of RubisCO (IA, IB, IC, ID, and II) are utilized by algae and autotrophic bacteria reliant on the Calvin-Benson cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs, and their ɛ values (={[12k/13k] - 1} × 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, explaining the variation in biomass δ13C values of autotrophs utilizing these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides and Ralstonia eutropha. The purpose of this work was to determine the ɛ values for form IC RubisCO enzymes from R. sphaeroides and R. eutropha. Recombinant form IC RubisCOs were purified by conventional column chromatography procedures. Assay conditions (pH, dissolved inorganic carbon concentration) were tested to determine which parameters were conducive to the high rates of carbon fixation necessary for ɛ determination. Under standard conditions (pH 8.5 and 5 mM DIC), form IC RubisCO activities were sufficient for ɛ determination. Experiments are currently being conducted to measure the ɛ values of these enzymes. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of δ13C values of organisms fixing carbon via the Calvin-Benson cycle. These results are critical for determining the degree to which Calvin cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.

  20. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

    2014-12-01

    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and Arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multiyear mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) buildup and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  1. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

    2014-08-01

    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multi-year mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) build-up and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  2. Malate-Mediated Carbon Catabolite Repression in Bacillus subtilis Involves the HPrK/CcpA Pathway ▿ §

    PubMed Central

    Meyer, Frederik M.; Jules, Matthieu; Mehne, Felix M. P.; Le Coq, Dominique; Landmann, Jens J.; Görke, Boris; Aymerich, Stéphane; Stülke, Jörg

    2011-01-01

    Most organisms can choose their preferred carbon source from a mixture of nutrients. This process is called carbon catabolite repression. The Gram-positive bacterium Bacillus subtilis uses glucose as the preferred source of carbon and energy. Glucose-mediated catabolite repression is caused by binding of the CcpA transcription factor to the promoter regions of catabolic operons. CcpA binds DNA upon interaction with its cofactors HPr(Ser-P) and Crh(Ser-P). The formation of the cofactors is catalyzed by the metabolite-activated HPr kinase/phosphorylase. Recently, it has been shown that malate is a second preferred carbon source for B. subtilis that also causes catabolite repression. In this work, we addressed the mechanism by which malate causes catabolite repression. Genetic analyses revealed that malate-dependent catabolite repression requires CcpA and its cofactors. Moreover, we demonstrate that HPr(Ser-P) is present in malate-grown cells and that CcpA and HPr interact in vivo in the presence of glucose or malate but not in the absence of a repressing carbon source. The formation of the cofactor HPr(Ser-P) could be attributed to the concentrations of ATP and fructose 1,6-bisphosphate in cells growing with malate. Both metabolites are available at concentrations that are sufficient to stimulate HPr kinase activity. The adaptation of cells to environmental changes requires dynamic metabolic and regulatory adjustments. The repression strength of target promoters was similar to that observed in steady-state growth conditions, although it took somewhat longer to reach the second steady-state of expression when cells were shifted to malate. PMID:22001508

  3. Cost of external fixation vs external fixation then nailing in bone infection

    PubMed Central

    Emara, Khaled Mohamed; Diab, Ramy Ahmed; Ghafar, Khaled Abd EL

    2015-01-01

    AIM: To study the cost benefit of external fixation vs external fixation then nailing in treatment of bone infection by segment transfer. METHODS: Out of 71 patients with infected nonunion tibia treated between 2003 and 2006, 50 patients fitted the inclusion criteria (26 patients were treated by external fixation only, and 24 patients were treated by external fixation early removal after segment transfer and replacement by internal fixation). Cost of inpatient treatment, total cost of inpatient and outpatient treatment till full healing, and the weeks of absence from school or work were calculated and compared between both groups. RESULTS: The cost of hospital stay and surgery in the group of external fixation only was 22.6 ± 3.3 while the cost of hospital stay and surgery in the group of early external fixation removal and replacement by intramedullary nail was 26.0 ± 3.2. The difference was statistically significant regarding the cost of hospital stay and surgery in favor of the group of external fixation only. The total cost of medical care (surgery, hospital stay, treatment outside the hospital including medications, dressing, physical therapy, outpatient laboratory work, etc.) in group of external fixation only was 63.3 ± 15.1, and total absence from work was 38.6 ± 6.6 wk. While the group of early removal of external fixation and replacement by IM nail, total cost of medical care was 38.3 ± 6.4 and total absence from work or school was 22.7 ± 4.1. The difference was statistically significant regarding the total cost and absence from work in favor of the group of early removal and replacement by IM nail. CONCLUSION: Early removal of external fixation and replacement by intramedullary nail in treatment of infected nonunion showed more cost effectiveness. Orthopaedic society needs to show the cost effectiveness of different procedures to the community, insurance, and health authorities. PMID:25621219

  4. Application of nano composites in the fixation and processing of histological material.

    PubMed

    Burkadze, G; Kikalishvili, N; Kargareteli, V

    2015-04-01

    The pathological examination is one of the longest in the list of medical tests. Most of this time is spent on preparation of the microslide, which involves the following phases: fixation, processing, cutting and staining. Our objective was to develop optimal regime of fixation and processing (namely, 1 and 2 stage of processing) by applying Nano composites for the development of quick, cheap and qualitative protocol of material processing. 24 various types and concentration Nano composite fixation device were used in study, made by applying single-layer, surface modified carbon nanotubes in the conditions of ultrasound treatment by UP200HT device. Also was developed Nano tubular network integration method in bio-material in the conditions of ultrasound treatment, when besides Nano composite fixation devices various Nano composite reagents (namely, 0.003% and 0.005% Nano composite alcohols) were used in material processing. There were carried out 126 experiments in sum and experiments were checked through standard processing. Fixation devices produced from formalin and alcohol base showed good result of fixation - by using them in the conditions of ultrasound treatment, practically 24 times decreased the period of fixation (as a standard of fixation was applied minimal rate of ASCO/Cap guideline dated by 2008 - 6 hours). The best way was considered Nano composite fixation device of NH2 functionalization of the 0.002% concentration on alcohol base A19 (according to the fixation rate 15 minutes with ultrasound maintenance). Nano tubular network integration method enabled us to have decreased the number of alcohols of ascending concentration and delay time in them. High time efficiency factor - Tk = 47.5% (time of new processing/ standard processing time X100) and high efficiency factor of the expense of reagents - Rk = 33% (number of reagents spent at the time of new processing/number of spent reagents at the time of standard processing X100) is obtained as a result of Nano integrated processing, so almost 2 times less time is spent and 1/3 times less reagents needed. PMID:25953945

  5. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion

    PubMed Central

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

    2013-01-01

    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C−C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

  6. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion

    NASA Astrophysics Data System (ADS)

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

    2013-07-01

    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C-C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion.

  7. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion.

    PubMed

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

    2013-01-01

    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N?) does not easily react with other chemicals. By dry ball-milling graphite with N?, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N? at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C--C bonds generated active carbon species that react directly with N? to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

  8. Comparison of the biomechanics and histology of two soft-tissue fixators composed of bioabsorbable copolymers.

    PubMed

    Powers, D L; Sonawala, M; Woolf, S K; An, Y H; Hawkins, R; Pietrzak, W S

    2001-01-01

    The purpose of this study was to assess the dynamic in vitro and in vivo characteristics of two different bioabsorbable copolymer soft-tissue fixation devices and to determine their efficacy in reattaching soft tissue to bone. Suretac fixators (Smith & Nephew/Acufex MicroSurgical Inc., Northwood, MA), made of polyglyconate (2:1 glycolic acid:trimethylene carbonate), and Pop Rivets (Arthrotek, Warsaw, IN), made of LactoSorb (82% poly L-lactic acid, 18% polyglycolic acid), were anchored into synthetic bone, and their pull-out strengths were evaluated. The devices were also evaluated with the use of an in vivo goat model in which the medial collateral ligament (MCL) was elevated from the tibia and directly reattached. In the in vitro biomechanical study, the Suretac fixators had negligible strength remaining by four weeks, whereas the Pop Rivets retained 50% of their strength at 4 weeks, 20% at 8 weeks, and negligible strength at 12 weeks. The in vivo strength of MCL repairs affected by each implant was not statistically different at any of the time points. Histologically, both implants were absorbed by 52 weeks, and there was no appreciable adverse tissue response. In conclusion, both copolymer fixators were found to be biocompatible. The Pop Rivet fixators demonstrated in vivo performance comparable to the Suretac fixators, although the Pop Rivets retained strength longer in vitro. Our results suggest that both devices provide adequate strength of fixation before degrading to allow the healing soft tissues to reach or surpass their native strength. PMID:11505422

  9. Clinical Incidence of PJK/ASD in Adult Deformity Surgery: A Comparison of Rigid Fixation and Semirigid Fixation-Rigid.

    PubMed

    Berven, Sigurd H

    2016-04-01

    Proximal junctional kyphosis (PJK) and adjacent segment degeneration (ASD) are important causes of reoperation for adult spinal deformity (). Reducing junctional complications can improve outcomes and cost-effectiveness of treatment. Rigid fixation is associated with significant proximal junctional pathology, but no clinical evidence indicates that less rigid fixation may reduce PJK. In lumbar degeneration, semirigid fixation has been associated with implant loosening, nonunion, and revision surgery. Rigid fixation is more reliable than semirigid fixation for management of spinal deformity. PMID:27015073

  10. The CCAAT box-binding factor stimulates ammonium assimilation in Saccharomyces cerevisiae, defining a new cross-pathway regulation between nitrogen and carbon metabolisms.

    PubMed Central

    Dang, V D; Bohn, C; Bolotin-Fukuhara, M; Daignan-Fornier, B

    1996-01-01

    In Saccharomyces cerevisiae, carbon and nitrogen metabolisms are connected via the incorporation of ammonia into glutamate; this reaction is catalyzed by the NADP-dependent glutamate dehydrogenase (NADP-GDH) encoded by the GDH1 gene. In this report, we show that the GDH1 gene requires the CCAAT box-binding activator (HAP complex) for optimal expression. This conclusion is based on several lines of evidence: (1) overexpression of GDH1 can correct the growth defect of hap2 and hap3 mutants on ammonium sulfate as a nitrogen source, (ii) Northern (RNA) blot analysis shows that the steady-state level of GDH1 mRNA is strongly lowered in a hap2 mutant, (iii) expression of a GDH1-lacZ fusion is drastically reduced in hap mutants, (iv) NADP-GDH activity is several times lower in the hap mutants compared with that in the isogenic wild-type strain, and finally, (v) site-directed mutagenesis of two consensual HAP binding sites in the GDH1 promoter strongly reduces expression of GDH1 and makes it HAP independent. Expression of GDH1 is also regulated by the carbon source, i.e., expression is higher on lactate than on ethanol, glycerol, or galactose, with the lowest expression being found on glucose. Finally, we show that a hap2 mutation does not affect expression of other genes involved in nitrogen metabolism (GDH2, GLN1, and GLN3 encoding, respectively, the NAD-GDH, glutamine synthetase, and a general activator of several nitrogen catabolic genes). The HAP complex is known to regulate expression of several genes involved in carbon metabolism; its role in the control of GDH1 gene expression, therefore, provides evidence for a cross-pathway regulation between carbon and nitrogen metabolisms. PMID:8606156

  11. John D.E., Z.A. Wang, X. Liu, R.H. Byrne, J.E. Corredor, J.M. López, A. Cabrera, D.A. Bronk, R. F. Tabita, and J.H. Paul. 2007. Carbon fixation gene (RuBisCO) transcripts and CO2 flux in the Mississippi River plume. ISME Journal. 1 -15.

    SciTech Connect

    John, D. E.; Wang, Z. A.; Liu, X.; Byrne, R. H.; Corredor, J. E.; López, J. M.; Cabrera, A.; Bronk, D. A.; Tabita, R. F.; Paul, J. H.

    2007-08-30

    River plumes deliver large quantities of nutrients to oligotrophic oceans, often resulting in significant CO2 drawdown. To determine the relationship between expression of the major gene in carbon fixation (large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, RuBisCO) and CO2 dynamics, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO2 in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30–32) stations were dominated by rbcL mRNA concentrations from heterokonts, such as diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, a-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34–36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO2. While Prochlorococcus cells did not exhibit a large difference between low and high pCO2 water, Prochlorococcus rbcL RNA concentrations had a strong positive correlation to pCO2, suggesting a very low level of RuBisCO RNA transcription among Prochlorococcus in the plume waters, possibly due to their relatively poor carbon concentrating mechanisms (CCMs). These results provide molecular evidence that diatom/pelagophyte productivity is largely responsible for the large CO2 drawdown occurring in the MRP, based on the cooccurrence of elevated RuBisCO gene transcript concentrations from this group and reduced seawater pCO2 levels. This may partly be due to efficient CCMs that enable heterokont eukaryotes such as diatoms to continue fixing CO2 in the face of strong CO2 drawdown. Our work represents the first attempt to relate in situ microbial gene expression to contemporaneous CO2 flux measurements in the ocean.

  12. Minimal internal fixation of tibial fractures.

    PubMed

    Rhinelander, F W

    1975-01-01

    Flexible wire and small pins cause minimal disturbance of osseous blood supply, and introduce minimal foreign material into the wound. Supplemental support by a plaster cast or by traction is required, but the external support can generally be discontinued early for joint mobilization. Several simple auxillary fixation devices extend the usefulness of wire fixation. Removal of metal is not required. Many common fractures of the tibia are amenable to this method of minimal internal fixation. In the diaphysis, long oblique fractures are the most suitable for this application; the firmness of their fixation by cerclage is augmented by muscle pull. Rotation is effectively controlled by a plate which is L-shaped in cross section, and is held in position by cerclage. In the metaphysis, articular fractures of the knee and ankle are securely fixed by a flattened loop of wire and two washers (wire-washer set), supplemented sometimes by pins or hand-made staples. Two pins alone provide excellent fixation of the medial malleolus. A single pin, or a single wire loop through drill holes, may be sufficient to impart stability to an unstable tibial fracture. A key-type graft of iliac bone, maintained by crossed wire loops through cortical drill holes, is effective in the tibial diaphysis. Autogenous iliac cancellous chips provide minimal and effective internal fixation for an infected ununited fracture of the tibia. The surgical instrument most important for making wire fixation highly successful is a tightener-twister which protects wire loops from excessive strain during application, and permits twisting at a predetermined and therefore reproducible tension. Other special and ordinary instruments are valuable assets. PMID:1093765

  13. Biomechanical evaluation of the Pinless external fixator.

    PubMed

    Stene, G M; Frigg, R; Schlegel, U; Swiontkowski, M

    1992-01-01

    In open fractures especially in those with severe soft tissue damage, fracture stabilisation is best achieved by using external fixators. There are some intrinsic complications which occur during classical external pin fixation. To overcome the problem of pin track infection and vascular damage from drilling, the Pinless external fixator was developed. It is based on the idea of a forceps with trocar points, which only penetrate the bone cortex superficially. The function of the device was tested in two mechanical trials and two in vitro tests in which one pinless clamp was put under a controlled load of 50 N, 150 cycles/day and studied over a 5 week period in sheep. The loads and time range of the experiment were chosen to simulate a temporary fracture stabilisation in a patient not bearing weight. The main question to be answered was whether the Pinless external fixator would be able to maintain stable fixation. Furthermore, it was to determine the changes at the trocar-to-bone interface. The clamp was found to maintain 72% of the initially applied clamping force after 5 weeks of in vivo application and it was found to be tight at removal. Some decrease of clamping force was found during the first 20 days and then the force tended to level off. There was no slippage nor did the clamp penetrate the cortex. There were no obvious signs of infection around the trocar-holes and in the bacterial tests no pathological cultures were grown. Histology revealed very localised bone reactions, the indentation caused by the trocar tips being only 1.2 mm deep. The study concludes, as far as could be ascertained from these tests, that it is safe to use pinless external fixation for temporary fracture fixation. PMID:1286923

  14. Nitrogen Fixation in Denitrified Marine Waters

    PubMed Central

    Fernandez, Camila; Farías, Laura; Ulloa, Osvaldo

    2011-01-01

    Nitrogen fixation is an essential process that biologically transforms atmospheric dinitrogen gas to ammonia, therefore compensating for nitrogen losses occurring via denitrification and anammox. Currently, inputs and losses of nitrogen to the ocean resulting from these processes are thought to be spatially separated: nitrogen fixation takes place primarily in open ocean environments (mainly through diazotrophic cyanobacteria), whereas nitrogen losses occur in oxygen-depleted intermediate waters and sediments (mostly via denitrifying and anammox bacteria). Here we report on rates of nitrogen fixation obtained during two oceanographic cruises in 2005 and 2007 in the eastern tropical South Pacific (ETSP), a region characterized by the presence of coastal upwelling and a major permanent oxygen minimum zone (OMZ). Our results show significant rates of nitrogen fixation in the water column; however, integrated rates from the surface down to 120 m varied by ∼30 fold between cruises (7.5±4.6 versus 190±82.3 µmol m−2 d−1). Moreover, rates were measured down to 400 m depth in 2007, indicating that the contribution to the integrated rates of the subsurface oxygen-deficient layer was ∼5 times higher (574±294 µmol m−2 d−1) than the oxic euphotic layer (48±68 µmol m−2 d−1). Concurrent molecular measurements detected the dinitrogenase reductase gene nifH in surface and subsurface waters. Phylogenetic analysis of the nifH sequences showed the presence of a diverse diazotrophic community at the time of the highest measured nitrogen fixation rates. Our results thus demonstrate the occurrence of nitrogen fixation in nutrient-rich coastal upwelling systems and, importantly, within the underlying OMZ. They also suggest that nitrogen fixation is a widespread process that can sporadically provide a supplementary source of fixed nitrogen in these regions. PMID:21687726

  15. Percutaneous limited internal fixation combined with external fixation to treat open pelvic fractures concomitant with perineal lacerations.

    PubMed

    Chen, Linwei; Zhang, Guoyou; Wu, Yaoshen; Guo, Xiaoshan; Yuan, Wen

    2011-12-01

    External fixation combined with colostomy is a traditional management of the pelvic fractures associated with perineal lacerations. However, malunion and dysfunction caused by malreduction and loss of reduction are common. One-stage definitive fixation without soft tissue harassment is requisite for the treatment. The purpose of this study was to assess the outcome of 1-stage definitive fixation by combining percutaneous limited internal fixation and external fixation in the treatment of pelvic fractures with perineal lacerations. Eighteen adults with high-energy unstable pelvic ring fractures associated with perineal lacerations were admitted between June 2003 and December 2010. Mean follow-up was 28 months. After wound closure and colostomy, 10 patients received external fixation and percutaneous screw fixation, and 8 patients underwent external fixation. Demographics, wound and fracture classification, and Injury Severity Score were comparable between the groups (P>.05). Initial reduction quality was comparable between the groups (P=.14), but the loss of reduction during follow-up was more significant in the external fixation group (P=.004). Combined fixation achieved better functional results than external fixation (P=.02). There were 2 cases of superficial wound infection in each group (P=1.0). By combining debridement, wound closure, colostomy, percutaneous limited internal fixation, and external fixation, we improved pelvic fracture recovery while reducing the risk of infection. One-stage definitive fixation is a better choice than external fixation in the treatment of open pelvic fracture concomitant with perineal wound. PMID:22146197

  16. Autotrophic Microbe Metagenomes and Metabolic Pathways Differentiate Adjacent Red Sea Brine Pools

    PubMed Central

    Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

    2013-01-01

    In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens. PMID:23624511

  17. Requirement of carbon dioxide for initial growth of facultative methylotroph, Acidomonas methanolica MB58.

    PubMed

    Mitsui, Ryoji; Katayama, Hiroko; Tanaka, Mitsuo

    2015-07-01

    The facultative methylotrophic bacterium Acidomonas methanolica MB58 can utilize C1 compounds via the ribulose monophosphate pathway. A large gene cluster comprising three components related to C1 metabolism was found in the genome. From upstream, the first was an mxa cluster encoding proteins for oxidation of methanol to formaldehyde; the second was the rmp cluster encoding enzymes for formaldehyde fixation; and the third was the cbb gene cluster encoding proteins for carbon dioxide (CO2) fixation. Examination of CO2 requirements for growth of A. methanolica MB58 cells demonstrated that it did not grow on any carbon source under CO2-free conditions. Measurement of ribulose-1,5-bisphosphate carboxylase activity and RT-PCR analysis demonstrated enzymatic activity was detected in A. methanolica MB58 at growth phase, regardless of carbon sources. However, methanol dehydrogenase and 3-hexlose-6-phosphate synthase expression was regulated by methanol or formaldehyde; it were detected during growth and apparently differed from ribulose-1,5-bisphosphate carboxylase expression. These results suggested that A. methanolica MB58 may be initially dependent on autotrophic growth and that carbon assimilation was subsequently coupled with the ribulose monophosphate pathway at early- to mid-log phases during methylotrophic growth. PMID:25511787

  18. Temporary external fixation facilitates open reduction and internal fixation of intra-articular calcaneal fractures.

    PubMed

    Elgamal, Tarek A; Tanagho, Andy E; Ferdinand, Rupert D

    2013-12-01

    Management of intra-articular calcaneal fractures during the past years has ranged from the nihilistic approach of no active treatment to open reduction and internal fixation or even to early subtalar arthrodesis. Operative treatment presents the surgeon with many challenges. Good results require atraumatic exposure, anatomic reduction, rigid fixation and early mobilization. We describe the use of a temporary external fixator as an intraoperative aid in the open reduction and internal fixation of intra-articular calcaneal fractures. We propose this operative strategy as an option for the treatment of calcaneal fractures. The controlled distractive force provides numerous benefits. These include improved exposure of the subtalar joint, correction of angulation and maintenance of temporary stability prior to definitive fixation. We have found this technique applicable and easily reproducible. PMID:24563983

  19. The importance of regulation of nitrogen fixation

    NASA Astrophysics Data System (ADS)

    Menge, D. N.

    2012-12-01

    I am not a proponent of including more detail in models simply because it makes them more realistic. More complexity increases the difficulty of model interpretation, so it only makes sense to include complexity if its benefit exceeds its costs. Biological nitrogen (N) fixation (BNF) is one process for which I feel the benefits of including greater complexity far outweigh the costs. I don't think that just because I work on BNF; I work on BNF because I think that. BNF, a microbial process carried out by free-living and symbiotic microbes, is the dominant N input to many ecosystems, the primary mechanism by which N deficiency can feed back to N inputs, and a main mechanism by which N surplus can develop. The dynamics of BNF, therefore, have huge implications for the rate of carbon uptake and the extent of CO2 fertilization, as well as N export to waterways and N2O emissions to the atmosphere. Unfortunately, there are serious deficiencies in our understanding of BNF. One main deficiency in our understanding is the extent to which various symbiotic N fixing organisms respond to imbalanced nutrition. Theory suggests that these responses, which I will call "strategies," have fundamental consequences for N fixer niches and ecosystem-level N and C cycling. Organisms that fix N regardless of whether they need it, a strategy that I will call "obligate," occupy post-disturbance niches and rapidly lead to N surplus. On the contrary, organisms that only fix as much N as they need, a "facultative" strategy, can occupy a wider range of successional niches, do not produce surplus N, and respond more rapidly to increased atmospheric CO2. In this talk I will show new results showing that consideration of these strategies could on its own explain the latitudinal distribution of symbiotic N fixing trees in North America. Specifically, the transition in N-fixing tree abundance from ~10% of basal area south of 35° latitude to ~1% of basal area north of 35° latitude that we observe from systematic forest inventory data can be explained by a concomitant switch from predominantly facultative N-fixing trees to predominantly obligate N-fixing trees. This transition in the dominant N-fixing strategy would have important consequences for the rate at which CO2 fertilization can occur and the extent of N surplus in different biomes. These theoretical and forest inventory results suggest that greater knowledge of BNF strategies would greatly increase our understanding of the distribution of N fixers and ecosystem responses to global change. I will finish the talk with a brief literature synthesis that attempts to draw generalizations about BNF strategies. With the limited data available, actinorhizal symbioses in temperate environments appear to be obligate but rhizobial symbioses appear to employ different strategies in different environments. From these results it is unclear whether the strategy is more strongly influenced by the microbes, the plants, or the environments in which the symbiosis has evolved; answering this question would point toward the best ways to incorporate N fixation into global ecosystem models.

  20. T-cell development of resistance to apoptosis is driven by a metabolic shift in carbon source and altered activation of death pathways.

    PubMed

    Bortner, C D; Scoltock, A B; Cain, D W; Cidlowski, J A

    2016-05-01

    We developed a model system to investigate apoptotic resistance in T cells using osmotic stress (OS) to drive selection of death-resistant cells. Exposure of S49 (Neo) T cells to multiple rounds of OS followed by recovery of surviving cells resulted in the selection of a population of T cells (S49 (OS 4-25)) that failed to die in response to a variety of intrinsic apoptotic stimuli including acute OS, but remained sensitive to extrinsic apoptotic initiators. Genome-wide microarray analysis comparing the S49 (OS 4-25) with the parent S49 (Neo) cells revealed over 8500 differentially regulated genes, with almost 90% of those identified being repressed. Surprisingly, our data revealed that apoptotic resistance is not associated with expected changes in pro- or antiapoptotic Bcl-2 family member genes. Rather, these cells lack several characteristics associated with the initial signaling or activation of the intrinsic apoptosis pathway, including failure to increase mitochondrial-derived reactive oxygen species, failure to increase intracellular calcium, failure to deplete glutathione, failure to release cytochrome c from the mitochondria, along with a lack of induced caspase activity. The S49 (OS 4-25) cells exhibit metabolic characteristics indicative of the Warburg effect, and, despite numerous changes in mitochondria gene expression, the mitochondria have a normal metabolic capacity. Interestingly, the S49 (OS 4-25) cells have developed a complete dependence on glucose for survival, and glucose withdrawal results in cell death with many of the essential characteristics of apoptosis. Furthermore, we show that other dietary sugars such as galactose support the viability of the S49 (OS 4-25) cells in the absence of glucose; however, this carbon source sensitizes these cells to die. Our findings suggest that carbon substrate reprogramming for energy production in the S49 (OS 4-25) cells results in stimulus-specific recognition defects in the activation of intrinsic apoptotic pathways. PMID:26658018

  1. [Visual fixation features after treatment of exudative age macular degeneration].

    PubMed

    Surguch, V K; Surnina, Z V; Sizova, M V

    2011-01-01

    Changes of visual fixation in patients with choroidal neovascularitation (CNV) associated with age macular degeneration (AMD) after bevacizumab are studied. 45 patients (45 eyes) with active CNV treated with intravitreal bevacizumab were enrolled into the study. Visual fixation was studied before and 3-6 months after treatment using original method that included fundus foto and fluorescein angiography. Fixation relative to fovea and lesion was evaluated. Foveal fixation beyond lesion was found in 9%, foveal fixation within lesion--in 47%, extrafoveal fixation beyond lesion--in 18%, extrafoveal fixation within lesion--in 26% of patients. Changes of fixation localization after treatment was found in 24% patients. Examination of visual fixation may be useful for prognosis of anti-VEGF treatment efficacy in patients with CNV. PMID:21721271

  2. Nano-scale, planar and multi-tiered current pathways from a carbon nanotube-copper composite with high conductivity, ampacity and stability

    NASA Astrophysics Data System (ADS)

    Subramaniam, Chandramouli; Sekiguchi, Atsuko; Yamada, Takeo; Futaba, Don N.; Hata, Kenji

    2016-02-01

    New lithographically processable materials with high ampacity are in demand to meet the increasing requirement for high operational current density at high temperatures existing in current pathways within electronic devices. To meet this demand, we report an approach to fabricate a high ampacity (~100 times higher than Cu) carbon nanotube-copper (CNT-Cu) composite into a variety of complex nano-scale, planar and multi-tiered current pathways. The approach involved the use of a two-stage electrodeposition of copper into a pre-patterned template of porous, thin CNT sheets acting as the electrode. The versatility of this approach enabled the realization of completely suspended multi-tier, dielectric-less `air-gap' CNT-Cu circuits that could be electrically isolated from each other and are challenging to fabricate with pure Cu or any metal. Importantly, all such complex structures, ranging from 500 nm to 20 μm in width, exhibited ~100-times higher ampacity than any known metal, with comparable electrical conductivity as Cu. In addition, CNT-Cu structures also exhibited a superior temperature stability compared to the ~10-times wider Cu counterparts. We believe that the combination of our approach and the properties demonstrated here are vital achievements for the future development of efficient and powerful electrical devices.

  3. Nano-scale, planar and multi-tiered current pathways from a carbon nanotube-copper composite with high conductivity, ampacity and stability.

    PubMed

    Subramaniam, Chandramouli; Sekiguchi, Atsuko; Yamada, Takeo; Futaba, Don N; Hata, Kenji

    2016-02-11

    New lithographically processable materials with high ampacity are in demand to meet the increasing requirement for high operational current density at high temperatures existing in current pathways within electronic devices. To meet this demand, we report an approach to fabricate a high ampacity (∼100 times higher than Cu) carbon nanotube-copper (CNT-Cu) composite into a variety of complex nano-scale, planar and multi-tiered current pathways. The approach involved the use of a two-stage electrodeposition of copper into a pre-patterned template of porous, thin CNT sheets acting as the electrode. The versatility of this approach enabled the realization of completely suspended multi-tier, dielectric-less 'air-gap' CNT-Cu circuits that could be electrically isolated from each other and are challenging to fabricate with pure Cu or any metal. Importantly, all such complex structures, ranging from 500 nm to 20 μm in width, exhibited ∼100-times higher ampacity than any known metal, with comparable electrical conductivity as Cu. In addition, CNT-Cu structures also exhibited a superior temperature stability compared to the ∼10-times wider Cu counterparts. We believe that the combination of our approach and the properties demonstrated here are vital achievements for the future development of efficient and powerful electrical devices. PMID:26486752

  4. Effects of multi-walled carbon nanotube (MWCNT) on antioxidant depletion, the ERK signaling pathway, and copper bioavailability in the copepod (Tigriopus japonicus).

    PubMed

    Lee, Jin Wuk; Won, Eun-Ji; Kang, Hye-Min; Hwang, Dae-Sik; Kim, Duck-Hyun; Kim, Rae-Kwon; Lee, Su-Jae; Lee, Jae-Seong

    2016-02-01

    Multi-walled carbon nanotubes (MWCNTs) are nanoparticles widely applicable in various industrial fields. However, despite the usefulness of MWCNTs in industry, their oxidative stress-induced toxicity, combined toxicity with metal, and mitogen-activated protein kinase (MAPK) activation have not been widely investigated in marine organisms. We used the intertidal copepod Tigriopus japonicus as a test organism to demonstrate the adverse effects induced by MWCNTs in aquatic test organisms. The dispersion of the MWCNTs in seawater was maintained over 48h without aggregation. MWCNTs caused a decrease in acute copper toxicity compared to the copper-only group in response to 20 and 100mg/L MWCNTs, but not in response to 4mg/L MWCNT, indicating that MWCNT may suppress acute copper toxicity. Reactive oxygen species (ROS) and enzymatic activities of glutathione S-transferase (GST) and catalase were significantly down-regulated in response to 100mg/L MWCNT exposure. Glutathione (GSH) and glutathione reductase (GR) activity did not change significantly, indicating that MWCNTs may cause failure of the antioxidant system in T. japonicus. However, MWCNT induced extracellular signal-regulated kinase (ERK) activation without p38 and c-jun NH2-terminal kinase (JNK) activation, suggesting that ERK activation plays a key role in cell signaling pathways downstream of CNT exposure. This suggests that this pathway can be used as a biomarker for CNT exposure in T. japonicus. This study provides a better understanding of the cellular-damage response to MWCNTs. PMID:26716406

  5. Single-walled carbon nanotube exposure induces membrane rearrangement and suppression of receptor-mediated signalling pathways in model mast cells

    PubMed Central

    Umemoto, Eric Y.; Speck, Mark; Shimoda, Lori M.N.; Kahue, Kara; Sung, Carl; Stokes, Alexander J.; Turner, Helen

    2014-01-01

    Carbon nanotubes (CNT) are environmental challenges to the respiratory and gastrointestinal mucosa, and to the dermal immune system. Mast cells (MC) are pro-inflammatory immunocytes that reside at these interfaces with the environment. Mast cells are sources of pro-inflammatory mediators (histamine, serotonin, matrix-active proteases, eicosanoids, prostanoids, cytokines and chemokines), which are released in a calcium-dependent manner following immunological challenge or physico-chemical stimulation. Since C-60 fullerenes, which share geometry with CNT, are suppressive of mast cell-driven inflammatory responses, we explored the effects of unmodified SWCNT aggregates on mast cell signaling pathways, phenotype and pro-inflammatory function. We noted SWCNT suppression of antigen-induced signalling pathways and pro-inflammatory degranulation responses. Mast cells recognize unmodified SWCNT by remodeling the plasma membrane, disaggregating the cortical actin cytoskeleton and relocalizing clathrin. Clathrin was also identified as a component of an affinity-purified interactome isolated from MC using an SWCNT affinity matrix for mast cell lysates. Together these data are consistent with the ability of SWCNT to suppress mast cell pro-inflammatory function via a novel recognition mechanism. PMID:24910985

  6. Operative fixation for complex tibial fractures

    PubMed Central

    Hutchinson, AJP; Frampton, AE; Bhattacharya, R

    2012-01-01

    INTRODUCTION The management of open tibial shaft fractures remains challenging. Intramedullary nailing and external fixation are the most commonly used fixation techniques although the optimal fixation technique remains unresolved. In this article the outcomes of these two surgical techniques are compared. METHODS A comprehensive literature search was conducted through MEDLINE® using Ovid® and MeSH (Medical Subject Heading) terms for articles published in the English literature between 1999 and 2009. The outcome measures compared were time to fracture union, infection rates and complications. RESULTS Forty-one studies were identified, of which only three met the inclusion criteria. The average time to union was variable. Delayed union and non-union appeared to be more prevalent in the external fixator group although this was not statistically significant. Both techniques were associated with secondary procedures as well as infection. CONCLUSIONS The current literature indicates little evidence to suggest the superiority of one fixation technique over another for open tibial fractures. PMID:22524923

  7. Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria

    PubMed Central

    Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M.; Pinhassi, Jarone

    2014-01-01

    Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light—but only in Ala—contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy. PMID:25136122

  8. Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria.

    PubMed

    Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M; Pinhassi, Jarone

    2014-09-01

    Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light--but only in Ala--contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observe