Sample records for carbon fixation pathways

  1. MICROBIOLOGY: A Fifth Pathway of Carbon Fixation

    NSDL National Science Digital Library

    Rudolf K. Thauer (Max Planck Institute for Terrestrial Microbiology; )

    2007-12-14

    Access to the article is free, however registration and sign-in are required. Genome sequence analyses and enzymatic studies reveal a novel CO2 fixation cycle in some autotrophic archaea. Autotrophs are organisms that can grow using carbon dioxide (CO2) as their sole source of carbon. Four mechanisms are known by which autotrophic organisms fix carbon. Berg et al. describe a fifth autotrophic CO2 fixation pathway in archaea that may have been used by some of the earliest organisms on Earth.

  2. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

    PubMed Central

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker

    2012-01-01

    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  3. The Role of the C4 Pathway in Carbon Accumulation and Fixation in a Marine Diatom1

    PubMed Central

    Reinfelder, John R.; Milligan, Allen J.; Morel, François M.M.

    2004-01-01

    The role of a C4 pathway in photosynthetic carbon fixation by marine diatoms is presently debated. Previous labeling studies have shown the transfer of photosynthetically fixed carbon through a C4 pathway and recent genomic data provide evidence for the existence of key enzymes involved in C4 metabolism. Nonetheless, the importance of the C4 pathway in photosynthesis has been questioned and this pathway is seen as redundant to the known CO2 concentrating mechanism of diatoms. Here we show that the inhibition of phosphoenolpyruvate carboxylase (PEPCase) by 3,3-dichloro-2-dihydroxyphosphinoylmethyl-2-propenoate resulted in a more than 90% decrease in whole cell photosynthesis in Thalassiosira weissflogii cells acclimated to low CO2 (10 ?m), but had little effect on photosynthesis in the C3 marine Chlorophyte, Chlamydomonas sp. In 3,3-dichloro-2-dihydroxyphosphinoylmethyl-2-propenoate-treated T. weissflogii cells, elevated CO2 (150 ?m) or low O2 (80–180 ?m) restored photosynthesis to the control rate linking PEPCase inhibition with CO2 supply in this diatom. In C4 organic carbon-inorganic carbon competition experiments, the 12C-labeled C4 products of PEPCase, oxaloacetic acid and its reduced form malic acid suppressed the fixation of 14C-labeled inorganic carbon by 40% to 50%, but had no effect on O2 evolution in photosynthesizing diatoms. Oxaloacetic acid-dependent O2 evolution in T. weissflogii was twice as high in cells acclimated to 10 ?m rather than 22 ?m CO2, indicating that the use of C4 compounds for photosynthesis is regulated over the range of CO2 concentrations observed in marine surface waters. Short-term 14C uptake (silicone oil centrifugation) and CO2 release (membrane inlet mass spectrometry) experiments that employed a protein denaturing cell extraction solution containing the PEPCKase inhibitor mercaptopicolinic acid revealed that much of the carbon taken up by diatoms during photosynthesis is stored as organic carbon before being fixed in the Calvin cycle, as expected if the C4 pathway functions as a CO2 concentrating mechanism. Together these results demonstrate that the C4 pathway is important in carbon accumulation and photosynthetic carbon fixation in diatoms at low (atmospheric) CO2. PMID:15286292

  4. Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans

    PubMed Central

    2010-01-01

    Background Acidithiobacillus ferrooxidans is chemolithoautotrophic ?-proteobacterium that thrives at extremely low pH (pH 1-2). Although a substantial amount of information is available regarding CO2 uptake and fixation in a variety of facultative autotrophs, less is known about the processes in obligate autotrophs, especially those living in extremely acidic conditions, prompting the present study. Results Four gene clusters (termed cbb1-4) in the A. ferrooxidans genome are predicted to encode enzymes and structural proteins involved in carbon assimilation via the Calvin-Benson-Bassham (CBB) cycle including form I of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO, EC 4.1.1.39) and the CO2-concentrating carboxysomes. RT-PCR experiments demonstrated that each gene cluster is a single transcriptional unit and thus is an operon. Operon cbb1 is divergently transcribed from a gene, cbbR, encoding the LysR-type transcriptional regulator CbbR that has been shown in many organisms to regulate the expression of RubisCO genes. Sigma70-like -10 and -35 promoter boxes and potential CbbR-binding sites (T-N11-A/TNA-N7TNA) were predicted in the upstream regions of the four operons. Electrophoretic mobility shift assays (EMSAs) confirmed that purified CbbR is able to bind to the upstream regions of the cbb1, cbb2 and cbb3 operons, demonstrating that the predicted CbbR-binding sites are functional in vitro. However, CbbR failed to bind the upstream region of the cbb4 operon that contains cbbP, encoding phosphoribulokinase (EC 2.7.1.19). Thus, other factors not present in the assay may be required for binding or the region lacks a functional CbbR-binding site. The cbb3 operon contains genes predicted to encode anthranilate synthase components I and II, catalyzing the formation of anthranilate and pyruvate from chorismate. This suggests a novel regulatory connection between CO2 fixation and tryptophan biosynthesis. The presence of a form II RubisCO could promote the ability of A. ferrooxidans to fix CO2 at different concentrations of CO2. Conclusions A. ferrooxidans has features of cbb gene organization for CO2-assimilating functions that are characteristic of obligate chemolithoautotrophs and distinguish this group from facultative autotrophs. The most conspicuous difference is a separate operon for the cbbP gene. It is hypothesized that this organization may provide greater flexibility in the regulation of expression of genes involved in inorganic carbon assimilation. PMID:20799944

  5. Widespread Occurrence of Two Carbon Fixation Pathways in Tubeworm Endosymbionts: Lessons from Hydrothermal Vent Associated Tubeworms from the Mediterranean Sea

    PubMed Central

    Thiel, Vera; Hügler, Michael; Blümel, Martina; Baumann, Heike I.; Gärtner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schönberg, Dieter; Petersen, Sven; Cowart, Dominique A.; Fisher, Charles R.; Imhoff, Johannes F.

    2012-01-01

    Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL – the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat. PMID:23248622

  6. CARBON DIOXIDE FIXATION.

    SciTech Connect

    FUJITA,E.

    2000-01-12

    Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO{sub 2} conversion. Recent achievements in the efficiency of solar energy conversion and in catalysis suggest that this approach holds a great deal of promise for contributing to future needs for fuels and chemicals.

  7. Structural studies of metalloenzyme complexes in acetogenic carbon fixation

    E-print Network

    Kung, Yan

    2011-01-01

    Acetogenic bacteria use the Wood-Ljungdahl carbon fixation pathway to produce cellular carbon from CO?. This process requires several metalloenzymes that employ transition metals such as iron, nickel, and cobalt towards ...

  8. Photosynthesis of Grass Species Differing in Carbon Dioxide Fixation Pathways 1

    PubMed Central

    Bouton, Joseph H.; Brown, R. Harold; Bolton, Jacqueline K.; Campagnoli, Raymond P.

    1981-01-01

    Panicum species of the Laxa group were investigated in a series of published reports and were found to possess C4, C3, and intermediate photosynthetic characteristics. Taxonomic and other relationships among these plants, however, are not clear. It was the objective of this investigation to document chromosome number, metaphase I chromosome behavior, and mode of reproduction, including abnormalities in the embryo sac, for these species. Chromosome counts showed a basic number (x) of 10 and ploidy levels of diploid (2n = 2x = 20), tetraploid (2n = 4x = 40), and hexaploid (2n = 6x = 60) in this group of Panicum. One diploid and one tetraploid accession of the C4 species, Panicum prionitis Griseb., were obtained. Of the intermediate species, Panicum milioides Nees ex Trin. was diploid, Panicum schenckii Hack. was hexaploid, and Panicum decipiens Nees, ex Trin. was found to possess two ploidy levels, one accession being diploid and the other accession being hexaploid. All the C3 species, which included two accessions of Panicum laxum Sw., three accessions of Panicum hylaeicum Mez., and one accession of Panicum rivulare Trin., were tetraploid. Meiosis was regular with primarily bivalent pairing at metaphase I in all species except the tetraploid accession of P. prionitis which possessed from 4 to 10 tetravalents. Stainable pollen was high in all species, ranging from 70 to 99%. Embryo sac analyses showed a single sac in all plants except the tetraploid accession of P. prionitis, which was found to possess an additional sac at anthesis. An additional sac was also observed in some ovaries of the P. schenckii accession. Self-pollinated seed set was high in all accessions except the diploid accession of P. prionitis and one accession of P. laxum where no seed was set under bagged conditions. This information establishes, within the limits of this collection, a base for future studies on genetic, taxonomic, photosynthetic, and evolutionary relationships among these plants. Possession of the same basic chromosome number, regular meiotic pairing, a high degree of stainable pollen, and good seed set in most of the plants studied indicate possible success in making hybrids for a genetic study of photosynthetic pathways in Panicum. Images PMID:16661689

  9. Evidence of carbon fixation pathway in a bacterium from candidate phylum SBR1093 revealed with genomic analysis.

    PubMed

    Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

    2014-01-01

    Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30?50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30?80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere. PMID:25310003

  10. De Novo Transcriptome Analysis of an Aerial Microalga Trentepohlia jolithus: Pathway Description and Gene Discovery for Carbon Fixation and Carotenoid Biosynthesis

    PubMed Central

    Li, Qianqian; Liu, Jianguo; Zhang, Litao; Liu, Qian

    2014-01-01

    Background Algae in the order Trentepohliales have a broad geographic distribution and are generally characterized by the presence of abundant ?-carotene. The many monographs published to date have mainly focused on their morphology, taxonomy, phylogeny, distribution and reproduction; molecular studies of this order are still rare. High-throughput RNA sequencing (RNA-Seq) technology provides a powerful and efficient method for transcript analysis and gene discovery in Trentepohlia jolithus. Methods/Principal Findings Illumina HiSeq 2000 sequencing generated 55,007,830 Illumina PE raw reads, which were assembled into 41,328 assembled unigenes. Based on NR annotation, 53.28% of the unigenes (22,018) could be assigned to gene ontology classes with 54 subcategories and 161,451 functional terms. A total of 26,217 (63.44%) assembled unigenes were mapped to 128 KEGG pathways. Furthermore, a set of 5,798 SSRs in 5,206 unigenes and 131,478 putative SNPs were identified. Moreover, the fact that all of the C4 photosynthesis genes exist in T. jolithus suggests a complex carbon acquisition and fixation system. Similarities and differences between T. jolithus and other algae in carotenoid biosynthesis are also described in depth. Conclusions/Significance This is the first broad transcriptome survey for T. jolithus, increasing the amount of molecular data available for the class Ulvophyceae. As well as providing resources for functional genomics studies, the functional genes and putative pathways identified here will contribute to a better understanding of carbon fixation and fatty acid and carotenoid biosynthesis in T. jolithus. PMID:25254555

  11. Carbon consequences of a nitrogen fixation feedback

    NASA Astrophysics Data System (ADS)

    Levy, J.; Medvigy, D.; Hedin, L.; Batterman, S. A.; Xu, X.

    2014-12-01

    Tropical forests constitute a globally important carbon sink but it is unclear how their productivity and carbon storage depend upon nutrients. There is increasing evidence of an ecosystem carbon-nitrogen feedback mechanism, by which symbiotic dinitrogen (N2) fixing trees can provide the nitrogen needed to maintain high rates of forest biomass growth following disturbance. Field-based evaluation of this feedback is difficult, however, as the expected effects on forest carbon stores would emerge very slowly, over decades to centuries of ecological succession. Moreover, there is no known way to inhibit the fixation process in trees without causing structural damage and perturbing the carbon cycle. Coupled land biogeochemistry-vegetation models offer a way to examine the role of feedbacks that unfold over successional time. However, it is unclear how the process of nitrogen fixation ought to be represented in models so that they can capture the potential effect of fixation on the long-term forest carbon sink. In this study, we integrate a newly developed individual-based model with field observations across Panamanian tropical forests to address: 1) whether N2 fixation enhances tropical forest carbon storage; 2) whether models must resolve fixation at the individual plant level to capture the fixation feedback; and 3) whether fixation interacts with plant functional types (i.e., early, mid, vs. late succession) to determine the carbon sink? We find that forests that have fixation recover faster and store more carbon in the long term than forests without fixation. This results in 94-118% more plant carbon stored by 30 years and an additional 13 tons C ha -1 stored over 300 years when compared to forests without fixation. Additionally, resolving fixation at the individual plant level is necessary to capture nitrogen dynamics over time and is particularly important for modeling succession and disturbance events. Finally, we find that the overall fixation effect is the result of two processes, the direct effect of the fixation on carbon accumulation and the indirect effect of fixation on the successional plant functional type sequence.

  12. CARBON FIXATION BY CULTURED CLAMSCARBON FIXATION BY CULTURED CLAMSCARBON FIXATION BY CULTURED CLAMSCARBON FIXATION BY CULTURED CLAMS Patrick BakerPatrick Baker

    E-print Network

    Florida, University of

    CARBON FIXATION BY CULTURED CLAMSCARBON FIXATION BY CULTURED CLAMSCARBON FIXATION BY CULTURED, Gainesville, FL, USA Clam Farming in FloridaClam Farming in Florida Calculating Carbon per Clam Bag E t l th E th g Calculating Carbon per Clam Bag Eat a clam, save the EarthEat a clam, save the Earth · Northern

  13. Dark Carbon Fixation: An Important Process in Lake Sediments

    PubMed Central

    Santoro, Ana Lúcia; Bastviken, David; Gudasz, Cristian; Tranvik, Lars; Enrich-Prast, Alex

    2013-01-01

    Close to redox boundaries, dark carbon fixation by chemoautotrophic bacteria may be a large contributor to overall carbon fixation. Still, little is known about the relative importance of this process in lake systems, in spite the potentially high chemoautotrophic potential of lake sediments. We compared rates of dark carbon fixation, bacterial production and oxygen consumption in sediments from four Swedish boreal and seven tropical Brazilian lakes. Rates were highly variable and dark carbon fixation amounted up to 80% of the total heterotrophic bacterial production. The results indicate that non-photosynthetic carbon fixation can represent a substantial contribution to bacterial biomass production, especially in sediments with low organic matter content. PMID:23776549

  14. A carbon sink pathway increases carbon productivity in cyanobacteria.

    PubMed

    Oliver, John W K; Atsumi, Shota

    2015-05-01

    The burning of fossil reserves, and subsequent release of carbon into the atmosphere is depleting the supply of carbon-based molecules used for synthetic materials including plastics, oils, medicines, and glues. To provide for future society, innovations are needed for the conversion of waste carbon (CO2) into organic carbon useful for materials. Chemical production directly from photosynthesis is a nascent technology, with great promise for capture of CO2 using sunlight. To improve low yields, it has been proposed that photosynthetic capacity can be increased by a relaxation of bottlenecks inherent to growth. The limits of carbon partitioning away from growth within the cell and the effect of partitioning on carbon fixation are not well known. Here we show that expressing genes in a pathway between carbon fixation and pyruvate increases partitioning to 2,3-butanediol (23BD) and leads to a 1.8-fold increase in total carbon yield in the cyanobacterium Synechococcus elongatus PCC 7942. Specific 2,3-butanediol production increases 2.4-fold. As partitioning increases beyond 30%, it leads to a steep decline in total carbon yield. The data suggests a local maximum for carbon partitioning from the Calvin Benson cycle that is scalable with light intensity. PMID:25777135

  15. Acetogenesis and the Wood-Ljungdahl Pathway of CO2 Fixation

    PubMed Central

    Ragsdale, Stephen W.; Pierce, Elizabeth

    2008-01-01

    I. Summary Conceptually, the simplest way to synthesize an organic molecule is to construct it one carbon at a time. The Wood-Ljungdahl pathway of CO2 fixation involves this type of stepwise process. The biochemical events that underlie the condensation of two one-carbon units to form the two-carbon compound, acetate, have intrigued chemists, biochemists, and microbiologists for many decades. We begin this review with a description of the biology of acetogenesis. Then, we provide a short history of the important discoveries that have led to the identification of the key components and steps of this usual mechanism of CO and CO2 fixation. In this historical perspective, we have included reflections that hopefully will sketch the landscape of the controversies, hypotheses, and opinions that led to the key experiments and discoveries. We then describe the properties of the genes and enzymes involved in the pathway and conclude with a section describing some major questions that remain unanswered. PMID:18801467

  16. ORIGINAL ARTICLE Carbon and nitrogen fixation and

    E-print Network

    Capone, Douglas G.

    cells of Anabaena oscillarioides Radu Popa1 , Peter K Weber2 , Jennifer Pett-Ridge2 , Juliette A Finzi3 incubations of Anabaena oscillarioides, we imaged the cellular distributions of C, N and P and 13 C and 15 N: cyanobacteria; heterocyst; nitrogen fixation; nitrogenase; Anabaena Introduction Some cyanobacteria are uniquely

  17. Phytoplankton plasticity drives large variability in carbon fixation efficiency

    NASA Astrophysics Data System (ADS)

    Ayata, Sakina-Dorothée.; Lévy, Marina; Aumont, Olivier; Resplandy, Laure; Tagliabue, Alessandro; Sciandra, Antoine; Bernard, Olivier

    2014-12-01

    Phytoplankton C:N stoichiometry is highly flexible due to physiological plasticity, which could lead to high variations in carbon fixation efficiency (carbon consumption relative to nitrogen). However, the magnitude, as well as the spatial and temporal scales of variability, remains poorly constrained. We used a high-resolution biogeochemical model resolving various scales from small to high, spatially and temporally, in order to quantify and better understand this variability. We find that phytoplankton C:N ratio is highly variable at all spatial and temporal scales (5-12 molC/molN), from mesoscale to regional scale, and is mainly driven by nitrogen supply. Carbon fixation efficiency varies accordingly at all scales (±30%), with higher values under oligotrophic conditions and lower values under eutrophic conditions. Hence, phytoplankton plasticity may act as a buffer by attenuating carbon sequestration variability. Our results have implications for in situ estimations of C:N ratios and for future predictions under high CO2 world.

  18. Abundance and Distribution of Diagnostic Carbon Fixation Genes in a Deep-Sea Hydrothermal Gradient Ecosystem

    NASA Astrophysics Data System (ADS)

    Blumenfeld, H. N.; Kelley, D. S.; Girguis, P. R.; Schrenk, M. O.

    2010-12-01

    The walls of deep-sea hydrothermal vent chimneys sustain steep thermal and chemical gradients resulting from the mixing of hot (350°C+) hydrothermal fluids with cold, oxygenated seawater. The chemical disequilibrium generated from this process has the potential to drive numerous chemolithoautotrophic metabolisms, many of which have been demonstrated to be operative in microbial pure cultures. In addition to the well-known Calvin Cycle, at least five additional pathways have been discovered including the Reverse Tricarboxylic Acid Cycle (rTCA), the Reductive Acetyl-CoA pathway, and the 3-hydroxyproprionate pathway. Most of the newly discovered pathways have been found in thermophilic and hyperthermophilic Bacteria and Archaea, which are the well represented in microbial diversity studies of hydrothermal chimney walls. However, to date, little is known about the environmental controls that impact various carbon fixation pathways. The overlap of limited microbial diversity with distinct habitat conditions in hydrothermal chimney walls provides an ideal setting to explore these relationships. Hydrothermal chimney walls from multiple structures recovered from the Juan de Fuca Ridge in the northeastern Pacific were sub-sampled and analyzed using PCR-based assays. Earlier work showed elevated microbial abundances in the outer portions of mature chimney walls, with varying ratios of Archaea to Bacteria from the outer to inner portions of the chimneys. Common phylotypes identified in these regions included Epsilonproteobacteria, Gammaproteobacteria, and Desulfurococcales. Total genomic DNA was extracted from mineralogically distinct niches within these structures and queried for genes coding key regulatory enzymes for each of the well studied carbon fixation pathways. Preliminary results show the occurrence of genes representing rTCA cycle (aclB) and methyl coenzyme A reductase (mcrA) - a proxy for the Reductive Acetyl-CoA Pathway within interior portion of mature hydrothermal chimneys. Ongoing analyses are aimed at quantifying the abundances of these diagnostic carbon fixation genes within the hydrothermal chimney gradients. These data are being compared to a broad array of contextual data to provide insight into the environmental and biological controls that may impact the distribution of the various carbon fixation pathways. Application of genomic approaches to the hydrothermal chimney ecosystem will provide insight into the microbial ecology of such structures and refine our ability to measure autotrophy in hydrothermal habitats sustained by chemical energy.

  19. Potential carbon dioxide fixation by industrially important microalgae.

    PubMed

    Sydney, Eduardo Bittencourt; Sturm, Wilerson; de Carvalho, Julio Cesar; Thomaz-Soccol, Vanete; Larroche, Christian; Pandey, Ashok; Soccol, Carlos Ricardo

    2010-08-01

    The present study aimed at investigating the carbon metabolism in terms of carbon dioxide fixation and its destination in microalgae cultivations. To this purpose, analysis of growth parameters, media of cultivation, biomass composition and productivity and nutrients balance were performed. Four microalgae suitable for mass cultivation were evaluated: Dunaliella tertiolecta SAD-13.86, Chlorella vulgaris LEB-104, Spirulina platensis LEB-52 and Botryococcus braunii SAG-30.81. Global rates of carbon dioxide and oxygen were determinated by a system developed in our laboratory. B. braunii presented the highest CO(2) fixation rate, followed by S. platensis,D. tertiolecta and C. vulgaris (496.98, 318.61, 272.4 and 251.64 mg L(-1)day(-1), respectively). Carbon dioxide fixated was mainly used for microalgal biomass production. Nitrogen, phosphorus (calcium for D. tertiolecta), potassium and magnesium consumption rates (mg gX(-1)) were evaluated for the four microalgae. Biomass composition presented a predominance of proteins but also a high amount of lipids, especially in D. tertiolecta and B. braunii. PMID:20350804

  20. Computational protein design enables a novel one-carbon assimilation pathway.

    PubMed

    Siegel, Justin B; Smith, Amanda Lee; Poust, Sean; Wargacki, Adam J; Bar-Even, Arren; Louw, Catherine; Shen, Betty W; Eiben, Christopher B; Tran, Huu M; Noor, Elad; Gallaher, Jasmine L; Bale, Jacob; Yoshikuni, Yasuo; Gelb, Michael H; Keasling, Jay D; Stoddard, Barry L; Lidstrom, Mary E; Baker, David

    2015-03-24

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway. PMID:25775555

  1. Recovering of carbon fixation in a eucalyptus site after felling

    NASA Astrophysics Data System (ADS)

    Rodrigues, A. M.; Pita, G. P. A.; Mateus, A.; Santos Pereira, J.

    2009-04-01

    Espirra site (38°38'N,8°36'W) is located in a 300ha Eucalyptus globulus plantation, with a Mediterranean type climate with a mean annual precipitation of 709mm and a mean annual air temperature of 15.9°C. The plantation was established in 1986 with about 1100 trees ha-1. A 33m observation tower was installed in 2002, with an ultrasonic Gill anemometer R2, an open path analyzer IRGA LI-7500 and a microclimate unit at its top. A harvesting of trees was made at the end of the 2nd rotation period, from November to December 2006. During the last four years of the second rotation the coppice were 20m height. Harvesting was planned in order to initiate a new 12 year productive cycle. In October 2008 a first thinning was made in three fourths of emerging stems from stumps. At this stage the forest trees had a mean height of 6m. For the 2002-2006 period, mean annual values of carbon net ecosystem exchange (NEE), gross production(GPP) and ecosystem respiration(Reco) were -533.3 gCm-2, 1628.6 gCm-2 and 1095.2 gCm-2. Seasonal patterns of carbon fixation for the five years showed a decrease in July-August periods due to highest air temperatures, atmospheric water vapour deficits and stomata partial closure to prevent water transpiration losses. For the period 2002-2006, the dry year of 2005 with a precipitation of about 390 mm, corresponded to the smaller carbon fixation of 390 gCm-2. Similarly, values of Reco, GPP and estimated leaf area index (less than three) were also minimal in 2005. Water use efficiency, WUE (ratio GPP/precipitation) was maximum in summer periods and in driest years, reaching values of about 12g/L-1. Recovery of carbon sink capacity, after the felling, begun after August 2007. The 2007 and 2008 annual NEE values were respectively 105.8 gCm-2 and -35.78 gCm-2. This negative value of NEE for 2008 is indicative of a carbon sink recovery. Annual Reco values for 2007 and 2008 were respectively 1059.03 gCm-2 and 1148.21 gCm-2. For GPP the annual values of 2007 and 2008 were respectively 953.24 gCm-2 and 1148.10 gCm-2. After the felling, stems rapidly grew and monthly GPP increased from 32 gCm-2 to 114 gCm-2 from January to October 2007. In November and December 2007, GPP decreased as a consequence of less solar radiation and frost in the young plants. In 2008 monthly GPP increased again till September. In the last three months of 2008, GPP diminished as a consequence of lack of water loss by evapotranspiration and the thinning. The results showed a chronological tendency for carbon fixation of the eucalyptus site according to physiological status of plants, concerning age and physical environmental factors.

  2. Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park.

    PubMed

    Jennings, Ryan M; Whitmore, Laura M; Moran, James J; Kreuzer, Helen W; Inskeep, William P

    2014-05-01

    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope ((13)CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ?2.5‰. Analysis of the (13)C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  3. Carbon Dioxide Fixation by Metallosphaera yellowstonensis and Acidothermophilic Iron-Oxidizing Microbial Communities from Yellowstone National Park

    PubMed Central

    Jennings, Ryan M.; Whitmore, Laura M.; Moran, James J.

    2014-01-01

    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope (13CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ?2.5‰. Analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  4. Stapes fixation accompanied with abnormal facial nerve pathway.

    PubMed

    Inagaki, Taro; Kawano, Atsushi; Ogawa, Yasuo; Shimizu, Masaaki; Negishi, Miho; Kawada, Yuri; Suzuki, Mamoru

    2014-06-01

    The patient was a 52-year-old woman. She had been aware of her bilateral hearing loss since she was 20 years old. The hearing in her left ear started to deteriorate at the age of 49. Pure-tone audiometry showed a bilateral mixed hearing loss. The hearing levels for the right ear and the left ear were 52 dB and 68 dB, respectively. There were no remarkable findings in a computed tomography (CT) scan of the temporal bone. We suspected that she had otosclerosis, and an operation was performed on her left ear. When the incudostapedial joint (I-S joint) was exposed to investigate the movement of the stapes, a soft white band that ran under the superstructure of the stapes was noted. By using a nerve monitoring system, we confirmed that the white band was the bare facial nerve. The ossicular chain was normal, except for a malformed stape due to the facial nerve, and the footplate of the stapes was fixed. Therefore, she was diagnosed as having otosclerosis with an abnormal facial nerve pathway. The malformed superstructure of the stapes was removed carefully. When the ectopic facial nerve was shifted to anteroinferior side, the oval window could be seen. Stapedotomy using a Teflon piston prosthesis was performed with no complications. PMID:24581447

  5. Dark inorganic carbon fixation sustains the functioning of benthic deep-sea ecosystems

    NASA Astrophysics Data System (ADS)

    Molari, Massimiliano; Manini, Elena; Dell'Anno, Antonio

    2013-01-01

    studies have provided evidence that dark inorganic carbon fixation is an important process for the functioning of the ocean interior. However, its quantitative relevance and ecological significance in benthic deep-sea ecosystems remain unknown. We investigated the rates of inorganic carbon fixation together with prokaryotic abundance, biomass, assemblage composition, and heterotrophic carbon production in surface sediments of different benthic deep-sea systems along the Iberian margin (northeastern Atlantic Ocean) and in the Mediterranean Sea. Inorganic carbon fixation rates in these surface deep-sea sediments did not show clear depth-related patterns, and, on average, they accounted for 19% of the total heterotrophic biomass production. The incorporation rates of inorganic carbon were significantly related to the abundance of total Archaea (as determined by catalyzed reporter deposition fluorescence in situ hybridization) and completely inhibited using an inhibitor of archaeal metabolism, N1-guanyl-1,7-diaminoheptane. This suggests a major role of the archaeal assemblages in inorganic carbon fixation. We also show that benthic archaeal assemblages contribute approximately 25% of the total 3H-leucine incorporation. Inorganic carbon fixation in surface deep-sea sediments appears to be dependent not only upon chemosynthetic processes but also on heterotrophic/mixotrophic metabolism, as suggested by estimates of the chemolithotrophic energy requirements and the enhanced inorganic carbon fixation due to the increase in the availability of organic trophic resources. Overall, our data suggest that archaeal assemblages of surface deep-sea sediments are responsible for the high rates of inorganic carbon incorporation and thereby sustain the functioning of the food webs as well as influence the carbon cycling of benthic deep-sea ecosystems.

  6. Community Structure and Soil pH Determine Chemoautotrophic Carbon Dioxide Fixation in Drained Paddy Soils.

    PubMed

    Long, Xi-En; Yao, Huaiying; Wang, Juan; Huang, Ying; Singh, Brajesh K; Zhu, Yong-Guan

    2015-06-16

    Previous studies suggested that microbial photosynthesis plays a potential role in paddy fields, but little is known about chemoautotrophic carbon fixers in drained paddy soils. We conducted a microcosm study using soil samples from five paddy fields to determine the environmental factors and quantify key functional microbial taxa involved in chemoautotrophic carbon fixation. We used stable isotope probing in combination with phospholipid fatty acid (PLFA) and molecular approaches. The amount of microbial (13)CO2 fixation was determined by quantification of (13)C-enriched fatty acid methyl esters and ranged from 21.28 to 72.48 ng of (13)C (g of dry soil)(-1), and the corresponding ratio (labeled PLFA-C:total PLFA-C) ranged from 0.06 to 0.49%. The amount of incorporationof (13)CO2 into PLFAs significantly increased with soil pH except at pH 7.8. PLFA and high-throughput sequencing results indicated a dominant role of Gram-negative bacteria or proteobacteria in (13)CO2 fixation. Correlation analysis indicated a significant association between microbial community structure and carbon fixation. We provide direct evidence of chemoautotrophic C fixation in soils with statistical evidence of microbial community structure regulation of inorganic carbon fixation in the paddy soil ecosystem. PMID:25989872

  7. [Regulation of alternative CO[sub 2] fixation pathways in procaryotic and eucaryotic photosynthetic organisms

    SciTech Connect

    Not Available

    1992-01-01

    The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.

  8. Carbon fixation into lipid in small freshwater lakes

    Microsoft Academic Search

    BRUCE C. WAINMAN; DAVID R. S. LEAN

    1992-01-01

    Algal lipid is a critical food resource for zooplankton, a solvent for lipophilic contaminants, and a useful indicator of phytoplankton nutrient status in culture. Seasonal patterns in lipid production and the photosynthetic parameters describing lipid production were determined for three meso- trophic to oligotrophic, headwater lakes. The mean lipid fraction of C fixation (LFCF) was 15.8% (range 8.5-22.5%) measured bimonthly

  9. Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

    PubMed Central

    Feist, Adam M.; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P.; Lovley, Derek R.; Zengler, Karsten

    2014-01-01

    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. PMID:24762737

  10. Fixation of carbon dioxide by producing hydromagnesite from serpentinite

    Microsoft Academic Search

    Sebastian Teir; Sanni Eloneva; Carl-Johan Fogelholm; Ron Zevenhoven

    2009-01-01

    Fixing carbon dioxide (CO2) as carbonates using silicate-based materials is an interesting alternative option for storage of carbon dioxide. Suitable magnesium-rich rocks are distributed throughout the world. The magnesium silicate deposits in Eastern Finland alone could be sufficient for storing 10Mt CO2 each year during a period of 200–300 years. Rocks potentially suitable for carbonation are already mined, processed, piled,

  11. Autotrophic Carbon Dioxide Fixation via the Calvin-Benson-Bassham Cycle by the Denitrifying Methanotroph “Candidatus Methylomirabilis oxyfera”

    PubMed Central

    Kool, Dorien M.; Jetten, Mike S. M.; Sinninghe Damsté, Jaap S.; Ettwig, Katharina F.

    2014-01-01

    Methane is an important greenhouse gas and the most abundant hydrocarbon in the Earth's atmosphere. Methanotrophic microorganisms can use methane as their sole energy source and play a crucial role in the mitigation of methane emissions in the environment. “Candidatus Methylomirabilis oxyfera” is a recently described intra-aerobic methanotroph that is assumed to use nitric oxide to generate internal oxygen to oxidize methane via the conventional aerobic pathway, including the monooxygenase reaction. Previous genome analysis has suggested that, like the verrucomicrobial methanotrophs, “Ca. Methylomirabilis oxyfera” encodes and transcribes genes for the Calvin-Benson-Bassham (CBB) cycle for carbon assimilation. Here we provide multiple independent lines of evidence for autotrophic carbon dioxide fixation by “Ca. Methylomirabilis oxyfera” via the CBB cycle. The activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO), a key enzyme of the CBB cycle, in cell extracts from an “Ca. Methylomirabilis oxyfera” enrichment culture was shown to account for up to 10% of the total methane oxidation activity. Labeling studies with whole cells in batch incubations supplied with either 13CH4 or [13C]bicarbonate revealed that “Ca. Methylomirabilis oxyfera” biomass and lipids became significantly more enriched in 13C after incubation with 13C-labeled bicarbonate (and unlabeled methane) than after incubation with 13C-labeled methane (and unlabeled bicarbonate), providing evidence for autotrophic carbon dioxide fixation. Besides this experimental approach, detailed genomic and transcriptomic analysis demonstrated an operational CBB cycle in “Ca. Methylomirabilis oxyfera.” Altogether, these results show that the CBB cycle is active and plays a major role in carbon assimilation by “Ca. Methylomirabilis oxyfera” bacteria. Our results suggest that autotrophy might be more widespread among methanotrophs than was previously assumed and implies that a methanotrophic community in the environment is not necessarily revealed by 13C-depleted lipids. PMID:24509918

  12. Autotrophic carbon dioxide fixation via the Calvin-Benson-Bassham cycle by the denitrifying methanotroph "Candidatus Methylomirabilis oxyfera".

    PubMed

    Rasigraf, Olivia; Kool, Dorien M; Jetten, Mike S M; Sinninghe Damsté, Jaap S; Ettwig, Katharina F

    2014-04-01

    Methane is an important greenhouse gas and the most abundant hydrocarbon in the Earth's atmosphere. Methanotrophic microorganisms can use methane as their sole energy source and play a crucial role in the mitigation of methane emissions in the environment. "Candidatus Methylomirabilis oxyfera" is a recently described intra-aerobic methanotroph that is assumed to use nitric oxide to generate internal oxygen to oxidize methane via the conventional aerobic pathway, including the monooxygenase reaction. Previous genome analysis has suggested that, like the verrucomicrobial methanotrophs, "Ca. Methylomirabilis oxyfera" encodes and transcribes genes for the Calvin-Benson-Bassham (CBB) cycle for carbon assimilation. Here we provide multiple independent lines of evidence for autotrophic carbon dioxide fixation by "Ca. Methylomirabilis oxyfera" via the CBB cycle. The activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO), a key enzyme of the CBB cycle, in cell extracts from an "Ca. Methylomirabilis oxyfera" enrichment culture was shown to account for up to 10% of the total methane oxidation activity. Labeling studies with whole cells in batch incubations supplied with either (13)CH4 or [(13)C]bicarbonate revealed that "Ca. Methylomirabilis oxyfera" biomass and lipids became significantly more enriched in (13)C after incubation with (13)C-labeled bicarbonate (and unlabeled methane) than after incubation with (13)C-labeled methane (and unlabeled bicarbonate), providing evidence for autotrophic carbon dioxide fixation. Besides this experimental approach, detailed genomic and transcriptomic analysis demonstrated an operational CBB cycle in "Ca. Methylomirabilis oxyfera." Altogether, these results show that the CBB cycle is active and plays a major role in carbon assimilation by "Ca. Methylomirabilis oxyfera" bacteria. Our results suggest that autotrophy might be more widespread among methanotrophs than was previously assumed and implies that a methanotrophic community in the environment is not necessarily revealed by (13)C-depleted lipids. PMID:24509918

  13. The effect of nutrients on carbon and nitrogen fixation by the UCYN-A-haptophyte symbiosis.

    PubMed

    Krupke, Andreas; Mohr, Wiebke; LaRoche, Julie; Fuchs, Bernhard M; Amann, Rudolf I; Kuypers, Marcel Mm

    2015-07-01

    Symbiotic relationships between phytoplankton and N2-fixing microorganisms play a crucial role in marine ecosystems. The abundant and widespread unicellular cyanobacteria group A (UCYN-A) has recently been found to live symbiotically with a haptophyte. Here, we investigated the effect of nitrogen (N), phosphorus (P), iron (Fe) and Saharan dust additions on nitrogen (N2) fixation and primary production by the UCYN-A-haptophyte association in the subtropical eastern North Atlantic Ocean using nifH expression analysis and stable isotope incubations combined with single-cell measurements. N2 fixation by UCYN-A was stimulated by the addition of Fe and Saharan dust, although this was not reflected in the nifH expression. CO2 fixation by the haptophyte was stimulated by the addition of ammonium nitrate as well as Fe and Saharan dust. Intriguingly, the single-cell analysis using nanometer scale secondary ion mass spectrometry indicates that the increased CO2 fixation by the haptophyte in treatments without added fixed N is likely an indirect result of the positive effect of Fe and/or P on UCYN-A N2 fixation and the transfer of N2-derived N to the haptophyte. Our results reveal a direct linkage between the marine carbon and nitrogen cycles that is fuelled by the atmospheric deposition of dust. The comparison of single-cell rates suggests a tight coupling of nitrogen and carbon transfer that stays balanced even under changing nutrient regimes. However, it appears that the transfer of carbon from the haptophyte to UCYN-A requires a transfer of nitrogen from UCYN-A. This tight coupling indicates an obligate symbiosis of this globally important diazotrophic association. PMID:25535939

  14. Effects of elevated carbon dioxide concentration on growth and N2 fixation of young Robinia pseudoacacia.

    PubMed

    Feng, Z; Dyckmans, J; Flessa, H

    2004-03-01

    Effects of elevated CO2 concentration ([CO2]) on carbon (C) and nitrogen (N) uptake and N source partitioning (N2 fixation versus mineral soil N uptake) of 1-year-old Robinia pseudoacacia were determined in a dual 13C and 15N continuous labeling experiment. Seedlings were grown for 16 weeks in ambient (350 ppm) or elevated [CO2] (700 ppm) with 15NH4 15NO3 as the only mineral nitrogen source. Elevated [CO2] increased the fraction of new C in total C, but it did not alter C partitioning among plant compartments. Elevated [CO2] also increased the fraction of new N in total N and this was coupled with a shift in N source partitioning toward N2 fixation. Soil N uptake was unaffected by elevated [CO2], whereas N2 fixation was markedly increased by the elevated [CO2] treatment, mainly because of increased specific fixation (mg N mg(-1) nodule). As a result of increased N2 fixation, the C/N ratio of tree biomass tended to decrease in the elevated [CO2] treatment. Partitioning of N uptake among plant compartments was unaffected by elevated [CO2]. Total dry mass of root nodules doubled in response to elevated [CO2], but this effect was not significant because of the great variability of root nodule formation. Our results show that, in the N2-fixing R. pseudoacacia, increased C uptake in response to increased [CO2] is matched by increased N2 fixation, indicating that enhanced growth in elevated [CO2] might not be restricted by N limitations. PMID:14704141

  15. Water Conservation in Kalanchoe blossfeldiana in Relation to Carbon Dioxide Dark Fixation.

    PubMed

    Zabka, G G; Chaturvedi, S N

    1975-03-01

    The succulent Kalanchoe blossfeldiana v. Poel. var Tom Thumb was treated on long and short photoperiods for 6 weeks during which short day plants developed thicker leaves, flowered prolifically, and exhibited extensive net dark fixation of carbon dioxide. In contrast, long day plants remained vegetative and did not develop thicker leaves or exhibit net carbon dioxide dark fixation. When examined after the photoperiodic state described, long day plants showed approximately three times more water loss over a 10-day period than short day plants. Water loss is similar during light and dark periods for short day plants but long day plants exhibited two times more water loss during the day than at night. The latter plants also lost three and one-half times more water during the light period than short day plants. The water conservation by short day plants is correlated with conditions of high carbon dioxide dark fixation and effects of its related Crassulacean acid metabolism on stomatal behavior. PMID:16659116

  16. Water Conservation in Kalanchoe blossfeldiana in Relation to Carbon Dioxide Dark Fixation

    PubMed Central

    Zabka, George G.; Chaturvedi, S. N.

    1975-01-01

    The succulent Kalanchoe blossfeldiana v. Poel. var Tom Thumb was treated on long and short photoperiods for 6 weeks during which short day plants developed thicker leaves, flowered prolifically, and exhibited extensive net dark fixation of carbon dioxide. In contrast, long day plants remained vegetative and did not develop thicker leaves or exhibit net carbon dioxide dark fixation. When examined after the photoperiodic state described, long day plants showed approximately three times more water loss over a 10-day period than short day plants. Water loss is similar during light and dark periods for short day plants but long day plants exhibited two times more water loss during the day than at night. The latter plants also lost three and one-half times more water during the light period than short day plants. The water conservation by short day plants is correlated with conditions of high carbon dioxide dark fixation and effects of its related Crassulacean acid metabolism on stomatal behavior. PMID:16659116

  17. Chemoautotrophic carbon fixation rates and active bacterial communities in intertidal marine sediments.

    PubMed

    Boschker, Henricus T S; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W C; Moodley, Leon

    2014-01-01

    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, The Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m(-2) d(-1). Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)(-1), which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  18. Chemoautotrophic Carbon Fixation Rates and Active Bacterial Communities in Intertidal Marine Sediments

    PubMed Central

    Boschker, Henricus T. S.; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W. C.; Moodley, Leon

    2014-01-01

    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, the Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m?2 d?1. Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)?1, which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  19. [Regulation of alternative CO{sub 2} fixation pathways in procaryotic and eucaryotic photosynthetic organisms]. Progress report

    SciTech Connect

    Not Available

    1992-12-31

    The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.

  20. Carboxysomal carbonic anhydrases: Structure and role in microbial CO2 fixation

    SciTech Connect

    Cannon, Gordon C.; Heinhorst, Sabine; Kerfeld, Cheryl A.

    2010-06-23

    Cyanobacteria and some chemoautotrophic bacteria are able to grow in environments with limiting CO2 concentrations by employing a CO2-concentrating mechanism (CCM) that allows them to accumulate inorganic carbon in their cytoplasm to concentrations several orders of magnitude higher than that on the outside. The final step of this process takes place in polyhedral protein microcompartments known as carboxysomes, which contain the majority of the CO2-fixing enzyme, RubisCO. The efficiency of CO2 fixation by the sequestered RubisCO is enhanced by co-localization with a specialized carbonic anhydrase that catalyzes dehydration of the cytoplasmic bicarbonate and ensures saturation of RubisCO with its substrate, CO2. There are two genetically distinct carboxysome types that differ in their protein composition and in the carbonic anhydrase(s) they employ. Here we review the existing information concerning the genomics, structure and enzymology of these uniquely adapted carbonic anhydrases, which are of fundamental importance in the global carbon cycle.

  1. Genomic signatures of fifth autotrophic carbon assimilation pathway in bathypelagic Crenarchaeota.

    PubMed

    La Cono, Violetta; Smedile, Francesco; Ferrer, Manuel; Golyshin, Peter N; Giuliano, Laura; Yakimov, Michail M

    2010-09-01

    Marine Crenarchaeota, ubiquitous and abundant organisms in the oceans worldwide, remain metabolically uncharacterized, largely due to their low cultivability. Identification of candidate genes for bicarbonate fixation pathway in the Cenarchaeum symbiosum A was an initial step in understanding the physiology and ecology of marine Crenarchaeota. Recent cultivation and genome sequencing of obligate chemoautotrophic Nitrosopumilus maritimus SCM1 were a major breakthrough towards understanding of their functioning and provide a valuable model for experimental validation of genomic data. Here we present the identification of multiple key components of 3-hydroxipropionate/4-hydroxybutyrate cycle, the fifth pathway in carbon fixation, found in data sets of environmental sequences representing uncultivated superficial and bathypelagic Crenarchaeota from Sargasso sea (GOS data set) and KM3 (Mediterranean Sea) and ALOHA (Atlantic ocean) stations. These organisms are likely to use acetyl-CoA/propionyl-CoA carboxylase(s) as CO?-fixing enzyme(s) to form succinyl-CoA, from which one molecule of acetyl-CoA is regenerated via 4-hydroxybutyrate cleavage and another acetyl-CoA to be the pathway product. The genetic distinctiveness and matching sympatric abundance imply that marine crenarchaeal genotypes from the three different geographic sites share similar ecophysiological properties, and therefore may represent fundamental units of marine ecosystem functioning. To couple results of sequence comparison with the dark ocean primary production, dissolved inorganic carbon fixation rates were measured at KM3 Station (3000 m depth, Eastern Mediterranean Sea), i.e. at the same site and depth used for metagenomic library construction. PMID:21255356

  2. Lipid Biomarkers and Molecular Carbon Isotopes for Elucidating Carbon Cycling Pathways in Hydrothermal Vents

    NASA Astrophysics Data System (ADS)

    Zhang, C. L.; Dai, J.; Campbell, B.; Cary, C.; Sun, M.

    2003-12-01

    Increasing molecular evidence suggests that hydrothermal vents in mid-ocean ridges harbor large populations of free-living bacteria, particularly the epsilon Proteobacteria. However, pathways for carbon metabolism by these bacteria are poorly known. We are addressing this question by analyzing the lipid biomarkers and their isotope signatures in environments where the epsilon Proteobacteria are likely predominant. Solid materials were collected from hydrothermal vents in the East Pacific Rise and at the Guaymas Basin in the Gulf of California. Fatty acids extracted from these samples are dominated by 16:0 (27-41%), 18:0 (16-48%), 18:1 (11-42%), 16:1 (7-12%), and 14:0 (5-28%). In addition, 15:0 and anteiso-15:0 are significantly present (2-3%) in samples from the Guaymas Basin. The isotopic compositions of these fatty acids range from -15.0\\permil to -33.1\\permil with the most positive values occurring only in monounsaturated fatty acids (16:1 and 18:1). We are currently unable to assign these biomarkers to any of the epsilon Proteobacteria because biomarkers are poorly known for these organisms isolated from the vents. However, no polyunsaturated fatty acids were detected in these samples, which are consistent with the absence of vent animals at the sampling sites. Signature biomarkers of 20:1 and cy21:0, which are characteristic of the thermophilic chemolithoautotrophs such as Aquificales, are also absent in these samples. These results imply that the deeply branched Aquificales species do not constitute the major microbial community in these vent environments. The large range of molecular isotopic compositions suggests that these lipids are synthesized from various carbon sources with different isotopic compositions or through different biosynthetic pathways, or both. We are currently measuring the isotopic compositions of the total organic carbon in the bulk samples and will determine the fractionations between lipid biomarkers and the total organic carbon. Molecular DNA data from these vent environments indicate that the reversed TCA cycle may be used for CO2 fixation by the epsilon Proteobacteria for chemolithoautotrophic growth. Isotopic fractionation patterns between lipid biomarkers and the bulk organic carbon can provide independent information on this unique biosynthetic pathway.

  3. Predicting the Electron Requirement for Carbon Fixation in Seas and Oceans

    PubMed Central

    Lawrenz, Evelyn; Silsbe, Greg; Capuzzo, Elisa; Ylöstalo, Pasi; Forster, Rodney M.; Simis, Stefan G. H.; Prášil, Ond?ej; Kromkamp, Jacco C.; Hickman, Anna E.; Moore, C. Mark; Forget, Marie-Hélèn; Geider, Richard J.; Suggett, David J.

    2013-01-01

    Marine phytoplankton account for about 50% of all global net primary productivity (NPP). Active fluorometry, mainly Fast Repetition Rate fluorometry (FRRf), has been advocated as means of providing high resolution estimates of NPP. However, not measuring CO2-fixation directly, FRRf instead provides photosynthetic quantum efficiency estimates from which electron transfer rates (ETR) and ultimately CO2-fixation rates can be derived. Consequently, conversions of ETRs to CO2-fixation requires knowledge of the electron requirement for carbon fixation (?e,C, ETR/CO2 uptake rate) and its dependence on environmental gradients. Such knowledge is critical for large scale implementation of active fluorescence to better characterise CO2-uptake. Here we examine the variability of experimentally determined ?e,C values in relation to key environmental variables with the aim of developing new working algorithms for the calculation of ?e,C from environmental variables. Coincident FRRf and 14C-uptake and environmental data from 14 studies covering 12 marine regions were analysed via a meta-analytical, non-parametric, multivariate approach. Combining all studies, ?e,C varied between 1.15 and 54.2 mol e? (mol C)?1 with a mean of 10.9±6.91 mol e? mol C)?1. Although variability of ?e,C was related to environmental gradients at global scales, region-specific analyses provided far improved predictive capability. However, use of regional ?e,C algorithms requires objective means of defining regions of interest, which remains challenging. Considering individual studies and specific small-scale regions, temperature, nutrient and light availability were correlated with ?e,C albeit to varying degrees and depending on the study/region and the composition of the extant phytoplankton community. At the level of large biogeographic regions and distinct water masses, ?e,C was related to nutrient availability, chlorophyll, as well as temperature and/or salinity in most regions, while light availability was also important in Baltic Sea and shelf waters. The novel ?e,C algorithms provide a major step forward for widespread fluorometry-based NPP estimates and highlight the need for further studying the natural variability of ?e,C to verify and develop algorithms with improved accuracy. PMID:23516441

  4. Assaying the catalytic potential of transition metal sulfides for abiotic carbon fixation

    NASA Astrophysics Data System (ADS)

    Cody, G. D.; Boctor, N. Z.; Brandes, J. A.; Filley, T. R.; Hazen, R. M.; Yoder, H. S.

    2004-05-01

    A suite of nickel, cobalt, iron, copper, and zinc containing sulfides are assayed for the promotion of a model carbon fixation reaction with relevance to local reducing environments of the early Earth. The assay tests the promotion of hydrocarboxylation (the Koch reaction) wherein a carboxylic acid is synthesized via carbonyl insertion at a metal-sulfide-bound alkyl group. The experimental conditions are chosen for optimal assay, i.e., high reactant concentrations and pressures (200 MPa) to enhance chemisorption, and high temperature (250°C) to enhance reaction kinetics. All of the metal sulfides studied, with the exception CuS, promote hydrocarboxylation. Two other significant reactions involve the catalytic reduction of CO to form a surface-bound methyl group, detected after nucleophilic attack by nonane thiol to form methyl nonyl sulfide, and the formation of dinonyl sulfide via a similar reaction. Estimation of the catalytic turnover frequencies for each of the metal sulfides with respect to each of the primary reactions reveals that NiS, Ni 3S 2, and CoS perform comparably to commonly employed industrial catalysts. A positive correlation between the yield of primary product to NiS and Ni 3S 2 surface areas provides strong evidence that the reactions are surface catalytic in these cases. The sulfides FeS and Fe (1-x)S are unique in that they exhibit evidence of extensive dissolution, thus, complicating interpretation regarding heterogeneous vs. homogeneous catalysis. With the exception of CuS, each of the metal sulfides promotes reactions that mimic key intermediate steps manifest in the mechanistic details of an important autotrophic enzyme, acetyl-CoA synthase. The relatively high temperatures chosen for assaying purposes, however, are incompatible with the accumulation of thioesters. The results of this study support the hypothesis that transition metal sulfides may have provided useful catalytic functionality for geochemical carbon fixation in a prebiotic world (at least intially) devoid of peptide-based enzymes.

  5. Induction of Photosynthetic Carbon Fixation in Anoxia Relies on Hydrogenase Activity and Proton-Gradient Regulation-Like1-Mediated Cyclic Electron Flow in Chlamydomonas reinhardtii.

    PubMed

    Godaux, Damien; Bailleul, Benjamin; Berne, Nicolas; Cardol, Pierre

    2015-06-01

    The model green microalga Chlamydomonas reinhardtii is frequently subject to periods of dark and anoxia in its natural environment. Here, by resorting to mutants defective in the maturation of the chloroplastic oxygen-sensitive hydrogenases or in Proton-Gradient Regulation-Like1 (PGRL1)-dependent cyclic electron flow around photosystem I (PSI-CEF), we demonstrate the sequential contribution of these alternative electron flows (AEFs) in the reactivation of photosynthetic carbon fixation during a shift from dark anoxia to light. At light onset, hydrogenase activity sustains a linear electron flow from photosystem II, which is followed by a transient PSI-CEF in the wild type. By promoting ATP synthesis without net generation of photosynthetic reductants, the two AEF are critical for restoration of the capacity for carbon dioxide fixation in the light. Our data also suggest that the decrease in hydrogen evolution with time of illumination might be due to competition for reduced ferredoxins between ferredoxin-NADP(+) oxidoreductase and hydrogenases, rather than due to the sensitivity of hydrogenase activity to oxygen. Finally, the absence of the two alternative pathways in a double mutant pgrl1 hydrogenase maturation factor G-2 is detrimental for photosynthesis and growth and cannot be compensated by any other AEF or anoxic metabolic responses. This highlights the role of hydrogenase activity and PSI-CEF in the ecological success of microalgae in low-oxygen environments. PMID:25931521

  6. Carbon and nitrogen fixation differ between successional stages of biological soil crusts in the Colorado Plateau and Chihuahuan Desert

    USGS Publications Warehouse

    Housman, D.C.; Powers, H.H.; Collins, A.D.; Belnap, J.

    2006-01-01

    Biological soil crusts (cyanobacteria, mosses and lichens collectively) perform essential ecosystem services, including carbon (C) and nitrogen (N) fixation. Climate and land-use change are converting later successional soil crusts to early successional soil crusts with lower C and N fixation rates. To quantify the effect of such conversions on C and N dynamics in desert ecosystems we seasonally measured diurnal fixation rates in different biological soil crusts. We classified plots on the Colorado Plateau (Canyonlands) and Chihuahuan Desert (Jornada) as early (Microcoleus) or later successional (Nostoc/Scytonema or Placidium/Collema) and measured photosynthesis (Pn), nitrogenase activity (NA), and chlorophyll fluorescence (Fv/Fm) on metabolically active (moist) soil crusts. Later successional crusts typically had greater Pn, averaging 1.2-1.3-fold higher daily C fixation in Canyonlands and 2.4-2.8-fold higher in the Jornada. Later successional crusts also had greater NA, averaging 1.3-7.5-fold higher daily N fixation in Canyonlands and 1.3-25.0-fold higher in the Jornada. Mean daily Fv/Fm was also greater in later successional Canyonlands crusts during winter, and Jornada crusts during all seasons except summer. Together these findings indicate conversion of soil crusts back to early successional stages results in large reductions of C and N inputs into these ecosystems.

  7. Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5?-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

    PubMed Central

    Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

    2013-01-01

    Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5?- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae. PMID:23585853

  8. Establishment of microbial eukaryotic enrichment cultures from a chemically stratified antarctic lake and assessment of carbon fixation potential.

    PubMed

    Dolhi, Jenna M; Ketchum, Nicholas; Morgan-Kiss, Rachael M

    2012-01-01

    Lake Bonney is one of numerous permanently ice-covered lakes located in the McMurdo Dry Valleys, Antarctica. The perennial ice cover maintains a chemically stratified water column and unlike other inland bodies of water, largely prevents external input of carbon and nutrients from streams. Biota are exposed to numerous environmental stresses, including year-round severe nutrient deficiency, low temperatures, extreme shade, hypersalinity, and 24-hour darkness during the winter (1). These extreme environmental conditions limit the biota in Lake Bonney almost exclusively to microorganisms (2). Single-celled microbial eukaryotes (called "protists") are important players in global biogeochemical cycling (3) and play important ecological roles in the cycling of carbon in the dry valley lakes, occupying both primary and tertiary roles in the aquatic food web. In the dry valley aquatic food web, protists that fix inorganic carbon (autotrophy) are the major producers of organic carbon for organotrophic organisms (4, 2). Phagotrophic or heterotrophic protists capable of ingesting bacteria and smaller protists act as the top predators in the food web (5). Last, an unknown proportion of the protist population is capable of combined mixotrophic metabolism (6, 7). Mixotrophy in protists involves the ability to combine photosynthetic capability with phagotrophic ingestion of prey microorganisms. This form of mixotrophy differs from mixotrophic metabolism in bacterial species, which generally involves uptake dissolved carbon molecules. There are currently very few protist isolates from permanently ice-capped polar lakes, and studies of protist diversity and ecology in this extreme environment have been limited (8, 4, 9, 10, 5). A better understanding of protist metabolic versatility in the simple dry valley lake food web will aid in the development of models for the role of protists in the global carbon cycle. We employed an enrichment culture approach to isolate potentially phototrophic and mixotrophic protists from Lake Bonney. Sampling depths in the water column were chosen based on the location of primary production maxima and protist phylogenetic diversity (4, 11), as well as variability in major abiotic factors affecting protist trophic modes: shallow sampling depths are limited for major nutrients, while deeper sampling depths are limited by light availability. In addition, lake water samples were supplemented with multiple types of growth media to promote the growth of a variety of phototrophic organisms. RubisCO catalyzes the rate limiting step in the Calvin Benson Bassham (CBB) cycle, the major pathway by which autotrophic organisms fix inorganic carbon and provide organic carbon for higher trophic levels in aquatic and terrestrial food webs (12). In this study, we applied a radioisotope assay modified for filtered samples (13) to monitor maximum carboxylase activity as a proxy for carbon fixation potential and metabolic versatility in the Lake Bonney enrichment cultures. PMID:22546995

  9. Microbial microstratification, inorganic carbon photoassimilation and dark carbon fixation at the chemocline of the meromictic Lake Cadagno (Switzerland) and its relevance to the food web

    Microsoft Academic Search

    Antonio Camacho; Jonathan Erez; Alvaro Chicote; Máximo Florín; Margaret M. Squires; Christine Lehmann; Reinhard Backofen

    2001-01-01

    The microstratification of the microbial community at the chemocline of Lake Cadagno and the associated inorganic carbon fixation activity was studied by fine layer sampling. A deep chlorophyll maximum caused by diatoms overlying Cryptomonas was found at the upper edge of the chemocline. A high population density of phototrophic sulphur bacteria, mainly Amoebobacter cf. purpureus, occurred closely below the oxic-anoxic

  10. Fixation of Bromine and of Uranium Hexafluoride on Carbon; FIXATION DU BROME ET DE L'HEXAFLUORURE D'URANIUM SUR LES CARBONES

    Microsoft Academic Search

    Maire

    1959-01-01

    The fixation of bromine on pitch coke, paraffin coke, petroleum, coke, ; and various blacks was studied. The sorption curves were determined as a ; function of the bromine partial pressure. The results obtained with petroleum ; coke and pitch coke are analogous to those obtained with graphite. The paraffin ; cokes and blacks give isotherms sharply different from those

  11. Fixation stability dictates the differentiation pathway of periosteal progenitor cells in fracture repair.

    PubMed

    Hagiwara, Yusuke; Dyment, Nathaniel A; Jiang, Xi; Jiang Ping, Huang; Ackert-Bicknell, Cheryl; Adams, Douglas J; Rowe, David W

    2015-07-01

    This study compared fracture repair stabilized by intramedullary pin (IMP) or external fixation (EF) in GFP reporter mice. A modified IMP was used as control while EF utilized six needles inserted transversely through the tibia and into a segment of a syringe barrel. X-rays taken at days 0, 14, and 35 showed that IMP resulted in significant three-dimensional deformity with a large callus while EF showed minimal deformity and callus formation. Cryohistological analysis of IMP at day 14 confirmed a large ColX-RFPchry+ callus surrounded by woven bone (Col3.6-GFPcyan) and TRAP+ osteoclasts with mature bone (hOC-GFPtpz) at the base. By day 35, cartilaginous components had been resorbed and an outer cortical shell (OCS) showed evidence of inward modeling. In contrast, the EF at day 14 showed no evidence of cartilage formation. Instead, periosteal-derived osteoblasts (Col3.6-GFPcyan) entered the fracture cleft and formed woven bone that spanned the marrow space. By day 35, mature bone had formed that was contiguous with the opposing cortical bone. Fracture site stability greatly affects the cellular response during repair and must be considered in the preclinical models that test therapies for improving fracture healing. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 33:948-956, 2015. PMID:25639792

  12. Biology of a widespread uncultivated archaeon that contributes to carbon fixation in the subsurface.

    PubMed

    Probst, Alexander J; Weinmaier, Thomas; Raymann, Kasie; Perras, Alexandra; Emerson, Joanne B; Rattei, Thomas; Wanner, Gerhard; Klingl, Andreas; Berg, Ivan A; Yoshinaga, Marcos; Viehweger, Bernhard; Hinrichs, Kai-Uwe; Thomas, Brian C; Meck, Sandra; Auerbach, Anna K; Heise, Matthias; Schintlmeister, Arno; Schmid, Markus; Wagner, Michael; Gribaldo, Simonetta; Banfield, Jillian F; Moissl-Eichinger, Christine

    2014-01-01

    Subsurface microbial life contributes significantly to biogeochemical cycling, yet it remains largely uncharacterized, especially its archaeal members. This 'microbial dark matter' has been explored by recent studies that were, however, mostly based on DNA sequence information only. Here, we use diverse techniques including ultrastuctural analyses to link genomics to biology for the SM1 Euryarchaeon lineage, an uncultivated group of subsurface archaea. Phylogenomic analyses reveal this lineage to belong to a widespread group of archaea that we propose to classify as a new euryarchaeal order ('Candidatus Altiarchaeales'). The representative, double-membraned species 'Candidatus Altiarchaeum hamiconexum' has an autotrophic metabolism that uses a not-yet-reported Factor420-free reductive acetyl-CoA pathway, confirmed by stable carbon isotopic measurements of archaeal lipids. Our results indicate that this lineage has evolved specific metabolic and structural features like nano-grappling hooks empowering this widely distributed archaeon to predominate anaerobic groundwater, where it may represent an important carbon dioxide sink. PMID:25425419

  13. Simultaneous Quantification of Active Carbon- and Nitrogen-Fixing Communities and Estimation of Fixation Rates Using Fluorescence In Situ Hybridization and Flow Cytometry

    PubMed Central

    Shepard, Alicia K.; Raes, Eric J.; Waite, Anya M.; Quigg, Antonietta

    2014-01-01

    Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and 14C/15N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

  14. Enhancing Carbon Fixation by Metabolic Engineering: A Model System of Complex Network Modulation

    SciTech Connect

    Dr. Gregory Stephanopoulos

    2008-04-10

    In the first two years of this research we focused on the development of a DNA microarray for transcriptional studies in the photosynthetic organism Synechocystis and the elucidation of the metabolic pathway for biopolymer synthesis in this organism. In addition we also advanced the molecular biological tools for metabolic engineering of biopolymer synthesis in Synechocystis and initiated a series of physiological studies for the elucidation of the carbon fixing pathways and basic central carbon metabolism of these organisms. During the last two-year period we focused our attention on the continuation and completion of the last task, namely, the development of tools for basic investigations of the physiology of these cells through, primarily, the determination of their metabolic fluxes. The reason for this decision lies in the importance of fluxes as key indicators of physiology and the high level of information content they carry in terms of identifying rate limiting steps in a metabolic pathway. While flux determination is a well-advanced subject for heterotrophic organisms, for the case of autotrophic bacteria, like Synechocystis, some special challenges had to be overcome. These challenges stem mostly from the fact that if one uses {sup 13}C labeled CO{sub 2} for flux determination, the {sup 13}C label will mark, at steady state, all carbon atoms of all cellular metabolites, thus eliminating the necessary differentiation required for flux determination. This peculiarity of autotrophic organisms makes it imperative to carry out flux determination under transient conditions, something that had not been accomplished before. We are pleased to report that we have solved this problem and we are now able to determine fluxes in photosynthetic organisms from stable isotope labeling experiments followed by measurements of label enrichment in cellular metabolites using Gas Chromatography-Mass Spectrometry. We have conducted extensive simulations to test the method and also are presently validating it experimentally using data generated in collaboration with a research group at Purdue University. As result of these studies we can now determine, for the first time, fluxes in photosynthetic organisms and, eventually, in plants.

  15. Fluorinated Alcohols as Activators for the Solvent-Free Chemical Fixation of Carbon Dioxide into Epoxides.

    PubMed

    Gennen, Sandro; Alves, Margot; Méreau, Raphaël; Tassaing, Thierry; Gilbert, Bernard; Detrembleur, Christophe; Jerome, Christine; Grignard, Bruno

    2015-06-01

    The addition of fluorinated alcohols to onium salts provides highly efficient organocatalysts for the chemical fixation of CO2 into epoxides under mild experimental conditions. The combination of online kinetic studies, NMR titrations and DFT calculations allows understanding this synergistic effect that provides an active organocatalyst for CO2 /epoxides coupling. PMID:25951520

  16. Will Elevated Carbon Dioxide Concentration Amplify the Benefits of Nitrogen Fixation in Legumes?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Current evidence suggests there are three key features of the response of legumes to elevated [CO2]: (1) unlike other non-leguminous C3 plants, only legumes have the potential to maximize the benefit of elevated [CO2] by matching stimulated photosynthesis with increased N2 fixation; (2) this potenti...

  17. Ammonia fixation by humic substances: A nitrogen-15 and carbon-13 NMR study

    USGS Publications Warehouse

    Thorn, K.A.; Mikita, M.A.

    1992-01-01

    The process of ammonia fixation has been studied in three well characterized and structurally diverse fulvic and humic acid samples. The Suwannee River fulvic acid, and the IHSS peat and leonardite humic acids, were reacted with 15N-labelled ammonium hydroxide, and analyzed by liquid phase 15N NMR spectrometry. Elemental analyses and liquid phase 13C NMR spectra also were recorded on the samples before and after reaction with ammonium hydroxide. The largest increase in percent nitrogen occurred with the Suwannee River fulvic acid, which had a nitrogen content of 0.88% before fixation and 3.17% after fixation. The 15N NMR spectra revealed that ammonia reacted similarly with all three samples, indicating that the functional groups which react with ammonia exist in structural configurations common to all three samples. The majority of nitrogcn incorporated into the samples appears to be in the form of indole and pyrrole nitrogen, followed by pyridine, pyrazine, amide and aminohydroquinone nitrogen. Chemical changes in the individual samples upon fixation could not be discerned from the 13C NMR spectra.

  18. Carbon metabolism and strobilation in Cassiopea andromedea (Cnidaria: Scyphozoa): Significance of endosymbiotic dinoflagellates

    Microsoft Academic Search

    D. K. Hofmann; B. P. Kremer

    1981-01-01

    Scyphopolyps and scyphomedusae of Cassiopea andromeda Forskål (Cnidaria, Scyphozoa) containing dinoflagellate endosymbionts (zooxanthellae) were investigated for rates and pathways of carbon fixation. Photosynthesis by the algae, accounting for 80 and 15 µmol C h-1 on a dry weight basis in medusae and polyps, respectively, by far exceeds dark incorporation of inorganic carbon by the intact association. Photosynthetic carbon fixation is

  19. [ 14 C]Carbon-dioxide fixation by isolated leaf epidermes with stomata closed or open

    Microsoft Academic Search

    K. Raschke; P. Dittrich

    1977-01-01

    Isolated epidermes of Tulipa gesneriana L. and Commelian communis L. were exposed to 14CO2 in the light and in darkness, when stomata were either closed or open. The labelling patterns did not differ: the main products of CO2 fixation were malate and aspartate. Small amounts of radioactivity appeared also in acids of the tricarboxylic-acid cycle and their transamination products. Since

  20. Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use

    SciTech Connect

    Kleiner, Manuel [Max Planck Institute for Marine Microbiology; Wentrop, C. [Max Planck Institute for Marine Microbiology; Lott, C. [Max Planck Institute for Marine Microbiology; Teeling, Hanno [Max Planck Institute for Marine Microbiology; Wetzel, Silke [Max Planck Institute for Marine Microbiology; Young, Jacque C [ORNL; Chang, Y. [Oak Ridge National Laboratory (ORNL); Shah, Manesh B [ORNL; Verberkmoes, Nathan C [ORNL; Zarzycki, Jan [University of Freiburg, Germany; Fuchs, Georg [University of Freiburg, Germany; Markert, Stephanie [Institute of Marine Biotechnology, Germany; Hempel, Kristina [Institute for Microbiology, Germany

    2012-01-01

    Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such as sulfide and CO2. Remarkably little is known about the physiological strategies that enable chemosynthetic symbioses to colonize oligotrophic environments. In this study, we used metaproteomics and metabolomics to investigate the intricate network of metabolic interactions in the chemosynthetic association between Olavius algarvensis, a gutless marine worm, and its bacterial symbionts. We propose novel pathways for coping with energy and nutrient limitation, some of which may be widespread in both free-living and symbiotic bacteria. These include (i) a pathway for symbiont assimilation of the host waste products acetate, propionate, succinate and malate, (ii) the potential use of carbon monoxide as an energy source, a substrate previously not known to play a role in marine invertebrate symbioses, (iii) the potential use of hydrogen as an energy source, (iv) the strong expression of high affinity uptake transporters, and (v) novel energy efficient steps in CO2 fixation and sulfate reduction. The high expression of proteins involved in pathways for energy and carbon uptake and conservation in the O. algarvensis symbiosis indicates that the oligotrophic nature of its environment exerted a strong selective pressure in shaping these associations.

  1. Fixation of CO 2 by carbonating calcium derived from blast furnace slag

    Microsoft Academic Search

    Sanni Eloneva; Sebastian Teir; Justin Salminen; Carl-Johan Fogelholm; Ron Zevenhoven

    2008-01-01

    Industrial waste materials, such as steelmaking slags, appear to be potential raw materials for reducing CO2 emissions by carbonation. The suitability of applying a carbonation route based on acetic acid leaching to produce carbonates from blast furnace slag is presented in this study. The effect of solution pH, temperature, and CO2 pressure on the precipitation of carbonates was experimentally studied.

  2. Activity of carbon dioxide fixation by anthers and leaves of cereal grains

    SciTech Connect

    Kirichenko, E.B.; Chernyad'ev, I.I.; Doman, N.G.; Talibullina, K.K.; Voronkova, T.V.

    1986-05-01

    This paper gives a comparative evaluation of the photosynthetic activity of anthers and flag leaves in winter wheat, rye, and triticale. The content of chlorophylls in anthers and leaves was determined. The activity of /sup 14/CO/sub 2/ fixation by anthers and leaf disks was determined by the radiometric method in a chamber floating on mercury under standard exposure conditions (0.1% concentration of /sup 14/CO/sub 2/, illumination of 15,000 1x, temperature of 23 C). Analyses were conducted in three replications and the results of typical biological experiments are cited. Data show that chlorophyll is actively synthesized in the anthers of cereal grains.

  3. Recent advances in carbon dioxide capture, fixation, and activation by using N-heterocyclic carbenes.

    PubMed

    Yang, Longhua; Wang, Hongming

    2014-04-01

    In the last two decades, CO2 emission has caused a lot of environmental problems. To mitigate the concentration of CO2 in the atmosphere, various strategies have been implemented, one of which is the use of N-heterocyclic carbenes (NHCs) and related complexes to accomplish the capture, fixation, and activation of CO2 effectively. In this review, we summarize CO2 capture, fixation, and activation by utilizing NHCs and related complexes; homogeneous reactions and their reaction mechanisms are discussed. Free NHCs and NHC salts can capture CO2 in both direct and indirect ways to form imidazolium carboxylates, and they can also catalyze the reaction of aromatic aldehydes with CO2 to form carboxylic acids and derivatives. Moreover, associated with transition metals (TMs), NHCs can form NHC-TM complexes to transform CO2 into industrial acid or esters. Non-metal-NHC complexes can also catalyze the reactions of silicon and boron complexes with CO2 . In addition, catalytic cycloaddition of epoxides with CO2 is another effective function of NHC complexes, and NHC ionic liquids perform excellently in this aspect. PMID:24644039

  4. Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L

    SciTech Connect

    Singal, H.R.; Sheoran, I.S.; Singh, R.

    1987-04-01

    Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwall and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.

  5. Antioxidant pathways are up-regulated during biological nitrogen fixation to prevent ROS-induced nitrogenase inhibition in Gluconacetobacter diazotrophicus.

    PubMed

    Alquéres, Sylvia M C; Oliveira, Jose Henrique M; Nogueira, Eduardo M; Guedes, Helma V; Oliveira, Pedro L; Câmara, Fernando; Baldani, Jose I; Martins, Orlando B

    2010-10-01

    Gluconacetobacter diazotrophicus, an endophyte isolated from sugarcane, is a strict aerobe that fixates N(2). This process is catalyzed by nitrogenase and requires copious amounts of ATP. Nitrogenase activity is extremely sensitive to inhibition by oxygen and reactive oxygen species (ROS). However, the elevated oxidative metabolic rates required to sustain biological nitrogen fixation (BNF) may favor an increased production of ROS. Here, we explored this paradox and observed that ROS levels are, in fact, decreased in nitrogen-fixing cells due to the up-regulation of transcript levels of six ROS-detoxifying genes. A cluster analyses based on common expression patterns revealed the existence of a stable cluster with 99.8% similarity made up of the genes encoding the ?-subunit of nitrogenase Mo-Fe protein (nifD), superoxide dismutase (sodA) and catalase type E (katE). Finally, nitrogenase activity was inhibited in a dose-dependent manner by paraquat, a redox cycler that increases cellular ROS levels. Our data revealed that ROS can strongly inhibit nitrogenase activity, and G. diazotrophicus alters its redox metabolism during BNF by increasing antioxidant transcript levels resulting in a lower ROS generation. We suggest that careful controlled ROS production during this critical phase is an adaptive mechanism to allow nitrogen fixation. PMID:20697694

  6. Effects of Organic Carbon\\/Carbonate Burial Ratios and Biological Carbon Fixation on the Global Carbon Cycle Over the Past ~200 myr

    Microsoft Academic Search

    M. E. Katz; A. J. Milligan; B. S. Cramer; K. Fennel; K. G. Miller; J. D. Wright; P. G. Falkowski

    2004-01-01

    The isotopic composition of the global carbon reservoir integrates large kinetic fractionations from photosynthesis with small thermodynamic fractionations from carbonate precipitation. We present concordant delta 13C records of carbonates (delta 13Ccarb) and organic matter (delta 13Corg), along with new carbonate (Ccarb) and organic carbonate (Corg) fluxes for the past ˜205 myrs (Jurassic-Cenozoic) generated from bulk sediment samples from the Atlantic.

  7. Pathways of organic carbon oxidation in three continental margin sediments

    NASA Technical Reports Server (NTRS)

    Canfield, D. E.; Jorgensen, B. B.; Fossing, H.; Glud, R.; Gundersen, J.; Ramsing, N. B.; Thamdrup, B.; Hansen, J. W.; Nielsen, L. P.; Hall, P. O.

    1993-01-01

    We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and Mn reduction) has probably been well underestimated.

  8. Fixation and distribution of bacterial activity in sand to induce carbonate precipitation for ground reinforcement

    Microsoft Academic Search

    Marien P. Harkes; Leon A. van Paassen; Jacco L. Booster; Victoria S. Whiffin; Mark C. M. van Loosdrecht

    2010-01-01

    The mechanical properties of soil (cohesion, friction, stiffness and permeability) are important parameters for engineering constructions and ecosystems in sedimentary environments. BioGrout is an in situ soil strengthening technique involving microbial-induced carbonate precipitation (MICP). This process involves hydrolysis of urea by bacteria containing the enzyme urease in the presence of dissolved calcium ions, resulting in calcium carbonate precipitation. In order

  9. Carbon isotope fractionation and the acetyl-CoA pathway

    NASA Astrophysics Data System (ADS)

    Blaser, Martin; Conrad, Ralf

    2010-05-01

    Homoacetogenic bacteria can catalyze the reductive synthesis of acetate from CO2 via the acetyl-CoA pathway. Besides this unifying property homoacetogenic bacteria constitute a metabolically and phylogenetically diverse bacteriological group. Therefore their environmental role is difficult to address. It has been recognized that in methanogenic environments homoacetogenic bacteria contribute to the degradation of organic matter. The natural abundance of 13C may be used to understand the functional impact of homoacetogenic bacteria in the soil environment. To distinguish the acetyl-CoA pathway from other dominant processes, the isotopic composition of acetate and CO2 can be determined and the fractionation factors of the individual processes may be used to discriminate between the dominant pathways. To characterize the fractionation factor associated with the acetyl-CoA pathway the phylogenetic and metabolic diversity needs to be considered. Therefore the fractionation factor of substrate utilization and product formation of different homoacetogens (Acetobacterium woodii, Sporomusa ovata, Thermoanaerobacter kivui, Morella thermoautotrophica) has been studied under pure culture conditions in two defined minimal medium with H2/CO2 as sole source of carbon and energy. It became obvious that the cultivation conditions have a major impact on the obtained fractionation factors.

  10. Carbon cost of plant nitrogen acquisition: A mechanistic, globally applicable model of plant nitrogen uptake, retranslocation, and fixation

    NASA Astrophysics Data System (ADS)

    Fisher, J. B.; Sitch, S.; Malhi, Y.; Fisher, R. A.; Huntingford, C.; Tan, S.-Y.

    2010-03-01

    Nitrogen (N) generally limits plant growth and controls biosphere responses to climate change. We introduce a new mathematical model of plant N acquisition, called Fixation and Uptake of Nitrogen (FUN), based on active and passive soil N uptake, leaf N retranslocation, and biological N fixation. This model is unified under the theoretical framework of carbon (C) cost economics, or resource optimization. FUN specifies C allocated to N acquisition as well as remaining C for growth, or N-limitation to growth. We test the model with data from a wide range of sites (observed versus predicted N uptake r2 is 0.89, and RMSE is 0.003 kg N m-2·yr-1). Four model tests are performed: (1) fixers versus nonfixers under primary succession; (2) response to N fertilization; (3) response to CO2 fertilization; and (4) changes in vegetation C from potential soil N trajectories for five DGVMs (HYLAND, LPJ, ORCHIDEE, SDGVM, and TRIFFID) under four IPCC scenarios. Nonfixers surpass the productivity of fixers after ˜150-180 years in this scenario. FUN replicates the N uptake response in the experimental N fertilization from a modeled N fertilization. However, FUN cannot replicate the N uptake response in the experimental CO2 fertilization from a modeled CO2 fertilization; nonetheless, the correct response is obtained when differences in root biomass are included. Finally, N-limitation decreases biomass by 50 Pg C on average globally for the DGVMs. We propose this model as being suitable for inclusion in the new generation of Earth system models that aim to describe the global N cycle.

  11. Pathways to Adoption of Carbon Capture and Sequestration in India: Technologies and Policies

    E-print Network

    Pathways to Adoption of Carbon Capture and Sequestration in India: Technologies and Policies, Technology and Policy Program #12;2 #12;Pathways to Carbon Capture and Sequestration in India: Technologies to control India's emissions will have to be a global priority. Carbon capture and sequestration (CCS) can

  12. Enantioselective Small Molecule Synthesis by Carbon Dioxide Fixation using a Dual Brønsted Acid/Base Organocatalyst.

    PubMed

    Vara, Brandon A; Struble, Thomas J; Wang, Weiwei; Dobish, Mark C; Johnston, Jeffrey N

    2015-06-17

    Carbon dioxide exhibits many of the qualities of an ideal reagent: it is nontoxic, plentiful, and inexpensive. Unlike other gaseous reagents, however, it has found limited use in enantioselective synthesis. Moreover, unprecedented is a tool that merges one of the simplest biological approaches to catalysis-Brønsted acid/base activation-with this abundant reagent. We describe a metal-free small molecule catalyst that achieves the three component reaction between a homoallylic alcohol, carbon dioxide, and an electrophilic source of iodine. Cyclic carbonates are formed enantioselectively. PMID:26039818

  13. A hypersaline microbial mat from the Pacific Atoll Kiritimati: insights into composition and carbon fixation

    E-print Network

    Gilli, Adrian

    and farnesol were attributed to this group that was also actively fixing carbon. Back- ground isotopic values indicate Calvin­Benson cycle-based autotrophy for cycC19:0 and farnesol-producing PSBs. Biomarkers from

  14. QUANTITATIVE STUDIES OF THE EFFECT OF ORGANIC SUBSTRATES AND 2,4-DINITROPHENOL ON HETEROTROPHIC CARBON DIOXIDE FIXATION IN HYDROGENOMONAS FACILIS

    PubMed Central

    McFadden, Bruce A.; Homann, H. Robert

    1963-01-01

    McFadden, Bruce A. (Washington State University, Pullman), and H. Robert Homann. Quantitative studies of the effect of organic substrates and 2,4-dinitrophenol on heterotrophic carbon dioxide fixation in Hydrogenomonas facilis. J. Bacteriol. 86:971–977. 1963.—Whole cells of Hydrogenomonas facilis under heterotrophic conditions fixed levels of C14O2 which depended upon the nature of the carbon source being oxidized. It was established that oxidative rates varied as a function of pCO2. Therefore, all studies were conducted in the presence of 1.5 mole% CO2 in the gas phase. With glucose-grown cells supplied with glucose as substrate, the heterotrophic fixation was curtailed 98% by the addition of 8.3 × 10?4m 2,4-dinitrophenol (DNP). A coupling between reductive fixation of CO2 and heterotrophic oxidation of substrate is consistent with the observed effect of DNP. The efficiency of coupling of fixation with oxidation was studied for acetate, d-glucose, l-glutamate, d,l-lactate, d-ribose, and succinate as substrates. Kinetic studies showed that the efficiency of coupling (expressed as disintegrations per minute of C14 per microliter of O2) was initially time-variable for all substrates; however, it approached a constant value after 30 to 45 min for acetate, glutamate, lactate, and succinate. The initial variation of the ratio with time was due primarily to C14O2 uptake, which was nonlinear with time. Control studies in the absence of exogenous substrate indicated that CO2 fixation may also be linked to oxidation of endogenous stores accumulated during heterotrophic growth. d-Ribose appears to be the most promising substrate for short-term fixation studies owing to the rapid incorporation of C14 and the unusually low endogenous fixation rate by cells grown on ribose. Calculations reveal that, after isotopic equilibrium has occurred, the amount of CO2 utilized during glucose oxidation is almost 50% of O2 uptake during the same interval. Even during succinate oxidation, which was shown to be coupled much less effectively with CO2 fixation, the CO2 utilized during the same interval is 8% of O2 uptake. PMID:14080809

  15. Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation

    PubMed Central

    Karl, David M.; Church, Matthew J.; Dore, John E.; Letelier, Ricardo M.; Mahaffey, Claire

    2012-01-01

    The atmospheric and deep sea reservoirs of carbon dioxide are linked via physical, chemical, and biological processes. The last of these include photosynthesis, particle settling, and organic matter remineralization, and are collectively termed the “biological carbon pump.” Herein, we present results from a 13-y (1992–2004) sediment trap experiment conducted in the permanently oligotrophic North Pacific Subtropical Gyre that document a large, rapid, and predictable summertime (July 15–August 15) pulse in particulate matter export to the deep sea (4,000 m). Peak daily fluxes of particulate matter during the summer export pulse (SEP) average 408, 283, 24.1, 1.1, and 67.5 ?mol·m?2·d?1 for total carbon, organic carbon, nitrogen, phosphorus (PP), and biogenic silica, respectively. The SEP is approximately threefold greater than mean wintertime particle fluxes and fuels more efficient carbon sequestration because of low remineralization during downward transit that leads to elevated total carbon/PP and organic carbon/PP particle stoichiometry (371:1 and 250:1, respectively). Our long-term observations suggest that seasonal changes in the microbial assemblage, namely, summertime increases in the biomass and productivity of symbiotic nitrogen-fixing cyanobacteria in association with diatoms, are the main cause of the prominent SEP. The recurrent SEP is enigmatic because it is focused in time despite the absence of any obvious predictable stimulus or habitat condition. We hypothesize that changes in day length (photoperiodism) may be an important environmental cue to initiate aggregation and subsequent export of organic matter to the deep sea. PMID:22308450

  16. Chemolithotrophic nitrite oxidation by Nitrobacter: coupling with carbon dioxide fixation for growth and influence of metal ions and inorganic compounds of sulfur

    SciTech Connect

    Tsai, Y.L.

    1986-01-01

    The growth of Nitrobacter winogradskyi was completely inhibited by 0.1 mM persulfate, 0.5 mM tetrathionate, or by 5 mM each of dithionite, metabisulfite, or trithionate. The oxygen uptake activity of washed N. agilis cell suspensions was not influenced by persulfate or tetrathionate. Carbon dioxide fixation was insensitive to tetrathionate and in fact an enhancement by tetrathionate was observed. Persulfate inhibited the fixation of carbon dioxide only at a high concentration. The oxygen uptake activity of washed ell suspensions of N. agilis was tested in the presence of copper, nickel, aluminum, uranyl, and molybdate ions. Copper ion was slightly stimulatory at 0.17 M and strongly inhibitory at 17 mM. Molybdate ion showed either slight enhancement or no inhibition at all test concentrations. With the other test ions inhibition of oxygen uptake was observed.

  17. Regulation of photosynthetic carbon fixation on the ocean margins. Final report

    SciTech Connect

    Paul, J.H.

    1997-06-01

    The US Department of Energy is concerned with the fate of energy-related materials, including carbon dioxide, in the marine environment. Using laboratory studies, as well as field studies, an attempt was made to understand the molecular regulation of photosynthetic carbon reduction. The objectives were: to determine the mechanism of regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBPCase) in phytoplankton in response to changes in light fields; and to determine regulation of (RuBPCase) in response to light under nutrient deprivation.

  18. Factors influencing carbon fixation and water use by mediterranean sclerophyll shrubs during summer drought

    Microsoft Academic Search

    J. D. Tenhunen; A. Sala Serra; P. C. Harley; R. L. Dougherty; J. F. Reynolds

    1990-01-01

    Mediterranean sclerophyll shrubs respond to seasonal drought by adjusting the amount of leaf area exposed and by reducing gas exchange via stomatal closure mechanisms. The degree to which each of these modifications can influence plant carbon and water balances under typical mediterranean-type climate conditions is examined. Leaf area changes are assessed in the context of a canopy structure and light

  19. Carbonate hydroxyapatite functionalization: a comparative study towards (bio)molecules fixation

    PubMed Central

    Russo, Laura; Taraballi, Francesca; Lupo, Cristina; Poveda, Ana; Jiménez-Barbero, Jesús; Sandri, Monica; Tampieri, Anna; Nicotra, Francesco; Cipolla, Laura

    2014-01-01

    Different methods for the functionalization of carbonate hydroxyapatite granules with free amine groups by reaction with (3-aminopropyl)triethoxysilane (APTES) have been compared in order to improve the potential for tethering of bioactive molecules to bioceramics. The combined use of tetraethoxyorthosilicate and APTES with acid catalysis resulted in an evident increase in amine surface grafting. PMID:24501671

  20. Carbon pathways for the partial oxidation of methane

    SciTech Connect

    Koranne, M.M.; Goodwin, J.G. Jr.; Marcelin, G. (Univ. of Pittsburgh, PA (United States))

    1993-01-21

    The partial oxidation of methane to formaldehyde was studied at 1-atm pressure using a 2% V[sub 2]O[sub 5]/SiO[sub 2] catalyst with molecular oxygen as an oxidant. As methane conversion increased, formaldehyde selectivity decreased rapidly while CO[sub x] selectivity increased, indicating that formaldehyde was a primary product of the reaction, while CO[sub x] formation occurred apparently in large part by secondary reaction. Using steady-state isotopic transient kinetic analysis technique, carbon transients were obtained by switching from [sup 12]CH[sub 4] to [sup 13]CH[sub 4] at steady state, permitting the determination of surface residence times and surface concentrations of various carbon-containing intermediates. It was possible to observe detectable reversible chemisorption of methane on the catalyst studied and other reference oxides only at conditions where significant reaction took place. For the partial oxidation of methane over the 2% V[sub 2]O[sub 5]/SiO[sub 2] catalyst, it was found that HCHO and CO did not exhibit significant reversible readsorption under the reaction conditions used. It is suggested that the formation of CO involves a sequential pathway wherein an irreversible readsorption of HCHO is involved. A carbon pathway consistent with the observations is proposed. It is speculated that different types of sites involved in the formation of HCHO, CO and C[sub 2]H[sub 6] may correspond to vanadium oxide species in different redox states. 30 refs., 6 figs., 5 tabs.

  1. Pathways of Carbon and Energy Metabolism of the Epibiotic Community Associated with the Deep-Sea Hydrothermal Vent Shrimp Rimicaris exoculata

    PubMed Central

    Hügler, Michael; Petersen, Jillian M.; Dubilier, Nicole; Imhoff, Johannes F.; Sievert, Stefan M.

    2011-01-01

    Background The shrimp Rimicaris exoculata dominates the faunal biomass at many deep-sea hydrothermal vent sites at the Mid-Atlantic Ridge. In its enlarged gill chamber it harbors a specialized epibiotic bacterial community for which a nutritional role has been proposed. Methodology/Principal Findings We analyzed specimens from the Snake Pit hydrothermal vent field on the Mid-Atlantic Ridge by complementing a 16S rRNA gene survey with the analysis of genes involved in carbon, sulfur and hydrogen metabolism. In addition to Epsilon- and Gammaproteobacteria, the epibiotic community unexpectedly also consists of Deltaproteobacteria of a single phylotype, closely related to the genus Desulfocapsa. The association of these phylogenetic groups with the shrimp was confirmed by fluorescence in situ hybridization. Based on functional gene analyses, we hypothesize that the Gamma- and Epsilonproteobacteria are capable of autotrophic growth by oxidizing reduced sulfur compounds, and that the Deltaproteobacteria are also involved in sulfur metabolism. In addition, the detection of proteobacterial hydrogenases indicates the potential for hydrogen oxidation in these communities. Interestingly, the frequency of these phylotypes in 16S rRNA gene clone libraries from the mouthparts differ from that of the inner lining of the gill chamber, indicating potential functional compartmentalization. Conclusions Our data show the specific association of autotrophic bacteria with Rimicaris exoculata from the Snake Pit hydrothermal vent field, and suggest that autotrophic carbon fixation is contributing to the productivity of the epibiotic community with the reductive tricarboxylic acid cycle as one important carbon fixation pathway. This has not been considered in previous studies of carbon fixation and stable carbon isotope composition of the shrimp and its epibionts. Furthermore, the co-occurrence of sulfur-oxidizing and sulfur-reducing epibionts raises the possibility that both may be involved in the syntrophic exchange of sulfur compounds, which could increase the overall efficiency of this epibiotic community. PMID:21249205

  2. Solar energy fixation of carbon dioxide via cadmium sulfide and other semiconductor photocatalysts

    SciTech Connect

    Irvine, J.T.S.; Eggins, B.R. (Univ. of Ulster, Newtownabbey (England)); Grimshaw, J. (The Queens Univ. of Belfast (Ireland))

    1990-01-01

    Aqueous carbon dioxide is photochemically reduced in the presence of semiconductor suspensions and colloids. Experiments have been performed using CdS, ZnO, SiC, Ba TiO{sub 3}, and SrTiO{sub 3}, dispersions. Product analysis showed the formation of formic acid, formaldehyde, sometimes methanol and in the presence of tetramethylammonium chloride, two-carbon products such as glyoxylic and acetic acids and sometimes acetaldehyde. Product yields and photochemical yields were studied as a function of pH, solution composition, added sacrificial electron donors and catalysts, irradiation intensity and irradiation time. A demonstration experiment with a flat-bed solar collector showed the formation of formic acid and formaldehyde using direct sunlight.

  3. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco

    PubMed Central

    Simkin, Andrew J.; McAusland, Lorna; Headland, Lauren R.; Lawson, Tracy; Raines, Christine A.

    2015-01-01

    Over the next 40 years it has been estimated that a 50% increase in the yield of grain crops such as wheat and rice will be required to meet the food and fuel demands of the increasing world population. Transgenic tobacco plants have been generated with altered combinations of sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and the cyanobacterial putative-inorganic carbon transporter B, ictB, of which have all been identified as targets to improve photosynthesis based on empirical studies. It is shown here that increasing the levels of the three proteins individually significantly increases the rate of photosynthetic carbon assimilation, leaf area, and biomass yield. Furthermore, the daily integrated measurements of photosynthesis showed that mature plants fixed between 12–19% more CO2 than the equivalent wild-type plants. Further enhancement of photosynthesis and yield was observed when sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and ictB were over-expressed together in the same plant. These results demonstrate the potential for the manipulation of photosynthesis, using multigene-stacking approaches, to increase crop yields. PMID:25956882

  4. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco.

    PubMed

    Simkin, Andrew J; McAusland, Lorna; Headland, Lauren R; Lawson, Tracy; Raines, Christine A

    2015-07-01

    Over the next 40 years it has been estimated that a 50% increase in the yield of grain crops such as wheat and rice will be required to meet the food and fuel demands of the increasing world population. Transgenic tobacco plants have been generated with altered combinations of sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and the cyanobacterial putative-inorganic carbon transporter B, ictB, of which have all been identified as targets to improve photosynthesis based on empirical studies. It is shown here that increasing the levels of the three proteins individually significantly increases the rate of photosynthetic carbon assimilation, leaf area, and biomass yield. Furthermore, the daily integrated measurements of photosynthesis showed that mature plants fixed between 12-19% more CO2 than the equivalent wild-type plants. Further enhancement of photosynthesis and yield was observed when sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and ictB were over-expressed together in the same plant. These results demonstrate the potential for the manipulation of photosynthesis, using multigene-stacking approaches, to increase crop yields. PMID:25956882

  5. Investigation of a HA/PDLGA/Carbon Foam Material System for Orthopedic Fixation Plates Based on Time-Dependent Properties

    E-print Network

    Rodriguez, Douglas E.

    2010-01-14

    While there is continuing interest in bioresorbable materials for orthopedic fixation devices, the major challenge in utilizing these materials in load-bearing applications is creating materials sufficiently stiff and strong to sustain loads...

  6. Oxygen Pathways and Carbon Dioxide Utilization in Methane Partial Oxidation in Ambient Temperature

    E-print Network

    Mallinson, Richard

    Oxygen Pathways and Carbon Dioxide Utilization in Methane Partial Oxidation in Ambient Temperature and lower environmental impacts make this the carbon-based fuel of choice well into the twenty-first century into enhance- ment of the carbon balance of methane conversion by reforming with CO2 in order to "recycle

  7. 14C Fixation by Leaves and Leaf Cell Protoplasts of the Submerged Aquatic Angiosperm Potamogeton lucens: Carbon Dioxide or Bicarbonate? 1

    PubMed Central

    Staal, Marten; Elzenga, J. Theo M.; Prins, Hidde B. A.

    1989-01-01

    Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is, acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant. PMID:16666848

  8. Advances in mechanisms and signaling pathways of carbon nanotube toxicity.

    PubMed

    Dong, Jie; Ma, Qiang

    2015-08-01

    Carbon nanotubes (CNT) have been developed into new materials with a variety of industrial and commercial applications. In contrast, the physicochemical properties of CNT at the nanoscale render them the potency to generate toxic effects. Indeed, the potential health impacts of CNT have drawn a great deal of attention in recent years, owing to their identified toxicological and pathological consequences including cytotoxicity, inflammation, fibrosis, genotoxicity, tumorigenesis, and immunotoxicity. Understanding the mechanisms by which CNT induce toxicity and pathology is thus urgently needed for accurate risk assessment of CNT exposure in humans, and for safe and responsible development and commercialization of nanotechnology. Here, we summarize and discuss recent advances in this area with a focus on the molecular interactions between CNT and mammalian systems, and the signaling pathways important for the development of CNT toxicity such as the NF-?B, NLRP3 inflammasome, TGF-?1, MAPK, and p53 signaling cascades. With the current mechanistic evidence summarized in this review, we expect to provide new insights into CNT toxicology at the molecular level and offer new clues to the prevention of health effects resulting from CNT exposure. Moreover, we disclose questions and issues that remain in this rapidly advancing field of nanotoxicology, which would facilitate ascertaining future research directions. PMID:25676622

  9. Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata

    PubMed Central

    Ponsard, Julie; Cambon-Bonavita, Marie-Anne; Zbinden, Magali; Lepoint, Gilles; Joassin, André; Corbari, Laure; Shillito, Bruce; Durand, Lucile; Cueff-Gauchard, Valérie; Compère, Philippe

    2013-01-01

    The shrimp Rimicaris exoculata dominates several hydrothermal vent ecosystems of the Mid-Atlantic Ridge and is thought to be a primary consumer harbouring a chemoautotrophic bacterial community in its gill chamber. The aim of the present study was to test current hypotheses concerning the epibiont's chemoautotrophy, and the mutualistic character of this association. In-vivo experiments were carried out in a pressurised aquarium with isotope-labelled inorganic carbon (NaH13CO3 and NaH14CO3) in the presence of two different electron donors (Na2S2O3 and Fe2+) and with radiolabelled organic compounds (14C-acetate and 3H-lysine) chosen as potential bacterial substrates and/or metabolic by-products in experiments mimicking transfer of small biomolecules from epibionts to host. The bacterial epibionts were found to assimilate inorganic carbon by chemoautotrophy, but many of them (thick filaments of epsilonproteobacteria) appeared versatile and able to switch between electron donors, including organic compounds (heterotrophic acetate and lysine uptake). At least some of them (thin filamentous gammaproteobacteria) also seem capable of internal energy storage that could supply chemosynthetic metabolism for hours under conditions of electron donor deprivation. As direct nutritional transfer from bacteria to host was detected, the association appears as true mutualism. Import of soluble bacterial products occurs by permeation across the gill chamber integument, rather than via the digestive tract. This first demonstration of such capabilities in a decapod crustacean supports the previously discarded hypothesis of transtegumental absorption of dissolved organic matter or carbon as a common nutritional pathway. PMID:22914596

  10. Special Aspects of Nitrogen Fixation by Blue-Green Algae

    Microsoft Academic Search

    Rosalie M. Cox; P. Fay

    1969-01-01

    When carbon dioxide fixation was over 90% inhibited by CMU, nitrogen fixation remained unaffected in nitrogen-starved cells of Anabaena cylindrica. In normal cells under the same conditions nitrogen fixation was about 50% inhibited by CMU. These data suggest, first, that nitrogen fixation in this organism is independent of reducing potential generated by non-cyclic photo-electron transport and, secondly, that nitrogen fixation

  11. Modelling Urban scale Retrofit, Pathways to 2050 Low Carbon Residential Building Stock 

    E-print Network

    Lannon, Simon; Georgakaki, Aliki; Macdonald, Stuart

    A bottom up engineering modelling approach has been used to investigate the pathways to 2050 low carbon residential building stock. The impact of housing retrofit, renewable technologies, occupant behaviour, and grid decarbonisation is measured at a...

  12. Carbon dioxide fixation in batch culture of Chlorella sp. using a photobioreactor with a sunlight-cellection device

    Microsoft Academic Search

    Satoshi Hirata; Masao Hayashitani; Masahito Taya; Setsuji Tone

    1996-01-01

    In a batch culture of Chlorella sp. using sunlight as a light source, the cell concentration reached a maximum of 150 mg dry cells dm?3 at 200 h. The mean rate of CO2 fixation during the culture was 31.8 mg CO2 dm?3 d?1. The efficiency of conversion of energy to biomass was estimated as 4.3%.

  13. Two-dimensional isobutyl acetate production pathways to improve carbon yield

    PubMed Central

    Tashiro, Yohei; Desai, Shuchi H.; Atsumi, Shota

    2015-01-01

    For an economically competitive biological process, achieving high carbon yield of a target chemical is crucial. In biochemical production, pyruvate and acetyl-CoA are primary building blocks. When sugar is used as the sole biosynthetic substrate, acetyl-CoA is commonly generated by pyruvate decarboxylation. However, pyruvate decarboxylation during acetyl-CoA formation limits the theoretical maximum carbon yield (TMCY) by releasing carbon, and in some cases also leads to redox imbalance. To avoid these problems, we describe here the construction of a metabolic pathway that simultaneously utilizes glucose and acetate. Acetate is utilized to produce acetyl-CoA without carbon loss or redox imbalance. We demonstrate the utility of this approach for isobutyl acetate (IBA) production, wherein IBA production with glucose and acetate achieves a higher carbon yield than with either sole carbon source. These results highlight the potential for this multiple carbon source approach to improve the TMCY and balance redox in biosynthetic pathways. PMID:26108471

  14. Two-dimensional isobutyl acetate production pathways to improve carbon yield.

    PubMed

    Tashiro, Yohei; Desai, Shuchi H; Atsumi, Shota

    2015-01-01

    For an economically competitive biological process, achieving high carbon yield of a target chemical is crucial. In biochemical production, pyruvate and acetyl-CoA are primary building blocks. When sugar is used as the sole biosynthetic substrate, acetyl-CoA is commonly generated by pyruvate decarboxylation. However, pyruvate decarboxylation during acetyl-CoA formation limits the theoretical maximum carbon yield (TMCY) by releasing carbon, and in some cases also leads to redox imbalance. To avoid these problems, we describe here the construction of a metabolic pathway that simultaneously utilizes glucose and acetate. Acetate is utilized to produce acetyl-CoA without carbon loss or redox imbalance. We demonstrate the utility of this approach for isobutyl acetate (IBA) production, wherein IBA production with glucose and acetate achieves a higher carbon yield than with either sole carbon source. These results highlight the potential for this multiple carbon source approach to improve the TMCY and balance redox in biosynthetic pathways. PMID:26108471

  15. Presence of Acetyl Coenzyme A (CoA) Carboxylase and Propionyl-CoA Carboxylase in Autotrophic Crenarchaeota and Indication for Operation of a 3-Hydroxypropionate Cycle in Autotrophic Carbon Fixation

    Microsoft Academic Search

    CASTOR MENENDEZ; ZSUZSA BAUER; HARALD HUBER; NASSER GAD' ON; KARL-OTTO STETTER; GEORG FUCHS

    1999-01-01

    The pathway of autotrophic CO2 fixation was studied in the phototrophic bacterium Chloroflexus aurantiacus and in the aerobic thermoacidophilic archaeon Metallosphaera sedula. In both organisms, none of the key enzymes of the reductive pentose phosphate cycle, the reductive citric acid cycle, and the reductive acetyl coenzyme A (acetyl-CoA) pathway were detectable. However, cells contained the biotin-dependent acetyl-CoA carboxylase and propionyl-CoA

  16. Carbon partitioning to the terpenoid biosynthetic pathway enables heterologous ?-phellandrene production in Escherichia coli cultures.

    PubMed

    Formighieri, Cinzia; Melis, Anastasios

    2014-12-01

    Escherichia coli was used as a microbial system for the heterologous synthesis of ?-phellandrene, a monoterpene of plant origin with several potential commercial applications. Expression of Lavandula angustifolia ?-phellandrene synthase (PHLS), alone or in combination with Picea abies geranyl-diphosphate synthase in E. coli, resulted in no ?-phellandrene accumulation, in sharp contrast to observations with PHLS-transformed cyanobacteria. Lack of ?-phellandrene biosynthesis in E. coli was attributed to the limited endogenous carbon partitioning through the native 2-C-methylerythritol-4-phosphate (MEP) pathway. Heterologous co-expression of the mevalonic acid pathway, enhancing cellular carbon partitioning and flux toward the universal isoprenoid precursors, isopentenyl-diphosphate and dimethylallyl-diphosphate, was required to confer ?-phellandrene production. Differences in endogenous carbon flux toward the synthesis of isoprenoids between photosynthetic (Synechocystis) and non-photosynthetic bacteria (E. coli) are discussed in terms of differences in the regulation of carbon partitioning through the MEP biosynthetic pathway in the two systems. PMID:25116411

  17. Carbon Assimilation Pathways, Water Relationships and Plant Ecology.

    ERIC Educational Resources Information Center

    Etherington, John R.

    1988-01-01

    Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

  18. Carbon dioxide concentration dictates alternative methanogenic pathways in oil reservoirs

    PubMed Central

    Mayumi, Daisuke; Dolfing, Jan; Sakata, Susumu; Maeda, Haruo; Miyagawa, Yoshihiro; Ikarashi, Masayuki; Tamaki, Hideyuki; Takeuchi, Mio; Nakatsu, Cindy H.; Kamagata, Yoichi

    2013-01-01

    Deep subsurface formations (for example, high-temperature oil reservoirs) are candidate sites for carbon capture and storage technology. However, very little is known about how the subsurface microbial community would respond to an increase in CO2 pressure resulting from carbon capture and storage. Here we construct microcosms mimicking reservoir conditions (55?°C, 5?MPa) using high-temperature oil reservoir samples. Methanogenesis occurs under both high and low CO2 conditions in the microcosms. However, the increase in CO2 pressure accelerates the rate of methanogenesis to more than twice than that under low CO2 conditions. Isotope tracer and molecular analyses show that high CO2 conditions invoke acetoclastic methanogenesis in place of syntrophic acetate oxidation coupled with hydrogenotrophic methanogenesis that typically occurs in this environment (low CO2 conditions). Our results present a possibility of carbon capture and storage for enhanced microbial energy production in deep subsurface environments that can mitigate global warming and energy depletion. PMID:23759740

  19. The intramolecular ¹³C-distribution in ethanol reveals the influence of the CO? -fixation pathway and environmental conditions on the site-specific ¹³C variation in glucose.

    PubMed

    Gilbert, Alexis; Silvestre, Virginie; Segebarth, Nicolas; Tcherkez, Guillaume; Guillou, Claude; Robins, Richard J; Akoka, Serge; Remaud, Gérald S

    2011-07-01

    Efforts to understand the cause of ¹²C versus ¹³C isotope fractionation in plants during photosynthesis and post-photosynthetic metabolism are frustrated by the lack of data on the intramolecular ¹³C-distribution in metabolites and its variation with environmental conditions. We have exploited isotopic carbon-13 nuclear magnetic resonance (¹³C NMR) spectrometry to measure the positional isotope composition (?¹³C(i) , ‰) in ethanol samples from different origins: European wines, liquors and sugars from C?, C? and crassulacean acid metabolism (CAM) plants. In C?-ethanol samples, the methylene group was always ¹³C-enriched (?2‰) relative to the methyl group. In wines, this pattern was correlated with both air temperature and ?(18)O of wine water, indicating that water vapour deficit may be a critical defining factor. Furthermore, in C?-ethanol, the reverse relationship was observed (methylene-C relatively ¹³C-depleted), supporting the concept that photorespiration is the key metabolic process leading to the ¹³C distribution in C?-ethanol. By contrast, in CAM-ethanol, the isotopic pattern was similar to but stronger than C?-ethanol, with a relative ¹³C-enrichment in the methylene-C of up to 13‰. Plausible causes of this ¹³C-pattern are briefly discussed. As the intramolecular ?¹³C(i) -values in ethanol reflect that in source glucose, our data point out the crucial impact on the ratio of metabolic pathways sustaining glucose synthesis. PMID:21410708

  20. Molybdenum Trafficking for Nitrogen Fixation

    PubMed Central

    Hernandez, Jose A.; George, Simon J.; Rubio, Luis M.

    2009-01-01

    The molybdenum nitrogenase is responsible for most biological nitrogen fixation, a prokaryotic metabolic process that determines the global biogeochemical cycles of nitrogen and carbon. Here we describe the trafficking of molybdenum for nitrogen fixation in the model diazotrophic bacterium Azotobacter vinelandii. The genes and proteins involved in molybdenum uptake, homeostasis, storage, regulation, and nitrogenase cofactor biosynthesis are reviewed. Molybdenum biochemistry in A. vinelandii reveals unexpected mechanisms and a new role for iron-sulfur clusters in the sequestration and delivery of molybdenum. PMID:19772354

  1. INCREASING CO2 FROM SUBAMBIENT TO ELEVATED CONCENTRATIONS INCREASES GRASSLAND RESPIRATION PER UNIT OF NET CARBON FIXATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Respiration (carbon efflux) by terrestrial ecosystems is a major component of the global carbon (C) cycle, but the response of C efflux to atmospheric CO2 enrichment remains uncertain. Respiration may respond directly to an increase in the availability of C substrates at high CO2, but also may be a...

  2. Zonal and meridional patterns of phytoplankton biomass and carbon fixation in the Equatorial Pacific Ocean, between 110°W and 140°W

    NASA Astrophysics Data System (ADS)

    Balch, W. M.; Poulton, A. J.; Drapeau, D. T.; Bowler, B. C.; Windecker, L. A.; Booth, E. S.

    2011-03-01

    Primary production (P prim) and calcification (C calc) were measured in the eastern and central Equatorial Pacific during December 2004 and September 2005, between 110°W and 140°W. The design of the field sampling allowed partitioning of P prim and total chlorophyll a (B) between large (>3 ?m) and small (0.45-3 ?m) phytoplankton cells. The station locations allowed discrimination of meridional and zonal patterns. The cruises coincided with a warm El Niño Southern Oscillation (ENSO) phase and ENSO-neutral phase, respectively, which proved to be the major factors relating to the patterns of productivity. Production and biomass of large phytoplankton generally covaried with that of small cells; large cells typically accounted for 20-30% of B and 20% of P prim. Elevated biomass and primary production of all size fractions were highest along the equator as well as at the convergence zone between the North Equatorial Counter Current and the South Equatorial Current. C calc by >0.4 ?m cells was 2-3% of P prim by the same size fraction, for both cruises. Biomass-normalized P prim values were, on average, slightly higher during the warm-phase ENSO period, inconsistent with a "bottom-up" control mechanism (such as nutrient supply). Another source of variability along the equator was Tropical Instability Waves (TIWs). Zonal variance in integrated phytoplankton biomass (along the equator, between 110° and 140°) was almost the same as the meridional variance across it (between 4° N and 4° S). However, the zonal variance in integrated P prim was half the variance observed meridionally. The variance in integrated C calc along the equator was half that seen meridionally during the warm ENSO phase cruise whereas during the ENSO-neutral period, it was identical. No relation could be observed between the patterns of integrated carbon fixation (P prim or C calc) and integrated nutrients (nitrate, ammonium, silicate or dissolved iron). This suggests that the factors controlling integrated P prim or C calc are more complex than a simple bottom-up supply model and likely also will involve a top-down grazer-control component, as well. The carbon fixation within the Equatorial Pacific is well balanced with diatom and coccolithophore production contributing a relatively steady proportion of the total primary production. This maintains a steady balance between organic and inorganic production, relevant to the ballasting of organic matter and the export flux of carbon from this important upwelling region.

  3. Edinburgh Research Explorer Modelling Urban scale Retrofit, Pathways to 2050 Low Carbon

    E-print Network

    Millar, Andrew J.

    Building Stock Citation for published version: Lannon, S, Georgakaki, A & Macdonald, S 2013, 'Modelling Urban scale Retrofit, Pathways to 2050 Low Carbon Residential Building Stock'. in Proceedings of BS2013 BUILDING STOCK. Simon Lannon 1 , Aliki Georgakaki 1 , Stuart Macdonald 2 , 1 Welsh School of Architecture

  4. A single leaf of Camellia oleifera has two types of carbon assimilation pathway, C(3) and crassulacean acid metabolism.

    PubMed

    Yuan, Ming; Xu, Fei; Wang, Shao-Dong; Zhang, Da-Wei; Zhang, Zhong-Wei; Cao, Yang; Xu, Xiao-Chao; Luo, Ming-Hua; Yuan, Shu

    2012-02-01

    The C(4) plants, whose first product of photosynthetic CO(2) fixation is a four-carbon acid, have evolved independently many times. Crassulacean acid metabolism (CAM) is a biological mechanism known to exhibit some C(4) characteristics such as the C(3) cycle during daylight and demonstrates the C(4) cycle at night. There are also various C(3)-CAM intermediates, whose CAM pathway can be induced by environmental changes. However, neither fungus-induced CAM nor Theaceae CAM have been reported previously. Here, we show that CAM could be generated by fungus infection in Camellia oleifera Abel. young leaves, even at a location of a single leaf where the upper part had been transformed into a succulent one, while the lower part remained unchanged. The early photosynthetic products of dark-grown C. oleifera succulent leaves were malate, whereas C. oleifera normal leaves and light-grown succulent leaves incorporated most of (14)C into the primary photosynthetic product 3-phosphoglycerate. Camellia oleifera succulent leaves have a lower absolute ?(13)C value, much lower photorespiration rates and lower transpiration rates during the day than those of C. oleifera normal leaves. Like a typical CAM plant, stomata of C. oleifera succulent leaves closed during the daylight, but opened at night, and therefore had a detectable CO(2) compensation point in darkness. Net photosynthetic rates (P(n)) fluctuated diurnally and similarly with stomatal aperture. No light intensity saturation could be defined for C. oleifera succulent leaves. C(4) key enzymes in C. oleifera succulent leaves were increased at both the transcriptional/translational levels as well as at the enzyme activity level. PMID:22337600

  5. Incomplete Wood-Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi.

    PubMed

    Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L; Feng, Xueyang; Men, Yujie; Conrad, Mark E; Tang, Yinjie J; Alvarez-Cohen, Lisa

    2014-04-29

    The acetyl-CoA "Wood-Ljungdahl" pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood-Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood-Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

  6. Incomplete Wood–Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi

    PubMed Central

    Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L.; Feng, Xueyang; Men, Yujie; Conrad, Mark E.; Tang, Yinjie J.; Alvarez-Cohen, Lisa

    2014-01-01

    The acetyl-CoA “Wood–Ljungdahl” pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood–Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood–Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

  7. NifA- and CooA-Coordinated cowN Expression Sustains Nitrogen Fixation by Rhodobacter capsulatus in the Presence of Carbon Monoxide

    PubMed Central

    Hoffmann, Marie-Christine; Pfänder, Yvonne; Fehringer, Maria; Narberhaus, Franz

    2014-01-01

    Rhodobacter capsulatus fixes atmospheric dinitrogen via two nitrogenases, Mo- and Fe-nitrogenase, which operate under different conditions. Here, we describe the functions in nitrogen fixation and regulation of the rcc00574 (cooA) and rcc00575 (cowN) genes, which are located upstream of the structural genes of Mo-nitrogenase, nifHDK. Disruption of cooA or cowN specifically impaired Mo-nitrogenase-dependent growth at carbon monoxide (CO) concentrations still tolerated by the wild type. The cooA gene was shown to belong to the Mo-nitrogenase regulon, which is exclusively expressed when ammonium is limiting. Its expression was activated by NifA1 and NifA2, the transcriptional activators of nifHDK. AnfA, the transcriptional activator of Fe-nitrogenase genes, repressed cooA, thereby counteracting NifA activation. CooA activated cowN expression in response to increasing CO concentrations. Base substitutions in the presumed CooA binding site located upstream of the cowN transcription start site abolished cowN expression, indicating that cowN regulation by CooA is direct. In conclusion, a transcription factor-based network controls cowN expression to protect Mo-nitrogenase (but not Fe-nitrogenase) under appropriate conditions. PMID:25070737

  8. Selective breakdown of metallic pathways in double-walled carbon nanotube networks.

    PubMed

    Ng, Allen L; Sun, Yong; Powell, Lyndsey; Sun, Chuan-Fu; Chen, Chien-Fu; Lee, Cheng S; Wang, YuHuang

    2015-01-01

    Covalently functionalized, semiconducting double-walled carbon nanotubes exhibit remarkable properties and can outperform their single-walled carbon nanotube counterparts. In order to harness their potential for electronic applications, metallic double-walled carbon nanotubes must be separated from the semiconductors. However, the inner wall is inaccessible to current separation techniques which rely on the surface properties. Here, the first approach to address this challenge through electrical breakdown of metallic double-walled carbon nanotubes, both inner and outer walls, within networks of mixed electronic types is described. The intact semiconductors demonstrate a ?62% retention of the ON-state conductance in thin film transistors in response to covalent functionalization. The selective elimination of the metallic pathways improves the ON/OFF ratio, by more than 360 times, to as high as 40 700, while simultaneously retaining high ON-state conductance. PMID:25180916

  9. Lung Macrophages “Digest” Carbon Nanotubes Using a Superoxide/Peroxynitrite Oxidative Pathway

    PubMed Central

    2015-01-01

    In contrast to short-lived neutrophils, macrophages display persistent presence in the lung of animals after pulmonary exposure to carbon nanotubes. While effective in the clearance of bacterial pathogens and injured host cells, the ability of macrophages to “digest” carbonaceous nanoparticles has not been documented. Here, we used chemical, biochemical, and cell and animal models and demonstrated oxidative biodegradation of oxidatively functionalized single-walled carbon nanotubes via superoxide/NO* ? peroxynitrite-driven oxidative pathways of activated macrophages facilitating clearance of nanoparticles from the lung. PMID:24871084

  10. Histoplasma complement fixation

    MedlinePLUS

    Histoplasma complement fixation is a blood test that checks for infection due to a fungus called Histoplasma capsulatum ( H. ... for Histoplasma antibodies using a laboratory method called complement fixation. This technique checks if your body has ...

  11. Dinitrogen fixation in aphotic oxygenated marine environments

    PubMed Central

    Rahav, Eyal; Bar-Zeev, Edo; Ohayon, Sarah; Elifantz, Hila; Belkin, Natalia; Herut, Barak; Mulholland, Margaret R.; Berman-Frank, Ilana

    2013-01-01

    We measured N2 fixation rates from oceanic zones that have traditionally been ignored as sources of biological N2 fixation; the aphotic, fully oxygenated, nitrate (NO?3)-rich, waters of the oligotrophic Levantine Basin (LB) and the Gulf of Aqaba (GA). N2 fixation rates measured from pelagic aphotic waters to depths up to 720 m, during the mixed and stratified periods, ranged from 0.01 nmol N L?1 d?1 to 0.38 nmol N L?1 d?1. N2 fixation rates correlated significantly with bacterial productivity and heterotrophic diazotrophs were identified from aphotic as well as photic depths. Dissolved free amino acid amendments to whole water from the GA enhanced bacterial productivity by 2–3.5 fold and N2 fixation rates by ~2-fold in samples collected from aphotic depths while in amendments to water from photic depths bacterial productivity increased 2–6 fold while N2 fixation rates increased by a factor of 2 to 4 illustrating that both BP and heterotrophic N2 fixation were carbon limited. Experimental manipulations of aphotic waters from the LB demonstrated a significant positive correlation between transparent exopolymeric particle (TEP) concentrations and N2 fixation rates. This suggests that sinking organic material and high carbon (C): nitrogen (N) micro-environments (such as TEP-based aggregates or marine snow) could support high heterotrophic N2 fixation rates in oxygenated surface waters and in the aphotic zones. Indeed, our calculations show that aphotic N2 fixation accounted for 37 to 75% of the total daily integrated N2 fixation rates at both locations in the Mediterranean and Red Seas with rates equal or greater to those measured from the photic layers. Moreover, our results indicate that that while N2 fixation may be limited in the surface waters, aphotic, pelagic N2 fixation may contribute significantly to new N inputs in other oligotrophic basins, yet it is currently not included in regional or global N budgets. PMID:23986748

  12. Carbon-ion-induced activation of the NF-?B pathway.

    PubMed

    Hellweg, Christine E; Baumstark-Khan, Christa; Schmitz, Claudia; Lau, Patrick; Meier, Matthias M; Testard, Isabelle; Berger, Thomas; Reitz, Günther

    2011-04-01

    Carbon-ion cancer therapy offers several physical and radiobiological advantages over conventional photon cancer therapy. The molecular mechanisms that determine cellular outcome, including the activation of transcription factors and the alteration of gene expression profiles, after carbon-ion exposure are still under investigation. We have previously shown that argon ions (LET 272 keV/µm) had a much higher potential to activate the transcription factor nuclear factor ?B (NF-?B) than X rays. NF-?B is involved in the regulation of cellular survival, mostly by antiapoptosis and cell cycle-regulating target genes, which are important in the resistance of cancer cells to radiotherapy. Therefore, activation of the NF-?B pathway by accelerated carbon ions (LET 33 and 73 keV/µm) was examined. For comparison, cells were exposed to 150 kV X rays and to accelerated carbon ions. NF-?B-dependent gene induction after exposure was detected in stably transfected human 293 reporter cells. Carbon ions and X rays had a comparable potential to activate NF-?B in human cells, indicating a comparable usefulness of pharmacological NF-?B inhibition during photon and carbon-ion radiotherapy. PMID:21222514

  13. Integrated carbon dioxide/sludge gasification using waste heat from hot slags: syngas production and sulfur dioxide fixation.

    PubMed

    Sun, Yongqi; Zhang, Zuotai; Liu, Lili; Wang, Xidong

    2015-04-01

    The integrated CO2/sludge gasification using the waste heat in hot slags, was explored with the aim of syngas production, waste heat recovery and sewage sludge disposal. The results demonstrated that hot slags presented multiple roles on sludge gasification, i.e., not only a good heat carrier (500-950 °C) but also an effective desulfurizer (800-900 °C). The total gas yields increased from 0.022 kg/kgsludge at 500 °C to 0.422 kg/kgsludge at 900 °C; meanwhile, the SO2 concentration at 900 °C remarkably reduced from 164 ppm to 114 ppm by blast furnace slags (BFS) and 93 ppm by steel slags (SS), respectively. A three-stage reaction was clarified including volatile release, char transformation and fixed carbon using Gaussian fittings and the kinetic model was analyzed. Accordingly, a decline process using the integrated method was designed and the optimum slag/sludge ratio was deduced. These deciphered results appealed potential ways of reasonable disposal of sewage sludge and efficient recovery of waste heat from hot slags. PMID:25647028

  14. Fixation strength of taper connection at head-neck junction in retrieved carbon fiber-reinforced PEEK hip stems.

    PubMed

    Nakahara, Ichiro; Takao, Masaki; Bandoh, Shunichi; Sugano, Nobuhiko

    2014-12-01

    Carbon fiber-reinforced polyetheretherketone (CFR-PEEK) hip prostheses possess numerous advantages over metal prostheses; however, the security of the taper connection between the CFR-PEEK stem and the modular femoral head in vivo has not been verified. Therefore, we mechanically examined the taper connection of retrieved in vivo loaded CFR-PEEK stems in comparison with in vivo loaded titanium alloy stems. CFR-PEEK and titanium alloy femoral stems with a 12/14 taper trunnion were implanted in ovine hips. A 22-mm ceramic head was intraoperatively impacted to the stem. Retrieved specimens were obtained following weight-bearing conditions for up to 39 postoperative weeks and taper junction pull-off tests were conducted. Postoperative retrieved CFR-PEEK stem pull-off strength was significantly greater than that at time zero. Postoperative retrieved CFR-PEEK stem pull-off strength was also significantly higher than that of postoperative retrieved titanium alloy stem. Microscopic findings of the taper surface revealed no obvious damage in the retrieved CFR-PEEK stems, whereas fretting and corrosion were observed in the retrieved titanium alloy stems. The present findings suggest that the taper connection between the ceramic head and the 12/14 CFR-PEEK stem trunnion is more secure than that between the ceramic head and the titanium alloy trunnion. PMID:25190272

  15. Autotrophic Methanotrophy in Verrucomicrobia: Methylacidiphilum fumariolicumSolV Uses the Calvin-Benson-Bassham Cycle for Carbon Dioxide Fixation ? †

    PubMed Central

    Khadem, Ahmad F.; Pol, Arjan; Wieczorek, Adam; Mohammadi, Seyed S.; Francoijs, Kees-Jan; Stunnenberg, Henk G.; Jetten, Mike S. M.; Op den Camp, Huub J. M.

    2011-01-01

    Genome data of the extreme acidophilic verrucomicrobial methanotroph Methylacidiphilum fumariolicumstrain SolV indicated the ability of autotrophic growth. This was further validated by transcriptome analysis, which showed that all genes required for a functional Calvin-Benson-Bassham (CBB) cycle were transcribed. Experiments with 13CH4or 13CO2in batch and chemostat cultures demonstrated that CO2is the sole carbon source for growth of strain SolV. In the presence of CH4, CO2concentrations in the headspace below 1% (vol/vol) were growth limiting, and no growth was observed when CO2concentrations were below 0.3% (vol/vol). The activity of the key enzyme of the CBB cycle, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), measured with a 13C stable-isotope method was about 70 nmol CO2fixed · min?1· mg of protein?1. An immune reaction with antibody against the large subunit of RuBisCO on Western blots was found only in the supernatant fractions of cell extracts. The apparent native mass of the RuBisCO complex in strain SolV was about 482 kDa, probably consisting of 8 large (53-kDa) and 8 small (16-kDa) subunits. Based on phylogenetic analysis of the corresponding RuBisCO gene, we postulate that RuBisCO of the verrucomicrobial methanotrophs represents a new type of form I RuBisCO. PMID:21725016

  16. Catalytic ozonation of sulphamethoxazole in the presence of carbon materials: catalytic performance and reaction pathways.

    PubMed

    Gonçalves, Alexandra G; Órfão, José J M; Pereira, Manuel Fernando R

    2012-11-15

    Two carbon materials (multi-walled carbon nanotubes, MWCNTs, and activated carbon) were investigated as ozonation catalysts for the mineralization of the antibiotic sulphamethoxazole (SMX). MWCNTs presented a higher catalytic performance than activated carbons, which was justified by their differences in surface chemistry and by the higher internal mass transfer resistances expected for activated carbons. 3-Amino-5-methylisoxazole and p-benzoquinone were detected as primary products of single and catalytic ozonation of SMX, whereas oxamic, oxalic, pyruvic and maleic acids were identified as refractory final oxidation products. The original sulphur of the SMX was almost completely converted to sulphate and part of the nitrogen was converted to NH4+ and NO3-. The presence of the radical scavenger tert-butanol during catalytic and single ozonation evidenced the participation of HO radicals in the oxidation mechanisms of SMX, especially in the mineralization of several intermediates. Microtox tests revealed that simultaneous use of ozone and MWCNTs originated lower acute toxicity. The time course of all detected compounds was studied and the transformation pathway for the complete mineralization of SMX by single and catalytic ozonation in the presence of the selected materials was elucidated. PMID:23009796

  17. Photoluminescence saturation independent of excitation pathway in air-suspended single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Xiao, Yee-fang; Anderson, Mitchell D.; Fraser, James M.

    2014-06-01

    Photoluminescence (PL) spectroscopy is a useful probe of excitonic interactions in optically excited nanostructures. Under intense optical excitation, the diffusion-annihilation of excitons in single-walled carbon nanotubes (SWCNTs) results in strong nonlinear PL. This behavior has been observed in a number of samples and has, until recently, been believed to be independent of excitation pathway. Contrary to this assumption, recent studies show that nonlinear PL in encapsulated SWCNTs, excited resonant to E22, is not dominated by diffusion-annihilation but instead by laser induced quenching sites. In this paper, we show that, unlike encapsulated SWCNTs, air-suspended SWCNT PL saturation is independent of excitation pathway, validating the use of a diffusion model for excitons generated via E22 excitation. In addition, we show that the diffusion of excitons in air-suspended SWCNTs is independent of atmospheric adsorbates, strengthening the assertion that in this system exciton diffusion is intrinsic and not disorder limited.

  18. Engineering a synthetic pathway in cyanobacteria for isopropanol production directly from carbon dioxide and light.

    PubMed

    Kusakabe, Tamami; Tatsuke, Tsuneyuki; Tsuruno, Keigo; Hirokawa, Yasutaka; Atsumi, Shota; Liao, James C; Hanai, Taizo

    2013-11-01

    Production of alternate fuels or chemicals directly from solar energy and carbon dioxide using engineered cyanobacteria is an attractive method to reduce petroleum dependency and minimize carbon emissions. Here, we constructed a synthetic pathway composed of acetyl-CoA acetyl transferase (encoded by thl), acetoacetyl-CoA transferase (encoded by atoAD), acetoacetate decarboxylase (encoded by adc) and secondary alcohol dehydrogenase (encoded by adh) in Synechococcus elongatus strain PCC 7942 to produce isopropanol. The enzyme-coding genes, heterogeneously originating from Clostridium acetobutylicum ATCC 824 (thl and adc), Escherichia coli K-12 MG1655 (atoAD) and Clostridium beijerinckii (adh), were integrated into the S. elongatus genome. Under the optimized production conditions, the engineered cyanobacteria produced 26.5 mg/L of isopropanol after 9 days. PMID:24076145

  19. Methanotrophy Induces Nitrogen Fixation in Boreal Mosses

    NASA Astrophysics Data System (ADS)

    Tiirola, M. A.

    2014-12-01

    Many methanotrophic bacterial groups fix nitrogen in laboratory conditions. Furthermore, nitrogen (N) is a limiting nutrient in many environments where methane concentrations are highest. Despite these facts, methane-induced N fixation has previously been overlooked, possibly due to methodological problems. To study the possible link between methanotrophy and diazotrophy in terrestrial and aquatic habitats, we measured the co-occurrence of these two processes in boreal forest, peatland and stream mosses using a stable isotope labeling approach (15 N2 and 13 CH4 double labeling) and sequencing of the nifH gene marker. N fixation associated with forest mosses was dependent on the annual N deposition, whereas methane stimulate N fixation neither in high (>3 kg N ha -1 yr -1) nor low deposition areas, which was in accordance with the nifH gene sequencing showing that forest mosses (Pleurozium schreberi and Hylocomium splendens ) carried mainly cyanobacterial N fixers. On the other extreme, in stream mosses (Fontinalis sp.) methane was actively oxidized throughout the year, whereas N fixation showed seasonal fluctuation. The co-occurrence of the two processes in single cell level was proven by co-localizing both N and methane-carbon fixation with the secondary ion mass spectrometry (SIMS) approach. Methanotrophy and diazotrophy was also studied in peatlands of different primary successional stages in the land-uplift coast of Bothnian Bay, in the Siikajoki chronosequence, where N accumulation rates in peat profiles indicate significant N fixation. Based on experimental evidence it was counted that methane-induced N fixation explained over one-third of the new N input in the younger peatland successional stages, where the highest N fixation rates and highest methane oxidation activities co-occurred in the water-submerged Sphagnum moss vegetation. The linkage between methanotrophic carbon cycling and N fixation may therefore constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. It is still an open issue whether methanotrophy induces N fixation directly or by enhancing phototrophic or heterotrophic N fixation.

  20. Amino Acid Biosynthesis Pathways in Diatoms

    PubMed Central

    Bromke, Mariusz A.

    2013-01-01

    Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

  1. Methylamine Utilization via the N-Methylglutamate Pathway in Methylobacterium extorquens PA1 Involves a Novel Flow of Carbon through C1 Assimilation and Dissimilation Pathways

    PubMed Central

    Nayak, Dipti D.

    2014-01-01

    Methylotrophs grow on reduced single-carbon compounds like methylamine as the sole source of carbon and energy. In Methylobacterium extorquens AM1, the best-studied aerobic methylotroph, a periplasmic methylamine dehydrogenase that catalyzes the primary oxidation of methylamine to formaldehyde has been examined in great detail. However, recent metagenomic data from natural ecosystems are revealing the abundance and importance of lesser-known routes, such as the N-methylglutamate pathway, for methylamine oxidation. In this study, we used M. extorquens PA1, a strain that is closely related to M. extorquens AM1 but is lacking methylamine dehydrogenase, to dissect the genetics and physiology of the ecologically relevant N-methylglutamate pathway for methylamine oxidation. Phenotypic analyses of mutants with null mutations in genes encoding enzymes of the N-methylglutamate pathway suggested that ?-glutamylmethylamide synthetase is essential for growth on methylamine as a carbon source but not as a nitrogen source. Furthermore, analysis of M. extorquens PA1 mutants with defects in methylotrophy-specific dissimilatory and assimilatory modules suggested that methylamine use via the N-methylglutamate pathway requires the tetrahydromethanopterin (H4MPT)-dependent formaldehyde oxidation pathway but not a complete tetrahydrofolate (H4F)-dependent formate assimilation pathway. Additionally, we present genetic evidence that formaldehyde-activating enzyme (FAE) homologs might be involved in methylotrophy. Null mutants of FAE and homologs revealed that FAE and FAE2 influence the growth rate and FAE3 influences the yield during the growth of M. extorquens PA1 on methylamine. PMID:25225269

  2. A Central Role for Carbon-Overflow Pathways in the Modulation of Bacterial Cell Death

    PubMed Central

    Thomas, Vinai Chittezham; Sadykov, Marat R.; Chaudhari, Sujata S.; Jones, Joselyn; Endres, Jennifer L.; Widhelm, Todd J.; Ahn, Jong-Sam; Jawa, Randeep S.; Zimmerman, Matthew C.; Bayles, Kenneth W.

    2014-01-01

    Similar to developmental programs in eukaryotes, the death of a subpopulation of cells is thought to benefit bacterial biofilm development. However mechanisms that mediate a tight control over cell death are not clearly understood at the population level. Here we reveal that CidR dependent pyruvate oxidase (CidC) and ?-acetolactate synthase/decarboxylase (AlsSD) overflow metabolic pathways, which are active during staphylococcal biofilm development, modulate cell death to achieve optimal biofilm biomass. Whereas acetate derived from CidC activity potentiates cell death in cells by a mechanism dependent on intracellular acidification and respiratory inhibition, AlsSD activity effectively counters CidC action by diverting carbon flux towards neutral rather than acidic byproducts and consuming intracellular protons in the process. Furthermore, the physiological features that accompany metabolic activation of cell death bears remarkable similarities to hallmarks of eukaryotic programmed cell death, including the generation of reactive oxygen species and DNA damage. Finally, we demonstrate that the metabolic modulation of cell death not only affects biofilm development but also biofilm-dependent disease outcomes. Given the ubiquity of such carbon overflow pathways in diverse bacterial species, we propose that the metabolic control of cell death may be a fundamental feature of prokaryotic development. PMID:24945831

  3. Effect of transketolase modifications on carbon flow to the purine-nucleotide pathway in Corynebacterium ammoniagenes.

    PubMed

    Kamada, N; Yasuhara, A; Takano, Y; Nakano, T; Ikeda, M

    2001-09-01

    Transketolase, one of the enzymes in the nonoxidative branch of the pentose phosphate pathway, operates to shuttle ribose 5-phosphate and glycolytic intermediates together with transaldolase, and might be involved in the availability of ribose 5-phosphate, a precursor of nucleotide biosynthesis. The tkt and tal genes encoding transketolase and transaldolase, respectively, were cloned from the typical nucleotide- and nucleoside-producing organism Corynebacterium ammoniagenes by a PCR approach using oligonucleotide primers derived from conserved regions of each amino acid sequence from other organisms. Enzymatic and molecular analyses revealed that the two genes were clustered on the genome together with the glucose 6-phosphate dehydrogenase gene (zwf). The effect of transketolase modifications on the production of inosine and 5'-xanthylic acid was investigated in industrial strains of C. ammoniagenes. Multiple copies of plasmid-borne tkt caused about tenfold increases in transketolase activity and resulted in 10-20% decreased yields of products relative to the parents. In contrast, site-specific disruption of tkt enabled both producers to accumulate 10-30% more products concurrently with a complete loss of transketolase activity and the expected phenotype of shikimate auxotrophy. These results indicate that transketolase normally shunts ribose 5-phosphate back into glycolysis in these biosynthetic processes and interception of this shunt allows cells to redirect carbon flux through the oxidative pentose pathway from the intermediate towards the purine-nucleotide pathway. PMID:11601619

  4. Appearance and accumulation of C/sub 4/ carbon pathway enzymes in developing wheat leaves

    SciTech Connect

    Aoyagi, K.; Bassham, J.A.

    1986-02-01

    Soluble protein has been extracted from sections of wheat leaves, from base to tip, and the content of several key enzymes of photosynthetic carbon assimilation in each section has been determined by the protein blot method. In the first leaf, ribulose 1,5-bisphosphate carboxylase (RuBPC) (EC 4.1.1.39) in the basal 0 to 1 centimeter section is about 12% the level in the tip section, whereas phosphoenolpyruvate carboxylase (EC 4.1.1.31) is present in small amounts in the basal section and does not change much in the tip. Pyruvate orthophosphate dikinase (PPDK) (EC 2.7.9.1) first appears in the 4 to 6 centimeter section and increases gradually with development to 10-fold in the tip. Malic enzyme, NADP-dependent (EC 1.3.1.37) also appears in the 4 to 6 centimeter section but remains low to the tip. Fixation of /sup 14/CO/sub 2/ by wheat leaf base sections resulted in 42% of total incorporation into malate and aspartate, indicating ..beta..-carboxylation, whereas in the tip section these labeled compounds were only 8% of the total. Although the amount of PPDK in wheat leaves is only 1 to 3% of that in maize leaves, this C/sub 3/ PPDK may have a limited role in photosynthesis leading to formation of C/sub 4/ compounds. The possibility of a further role, similar to that in C/sub 4/ plants, but for intracellular carbon transport in wheat leaves is discussed. The presence of malic dehydrogenase, NADP-specific (EC 1.1.1.82) in wheat leaf chloroplasts was shown, a necessary though not sufficient condition for such a proposed role. Assuming each of the four enzymes associated with C/sub 4/ carbon transport were fully active in vivo during photosynthesis, PPDK would still be rate limiting, even in the leaf tip where its activity is maximal. Possible evolutionary and breeding implications are discussed.

  5. 13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose

    PubMed Central

    Jouhten, Paula; Pitkänen, Esa; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Maaheimo, Hannu

    2009-01-01

    Background The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions and the utilization of the respirative pathway has not been investigated on the level of in vivo fluxes. Results The biosynthetic pathways of amino acids in T. reesei supported by genome-level evidence were reconstructed with computational carbon path analysis. The pathway reconstructions were a prerequisite for analysis of in vivo fluxes. The distribution of in vivo fluxes in both wild type strain and cre1, a key regulator of carbon catabolite repression, deletion strain were quantitatively studied by performing 13C-labeling on both repressive carbon source glucose and non-repressive carbon source sorbitol. In addition, the 13C-labeling on sorbitol was performed both in the presence and absence of sophorose that induces the expression of cellulase genes. Carbon path analyses and the 13C-labeling patterns of proteinogenic amino acids indicated high similarity between biosynthetic pathways of amino acids in T. reesei and yeast Saccharomyces cerevisiae. In contrast to S. cerevisiae, however, mitochondrial rather than cytosolic biosynthesis of Asp was observed under all studied conditions. The relative anaplerotic flux to the TCA cycle was low and thus characteristic to respiratory metabolism in both strains and independent of the carbon source. Only minor differences were observed in the flux distributions of the wild type and cre1 deletion strain. Furthermore, the induction of the hydrolytic gene expression did not show altered flux distributions and did not affect the relative amino acid requirements or relative anabolic and respirative activities of the TCA cycle. Conclusion High similarity between the biosynthetic pathways of amino acids in T. reesei and yeast S. cerevisiae was concluded. In vivo flux distributions confirmed that T. reesei uses primarily the respirative pathway also when growing on the repressive carbon source glucose in contrast to Saccharomyces cerevisiae, which substantially diminishes the respirative pathway flux under glucose repression. PMID:19874611

  6. Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria

    SciTech Connect

    Ferry, J.G.

    1991-12-31

    Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

  7. Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria

    SciTech Connect

    Ferry, J.G.

    1991-01-01

    Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

  8. Carbon and chlorine isotope analysis to identify abiotic degradation pathways of 1,1,1-trichloroethane.

    PubMed

    Palau, Jordi; Shouakar-Stash, Orfan; Hunkeler, Daniel

    2014-12-16

    This study investigates dual C-Cl isotope fractionation during 1,1,1-TCA transformation by heat-activated persulfate (PS), hydrolysis/dehydrohalogenation (HY/DH) and Fe(0). Compound-specific chlorine isotope analysis of 1,1,1-TCA was performed for the first time, and transformation-associated isotope fractionation ? bulk C and ? bulk Cl values were -4.0 ± 0.2‰ and no chlorine isotope fractionation with PS, -1.6 ± 0.2‰ and -4.7 ± 0.1‰ for HY/DH, -7.8 ± 0.4‰ and -5.2 ± 0.2‰ with Fe(0). Distinctly different dual isotope slopes (??13C/??37Cl): ? with PS, 0.33 ± 0.04 for HY/DH and 1.5 ± 0.1 with Fe(0) highlight the potential of this approach to identify abiotic degradation pathways of 1,1,1-TCA in the field. The trend observed with PS agreed with a C-H bond oxidation mechanism in the first reaction step. For HY/DH and Fe(0) pathways, different slopes were obtained although both pathways involve cleavage of a C-Cl bond in their initial reaction step. In contrast to the expected larger primary carbon isotope effects relative to chlorine for C-Cl bond cleavage, ? bulk C < ? bulk Cl was observed for HY/DH and in a similar range for reduction by Fe(0), suggesting the contribution of secondary chlorine isotope effects. Therefore, different magnitude of secondary chlorine isotope effects could at least be partly responsible for the distinct slopes between HY/DH and Fe(0) pathways. Following this dual isotope approach, abiotic transformation processes can unambiguously be identified and quantified. PMID:25379605

  9. Guide to radiation fixatives

    SciTech Connect

    Tawil, J.J.; Bold, F.C.

    1983-11-01

    This report identifies and then characterizes a variety of substances available in the market place for potential effectiveness as a fixative on radiologically contaminated surfaces. The substances include both generic chemicals and proprietary products. In selecting a fixative for a particular application, several attributes of the fixative may be relevant to the choice. These attributes include: toxicity, durability, and cleanliness and removability. In addition to the attributes of the fixative, one should also take into account certain characteristics of the site to be treated. These characteristics relate to climate, nature of the surface, use to which the treated surface will be put, subsequent cleanup operations, and type of neighboring surfaces. Finally, costs and potential environmental effects may influence the decision. A variety of fixatives are evaluated with respect to these various attributes and summarized in a reference table.

  10. Investigation of inter-individual variability of the one-carbon folate pathway: a bioinformatic and genetic review

    Microsoft Academic Search

    D F Carr; G Whiteley; A Alfirevic; M Pirmohamed

    2009-01-01

    Genetic polymorphisms in the one-carbon folate pathway have been widely studied in association with a number of conditions. Most of the research has focused on the 677C>T polymorphism in the coding region of the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene. However, there are a total of 25 genes in this pathway coding for enzymes, transporters and receptors, which can be investigated using

  11. Characterization and role of carbonic anhydrase in the calcification process of the azooxanthellate coral Tubastrea aurea

    Microsoft Academic Search

    Sylvie Tambutté; Eric Tambutté; Didier Zoccola; Natacha Caminiti; Severine Lotto; Aurélie Moya; Denis Allemand; Jess Adkins

    2007-01-01

    In zooxanthellate corals, the photosynthetic fixation of carbon dioxide and the precipitation of CaCO3 are intimately linked both spatially and temporally making it difficult to study carbon transport mechanisms involved in each\\u000a pathway. When studying Tubastrea aurea, a coral devoid of zooxanthellae, we can focus on carbon transport mechanisms involved only in the calcification process.\\u000a We performed this study to

  12. The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast

    SciTech Connect

    Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

    2007-08-08

    The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates.

  13. Effects of carbon dioxide and oxygen on the regulation of photosynthetic carbon metabolism by ammonia in spinach mesophyll cells

    SciTech Connect

    Lawyer, A.L.; Cornwell, K.L.; Larsen, P.O.; Bassham, J.A.

    1981-01-01

    Photosynthetic carbon metabolism of isolated spinach mesophyll cells was characterized under conditions favoring photorespiratory (PR; 0.04% CO/sub 2/ and 20% O/sub 2/) and nonphotorespiratory (NPR; 0.2% CO/sub 2/ and 2% O/sub 2/) metabolism, as well as intermediate conditions. Comparisons were made between the metabolic effects of extracellularly supplied NH/sub 4//sup +/ and intracellular NH/sub 4//sup +/, produced primarily via PR metabolism. The metabolic effects of /sup 14/CO/sub 2/ fixation under PR conditions were similar to perturbations of photosynthetic metabolism brought about by externally supplied NH/sub 4//sup +/; both increased labeling and intracellular concentrations of glutamine at the expense of glutamate and increased anaplerotic synthesis through ..cap alpha..-ketoglutarate. The metabolic effects of added NH/sub 4//sup +/ during NPR fixation were greater than those during PR fixation, presumably due to lower initial NH/sub 4//sup +/ levels during NPR fixation. During PR fixation, addition of ammonia caused decreased pools and labeling of glutamate and serine and increased glycolate, glyoxylate, and glycine labeling. The glycolate pathway was thus affected by increased rates of carbon flow and decreased glutamate availability for glyoxylate transamination, resulting in increased usage of serine for transamination. Sucrose labeling decreased with NH/sub 4//sup +/ addition only during PR fixation, suggesting that higher photosynthetic rates under NPR conditions can accommodate the increased drain of carbon toward amino acid synthesis while maintaining sucrose synthesis.

  14. Tight coupling of root-associated nitrogen fixation and plant photosynthesis in the salt marsh Spartina alterniflora and carbon dioxide enhancement of Nitrogenase activity

    SciTech Connect

    Whiting, G.J.; Gandy, E.L.; Yoch, D.C.

    1986-07-01

    The coupling of root-associated nitrogen fixation and plant photosynthesis was examined in the salt marsh grass Spartina alterniflora. In both field experiments and hydroponic assay chambers, nitrogen fixation associated with the roots was rapidly enhanced by stimulating plant photosynthesis. A kinetic analysis of acetylene reduction activity (ARA) showed that a five-to-sixfold stimulation occurred within 10 to 60 min after the plant leaves were exposed to light or increase CO/sub 2/ concentrations (with the light held constant). In field experiments, CO/sub 2/ enrichment increased plant-associated ARA by 27%. Further evidence of the dependence of ARA on plant photosynthate was obtained when activity in excised roots was shown to decrease after young greenhouse plants were placed in the dark. Seasonal variation in the ARA of excised plant roots from field cores appears to be related to the annual cycle of net photosynthesis in S. alterniflora.

  15. C1 Metabolism in Corynebacterium glutamicum: an Endogenous Pathway for Oxidation of Methanol to Carbon Dioxide

    PubMed Central

    Witthoff, Sabrina; Mühlroth, Alice

    2013-01-01

    Methanol is considered an interesting carbon source in “bio-based” microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert 13C-labeled methanol to 13CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

  16. C1 metabolism in Corynebacterium glutamicum: an endogenous pathway for oxidation of methanol to carbon dioxide.

    PubMed

    Witthoff, Sabrina; Mühlroth, Alice; Marienhagen, Jan; Bott, Michael

    2013-11-01

    Methanol is considered an interesting carbon source in "bio-based" microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert (13)C-labeled methanol to (13)CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

  17. Energy transfer pathways in semiconducting carbon nanotubes revealed using two-dimensional white-light spectroscopy.

    PubMed

    Mehlenbacher, Randy D; McDonough, Thomas J; Grechko, Maksim; Wu, Meng-Yin; Arnold, Michael S; Zanni, Martin T

    2015-01-01

    Thin film networks of highly purified semiconducting carbon nanotubes (CNTs) are being explored for energy harvesting and optoelectronic devices because of their exceptional transport and optical properties. The nanotubes in these films are in close contact, which permits energy to flow through the films, although the pathways and mechanisms for energy transfer are largely unknown. Here we use a broadband continuum to collect femtosecond two-dimensional white-light spectra. The continuum spans 500 to 1,300?nm, resolving energy transfer between all combinations of bandgap (S1) and higher (S2) transitions. We observe ultrafast energy redistribution on the S2 states, non-Förster energy transfer on the S1 states and anti-correlated energy levels. The two-dimensional spectra reveal competing pathways for energy transfer, with S2 excitons taking routes depending on the bandgap separation, whereas S1 excitons relax independent of the bandgap. These observations provide a basis for understanding and ultimately controlling the photophysics of energy flow in CNT-based devices. PMID:25865487

  18. Modulation of Apoptotic Pathways of Macrophages by Surface-Functionalized Multi-Walled Carbon Nanotubes

    PubMed Central

    Jiang, Yuanqin; Zhang, Honggang; Wang, Yange; Chen, Min; Ye, Shefang; Hou, Zhenqing; Ren, Lei

    2013-01-01

    Biomedical applications of carbon nanotubes (CNTs) often involve improving their hydrophilicity and dispersion in biological media by modifying them through noncovalent or covalent functionalization. However, the potential adverse effects of surface-functionalized CNTs have not been well characterized. In this study, we functionalized multi-walled CNTs (MWCNTs) via carboxylation, to produce MWCNTs-COOH, and via poly (ethylene glycol) linking, to produce MWCNTs-PEG. We used these functionalized MWCNTs to study the effect of surface functionalization on MWCNTs-induced toxicity to macrophages, and elucidate the underlying mechanisms of action. Our results revealed that MWCNTs-PEG were less cytotoxic and were associated with less apoptotic cell death of macrophages than MWCNTs-COOH. Additionally, MWCNTs-PEG induced less generation of reactive oxygen species (ROS) involving less activation of NADPH oxidase compared with MWCNTs-COOH, as evidenced by membrane translocation of p47phox and p67phox in macrophages. The less cytotoxic and apoptotic effect of MWCNTs-PEG compared with MWCNTs-COOH resulted from the lower cellular uptake of MWCNTs-PEG, which resulted in less activation of oxidative stress-responsive pathways, such as p38 mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-?B. These results demonstrate that surface functionalization of CNTs may alter ROS-mediated cytotoxic and apoptotic response by modulating apoptotic signaling pathways. Our study thus provides new insights into the molecular basis for the surface properties affecting CNTs toxicity. PMID:23755279

  19. Energy transfer pathways in semiconducting carbon nanotubes revealed using two-dimensional white-light spectroscopy

    NASA Astrophysics Data System (ADS)

    Mehlenbacher, Randy D.; McDonough, Thomas J.; Grechko, Maksim; Wu, Meng-Yin; Arnold, Michael S.; Zanni, Martin T.

    2015-04-01

    Thin film networks of highly purified semiconducting carbon nanotubes (CNTs) are being explored for energy harvesting and optoelectronic devices because of their exceptional transport and optical properties. The nanotubes in these films are in close contact, which permits energy to flow through the films, although the pathways and mechanisms for energy transfer are largely unknown. Here we use a broadband continuum to collect femtosecond two-dimensional white-light spectra. The continuum spans 500 to 1,300 nm, resolving energy transfer between all combinations of bandgap (S1) and higher (S2) transitions. We observe ultrafast energy redistribution on the S2 states, non-Förster energy transfer on the S1 states and anti-correlated energy levels. The two-dimensional spectra reveal competing pathways for energy transfer, with S2 excitons taking routes depending on the bandgap separation, whereas S1 excitons relax independent of the bandgap. These observations provide a basis for understanding and ultimately controlling the photophysics of energy flow in CNT-based devices.

  20. Photographic fixative poisoning

    MedlinePLUS

    Photographic developer poisoning; Hydroquinone poisoning; Quinone poisoning; Sulfite poisoning ... Hydroquinones Quinones Sodium thiosulfate Sodium sulfite/bisulfite Boric acid Photographic fixative can also break down (decompose) to form sulfur ...

  1. Temporal and Spatial Deployment of Carbon Dioxide Capture and Storage Technologies across the Representative Concentration Pathways

    SciTech Connect

    Dooley, James J.; Calvin, Katherine V.

    2011-04-18

    The Intergovernmental Panel on Climate Change’s (IPCC) Fifth Assessment (to be published in 2013-2014) will to a significant degree be built around four Representative Concentration Pathways (RCPs) that are intended to represent four scenarios of future development of greenhouse gas emissions, land use, and concentrations that span the widest range of potential future atmospheric radiative forcing. Under the very stringent climate policy implied by the 2.6 W/m2 overshoot scenario, all electricity is eventually generated from low carbon sources. However, carbon dioxide capture and storage (CCS) technologies never comprise more than 50% of total electricity generation in that very stringent scenario or in any of the other cases examined here. There are significant differences among the cases studied here in terms of how CCS technologies are used, with the most prominent being is the significant expansion of biomass+CCS as the stringency of the implied climate policy increases. Cumulative CO2 storage across the three cases that imply binding greenhouse gas constraints ranges by nearly an order of magnitude from 170GtCO2 (radiative forcing of 6.0W/m2 in 2100) to 1600GtCO2 (2.6W/m2 in 2100) over the course of this century. This potential demand for deep geologic CO2 storage is well within published estimates of total global CO2 storage capacity.

  2. Constraining pathways of microbial mediation for carbonate concretions of the Miocene Monterey Formation using carbonate-associated sulfate

    NASA Astrophysics Data System (ADS)

    Loyd, Sean J.; Berelson, William M.; Lyons, Timothy W.; Hammond, Douglas E.; Corsetti, Frank A.

    2012-02-01

    Carbonate concretions can form as a result of organic matter degradation within sediments. However, the ability to determine specific processes and timing relationships to particular concretions has remained elusive. Previously employed proxies (e.g., carbon and oxygen isotopes) cannot uniquely distinguish among diagenetic alkalinity sources generated by microbial oxidation of organic matter using oxygen, nitrate, metal oxides, and sulfate as electron acceptors, in addition to degradation by thermal decarboxylation. Here, we employ concentrations of carbonate-associated sulfate (CAS) and ? 34S CAS (along with more traditional approaches) to determine the specific nature of concretion authigenesis within the Miocene Monterey Formation. Integrated geochemical analyses reveal that at least three specific organo-diagenetic reaction pathways can be tied to concretion formation and that these reactions are largely sample-site specific. One calcitic concretion from the Phosphatic Shale Member at Naples Beach yields ? 34S CAS values near Miocene seawater sulfate (˜+22‰ VCDT), abundant CAS (ca. 1000 ppm), depleted ? 13C carb (˜-11‰ VPDB), and very low concentrations of Fe (ca. 700 ppm) and Mn (ca. 15 ppm)—characteristics most consistent with shallow formation in association with organic matter degradation by nitrate, iron-oxides and/or minor sulfate reduction. Cemented concretionary layers of the Phosphatic Shale Member at Shell Beach display elevated ? 34S CAS (up to ˜+37‰), CAS concentrations of ˜600 ppm, mildly depleted ? 13C carb (˜-6‰), moderate amounts of Mn (ca. 250 ppm), and relatively low Fe (ca. 1700 ppm), indicative of formation in sediments dominated by sulfate reduction. Finally, concretions within a siliceous host at Montaña de Oro and Naples Beach show minimal CAS concentrations, positive ? 13C values, and the highest concentrations of Fe (ca. 11,300 ppm) and Mn (ca. 440 ppm), consistent with formation in sediments experiencing methanogenesis in a highly reducing environment. This study highlights the promise in combining CAS analysis with more traditional techniques to differentiate among diagenetic reactions as preserved in the geologic record and shows potential for unraveling subsurface biospheric processes in ancient samples with a high degree of specificity.

  3. Oxidation state, bioavailability & biochemical pathway define the fate of carbon in soil

    NASA Astrophysics Data System (ADS)

    Kuzyakov, Yakov; Apostel, Carolin; Gunina, Anna; Herrmann, Anke M.; Dippold, Michaela

    2015-04-01

    Numerous experiments under laboratory and field conditions analyzed microbial utilization and mean residence time (MRT) of carbon (C) from plant and microbial residues as well as root exudates in soil. Most of these studies tested the effects of various environmental factors, such as temperature, soil moisture, texture etc. on these parameters. However, only a few studies compared the properties of the substances themselves and there is no conceptual framework based on biochemical pathways. We hypothesize that the fate of C from organic substances in soil strongly depends on the first step of their microbial utilization, specifically, on biochemical pathway and initial C oxidation state, as well as its bioavailability in soils, defined by its hydrophobicity and molecular weight. Here we introduce and evaluate a new conceptual framework based on the following parameters: 1) C oxidation state, 2) molecular weight and hydrophobicity, 3) initial biochemical pathway of a substance class in microbial cells. To assess these parameters, two databases were prepared based on the literature and own studies. The first database included only the studies with 14C or 13C position specific labeled sugars, amino acids, carboxylic acids, phenols and lipids in soil. This database allowed us to analyze microbial utilization and mineralization of organics to CO2 depending on their C oxidation state (OS) and on functional groups. Additionally, we calculated data on the bond electronegativity of all compounds investigated in these studies. The second data base included the results of 14C and 13C studies with uniformly labeled substances of various classes. This database considered the free enthalpie (Delta H) per C unit from a variety of substrates differing in their aromaticity, hydrophobicity/electronegativity and location of the substance on the van Krevelen diagram. In addition, we calculated the hydrophobicity from the electronegativity of the individual bonds and recorded their molecular weight in our databases. For both data bases the decomposition rates and the MRT of C remaining in soil were calculated by the double first-order kinetics and related to the four parameter groups. The first database showed high correlation of mineralization rates to CO2 with the C oxidation state and biochemical pathway. Carboxyl group (OS = +3) was split at first from the skeleton of nearly all substances. In contrast, the methyl group (OS = -3) was mineralized as the slowest and after incorporation into microbial cells remained the longest period in soil. This general pattern reflects a clear preferential oxidation of already highly oxidized, polar functional groups. The initial use of substances within glucolysis (e.g. sugars) lead to a higher portion of remaining C in soil compared to C introduced via citric acid cycle (e.g. carboxylic acids). Concerning substance groups, the mineralization rates were the fastest for amino acids and sugars and the slowest for of the lipids - corresponding to their molecular weight and hydropobicity. This corresponded well with localization of the substance classes on the van Krevelen diagram. Generally, high oxidation state of the initial substance and consequently its low free enthalpy content lead to faster decomposition. In contrast, low oxidation state (e.g. lipids, aromatics) corresponds to high hydrophobicity and so, slow uptake from soil solution and utilization within microbial cells. Consequently, the optimum for microbial biomass utilization in soil and use for anabolic processes is common for sugars that have the oxidation state close to 0, have medium energy content and are hydrophilic. We conclude that from the tested substance properties, the oxidation state and biochemical pathway explained well the initial fate of C in soil, i.e. its mineralization to CO2 and incorporation into microbial biomass. Because the first step and microbial cycling are crucial for its further transformations, the same criteria are pivotal for C stabilization in soil.

  4. Integrated carboxylic carbon nanotube pathways with membranes for voltage-activated humidity detection and microclimate regulation.

    PubMed

    Pingitore, V; Miriello, D; Drioli, E; Gugliuzza, A

    2015-05-27

    This work describes some single walled carboxylic carbon nanotubes with outstanding transport properties when assembled in a 3D microarray working like a humidity membrane-sensor and an adjustable moisture regulator. Combined nano-assembly approaches are used to build up a better quality pathway through which assisted-charge and mass transport synchronically takes place. The structure-electrical response relationship is found, while controllable and tunable donor-acceptor interactions established at material interfaces are regarded as key factors for the accomplishment of charge transportation, enhanced electrical responses and adjustable moisture exchange. Raman and infrared spectroscopy provides indications about the fine structural and chemical features of the hybrid-composite membranes, resulting in perfect agreement with related morphology and electrical properties. Enhanced and modular electrical response to changes in the surrounding atmosphere is concerned with doping events, while assisted moisture regulation is discussed in relation to swelling and hopping actions. The electro-activated hybrid-composite membrane proposed in this work can be regarded as an attractive 'sense-to-act' precursor for smart long-distance monitoring systems with capability to adapt itself and provide local comfortable microenvironments. PMID:25939404

  5. The coupling of glycolysis and the Rubisco-based pathway through the non-oxidative pentose phosphate pathway to achieve low carbon dioxide emission fermentation.

    PubMed

    Li, Ya-Han; Ou-Yang, Fan-Yu; Yang, Cheng-Han; Li, Si-Yu

    2015-07-01

    In this study, Rubisco-based engineered Escherichia coli, containing two heterologous enzymes of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) and phosphoribulokinase (PrkA), has been shown to be capable of the in situ recycling of carbon dioxide (CO2) during glycolysis. Two alternative approaches have been proposed to further enhance the carbon flow from glycolysis to a Rubisco-based pathway through the non-oxidative pentose phosphate pathway (NOPPP). The first is achieved by elevating the expression of transketolase I (TktA) and the second by blocking the native oxidation-decarboxylation reaction of E. coli by deleting the zwf gene from the chromosome (designated as JB/pTA and MZB, respectively). Decreases in the CO2 yield and the CO2 evolution per unit mole of ethanol production by at least 81% and 40% are observed. It is demonstrated in this study that the production of one mole of ethanol using E. coli strain MZB, the upper limit of CO2 emission is 0.052mol. PMID:25846189

  6. Update: Biological Nitrogen Fixation.

    ERIC Educational Resources Information Center

    Wiseman, Alan; And Others

    1985-01-01

    Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,…

  7. The Fixation of Nitrogen.

    ERIC Educational Resources Information Center

    Andrew, S. P. S.

    1978-01-01

    Discusses the fixation of atmospheric nitrogen in the form of ammonia as one of the foundations of modern chemical industry. The article describes ammonia production and synthesis, purifying the hydrogen-nitrogen mix, nitric acid production, and its commericial plant. (HM)

  8. Transport of dissolved organic carbon from soil to surface water: Identifying the transport pathways

    NASA Astrophysics Data System (ADS)

    Van Gaelen, Nele

    2013-04-01

    Over the last decades, increasing concentrations of dissolved organic carbon (DOC) have been found in surface waters. It has also become clear that land use is an important driver for DOC export. However, causal factors controlling this temporal and spatial variation are not clear. Efforts to model DOC export on a catchment scale are rare. In this research, we aim to determine the factors controlling variations in DOC concentration and quality in surface waters. Secondly, the importance of the different pathways (surface runoff, subsurface flow and groundwater flow) for the transport of dissolved organic matter from the soil to the surface water is investigated. Six headwater catchments (100 - 400 ha) were selected in Belgium, representing three different types of land use, namely forest, grassland and arable land. At the outlet of each catchment, a flow-proportional sampler has been collecting samples of base flow and peak discharge since January 2010. In addition, samples of groundwater, subsurface water and precipitation water were collected on a regular base in three of the catchments. Samples were analyzed for DOC, specific UV absorbance (SUVA) and dissolved silica (DSi). Elemental analysis was carried out using ICP-OES. Since 2012, precipitation water and a selection of river water samples was also analyzed for O and H isotopes. Overall, DOC concentrations were highest in forest catchments and lowest in grassland catchments. For all land use types, measured DOC concentrations were highest during peak discharge. The rise in DOC concentrations was associated with a change in DOC quality. During periods of greater discharge, higher SUVA values were measured, indicating DOC with higher aromaticity (humic and fulvic fractions) reaches the outlet. ICP and DSi results also showed a significant difference in geochemical composition of the river water if peak events are compared to base flow samples. During an event, Ca, Mg, Na, S and DSi concentrations were lowered, while K concentrations rose. Isotope analysis showed more heavy O an H isotopes during peak events than during baseflow. Results of the river water were combined with analysis of possible end-members in the catchments, using the groundwater, soil water and precipitation samples. An end-member-mixing-analysis (EMMA) gained more insight into the contributing pathways for the transport of organic matter from the soil to the surface water during base and peak flow. Furthermore, results from the different catchments were compared, and allowed to relate DOC transport to land use type. This is an important step towards a model describing DOC transport at the catchment scale.

  9. Synthetic Pathway for Production of Five-Carbon Alcohols from Isopentenyl Diphosphate

    PubMed Central

    Chou, Howard H.

    2012-01-01

    Synthetic biological pathways could enhance the development of novel processes to produce chemicals from renewable resources. On the basis of models that describe the evolution of metabolic pathways and enzymes in nature, we developed a framework to rationally identify enzymes able to catalyze reactions on new substrates that overcomes one of the major bottlenecks in the assembly of a synthetic biological pathway. We verified the framework by implementing a pathway with two novel enzymatic reactions to convert isopentenyl diphosphate into 3-methyl-3-butenol, 3-methyl-2-butenol, and 3-methylbutanol. To overcome competition with native pathways that share the same substrate, we engineered two bifunctional enzymes that redirect metabolic flux toward the synthetic pathway. Taken together, our work demonstrates a new approach to the engineering of novel synthetic pathways in the cell. PMID:22941086

  10. Elementary Flux Mode Analysis Revealed Cyclization Pathway as a Powerful Way for NADPH Regeneration of Central Carbon Metabolism

    PubMed Central

    Shen, Tie; Zheng, Meijuan; Zhou, Wenwei; Du, Honglin; Fan, Yadong; Wang, Yongkang; Zhang, Zhengdong; Xu, Shengsheng; Liu, Zhijie; Wen, Han; Xie, Xiaoyao

    2015-01-01

    NADPH regeneration capacity is attracting growing research attention due to its important role in resisting oxidative stress. Besides, NADPH availability has been regarded as a limiting factor in production of industrially valuable compounds. The central carbon metabolism carries the carbon skeleton flux supporting the operation of NADPH-regenerating enzyme and offers flexibility in coping with NADPH demand for varied intracellular environment. To acquire an insightful understanding of its NADPH regeneration capacity, the elementary mode method was employed to compute all elementary flux modes (EFMs) of a network representative of central carbon metabolism. Based on the metabolic flux distributions of these modes, a cluster analysis of EFMs with high NADPH regeneration rate was conducted using the self-organizing map clustering algorithm. The clustering results were used to study the relationship between the flux of total NADPH regeneration and the flux in each NADPH producing enzyme. The results identified several reaction combinations supporting high NADPH regeneration, which are proven to be feasible in cells via thermodynamic analysis and coincident with a great deal of previous experimental report. Meanwhile, the reaction combinations showed some common characteristics: there were one or two decarboxylation oxidation reactions in the combinations that produced NADPH and the combination constitution included certain gluconeogenesis pathways. These findings suggested cyclization pathways as a powerful way for NADPH regeneration capacity of bacterial central carbon metabolism. PMID:26086807

  11. Genetic variation in the one carbon transfer pathway and ovarian cancer risk

    PubMed Central

    Kelemen, Linda E; Sellers, Thomas A; Schildkraut, Joellen M; Cunningham, Julie M; Vierkant, Robert A; Pankratz, V Shane; Fredericksen, Zachary S; Gadre, Madhura K; Rider, David N; Liebow, Mark; Goode, Ellen L

    2009-01-01

    Dysfunction in enzymes involved in one carbon (1-C) metabolism can lead to increased chromosomal strand breaking and abnormal methylation patterns; both are associated with cancer risk. Availability of 1-C units may modify risk. We investigated the association of single nucleotide polymorphisms (SNPs) in 21 genes in the 1-C metabolism pathway among 829 Caucasian cases with primary epithelial ovarian cancer (EOC) and 941 frequency-matched unaffected controls enrolled at Mayo Clinic, Rochester, MN and Duke University, Durham, NC, and examined risk modification by multivitamin supplement use. Multivariable-adjusted SNP-specific logistic regression and haplotype analyses were performed for 180 SNPs and false positive report probabilities (FPRP) were calculated. Each additional copy of the minor allele in the intronic SNP SHMT1 rs9909104 was associated with EOC [odds ratio (OR), 1.2; confidence interval (95% CI), 1.0–1.4; P trend = 0.02; FPRP 0.16] and a 5-SNP SHMT1 haplotype was associated with decreased risk [P = 0.01; FPRP 0.09]. Three SNPs in DNMT3A were associated with risk among multivitamin supplement users: rs13420827 [OR, 0.8; 95% CI, 0.6–1.0; P interaction = 0.006; FPRP 0.54], rs11887120 [OR, 0.8; 95% CI, 0.7–1.0; P interaction = 0.007; FPRP 0.57] and rs11695471 [OR, 1.2; 95% CI, 1.0–1.5; P interaction = 0.01; FPRP 0.66]. These data extend previous findings from other cancers of a role for SHMT1 in ovarian cancer, and provide evidence that SNPs in methylation and DNA synthesis reactions are associated with risk of ovarian cancer. Interventions with modifiable factors such as multivitamin intake may reduce risk. PMID:18381459

  12. A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime

    NASA Technical Reports Server (NTRS)

    Carr, Mary-Elena

    1998-01-01

    A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

  13. Synthetic non-oxidative glycolysis enables complete carbon conservation.

    PubMed

    Bogorad, Igor W; Lin, Tzu-Shyang; Liao, James C

    2013-10-31

    Glycolysis, or its variations, is a fundamental metabolic pathway in life that functions in almost all organisms to decompose external or intracellular sugars. The pathway involves the partial oxidation and splitting of sugars to pyruvate, which in turn is decarboxylated to produce acetyl-coenzyme A (CoA) for various biosynthetic purposes. The decarboxylation of pyruvate loses a carbon equivalent, and limits the theoretical carbon yield to only two moles of two-carbon (C2) metabolites per mole of hexose. This native route is a major source of carbon loss in biorefining and microbial carbon metabolism. Here we design and construct a non-oxidative, cyclic pathway that allows the production of stoichiometric amounts of C2 metabolites from hexose, pentose and triose phosphates without carbon loss. We tested this pathway, termed non-oxidative glycolysis (NOG), in vitro and in vivo in Escherichia coli. NOG enables complete carbon conservation in sugar catabolism to acetyl-CoA, and can be used in conjunction with CO2 fixation and other one-carbon (C1) assimilation pathways to achieve a 100% carbon yield to desirable fuels and chemicals. PMID:24077099

  14. A batch study on the bio-fixation of carbon dioxide in the absorbed solution from a chemical wet scrubber by hot spring and marine algae.

    PubMed

    Hsueh, H T; Chu, H; Yu, S T

    2007-01-01

    Carbon dioxide mass transfer is a key factor in cultivating micro-algae except for the light limitation of photosynthesis. It is a novel idea to enhance mass transfer with the cyclic procedure of absorbing CO(2) with a high performance alkaline abosorber such as a packed tower and regenerating the alkaline solution with algal photosynthesis. Hence, the algae with high affinity for alkaline condition must be purified. In this study, a hot spring alga (HSA) was purified from an alkaline hot spring (pH 9.3, 62 degrees C) in Taiwan and grows well over pH 11.5 and 50 degrees C. For performance of HSA, CO(2) removal efficiencies in the packed tower increase about 5-fold in a suitable growth condition compared to that without adding any potassium hydroxide. But ammonia solution was not a good choice for this system with regard to carbon dioxide removal efficiency because of its toxicity on HSA. In addition, HSA also exhibits a high growth rate under the controlled pHs from 7 to 11. Besides, a well mass balance of carbon and nitrogen made sure that less other byproducts formed in the procedure of carboxylation. For analysis of some metals in HSA, such as Mg, Mn, Fe, Zn, related to the photosynthesis increased by a rising cultivated pH and revealed that those metals might be accumulated under alkaline conditions but the growth rate was still limited by the ratio of bicarbonate (useful carbon source) and carbonate. Meanwhile, Nannochlopsis oculta (NAO) was also tested under different additional carbon sources. The results revealed that solutions of sodium/potassium carbonate are better carbon sources than ammonia carbonate/bicarbonate for the growth of NAO. However, pH 9.6 of growth limitation based on sodium was lower than one of HSA. The integrated system is, therefore, more feasible to treat CO(2) in the flue gases using the algae with higher alkaline affinity such as HSA in small volume bioreactors. PMID:16860839

  15. Novel posterior fixation keratoprosthesis

    NASA Astrophysics Data System (ADS)

    Lacombe, Emmanuel

    1992-08-01

    The keratoprosthesis is the last solution for corneally blind patients that cannot benefit from corneal transplants. Keratoprostheses that have been designed to be affixed anteriorly usually necessitate multi-step surgical procedures and are continuously subjected to the extrusion forces generated by the positive intraocular pressure; therefore, clinical results in patients prove inconsistent. We proposed a novel keratoprosthesis concept that utilizes posterior corneal fixation which `a priori' minimizes the risk of aqueous leakage and expulsion. This prosthesis is implanted in a single procedure thereby reducing the number of surgical complications normally associated with anterior fixation devices. In addition, its novel design makes this keratoprosthesis implantable in phakic eyes. With an average follow-up of 13 months (range 3 to 25 months), our results on 21 cases are encouraging. Half of the keratoprostheses were implanted in severe burn cases, with the remainder in cases of pseudo- pemphigus. Good visual results and cosmetic appearance were obtained in 14 of 21 eyes.

  16. Mineralization pathways in lake sediments with different oxygen and organic carbon supply

    E-print Network

    Wehrli, Bernhard

    in the global carbon cycle. The extent of organic matter (OM) mineralization and preservation in marine that lakes may play a significant role in the global carbon cycle at a decadal timescale. In analogy

  17. Elevated carbon dioxide ameliorates the eects of ozone on photosynthesis and growth: species respond similarly regardless of photosynthetic pathway or plant functional group

    Microsoft Academic Search

    JOHN C. V OLIN; P ETER B. R EICH; THOMAS J. G IVNISH

    summary Due to their dierent physiological eects, elevated carbon dioxide and elevated ozone might have interactive impacts on plants, and dierentially so on plants diering in photosynthetic pathway and growth rate. To test several hypotheses related to these issues, we examined the physiological, morphological and growth responses of six perennial species grown at various atmospheric concentrations of carbon dioxide and

  18. Multifactor dimensionality reduction analysis to elucidate the cross-talk between one-carbon and xenobiotic metabolic pathways in multi-disease models.

    PubMed

    Naushad, Shaik Mohammad; Vijayalakshmi, Sana Venkata; Rupasree, Yedluri; Kumudini, Nadella; Sowganthika, Sampathkumar; Naidu, Janardhanan Venketlakshmi; Ramaiah, M Janaki; Rao, Dunna Nageswara; Kutala, Vijay Kumar

    2015-07-01

    Putatively functional polymorphisms of one-carbon and xenobiotic metabolic pathways influence susceptibility for wide spectrum of diseases. The current study was aimed to explore gene-gene interactions among these two metabolic pathways in four diseases i.e. breast cancer, systemic lupus erythematosus (SLE), coronary artery disease (CAD) and Parkinson's disease (PD). Multifactor dimensionality reduction analysis was carried out on four case-control datasets. Cross-talk was observed between one-carbon and xenobiotic pathways in breast cancer (RFC 80 G>A, COMT H108L and TYMS 5'-UTR 28 bp tandem repeat) and SLE (CYP1A1 m1, MTRR 66 A>G and GSTT1). Gene-gene interactions within one-carbon metabolic pathway were observed in CAD (GCPII 1561 C>T, SHMT 1420 C>T and MTHFR 677 C>T) and PD (cSHMT 1420 C>T, MTRR 66 A>G and RFC1 80 G>A). These interaction models showed good predictability of risk for PD (The area under the receiver operating characteristic curve (C) = 0.83) and SLE (C = 0.73); and moderate predictability of risk for breast cancer (C = 0.64) and CAD (C = 0.63). Cross-talk between one-carbon and xenobiotic pathways was observed in diseases with female preponderance. Gene-gene interactions within one-carbon metabolic pathway were observed in diseases with male preponderance. PMID:25648260

  19. Microbial fixation of CO2 in water bodies and in drylands to combat climate change, soil loss and desertification.

    PubMed

    Rossi, Federico; Olguín, Eugenia J; Diels, Ludo; De Philippis, Roberto

    2015-01-25

    The growing concern for the increase of the global warming effects due to anthropogenic activities raises the challenge of finding novel technological approaches to stabilize CO2 emissions in the atmosphere and counteract impinging interconnected issues such as desertification and loss of biodiversity. Biological-CO2 mitigation, triggered through biological fixation, is considered a promising and eco-sustainable method, mostly owing to its downstream benefits that can be exploited. Microorganisms such as cyanobacteria, green algae and some autotrophic bacteria could potentially fix CO2 more efficiently than higher plants, due to their faster growth. Some examples of the potential of biological-CO2 mitigation are reported and discussed in this paper. In arid and semiarid environments, soil carbon sequestration (CO2 fixation) by cyanobacteria and biological soil crusts is considered an eco-friendly and natural process to increase soil C content and a viable pathway to soil restoration after one disturbance event. Another way for biological-CO2 mitigation intensively studied in the last few years is related to the possibility to perform carbon dioxide sequestration using microalgae, obtaining at the same time bioproducts of industrial interest. Another possibility under study is the exploitation of specific chemotrophic bacteria, such as Ralstonia eutropha (or picketii) and related organisms, for CO2 fixation coupled with the production chemicals such as polyhydroxyalkanoates (PHAs). In spite of the potential of these processes, multiple factors still have to be optimized for maximum rate of CO2 fixation by these microorganisms. The optimization of culture conditions, including the optimal concentration of CO2 in the provided gas, the use of metabolic engineering and of dual purpose systems for the treatment of wastewater and production of biofuels and high value products within a biorefinery concept, the design of photobioreactors in the case of phototrophs are some of the issues that, among others, have to be addressed and tested for cost-effective CO2 sequestration. PMID:24355428

  20. Fixation of CO2 by chrysotile in low-pressure dry and moist carbonation: Ex-situ and in-situ characterizations

    E-print Network

    Long, Bernard

    amorphisation, formation of periclase, brucite, and hydromagnesite crystalline phases, and surface passivation. On the basis of chrysotile fresh N2 BET area, nearly 15 atoms out of 100 of the surface chrysotile brucitic Mg. % of the total brucitic Mg moiety in chrysotile. The carbon- ation of brucite (Mg(OH)2) impurities coexisting

  1. A Dynamic Pathway for Stone-Wales Bond Rotation on Carbon Nanotubes through Diamond-Like Bonds

    NASA Technical Reports Server (NTRS)

    Wei, Chen-Yu; Srivastava, Deepak; Cho, Kyeong-Jae; Menon, Madhu

    2003-01-01

    A new lower energy barrier with a two-step pathway of Stone-Wales (SW) ,ond rotation on carbon nanotubes (CNTs) is found through molecular dynamics (MD) simulations of CNTs under tension. The first step involves going over to a stable sp3-like metastable configuration with half rotated and partially tilted C-C bond. The second step involves going over to the fully rotated C-C bond with the formation of a SW defect in the nanotube. The energy barrier for this two-step dynamic pathway is significantly lower than the previously known static barrier for in-plane rotation of the C-C bond on a tensile strained (> 4%) CNT.

  2. Absorbable biologically based internal fixation.

    PubMed

    Ibrahim, Ahmed M S; Koolen, Pieter G L; Kim, Kuylhee; Perrone, Gabe S; Kaplan, David L; Lin, Samuel J

    2015-01-01

    Absorbable devices for use in internal fixation have advanced over the years to become reliable and cost-effective alternatives to metallic hardware. In the past, biodegradable fixation involved a laborious implantation process, and induced osteolysis and inflammatory reactions. Modern iterations exhibit increased strength, smoother resorption, and lower rates of reactivity. A newer generation manufactured from silk has emerged that may address existing limitations and provide a greater range of fixation applications. PMID:25440418

  3. Photosynthesis in Ceratophyllum demersum . Carbon fixation rates in relation to the plants' physiological stage, and the contents of chlorophylland non-structural carbohydrates

    Microsoft Academic Search

    Elly P. H. Best

    1979-01-01

    Summary  Since the role of the submerged aquatic macrophytes in the carbon cycle of lake Vechten (the Netherlands) is in study, attention is paid to several aspects of their productivity.Ceratophyllum demersum is a predominant macrophytic species in the littoral zone of this lake, occurring mainly from three to five metres depth.\\u000aIn situ measurements of its photosynthetic rate demonstrated a maximum

  4. Historical and future anthropogenic emission pathways derived from coupled climate–carbon cycle simulations

    Microsoft Academic Search

    Erich Roeckner; M. A. Giorgetta; T. Crueger; M. Esch; Julia Pongratz

    2011-01-01

    Using a coupled climate–carbon cycle model, fossil fuel carbon dioxide (CO2) emissions are derived through a reverse approach of prescribing atmospheric CO2 concentrations according to observations and future projections, respectively. In the second half of the twentieth century,\\u000a the implied fossil fuel emissions, and also the carbon uptake by land and ocean, are within the range of observational estimates.\\u000a Larger

  5. Pathways and Mechanisms of OceanTracer Transport: Implications for Carbon Sequestration

    SciTech Connect

    Marshall, John; Follows, MIchael

    2006-11-06

    This funding enabled the following published manuscripts in which we have developed models of direct relevance to ocean carbon sequestration and of the oceanic iron cycle, its connection to the global carbon cycle, and the sensitivity of atmospheric carbon dioxide to the external source of iron. As part of this process we have developed the adjoint of the MIT ocean biogeochemistry model which has enabled us to perform rigorous and efficient sensitivity studies.

  6. Regulation of Autotrophic CO2 Fixation in the Archaeon Thermoproteus neutrophilus? †

    PubMed Central

    Ramos-Vera, W. Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

    2010-01-01

    Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO2 fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes. PMID:20693323

  7. Nitrogen fixation apparatus

    DOEpatents

    Chen, Hao-Lin (Walnut Creek, CA)

    1984-01-01

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

  8. Alterations in hepatic one-carbon metabolism and related pathways following a high-fat dietary intervention.

    PubMed

    Rubio-Aliaga, Isabel; Roos, Baukje de; Sailer, Manuela; McLoughlin, Gerard A; Boekschoten, Mark V; van Erk, Marjan; Bachmair, Eva-Maria; van Schothorst, Evert M; Keijer, Jaap; Coort, Susan L; Evelo, Chris; Gibney, Michael J; Daniel, Hannelore; Muller, Michael; Kleemann, Robert; Brennan, Lorraine

    2011-04-27

    Obesity frequently leads to insulin resistance and the development of hepatic steatosis. To characterize the molecular changes that promote hepatic steatosis, transcriptomics, proteomics, and metabolomics technologies were applied to liver samples from C57BL/6J mice obtained from two independent intervention trials. After 12 wk of high-fat feeding the animals became obese, hyperglycemic, and insulin resistant, had elevated levels of blood cholesterol and VLDL, and developed hepatic steatosis. Nutrigenomic analysis revealed alterations of key metabolites and enzyme transcript levels of hepatic one-carbon metabolism and related pathways. The hepatic oxidative capacity and the lipid milieu were significantly altered, which may play a key role in the development of insulin resistance. Additionally, high choline levels were observed after the high-fat diet. Previous studies have linked choline levels with insulin resistance and hepatic steatosis in conjunction with changes of certain metabolites and enzyme levels of one-carbon metabolism. The present results suggest that the coupling of high levels of choline and low levels of methionine plays an important role in the development of insulin resistance and liver steatosis. In conclusion, the complexities of the alterations induced by high-fat feeding are multifactorial, indicating that the interplay between several metabolic pathways is responsible for the pathological consequences. PMID:21303933

  9. Molybdenum limitation of asymbiotic nitrogen fixation in tropical forest soils

    NASA Astrophysics Data System (ADS)

    Barron, Alexander R.; Wurzburger, Nina; Bellenger, Jean Phillipe; Wright, S. Joseph; Kraepiel, Anne M. L.; Hedin, Lars O.

    2009-01-01

    Nitrogen fixation, the biological conversion of di-nitrogen to plant-available ammonium, is the primary natural input of nitrogen to ecosystems, and influences plant growth and carbon exchange at local to global scales. The role of this process in tropical forests is of particular concern, as these ecosystems harbour abundant nitrogen-fixing organisms and represent one third of terrestrial primary production. Here we show that the micronutrient molybdenum, a cofactor in the nitrogen-fixing enzyme nitrogenase, limits nitrogen fixation by free-living heterotrophic bacteria in soils of lowland Panamanian forests. We measured the fixation response to long-term nutrient manipulations in intact forests, and to short-term manipulations in soil microcosms. Nitrogen fixation increased sharply in treatments of molybdenum alone, in micronutrient treatments that included molybdenum by design and in treatments with commercial phosphorus fertilizer, in which molybdenum was a `hidden' contaminant. Fixation did not respond to additions of phosphorus that were not contaminated by molybdenum. Our findings show that molybdenum alone can limit asymbiotic nitrogen fixation in tropical forests and raise new questions about the role of molybdenum and phosphorus in the tropical nitrogen cycle. We suggest that molybdenum limitation may be common in highly weathered acidic soils, and may constrain the ability of some forests to acquire new nitrogen in response to CO2 fertilization.

  10. Variation in moss-associated nitrogen fixation in boreal forest stands.

    PubMed

    Markham, John H

    2009-08-01

    Traditionally it has been thought that most boreal forest communities lack a significant input of biologically fixed nitrogen. Recent discoveries of nitrogen fixation by cyanobacteria associated with mosses have resulted in a re-evaluation of this view. While it is recognized that rates of nitrogen fixation in mosses can be highly variable, there is little understanding as to why this occurs. I monitored nitrogen fixation, using acetylene reduction, in wet lowland and dry upland boreal forest communities, in central Canada, over a growing season. At the peak of nitrogen fixation in mid summer, Sphagnum capillifolium had an 11 times higher rate of fixation than Pleurozium schreberi. Variation in canopy openness and precipitation had no effect on rates of fixation over the growing season. In P. schreberi fixation rates did not vary between sites. Temperature had a positive effect on fixation rates in both S. capillifolium and P. schreberi, but the effect was 4 times more pronounced in S. capillifolium. Seasonal rates of nitrogen fixation were estimated at 193 mg N m(-2) for S. capillifolium and 23 mg N m(-2) for P. schreberi. With moderate increases in climate warming, predicted increases in nitrogen fixation in S. capillifolium are sufficient to raise its decomposition rate. Increased temperatures may therefore act synergistically to change boreal systems from a sink to a source of carbon. PMID:19543750

  11. Eighth international congress on nitrogen fixation

    SciTech Connect

    Not Available

    1990-01-01

    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  12. Effect of multiple mutations in tricarboxylic acid cycle and one-carbon metabolism pathways on Edwardsiella ictaluri pathogenesis.

    PubMed

    Dahal, N; Abdelhamed, H; Lu, J; Karsi, A; Lawrence, M L

    2014-02-21

    Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of catfish (ESC). We have shown recently that tricarboxylic acid cycle (TCA) and one-carbon (C1) metabolism are involved in E. ictaluri pathogenesis. However, the effect of multiple mutations in these pathways is unknown. Here, we report four novel E. ictaluri mutants carrying double gene mutations in TCA cycle (Ei?mdh?sdhC, Ei?frdA?sdhC), C1 metabolism (Ei?glyA?gcvP), and both TCA and C1 metabolism pathways (Ei?gcvP?sdhC). In-frame gene deletions were constructed by allelic exchange and mutants' virulence and vaccine efficacy were evaluated using in vivo bioluminescence imaging (BLI) as well as end point mortality counts in catfish fingerlings. Results indicated that all the double gene mutants were attenuated compared to wild-type (wt) E. ictaluri. There was a 1.39-fold average reduction in bioluminescence, and hence bacterial numbers, from all the mutants except for Ei?frdA?sdhC at 144 h post-infection. Vaccination with mutants was very effective in protecting channel catfish against subsequent infection with virulent E. ictaluri 93-146 strain. In particular, immersion vaccination resulted in complete protection. Our results provide further evidence on the importance of TCA and C1 metabolism pathways in bacterial pathogenesis. PMID:24418045

  13. Carbon-dependent control of electron transfer and central carbon pathway genes for methane biosynthesis in the Archaean, Methanosarcina acetivorans strain C2A

    PubMed Central

    2010-01-01

    Background The archaeon, Methanosarcina acetivorans strain C2A forms methane, a potent greenhouse gas, from a variety of one-carbon substrates and acetate. Whereas the biochemical pathways leading to methane formation are well understood, little is known about the expression of the many of the genes that encode proteins needed for carbon flow, electron transfer and/or energy conservation. Quantitative transcript analysis was performed on twenty gene clusters encompassing over one hundred genes in M. acetivorans that encode enzymes/proteins with known or potential roles in substrate conversion to methane. Results The expression of many seemingly "redundant" genes/gene clusters establish substrate dependent control of approximately seventy genes for methane production by the pathways for methanol and acetate utilization. These include genes for soluble-type and membrane-type heterodisulfide reductases (hdr), hydrogenases including genes for a vht-type F420 non-reducing hydrogenase, molybdenum-type (fmd) as well as tungsten-type (fwd) formylmethanofuran dehydrogenases, genes for rnf and mrp-type electron transfer complexes, for acetate uptake, plus multiple genes for aha- and atp-type ATP synthesis complexes. Analysis of promoters for seven gene clusters reveal UTR leaders of 51-137 nucleotides in length, raising the possibility of both transcriptional and translational levels of control. Conclusions The above findings establish the differential and coordinated expression of two major gene families in M. acetivorans in response to carbon/energy supply. Furthermore, the quantitative mRNA measurements demonstrate the dynamic range for modulating transcript abundance. Since many of these gene clusters in M. acetivorans are also present in other Methanosarcina species including M. mazei, and in M. barkeri, these findings provide a basis for predicting related control in these environmentally significant methanogens. PMID:20178638

  14. DINITROGEN FIXATION IN ILLINOIS BUNDLEFLOWER

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Illinois bundleflower [Desmanthus illinoensis (Michx.) MacMillan] is a warm-season perennial forage legume that may serve as a pulse crop. Its productivity is influenced by its N2 fixation capability. Our objective was to estimate symbiotic N2 fixation of three Illinois bundleflower accessions from ...

  15. Overdesign of external fixation systems.

    PubMed

    Habboushe, M P

    1992-05-01

    This article reviews 850 cases of open fractures of the extremities caused by high velocity missiles and shell fragments, and treated by two varieties of external fixation devices. If a protocol for grading the severity of injury is followed, the results encourage avoiding sophisticated, expensive, and overdesigned external fixation systems. PMID:1589355

  16. Surgical rib fixation - technical aspects.

    PubMed

    Marasco, Silvana; Saxena, Pankaj

    2015-05-01

    Surgical rib fixation (SRF) for severe rib fracture injuries is increasingly becoming an accepted treatment modality. There is now adequate evidence in randomised controlled trials that rib fixation in flail chest patients reduces ventilator times, intensive care stay and costs of treatment in ventilator dependent patients [1-3]. Despite this, rib fixation has not become standard of care for these patients and remains a treatment modality practised by few centres, usually those with large trauma loads who see high volumes of severe rib fracture injury patients. The purpose of this article is to outline the available prostheses, indications, operative planning and techniques of rib fixation. Surgical approaches to rib fractures in anterior, lateral and posterior positions are described as are the use of currently available cortical and medullary fixation prostheses. PMID:25624272

  17. Effect of transketolase modifications on carbon flow to the purine-nucleotide pathway in Corynebacterium ammoniagenes

    Microsoft Academic Search

    N. Kamada; A. Yasuhara; Y. Takano; T. Nakano; M. Ikeda

    2001-01-01

    Transketolase, one of the enzymes in the nonoxidative branch of the pentose phosphate pathway, operates to shuttle ribose 5-phosphate and glycolytic intermediates together with transaldolase, and might be involved in the availability of ribose 5-phosphate, a precursor of nucleotide biosynthesis. The tkt and tal genes encoding transketolase and transaldolase, respectively, were cloned from the typical nucleotide- and nucleoside-producing organism Corynebacterium

  18. Calcium Isotope Signature of Amorphous Calcium Carbonate: A Probe of Crystallization Pathway? (Invited)

    Microsoft Academic Search

    A. C. Gagnon; D. J. Depaolo; J. J. Deyoreo

    2010-01-01

    Stable isotope fractionation is sensitive to the energy landscape of nucleation and growth. Thus isotope ratios represent a promising tool to understand the chemical mechanisms controlling precipitation in geological systems. To realize this potential we must (1) determine the isotopic fractionation associated with different growth pathways, (2) use these isotopic constraints to test nucleation or growth mechanism, and (3) compare

  19. CO(2) fixation through hydrogenation by chemical or enzymatic methods.

    PubMed

    Beller, Matthias; Bornscheuer, Uwe T

    2014-04-25

    Two birds with one stone: The simulaneous fixation of the greenhouse gas carbon dioxide and storage of the alternative fuel hydrogen can be accomplished with the formation of formic acid. In principle, this is now possible either with an enzymatic system based on a newly discovered bacterial hydrogen-dependent carbon dioxide reductase or by using organometallic catalysts at room temperature and ambient pressure. PMID:24706361

  20. Failure of posterior titanium atlantoaxial cable fixation

    Microsoft Academic Search

    Rolando Garcia; Stephen Gorin

    2003-01-01

    Background context: The operative treatment of rotatory atlantoaxial instability remains controversial. The use of cable fixation has largely replaced the use of wire for interlaminar fixation. Although cable fixation offers biomechanical advantages over wire fixation, it is still at risk of fatigue failure. The authors were unable to locate any published reports of fatigue failure of titanium cables in the

  1. Carbon isotopic composition of individual Precambrian microfossils

    NASA Technical Reports Server (NTRS)

    House, C. H.; Schopf, J. W.; McKeegan, K. D.; Coath, C. D.; Harrison, T. M.; Stetter, K. O.

    2000-01-01

    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

  2. Carbon isotopic composition of individual Precambrian microfossils

    NASA Astrophysics Data System (ADS)

    House, Christopher H.; Schopf, J. William; McKeegan, Kevin D.; Coath, Christopher D.; Harrison, T. Mark; Stetter, Karl O.

    2000-08-01

    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the ˜850 Ma Bitter Springs Formation, Australia, and the ˜2100 Ma Gunflint Formation, Canada. The ?13CPDB values from individual microfossils of the Bitter Springs Formation ranged from -21.3 ± 1.7‰ to -31.9 ± 1.2‰, and the ?13CPDB values from microfossils of the Gunflint Formation ranged from -32.4 ± 0.7‰ to -45.4 ± 1.2‰. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

  3. Pathways and transformations of dissolved methane and dissolved inorganic carbon in Arctic tundra soils: Evidence from analysis of stable isotopes

    NASA Astrophysics Data System (ADS)

    Throckmorton, H.; Perkins, G.; Muss, J. D.; Smith, L. J.; Conrad, M. E.; Torn, M. S.; Heikoop, J. M.; Newman, B. D.; Wilson, C. J.; Wullschleger, S. D.

    2014-12-01

    Arctic soils contain a large pool of terrestrial C and are of great interest because of their potential for releasing significant amounts of carbon dioxide (CO2) and methane (CH4) to the atmosphere. Few attempts have been made, however, to derive quantitative budgets of CO2 and CH4 budgets for high-latitude ecosystems. Therefore, this study used naturally occurring geochemical and isotopic tracers to estimate production pathways and transformations of dissolved inorganic carbon (DIC = ? (total) dissolved CO2) and dissolved CH4 in soil pore waters from 17 locations (drainages) in Barrow, Alaska (USA) in July and September, 2013; and to approximate a complete balance of belowground C cycling at our sampling locations. Results suggest that CH4 was primarily derived from biogenic acetate fermentation, with a shift at 4 locations from July to September towards CO2 reduction as the dominant methanogenic pathway. A large majority of CH4 produced at the frost table methane was transferred directly to the atmosphere via plant roots and ebullition (94.0 ± 1.4% and 96.6 ± 5.0% in July and September). A considerable fraction of the remaining CH4 was oxidized to CO2 during upward diffusion in July and September, respectively. Methane oxidization produced <1% of CO2 relative to alternative production mechanisms in deep subsurface pore waters. The majority of subsurface CO2 was produced from anaerobic respiration, likely due to reduction of Fe oxides and humics (52 ± 6 to 100 ± 13%, on average) while CO2 produced from methanogenesis accounted for the remainder (0 ± 13% to 47 ± 6%, on average) for July and September, respectively. Dissolved CH4 and dissolved CO2 concentrations correlated with thaw depth, suggesting that Arctic ecosystems will likely produce and release a greater amount of greenhouse gasses under projected warming and deepening of active layer thaw depth under future climate change scenarios.

  4. Photosynthetic and dark carbon metabolism in unicellular blue-green algae

    Microsoft Academic Search

    R. A. Pelroy; J. A. Bassham

    1972-01-01

    0946 091.The kinetics of 14CO2 incorporation into cellular intermediates was used to determine the primary pathway of carbon fixation by four genetically diverse unicellular blue-green algae. In each case label was first detected in 3-phosphoglycerate and then in compounds of the reductive pentose cycle.2.A light to dark transition evoked the same response in all four strains: Immediate cessation of biosynthesis,

  5. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    SciTech Connect

    Snyder-Talkington, Brandi N. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Dymacek, Julian [Lane Department of Computer Science and Electrical Engineering, West Virginia University, Morgantown, WV 26506-6070 (United States); Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Pacurari, Maricica [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Denvir, James [Department of Biochemistry and Microbiology, Marshall University, Huntington, WV 25755 (United States); Castranova, Vincent [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Qian, Yong, E-mail: yaq2@cdc.gov [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Guo, Nancy L., E-mail: lguo@hsc.wvu.edu [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States)

    2013-10-15

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 ?g MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung inflammation and fibrosis were revealed. • Two functional, representative genes, ccl2 and vegfa, were validated in vitro.

  6. Transition pathways for a low carbon energy system in the UK: assessing the compatibility of large-scale and small-scale options

    Microsoft Academic Search

    Timothy J Foxon; Geoffrey P Hammond; Peter J Pearson

    This paper describes initial work on transition pathways for a low carbon energy system in the UK, being pursued in a major new research project. The project is a collaboration between leading UK engineers, social scientists and policy analysts, supported by the UK Engineering and Physical Sciences Research Council (EPSRC) and the energy company E.ON UK. The project aims to

  7. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    SciTech Connect

    John J. Kilbane III

    2003-12-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage pathway. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum.

  8. Specific inhibitors for identifying pathways for methane production from carbon monoxide by a nonadapted anaerobic mixed culture.

    PubMed

    Navarro, Silvia Sancho; Cimpoia, Ruxandra; Bruant, Guillaume; Guiot, Serge R

    2014-06-01

    Specific inhibitors such as 2-bromoethanesulfonate (BES) and vancomycin were employed in activity batch tests to decipher metabolic pathways that are preferentially used by a mixed anaerobic consortium (sludge from an anaerobic digester) to transform carbon monoxide (CO) into methane (CH4). We first evaluated the inhibitory effect of both BES and vancomycin on the microbial community, as well as the efficiency and stability of vancomycin at 35 °C, over time. The activity tests with CO2-H2, CO, glucose, acetate, formate, propionate, butyrate, methanol, and ethanol showed that vancomycin does not inhibit some Gram-negative bacteria, and 50 mmol/L BES effectively blocks CH4 production in the sludge. However, when sludge was incubated with propionate, butyrate, methanol, or ethanol as the sole energy and carbon source, methanogenesis was only partially inhibited by BES. Separate tests showed that 0.07 mmol/L vancomycin is enough to maintain its inhibitory efficiency and stability in the population for at least 32 days at 35 °C. Using the inhibitors above, it was demonstrated that CO conversion to CH4 is an indirect, 2-step process, in which the CO is converted first to acetate and subsequently to CH4. PMID:24896194

  9. Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds

    SciTech Connect

    John J. Kilbane II

    2005-10-01

    The objective of the project is to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. The selective cleavage of the second C-N bond has been challenging, and efforts to overcome that challenge have been the focus of recent research in this project. Enrichment culture experiments succeeded in isolating bacterial cultures that can metabolize 2-aminobiphenyl, but no enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl has been identified. Aniline is very similar to the structure of 2-aminobiphenyl and aniline dioxygenase catalyzes the conversion of aniline to catechol and ammonia. For the remainder of the project the emphasis of research will be to simultaneously express the genes for carbazole dioxygenase and for aniline dioxygenase in the same bacterial host and then to select for derivative cultures capable of using carbazole as the sole source of nitrogen.

  10. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    SciTech Connect

    John J. Kilbane II

    2004-10-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project was focused on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate deaminase. The objective of the final phase of the project will be to develop derivative C-N bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments resulted in the isolation of microbial cultures that utilize aromatic amides as sole nitrogen sources, several amidase genes were cloned and were included in directed evolution experiments to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. During the second year of the project (October, 2003-September, 2004) enrichment culture experiments succeeded in isolating a mixed bacterial culture that can utilize 2-aminobiphenyl as a sole nitrogen source, directed evolution experiments were focused on the aniline dioxygenase enzyme that is capable of deaminating aniline, and expression vectors were constructed to enable the expression of genes encoding C-N bond cleaving enzymes in Rhodococcus hosts. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum. Aromatic compounds such as carbazole are representative of the difficult-to-treat organonitrogen compounds most commonly encountered in petroleum. There are two C-N bonds in carbazole and the construction of a metabolic pathway for the removal of nitrogen from carbazole will require enzymes capable cleaving both C-N bonds. A multi-component enzyme, carbazole dioxygenase, which can selectively cleave the first C-N bond has been identified and the genes that encode this enzyme have been cloned, sequenced, and are being expressed in Rhodococcus erythropolis, a bacterial culture that tolerates exposure to petroleum. An enzyme capable of selectively cleaving the second C-N bond in carbazole has not yet been identified, but enrichment culture experiments have recently succeeded in isolating a bacterial culture that is a likely candidate and may possess a suitable enzyme. Research in the near future will verify if a suitable enzyme for the cleavage of the second C-N bond in carbazole has indeed been found, then the genes encoding a suitable enzyme will be identified, cloned, and sequenced. Ultimately genes encoding enzymes for selective cleavage of both C-N bonds in carbazole will be assembled into a new metabolic pathway and the ability of the resulting bacterial culture to remove nitrogen from petroleum will be determined.

  11. Nitrogen fixation in boreal peatlands: the effects of increased N deposition on N2-fixation

    NASA Astrophysics Data System (ADS)

    Popma, J. M.; Wieder, R.; Lamers, L.; Vile, M. A.

    2013-12-01

    Boreal peatlands are of great importance to global carbon and nitrogen cycling. While covering only 3-4 % of the terrestrial surface, they account for 25-30 % of the world's soil C and 9-15 % of the world's soil N. In Western Canada atmospheric dry deposition rates are extremely low: approximately 1 kg N ha-1 yr-1. Though these systems have been functioning as net sinks over the past 11,000 years, natural and anthropogenic disturbances might compromise the historical balance of C and N. Biological N2-fixation has recently been shown to represent a very significant input of N into these systems, contributing to 62% of total N in Western Canada. Interactions between N deposition and biological N2-fixation are as yet, unknown, but the impact of elevated deposition of N-compounds from increased industrial expansion of oil sands mining to peatlands, is concerning. Given that nitrogenase, the enzyme responsible for catalyzing N2-fixation, is energetically costly when active, enhanced inputs of atmospheric N deposition could be a major determinant for enzyme activity and rates of biological N input to these bogs. Understanding interactions between N deposition and N2 fixation in boreal peatlands can aid in predicting the consequences of increased N deposition and setting critical loads. We conducted a field-fertilization experiment in a poor fen in Alberta, Canada, to determine the effects of enhanced N deposition on a dominant fen species Sphagnum angustifolium. The experiment consisted of seven N treatments: Control, 0, 5, 10, 15, 20 and 25 kg N ha-1 y1, n=3. N2-fixation was measured during summer 2012 and 2013 using the acetylene reduction assay (ARA). ARA rates were converted to rates of N2-fixation by calibrating ARA with paired 15N2-incubations. In both 2012 and 2013, with increasing N deposition from 0 kg N ha-1 yr-1 to 25 kg N ha-1 yr-1, rates of N2 fixation decreased, with highest rates in the 0 kg N ha-1 yr-1 treatment mosses (54.2 × 1.40; 48.58 × 7.12 kg N ha-1 yr-1, mean × std err for 2012 and 2013, respectively) followed by progressively lower rates with a low of 5.02 × 0.87 in 2012 and 8.94 × 3.09 in 2013 (mean × std err). As biological N2-fixation is an energetically costly process, up-regulating enzyme activity when N availability is low and down-regulating activity when N deposition is enhanced makes thermodynamic and evolutionary sense. N2-fixation shows to be one of the most early-warning indicators to the early response of boreal peatlands to increased N deposition, and can aid in setting critical loads to protect these historically pristine ecosystems.

  12. Biological nitrogen fixation is a much more important process in the nitrogen cycle of the oceans than previously thought.

    E-print Network

    Capone, Douglas G.

    341 Biological nitrogen fixation is a much more important process in the nitrogen cycle of the oceans than previously thought. Further, nitrogen fixation may have an influence on the capacity of the oceans to sequester carbon. A greater diversity of marine nitrogen fixers has also been uncovered

  13. Carbon dioxide fixation by artificial photosynthesis

    SciTech Connect

    Ibusuki, Takashi; Koike, Kazuhide; Ishitani, Osamu [National Inst. for Resources and Environment, AIST, MITI, Tsukuba, Ibaraki (Japan)

    1993-12-31

    Green plants can absorb atmospheric CO{sub 2} and transform it to sugars, carbohydrates through their photosynthetic systems, but they become the source of CO{sub 2} when they are dead. This is the reason why artificial leaves which can be alive forever should be developed to meet with global warming due to the increase of CO{sub 2} concentration. The goal of artificial photosynthesis is not to construct the same system as the photosynthetic one, but to mimic the ability of green plants to utilize solar energy to make high energy chemicals. Needless to say, the artificial photosynthetic system is desired to be as simple as possible and to be as efficient as possible. From the knowledge on photosynthesis and the results of previous investigations, the critical components of artificial photosynthetic system are understood as follows: (1) light harvesting chromophore, (2) a center for electron transfer and charge separation, (3) catalytic sites for converting small molecules like water and CO{sub 2} (mutilelectron reactions) which are schematically described.

  14. Reaction of benzene with atomic carbon: pathways to fulvenallene and the fulvenallenyl radical in extraterrestrial atmospheres and the interstellar medium.

    PubMed

    da Silva, Gabriel

    2014-06-01

    The reaction of benzene with ground-state atomic carbon, C((3)P), has been investigated using the G3X-K composite quantum chemical method. A suite of novel energetically favorable pathways that lead to previously unconsidered products are identified. Reaction is initiated by barrierless C atom cycloaddition to benzene on the triplet surface, producing a vibrationally excited [C7H6]* adduct that can dissociate to the cycloheptatrienyl radical (+ H) via a relatively loose transition state 4.4 kcal mol(-1) below the reactant energies. This study also identifies that this reaction adduct can isomerize to generate five-membered ring intermediates that can further dissociate to the global C7H5 minima, the fulvenallenyl radical (+ H), or to c-C5H4 and acetylene, with limiting barriers around 20 and 10 kcal mol(-1) below the reactants, respectively. If intersystem crossing to the singlet surface occurs, isomerization pathways that are lower-yet in energy are available leading to the C7H6 minima fulvenallene, with all barriers over 40 kcal mol(-1) below the reactants. From here further barrierless fragmentation to fulvenallenyl + H can proceed at ca. 25 kcal mol(-1) below the reactants. In the reducing atmospheres of planets like Jupiter and satellites like Titan, where benzene and C((3)P) are both expected, it is proposed that fulvenallene and the fulvenallenyl radical would be the dominant products of the C6H6 + C((3)P) reaction. Fulvenallenyl may also be a significant reaction product under collision-free conditions representative of the interstellar medium, although further work is required here to confirm the identity of the C7H5 radical product. PMID:24828689

  15. Carbon monoxide alleviates ethanol-induced oxidative damage and inflammatory stress through activating p38 MAPK pathway.

    PubMed

    Li, Yanyan; Gao, Chao; Shi, Yanru; Tang, Yuhan; Liu, Liang; Xiong, Ting; Du, Min; Xing, Mingyou; Liu, Liegang; Yao, Ping

    2013-11-15

    Stress-inducible protein heme oxygenase-1(HO-1) is well-appreciative to counteract oxidative damage and inflammatory stress involving the pathogenesis of alcoholic liver diseases (ALD). The potential role and signaling pathways of HO-1 metabolite carbon monoxide (CO), however, still remained unclear. To explore the precise mechanisms, ethanol-dosed adult male Balb/c mice (5.0g/kg.bw.) or ethanol-incubated primary rat hepatocytes (100mmol/L) were pretreated by tricarbonyldichlororuthenium (II) dimmer (CORM-2, 8mg/kg for mice or 20?mol/L for hepatocytes), as well as other pharmacological reagents. Our data showed that CO released from HO-1 induction by quercetin prevented ethanol-derived oxidative injury, which was abolished by CO scavenger hemoglobin. The protection was mimicked by CORM-2 with the attenuation of GSH depletion, SOD inactivation, MDA overproduction, and the leakage of AST, ALT or LDH in serum and culture medium induced by ethanol. Moreover, CORM-2 injection or incubation stimulated p38 phosphorylation and suppressed abnormal Tnfa and IL-6, accompanying the alleviation of redox imbalance induced by ethanol and aggravated by inflammatory factors. The protective role of CORM-2 was abolished by SB203580 (p38 inhibitor) but not by PD98059 (ERK inhibitor) or SP600125 (JNK inhibitor). Thus, HO-1 released CO prevented ethanol-elicited hepatic oxidative damage and inflammatory stress through activating p38 MAPK pathway, suggesting a potential therapeutic role of gaseous signal molecule on ALD induced by naturally occurring phytochemicals. PMID:23994557

  16. Hydrogen coupled CO2 fixation in legume cropping systems

    NASA Astrophysics Data System (ADS)

    Philpott, T.; Cen, Y.; Layzell, D. B.; Kyser, K.; Scott, N. A.

    2009-05-01

    Electron flow from oxidation of excess H2 released by root nodules was shown to contribute to microbial CO2 fixation in soybean crops. This discovery has important implications for carbon storage in soils used to grow legumes; however, further research is needed to understand the fate and turnover time of this H2-coupled CO2 fixation. Isotopic labeling of soil through incubation with 13CO2 was used to elucidate movement of sequestered carbon into soil carbon pools. Measurement of isotopic shifts was determined using Isotope Ratio Mass Spectrometry. Preliminary experiments have confirmed CO2 uptake through an isotopic shift (?13C -20.4 to -14.5 ‰) in 24 hour incubated soils labeled with 13CO2 (1% v/v, 99.5 Atom%) under elevated H2 concentration (6000 ppm). Other incubation experiments have confirmed the biotic nature of observed CO2 uptake by comparing isotopic shifts in oven dried and autoclaved soils to moist soil. Under an elevated H2 atmosphere, no significant isotopic shift was observed in dry and autoclaved soils whereas moist soil showed an isotopic shift of ?13C -21.9 to 11.4 ‰ over 48 hours. Future experiments will involve longer incubations (7 days) and will be aimed at determining isotopic shifts within soil carbon pools. Samples will be incubated and fractionated into microbial biomass, light fraction carbon, and acid stable carbon and subsequent isotopic analysis will be carried out. This will help determine the distribution of H2- coupled fixed CO2 within soil carbon pools and the turnover time of sequestered carbon. This and further research may lead to modification of greenhouse gas coefficients for leguminous crops that includes a CO2 fixation component.

  17. Activation of lysosomal degradative pathway in spinal cord tissues of carbon disulfide-treated rats.

    PubMed

    Gao, Yuan; Wang, Shasha; Yi, Anji; Kou, Ruirui; Xie, Keqin; Song, Fuyong

    2014-08-01

    Chronic exposure to carbon disulfide (CS?) can induce polyneuropathy in occupational worker and experimental animals, but underlying mechanism for CS? neuropathy is currently unknown. In the present study, male Wistar rats were randomly divided into three experimental groups and one control group. The rats in experimental groups were treated with CS? by gavage at dosages of 200, 400 and 600 mg/kg/day respectively, six times per week for 6 weeks. The formation of autophagosomes and lysosomes in motor neurons of rat spinal cord was observed by transmission electron microscopy, the level of autophagy-related proteins, lysosome-associated membrane protein 1 (LAMP-1), and cathepsin B in spinal cord tissues was determined by Western blot analysis, and the activity of cathepsin B was measured by fluorescence assay. The results demonstrated that the number of lysosomes in motor neurons was markedly increased in CS?-treated rats. In the meantime, the administration of CS? significantly increased the level of microtubule-associated protein light chain 3-II (LC3-II), Atg1, UVRAG and LAMP-1 in rat spinal cord. Furthermore, the content and activity of cathepsin B in rat spinal cord also showed a significant elevation. Taken together, this study suggested that CS? intoxication was associated with the activation of lysosomal degradative machinery, which might play a protective role against CS?-induced neuronal damage. PMID:24887698

  18. Liquiritigenin Protects Rats from Carbon Tetrachloride Induced Hepatic Injury through PGC-1? Pathway

    PubMed Central

    Zhang, Yiping; He, Yuanqiao; Yu, Hongbo; Ma, Fuying; Wu, Jianguo; Zhang, Xiaoyu

    2015-01-01

    The lack of effective treatment for liver cirrhosis and hepatocellular carcinomas imposes serious challenges to the healthcare system. Here, we investigated the efficacy and mechanism of liquiritigenin involved in preventing or retarding the progression of liver diseases in a rat model with chronic carbon tetrachloride (CCl4) exposure. Sprague Dawley rats were given CCl4 and lliquiritigenin alone or simultaneously for 8 weeks before liver was harvested to check histological changes by Hematoxylin and Eosin (H&E) staining, apoptosis by TUNEL assay, ROS by dihydroethidium staining, antioxidant enzyme activities and malondialdehyde using specific kits, and gene expression by quantitative real-time PCR and western blot. Chronic CCl4 exposure caused profound changes in liver histology with extensive hepatocyte death (necrosis and apoptosis), fat accumulation, and infiltration of inflammatory cells, accompanied by depressed activities of antioxidant enzymes, increased oxidative stress, elevated expression of inflammation and fibrotic genes, and downregulation of PGC-1?, ND1, and Bcl-x in rat liver. All these changes were abolished or alleviated by lliquiritigenin. The results demonstrated that liquiritigenin is effective in protecting liver from injury or treating chronic liver diseases. The modulation of PGC-1? and its downstream genes might play a critical role in relieving CCl4-induced hepatic pathogenesis by liquiritigenin. PMID:26199636

  19. Nitrogen fixation in Clear Lake, California.II. Synoptic studies on the autumn Anabaena bloom

    Microsoft Academic Search

    ALEXANDER J. HORNE; J. E. DILLARD; D. K. FUJITA; C. R. GOLDMAN

    1972-01-01

    Nitrogen fixation at three stages of an autumnal bloom of Anabaena circinulis was mea- sured after almost simultaneous collection at up to 32 stations in Clear Lake and algal hetcrocysts, phytoplankton cell numbers, NO,-N, NIL-N, dissolved organic-N, POh-P, Fe, primary production, particulate carbon, and chlorophyll a were also measured. Nitrogen fixation was significantly and positively correlated to Anabaena heterocyst numbers

  20. Complement fixation test to C. burnetii

    MedlinePLUS

    The complement fixation test to C. burnetii is a blood test that checks for infection due to bacterium called ... for Coxiella antibodies using a laboratory method called complement fixation. This technique checks if the body has ...

  1. Changes in North Atlantic nitrogen fixation controlled by ocean circulation.

    PubMed

    Straub, Marietta; Sigman, Daniel M; Ren, Haojia; Martínez-García, Alfredo; Meckler, A Nele; Hain, Mathis P; Haug, Gerald H

    2013-09-12

    In the ocean, the chemical forms of nitrogen that are readily available for biological use (known collectively as 'fixed' nitrogen) fuel the global phytoplankton productivity that exports carbon to the deep ocean. Accordingly, variation in the oceanic fixed nitrogen reservoir has been proposed as a cause of glacial-interglacial changes in atmospheric carbon dioxide concentration. Marine nitrogen fixation, which produces most of the ocean's fixed nitrogen, is thought to be affected by multiple factors, including ocean temperature and the availability of iron and phosphorus. Here we reconstruct changes in North Atlantic nitrogen fixation over the past 160,000?years from the shell-bound nitrogen isotope ratio ((15)N/(14)N) of planktonic foraminifera in Caribbean Sea sediments. The observed changes cannot be explained by reconstructed changes in temperature, the supply of (iron-bearing) dust or water column denitrification. We identify a strong, roughly 23,000-year cycle in nitrogen fixation and suggest that it is a response to orbitally driven changes in equatorial Atlantic upwelling, which imports 'excess' phosphorus (phosphorus in stoichiometric excess of fixed nitrogen) into the tropical North Atlantic surface. In addition, we find that nitrogen fixation was reduced during glacial stages 6 and 4, when North Atlantic Deep Water had shoaled to become glacial North Atlantic intermediate water, which isolated the Atlantic thermocline from excess phosphorus-rich mid-depth waters that today enter from the Southern Ocean. Although modern studies have yielded diverse views of the controls on nitrogen fixation, our palaeobiogeochemical data suggest that excess phosphorus is the master variable in the North Atlantic Ocean and indicate that the variations in its supply over the most recent glacial cycle were dominated by the response of regional ocean circulation to the orbital cycles. PMID:23965620

  2. Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre.

    PubMed

    Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel M M

    2012-06-01

    Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N(2)-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N(2)-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200 m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of (15)N-labeled ammonium and leucine in our incubation experiments. N(2)-fixation was detectable throughout the upper 200 m at most stations, with rates ranging from 0.001 to 0.19 nM N h(-1). N(2)-fixation in the SPG may account for the production of 8-20% of global oceanic new nitrogen. Interestingly, comparable (15)N(2)-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

  3. Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre

    PubMed Central

    Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel MM

    2012-01-01

    Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N2-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N2-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200?m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of 15N-labeled ammonium and leucine in our incubation experiments. N2-fixation was detectable throughout the upper 200?m at most stations, with rates ranging from 0.001 to 0.19?nM?N?h?1. N2-fixation in the SPG may account for the production of 8–20% of global oceanic new nitrogen. Interestingly, comparable 15N2-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

  4. N? fixation by subsurface populations of Trichodesmium : an important source of new nitrogen to the North Atlantic Ocean

    E-print Network

    Heithoff, Abigail

    2011-01-01

    Trichodesmium, a genus of diazotrophic cyanobacteria, is an important contributor to the marine nitrogen (N) and carbon (C) cycles. The extent to which Trichodesmium dinitrogen (N2) fixation contributes to the marine N ...

  5. OVEREXPRESSION OF A NODULE-ENHANCED MALATE DEHYDROGENASE INCREASES NITROGEN FIXATION IN ALFALFA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Malate is crucial for symbiotic dinitrogen (N2) fixation, occurring in high concentrations in N2-fixing nodules as the major carbon source for bacteroid respiration. Malate also provides carbon skeletons for the assimilation of fixed nitrogen from ammonia into amino acids and is proposed to be invol...

  6. Tissue fixation and the effect of molecular fixatives on downstream staining procedures

    PubMed Central

    Howat, William J.; Wilson, Beverley A.

    2014-01-01

    It is impossible to underplay the importance of fixation in histopathology. Whether the scientist is interested in the extraction of information on lipids, proteins, RNA or DNA, fixation is critical to this extraction. This review aims to give a brief overview of the current “state of play” in fixation and focus on the effect fixation, and particularly the effect of the newer brand of “molecular fixatives” have on morphology, histochemistry, immunohistochemistry and RNA/DNA analysis. A methodology incorporating the creation of a fixation tissue microarray for the study of the effect of fixation on histochemistry is detailed. PMID:24561827

  7. FIXATIVES AND EMBEDDING MEDIA FOR IMMUNOCYTOCHEMISTRY

    Microsoft Academic Search

    B. B. Rawdon

    1998-01-01

    In this article fixation and embedding procedures compatible with preparation of animal tissues for immunocytochemistry are reviewed. A number of methods is available for light microscopic immunocytochemistry: these include cryostat, freeze-dried and wax sections of tissue fixed with either vapour or immersion fixatives. Use of the microwave oven to fix tissues for immunocytochemistry is also discussed. Fixation methods for immuno-electron

  8. Transit Fixatives: An Innovative Study

    PubMed Central

    A, Ravi Prakash; G, Sreenath; JK, Sonia Bai; NDVN, Shyam

    2015-01-01

    Background: Universally accepted fixative is 10% formalin which has been used for preserving the tissues and their architecture. In certain conditions, formalin might not be readily available for immediate fixation. We here by explore more economical, eco-friendly and easily available solutions that can be used as transit media/ transporting media for tissue specimens. Materials and Methods: The study included commonly available solutions like Spirit, Saline, Betadine solution, Hydrogen peroxide (H2O2), Local anesthesia (L.A), Rose water, Coconut oil, Coconut water, Ice cold water, Honey and Milk while keeping formalin as control. The fresh tissue sample was cut into multiple bits and placed in different containers for a period of 8 hours before transferring to formalin solution. Conclusion: Transit fixatives are very important in certain situations where formalin is not readily available. These fixatives can be used to fix the tissues for a period of at least 8 hours without causing any damage or distortion before they are fixed in formalin solution. PMID:25954725

  9. The relationship between dissolved hydrogen and nitrogen fixation in ocean waters

    NASA Astrophysics Data System (ADS)

    Moore, Robert M.; Punshon, Stephen; Mahaffey, Claire; Karl, David

    2009-09-01

    Fixed nitrogen is a key nutrient involved in regulating global marine productivity and hence the global oceanic carbon cycle. Oceanic nitrogen (N 2) fixation is estimated to supply 8×10 12 moles N y -1 to the ocean, approximately equal to current riverine and the atmospheric inputs of fixed N, and between 50 and 100% of current estimates of oceanic denitrification. However, the spatial and temporal variability of N 2 fixation remains uncertain, mostly because of the normal low resolution sampling for diazotroph distribution and fixation rates. It is well established that N 2 fixation, mediated by the enzyme nitrogenase, is a source of hydrogen (H 2), but the extent to which it leads to supersaturation of H 2 in oceanic waters is unresolved. Here, we present simultaneous measurements of upper ocean dissolved H 2 concentration (nmol L -1), and rates of N 2 fixation (?mol N m -3 d -1), determined using 15N 2 tracer techniques (at 7 or 15 m), on a transect from Fiji to Hawaii. We find a significant correlation ( r=0.98) between dissolved H 2 and rates of N 2 fixation, with the greatest supersaturation of H 2 and highest rates of N 2 fixation being observed in the subtropical gyres at the southern (˜18°S) and northern (18°N) reaches of the transect. The lowest H 2 saturation and N 2 fixation were observed in the equatorial region between 8°S and 14°N. We propose that an empirical relationship between H 2 supersaturations and N 2 fixation measurements could be used to guide sampling for 15N fixation measurements or to aid the spatial interpolation of such measurements.

  10. Analysis of gene expression profiles in healing rat fractures treated with nail and plate fixation.

    PubMed

    Wang, S D; Li, X L; Liu, H P

    2014-01-01

    To compare fracture healing therapies, the gene expression profiles of rat fracture samples treated with nail and plate fixation were analyzed at 1 day, 3 days, 1 week, 2 weeks, 4 weeks, and 6 weeks after surgery. The gene expression profiles GSE1685, which include 19 samples, were downloaded from the Gene Expression Omnibus database. After preprocessing, the gene expression profiles were subjected to time series analysis using the Short Time-series Expression Miner software, and the significantly differentially expressed gene (DEG) sets were selected. Further, the distributions of those DEG sets on the corresponding chromosomes were identified using the functional classification tool. Finally, the DEGs were subjected to function and pathway enrichment analysis. DEG analysis indicated that the number of DEGs (854 genes) from nail fixation was significantly lower than that of DEGs (1029 genes) from plate fixation. The DEGs were mainly enriched in cell proliferation, cellular localization, and response to wounding functions. Several critical DEGs expressed during the fracture healing process were screened, and 2 common pathways were enriched for the DEGs in the nail fixation and plate fixation. These DEGs and pathways may be potential targets or predictive markers during fracture healing. PMID:25366739

  11. Polymorphism in one-carbon metabolism pathway affects survival of gastric cancer patients: Large and comprehensive study.

    PubMed

    Zhao, Tingting; Gu, Dongying; Xu, Zhi; Huo, Xinying; Shen, Lili; Wang, Chun; Tang, Yongfei; Wu, Peng; He, Jason; Gong, Weida; He, Ming-Liang; Chen, Jinfei

    2015-04-20

    Although it has been shown that polymorphisms in one-carbon metabolism (OCM) pathway are associated with gastric cancer (GC), their interactions and contributions for patients' survival are elusive. In this study, we investigated the effects of polymorphisms and their interactions on the survival of GC patients, including genes of Methylenetetrahydrofolate reductase (MTHFR 677C > T, 1298A > C), Methionine synthase reductase (MTRR 66A > G), Methionine synthase (MTR 2756A > G), and Thymidylate synthase (TS 3'-UTR ins6 > del6, 5'-UTR 2R > 3R). We recruited 919 GC patients from 1998 to 2006. The Kaplan-Meier plots, Cox regression analyses and the log-rank tests were carried out in this study. MTHFR 1298CC genotype showed protective effect (HR = 0.444, 95% CI = 0.210-0.940). MTRR 66 GA + GG genotypes decreased the risk of death (HR = 0.793, 95% CI = 0.651-0.967) in general, and in subgroups with more pronounced diffuse type, greater depth of invasion (T2/T3/T4), higher level lymph node metastasis (N1/N2/N3), advanced TNM stages (II/III level) and 5-Fu treatment. However, the improved survival disappeared when GC patients simultaneously had MTR 2756 GA + GG genotypes (HR = 1.063, 95% CI = 0.750-1.507). Although MTRR 66GA genotype was not associated with the survival of GC patients, patients with simultaneous MTRR 66GA and MTR 2756AA genotypes exhibited significant risk reduction of death (HR = 0.773, 95% CI = 0.609-0.981). MTHFR 1298 CA + CC combined with TS 5-UTR 2R3R + 3R3R genotypes (HR = 0.536, 95% CI = 0.315-0.913) also increased patient survival rates. Our results suggest that the MTRR 66A > G and MTHFR 1298A > C polymorphisms may be useful prognostic biomarkers for GC patients. PMID:25840420

  12. Polymorphism in one-carbon metabolism pathway affects survival of gastric cancer patients: Large and comprehensive study

    PubMed Central

    Huo, Xinying; Shen, Lili; Wang, Chun; Tang, Yongfei; Wu, Peng; He, Jason; Gong, Weida; He, Ming-Liang; Chen, Jinfei

    2015-01-01

    Although it has been shown that polymorphisms in one-carbon metabolism (OCM) pathway are associated with gastric cancer (GC), their interactions and contributions for patients’ survival are elusive. In this study, we investigated the effects of polymorphisms and their interactions on the survival of GC patients, including genes of Methylenetetrahydrofolate reductase (MTHFR 677C > T, 1298A > C), Methionine synthase reductase (MTRR 66A > G), Methionine synthase (MTR 2756A > G), and Thymidylate synthase (TS 3?-UTR ins6 > del6, 5?-UTR 2R > 3R). We recruited 919 GC patients from 1998 to 2006. The Kaplan–Meier plots, Cox regression analyses and the log-rank tests were carried out in this study. MTHFR 1298CC genotype showed protective effect (HR = 0.444, 95% CI = 0.210–0.940). MTRR 66 GA + GG genotypes decreased the risk of death (HR = 0.793, 95% CI = 0.651–0.967) in general, and in subgroups with more pronounced diffuse type, greater depth of invasion (T2/T3/T4), higher level lymph node metastasis (N1/N2/N3), advanced TNM stages (II/III level) and 5-Fu treatment. However, the improved survival disappeared when GC patients simultaneously had MTR 2756 GA + GG genotypes (HR = 1.063, 95% CI = 0.750–1.507). Although MTRR 66GA genotype was not associated with the survival of GC patients, patients with simultaneous MTRR 66GA and MTR 2756AA genotypes exhibited significant risk reduction of death (HR = 0.773, 95% CI = 0.609–0.981). MTHFR 1298 CA + CC combined with TS 5-UTR 2R3R + 3R3R genotypes (HR = 0.536, 95% CI = 0.315–0.913) also increased patient survival rates. Our results suggest that the MTRR 66A > G and MTHFR 1298A > C polymorphisms may be useful prognostic biomarkers for GC patients. PMID:25840420

  13. Significance of the non-oxidative route of the pentose phosphate pathway for supplying carbon to the purine-nucleotide pathway in Corynebacterium ammoniagenes

    Microsoft Academic Search

    N. Kamada; A. Yasuhara; M. Ikeda

    2003-01-01

      \\u000a To evaluate the strategy of supplying ribose 5-phosphate to the purine-nucleotide pathway exclusively via the nonoxidative\\u000a route, the glucose 6-phosphate dehydrogenase gene zwf was disrupted in inosine- and 5?-xanthylic acid-producers of Corynebacterium ammoniagenes. In both producers, interruption of the oxidative route caused a decrease in production yields of about 50%. Attempts to\\u000a increase the capacity of the nonoxidative route

  14. 13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose

    Microsoft Academic Search

    Paula Jouhten; Esa Pitkänen; Tiina Pakula; Markku Saloheimo; Merja Penttilä; Hannu Maaheimo

    2009-01-01

    BACKGROUND: The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions

  15. Carbon-Isotope Fractionations of Autotrophic Bacteria: Relevance to Primary Production and Microbial Evolution in Hot Springs and Hydrothermal Vents

    NASA Astrophysics Data System (ADS)

    Zhang, C. L.; Romanek, C. S.; Mills, G.

    2004-12-01

    Terrestrial hot springs and marine hydrothermal vents are often dominated by autotrophic microorganisms. Species of the Bacteria Domain in these environments are known to use different pathways for CO2 fixation. These may include the Calvin cycle, the Acetyl CoA pathway, the reverse TCA cycle, and the 3-HP pathway. Each cycle or pathway may be characterized by distinct patterns of carbon isotope fractionation. This presentation will summarize isotope fractionation patterns associated with known autotrophic bacteria and to use these patterns for interpreting natural isotopic variations. Examples will include hot springs from the Yellowstone National Park and Nevada desert, USA and Kamchatka, Russia, and hydrothermal vents from the East Pacific Rise. An attempt will be made to discuss isotopic variations within a particular pathway in the context of species evolution through horizontal gene transfer.

  16. Determination of methanogenic pathways through carbon isotope (?13C) analysis for the two-stage anaerobic digestion of high-solids substrates.

    PubMed

    Gehring, Tito; Klang, Johanna; Niedermayr, Andrea; Berzio, Stephan; Immenhauser, Adrian; Klocke, Michael; Wichern, Marc; Lübken, Manfred

    2015-04-01

    This study used carbon isotope (?(13)C)-based calculations to quantify the specific methanogenic pathways in a two-stage experimental biogas plant composed of three thermophilic leach bed reactors (51-56 °C) followed by a mesophilic (36.5 °C) anaerobic filter. Despite the continuous dominance of the acetoclastic Methanosaeta in the anaerobic filter, the methane (CH4) fraction derived from carbon dioxide reduction (CO2), fmc, varied significantly over the investigation period of 200 days. At organic loading rates (OLRs) below 6.0 gCOD L(-1) d(-1), the average fmc value was 33%, whereas at higher OLRs, with a maximum level of 17.0 gCOD L(-1) d(-1), the fmc values reached 47%. The experiments allowed for a clear differentiation of the isotope fractionation related to the formation and consumption of acetate in both stages of the plant. Our data indicate constant carbon isotope fractionation for acetate formation at different OLRs within the thermophilic leach bed reactors as well as a negligible contribution of homoacetogenesis. These results present the first quantification of methanogenic pathway (fmc values) dynamics for a continually operated mesophilic bioreactor and highlight the enormous potential of ?(13)C analysis for a more comprehensive understanding of the anaerobic degradation processes in CH4-producing biogas plants. PMID:25741999

  17. Investigations of potential microbial methanogenic and carbon monoxide utilization pathways in ultra-basic reducing springs associated with present-day continental serpentinization: the Tablelands, NL, CAN

    PubMed Central

    Morrill, Penny L.; Brazelton, William J.; Kohl, Lukas; Rietze, Amanda; Miles, Sarah M.; Kavanagh, Heidi; Schrenk, Matthew O.; Ziegler, Susan E.; Lang, Susan Q.

    2014-01-01

    Ultra-basic reducing springs at continental sites of serpentinization act as portals into the biogeochemistry of a subsurface environment with H2 and CH4 present. Very little, however, is known about the carbon substrate utilization, energy sources, and metabolic pathways of the microorganisms that live in this ultra-basic environment. The potential for microbial methanogenesis with bicarbonate, formate, acetate, and propionate precursors and carbon monoxide (CO) utilization pathways were tested in laboratory experiments by adding substrates to water and sediment from the Tablelands, NL, CAD, a site of present-day continental serpentinization. Microbial methanogenesis was not observed after bicarbonate, formate, acetate, or propionate addition. CO was consumed in the live experiments but not in the killed controls and the residual CO in the live experiments became enriched in 13C. The average isotopic enrichment factor resulting from this microbial utilization of CO was estimated to be 11.2 ± 0.2‰. Phospholipid fatty acid concentrations and ?13C values suggest limited incorporation of carbon from CO into microbial lipids. This indicates that in our experiments, CO was used primarily as an energy source, but not for biomass growth. Environmental DNA sequencing of spring fluids collected at the same time as the addition experiments yielded a large proportion of Hydrogenophaga-related sequences, which is consistent with previous metagenomic data indicating the potential for these taxa to utilize CO. PMID:25431571

  18. Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms

    PubMed Central

    Sulieman, Saad; Tran, Lam-Son Phan

    2014-01-01

    The special issue “Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms” aims to investigate the physiological and biochemical advances in the symbiotic process with an emphasis on nodule establishment, development and functioning. The original research articles included in this issue provide important information regarding novel aspects of nodule metabolism and various regulatory pathways, which could have important future implications. This issue also included one review article that highlights the importance of using legume trees in the production of renewable biofuels. PMID:25347276

  19. Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle 1

    PubMed Central

    Vanlerberghe, Greg C.; Horsey, Anne K.; Weger, Harold G.; Turpin, David H.

    1989-01-01

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH4+ in the dark under anaerobic conditions. Addition of NH4+ to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO2 efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H14CO3? to anaerobic cells assimilating NH4+ results in the incorporation of radiolabel into the ?-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH4+ addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply ?-ketoglutarate for glutamate production. During dark aerobic NH4+ assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH4+ assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH4+ assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity. PMID:16667215

  20. Sacrospinous ligament fixation for vaginal vault prolapse

    Microsoft Academic Search

    T. Lantzsch; C. Goepel; M. Wolters; H. Koelbl; H. D. Methfessel

    2001-01-01

    Introduction. To assess intra- and postoperative complications and to look for long term follow-up results in women with sacrospinous ligament\\u000a fixation. Methods. Between 1988 and 1999, 200 women (mean age 59.8 years, range 33 to 83 years) underwent vaginal unilateral sacrospinous ligament\\u000a fixation. 172 patients had had prior hysterectomy. In 28 patients concomitant hysterectomy and sacrospinous ligament fixation\\u000a was performed.

  1. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-09-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (?D, ?13C, and ?15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ?13C and increasing ?D with increasing carbon number in the ?-H, ?-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light ?13C signatures for ?-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-?-amino acids). Higher deuterium enrichments are observed in ?-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  2. Modeling the Dynamic Regulation of Nitrogen Fixation in the Cyanobacterium Trichodesmium sp.

    PubMed Central

    Rabouille, Sophie; Staal, Marc; Stal, Lucas J.; Soetaert, Karline

    2006-01-01

    A physiological, unbalanced model is presented that explicitly describes growth of the marine cyanobacterium Trichodesmium sp. at the expense of N2 (diazotrophy). The model involves the dynamics of intracellular reserves of carbon and nitrogen and allows the uncoupling of the metabolism of these elements. The results show the transient dynamics of N2 fixation when combined nitrogen (NO3?, NH4+) is available and the increased rate of N2 fixation when combined nitrogen is insufficient to cover the demand. The daily N2 fixation pattern that emerges from the model agrees with measurements of rates of nitrogenase activity in laboratory cultures of Trichodesmium sp. Model simulations explored the influence of irradiance levels and the length of the light period on fixation activity and cellular carbon and nitrogen stoichiometry. Changes in the cellular C/N ratio resulted from allocations of carbon to different cell compartments as demanded by the growth of the organism. The model shows that carbon availability is a simple and efficient mechanism to regulate the balance of carbon and nitrogen fixed (C/N ratio) in filaments of cells. The lowest C/N ratios were obtained when the light regime closely matched nitrogenase dynamics. PMID:16672460

  3. Modeling fixation locations using spatial point processes.

    PubMed

    Barthelmé, Simon; Trukenbrod, Hans; Engbert, Ralf; Wichmann, Felix

    2013-01-01

    Whenever eye movements are measured, a central part of the analysis has to do with where subjects fixate and why they fixated where they fixated. To a first approximation, a set of fixations can be viewed as a set of points in space; this implies that fixations are spatial data and that the analysis of fixation locations can be beneficially thought of as a spatial statistics problem. We argue that thinking of fixation locations as arising from point processes is a very fruitful framework for eye-movement data, helping turn qualitative questions into quantitative ones. We provide a tutorial introduction to some of the main ideas of the field of spatial statistics, focusing especially on spatial Poisson processes. We show how point processes help relate image properties to fixation locations. In particular we show how point processes naturally express the idea that image features' predictability for fixations may vary from one image to another. We review other methods of analysis used in the literature, show how they relate to point process theory, and argue that thinking in terms of point processes substantially extends the range of analyses that can be performed and clarify their interpretation. PMID:24084942

  4. Significance of the non-oxidative route of the pentose phosphate pathway for supplying carbon to the purine-nucleotide pathway in Corynebacterium ammoniagenes.

    PubMed

    Kamada, N; Yasuhara, A; Ikeda, M

    2003-02-01

    To evaluate the strategy of supplying ribose 5-phosphate to the purine-nucleotide pathway exclusively via the nonoxidative route, the glucose 6-phosphate dehydrogenase gene zwf was disrupted in inosine- and 5'-xanthylic acid-producers of Corynebacterium ammoniagenes. In both producers, interruption of the oxidative route caused a decrease in production yields of about 50%. Attempts to increase the capacity of the nonoxidative route through overexpression of the transketolase or transaldolase gene in the zwf mutants led to no discernable effects on production, indicating that, in C. ammoniagenes, the nonoxidative route alone cannot provide sufficient ribose 5-phosphate for high-level production, although nonoxidative synthesis of the precursor is possible. PMID:12612788

  5. Regulation of Carbon Flow by Nitrogen and Light in the Red Alga, Gelidium coulteri1

    PubMed Central

    Macler, Bruce A.

    1986-01-01

    The red alga Gelidium coulteri Harv. photosynthetically fixed [14C] bicarbonate at high rates under defined conditions in unialgal laboratory culture. The fixation rate and flow of photosynthate into various end products were dependent on the nitrogen status of the tissue. Plants fed luxury levels of nitrogen (approximately 340 micromolar) showed fixation rates several-fold higher than those seen for plants starved for nitrogen. The addition of NO3? or NH4+ to such starved plants further inhibited fixation over at least the first several hours after addition. The majority of 14C after incubations of 30 minutes to 8 hours was found in the compounds floridoside, agar and floridean starch. In addition, amino acids and intermediate compounds of the reductive pentose phosphate pathway, glycolytic pathway and tricarboxylic acid cycle were detected. Nitrogen affected the partitioning of labeled carbon into these compounds. Plants under luxury nitrogen conditions had higher floridoside levels and markedly lower amounts of agar and starch than found in plants limited for nitrogen. Amino acid, phycobiliprotein and chlorophyll levels were also significantly higher in nitrogen-enriched plants. Addition of NO3? to starved plants led to an increase in floridoside, tricarboxylic acid cycle intermediates and amino acids within 1 hour and inhibited carbon flow into agar and starch. Carbon fixation in the dark was only 1 to 7% of that seen in the light. Dark fixation of [14C]bicarbonate yielded label primarily in tricarboxylic acid cycle intermediates, amino acids and polysaccharides. Nitrogen stimulated amino acid synthesis at the expense of agar and starch. Floridoside was only a minor component in the dark. Pulse-chase experiments, designed to show carbon turnover, indicated a 2-fold increase in labeling of agar over 96 hours of chase in the light. No increases were seen in the dark. Low molecular weight pools, including floridoside, decreased 2- to 5-fold over this period under both light and dark conditions. Nitrogen status did not influence turnover. There was little or no organic carbon released into the culture medium over this period. The results are consistent with biosynthetic pathways to floridoside and agar that share the common intermediate UDP-d-galactose. It is hypothesized that synthesis of floridoside is regulated by nitrogen and light at the enzymic level. PMID:16664980

  6. Regulation of Carbon Flow by Nitrogen and Light in the Red Alga, Gelidium coulteri.

    PubMed

    Macler, B A

    1986-09-01

    The red alga Gelidium coulteri Harv. photosynthetically fixed [(14)C] bicarbonate at high rates under defined conditions in unialgal laboratory culture. The fixation rate and flow of photosynthate into various end products were dependent on the nitrogen status of the tissue. Plants fed luxury levels of nitrogen (approximately 340 micromolar) showed fixation rates several-fold higher than those seen for plants starved for nitrogen. The addition of NO(3) (-) or NH(4) (+) to such starved plants further inhibited fixation over at least the first several hours after addition. The majority of (14)C after incubations of 30 minutes to 8 hours was found in the compounds floridoside, agar and floridean starch. In addition, amino acids and intermediate compounds of the reductive pentose phosphate pathway, glycolytic pathway and tricarboxylic acid cycle were detected. Nitrogen affected the partitioning of labeled carbon into these compounds. Plants under luxury nitrogen conditions had higher floridoside levels and markedly lower amounts of agar and starch than found in plants limited for nitrogen. Amino acid, phycobiliprotein and chlorophyll levels were also significantly higher in nitrogen-enriched plants. Addition of NO(3) (-) to starved plants led to an increase in floridoside, tricarboxylic acid cycle intermediates and amino acids within 1 hour and inhibited carbon flow into agar and starch. Carbon fixation in the dark was only 1 to 7% of that seen in the light. Dark fixation of [(14)C]bicarbonate yielded label primarily in tricarboxylic acid cycle intermediates, amino acids and polysaccharides. Nitrogen stimulated amino acid synthesis at the expense of agar and starch. Floridoside was only a minor component in the dark. Pulse-chase experiments, designed to show carbon turnover, indicated a 2-fold increase in labeling of agar over 96 hours of chase in the light. No increases were seen in the dark. Low molecular weight pools, including floridoside, decreased 2- to 5-fold over this period under both light and dark conditions. Nitrogen status did not influence turnover. There was little or no organic carbon released into the culture medium over this period. The results are consistent with biosynthetic pathways to floridoside and agar that share the common intermediate UDP-d-galactose. It is hypothesized that synthesis of floridoside is regulated by nitrogen and light at the enzymic level. PMID:16664980

  7. PERIODATE-LYSINE-PARAFORMALDEHYDE FIXATIVE A NEW FIXATIVE FOR IMMUNOELECTRON MICROSCOPY

    Microsoft Academic Search

    PAUL K. NAKANE

    A new fixative which primarily stabilizes carbohydrate moieties was developed for immunoelectron microscopy. It contains periodate, lysine and paraformaldehyde. Theoreti- cally, the carbohydrates are oxidized by periodate and cross-linked by lysine. The fixative can preserve antigenicity as well as paraformaldehyde and ultrastructure as well as glutaraldehyde. Using this fixative and the peroxidase-labeled antibody technique, base- ment membrane antigen was localized

  8. Elementary Flux Mode Analysis of Acetyl-CoA Pathway in Carboxydothermus hydrogenoformans Z-2901

    PubMed Central

    Chinnasamy Perumal, Rajadurai; Selvaraj, Ashok; Ramesh Kumar, Gopal

    2014-01-01

    Carboxydothermus hydrogenoformans is a carboxydotrophic hydrogenogenic bacterium species that produces hydrogen molecule by utilizing carbon monoxide (CO) or pyruvate as a carbon source. To investigate the underlying biochemical mechanism of hydrogen production, an elementary mode analysis of acetyl-CoA pathway was performed to determine the intermediate fluxes by combining linear programming (LP) method available in CellNetAnalyzer software. We hypothesized that addition of enzymes necessary for carbon monoxide fixation and pyruvate dissimilation would enhance the theoretical yield of hydrogen. An in silico gene knockout of pyk, pykC, and mdh genes of modeled acetyl-CoA pathway allows the maximum theoretical hydrogen yield of 47.62?mmol/gCDW/h for 1 mole of carbon monoxide (CO) uptake. The obtained hydrogen yield is comparatively two times greater than the previous experimental data. Therefore, it could be concluded that this elementary flux mode analysis is a crucial way to achieve efficient hydrogen production through acetyl-CoA pathway and act as a model for strain improvement. PMID:24822064

  9. Involvement of the heme oxygenase-carbon monoxide-cGMP pathway in the nociception induced by acute painful stimulus in rats.

    PubMed

    Carvalho, Priscila G; Branco, Luiz G S; Panissi, Christie Ramos Andrade Leite-

    2011-04-18

    Heme oxygenase-carbon monoxide-cGMP (HO-CO-cGMP) pathway has been reported to be involved in peripheral and spinal modulation of inflammatory pain. However, the involvement of this pathway in the modulation of acute painful stimulus in the absence of inflammation remains unknown. Thus, we evaluated the involvement of the HO-CO-cGMP pathway in nociception by means the of analgesia index (AI) in the tail flick test. Rats underwent surgery for implantation of unilateral guide cannula directed toward the lateral ventricle and after the recovery period (5-7 days) were subjected to the measures of baseline tail flick test. Animals were divided into groups to assess the effect of intracerebroventricular administration (i.c.v.) of the following compounds: ZnDPBG (HO inhibitor) or vehicle (Na(2)CO(3)), heme-lysinate (substrate overload) or vehicle (l-lysine), or the selective inhibitor of soluble guanilate cyclase ODQ or vehicle (DMSO 1%) following the administration of heme-lysinate or vehicle. Heme overload increased AI, indicating an antinociceptive role of the pathway. This response was attenuated by i.c.v. pretreatment with the HO inhibitor ZnDPBG. In addition, this effect was dependent on cGMP activity, since the pretreatment with ODQ blocked the increase in the AI. Because CO produces most of its actions via cGMP, these data strongly imply that CO is the HO product involved in the antinociceptive response. This modulation seems to be phasic rather than tonic, since i.c.v. treatment with ZnDPBG or ODQ did not alter the AI. Therefore, we provide evidence consistent with the notion that HO-CO-cGMP pathway plays a key phasic antinociceptive role modulating noninflammatory acute pain. PMID:21349250

  10. Nitrogen fixation method and apparatus

    DOEpatents

    Chen, H.L.

    1983-08-16

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O[sub 2]/cm promotes the formation of vibrationally excited N[sub 2]. Atomic oxygen interacts with vibrationally excited N[sub 2] at a much quicker rate than unexcited N[sub 2], greatly improving the rate at which NO is formed. 1 fig.

  11. Nitrogen fixation method and apparatus

    DOEpatents

    Chen, Hao-Lin (Walnut Creek, CA)

    1983-01-01

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

  12. 21 CFR 868.5770 - Tracheal tube fixation device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...2011-04-01 2011-04-01 false Tracheal tube fixation device. 868.5770 Section...Therapeutic Devices § 868.5770 Tracheal tube fixation device. (a) Identification. A tracheal tube fixation device is a device used to...

  13. 21 CFR 868.5770 - Tracheal tube fixation device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...2014-04-01 2014-04-01 false Tracheal tube fixation device. 868.5770 Section...Therapeutic Devices § 868.5770 Tracheal tube fixation device. (a) Identification. A tracheal tube fixation device is a device used to...

  14. 21 CFR 868.5770 - Tracheal tube fixation device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...2012-04-01 2012-04-01 false Tracheal tube fixation device. 868.5770 Section...Therapeutic Devices § 868.5770 Tracheal tube fixation device. (a) Identification. A tracheal tube fixation device is a device used to...

  15. 21 CFR 868.5770 - Tracheal tube fixation device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...2013-04-01 2013-04-01 false Tracheal tube fixation device. 868.5770 Section...Therapeutic Devices § 868.5770 Tracheal tube fixation device. (a) Identification. A tracheal tube fixation device is a device used to...

  16. 21 CFR 868.5770 - Tracheal tube fixation device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...2010-04-01 2010-04-01 false Tracheal tube fixation device. 868.5770 Section...Therapeutic Devices § 868.5770 Tracheal tube fixation device. (a) Identification. A tracheal tube fixation device is a device used to...

  17. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...Spinal intervertebral body fixation orthosis. 888.3060 Section 888.3060...Spinal intervertebral body fixation orthosis. (a) Identification. A spinal intervertebral body fixation orthosis is a device intended to...

  18. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...Spinal intervertebral body fixation orthosis. 888.3060 Section 888.3060...Spinal intervertebral body fixation orthosis. (a) Identification. A spinal intervertebral body fixation orthosis is a device intended to...

  19. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...false Spinal interlaminal fixation orthosis. 888.3050 Section 888.3050...3050 Spinal interlaminal fixation orthosis. (a) Identification. A spinal interlaminal fixation orthosis is a device intended to...

  20. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...false Spinal interlaminal fixation orthosis. 888.3050 Section 888.3050...3050 Spinal interlaminal fixation orthosis. (a) Identification. A spinal interlaminal fixation orthosis is a device intended to...

  1. Carbon and nitrogen cycling in thermally heated sediments

    NASA Astrophysics Data System (ADS)

    Meyer-Dombard, D. R.; Burton, M.; Vennelakanti, S.; Havig, J. R.; Shock, E.

    2009-12-01

    Hydrothermally heated sediment environments, such as are found in abundance throughout Yellowstone National Park, host fully functional microbial ecosystems. As with any ecosystem, both sources and sinks of carbon, nitrogen, and a myriad of other nutrients and energy-driving factors must be supplied. While we know microbial communities in hydrothermal environments can be surprisingly diverse, we know little about basic ecological functions such as carbon and nitrogen cycling. Previous work has shown that carbon cycling in one hot spring in Yellowstone National Park [“Bison Pool”] and its associated runoff channel functions as a complex system. Analysis of carbon and nitrogen isotopes in sediments and biofilms across a temperature and chemical gradient at this location revealed that the four best studied carbon fixation pathways [Calvin, reverse tricarboxylic acid, acetyl-CoA, 3-hydroxypropionate cycles] may all be functioning in this system, and nitrogen fixation varies across the chemosynthetic/photosynthetic ecotone [1]. Microcosm experiments using biofilms from this hot spring as inoculae with 13C labeled carbon substrates indicate heterotrophic growth [2]. In addition, metagenomic analysis of environmental DNA has indicated the presence of genes involved in carbon fixation [both phototrophic and autotrophic], and heterotrophy, as well as nitrogen fixation [3]. Studies from other Yellowstone locations have also found genetic evidence for carbon and nitrogen fixation [4, 5]. Of particular interest is the role of individuals in carbon and nitrogen cycling as environmental conditions suitable for chemosynthetic and photosynthetic growth vary. This study explores the diversity of cbbM/cbbL [Calvin cycle], aclB/oor/porA [rTCA cycle], nifH [nitrogen fixation], nirK [nitrite reduction] and amoA [ammonia oxidation] genes across a variety of Yellowstone environments. The transition of genetic diversity within sediments and biofilms is focused on the chemosynthetic/photosynthetic ecotone from a variety of hot springs spanning a range of pH and geochemical conditions. By sampling across this ecotone, changes in carbon and nitrogen fixation as a function of changing community structure become apparent. Environmental DNA was extracted from these samples, and the presence/absence of Bacteria and Archaea determined by PCR. In addition, PCR-directed screens reveal the presence or absence of the aforementioned functional genes. Further, comparison across a broad spectrum of environmental conditions supplies context for phylogenetic analysis of diversity. [1] Havig, J.R., 2009. Geochemistry of Hydrothermal Biofilms: Composition of Biofilms in Siliceous Sinter-Deposting Hot Springs. Doctoral Dissertation, Arizona State University. [2] Meyer-Dombard et al., 2007. Microbial Diversity and SIP Investigations of Streamer Biofilm Communities in Yellowstone. Goldschmidt Geochemical Conference. [3] Raymond et al., 2008. EOS Trans AGU. Abstract B14A-03. [4] Hall et al., 2008. AEM 74:4910-4922. [5] Steunou et al., 2006. PNAS 103:2398-2403.

  2. Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}

    NASA Astrophysics Data System (ADS)

    Thomas, P. J.; Boller, A. J.; Zhao, Z.; Tabita, F. R.; Cavanaugh, C. M.; Scott, K. M.

    2006-12-01

    Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (?13C = {[13C/12Csample/13C/12Cstandard] - 1} × 1000). Five different forms of RubisCO (IA, IB, IC, ID, and II) are utilized by algae and autotrophic bacteria reliant on the Calvin-Benson cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs, and their ? values (={[12k/13k] - 1} × 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, explaining the variation in biomass ?13C values of autotrophs utilizing these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides and Ralstonia eutropha. The purpose of this work was to determine the ? values for form IC RubisCO enzymes from R. sphaeroides and R. eutropha. Recombinant form IC RubisCOs were purified by conventional column chromatography procedures. Assay conditions (pH, dissolved inorganic carbon concentration) were tested to determine which parameters were conducive to the high rates of carbon fixation necessary for ? determination. Under standard conditions (pH 8.5 and 5 mM DIC), form IC RubisCO activities were sufficient for ? determination. Experiments are currently being conducted to measure the ? values of these enzymes. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of ?13C values of organisms fixing carbon via the Calvin-Benson cycle. These results are critical for determining the degree to which Calvin cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.

  3. Appearance and accumulation of C/sub 4/ carbon pathway enzymes in developing maize leaves and differentiating maize A188 callus

    SciTech Connect

    Aoyagi, K.; Bassham, J.A.

    1986-02-01

    Regenerating maize A188 tissue cultures were examined for the presence of enzymes involved in C/sub 4/ photosynthesis, for cell morphology, and for /sup 14/C labeling kinetics to study the implementation of this pathway during plant development. For comparison, sections of maize seedling leaves were examined. Protein blot analysis using antibodies to leaf enzymes showed a different profile of these enzymes during the early stages of shoot regeneration from callus from the closely-coordinated profile observed in seedling leaves. Pyruvate orthophosphate dikinase (PPDK) (EC 2.7.9.1) and phosphoenolpyruvate carboxylase (PEPC) (EC 4.1.1.31) were found in nonchlorophyllous callus while ribulose 1,5-bisphosphate carboxylase (RuBPC, EC 4.1.1.39) and malic enzyme, NADP-specific (ME-NADP) (EC 1.3.1.37) were not detectable until later. Enzyme activity assays showed the presence of ME-NADP as well as PEPC and PPDK in nonchlorophyllous callus. However, the activities of ME-NADP and PEPC had properties similar to those of the enzymes from C/sub 3/ leaves and from etiolated C/sub 4/ leaf tissues, but differing from the corresponding enzymes in the mature leaf. Immunoprecipitation of in vitro translation products of poly(A)RNA extracted from embryoid-forming callus showed both the 110 kilodalton precursor to chloroplast PPDK and the 94 kilodalton polypeptide. Therefore, the chloroplast tye of PPDK mRNA is present prior to the appearance of leaf morphology. Analysis of the labeled products of /sup 14/CO/sub 2/ fixation by nonchlorophyllous calli indicated ..beta..-carboxylation to give acids of the tricarboxylic acid cycle, but no incorporation into phosphoglycerate. With greening of the callus, some incorporation into phosphoglycerate and sugar phosphates occurred, and this increased in shoots as they developed, although with older shoots the increase in ..beta..-carboxylation products was even greater.

  4. Eighth international congress on nitrogen fixation. Final program

    SciTech Connect

    Not Available

    1990-12-31

    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  5. Pedicle Instrumentation Failure in Thoracolumbar Fixation

    Microsoft Academic Search

    Mohamed Lotfy; Nasser M. Sayed Ahmed; Alaa A. Farag; Walid Raafat; Walid A. Badawy; Hossam Ibrahim; Islam Abou El Fotouh; Ahmed Saleh

    2007-01-01

    Objective: The authors reviewed factors related to the surgical techniques resulting in failure of the construct of the internal fixation of thoracolumbar fractures through transpedicular screw systems and how to be avoided. Patients and Methods: The authors reviewed 280 consecutive patients with traumatic thoracolumbar fractures who underwent spinal surgical fixation with short segment transpedicular screw instrumentation at three institutions, between

  6. Biochemical Approaches to Improved Nitrogen Fixation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Improving symbiotic nitrogen fixation by legumes has emerged again as an important topic on the world scene due to the energy crisis and lack of access to nitrogen fertilizer in developing countries. We have taken a biochemical genomics approach to improving symbiotic nitrogen fixation in legumes. L...

  7. Bioabsorbable fixation in orthopaedic surgery and traumatology

    Microsoft Academic Search

    Pentti U Rokkanen; Ole Böstman; Eero Hirvensalo; E. Antero Mäkelä; Esa K Partio; Hannu Pätiälä; Seppo Vainionpää; Kimmo Vihtonen; Pertti Törmälä

    2000-01-01

    Bioabsorbable internal fixation devices were introduced clinically in the treatment of fractures and osteotomies of the extremities at the Department of Orthopaedics and Traumatology, Helsinki University, in 1984. Since November 5, 1984, a total of 3200 patients were managed using bone or ligament fixation devices made of self-reinforced (matrix and fibres of the same polymer) bioabsorbable alpha-hydroxy polyesters. The devices

  8. Whole Animal Perfusion Fixation for Rodents

    PubMed Central

    Gage, Gregory J.; Kipke, Daryl R.; Shain, William

    2012-01-01

    The goal of fixation is to rapidly and uniformly preserve tissue in a life-like state. While placing tissue directly in fixative works well for small pieces of tissue, larger specimens like the intact brain pose a problem for immersion fixation because the fixative does not reach all regions of the tissue at the same rate 5,7. Often, changes in response to hypoxia begin before the tissue can be preserved 12. The advantage of directly perfusing fixative through the circulatory system is that the chemical can quickly reach every corner of the organism using the natural vascular network. In order to utilize the circulatory system most effectively, care must be taken to match physiological pressures 3. It is important to note that physiological pressures are dependent on the species used. Techniques for perfusion fixation vary depending on the tissue to be fixed and how the tissue will be processed following fixation. In this video, we describe a low-cost, rapid, controlled and uniform fixation procedure using 4% paraformaldehyde perfused via the vascular system: through the heart of the rat to obtain the best possible preservation of the brain for immunohistochemistry. The main advantage of this technique (vs. gravity-fed systems) is that the circulatory system is utilized most effectively. PMID:22871843

  9. [Intrascleral haptic fixation of intraocular lenses].

    PubMed

    Scharioth, G B

    2014-03-01

    Scharioth's intrascleral haptic fixation in cases of no or insufficient capsular support has become a standardized and safe procedure for long-term fixation of intraocular lenses. The surgical technique is explained in detail. The postoperative results have demonstrated a low complication rate and a lack of contraindications for this technique. PMID:24549683

  10. Nitrogen fixation in Lake Mendota, Madison, Wisconsin

    Microsoft Academic Search

    MARGUERITE SHERMAN TORREY; G. F. LEE

    1976-01-01

    The cffccts of various environmental conditions, and of ccl1 composition, heterocyst con- tent, and nitrogen content of algal s'amples, on fixation of N, by colonial and filamentous algae in Lake Mendota were investigated. IIctcrocyst content and temperature were significantly and positively related to accty- lcnc recluction activity ( NB fixation); depth of sample collection was negatively related. Rvailablc data do

  11. Biological nitrogen fixation in sugar cane: A key to energetically viable biofuel production

    Microsoft Academic Search

    R. M. Boddey

    1995-01-01

    The advantages of producing biofuels to replace fossil energy sources are derived from the fact that the energy accumulated in the biomass in captured directly from photosynthesis and is thus renewable, and that the cycle of carbon dioxide fixation by the crop, followed by burning of the fuel makes no overall contribution to atmospheric COâ or, consequently, to global warming.

  12. Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria.

    PubMed

    Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M; Pinhassi, Jarone

    2014-09-01

    Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light--but only in Ala--contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy. PMID:25136122

  13. Requirement of carbon dioxide for initial growth of facultative methylotroph, Acidomonas methanolica MB58.

    PubMed

    Mitsui, Ryoji; Katayama, Hiroko; Tanaka, Mitsuo

    2015-07-01

    The facultative methylotrophic bacterium Acidomonas methanolica MB58 can utilize C1 compounds via the ribulose monophosphate pathway. A large gene cluster comprising three components related to C1 metabolism was found in the genome. From upstream, the first was an mxa cluster encoding proteins for oxidation of methanol to formaldehyde; the second was the rmp cluster encoding enzymes for formaldehyde fixation; and the third was the cbb gene cluster encoding proteins for carbon dioxide (CO2) fixation. Examination of CO2 requirements for growth of A. methanolica MB58 cells demonstrated that it did not grow on any carbon source under CO2-free conditions. Measurement of ribulose-1,5-bisphosphate carboxylase activity and RT-PCR analysis demonstrated enzymatic activity was detected in A. methanolica MB58 at growth phase, regardless of carbon sources. However, methanol dehydrogenase and 3-hexlose-6-phosphate synthase expression was regulated by methanol or formaldehyde; it were detected during growth and apparently differed from ribulose-1,5-bisphosphate carboxylase expression. These results suggested that A. methanolica MB58 may be initially dependent on autotrophic growth and that carbon assimilation was subsequently coupled with the ribulose monophosphate pathway at early- to mid-log phases during methylotrophic growth. PMID:25511787

  14. Oxygen-Poor Microzones as Potential Sites of Microbial N2 Fixation in Nitrogen-Depleted Aerobic Marine Waters

    PubMed Central

    Paerl, Hans W.; Prufert, Leslie E.

    1987-01-01

    The nitrogen-deficient coastal waters of North Carolina contain suspended bacteria potentially able to fix N2. Bioassays aimed at identifying environmental factors controlling the development and proliferation of N2 fixation showed that dissolved organic carbon (as simple sugars and sugar alcohols) and particulate organic carbon (derived from Spartina alterniflora) additions elicited and enhanced N2 fixation (nitrogenase activity) in these waters. Nitrogenase activity occurred in samples containing flocculent, mucilage-covered bacterial aggregates. Cyanobacterium-bacterium aggregates also revealed N2 fixation. In all cases bacterial N2 fixation occurred in association with surficial microenvironments or microzones. Since nitrogenase is oxygen labile, we hypothesized that the aggregates themselves protected their constituent microbes from O2. Microelectrode O2 profiles revealed that aggregates had lower internal O2 tensions than surrounding waters. Tetrazolium salt (2,3,5-triphenyl-3-tetrazolium chloride) reduction revealed that patchy zones existed both within microbes and extracellularly in the mucilage surrounding microbes where free O2 was excluded. Triphenyltetrazolium chloride reduction also strongly inhibited nitrogenase activity. These findings suggest that N2 fixation is mediated by the availability of the appropriate types of reduced microzones. Organic carbon enrichment appears to serve as an energy and structural source for aggregate formation, both of which were required for eliciting N2 fixation responses of these waters. Images PMID:16347337

  15. The Contemporary Carbon Cycle

    Microsoft Academic Search

    R. A. Houghton

    2003-01-01

    The global carbon cycle refers to the exchanges of carbon within and between four major reservoirs: the atmosphere, the oceans, land, and fossil fuels. Carbon may be transferred from one reservoir to another in seconds (e.g., the fixation of atmospheric CO2 into sugar through photosynthesis) or over millennia (e.g., the accumulation of fossil carbon (coal, oil, gas) through deposition and

  16. Hepatic Progenitor Cells Contribute to the Progression of 2-Acetylaminofluorene/Carbon Tetrachloride-Induced Cirrhosis via the Non-Canonical Wnt Pathway

    PubMed Central

    Chen, Jiamei; Zhang, Xiao; Xu, Ying; Li, Xuewei; Ren, Shuang; Zhou, Yaning; Duan, Yuyou; Zern, Mark; Zhang, Hua; Chen, Gaofeng; Liu, Chenghai

    2015-01-01

    Hepatic progenitor cells (HPCs) appear to play an important role in chronic liver injury. In this study, cirrhosis was induced in F-344 rats (n = 32) via subcutaneous injection of 50% carbon tetrachloride (CCl4) twice a week for 8 weeks. Then, 30% CCl4 was administered in conjunction with intragastric 2-acetylaminofluorine (2-AAF) for 4 weeks to induce activation of HPCs. WB-F344 cells were used to provide direct evidence for differentiation of HPCs to myofibroblasts. The results showed that after administration of 2-AAF, the hydroxyproline content and the expressions of ?-SMA, Col I, Col IV, TGF-?1, CD68, TNF-?, CK19 and OV6 were significantly increased. OV6 and ?-SMA were largely co-expressed in fibrous septum and the expressions of Wnt5b, frizzled2, frizzled3 and frizzled6 were markedly increased, while ?-catenin expression was not statistically different among the different groups. Consistent with the above results, WB-F344 cells, treated with TGF-?1 in vitro, differentiated into myofibroblasts and ?-SMA, Col I, Col IV, Wnt5b and frizzled2 expressions were significantly increased, while ?-catenin expression was decreased. After blocking the non-canonical Wnt pathway via WIF-1, the Wnt5b level was down regulated, and ?-SMA and F-actin expressions were significantly decreased in the WIF-1-treated cells. In conclusion, these results indicate that HPCs appear to differentiate into myofibroblasts and exhibit a profibrotic effect in progressive cirrhosis via activation of the non-canonical Wnt pathway. Blocking the non-canonical Wnt pathway can inhibit the differentiation of HPCs into myofibroblasts, suggesting that blocking this pathway and changing the fate of differentiated HPCs may be a potential treatment for cirrhosis. PMID:26087010

  17. Heme oxygenase/carbon monoxide-biliverdin pathway may be involved in the antinociceptive activity of etoricoxib, a selective COX-2 inhibitor.

    PubMed

    Grangeiro, Niedja M G; Aguiar, Jordana A; Chaves, Hellíada V; Silva, Antonio A R; Lima, Vilma; Benevides, Norma M B; Brito, Gerly A C; da Graça, José R V; Bezerra, Mirna M

    2011-01-01

    The aim of this study was to assess the interaction between the heme oxygenase-1/ biliverdin/carbon monoxide (HO-1/BVD/CO) and cyclooxygenase-2 (COX-2) pathways in the writhing test. Mice were pretreated with 0.1, 1 or 10 mg/kg, ip etoricoxib, a selective COX-2 inhibitor, or with one of the following HO-1/BVD/CO pathway modulators: 1, 3 or 9 mg/kg, sc ZnPP IX, a specific HO-1 inhibitor, 0.3, 1 or 3 mg/kg, sc hemin, a substrate of the HO-1/BVD/CO pathway; or 0.00025, 0.025 or 2.5 ?mol/kg, sc DMDC, a CO donor. Mice pretreated with etoricoxib or one of the HO-1/BVD/CO pathway modulators received an injection of acetic acid (ip) after 30 and 60 min, respectively. Next, the number of writhes was quantified between 0 and 30 min after stimulus injection. In another series of experiments, ineffective doses of etoricoxib were co-administered with hemin or DMDC and an effective dose of etoricoxib with ZnPP IX, followed by an acetic acid injection. Four hours after the acetic acid injection, levels of bilirubin, which is a product of BVD conversion by the BVD reductase enzyme, in the peritoneal lavage were determined. Hemin or DMDC reduced (p<0.05) the number of writhes, but ZnPP IX potentiated (p<0.05) the effect of acetic acid by increasing (p < 0.05) the number of writhes. The co-administration of etoricoxib with hemin or DMDC reduced (p<0.05) the number of writhes. However, the analgesic effect of etoricoxib was not observed in the presence of ZnPP IX. Pretreatment with ZnPP IX reduced bilirubin levels, but etoricoxib pretreatment significantly increased the bilirubin concentration in peritoneal exudates. The data obtained from these experiments showed that the HO-1/BVD/CO pathway was activated in the acetic acid-induced abdominal writhing model. The analgesic effect of etoricoxib was at least partially dependent on the participation of the HO-1/BVD/CO pathway. PMID:21441618

  18. Direct and Indirect Costs of Dinitrogen Fixation in Crocosphaera watsonii WH8501 and Possible Implications for the Nitrogen Cycle

    PubMed Central

    Großkopf, Tobias; LaRoche, Julie

    2012-01-01

    The recent detection of heterotrophic nitrogen (N2) fixation in deep waters of the southern Californian and Peruvian OMZ questions our current understanding of marine N2 fixation as a process confined to oligotrophic surface waters of the oceans. In experiments with Crocosphaera watsonii WH8501, a marine unicellular diazotrophic (N2 fixing) cyanobacterium, we demonstrated that the presence of high nitrate concentrations (up to 800??M) had no inhibitory effect on growth and N2 fixation over a period of 2?weeks. In contrast, the environmental oxygen concentration significantly influenced rates of N2 fixation and respiration, as well as carbon and nitrogen cellular content of C. watsonii over a 24-h period. Cells grown under lowered oxygen atmosphere (5%) had a higher nitrogenase activity and respired less carbon during the dark cycle than under normal oxygen atmosphere (20%). Respiratory oxygen drawdown during the dark period could be fully explained (104%) by energetic needs due to basal metabolism and N2 fixation at low oxygen, while at normal oxygen these two processes could only account for 40% of the measured respiration rate. Our results revealed that under normal oxygen concentration most of the energetic costs during N2 fixation (?60%) are not derived from the process of N2 fixation per se but rather from the indirect costs incurred for the removal of intracellular oxygen or by the reversal of oxidative damage (e.g., nitrogenase de novo synthesis). Theoretical calculations suggest a slight energetic advantage of N2 fixation relative to assimilatory nitrate uptake, when oxygen supply is in balance with the oxygen requirement for cellular respiration (i.e., energy generation for basal metabolism and N2 fixation). Taken together our results imply the existence of a niche for diazotrophic organisms inside oxygen minimum zones, which are predicted to further expand in the future ocean. PMID:22833737

  19. Carbon and nitrogen metabolism in Rhizobium.

    PubMed

    Poole, P; Allaway, D

    2000-01-01

    One of the paradigms of symbiotic nitrogen fixation has been that bacteroids reduce N2 to ammonium and secrete it without assimilation into amino acids. This has recently been challenged by work with soybeans showing that only alanine is excreted in 15N2 labelling experiments. Work with peas shows that the bacteroid nitrogen secretion products during in vitro experiments depend on the experimental conditions. There is a mixed secretion of both ammonium and alanine depending critically on the concentration of bacteroids and ammonium concentration. The pathway of alanine synthesis has been shown to be via alanine dehydrogenase, and mutation of this enzyme indicates that in planta there is likely to be mixed secretion of ammonium and alanine. Alanine synthesis directly links carbon catabolism and nitrogen assimilation in the bacteroid. There is now overwhelming evidence that the principal carbon sources of bacteroids are the C4-dicarboxylic acids. This is based on labelling and bacteroid respiration data, and mutation of both the dicarboxylic acid transport system (dct) and malic enzyme. L-malate is at a key bifurcation point in bacteroid metabolism, being oxidized to oxaloacetate and oxidatively decarboxylated to pyruvate. Pyruvate can be aminated to alanine or converted to acetyl-CoA where it either enters the TCA cycle by condensation with oxaloacetate or forms polyhydroxybutyrate (PHB). Thus regulation of carbon and nitrogen metabolism are strongly connected. Efficient catabolism of C4-dicarboxylates requires the balanced input and removal of intermediates from the TCA cycle. The TCA cycle in bacteroids may be limited by the redox state of NADH/NAD+ at the 2-ketoglutarate dehydrogenase complex, and a number of pathways may be involved in bypassing this block. These pathways include PHB synthesis, glutamate synthesis, glycogen synthesis, GABA shunt and glutamine cycling. Their operation may be critical in maintaining the optimum redox poise and carbon balance of the TCA cycle. They can also be considered to be overflow pathways since they act to remove or add electrons and carbon into the TCA cycle. Optimum operation of the TCA cycle has a major impact on nitrogen fixation. PMID:10907556

  20. Methodological Underestimation of Oceanic Nitrogen Fixation Rates

    PubMed Central

    Mohr, Wiebke; Großkopf, Tobias; Wallace, Douglas W. R.; LaRoche, Julie

    2010-01-01

    The two commonly applied methods to assess dinitrogen (N2) fixation rates are the 15N2-tracer addition and the acetylene reduction assay (ARA). Discrepancies between the two methods as well as inconsistencies between N2 fixation rates and biomass/growth rates in culture experiments have been attributed to variable excretion of recently fixed N2. Here we demonstrate that the 15N2-tracer addition method underestimates N2 fixation rates significantly when the 15N2 tracer is introduced as a gas bubble. The injected 15N2 gas bubble does not attain equilibrium with the surrounding water leading to a 15N2 concentration lower than assumed by the method used to calculate 15N2-fixation rates. The resulting magnitude of underestimation varies with the incubation time, to a lesser extent on the amount of injected gas and is sensitive to the timing of the bubble injection relative to diel N2 fixation patterns. Here, we propose and test a modified 15N2 tracer method based on the addition of 15N2-enriched seawater that provides an instantaneous, constant enrichment and allows more accurate calculation of N2 fixation rates for both field and laboratory studies. We hypothesise that application of N2 fixation measurements using this modified method will significantly reduce the apparent imbalances in the oceanic fixed-nitrogen budget. PMID:20838446

  1. Glycolate Pathway in Algae 1

    PubMed Central

    Hess, J. L.; Tolbert, N. E.

    1967-01-01

    No glycolate oxidase activity could be detected by manometric, isotopic, or spectrophotometric techniques in cell extracts from 5 strains of algae grown in the light with CO2. However, NADH:glyoxylate reductase, phosphoglycolate phosphatase and isocitrate dehydrogenase were detected in the cell extracts. The serine formed by Chlorella or Chlamydomonas after 12 seconds of photosynthetic 14CO2 fixation contained 70 to 80% of its 14C in the carboxyl carbon. This distribution of label in serine was similar to that in phosphoglycerate from the same experiment. Thus, in algae serine is probably formed directly from phosphoglycerate. These results differ from those of higher plants which form uniformly labeled serine from glycolate in short time periods when phosphoglycerate is still carboxyl labeled. In glycolate formed by algae in 5 and 10 seconds of 14CO2 fixation, C2 was at least twice as radioactive as C1. A similar skewed labeling in C2 and C3 of 3-phosphoglycerate and serine suggests a common precursor for glycolate and 3-phosphoglycerate. Glycine formed by the algae, however, from the same experiments was uniformly labeled. Manganese deficient Chlorella incorporated only 2% of the total 14CO2 fixed in 10 minutes into glycolate, while in normal Chlorella 30% of the total 14C was found in glycolate. Manganese deficient Chlorella also accumulated more 14C in glycine and serine. Glycolate excretion by Chlorella was maximal in 10 mm bicarbonate and occurred only in the light, and was not influenced by the addition of glycolate. No time dependent uptake of significant amounts of either glycolate or phosphoglycolate was observed. When small amounts of glycolate-2-14C were fed to Chlorella or Scenedesmus, only 2 to 3% was metabolized after 30 to 60 minutes. The algae were not capable of significant glycolate metabolism as is the higher plant. The failure to detect glycolate oxidase, the low level glycolate-14C metabolism, and the formation of serine from phosphoglycerate rather than from glycolate are consistent with the concept of an incomplete glycolate pathway in algae. PMID:6045296

  2. Artificial photosynthesis of. beta. -ketocarboxylic acids from carbon dioxide and ketones via enolate complexes of aluminum porphyrin

    SciTech Connect

    Hirai, Yasuhiro; Aida, Takuzo; Inoue, Shohei (Univ. of Tokyo (Japan))

    1989-04-12

    Photochemical fixation of carbon dioxide is of much interest in connection with biological photosynthesis by green plants as well as from the viewpoint of carbon resource utilization. One of the important steps in the assimilation of carbon dioxide is the carboxylation of a carbonyl compound into ketocarboxylic acid, where the reaction proceeds via an enolate species as reactive intermediate. For example, in four carbon (C{sub 4}) pathway and Crassulacean acid metabolism (CAM) processes, pyruvate is converted with the aid of ATP into phosphoenolpyruvate, which is subsequently carboxylated to give oxaloacetate by the action of pyruvate carboxylase. In relation to this interesting biological process, some artificial systems have been exploited for the synthesis of {beta}-ketocarboxylic acid derivatives from carbon dioxide and ketones using nucleophiles such as metal carbonates, thiazolates, phenolates, alkoxides, and strong organic as well as inorganic basis, which promote the enolization of ketones in the intermediate step. We wish to report here a novel, visible light-induced fixation of carbon dioxide with the enolate complex of aluminum porphyrin, giving {beta}-ketocarboxylic acid under mild conditions.

  3. Genetic evidence of a major role for glucose-6-phosphate dehydrogenase in nitrogen fixation and dark growth of the cyanobacterium Nostoc sp. strain ATCC 29133.

    PubMed Central

    Summers, M L; Wallis, J G; Campbell, E L; Meeks, J C

    1995-01-01

    Heterocysts, sites of nitrogen fixation in certain filamentous cyanobacteria, are limited to a heterotrophic metabolism, rather than the photoautotrophic metabolism characteristic of cyanobacterial vegetative cells. The metabolic route of carbon catabolism in the supply of reductant to nitrogenase and for respiratory electron transport in heterocysts is unresolved. The gene (zwf) encoding glucose-6-phosphate dehydrogenase (G6PD), the initial enzyme of the oxidative pentose phosphate pathway, was inactivated in the heterocyst-forming, facultatively heterotrophic cyanobacterium, Nostoc sp. strain ATCC 29133. The zwf mutant strain had less than 5% of the wild-type apparent G6PD activity, while retaining wild-type rates of photoautotrophic growth with NH4+ and of dark O2 uptake, but it failed to grow either under N2-fixing conditions or in the dark with organic carbon sources. A wild-type copy of zwf in trans in the zwf mutant strain restored only 25% of the G6PD specific activity, but the defective N2 fixation and dark growth phenotypes were nearly completely complemented. Transcript analysis established that zwf is in an operon also containing genes encoding two other enzymes of the oxidative pentose phosphate cycle, fructose-1,6-bisphosphatase and transaldolase, as well as a previously undescribed gene (designated opcA) that is cotranscribed with zwf. Inactivation of opcA yielded a growth phenotype identical to that of the zwf mutant, including a 98% decrease, relative to the wild type, in apparent G6PD specific activity. The growth phenotype and lesion of G6PD activity in the opcA mutant were complemented in trans with a wild-type copy of opcA. In addition, placement in trans of a multicopy plasmid containing the wild-type copies of both zwf and opcA in the zwf mutant resulted in an approximately 20-fold stimulation of G6PD activity, relative to the wild type, complete restoration of nitrogenase activity, and a slight stimulation of N2-dependent photoautotrophic growth and fructose-supported dark growth. These results unequivocally establish that G6PD, and most likely the oxidative pentose phosphate pathway, represents the essential catabolic route for providing reductant for nitrogen fixation and respiration in differentiated heterocysts and for dark growth of vegetative cells. Moreover, the opcA gene product is involved by an as yet unknown mechanism in G6PD synthesis or catalytic activity. PMID:7592384

  4. Carbon metabolism in legume nodules. Progress report, July 1982-July 1983

    SciTech Connect

    LaRue, T.A.

    1983-01-01

    The goal is to understand how the legume nodule metabolizes carbohydrate to provide energy and reductant for symbiotic fixation. The working hypothesis has been that the plant cytosol is microacrobic and that some carbon metabolism may be via anaerobic pathways similar to those in roots of flood tolerant plants. A method of analyzing redox changes in intact mitochondria, bacteroids or bacteria was adapted; a method of manipulating nitrogenase activity by oxygen inhibition was developed; the production of alcohol by soybean nodules was studied; and enzymes metabolizing alcohol/aldehyde were found in other nitrogen fixing systems. (ACR)

  5. Biosynthesis of novel carotenoid families based on unnatural carbon backbones: A model for diversification of natural product pathways

    E-print Network

    Arnold, Frances H.

    Biosynthesis of novel carotenoid families based on unnatural carbon backbones: A model Available online 30 January 2006 Abstract We show that the C40 carotenoid desaturase CrtI from Pantoea ananatis (Erwinia uredovora) is capable of desaturating unnaturally long C45 and C50 carotenoid backbones

  6. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion

    PubMed Central

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

    2013-01-01

    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C?C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

  7. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion.

    PubMed

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

    2013-01-01

    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N?) does not easily react with other chemicals. By dry ball-milling graphite with N?, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N? at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C--C bonds generated active carbon species that react directly with N? to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

  8. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

    2014-12-01

    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and Arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multiyear mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) buildup and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  9. Nitrogen fixation on Arctic glaciers, Svalbard

    NASA Astrophysics Data System (ADS)

    Telling, Jon; Anesio, Alexandre M.; Tranter, Martyn; Irvine-Fynn, Tristram; Hodson, Andy; Butler, Catriona; Wadham, Jemma

    2011-09-01

    Glacier surfaces contain a wide diversity of microorganisms and can host a range of microbial activities. However, microbial nutrient cycling on glaciers is poorly understood. This study is the first to document nitrogen fixation (nitrogenase activity) on glaciers and demonstrate its importance in supporting microbial growth. Rates of nitrogen fixation (nitrogenase activity) in cryoconite holes on three valley glaciers in Svalbard ranged from <2.0 to 99.9 ?mol ethylene m-2 d-1 with rates inversely correlated to concentrations of available inorganic nitrogen. Annual inputs of nitrogen by nitrogen fixation on a glacier catchment scale are more than 2 orders of magnitude lower than the combined nitrogen inputs from snowmelt and rain. However, nitrogen fixation can be important for supporting microbial growth on the glaciers during the middle to late melt season after the snowline has retreated upslope.

  10. Carbon ion beam triggers both caspase-dependent and caspase-independent pathway of apoptosis in HeLa and status of PARP-1 controls intensity of apoptosis.

    PubMed

    Ghorai, Atanu; Sarma, Asitikantha; Bhattacharyya, Nitai P; Ghosh, Utpal

    2015-04-01

    High linear energy transfer (LET) carbon ion beam (CIB) is becoming very promising tool for various cancer treatments and is more efficient than conventional low LET gamma or X-rays to kill malignant or radio-resistant cells, although detailed mechanism of cell death is still unknown. Poly (ADP-ribose) polymerase-1 (PARP-1) is a key player in DNA repair and its inhibitors are well-known as radio-sensitizer for low LET radiation. The objective of our study was to find mechanism(s) of induction of apoptosis by CIB and role of PARP-1 in CIB-induced apoptosis. We observed overall higher apoptosis in PARP-1 knocked down HeLa cells (HsiI) compared with negative control H-vector cells after irradiation with CIB (0-4 Gy). CIB activated both intrinsic and extrinsic pathways of apoptosis via caspase-9 and caspase-8 activation respectively, followed by caspase-3 activation, apoptotic body, nucleosomal ladder formation and sub-G1 accumulation. Apoptosis inducing factor translocation into nucleus in H-vector but not in HsiI cells after CIB irradiation contributed caspase-independent apoptosis. Higher p53 expression was observed in HsiI cells compared with H-vector after exposure with CIB. Notably, we observed about 37 % fall of mitochondrial membrane potential, activation of caspase-9 and caspase-3 and mild activation of caspase-8 without any detectable apoptotic body formation in un-irradiated HsiI cells. We conclude that reduction of PARP-1 expression activates apoptotic signals via intrinsic and extrinsic pathways in un-irradiated cells. CIB irradiation further intensified both intrinsic and extrinsic pathways of apoptosis synergistically along with up-regulation of p53 in HsiI cells resulting overall higher apoptosis in HsiI than H-vector. PMID:25670618

  11. Proteomic analysis of carbon concentrating chemolithotrophic bacteria Serratia sp. for sequestration of carbon dioxide.

    PubMed

    Bharti, Randhir K; Srivastava, Shaili; Thakur, Indu Shekhar

    2014-01-01

    A chemolithotrophic bacterium enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was identified as Serratia sp. by 16S rRNA sequencing. Carbon dioxide sequestering capacity of bacterium was detected by carbonic anhydrase enzyme and ribulose-1, 5- bisphosphate carboxylase/oxygenase (RuBisCO). The purified carbonic anhydrase showed molecular weight of 29 kDa. Molecular weight of RuBisCO was 550 kDa as determined by fast protein liquid chromatography (FPLC), however, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) showed presence of two subunits whose molecular weights were 56 and 14 kDa. The Western blot analysis of the crude protein and purified sample cross reacted with RuBisCO large-subunit polypeptides antibodies showed strong band pattern at molecular weight around 56 kDa regions. Whole cell soluble proteins of Serratia sp. grown under autotrophic and heterotrophic conditions were resolved by two-dimensional gel electrophoresis and MALDI-TOF/MS for differential expression of proteins. In proteomic analysis of 63 protein spots, 48 spots were significantly up-regulated in the autotrophically grown cells; seven enzymes showed its utilization in autotrophic carbon fixation pathways and other metabolic activities of bacterium including lipid metabolisms indicated sequestration potency of carbon dioxide and production of biomaterials. PMID:24619032

  12. Proteomic Analysis of Carbon Concentrating Chemolithotrophic Bacteria Serratia sp. for Sequestration of Carbon Dioxide

    PubMed Central

    Bharti, Randhir K.; Srivastava, Shaili; Thakur, Indu Shekhar

    2014-01-01

    A chemolithotrophic bacterium enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was identified as Serratia sp. by 16S rRNA sequencing. Carbon dioxide sequestering capacity of bacterium was detected by carbonic anhydrase enzyme and ribulose-1, 5- bisphosphate carboxylase/oxygenase (RuBisCO). The purified carbonic anhydrase showed molecular weight of 29 kDa. Molecular weight of RuBisCO was 550 kDa as determined by fast protein liquid chromatography (FPLC), however, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) showed presence of two subunits whose molecular weights were 56 and 14 kDa. The Western blot analysis of the crude protein and purified sample cross reacted with RuBisCO large-subunit polypeptides antibodies showed strong band pattern at molecular weight around 56 kDa regions. Whole cell soluble proteins of Serratia sp. grown under autotrophic and heterotrophic conditions were resolved by two-dimensional gel electrophoresis and MALDI-TOF/MS for differential expression of proteins. In proteomic analysis of 63 protein spots, 48 spots were significantly up-regulated in the autotrophically grown cells; seven enzymes showed its utilization in autotrophic carbon fixation pathways and other metabolic activities of bacterium including lipid metabolisms indicated sequestration potency of carbon dioxide and production of biomaterials. PMID:24619032

  13. Pin loosening in external skeletal fixation 

    E-print Network

    Vittal, Bamini

    1993-01-01

    OF TABLES Page TABLE 1 Table showing the problems and complications of external fixations. TABLE 2 Table showing the experimental design. . . 22 TABLE 3 Table showing the number of cadaver dogs tested and the twist out rates and the pull out rates... included a chapter outlining technical details pertinent to the prevention of unnecessary complications associated with the use of external fixation. While their discussion of the strategies for avoiding complications was extensive, Shaar and Document...

  14. Biological nitrogen fixation: A scientific perspective

    Microsoft Academic Search

    R. H. Burris

    1988-01-01

    The discoveries of Hellriegel and Wilfarth ended the period of controversy about the existence of biological N2 fixation and launched a period featuring the agronomic application of the inoculation of legumes. Serious studies of the\\u000a biochemistry of N2 fixation started in the late 1920's, and defined some of the basic properties of the N2-fixing system. Application of15N as a tracer

  15. Stability of external skeletal fixation clamps

    E-print Network

    Sandel, Mark Eugene

    1995-01-01

    STABILITY OF EXTERNAL SKELETAL FIXATION CLAMPS A Thesis by MARK EUGENE SANDEL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 1995 Major... Eugene Sandel, B. S. , Texas A%M University Chair of Advisory Committee: Dr. William A. Hyman External skeletal fixation is commonly used for treatment of many orthopedic diseases and injuries in both human and animal patients. It is mainly used...

  16. Contribution of dinitrogen fixation to bacterial and primary productivity in the Gulf of Aqaba (Red Sea)

    NASA Astrophysics Data System (ADS)

    Rahav, E.; Herut, B.; Mulholland, M. R.; Voß, B.; Stazic, D.; Steglich, C.; Hess, W. R.; Berman-Frank, I.

    2013-06-01

    We evaluated the seasonal contribution of heterotrophic and autotrophic diazotrophy to the total dinitrogen (N2) fixation in a representative pelagic station in the northern Gulf of Aqaba in early spring when the water column was mixed and during summer under full thermal stratification. N2 fixation rates were low during the mixed period (˜ 0.1 nmol N L-1 d-1) and were significantly coupled with both primary and bacterial productivity. During the stratified period N2 fixation rates were four-fold higher (˜ 0.4 nmol N L-1 d-1) and were significantly correlated solely with bacterial productivity. Furthermore, while experimental enrichment of seawater by phosphorus (P) enhanced bacterial productivity and N2 fixation rates during both seasons primary productivity was stimulated by P only in the early spring. Metatranscriptomic analyses from the stratified period identified the major diazotrophic contributors as related to heterotrophic prokaryotes from the Euryarchaeota and Desulfobacterales (Deltaproteobacteria) or Chlorobiales (Chlorobia). Moreover, during this season, experimental amendments to seawater applying a combination of the photosynthetic inhibitor 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and a mixture of amino acids increased both bacterial productivity and N2 fixation rates. Our findings from the northern Gulf of Aqaba indicate a~shift in the diazotrophic community from phototrophic and heterotrophic populations, including small blooms of the cyanobacterium Trichodesmium, in winter/early spring, to predominantly heterotrophic diazotrophs in summer that may be both P and carbon limited as the additions of P and amino acids illustrated.

  17. Influence of chemical and freezing fixation methods in the freeze-fracture of stratum corneum.

    PubMed

    López, O; López-Iglesias, C; Cócera, M; Walther, P; Parra, J L; De La Maza, A

    2004-06-01

    A comparison between two fixation techniques for freeze-fracture was established. Stratum corneum (SC) samples from pig epidermis were fixed using high-pressure freezing (HPF) and using plunging in propane freezing; the latter after chemical fixation. Then, frozen samples were freeze-fractured, coated with platinum-carbon, and visualized using a high-resolution low-temperature scanning electron microscope and a transmission electron microscope. Our results indicate that the plane of freeze-fracture was different depending on the fixation and freezing methodology used. In the samples frozen by HPF without chemical fixation, the fracture plane laid mainly between the lipid lamellae. However, when chemical fixation and plunging in propane freezing was used, the fracture plane did not show preference to a specific way. Plunging in propane freezing of chemically fixed samples, on the other hand, provides a more homogeneous fracture behaviour. Thus, depending on the methodology used, we can favour a visualization of either lipid or protein domains of the SC. These results could be very useful in future ultrastructural studies in order to facilitate the microscopic visualization and interpretation of the complex images such as those of SC and even of other samples in which different domains coexist. PMID:15099572

  18. Fracture fixation problems in osteoporosis.

    PubMed

    Strømsøe, Knut

    2004-02-01

    Osteoporosis, or loss of bone mass and microarchitectural deterioration of bone tissue, does not only enhance risk of fracture but also represents a problem in osteofixation of fractures in fracture treatment. Aging of the western population changes the epidemiology of fractures. An increasing socioeconomic interest in geriatric traumatology makes the need for much urgent study in the field of osteoporotic fractures self evident. It is no longer the province of only one medical group to look for fragmented solutions in the treatment of osteoporotic fractures. Efforts have to be united across professional boundaries to meet the challenge of this problem. Assessment of bone mineral may be used in evaluation of fracture risk but also in the choice of implant as well as in the design of implants used in fracture treatment. The differences in mechanical properties of different types of bone in the same individual have to be respected. Changes in the pattern of fractures and problems with implant anchorage in bone, due to a demographic increase in patients with osteoporosis remain problems requiring new solutions. Still basic principals in fracture treatment may not be eclipsed by new fixation devices. PMID:14736465

  19. Carbon monoxide protects hepatocytes from TNF-?\\/Actinomycin D by inhibition of the caspase-8-mediated apoptotic pathway

    Microsoft Academic Search

    Hoe Suk Kim; Patricia A. Loughran; Peter K. Kim; Timothy R. Billiar; Brian S. Zuckerbraun

    2006-01-01

    We have previously shown that carbon monoxide (CO) (250ppm) prevented tumor necrosis factor-? (TNF?)-induced apoptosis and activated the transcription factor NF-?B in hepatocytes both in vivo and in vitro. These studies were conducted to further determine the mechanisms by which CO suppresses apoptotic signaling in TNF? (10ng\\/ml) and Actinomycin D (ActD, 200ng\\/ml)-treated hepatocytes. Consistent with our previous findings, CO protected

  20. Carboxylation of multiwalled carbon nanotube attenuated the cytotoxicity by limiting the oxidative stress initiated cell membrane integrity damage, cell cycle arrestment, and death receptor mediated apoptotic pathway.

    PubMed

    Liu, Zhenbao; Liu, Yanfei; Peng, Dongming

    2015-08-01

    In this study, the effects of carboxylated multiwalled carbon nanotubes (MWCNTs-COOH) on human normal liver cell line L02 was compared with that of pristine multiwalled carbon nanotubes (p-MWCNTs). It was shown that compared with MWCNTs-COOH, p-MWCNTs induced apoptosis, reduced the level of intracellular antioxidant glutathione more significantly, and caused severer cell membrane damage as demonstrated by lactate dehydrogenase leakage. Cell cycles were arrested by both MWCNTs, while p-MWCNTs induced higher ratio of G0/G1 phase arrestment as compared with MWCNTs-COOH. Caspase-8 was also activated after both MWCNTs exposure, indicating extrinsic apoptotic pathway was involved in the apoptosis induced by MWCNTs exposure, more importantly, MWCNTs-COOH significantly reduced the activation of caspase-8 as compared with p-MWCNTs. All these results suggested that MWCNTs-COOH might be safer for in vivo application as compared with p-MWCNTs. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 103A: 2770-2777, 2015. PMID:25684371

  1. Quantum Chemistry Study of Cycloaddition Pathways for the Reaction of o-Benzyne with Fullerenes and Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Jaffe, Richard; Han, Jie; Langhoff, Stephen R. (Technical Monitor)

    1997-01-01

    Functionalization of fullerenes via the [2+2] cycloaddition reaction with o-benzyne has been demonstrated in the laboratory. In contrast, [2+4) cycloaddition products are formed when benzyne reacts with planar polycyclic aromatic hydrocarbons. Using density functional theory (DFT) calculations with Becke's hybrid functional and small contracted gaussian basis sets, we are able to reproduce these product preferences. The objective of this work is to explore the functionalization of carbon nanotubes. We have studied o-benzyne cycloaddition products with a [14,0] single-walled nanotube. We find both the [2+2] and [2+4] adducts to be stable, with the latter product being somewhat favored.

  2. The importance of regulation of nitrogen fixation

    NASA Astrophysics Data System (ADS)

    Menge, D. N.

    2012-12-01

    I am not a proponent of including more detail in models simply because it makes them more realistic. More complexity increases the difficulty of model interpretation, so it only makes sense to include complexity if its benefit exceeds its costs. Biological nitrogen (N) fixation (BNF) is one process for which I feel the benefits of including greater complexity far outweigh the costs. I don't think that just because I work on BNF; I work on BNF because I think that. BNF, a microbial process carried out by free-living and symbiotic microbes, is the dominant N input to many ecosystems, the primary mechanism by which N deficiency can feed back to N inputs, and a main mechanism by which N surplus can develop. The dynamics of BNF, therefore, have huge implications for the rate of carbon uptake and the extent of CO2 fertilization, as well as N export to waterways and N2O emissions to the atmosphere. Unfortunately, there are serious deficiencies in our understanding of BNF. One main deficiency in our understanding is the extent to which various symbiotic N fixing organisms respond to imbalanced nutrition. Theory suggests that these responses, which I will call "strategies," have fundamental consequences for N fixer niches and ecosystem-level N and C cycling. Organisms that fix N regardless of whether they need it, a strategy that I will call "obligate," occupy post-disturbance niches and rapidly lead to N surplus. On the contrary, organisms that only fix as much N as they need, a "facultative" strategy, can occupy a wider range of successional niches, do not produce surplus N, and respond more rapidly to increased atmospheric CO2. In this talk I will show new results showing that consideration of these strategies could on its own explain the latitudinal distribution of symbiotic N fixing trees in North America. Specifically, the transition in N-fixing tree abundance from ~10% of basal area south of 35° latitude to ~1% of basal area north of 35° latitude that we observe from systematic forest inventory data can be explained by a concomitant switch from predominantly facultative N-fixing trees to predominantly obligate N-fixing trees. This transition in the dominant N-fixing strategy would have important consequences for the rate at which CO2 fertilization can occur and the extent of N surplus in different biomes. These theoretical and forest inventory results suggest that greater knowledge of BNF strategies would greatly increase our understanding of the distribution of N fixers and ecosystem responses to global change. I will finish the talk with a brief literature synthesis that attempts to draw generalizations about BNF strategies. With the limited data available, actinorhizal symbioses in temperate environments appear to be obligate but rhizobial symbioses appear to employ different strategies in different environments. From these results it is unclear whether the strategy is more strongly influenced by the microbes, the plants, or the environments in which the symbiosis has evolved; answering this question would point toward the best ways to incorporate N fixation into global ecosystem models.

  3. The Fixation and Saccade P3

    PubMed Central

    Dandekar, Sangita; Ding, Jian; Privitera, Claudio; Carney, Thom; Klein, Stanley A.

    2012-01-01

    Although most instances of object recognition during natural viewing occur in the presence of saccades, the neural correlates of objection recognition have almost exclusively been examined during fixation. Recent studies have indicated that there are post-saccadic modulations of neural activity immediately following eye movement landing; however, whether post-saccadic modulations affect relatively late occurring cognitive components such as the P3 has not been explored. The P3 as conventionally measured at fixation is commonly used in brain computer interfaces, hence characterizing the post-saccadic P3 could aid in the development of improved brain computer interfaces that allow for eye movements. In this study, the P3 observed after saccadic landing was compared to the P3 measured at fixation. No significant differences in P3 start time, temporal persistence, or amplitude were found between fixation and saccade trials. Importantly, sensory neural responses canceled in the target minus distracter comparisons used to identify the P3. Our results indicate that relatively late occurring cognitive neural components such as the P3 are likely less sensitive to post saccadic modulations than sensory neural components and other neural activity occurring shortly after eye movement landing. Furthermore, due to the similarity of the fixation and saccade P3, we conclude that the P3 following saccadic landing could possibly be used as a viable signal in brain computer interfaces allowing for eye movements. PMID:23144959

  4. Nitrogen fixation and nitrogen fertilization of soybeans.

    PubMed

    Merbach, W; Jacob, H J

    1996-08-01

    Abstract In pot experiments with (15)N labelled soil and mineral (15)N, the influence of Bradyrhizobium (Rhizobium japonicum) inoculation and N fertilization on the symbiotic N(2) fixation and yield of soybeans [Glycine max (L.) Merill., cv. 'Fiskeby V'] was investigated. Symbiotic N(2) fixation only occured after inoculation with Bradyrhizobium. Considerable differences in efficiency of the bacterial preparations were observed. Shortly after flowering, the symbiotic nitrogen fixation was finished and, subsequently, soybeans took up considerable N amounts from the soil. N fertilization at seeding suppressed N(2) fixation of soybeans. In this case, the dry matter and nitrogen yield increased, because the loss of fixed nitrogen was overcompensated by the mineral N uptake. During flowering of soybeans, the N(2) fixation was not affected by N supply, because this process was already terminated. The mineral N was additionally available to the plants and led to increased N amounts in plants. It was absorbed to a considerable degree by soybeans. The mineral N was translocated (partly, after intermediate storage in the vegetative organs) into the seeds thus increasing their yields. PMID:22088108

  5. Increase in cell motility by carbon ion irradiation via the Rho signaling pathway and its inhibition by the ROCK inhibitor Y-27632 in lung adenocarcinoma A549 cells.

    PubMed

    Murata, Kazutoshi; Noda, Shin-ei; Oike, Takahiro; Takahashi, Akihisa; Yoshida, Yukari; Suzuki, Yoshiyuki; Ohno, Tatsuya; Funayama, Tomoo; Kobayashi, Yasuhiko; Takahashi, Takeo; Nakano, Takashi

    2014-07-01

    This study aimed to investigate the effect of carbon ion (C-ion) irradiation on cell motility through the ras homolog gene family member (Rho) signaling pathway in the human lung adenocarcinoma cell line A549. Cell motility was assessed by a wound-healing assay, and the formation of cell protrusions was evaluated by F-actin staining. Cell viability was examined by the WST-1 assay. The expression of myosin light chain 2 (MLC2) and the phosphorylation of MLC2 at Ser19 (P-MLC2-S19) were analyzed by Western blot. At 48 h after irradiation, the wound-healing assay demonstrated that migration was significantly greater in cells irradiated with C-ion (2 or 8 Gy) than in unirradiated cells. Similarly, F-actin staining showed that the formation of protrusions was significantly increased in cells irradiated with C-ion (2 or 8 Gy) compared with unirradiated cells. The observed increase in cell motility due to C-ion irradiation was similar to that observed due to X-ray irradiation. Western-blot analysis showed that C-ion irradiation (8 Gy) increased P-MLC2-S19 expression compared with in unirradiated controls, while total MLC2 expression was unchanged. Exposure to a non-toxic concentration of Y-27632, a specific inhibitor of Rho-associated coiled-coil-forming protein kinase (ROCK), reduced the expression of P-MLC2-S19 after C-ion irradiation (8 Gy), resulting in a significant reduction in migration. These data suggest that C-ion irradiation increases cell motility in A549 cells via the Rho signaling pathway and that ROCK inhibition reduces that effect. PMID:24659807

  6. A global signal transduction system regulates aerobic and anaerobic CO2 fixation in Rhodobacter sphaeroides.

    PubMed

    Qian, Y; Tabita, F R

    1996-01-01

    Complementation of a mutant of Rhodobacter sphaeroides defective in photosynthetic CO2 reduction led to the identification of a gene which encodes a protein that is related to a class of sensor kinases involved in bacterial signal transduction. The nucleotide sequence and deduced amino acid sequence led to the finding that the gene which complemented the mutant is the regB (prrB) gene, previously isolated from both R. sphaeroides and Rhodobacter capsulatus and shown to regulate the anaerobic expression of structural genes required for the synthesis of the reaction center and light-harvesting systems of these organisms. The current investigation indicates that in addition to its role in the regulation of photosystem biosynthesis, regB (prrB) of R. sphaeroides is intimately involved in the positive regulation of the cbbI and cbbII Calvin cycle CO2 fixation operons. In addition to regulating the expression of structural genes encoding enzymes of the primary pathway for CO2 fixation in R. sphaeroides, regB was also found to be required for the expression of a gene(s) important for the putative alternative CO2 fixation pathway(s) of this organism. A mutation in regB also blocked expression of structural genes of the cbb regulon in a strain of R. sphaeroides capable of aerobic CO2-dependent growth in the dark. It is thus apparent that regB is part of a two-component system and encodes a sensor kinase involved in the global regulation of both anoxygenic light-dependent- and oxygenic light-independent CO2 fixation as well as anoxygenic photosystem biosynthesis. PMID:8550404

  7. Biometric recognition via fixation density maps

    NASA Astrophysics Data System (ADS)

    Rigas, Ioannis; Komogortsev, Oleg V.

    2014-05-01

    This work introduces and evaluates a novel eye movement-driven biometric approach that employs eye fixation density maps for person identification. The proposed feature offers a dynamic representation of the biometric identity, storing rich information regarding the behavioral and physical eye movement characteristics of the individuals. The innate ability of fixation density maps to capture the spatial layout of the eye movements in conjunction with their probabilistic nature makes them a particularly suitable option as an eye movement biometrical trait in cases when free-viewing stimuli is presented. In order to demonstrate the effectiveness of the proposed approach, the method is evaluated on three different datasets containing a wide gamut of stimuli types, such as static images, video and text segments. The obtained results indicate a minimum EER (Equal Error Rate) of 18.3 %, revealing the perspectives on the utilization of fixation density maps as an enhancing biometrical cue during identification scenarios in dynamic visual environments.

  8. Physical forcing of nitrogen fixation and diazotroph community structure in the North Pacific subtropical gyre

    NASA Astrophysics Data System (ADS)

    Church, Matthew J.; Mahaffey, Claire; Letelier, Ricardo M.; Lukas, Roger; Zehr, Jonathan P.; Karl, David M.

    2009-06-01

    Dinitrogen (N2) fixing microorganisms (termed diazotrophs) exert important control on the ocean carbon cycle. However, despite increased awareness on the roles of these microorganisms in ocean biogeochemistry and ecology, the processes controlling variability in diazotroph distributions, abundances, and activities remain largely unknown. In this study, we examine 3 years (2004-2007) of approximately monthly measurements of upper ocean diazotroph community structure and rates of N2 fixation at Station ALOHA (22°45'N, 158°W), the field site for the Hawaii Ocean Time-series program in the central North Pacific subtropical gyre (NPSG). The structure of the N2-fixing microorganism assemblage varied widely in time with unicellular N2-fixing microorganisms frequently dominating diazotroph abundances in the late winter and early spring, while filamentous microorganisms (specifically various heterocyst-forming cyanobacteria and Trichodesmium spp.) fluctuated episodically during the summer. On average, a large fraction (˜80%) of the daily N2 fixation was partitioned into the biomass of <10 ?m microorganisms. Rates of N2 fixation were variable in time, with peak N2 fixation frequently coinciding with periods when heterocystous N2-fixing cyanobacteria were abundant. During the summer months when sea surface temperatures exceeded 25.2°C and concentrations of nitrate plus nitrite were at their annual minimum, rates of N2 fixation often increased during periods of positive sea surface height anomalies, as reflected in satellite altimetry. Our results suggest mesoscale physical forcing may comprise an important control on variability in N2 fixation and diazotroph community structure in the NPSG.

  9. Bacterial N2-fixation in mangrove ecosystems: insights from a diazotroph–mangrove interaction

    PubMed Central

    Alfaro-Espinoza, Gabriela; Ullrich, Matthias S.

    2015-01-01

    Mangrove forests are highly productive ecosystems but represent low nutrient environments. Nitrogen availability is one of the main factors limiting mangrove growth. Diazotrophs have been identified as key organisms that provide nitrogen to these environments. N2-fixation by such organisms was found to be higher in the mangrove roots than in surrounding rhizosphere. Moreover, previous studies showed that mangroves grew better in the presence of N2-fixers indicating a potentially mutualistic relationship. However, the molecular signals and mechanisms that govern these interactions are still poorly understood. Here we present novel insights in the interaction of a diazotroph with a mangrove species to improve our understanding of the molecular and ecophysiological relationship between these two organisms under controlled conditions. Our results showed that Marinobacterium mangrovicola is a versatile organism capable of competing with other organisms to survive for long periods in mangrove soils. N2-fixation by this bacterium was up-regulated in the presence of mangrove roots, indicating a possible beneficial interaction. The increase in N2-fixation was limited to cells of the exponential growth phase suggesting that N2-fixation differs over the bacterial growth cycle. Bacterial transformants harboring a transcriptional nifH::gusA fusion showed that M. mangrovicola successfully colonized mangrove roots and simultaneously conducted N2-fixation. The colonization process was stimulated by the lack of an external carbon source suggesting a possible mutualistic relationship. M. mangrovicola represents an interesting genetically accessible diazotroph, which colonize mangrove roots and exhibit higher N2-fixation in the presence of mangrove roots. Consequently, we propose this microorganism as a tool to study molecular interactions between N2-fixers and mangrove plants and to better understand how changes in the environment could impact these important and relatively unknown interactions. PMID:26029186

  10. Effects of 18?-glycyrrhizin on TGF-?1/Smad signaling pathway in rats with carbon tetrachloride-induced liver fibrosis

    PubMed Central

    Qu, Ying; Zong, Lei; Xu, Mingyi; Dong, Yuwei; Lu, Lungen

    2015-01-01

    Background: Glycyrrhizin has various pharmacological effects including hepato-protection. This study aimed to investigate the potential mechanism underlying the protective effects of 18?-glycyrrhizin (18?-GL) in rats with carbon tetrachloride (CCl4) induced liver fibrosis. Methods: Male Sprague-Dawley (SD) rats were randomly divided into control group, fibrosis group, 25 mg/kg 18?-GL group and 12.5 mg/kg 18?-GL group. Rats in experimental groups were subcutaneously injected with 40% CCl4 twice weekly for 8 weeks. Immunohistochemical examination was carried out to detect the protein expressions of collagen I, collagen III, TGF-?1, p-Smad2, p-Smad3, Smad 7 and SP-1, in the liver, and the mRNA and protein expressions of these genes were determined in the liver by real time PCR and Western blot assay, respectively. Results: 18?-GL ameliorated histological changes and significantly suppressed collagen deposition. 18?-GL significantly decreased the mRNA expressions of TGF-?1, Smad2, Smad3 and SP-1 in the liver. Immunohistochemical staining revealed that TGF-?1, p-Smad2, p-Smad3 and SP-1 expressions reduced following 18?-GL therapy. Western blot assay showed p-Smad2, p-Smad3, smad2 and smad3 expressions decreased after 18?-GL treatment. The mRNA and protein expression of Smad7 remained unchanged. Conclusion: 18?-GL is able to attenuate CCl4 induced liver fibrosis in rat. PMID:25973013

  11. Role of CcpA in Regulation of the Central Pathways of Carbon Catabolism in Bacillus subtilis

    PubMed Central

    Tobisch, Steffen; Zühlke, Daniela; Bernhardt, Jörg; Stülke, Jörg; Hecker, Michael

    1999-01-01

    The Bacillus subtilis two-dimensional (2D) protein index contains almost all glycolytic and tricarboxylic acid (TCA) cycle enzymes, among them the most abundant housekeeping proteins of growing cells. Therefore, a comprehensive study on the regulation of glycolysis and the TCA cycle was initiated. Whereas expression of genes encoding the upper and lower parts of glycolysis (pgi, pfk, fbaA, and pykA) is not affected by the glucose supply, there is an activation of the glycolytic gap gene and the pgk operon by glucose. This activation seems to be dependent on the global regulator CcpA, as shown by 2D polyacrylamide gel electrophoresis analysis as well as by transcriptional analysis. Furthermore, a high glucose concentration stimulates production and excretion of organic acids (overflow metabolism) in the wild type but not in the ccpA mutant. Finally, CcpA is involved in strong glucose repression of almost all TCA cycle genes. In addition to TCA cycle and glycolytic enzymes, the levels of many other proteins are affected by the ccpA mutation. Our data suggest (i) that ccpA mutants are unable to activate glycolysis or carbon overflow metabolism and (ii) that CcpA might be a key regulator molecule, controlling a superregulon of glucose catabolism. PMID:10559165

  12. A mechanistic, globally-applicable model of plant nitrogen uptake, retranslocation and fixation

    NASA Astrophysics Data System (ADS)

    Fisher, J. B.; Tan, S.; Malhi, Y.; Fisher, R. A.; Sitch, S.; Huntingford, C.

    2008-12-01

    Nitrogen is one of the nutrients that can most limit plant growth, and nitrogen availability may be a controlling factor on biosphere responses to climate change. We developed a plant nitrogen assimilation model based on a) advective transport through the transpiration stream, b) retranslocation whereby carbon is expended to resorb nitrogen from leaves, c) active uptake whereby carbon is expended to acquire soil nitrogen, and d) biological nitrogen fixation whereby carbon is expended for symbiotic nitrogen fixers. The model relies on 9 inputs: 1) net primary productivity (NPP), 2) plant C:N ratio, 3) available soil nitrogen, 4) root biomass, 5) transpiration rate, 6) saturated soil depth,7) leaf nitrogen before senescence, 8) soil temperature, and 9) ability to fix nitrogen. A carbon cost of retranslocation is estimated based on leaf nitrogen and compared to an active uptake carbon cost based on root biomass and available soil nitrogen; for nitrogen fixers both costs are compared to a carbon cost of fixation dependent on soil temperature. The NPP is then allocated to optimize growth while maintaining the C:N ratio. The model outputs are total plant nitrogen uptake, remaining NPP available for growth, carbon respired to the soil and updated available soil nitrogen content. We test and validate the model (called FUN: Fixation and Uptake of Nitrogen) against data from the UK, Germany and Peru, and run the model under simplified scenarios of primary succession and climate change. FUN is suitable for incorporation into a land surface scheme of a General Circulation Model and will be coupled with a soil model and dynamic global vegetation model as part of a land surface model (JULES).

  13. Radiation characteristics of Botryococcus braunii, Chlorococcum littorale, and Chlorella sp. used for CO 2 fixation and biofuel production

    Microsoft Academic Search

    Halil Berberoglu; Pedro S. Gomez; Laurent Pilon

    2009-01-01

    This paper reports experimental measurements of the radiation characteristics of green algae used for carbon dioxide fixation via photosynthesis. The generated biomass can be used to produce not only biofuels but also feed for animal and food supplements for human consumptions. Particular attention was paid to three widely used species namely Botryococcus braunii, Chlorella sp., and Chlorococcum littorale. Their extinction

  14. The threonine degradation pathway of the Trypanosoma brucei procyclic form: the main carbon source for lipid biosynthesis is under metabolic control

    PubMed Central

    Millerioux, Yoann; Ebikeme, Charles; Biran, Marc; Morand, Pauline; Bouyssou, Guillaume; Vincent, Isabel M; Mazet, Muriel; Riviere, Loïc; Franconi, Jean-Michel; Burchmore, Richard J S; Moreau, Patrick; Barrett, Michael P; Bringaud, Frédéric

    2013-01-01

    The Trypanosoma brucei procyclic form resides within the digestive tract of its insect vector, where it exploits amino acids as carbon sources. Threonine is the amino acid most rapidly consumed by this parasite, however its role is poorly understood. Here, we show that the procyclic trypanosomes grown in rich medium only use glucose and threonine for lipid biosynthesis, with threonine's contribution being ??2.5 times higher than that of glucose. A combination of reverse genetics and NMR analysis of excreted end-products from threonine and glucose metabolism, shows that acetate, which feeds lipid biosynthesis, is also produced primarily from threonine. Interestingly, the first enzymatic step of the threonine degradation pathway, threonine dehydrogenase (TDH, EC 1.1.1.103), is under metabolic control and plays a key role in the rate of catabolism. Indeed, a trypanosome mutant deleted for the phosphoenolpyruvate decarboxylase gene (PEPCK, EC 4.1.1.49) shows a 1.7-fold and twofold decrease of TDH protein level and activity, respectively, associated with a 1.8-fold reduction in threonine-derived acetate production. We conclude that TDH expression is under control and can be downregulated in response to metabolic perturbations, such as in the PEPCK mutant in which the glycolytic metabolic flux was redirected towards acetate production. PMID:23899193

  15. Carbon monoxide modulates the response of human basophils to FcepsilonRI stimulation through the heme oxygenase pathway.

    PubMed

    Vannacci, Alfredo; Baronti, Roberto; Zagli, Giovanni; Marzocca, Cosimo; Pierpaoli, Simone; Bani, Daniele; Passani, Maria Beatrice; Mannaioni, Pier Francesco; Masini, Emanuela

    2003-04-01

    We report the effects of exogenous and endogenous carbon monoxide (CO) on the immunological activation of human basophils. Hemin (1-100 microM), a heme oxygenase substrate analogue, significantly increased the formation of bilirubin from partially purified human basophils, thus indicating that these cells express heme oxygenase. This effect was reversed by preincubating the cells for 30 min with Zn-protoporphyrin IX (100 microM), a heme oxygenase inhibitor. Hemin (100 microM) also decreased immunoglobulin G anti-Fcepsilon (anti-IgE)-induced activation of basophils, measured by the expression of a membrane granule-associated protein, identified as cluster differentiation protein 63 (CD63), and by histamine release. These effects were reversed by Zn-protoporphyrin IX (100 microM), by oxyhemoglobin (HbO(2)), a CO scavenger (100 microM), and by 1H-[1,2,4]oxadiazolo[4,3-a] quinoxalin-1-one (ODQ), an inhibitor of the soluble guanylyl cyclase (100 microM). Exposure of basophils to exogenous CO (10 microM for 30 min) also decreased their activation, while nitrogen (N(2)) was ineffective. HbO(2) and ODQ reversed the inhibition, reversing both membrane protein CD63 expression and histamine release to basal values. Both hemin and exogenous CO significantly raised cGMP levels in basophils and blunted the rise of calcium levels caused by immunological activation. This study suggests that CO increases cGMP formation, which in turn induces a fall in intracellular Ca(2+) concentration, thereby resulting in the inhibition of human basophil activation. PMID:12681441

  16. Renewable Hydrogen Carrier Carbohydrate: Constructing the Carbon-Neutral Carbohydrate Economy

    SciTech Connect

    Zhang, Y.-H. Percival [Virginia Polytechnic Institute and State University (Virginia Tech); Mielenz, Jonathan R [ORNL

    2011-01-01

    Abstract The hydrogen economy presents an appealing energy future but its implementation must solve numerous problems ranging from low-cost sustainable production, high-density storage, costly infrastructure, to eliminating safety concern. The use of renewable carbohydrate as a high-density hydrogen carrier and energy source for hydrogen production is possible due to emerging cell-free synthetic biology technology called cell-free synthetic pathway biotransformation (SyPaB). Assembly of numerous enzymes and co-enzymes in vitro can create complicated set of biological reactions or pathways that microorganisms cannot complete, for example, C6H10O5 (aq) + 7 H2O (l) 12 H2 (g) + 6 CO2 (g) (PLoS One 2007, 2:e456). Thanks to 100% selectivity of enzymes, modest reaction conditions, and high-purity of generated hydrogen, carbohydrate is a promising hydrogen carrier for end users. Gravimetric density of carbohydrate is 14.8 H2 mass% if water can be recycled from PEM fuel cells or 8.33% H2 mass% without water recycling. Renewable carbohydrate can be isolated from plant biomass or would be produced from a combination of solar electricity/hydrogen and carbon dioxide fixation mediated by high-efficiency artificial photosynthesis mediated by SyPaB. The construction of this carbon-neutral carbohydrate economy would address numerous sustainability challenges, such as electricity and hydrogen storage, CO2 fixation and long-term storage, water conservation, transportation fuel production, plus feed and food production.

  17. Potassium fixation of different soil types and nutrient levels

    Microsoft Academic Search

    K. Sardi; G. Csitari

    1998-01-01

    Potassium (K) fixation plays a significant role in the soil?plant system influencing the effectiveness of fertilizaiton. Among the factors controlling fixation capacity of soils, clay mineralogy and soil moisture are of primary importance. The objective of this experiment was to study the K fixation capacity of different soil types and K levels as well as to develop quantitative relationships between

  18. Unfixing Design Fixation: From Cause to Computer Simulation

    ERIC Educational Resources Information Center

    Dong, Andy; Sarkar, Somwrita

    2011-01-01

    This paper argues that design fixation, in part, entails fixation at the level of meta-representation, the representation of the relation between a representation and its reference. In this paper, we present a mathematical model that mimics the idea of how fixation can occur at the meta-representation level. In this model, new abstract concepts…

  19. Eye movement and visual fixation during profound sleepiness

    Microsoft Academic Search

    W. R. Miles; H. R. Laslett

    1931-01-01

    Five college men who had gone without sleep for 66 hours were studied by photographing their eye movements and consecutive fixations of two points separated by a visual angle of 40 degrees. Speed of saccadic eye movements was 30% below normal; visual fixations were profoundly modified; corrective movements were larger and less exact; there was wavering of fixation and drifting

  20. Nitrogen control of nitrogen fixation in free-living diazotrophs

    E-print Network

    Merrick, Mike

    Chapter 9 Nitrogen control of nitrogen fixation in free-living diazotrophs M. J. MERRICK Department of nitrogen fixation is found distributed amongst a taxonomically very diverse range of microorganisms the efficiency of nitrogen fixation some common themes are now becoming clear. The physiological issues

  1. An eye fixation database for saliency detection Subramanian Ramanathan

    E-print Network

    Sebe, Nicu

    An eye fixation database for saliency detection in images Subramanian Ramanathan Harish Katti+ Nicu- an eye fixation database compiled from a pool of 758 images and 75 subjects. Eye fixations feature-driven approaches em- ployed by saliency computation algorithms. The database comprises fix- ation

  2. Pathways and regulation of carbon, sulfur and energy transfer in marine sediments overlying methane gas hydrates on the Opouawe Bank (New Zealand)

    NASA Astrophysics Data System (ADS)

    Dale, A. W.; Sommer, S.; Haeckel, M.; Wallmann, K.; Linke, P.; Wegener, G.; Pfannkuche, O.

    2010-10-01

    This study combines sediment geochemical analysis, in situ benthic lander deployments and numerical modeling to quantify the biogeochemical cycles of carbon and sulfur and the associated rates of Gibbs energy production at a novel methane seep. The benthic ecosystem is dominated by a dense population of tube-building ampharetid polychaetes and conspicuous microbial mats were unusually absent. A 1D numerical reaction-transport model, which allows for the explicit growth of sulfide and methane oxidizing microorganisms, was tuned to the geochemical data using a fluid advection velocity of 14 cm yr -1. The fluids provide a deep source of dissolved hydrogen sulfide and methane to the sediment with fluxes equal to 4.1 and 18.2 mmol m -2 d -1, respectively. Chemosynthetic biomass production in the subsurface sediment is estimated to be 2.8 mmol m -2 d -1 of C biomass. However, carbon and oxygen budgets indicate that chemosynthetic organisms living directly above or on the surface sediment have the potential to produce 12.3 mmol m -2 d -1 of C biomass. This autochthonous carbon source meets the ampharetid respiratory carbon demand of 23.2 mmol m -2 d -1 to within a factor of 2. By contrast, the contribution of photosynthetically-fixed carbon sources to ampharetid nutrition is minor (3.3 mmol m -2 d -1 of C). The data strongly suggest that mixing of labile autochthonous microbial detritus below the oxic layer sustains high measured rates of sulfate reduction in the uppermost 2 cm of the sulfidic sediment (100-200 nmol cm -3 d -1). Similar rates have been reported in the literature for other seeps, from which we conclude that autochthonous organic matter is an important substrate for sulfate reducing bacteria in these sediment layers. A system-scale energy budget based on the chemosynthetic reaction pathways reveals that up to 8.3 kJ m -2 d -1 or 96 mW m -2 of catabolic (Gibbs) energy is dissipated at the seep through oxidation reactions. The microorganisms mediating sulfide oxidation and anaerobic oxidation of methane (AOM) produce 95% and 2% of this energy flux, respectively. The low power output by AOM is due to strong bioenergetic constraints imposed on the reaction rate by the composition of the chemical environment. These constraints provide a high potential for dissolved methane efflux from the sediment (12.0 mmol m -2 d -1) and indicates a much lower efficiency of (dissolved) methane sequestration by AOM at seeps than considered previously. Nonetheless, AOM is able to consume a third of the ascending methane flux (5.9 mmol m -2 d -1 of CH 4) with a high efficiency of energy expenditure (35 mmol CH 4 kJ -1). It is further proposed that bioenergetic limitation of AOM provides an explanation for the non-zero sulfate concentrations below the AOM zone observed here and in other active and passive margin sediments.

  3. Unfamiliar metabolic links in the central carbon metabolism.

    PubMed

    Fuchs, Georg; Berg, Ivan A

    2014-12-20

    The central carbon metabolism of all organisms is considered to follow a well established fixed scheme. However, recent studies of autotrophic carbon fixation in prokaryotes revealed unfamiliar metabolic links. A new route interconnects acetyl-coenzyme A (CoA) via 3-hydroxypropionate with succinyl-CoA. Succinyl-CoA in turn may be metabolized via 4-hydroxybutyrate to two molecules of acetyl-CoA; a reversal of this route would result in the assimilation of two molecules of acetyl-CoA into C4 compounds. C5-dicarboxylic acids are a rather neglected class of metabolites; yet, they play a key role not only in one of the CO2 fixation cycles, but also in two acetate assimilation pathways that replace the glyoxylate cycle. C5 compounds such as ethylmalonate, methylsuccinate, methylmalate, mesaconate, itaconate and citramalate or their CoA esters are thereby linked to the acetyl-CoA, propionyl-CoA, glyoxylate and pyruvate pools. A novel carboxylase/reductase converts crotonyl-CoA into ethylmalonyl-CoA; similar reductive carboxylations apply to other alpha-beta-unsaturated carboxy-CoA thioesters. These unfamiliar metabolic links may provide useful tools for metabolic engineering. PMID:24576434

  4. Systematic comparison of tissue fixation with alternative fixatives to conventional tissue fixation with buffered formalin in a xenograft-based model.

    PubMed

    Nietner, Thorben; Jarutat, Tiantom; Mertens, Alfred

    2012-09-01

    In our study we systematically compared the alternative fixatives acidified formal alcohol (AFA), PAXgene®, HOPE®, and combinations of AFA or formalin with ultrasound treatment to standard (buffered) formalin fixation. We examined general morphology and detectability of protein structures by immunohistochemistry of the membrane receptors epidermal growth factor receptor (EGFR), insulin-like growth factor 1 receptor (IGF-1R), and phosphorylated human epidermal growth factor receptor 2 (phospho-HER2). In order to allow for stringent comparability of different fixation techniques, we used matched mouse xenograft tumor samples from three different human cancer cell lines (colon, ovarian, and non-small cell lung cancer), either fixed conventionally with formalin or an alternative fixative. Tissue morphology after fixation with AFA and PAXgene® was comparable to formalin-fixed paraffin-embedded tissue (FFPET) morphology. Ultrasound fixations resulted in slightly inferior morphology and HOPE® fixation preserved morphology only poorly compared to FFPET in this system. None of the tested alternative fixatives enabled immunohistochemical detectability of all three targets in the same manner as FFPET. Pronounced staining was possible for EGFR and IGF-1R with all alternative fixatives but HOPE®, and phospho-HER2 staining was only noteworthy with formalin-ultrasound-fixed tissue. Therefore, the use of alternative fixatives comes with the need for careful validation of obtained IHC results individually for each target. PMID:22814649

  5. Nitrogen fixation : the microbial world the nitrogen cycle and nitrogen fixation

    NSDL National Science Digital Library

    Jim Deacon

    2007-01-01

    A nicely organized, reader friendly webpage. Provides a table of natural and synthetic nitrogen fixation processes. Includes photographs of plants, roots and nitrogen fixing bacteria nodules. A graphic representation of the nitrogen cycle is included.

  6. Environmental forcing of nitrogen fixation in the eastern tropical and sub-tropical North Atlantic Ocean.

    PubMed

    Rijkenberg, Micha J A; Langlois, Rebecca J; Mills, Matthew M; Patey, Matthew D; Hill, Polly G; Nielsdóttir, Maria C; Compton, Tanya J; Laroche, Julie; Achterberg, Eric P

    2011-01-01

    During the winter of 2006 we measured nifH gene abundances, dinitrogen (N(2)) fixation rates and carbon fixation rates in the eastern tropical and sub-tropical North Atlantic Ocean. The dominant diazotrophic phylotypes were filamentous cyanobacteria, which may include Trichodesmium and Katagnymene, with up to 10(6) L(-1)nifH gene copies, unicellular group A cyanobacteria with up to 10(5) L(-1)nifH gene copies and gamma A proteobacteria with up to 10(4) L(-1)nifH gene copies. N(2) fixation rates were low and ranged between 0.032-1.28 nmol N L(-1) d(-1) with a mean of 0.30 ± 0.29 nmol N L(-1) d(-1) (1?, n = 65). CO(2)-fixation rates, representing primary production, appeared to be nitrogen limited as suggested by low dissolved inorganic nitrogen to phosphate ratios (DIN:DIP) of about 2 ± 3.2 in surface waters. Nevertheless, N(2) fixation rates contributed only 0.55 ± 0.87% (range 0.03-5.24%) of the N required for primary production. Boosted regression trees analysis (BRT) showed that the distribution of the gamma A proteobacteria and filamentous cyanobacteria nifH genes was mainly predicted by the distribution of Prochlorococcus, Synechococcus, picoeukaryotes and heterotrophic bacteria. In addition, BRT indicated that multiple a-biotic environmental variables including nutrients DIN, dissolved organic nitrogen (DON) and DIP, trace metals like dissolved aluminum (DAl), as a proxy of dust inputs, dissolved iron (DFe) and Fe-binding ligands as well as oxygen and temperature influenced N(2) fixation rates and the distribution of the dominant diazotrophic phylotypes. Our results suggest that lower predicted oxygen concentrations and higher temperatures due to climate warming may increase N(2) fixation rates. However, the balance between a decreased supply of DIP and DFe from deep waters as a result of more pronounced stratification and an enhanced supply of these nutrients with a predicted increase in deposition of Saharan dust may ultimately determine the consequences of climate warming for N(2) fixation in the North Atlantic. PMID:22174940

  7. Environmental Forcing of Nitrogen Fixation in the Eastern Tropical and Sub-Tropical North Atlantic Ocean

    PubMed Central

    Rijkenberg, Micha J. A.; Langlois, Rebecca J.; Mills, Matthew M.; Patey, Matthew D.; Hill, Polly G.; Nielsdóttir, Maria C.; Compton, Tanya J.; LaRoche, Julie; Achterberg, Eric P.

    2011-01-01

    During the winter of 2006 we measured nifH gene abundances, dinitrogen (N2) fixation rates and carbon fixation rates in the eastern tropical and sub-tropical North Atlantic Ocean. The dominant diazotrophic phylotypes were filamentous cyanobacteria, which may include Trichodesmium and Katagnymene, with up to 106 L?1 nifH gene copies, unicellular group A cyanobacteria with up to 105 L?1 nifH gene copies and gamma A proteobacteria with up to 104 L?1 nifH gene copies. N2 fixation rates were low and ranged between 0.032–1.28 nmol N L?1 d?1 with a mean of 0.30±0.29 nmol N L?1 d?1 (1?, n?=?65). CO2-fixation rates, representing primary production, appeared to be nitrogen limited as suggested by low dissolved inorganic nitrogen to phosphate ratios (DIN:DIP) of about 2±3.2 in surface waters. Nevertheless, N2 fixation rates contributed only 0.55±0.87% (range 0.03–5.24%) of the N required for primary production. Boosted regression trees analysis (BRT) showed that the distribution of the gamma A proteobacteria and filamentous cyanobacteria nifH genes was mainly predicted by the distribution of Prochlorococcus, Synechococcus, picoeukaryotes and heterotrophic bacteria. In addition, BRT indicated that multiple a-biotic environmental variables including nutrients DIN, dissolved organic nitrogen (DON) and DIP, trace metals like dissolved aluminum (DAl), as a proxy of dust inputs, dissolved iron (DFe) and Fe-binding ligands as well as oxygen and temperature influenced N2 fixation rates and the distribution of the dominant diazotrophic phylotypes. Our results suggest that lower predicted oxygen concentrations and higher temperatures due to climate warming may increase N2 fixation rates. However, the balance between a decreased supply of DIP and DFe from deep waters as a result of more pronounced stratification and an enhanced supply of these nutrients with a predicted increase in deposition of Saharan dust may ultimately determine the consequences of climate warming for N2 fixation in the North Atlantic. PMID:22174940

  8. Stability of external skeletal fixation clamps 

    E-print Network

    Sandel, Mark Eugene

    1995-01-01

    FIGURES INTRODUCTION TABLE OF CONTENTS Page 1V V1 BACKGROUND Loads Applied to Skeletal Components . . . . Terminology. . Basic Biomechanics . . . . . . . . . . . . . . . Implant Failure and Complications . . . . . . . . . . . . MEI... complications associated with the use of external fixation. This document is styled after journal of Biomechanical Engineering. Unfortunately, they did not provide any documentation on the incidence or the details of the associated complications. However...

  9. Chemical fixation of sewage sludge derived ash

    Microsoft Academic Search

    Farhana Mohamed; I. Y. Sam Cheng; Ruey S. Huang; Evelyn C. Santos

    1991-01-01

    Los Angeles processes sewage sludge by dehydration and combustion at its Hyperion Treatment Plant. The ash product is usually classified as hazardous because of its heavy metal content, and four readily?available fixing agents have been evaluated for possible use as stabilizers. The ash leachability was assessed before and after fixation using the California Waste Extraction Test. The leaching characteristics of

  10. WHITE LUPIN NITROGEN FIXATION UNDER PHOSPHORUS DEFICIENCY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White lupin is highly adapted to growth in a low P environment. The objective of the present study was to evaluate whether white lupin grown under P-stress has adaptations in nodulation and N2 fixation that facilitate continued functioning. Nodulated plants were grown in silica sand supplied with N-...

  11. Augmentation of implant fixation in osteoporotic bone.

    PubMed

    Jones, Clifford B

    2012-12-01

    Osteoporosis presents a dilemma for the orthopedic surgeon. Screw fixation within the bone is crucial for mechanical stabilization, maintenance of reduction, and ultimately, fracture healing. For the patient, soft bones and physiological fragility usually benefit from immediate weight bearing and mobility to avoid further disuse osteoporosis, deconditioning, and immobility. For implant companies, traditional screws, plates, and nails function for simple fractures and compliant patients. Locked plating has improved screw purchase in osteoporotic bone and has expanded fracture fixation capabilities but is not the panacea for all fractures. For orthopedic surgeons, traditional surgical augmentation for osteoporosis consisting of dual plating, augmentation with polymethyl methacrylate, joint replacement, and now locked plating are beneficial. In order to advance orthopedic care in the expanding population of elderly osteoporotic patients, modern solutions utilizing the dual properties of secure fixation and relatively flexible implants are required. Endosteal substitution, extraosteal substitution, and combined nail/plate combinations are methods of utilizing traditional implants in a nontraditional way. Nonsurgical augmentation of fracture fixation is also paramount. PMID:23054960

  12. Adjustment of fixation duration in visual search

    Microsoft Academic Search

    Ignace Th. C. Hooge; Casper J. Erkelens

    1998-01-01

    To investigate whether fixation durations are adjusted to the duration of a foveal analysis task, we designed a search task in which each stimulus element yielded information about the position of the target. We asked subjects to look for the target by making eye movements in the direction indicated by each stimulus element. We explicitly asked the subjects to make

  13. Biomechanical evaluation of rotator cuff fixation methods

    Microsoft Academic Search

    E. Paul France; Lonnie E. Paulos; Chris D. Harner; Chris B. Straight

    1989-01-01

    Initial fixation strength and failure mode for various rotator cuff reattachment techniques (variations of the McLaughlin technique) were evaluated. Repair methods included standard suture (control), reinforced suture [expanded polytetrafluoroethylene (PTFE) patch and polydioxanone (PDS) tape augmentation] and stapling (nonarthroscopic and arthroscopic soft-tissue staples). The average strength of intact rotator cuff tissue (su praspinatus tendon) was also determined. The different rotator

  14. Microarray and bioinformatic analyses suggest models for carbon metabolism in the autotroph Acidithiobacillus ferrooxidans

    SciTech Connect

    C. Appia-ayme; R. Quatrini; Y. Denis; F. Denizot; S. Silver; F. Roberto; F. Veloso; J. Valdes; J. P. Cardenas; M. Esparza; O. Orellana; E. Jedlicki; V. Bonnefoy; D. Holmes

    2006-09-01

    Acidithiobacillus ferrooxidans is a chemolithoautotrophic bacterium that uses iron or sulfur as an energy and electron source. Bioinformatic analysis was used to identify putative genes and potential metabolic pathways involved in CO2 fixation, 2P-glycolate detoxification, carboxysome formation and glycogen utilization in At. ferrooxidans. Microarray transcript profiling was carried out to compare the relative expression of the predicted genes of these pathways when the microorganism was grown in the presence of iron versus sulfur. Several gene expression patterns were confirmed by real-time PCR. Genes for each of the above predicted pathways were found to be organized into discrete clusters. Clusters exhibited differential gene expression depending on the presence of iron or sulfur in the medium. Concordance of gene expression within each cluster, suggested that they are operons Most notably, clusters of genes predicted to be involved in CO2 fixation, carboxysome formation, 2P-glycolate detoxification and glycogen biosynthesis were up-regulated in sulfur medium, whereas genes involved in glycogen utilization were preferentially expressed in iron medium. These results can be explained in terms of models of gene regulation that suggest how A. ferrooxidans can adjust its central carbon management to respond to changing environmental conditions.

  15. Anaerobic carbon metabolism by the tricarboxylic acid cycle

    SciTech Connect

    Vanlerberghe, G.C.; Horsey, A.K.; Weger, H.G.; Turpin, D.H. (Queen's Univ., Kingston, Ontario (Canada))

    1989-12-01

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH{sub 4}{sup +} in the dark under anaerobic conditions. Addition of NH{sub 4}{sup +} to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO{sub 2} efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenspyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H{sup 14}CO{sub 3}{sup {minus}} to anaerobic cells assimilating NH{sub 4}{sup +} results in the incorporation of radiolabel into the {alpha}-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH{sub 4}{sup +} addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply {alpha}ketoglutarate for glutamate production. During dark aerobic NH{sub 4}{sup +} assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH{sub 4}{sup +} assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH{sub 4}{sup +} assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.

  16. Nitrogen Fixation By Sulfate-Reducing Bacteria in Coastal and Deep-Sea Sediments

    NASA Astrophysics Data System (ADS)

    Bertics, V. J.; Löscher, C.; Salonen, I.; Schmitz-Streit, R.; Lavik, G.; Kuypers, M. M.; Treude, T.

    2011-12-01

    Sulfate-reducing bacteria (SRB) can greatly impact benthic nitrogen (N) cycling, by for instance inhibiting coupled denitrification-nitrification through the production of sulfide or by increasing the availability of fixed N in the sediment via dinitrogen (N2)-fixation. Here, we explored several coastal and deep-sea benthic habitats within the Atlantic Ocean and Baltic Sea, for the occurrence of N2-fixation mediated by SRB. A combination of different methods including microbial rate measurements of N2-fixation and sulfate reduction, geochemical analyses (porewater nutrient profiles, mass spectrometry), and molecular analyses (CARD-FISH, HISH-SIMS, "nested" PCR, and QPCR) were applied to quantify and identify the responsible processes and organisms, respectively. Furthermore, we looked deeper into the question of whether the observed nitrogenase activity was associated with the final incorporation of N into microbial biomass or whether the enzyme activity served another purpose. At the AGU Fall Meeting, we will present and compare data from numerous stations with different water depths, temperatures, and latitudes, as well as differences in key geochemical parameters, such as organic carbon content and oxygen availability. Current metabolic and molecular data indicate that N2-fixation is occurring in many of these benthic environments and that a large part of this activity may linked to SRB.

  17. The EndoPearl device increases fixation strength and eliminates construct slippage of hamstring tendon grafts with interference screw fixation

    Microsoft Academic Search

    Andreas Weiler; Manuel Richter; Gerhard Schmidmaier; Frank Kandziora; Norbert P. Südkamp

    2001-01-01

    Purpose: The EndoPearl (Linvatec, Largo, FL), a biodegradable device to augment the femoral interference screw fixation of hamstring tendon grafts has been developed. The first objective of this study was to compare the initial fixation strength of quadrupled hamstring tendons and biodegradable interference screw fixation with and without the application of the EndoPearl device. The second objective was to determine

  18. Influence of amino acids on nitrogen fixation ability and growth of Azospirillum spp.

    PubMed Central

    Hartmann, A; Fu, H A; Burris, R H

    1988-01-01

    The utilization of amino acids for growth and their effects on nitrogen fixation differ greatly among the several strains of each species of Azospirillum spp. that were examined. A. brasiliense grew poorly or not at all on glutamate, aspartate, serine, or histidine as the sole nitrogen and carbon sources. Nitrogen fixation by most A. brasiliense strains was inhibited only slightly even by 10 mM concentrations of these amino acids. In contrast, A. lipoferum and A. amazonense grew very well on glutamate, aspartate, serine, or histidine as the sole nitrogen and carbon sources; nitrogen fixation, which was measured in the presence of malate or sucrose, was severely inhibited by these amino acids. It was concluded that growth on histidine as the sole source of nitrogen, carbon, and energy may be used for the taxonomic characterization of Azospirillum spp. and for the selective isolation of A. lipoferum. The different utilization of various amino acids by Azospirillum spp. may be important for their establishment in the rhizosphere and for their associative nitrogen fixation with plants. The physiological basis for the different utilization of glutamate by Azospirillum spp. was investigated further. A. brasiliense and A. lipoferum exhibited a high affinity for glutamate uptake (Km values for uptake were 8 and 40 microM, respectively); the Vmax was 6 times higher in A. lipoferum than in A. brasiliense. At high substrate concentrations (10 mM), the nonsaturable component of glutamate uptake was most active in A. lipoferum and A. amazonense.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2894202

  19. An effective fixative for glucocorticoid receptors in fetal tissues

    SciTech Connect

    Koga, T.; Kurisu, K.

    1982-01-01

    As a preliminary study in an autoradiographic study of glucocorticoid (GC) receptor localization in orofacial tissues of mouse fetuses, a search was made to determine the most effective fixative for preservation of the GC-receptor complex. Twelve-day-old mouse fetuses were administered tritiated triamcinolone acetonide (/sup 3/H-TAC) intraamniotically and subsequently processed by one of the following three procedures: freeze-drying, prefixation with Karnovsky's fixative, or the catechin fixative (Karnovsky's fixative containing 1% D-catechin) and postfixation with osmium tetroxide. Light microscopic autoradiography and liquid scintillation counting of the specimens revealed that the catechin fixative gave the best results for fixation of the steroid-receptor complex and preservation of tissue structure. Light and electron microscopic autoradiographic studies of the time course of the localization of /sup 3/H-TAC in palatal shelves supported the catechin fixative as being the most effective in preservation of GC-receptor or ligand complexes.

  20. Biomechanics of Fixation of Distal Radius Fractures: Comparison between Volar Plate Fixator (VPF) and NonBridging External Fixator (NBX)

    Microsoft Academic Search

    Takahiro Sano

    2008-01-01

    Fracture of the distal radius is one of the most frequent injuries, and it represents about 20% of all adults taken into emergency rooms. A number of studies suggest various methods to reduce the dislocation and to secure fragments of the distal radius. In this study, the Non-Bridging External Wrist Fixator System (NBX), a pre-market-released product manufactured by NUTEK Inc.

  1. Southwick Osteotomy Stabilised with External Fixator

    PubMed Central

    Grubor, Predrag; Mitkovic, Milorad; Grubor, Milan

    2014-01-01

    ABSTRACT Introduction: Epiphysiolysis of the femoral head is the most common accident occurring towards the end of pre-puberty and puberty growth. Case report: The author describes the experience in the treatment of chronic epiphysiolysis in two patients treated by Southwick osteotomy. The site is accessed by way of a 15-cm long lateral skin incision and the trochanteric region is reached through the layers. The osteotomy angles prepared beforehand on a thin aluminium model are used to mark the Southwick osteotomy site on the anterior and lateral sides at the level of the lesser trochanter. Before performing the trochanteric osteotomy, two Mitkovi? convergent pins type M20 are applied distally and proximally, above the planned osteotomy site. A tenotomy of the iliopsas muscle is performed, and then the previously marked bone triangle is redissected up to three quarters of the width of the femur. The distal part of the femur is rotated inwards, so that the patella is turned towards the ceiling. The osteotomised fragments of the femur are adapted, repositioned and fixated by installing an external fixator on the previously placed pins. Two more pins are placed, one proximally and one distally, with a view to adequately stabilising the femur. The patient was mobile from day two after the surgery. If, after the surgery, the lead surgeon realises that there is a requirement to make a correction of 5, 10 and 15 degrees of the valgus, varus, anteversion or retroversion deformity, the correction shall be performed without surgically opening the patient, using the fixator pins. Conclusion: After performing a Southwick osteotomy it is easier to adapt, reposition and fixate the osteotomised fragments of the femur using a fixator type M20. Adequate stability allows regaining mobility quickly, which in turn is the best prevention of chondrolysis of the hip. It is possible to make post-operative valgus, varus, anteversion and retroversion corrections of 5, 10 and 15 degrees without performing a surgery. Once the osteotomy is healed, the fixator type M20 is removed without any additional surgery. PMID:25568571

  2. Fructose Alters Intermediary Metabolism of Glucose in Human Adipocytes and Diverts Glucose to Serine Oxidation in the One–Carbon Cycle Energy Producing Pathway

    PubMed Central

    Varma, Vijayalakshmi; Boros, László G.; Nolen, Greg T.; Chang, Ching-Wei; Wabitsch, Martin; Beger, Richard D.; Kaput, Jim

    2015-01-01

    Increased consumption of sugar and fructose as sweeteners has resulted in the utilization of fructose as an alternative metabolic fuel that may compete with glucose and alter its metabolism. To explore this, human Simpson-Golabi-Behmel Syndrome (SGBS) preadipocytes were differentiated to adipocytes in the presence of 0, 1, 2.5, 5 or 10 mM of fructose added to a medium containing 5 mM of glucose representing the normal blood glucose concentration. Targeted tracer [1,2-13C2]-d-glucose fate association approach was employed to examine the influence of fructose on the intermediary metabolism of glucose. Increasing concentrations of fructose robustly increased the oxidation of [1,2-13C2]-d-glucose to 13CO2 (p < 0.000001). However, glucose-derived 13CO2 negatively correlated with 13C labeled glutamate, 13C palmitate, and M+1 labeled lactate. These are strong markers of limited tricarboxylic acid (TCA) cycle, fatty acid synthesis, pentose cycle fluxes, substrate turnover and NAD+/NADP+ or ATP production from glucose via complete oxidation, indicating diminished mitochondrial energy metabolism. Contrarily, a positive correlation was observed between glucose-derived 13CO2 formed and 13C oleate and doses of fructose which indicate the elongation and desaturation of palmitate to oleate for storage. Collectively, these results suggest that fructose preferentially drives glucose through serine oxidation glycine cleavage (SOGC pathway) one-carbon cycle for NAD+/NADP+ production that is utilized in fructose-induced lipogenesis and storage in adipocytes. PMID:26087138

  3. Fructose Alters Intermediary Metabolism of Glucose in Human Adipocytes and Diverts Glucose to Serine Oxidation in the One-Carbon Cycle Energy Producing Pathway.

    PubMed

    Varma, Vijayalakshmi; Boros, László G; Nolen, Greg T; Chang, Ching-Wei; Wabitsch, Martin; Beger, Richard D; Kaput, Jim

    2015-01-01

    Increased consumption of sugar and fructose as sweeteners has resulted in the utilization of fructose as an alternative metabolic fuel that may compete with glucose and alter its metabolism. To explore this, human Simpson-Golabi-Behmel Syndrome (SGBS) preadipocytes were differentiated to adipocytes in the presence of 0, 1, 2.5, 5 or 10 mM of fructose added to a medium containing 5 mM of glucose representing the normal blood glucose concentration. Targeted tracer [1,2-13C2]-d-glucose fate association approach was employed to examine the influence of fructose on the intermediary metabolism of glucose. Increasing concentrations of fructose robustly increased the oxidation of [1,2-13C2]-d-glucose to 13CO2 (p < 0.000001). However, glucose-derived 13CO2 negatively correlated with 13C labeled glutamate, 13C palmitate, and M+1 labeled lactate. These are strong markers of limited tricarboxylic acid (TCA) cycle, fatty acid synthesis, pentose cycle fluxes, substrate turnover and NAD+/NADP+ or ATP production from glucose via complete oxidation, indicating diminished mitochondrial energy metabolism. Contrarily, a positive correlation was observed between glucose-derived 13CO2 formed and 13C oleate and doses of fructose which indicate the elongation and desaturation of palmitate to oleate for storage. Collectively, these results suggest that fructose preferentially drives glucose through serine oxidation glycine cleavage (SOGC pathway) one-carbon cycle for NAD+/NADP+ production that is utilized in fructose-induced lipogenesis and storage in adipocytes. PMID:26087138

  4. Influence of light, temperature and salinity on dissolved organic carbon exudation rates in Zostera marina L.

    EPA Science Inventory

    Seagrass carbon budgets provide valuable insight on the minimum requirements needed to maintain this valuable resource. Carbon budgets are a balance between C fixation, storage and loss rates, most of which are well characterized. However, relatively few measurements of dissolv...

  5. Effectiveness of external fixator combined with T-plate internal fixation for the treatment of comminuted distal radius fractures.

    PubMed

    Han, L R; Jin, C X; Yan, J; Han, S Z; He, X B; Yang, X F

    2015-01-01

    This study compared the efficacy between external fixator combined with palmar T-plate internal fixation and simple plate internal fixation for the treatment of comminuted distal radius fractures. A total of 61 patients classified as type C according to the AO/ASIF classification underwent surgery for comminuted distal radius fractures. There were 54 and 7 cases of closed and open fractures, respectively. Moreover, 19 patients received an external fixator combined with T-plate internal fixation, and 42 received simple plate internal fixation. All patients were treated successfully during 12-month postoperative follow-up. The follow-up results show that the palmar flexion and dorsiflexion of the wrist, radial height, and palmar angle were significantly better in those treated with the external fixator combined with T-plate compared to those treated with the simple plate only (P < 0.05); however, there were no significant differences in radial-ulnar deviation, wrist range of motion, or wrist function score between groups (P > 0.05). Hence, the effectiveness of external fixator combined with T-plate internal fixation for the treatment of comminuted distal radius fractures was satisfactory. Patients sufficiently recovered wrist, forearm, and hand function. In conclusion, compared to the simple T-plate, the external fixator combined with T-plate internal fixation can reduce the possibility of the postoperative re-shifting of broken bones and keep the distraction of fractures to maintain radial height and prevent radial shortening. PMID:25867441

  6. Amazon River enhances diazotrophy and carbon sequestration in the tropical North Atlantic Ocean

    PubMed Central

    Subramaniam, A.; Yager, P. L.; Carpenter, E. J.; Mahaffey, C.; Björkman, K.; Cooley, S.; Kustka, A. B.; Montoya, J. P.; Sañudo-Wilhelmy, S. A.; Shipe, R.; Capone, D. G.

    2008-01-01

    The fresh water discharged by large rivers such as the Amazon is transported hundreds to thousands of kilometers away from the coast by surface plumes. The nutrients delivered by these river plumes contribute to enhanced primary production in the ocean, and the sinking flux of this new production results in carbon sequestration. Here, we report that the Amazon River plume supports N2 fixation far from the mouth and provides important pathways for sequestration of atmospheric CO2 in the western tropical North Atlantic (WTNA). We calculate that the sinking of carbon fixed by diazotrophs in the plume sequesters 1.7 Tmol of C annually, in addition to the sequestration of 0.6 Tmol of C yr?1 of the new production supported by NO3 delivered by the river. These processes revise our current understanding that the tropical North Atlantic is a source of 2.5 Tmol of C to the atmosphere [Mikaloff-Fletcher SE, et al. (2007) Inverse estimates of the oceanic sources and sinks of natural CO2 and the implied oceanic carbon transport. Global Biogeochem Cycles 21, doi:10.1029/2006GB002751]. The enhancement of N2 fixation and consequent C sequestration by tropical rivers appears to be a global phenomenon that is likely to be influenced by anthropogenic activity and climate change. PMID:18647838

  7. Double CO(2) fixation in photosynthesis-fermentation model enhances algal lipid synthesis for biodiesel production.

    PubMed

    Xiong, Wei; Gao, Chunfang; Yan, Dong; Wu, Chao; Wu, Qingyu

    2010-04-01

    In this study, a photosynthesis-fermentation model was proposed to merge the positive aspects of autotrophs and heterotrophs. Microalga Chlorella protothecoides was grown autotrophically for CO(2) fixation and then metabolized heterotrophically for oil accumulation. Compared to typical heterotrophic metabolism, 69% higher lipid yield on glucose was achieved at the fermentation stage in the photosynthesis-fermentation model. An elementary flux mode study suggested that the enzyme Rubisco-catalyzed CO(2) re-fixation, enhancing carbon efficiency from sugar to oil. This result may explain the higher lipid yield. In this new model, 61.5% less CO(2) was released compared with typical heterotrophic metabolism. Immunoblotting and activity assay further showed that Rubisco functioned in sugar-bleaching cells at the fermentation stage. Overall, the photosynthesis-fermentation model with double CO(2) fixation in both photosynthesis and fermentation stages, enhances carbon conversion ratio of sugar to oil and thus provides an efficient approach for the production of algal lipid. PMID:19963369

  8. Elevated temperature alters carbon cycling in a model microbial community

    NASA Astrophysics Data System (ADS)

    Mosier, A.; Li, Z.; Thomas, B. C.; Hettich, R. L.; Pan, C.; Banfield, J. F.

    2013-12-01

    Earth's climate is regulated by biogeochemical carbon exchanges between the land, oceans and atmosphere that are chiefly driven by microorganisms. Microbial communities are therefore indispensible to the study of carbon cycling and its impacts on the global climate system. In spite of the critical role of microbial communities in carbon cycling processes, microbial activity is currently minimally represented or altogether absent from most Earth System Models. Method development and hypothesis-driven experimentation on tractable model ecosystems of reduced complexity, as presented here, are essential for building molecularly resolved, benchmarked carbon-climate models. Here, we use chemoautotropic acid mine drainage biofilms as a model community to determine how elevated temperature, a key parameter of global climate change, regulates the flow of carbon through microbial-based ecosystems. This study represents the first community proteomics analysis using tandem mass tags (TMT), which enable accurate, precise, and reproducible quantification of proteins. We compare protein expression levels of biofilms growing over a narrow temperature range expected to occur with predicted climate changes. We show that elevated temperature leads to up-regulation of proteins involved in amino acid metabolism and protein modification, and down-regulation of proteins involved in growth and reproduction. Closely related bacterial genotypes differ in their response to temperature: Elevated temperature represses carbon fixation by two Leptospirillum genotypes, whereas carbon fixation is significantly up-regulated at higher temperature by a third closely related genotypic group. Leptospirillum group III bacteria are more susceptible to viral stress at elevated temperature, which may lead to greater carbon turnover in the microbial food web through the release of viral lysate. Overall, this proteogenomics approach revealed the effects of climate change on carbon cycling pathways and other microbial activities. When scaled to more complex ecosystems and integrated into Earth System Models, this approach could significantly improve predictions of global carbon-climate feedbacks. Experiments such as these are a critical first step designed at understanding climate change impacts in order to better predict ecosystem adaptations, assess the viability of mitigation strategies, and inform relevant policy decisions.

  9. Spatial and Dynamic Aspects of Visual Fixation

    Microsoft Academic Search

    G. M. JONESAND; J. H. Milsum

    1965-01-01

    The physiological processes concerned with the difficult dynamic task of fixating the retinal image during normal body and head movement are examined with a control engineering perspective. Spatial relationships between the two main system inputs (visual and vestibular) and three main outputs (operating on the eye-in-skull, skull-on-body, and body-in-space platforms) are examined in the context of the geometry of the

  10. Minimally invasive plate fixation of the tibia

    PubMed Central

    Coulter, Gareth; Pai, Vishal

    2006-01-01

    The treatment of fractures of the distal third of the tibia has evolved with the development of improved imaging and surgical techniques. The outcome of treatment using conventional fixation is poor. We report a study on indirect reduction in 26 patients. All cases achieved radiological union and full weight bearing. The good to excellent results suggest that this method should be considered in metaphyseal fractures where intra-medullary nails are not suitable. PMID:16960719

  11. Pin loosening in external skeletal fixation

    E-print Network

    Vittal, Bamini

    1993-01-01

    30 Ncm were considered representative of loose pins. The failure mode in pull out tests is generally shear fracture of interfacial tissues. The reason for the higher torque in specimen 9 could be because the bone marrow contained more substantial... of the fractured bone during the healing process. Loosening of percutaneous fixation pins commonly occurs. Pin loosening is considered the most significant feature in the development of pin tract osteomyelitis. The causes of pin loosening are under investigation...

  12. Nitrogen Fixation by Myxophyceae from Marine Environments

    Microsoft Academic Search

    W. D. P. Stewart

    1964-01-01

    SUMMARY Two blue-green algae from marine environments, Calothrix scopulorum and Nostoc entophytum, vigorously fixed 15N-labelled nitrogen in artificial sea-water free from combined nitrogen and, rather faster, in natural sea- water. A proportion of the nitrogen fixed was liberated into the medium. After a 7-day exposure period the extracellular nitrogen had a lower enrichment with 16N than the intracellular nitrogen. Fixation

  13. Evaluation of 3 Fixation Devices for Tibial-Sided Anterior Cruciate Ligament Graft Backup Fixation.

    PubMed

    Verioti, Christopher A; Sardelli, Matthew C; Nguyen, Tony

    2015-07-01

    We conducted a study to biomechanically evaluate 3 methods of tibial-sided fixation for anterior cruciate ligament reconstruction: fully threaded interference screw only, interference screw backed with 4.75-mm SwiveLock anchor, and fully threaded bio-interference screw backed with 4.5-mm bicortical screw (all Arthrex). Thirty skeletally mature porcine tibiae were used. The first group was prepared by graft fixation within the tibial tunnel using only an interference screw. The second and third groups included an interference screw with 2 types of secondary fixation: 4.5-mm bicortical post and SwiveLock anchor. Mechanical testing consisted of 500 cycles between 50 and 250 N at 1 Hz, followed by a pull to failure conducted at 20 mm per minute. Ultimate load-to-failure testing demonstrated the largest mean (SD) load tolerated in the post/washer group, 1148 (186) N, versus the SwiveLock group, 1007 (176) N, and the screw-only group, 778 (139) N. There was no statistical difference between the 2 backup fixation groups. Use of a SwiveLock anchor as backup fixation at the tibial side in soft-tissue anterior cruciate ligament reconstruction is a safe, effective alternative to a bicortical post and provides statistically equivalent pullout strength with unlikely requirement for future hardware removal. PMID:26161768

  14. Mesh fixation alternatives in laparoscopic ventral hernia repair.

    PubMed

    Muysoms, Filip E; Novik, Bengt; Kyle-Leinhase, Iris; Berrevoet, Frederik

    2012-12-01

    Since the introduction of laparoscopic ventral hernia repair, there has been an ongoing dispute over the optimal method of fixating the mesh against the abdominal wall. In general, one could say that the more penetrating the fixation used, the stronger the fixation, but at the cost of increased acute postoperative pain. The occurrence of chronic pain in some patients has led to the search for less permanent penetrating fixation, but without risking a less stable mesh fixation and increased recurrences due to shift or shrinkage of the mesh. Avoiding transfascial sutures by using a double crown of staples has been proposed and recently absorbable fixation devices have been developed. Some surgeons have proposed fixation with glue to reduce the number of staples, or even eliminate them entirely. The continuously increasing multitude of marketed meshes and fixating devices leads to unlimited options in mesh fixation combination and geometry. Therefore, we will never be able to get a clear view on the benefits and pitfalls of every specific combination. Clearance of the anterior abdominal wall from peritoneal fatty tissue and correct positioning of the mesh with ample overlap of the hernia defect are possibly as important as the choice of mesh and fixation. Other topics that are involved in successful outcomes but not addressed in this article are adequate training in the procedure, appropriate selection of patients, and careful adhesiolysis to minimize accidental visceral injuries. PMID:23225589

  15. Medial malleolar fractures: a biomechanical study of fixation techniques.

    PubMed

    Fowler, T Ty; Pugh, Kevin J; Litsky, Alan S; Taylor, Benjamin C; French, Bruce G

    2011-08-01

    Fracture fixation of the medial malleolus in rotationally unstable ankle fractures typically results in healing with current fixation methods. However, when failure occurs, pullout of the screws from tension, compression, and rotational forces is predictable. We sought to biomechanically test a relatively new technique of bicortical screw fixation for medial malleoli fractures. Also, the AO group recommends tension-band fixation of small avulsion type fractures of the medial malleolus that are unacceptable for screw fixation. A well-documented complication of this technique is prominent symptomatic implants and secondary surgery for implant removal. Replacing stainless steel 18-gauge wire with FiberWire suture could theoretically decrease symptomatic implants. Therefore, a second goal was to biomechanically compare these 2 tension-band constructs. Using a tibial Sawbones model, 2 bicortical screws were compared with 2 unicortical cancellous screws on a servohydraulic test frame in offset axial, transverse, and tension loading. Second, tension-band fixation using stainless steel wire was compared with FiberWire under tensile loads. Bicortical screw fixation was statistically the stiffest construct under tension loading conditions compared to unicortical screw fixation and tension-band techniques with FiberWire or stainless steel wire. In fact, unicortical screw fixation had only 10% of the stiffness as demonstrated in the bicortical technique. In a direct comparison, tension-band fixation using stainless steel wire was statistically stiffer than the FiberWire construct. PMID:21815575

  16. Autotrophy of green non-sulphur bacteria in hot spring microbial mats: biological explanations for isotopically heavy organic carbon in the geological record

    NASA Technical Reports Server (NTRS)

    van der Meer, M. T.; Schouten, S.; de Leeuw, J. W.; Ward, D. M.

    2000-01-01

    Inferences about the evidence of life recorded in organic compounds within the Earth's ancient rocks have depended on 13C contents low enough to be characteristic of biological debris produced by the well-known CO2 fixation pathway, the Calvin cycle. 'Atypically' high values have been attributed to isotopic alteration of sedimentary organic carbon by thermal metamorphism. We examined the possibility that organic carbon characterized by a relatively high 13C content could have arisen biologically from recently discovered autotrophic pathways. We focused on the green non-sulphur bacterium Chloroflexus aurantiacus that uses the 3-hydroxypropionate pathway for inorganic carbon fixation and is geologically significant as it forms modern mat communities analogous to stromatolites. Organic matter in mats constructed by Chloroflexus spp. alone had relatively high 13C contents (-14.9%) and lipids diagnostic of Chloroflexus that were also isotopically heavy (-8.9% to -18.5%). Organic matter in mats constructed by Chloroflexus in conjunction with cyanobacteria had a more typical Calvin cycle signature (-23.5%). However, lipids diagnostic of Chloroflexus were isotopically enriched (-15.1% to -24.1%) relative to lipids typical of cyanobacteria (-33.9% to -36.3%). This suggests that, in mats formed by both cyanobacteria and Chloroflexus, autotrophy must have a greater effect on Chloroflexus carbon metabolism than the photoheterotrophic consumption of cyanobacterial photosynthate. Chloroflexus cell components were also selectively preserved. Hence, Chloroflexus autotrophy and selective preservation of its products constitute one purely biological mechanism by which isotopically heavy organic carbon could have been introduced into important Precambrian geological features.

  17. Flux balance analysis reveals acetate metabolism modulates cyclic electron flow and alternative glycolytic pathways in Chlamydomonas reinhardtii

    PubMed Central

    Chapman, Stephen P.; Paget, Caroline M.; Johnson, Giles N.; Schwartz, Jean-Marc

    2015-01-01

    Cells of the green alga Chlamydomonas reinhardtii cultured in the presence of acetate perform mixotrophic growth, involving both photosynthesis and organic carbon assimilation. Under such conditions, cells exhibit a reduced capacity for photosynthesis but a higher growth rate, compared to phototrophic cultures. Better understanding of the down regulation of photosynthesis would enable more efficient conversion of carbon into valuable products like biofuels. In this study, Flux Balance Analysis (FBA) and Flux Variability Analysis (FVA) have been used with a genome scale model of C. reinhardtii to examine changes in intracellular flux distribution in order to explain their changing physiology. Additionally, a reaction essentiality analysis was performed to identify which reaction subsets are essential for a given growth condition. Our results suggest that exogenous acetate feeds into a modified tricarboxylic acid (TCA) cycle, which bypasses the CO2 evolution steps, explaining increases in biomass, consistent with experimental data. In addition, reactions of the oxidative pentose phosphate and glycolysis pathways, inactive under phototrophic conditions, show substantial flux under mixotrophic conditions. Importantly, acetate addition leads to an increased flux through cyclic electron flow (CEF), but results in a repression of CO2 fixation via Rubisco, explaining the down regulation of photosynthesis. However, although CEF enhances growth on acetate, it is not essential—impairment of CEF results in alternative metabolic pathways being increased. We have demonstrated how the reactions of photosynthesis interconnect with carbon metabolism on a global scale, and how systems approaches play a viable tool in understanding complex relationships at the scale of the organism. PMID:26175742

  18. Strength of surgical wire fixation. A laboratory study.

    PubMed

    Guadagni, J R; Drummond, D S

    1986-08-01

    Because of the frequent use of stainless steel wire in spinal surgery and to augment fracture fixation, several methods of securing wire fixation were tested in the laboratory to determine the relative strength of fixation. Any method of fixation stronger than the yield strength of the wire is sufficient. Square knots, knot twists, symmetric twists, and the AO loop-tuck techniques afforded acceptable resistance against tension loads, but the wire wrap and AO loop technique were unacceptable. The double symmetric twist, which is frequently used for tension banding, was barely acceptable. The symmetric twist technique was the most practical because it is strong enough, efficient in maintaining tension applied during fixation, and least likely to cause damage to the wire. To optimize the fixation strength of the symmetrical twist, at least two twists are required at a reasonably tight pitch. PMID:3731592

  19. Processing and evaluation of long fiber thermoplastic composite plates for internal fixation

    NASA Astrophysics Data System (ADS)

    Warren, Paul B.

    The metallic plates used in internal fracture fixation may have up to ten times the elastic modulus of normal bone tissue, causing stress shielding-induced osteopenia in healed bone that can lead to re-fracture after plate removal and prolonged and painful recovery. Thermoplastic polymer matrix composites reinforced with long carbon fiber are promising alternative materials for internal fixation plates because they may be produced with relative ease and be tailored to have specific mechanical properties, alleviating the stress shielding problem. Long carbon fiber-reinforced polyetheretherketone (LCF PEEK) plates were produced using the extrusion / compression molding process. Static flexural testing determined that LCF PEEK plates with rectangular cross-section had an average flexural modulus of 12 GPa, or 23% of the flexural modulus of a stainless steel plate. The LCF PEEK plates also experienced negligible (14.7%, 14.5%, and 16.7%) reductions in modulus after fatigue testing at applied moments of 2.5, 3.0, and 3.5 N•m, respectively, over 106 load cycles. Aging the plates in 0.9% NaCl solution for four and eight weeks caused 0.34% and 0.28% increases in plate mass, respectively. No significant decrease of flexural properties due to aging was detected. Differential scanning calorimetry (DSC) revealed the PEEK matrix of the plates to be 24.5% crystalline, which is lower than typical PEEK crystallinity values of 30-35%. Scanning electron microscopy (SEM) revealed three times as many fiber pullout areas in LCF PEEK fracture surfaces as in fracture surfaces of long carbon fiber-reinforced polyphenylenesulfide (LCF PPS), another plate material tested. DSC and SEM data suggest that improvements in processing conditions and fiber/matrix bonding, along with higher carbon fiber fractions, would enhance LCF PEEK plate performance. LCF PEEK remains a promising alternative to stainless steel for internal fixation plates.

  20. Elemental carbon and polycyclic aromatic compounds in a 150-year sediment core from Lake Qinghai, Tibetan Plateau, China: influence of regional and local sources and transport pathways.

    PubMed

    Han, Y M; Wei, C; Bandowe, B A M; Wilcke, W; Cao, J J; Xu, B Q; Gao, S P; Tie, X X; Li, G H; Jin, Z D; An, Z S

    2015-04-01

    Elemental carbon (EC) and polycyclic aromatic compounds (PACs) are potential proxies for the reconstruction of change in human activities and the origin of air masses in historic times. In this study, the historic deposition of char and soot (the two subtypes of EC) and PACs in a 150-year sediment core from different topographic subbasins of Lake Qinghai on the Qinghai Tibetan Plateau (QTP) were reconstructed. The objective was to explore how the variations in the concentrations of EC and PACs, in the ratios of char to soot and of oxygenated polycyclic aromatic hydrocarbons (OPAHs) to parent PAHs, and in the composition of the PAC mixtures reflect historical changes in climate and human activity and the origin of air masses arriving at the QTP. The deposition fluxes of soot in the different subbasins were similar, averaging 0.18 (range of 0.15-0.25) and 0.16 (0.13-0.23) g m(-2) year(-1), respectively, but they varied for char (averaging 0.11 and 0.22 g m(-2) year(-1), respectively), suggesting ubiquitous atmospheric deposition of soot and local river inputs of char. The different vertical distributions of the char/soot ratios in the different subbasins can be interpreted in terms of the different transport mechanisms of char and soot. An abrupt increase in soot concentrations since 1980 coincides with results from the QTP ice cores that were interpreted to be indicative of soot transport from South Asia. Similar concentration patterns of PAHs with soot and 9,10-anthraquinone/anthracene (9,10-AQ/ANT) ratios all >2.0 suggest regional PAC sources. Increasing PAH/soot ratios and decreasing 9,10-AQ/ANT ratios since the beginning of the 1970s indicate increasing local emissions. The historical trends of these diagnostic ratios indicate an increase in the fossil-fuel contribution since the beginning of the 1970s. The increase of perylene concentrations with increasing core depth and the ratio of perylene to its penta-aromatic isomers indicate that perylene originates mainly from in situ biogenic diagenesis. We demonstrate that the concentrations of EC, char, soot, and PACs in sediments can be used to reconstruct local, regional, and remote sources and transport pathways of pollutants to the QTP. PMID:25732352

  1. Association of seven functional polymorphisms of one-carbon metabolic pathway with total plasma homocysteine levels and susceptibility to Parkinson's disease among South Indians.

    PubMed

    Kumudini, Nadella; Uma, Addepally; Naushad, Shaik Mohammad; Mridula, Rukmini; Borgohain, Rupam; Kutala, Vijay Kumar

    2014-05-01

    This study from South India was performed to ascertain the impact of seven functional polymorphisms of one-carbon metabolic pathway on total plasma homocysteine levels and susceptibility to PD. A total of 151 cases of Parkinson's disease and 416 healthy controls were analyzed for fasting plasma homocysteine levels by reverse phase HPLC. PCR-RFLP approaches were used to analyze glutamate carboxypeptidase II (GCPII) 1561 C>T, reduced folate carrier 1 (RFC1) 80 G>A, cytosolic serine hydroxymethyl transferase (cSHMT) 1420 C>T, methylene tetrahydrofolate reductase (MTHFR) 677 C>T, methionine synthase (MTR) 2756 A>G and methionine synthase reductase (MTRR) 66 A>G polymorphisms. PCR-AFLP was used for the analysis of thymidylate synthase (TYMS) 5'-UTR 28bp tandem repeat. PD cases exhibited elevated plasma homocysteine levels compared to controls (men: 28.8 ± 6.9 vs. 16.4 ± 8.8 ?mol/L; women: 25.4 ± 5.3 vs. 11.2 ± 5.1?mol/L). Homocysteine levels showed positive correlation with male gender (r=0.39, p<0.0001) and MTRR 66 A>G (r=0.31, p<0.0001) whereas an inverse correlation was observed with cSHMT 1420 C>T polymorphism. MTRR 66 A>G polymorphism showed independent risk for PD (OR: 3.42, 95% CI: 2.35-4.98) whereas cSHMT 1420 C>T conferred protection against PD (OR: 0.11, 95% CI: 0.07-0.17). Multifactor dimensionality reduction analysis showed synergistic interactions between MTHFR 677 C>T and MTRR 66 A>G, whereas cSHMT 1420 C>T exhibited counteracting interactions in altering susceptibility to PD. To conclude, PD cases exhibited hyperhomocysteinemia and MTRR 66 A>G and cSHMT 1420 C>T gene variants were shown to modulate PD risk by altering the homocysteine levels. PMID:24686188

  2. Calibration and Standardization of Microwave Ovens for Fixation of Brain and Peripheral Nerve Tissue

    Microsoft Academic Search

    Jonathan B. Leonard; Ann M. Dvorak

    1998-01-01

    Rapid and reproducible fixation of brain and peripheral nerve tissue for light and electron microscopy studies can be done in a microwave oven. In this review we report a standardized nomenclature for diverse fixation techniques that use microwave heating: (1) microwave stabilization, (2) fast and ultrafast primary microwave–chemical fixation, (3) microwave irradiation followed by chemical fixation, (4) primary chemical fixation

  3. Assessment of biological nitrogen fixation in grassland and associated sites

    Microsoft Academic Search

    K. Vlassak; E. A. Paul; R. E. Harris

    1973-01-01

    Summary  The extent of nitrogen fixation in native grassland on clay soil was measured using the C2H2 reduction assay. Undisturbed soil cores incubated in microcanopies in the field indicated fixation rates of 2 kg N\\/ha per\\u000a season. Less nitrogen fixation activity was found in associated cultivated soils. Other sites on different soil associations\\u000a were found capable of fixing 1 kgN\\/ha or

  4. Buckminsterfullerenes A non-metal system for nitrogen fixation

    Microsoft Academic Search

    Yoshiaki Nishibayashi; Makoto Saito; Sakae Uemura; Shin-ichi Takekuma; Hideko Takekuma; Zen-ichi Yoshida

    2004-01-01

    In all nitrogen-fixation processes known so far - including the industrial Haber-Bosch process, biological fixation by nitrogenase enzymes and previously described homogeneous synthetic systems - the direct transformation of the stable, inert dinitrogen molecule (N2) into ammonia (NH3) relies on the powerful redox properties of metals. Here we show that nitrogen fixation can also be achieved by using a non-metallic

  5. Monitoring In Vivo Load Transmission Through an External Fixator

    Microsoft Academic Search

    J. Grasa; M. J. Gómez-Benito; L. A. González-Torres; D. Asiaín; F. Quero; J. M. García-Aznar

    2010-01-01

    This work presents a portable non-invasive external fixator to assess and monitor fracture healing in real time. To evaluate\\u000a the potential of this fixator, a transverse osteotomy was performed in the tibia of six adult sheep (mean age 3 ± 0.5 years\\u000a and weight 63 ± 5 kg). The fractures were stabilized by a specially designed unilateral external fixator, which was instrumented

  6. Carbon sequestration in Synechococcus Sp.: from molecular machines to hierarchical modeling.

    SciTech Connect

    Martino, Anthony A. (Sandia National Laboratories, Livermore, CA); Heffelfinger, Grant S.; Frink, Laura J. Douglas; Davidson, George S.; Haaland, David Michael; Timlin, Jerilyn Ann; Plimpton, Steven James; Lane, Todd W. (Sandia National Laboratories, Livermore, CA); Thomas, Edward Victor; Rintoul, Mark Daniel; Roe, Diana C. (Sandia National Laboratories, Livermore, CA); Faulon, Jean-Loup Michel; Hart, William Eugene

    2003-02-01

    The U.S. Department of Energy recently announced the first five grants for the Genomes to Life (GTL) Program. The goal of this program is to ''achieve the most far-reaching of all biological goals: a fundamental, comprehensive, and systematic understanding of life.'' While more information about the program can be found at the GTL website (www.doegenomestolife.org), this paper provides an overview of one of the five GTL projects funded, ''Carbon Sequestration in Synechococcus Sp.: From Molecular Machines to Hierarchical Modeling.'' This project is a combined experimental and computational effort emphasizing developing, prototyping, and applying new computational tools and methods to elucidate the biochemical mechanisms of the carbon sequestration of Synechococcus Sp., an abundant marine cyanobacteria known to play an important role in the global carbon cycle. Understanding, predicting, and perhaps manipulating carbon fixation in the oceans has long been a major focus of biological oceanography and has more recently been of interest to a broader audience of scientists and policy makers. It is clear that the oceanic sinks and sources of CO(2) are important terms in the global environmental response to anthropogenic atmospheric inputs of CO(2) and that oceanic microorganisms play a key role in this response. However, the relationship between this global phenomenon and the biochemical mechanisms of carbon fixation in these microorganisms is poorly understood. The project includes five subprojects: an experimental investigation, three computational biology efforts, and a fifth which deals with addressing computational infrastructure challenges of relevance to this project and the Genomes to Life program as a whole. Our experimental effort is designed to provide biology and data to drive the computational efforts and includes significant investment in developing new experimental methods for uncovering protein partners, characterizing protein complexes, identifying new binding domains. We will also develop and apply new data measurement and statistical methods for analyzing microarray experiments. Our computational efforts include coupling molecular simulation methods with knowledge discovery from diverse biological data sets for high-throughput discovery and characterization of protein-protein complexes and developing a set of novel capabilities for inference of regulatory pathways in microbial genomes across multiple sources of information through the integration of computational and experimental technologies. These capabilities will be applied to Synechococcus regulatory pathways to characterize their interaction map and identify component proteins in these pathways. We will also investigate methods for combining experimental and computational results with visualization and natural language tools to accelerate discovery of regulatory pathways. Furthermore, given that the ultimate goal of this effort is to develop a systems-level of understanding of how the Synechococcus genome affects carbon fixation at the global scale, we will develop and apply a set of tools for capturing the carbon fixation behavior of complex of Synechococcus at different levels of resolution. Finally, because the explosion of data being produced by high-throughput experiments requires data analysis and models which are more computationally complex, more heterogeneous, and require coupling to ever increasing amounts of experimentally obtained data in varying formats, we have also established a companion computational infrastructure to support this effort as well as the Genomes to Life program as a whole.

  7. Mechanistical studies on the formation and destruction of carbon monoxide (CO), carbon dioxide (CO2), and carbon trioxide (CO3)

    E-print Network

    Kaiser, Ralf I.

    Mechanistical studies on the formation and destruction of carbon monoxide (CO), carbon dioxide (CO2 monoxide (CO), carbon dioxide (CO2), and molecular oxygen (O2) with varying carbon-to-oxygen ratios from 1 and destruction pathways of carbon monoxide (CO), carbon dioxide (CO2), and carbon trioxide (CO3

  8. Nitrogen fixation in moss-cyanobacteria associations in boreal forest ecosystems

    NASA Astrophysics Data System (ADS)

    Rousk, Kathrin

    2014-05-01

    Nitrogen (N) limits the productivity in boreal forests. A major source of 'new' N for these forests is the fixation of atmospheric N2 preformed by cyanobacteria living in association with mosses and lichens. Mosses are a dominant feature in boreal forests, accounting for 60-90% of the groundcover in pristine boreal forests and have been found to be colonized by several N2-fixing cyanobacteria. Given the ubiquitous nature of mosses in these forests, their association with N2-fixing cyanobacteria could characterize the N cycle in these ecosystems. For instance, the feather moss Pleurozium schreberi with its associated cyanobacteria fixes 1-2 kg N ha-1 yr-1, which equals the amount that enters northern boreal forests via atmospheric N deposition. Nitrogen fixation in moss-cyanobacteria associations is affected by numerous abiotic factors that could modulate the N input to the system via the moss-cyanobacteria pathway. For instance, high N availability and dry conditions inhibit N2 fixation in moss-cyanobacteria associations while phosphorus availability and moist conditions promote N2 fixation. Further, N2fixation in moss-cyanobacteria associations is resilient, and can recover from increased N inputs (12 - 15 kg N ha-1 yr-1) as well as from drought stress (moss < 9% field moisture) upon removal of these stressors. Nevertheless, the question as to how important the N2 fixing capability of moss-cyanobacteria associations is as a source of 'new' N for the N cycle in boreal forests remains. For instance, mosses can retain acquired N over long periods of time (> 1 year) and the transfer of N from moss to soil in the short-term has so far only been shown to occur after disturbances (e.g. drying rewetting events, fires). I will present results from laboratory as well as field experiments aimed to elucidate the role moss-cyanobacteria associations play for the N cycle in boreal forests and how abiotic factors control the fixation of atmospheric N2.

  9. Decreased Fronto-Temporal Interaction during Fixation after Memory Retrieval

    PubMed Central

    Sasaki, Hiroki; Mori, Harushi; Kunimatsu, Akira; Ohtomo, Kuni; Jimura, Koji; Konishi, Seiki

    2014-01-01

    Previous studies have revealed top-down control during memory retrieval from the prefrontal cortex to the temporal cortex. In the present functional MRI study, we investigated whether the fronto-temporal functional interaction occurs even during fixation periods after memory retrieval trials. During recency judgments, subjects judged the temporal order of two items in a study list. The task used in the present study consisted of memory trials of recency judgments and non-memory trials of counting dots, and post-trial fixation periods. By comparing the brain activity during the fixation periods after the memory trials with that during the fixation periods after the non-memory trials, we detected heightened brain activity in the lateral prefrontal cortex, the lateral temporal cortex and the hippocampus. Functional interactions during the fixation periods after the memory vs. non-memory trials as examined using a psychophysiological interaction revealed a decreased interaction from the lateral prefrontal cortex to the lateral temporal cortex, but not to the hippocampus. The functional interaction between the same frontal and temporal regions was also present during the memory trials. A trial-based functional connectivity analysis further revealed that the fronto-temporal interaction was positive and decreased during the fixation periods after the memory trials, relative to the fixation periods after the non-memory trials. These results suggest that the fronto-temporal interaction existed during the post-trial fixation periods, which had been present during the memory trials and temporally extended into the fixation periods. PMID:25340398

  10. Endotracheal tube fixation methods for optimal stability: a comparison of adhesive tape, suture, and tape-suture fixation.

    PubMed

    Farbod, Frank; Tuli, Puneet; Robertson, Bernard F; Jackson, Ian T

    2010-07-01

    Accidental extubation of an intubated patient is a serious consideration in the surgical patient. Adequate fixation in the intubated patient is essential to prevent potentially life-threatening complications. Several methods of endotracheal tube fixation have been described in the literature. In this study, we examine 3 common methods of fixation: adhesive tape alone, suture, and tape-suture. Testing occurred in a laboratory setting with 2 fresh cadavers. Endotracheal tubes were inserted, using the methods of fixation in question. We subjected each fixation technique to progressively increasing weight to determine which technique is most resistant to accidental removal. We found that fixation of the tube by combining tape around the tube with a suture through the tape is the best noninvasive technique of the 3 methods evaluated in cases where movement of the head is anticipated. PMID:20613600

  11. Titanium alloys for fracture fixation implants.

    PubMed

    Disegi, J A

    2000-12-01

    This paper is intended to provide an overview of the composition, mechanical properties, biocompatibility, and clinical applications for titanium alloys that are used for fracture fixation implants. A new class of titanium implant alloys has emerged in recent years that exhibits a beta microstructure and a unique combination of mechanical properties. Important information regarding notch sensitivity testing and clinical significance is also discussed. Attributes such as stress corrosion cracking resistance, fatigue strength, and wear characteristics are also essential for specific clinical applications, but are beyond the scope of this presentation. PMID:11270074

  12. Effects of Boron Nutrition and Water Stress on Nitrogen Fixation, Seed ?15N and ?13C Dynamics, and Seed Composition in Soybean Cultivars Differing in Maturities

    PubMed Central

    Bellaloui, Nacer; Mengistu, Alemu

    2015-01-01

    Therefore, the objective of the current research was to investigate the effects of foliar B nutrition on seed protein, oil, fatty acids, and sugars under water stress conditions. A repeated greenhouse experiment was conducted using different maturity group (MG) cultivars. Plants were well-watered with no foliar B (W ? B), well-watered with foliar B (W + B), water-stressed with no foliar B (WS ? B), and water-stressed with foliar B (WS + B). Foliar B was applied at rate of 0.45?kg·ha?1 and was applied twice at flowering and at seed-fill stages. The results showed that seed protein, sucrose, fructose, and glucose were higher in W + B treatment than in W ? B, WS + B, and WS ? B. The increase in protein in W + B resulted in lower seed oil, and the increase of oleic in WS ? B or WS + B resulted in lower linolenic acid. Foliar B resulted in higher nitrogen fixation and water stress resulted in seed ?15N and ?13C alteration. Increased stachyose indicated possible physiological and metabolic changes in carbon and nitrogen pathways and their sources under water stress. This research is beneficial to growers for fertilizer management and seed quality and to breeders to use 15N/14N and 13C/12C ratios and stachyose to select for drought tolerance soybean. PMID:25667936

  13. Pentose pathway in human liver

    SciTech Connect

    Magnusson, I.; Chandramouli, V.; Schumann, W.C.; Kumaran, K.; Wahren, J.; Landau, B.R. (Karolinska Institute at Huddinge Hospital, Stockholm (Sweden))

    1988-07-01

    (1-{sup 14}C)Ribose and (1-{sup 14}C)glucose were given to normal subjects along with glucose loads (1 g per kg of body weight) after administration of diflunisal and acetaminophen, drugs that are excreted in urine as glucuronides. Distributions of {sup 14}C were determined in the carbons of the excreted glucoronides and in the glucose from blood samples drawn from hepatic veins before and after glucagon administration. Eighty percent or more of the {sup 14}C from (1-{sup 14}C)ribose incorporated into the glucuronic acid moiety of the glucuronides was in carbons 1 and 3, with less than 8% in carbon 2. In glucuronic acid from glucuronide excreted when (2-{sup 14}C)glucose was given, 3.5-8.1% of the {sup 14}C was in carbon 1, 2.5-4.3% in carbon 3, and more than 70% in carbon 2. These distributions are in accord with the glucuronides sampling the glucose unit of the glucose 6-phosphate pool that is a component of the pentose pathway and is intermediate in glycogen formation. It is concluded that the glucuronic acid conjugates of the drugs can serve as a noninvasive means of sampling hepatic glucose 6-phosphate. In human liver, as in animal liver, the classical pentose pathway functions, not the L-type pathway, and only a small percentage of the glucose is metabolized via the pathway.

  14. Impact of titanium dioxide nanomaterials on nitrogen fixation rate and intracellular nitrogen storage in Anabaena variabilis.

    PubMed

    Cherchi, Carla; Gu, April Z

    2010-11-01

    This study comprehensively investigated the impact of titanium dioxide nanomaterials (nTiO(2)) exposure on cell growth, nitrogen fixation activity, and nitrogen storage dynamics in the primary producer cyanobacteria Anabaena variabilis at various dose concentrations and exposure time lengths. The results indicated that both growth rate (EC(50)-96 h of 0.62 mgTiO(2)/L) and nitrogen fixation activity (EC(50)-96 h of 0.4 mgTiO(2)/L) were inhibited by nTiO(2) exposure. The Hom's law (C(n)T(m)) was used as inactivation model to predict the concentration- and time-dependent inhibition of growth and nitrogen fixation activity. The kinetic parameters determined suggested that the time of exposure has a greater influence than the nTiO(2) concentration in toxicity. We observed, for the first time, that nTiO(2) induced a dose (concentration and time)-dependent increase in both the occurrence and intracellular levels of the nitrogen-rich cyanophycin grana proteins (CGPs). The results implied that CGPs may play an important role in the stress response mechanisms of nTiO(2) exposure and can serve as a toxicity assessment endpoint indicator. This study demonstrated that nitrogen-fixing activity could be hampered by the release of nTiO(2) in aquatic environments; therefore it potentially impacts important biogeochemical processes, such as carbon and nitrogen cycling. PMID:20853867

  15. Atlantoaxial Rotatory Fixation in Adults Patient

    PubMed Central

    Jeon, Sei Woong; Moon, Seung Myung; Choi, Sun Kil

    2009-01-01

    Atlantoaxial rotatory fixation (AARF) in adult is a rare disorder that occurs followed by a trauma. The patients were presented with painful torticollis and a typical 'cock robin' position of the head. The clinical diagnosis is generally difficult and often made in the late stage. In some cases, an irreducible or chronic fixation develops. We reported a case of AARF in adult patient which was treated by immobilization with conservative treatment. A 25-year-old female was presented with a posterior neck pain and limitation of motion of cervical spine after a traffic accident. She had no neurological deficit but suffered from severe defect on the scalp and multiple thoracic compression fractures. Plain radiographs demonstrated torticollis, lateral shift of odontoid process to one side and widening of one side of C1-C2 joint space. Immobilization with a Holter traction were performed and analgesics and muscle relaxants were given. Posterior neck pain and limitation of the cervical spine's motion were resolved. Plain cervical radiographs taken at one month after the injury showed that torticollis disappeared and the dens were in the midline position. The authors reported a case of type I post-traumatic AARF that was successfully treated by immobilization alone. PMID:19444353

  16. Hiatus Hernia Repair with Bilateral Oesophageal Fixation

    PubMed Central

    Martin, David

    2015-01-01

    Background. Despite advances in surgical repair of hiatus hernias, there remains a high radiological recurrence rate. We performed a novel technique incorporating bilateral oesophageal fixation and evaluated outcomes, principally symptom improvement and hernia recurrence. Methods. A retrospective study was performed on a prospective database of patients undergoing hiatus hernia repair with bilateral oesophageal fixation. Retrospective and prospective quality of life (QOL), PPI usage, and patient satisfaction data were obtained. Hernia recurrence was assessed by either barium swallow or gastroscopy. Results. 87 patients were identified in the database with a minimum of 3 months followup. There were significant improvements in QOL scores including GERD HRQL (29.13 to 4.38, P < 0.01), Visick (3 to 1), and RSI (17.45 to 5, P < 0.01). PPI usage decreased from a median of daily to none, and there was high patient satisfaction (94%). 57 patients were assessed for recurrence with either gastroscopy or barium swallow, and one patient had evidence of recurrence on barium swallow at 45 months postoperatively. There was an 8% complication rate and no mortality or oesophageal perforation. Conclusions. This study demonstrates that our technique is both safe and effective in symptom control, and our recurrence investigations demonstrate at least short term durability. PMID:26065030

  17. Atlantoaxial rotatory fixation in adults patient.

    PubMed

    Jeon, Sei Woong; Jeong, Je Hoon; Moon, Seung Myung; Choi, Sun Kil

    2009-04-01

    Atlantoaxial rotatory fixation (AARF) in adult is a rare disorder that occurs followed by a trauma. The patients were presented with painful torticollis and a typical 'cock robin' position of the head. The clinical diagnosis is generally difficult and often made in the late stage. In some cases, an irreducible or chronic fixation develops. We reported a case of AARF in adult patient which was treated by immobilization with conservative treatment. A 25-year-old female was presented with a posterior neck pain and limitation of motion of cervical spine after a traffic accident. She had no neurological deficit but suffered from severe defect on the scalp and multiple thoracic compression fractures. Plain radiographs demonstrated torticollis, lateral shift of odontoid process to one side and widening of one side of C1-C2 joint space. Immobilization with a Holter traction were performed and analgesics and muscle relaxants were given. Posterior neck pain and limitation of the cervical spine's motion were resolved. Plain cervical radiographs taken at one month after the injury showed that torticollis disappeared and the dens were in the midline position. The authors reported a case of type I post-traumatic AARF that was successfully treated by immobilization alone. PMID:19444353

  18. Growth condition study of algae function in ecosystem for CO2 bio-fixation.

    PubMed

    Tsai, David Dah-Wei; Ramaraj, Rameshprabu; Chen, Paris Honglay

    2012-02-01

    Algae niche play a crucial role on carbon cycle and have great potential for CO(2) sequestration. This study was to investigate the CO(2) bio-fixation by the high rate pond (HRP) to mimic the algae function of nature. All the reactors can keep CO(2) consumption efficiencies over 100%. The statistical analyses proved HRPs were close to the natural system from all the growth conditions. The HRP could show the "natural optimization as nature" to perform as well as the artificial reactor of continuously stirred tank reactor (CSTR). In the nutrition study, the carbon mass balance indicated CO(2) was the main carbon source. Accordingly, the HRPs can keep a neutral pH range to provide dissolved oxygen (DO), to promote total nitrogen (TN)/total phosphorous (TP) removal efficiencies and to demonstrate self-purification process. Furthermore, the observations of different nitrogen species in the reactors demonstrated that the major nitrogen source was decided by pH. This finding logically explained the complex nitrogen uptake by algae in nature. Consequently, this study took advantage of HRP to explore the processes of efficient CO(2) uptake with the corresponding growth condition in the ecosystem. Those results contributed the further understanding of the role of CO(2) bio-fixation in nature and demonstrated HRP could be a potential ecological engineering alternative. PMID:22196805

  19. Macroporous Fe3O4/carbon composite microspheres with a short Li+ diffusion pathway for the fast charge/discharge of lithium ion batteries.

    PubMed

    Choi, Seung Ho; Ko, You Na; Jung, Kyeong Youl; Kang, Yun Chan

    2014-08-25

    Macroporous Fe3O4/carbon composite and core-shell Fe3O4@carbon composite microspheres have been prepared by means of one-pot spray pyrolysis. The addition of polystyrene (PS) nanobeads to a spray solution containing an iron salt and poly(vinylpyrrolidone) (PVP) led to macroporous Fe3O4/carbon composite microspheres, the carbon and iron components of which are uniformly distributed over the entire composite microsphere. The pore-size distribution curve for the macroporous Fe3O4/carbon composite shows distinct peaks at around 10 and 80?nm. An electrode prepared from the macroporous Fe3O4/carbon composite microspheres showed better cycling and rate performances than an electrode formed from core-shell Fe3O4@carbon composite microspheres. The initial discharge and charge capacities of the macroporous Fe3O4/carbon composite microsphere electrode were determined to be 1258 and 908?mA?h?g(-1) at 2?A?g(-1), respectively, and the corresponding initial coulombic efficiency was 72?%. The composite microsphere electrode cycled 500 times at 5?A?g(-1) showed a high discharge capacity of 733?mA?h?g(-1). PMID:25059480

  20. Precision of sustained fixation in trained and untrained observers.

    PubMed

    Cherici, Claudia; Kuang, Xutao; Poletti, Martina; Rucci, Michele

    2012-01-01

    During visual fixation, microscopic eye movements shift the image on the retina over a large number of photoreceptors. Although these movements have been investigated for almost a century, the amount of retinal image motion they create remains unclear. Currently available estimates rely on assumptions about the probability distributions of eye movements that have never been tested. Furthermore, these estimates were based on data collected with only a few, highly experienced and motivated observers and may not be representative of the instability of naive and inexperienced subjects in experiments that require steady fixation. In this study, we used a high-resolution eye-tracker to estimate the probability distributions of gaze position in a relatively large group of human observers, most of whom were untrained, while they were asked to maintain fixation at the center of a uniform field in the presence/absence of a fixation marker. In all subjects, the probability distribution of gaze position deviated from normality, the underlying assumption of most previous studies. The resulting fixational dispersion of gaze was much larger than previously reported and varied greatly across individuals. Unexpectedly, the precision by which different observers maintained fixation on the marker was best predicted by the properties of ocular drift rather than those of microsaccades. Our results show that, during fixation, the eyes move by larger amounts and at higher speeds than commonly assumed and highlight the importance of ocular drift in maintaining accurate fixation. PMID:22728680

  1. 3, 10491080, 2006 Fate of N2 fixation

    E-print Network

    Boyer, Edmond

    BGD 3, 1049­1080, 2006 Fate of N2 fixation M. R. Mulholland Title Page Abstract Introduction from N2 fixation M. R. Mulholland Department of Ocean, Earth and Atmospheric Sciences, Old Dominion 2006 ­ Published: 19 July 2006 Correspondence to: M. R. Mulholland (mmulholl@odu.edu) 1049 #12;BGD 3

  2. Possibilities for the Enhancement of Biological Nitrogen Fixation

    Microsoft Academic Search

    J. R. Postgate

    1977-01-01

    Modern developments in plant science and knowledge of nitrogen fixation have opened exciting medium and long term possibilities: (1) Extended exploitation of existing systems such as exotic legumes; nonleguminous shrubs; the newly discussed grass associations; wider use of 'green manures'. (2) Augmentation of the effectiveness of existing systems by altering the complement of nitrogen fixation (nif) genes; altering the genetic

  3. Cultivar effects on nitrogen fixation in peas and lentils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Increasing nitrogen fixation in legume crops could increase cropping productivity and reduce nitrogen fertilizer use. Studies have found that crop genotype, rhizobial strain, and occasionally genotype-specific interactions affect N fixation, but this knowledge has not yet been used to evaluate or br...

  4. Application of monorail fixator for femoral gap nonunion.

    PubMed

    Agrawal, Hemendra-Kumar; Jaiman, Ashish; Khatkar, Vipin; Sharma, Vinod-Kumar

    2014-01-01

    Difficult femoral nonunion takes account of infective nonunion and aseptic gap nonunion. Limb length discrepancy and nonunion need to be tackled simultaneously. Conventionally Ilizarov ring fixator is in vogue but it has some limitations. To overcome these, monorail fixator is an effective alternative. Persistent good results can be obtained if we can get a perfect anatomical alignment and good regeneration. PMID:25098853

  5. Sacroiliac screw fixation: A mini review of surgical technique

    PubMed Central

    Alvis-Miranda, Hernando Raphael; Farid-Escorcia, Hector; Alcalá-Cerra, Gabriel; Castellar-Leones, Sandra Milena; Moscote-Salazar, Luis Rafael

    2014-01-01

    The sacral percutaneous fixation has many advantages but can be associated with a significant exposure to X-ray radiation. Currently, sacroiliac screw fixation represents the only minimally invasive technique to stabilize the posterior pelvic ring. It is a technique that should be used by experienced surgeons. We present a practical review of important aspects of this technique. PMID:25336831

  6. Dry Matter Accumulation and Dinitrogen Fixation of Annual Medicago Species

    Microsoft Academic Search

    Yanping Zhu; Craig C. Sheaffer; Michael P. Russelle; Carroll P. Vance

    1998-01-01

    for predicting the net N contribution of annual medics in cropping systems and for selecting species with high Assessment of the N2 fixation potential of annual medics (Medicago N2 fixation under regional environmental conditions and spp.) in the upper Midwest is important for predicting the net N contribution to cropping systems. Our objectives were to determine farming practices. the dry

  7. [A new automated method for the complement fixation reaction].

    PubMed

    Müller, G; Thielecke, K H; Budek, I; Schabinski, G

    1975-01-01

    The authors describe an automatic method for the complement fixation reaction. Antigen, complement, and barbitolum-buffer are dropped automatically. The fixation reaction is performed in a refugotor, in Kolmer's method. An autoanalyzer (flow-stream principle) is used for the lysis reaction. The advantages of this method are discussed. PMID:1199394

  8. Session Fixation the Forgotten Vulnerability? Michael Schrank1

    E-print Network

    Posegga, Joachim

    steps to assess the current attack surface of Session Fixation. Finally, we present a transparent server attack surface of Session Fixation (Sec. 3). Finally, we present a transparent server-side method hijacking attack through controlling the victim's session identifier value. We explore this vulnerability

  9. CRISP: A Computational Model of Fixation Durations in Scene Viewing

    ERIC Educational Resources Information Center

    Nuthmann, Antje; Smith, Tim J.; Engbert, Ralf; Henderson, John M.

    2010-01-01

    Eye-movement control during scene viewing can be represented as a series of individual decisions about where and when to move the eyes. While substantial behavioral and computational research has been devoted to investigating the placement of fixations in scenes, relatively little is known about the mechanisms that control fixation durations.…

  10. Open reduction and internal fixation of the distal radius

    Microsoft Academic Search

    David S. Ruch; T. Adam Ginn

    2003-01-01

    Fractures of the distal radius are one of the most common problems treated by orthopaedic surgeons. The managementof unstable fractures is now almost routinely surgical, and multiple techniques have been developed to accomplish this including pins and plaster, external fixation, and internal fixation. Recent studies and classification systems have stressed the importance of identification of specific fracture fragments. Given that

  11. Fusion of Fixation and Odometry for Vehicle Navigation

    Microsoft Academic Search

    Amit Adam; Ehud Rivlin; Héctor Rotstein

    1999-01-01

    This paper deals with the problem of determining the position and orientation of an autonomous guided vehicle (AGV) by fusing odometry with the information provided by a vision system. The main idea is to exploit the ability of pointing a camera in different directions, to fixate on a point of the environment while the AGV is moving. By fixating on

  12. Humor Preference as a Function of Preoedipal Fixation.

    ERIC Educational Resources Information Center

    Juni, Samuel

    1982-01-01

    Psychoanalytic theory predicts that humor preference is a derivative of unresolved childhood conflicts. Analyzed students' (N=104) Rorschach protocols to yield measures of preoedipal fixation. Students ranked jokes from most to least funny. Results showed that the ranking of jokes was a function of the fixation measures for women only. (Author/RC)

  13. FIXATION OF FISH TISSUES. IN: THE LABORATORY FISH.

    EPA Science Inventory

    This chapter deals with the fixation of fish tissues and whole fish. Traditionally, fixation has been applied to animal tissues mainly for histological or pathological studies. Development of new molecular and immunologic tools now allows tissue and cellular localization of nucle...

  14. Minimally Invasive Strabismus Surgery for Rectus Muscle Posterior Fixation

    Microsoft Academic Search

    Daniel S. Mojon

    2009-01-01

    Aims: To present a novel, minimally invasive strabismus surgery (MISS) technique for rectus muscle posterior fixation. Methods: This study reports the results of 32 consecutive MISS rectus muscle posterior fixation surgeries performed on 19 patients by applying only two small L-shaped openings where the two retroequatorial scleromuscular sutures were placed. Results: On the first postoperative day, in primary position, redness

  15. What Eye Fixation Patterns Tell Us About Subitizing

    Microsoft Academic Search

    Catherine Sophian; Martha E. Crosby

    2008-01-01

    Differences between the enumeration of very small (1–3) versus larger (4–6) numerosities were examined by investigating where people fixate when they are enumerating different numbers of items. Overall, fixations were more likely to be located in regions of the array that contained target items when the array contained 4 or more targets than when it contained 3 or fewer, a

  16. A new adhesive technique for internal fixation in midfacial surgery

    Microsoft Academic Search

    Kira Endres; Rudolf Marx; Joachim Tinschert; Dieter Christian Wirtz; Christian Stoll; Dieter Riediger; Ralf Smeets

    2008-01-01

    BACKGROUND: The current surgical therapy of midfacial fractures involves internal fixation in which bone fragments are fixed in their anatomical positions with osteosynthesis plates and corresponding screws until bone healing is complete. This often causes new fractures to fragile bones while drilling pilot holes or trying to insert screws. The adhesive fixation of osteosynthesis plates using PMMA bone cement could

  17. The role of nitrogen fixation in biogeochemical cycling in the subtropical North Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Karl, D.; Letelier, R.; Tupas, L.; Dore, J.; Christian, J.; Hebel, D.

    1997-08-01

    Seven years of time-series observations of biogeochemical processes in the subtropical North Pacific Ocean gyre have revealed dramatic changes in the microbial community structure and in the mechanisms of nutrient cycling in response to large-scale ocean-atmosphere interactions. Several independent lines of evidence show that the fixation of atmospheric nitrogen by cyanobacteria can fuel up to half of the new production. These and other observations demand a reassessment of present views of nutrient and carbon cycling in one of the Earth's largest biomes.

  18. Metabolic Activities in Extracts of Mesophyll and Bundle Sheath Cells of Panicum miliaceum (L.) in Relation to the C(4) Dicarboxylic Acid Pathway of Photosynthesis.

    PubMed

    Edwards, G E; Gutierrez, M

    1972-12-01

    The activities of certain enzymes related to the carbon assimilation pathway in whole leaves, mesophyll cell extracts, and bundle sheath extracts of the C(4) plant Panicum miliaceum have been measured and compared on a chlorophyll basis. Enzymes of the C(4) dicarboxylic acid pathway-phosphoenolpyruvate carboxylase and NADP-malic dehydrogenase-were localized in mesophyll cells. Carbonic anhydrase was also localized in mesophyll cell extracts. Ribose 5-phosphate isomerase, ribulose 5-phosphate kinase, and ribulose diphosphate carboxylase-enzymes of the reductive pentose phosphate pathway-were predominantly localized in bundle sheath extracts. High activities of aspartate and alanine transaminases and glyceraldehyde-3-P dehydrogenase were found about equally distributed between the photosynthetic cell types. P. miliaceum had low malic enzyme activity in both mesophyll and bundle sheath extracts.Isolated bundle sheath cells were capable of converting aspartate to oxalacetate at rates approaching the aspartate transaminase activity of bundle sheath extracts. The bundle sheath cells had a light induced CO(2) fixation of 23 mumoles of CO(2)/mg chl.hr in the absence of exogenous substrates.The photorespiratory enzymes, hydroxypyruvate reductase and glycolic oxidase, were about 3 fold higher in bundle sheath extracts than in mesophyll extracts when compared on a chlorophyll basis. PMID:16658252

  19. Increasing subtropical North Pacific Ocean nitrogen fixation since the Little Ice Age

    NASA Astrophysics Data System (ADS)

    Sherwood, Owen A.; Guilderson, Thomas P.; Batista, Fabian C.; Schiff, John T.; McCarthy, Matthew D.

    2014-01-01

    The North Pacific subtropical gyre (NPSG) plays a major part in the export of carbon and other nutrients to the deep ocean. Primary production in the NPSG has increased in recent decades despite a reduction in nutrient supply to surface waters. It is thought that this apparent paradox can be explained by a shift in plankton community structure from mostly eukaryotes to mostly nitrogen-fixing prokaryotes. It remains uncertain, however, whether the plankton community domain shift can be linked to cyclical climate variability or a long-term global warming trend. Here we analyse records of bulk and amino-acid-specific 15N/14N isotopic ratios (?15N) preserved in the skeletons of long-lived deep-sea proteinaceous corals collected from the Hawaiian archipelago; these isotopic records serve as a proxy for the source of nitrogen-supported export production through time. We find that the recent increase in nitrogen fixation is the continuation of a much larger, centennial-scale trend. After a millennium of relatively minor fluctuation, ?15N decreases between 1850 and the present. The total shift in ?15N of -2 per mil over this period is comparable to the total change in global mean sedimentary ?15N across the Pleistocene-Holocene transition, but it is happening an order of magnitude faster. We use a steady-state model and find that the isotopic mass balance between nitrate and nitrogen fixation implies a 17 to 27 per cent increase in nitrogen fixation over this time period. A comparison with independent records suggests that the increase in nitrogen fixation might be linked to Northern Hemisphere climate change since the end of the Little Ice Age.

  20. Screw fixation of an OCD loose body: 21-year results.

    PubMed

    Cvetanovich, Gregory L; Mall, Nathan A; Van Thiel, Geoffrey S; Chahal, Jaskarndip; Bach, Bernard

    2013-12-01

    Osteochondritis dissecans (OCD) lesions can progress to loose body formation for which treatment is controversial and may involve excision or fixation. There is a paucity of published data regarding long-term outcomes following OCD loose body fixation. This case report presents an interval follow-up of a patient from a previous small case series of individuals who underwent open reduction internal fixation of large, lateral OCD loose bodies. At 21-year follow-up the patient has full, pain-free range of motion, and has not required subsequent surgery. This case, to our knowledge, is the first to report over 20-year follow-up from fixation of an OCD loose body and demonstrates a good long-term outcome. Clinicians should consider replacement and fixation of an OCD loose body when possible, as this may provide the best chance of long-term function. PMID:23288769

  1. Fixation and escape times in stochastic game learning

    NASA Astrophysics Data System (ADS)

    Realpe-Gomez, John; Szczesny, Bartosz; Dall'Asta, Luca; Galla, Tobias

    2012-10-01

    Evolutionary dynamics in finite populations is known to fixate eventually in the absence of mutation. We here show that a similar phenomenon can be found in stochastic game dynamical batch learning, and investigate fixation in learning processes in a simple 2×2 game, for two-player games with cyclic interaction, and in the context of the best-shot network game. The analogues of finite populations in evolution are here finite batches of observations between strategy updates. We study when and how such fixation can occur, and present results on the average time-to-fixation from numerical simulations. Simple cases are also amenable to analytical approaches and we provide estimates of the behaviour of so-called escape times as a function of the batch size. The differences and similarities with escape and fixation in evolutionary dynamics are discussed.

  2. Les dterminants du prix du carbone sur le march europen des quotas Carbon price drivers in the EU Emissions Trading Scheme

    E-print Network

    Paris-Sud XI, Université de

    Les déterminants du prix du carbone sur le marché européen des quotas Carbon price drivers développement du prix du carbone en Europe de 2005 à 2009 et ses fondamentaux, avant de fournir les préceptes négociations sur un point majeur : la fixation du prix du carbone. Les négociateurs doivent retenir trois

  3. Making a living while starving in the dark: metagenomic insights into the energy dynamics of a carbonate cave

    PubMed Central

    Ortiz, Marianyoly; Legatzki, Antje; Neilson, Julia W; Fryslie, Brandon; Nelson, William M; Wing, Rod A; Soderlund, Carol A; Pryor, Barry M; Maier, Raina M

    2014-01-01

    Carbonate caves represent subterranean ecosystems that are largely devoid of phototrophic primary production. In semiarid and arid regions, allochthonous organic carbon inputs entering caves with vadose-zone drip water are minimal, creating highly oligotrophic conditions; however, past research indicates that carbonate speleothem surfaces in these caves support diverse, predominantly heterotrophic prokaryotic communities. The current study applied a metagenomic approach to elucidate the community structure and potential energy dynamics of microbial communities, colonizing speleothem surfaces in Kartchner Caverns, a carbonate cave in semiarid, southeastern Arizona, USA. Manual inspection of a speleothem metagenome revealed a community genetically adapted to low-nutrient conditions with indications that a nitrogen-based primary production strategy is probable, including contributions from both Archaea and Bacteria. Genes for all six known CO2-fixation pathways were detected in the metagenome and RuBisCo genes representative of the Calvin–Benson–Bassham cycle were over-represented in Kartchner speleothem metagenomes relative to bulk soil, rhizosphere soil and deep-ocean communities. Intriguingly, quantitative PCR found Archaea to be significantly more abundant in the cave communities than in soils above the cave. MEtaGenome ANalyzer (MEGAN) analysis of speleothem metagenome sequence reads found Thaumarchaeota to be the third most abundant phylum in the community, and identified taxonomic associations to this phylum for indicator genes representative of multiple CO2-fixation pathways. The results revealed that this oligotrophic subterranean environment supports a unique chemoautotrophic microbial community with potentially novel nutrient cycling strategies. These strategies may provide key insights into other ecosystems dominated by oligotrophy, including aphotic subsurface soils or aquifers and photic systems such as arid deserts. PMID:24030597

  4. Lipid antigen presentation through CD1d pathway in mouse lung epithelial cells, macrophages and dendritic cells and its suppression by poly-dispersed single-walled carbon nanotubes.

    PubMed

    Rizvi, Zaigham Abbas; Puri, Niti; Saxena, Rajiv K

    2015-09-01

    Effect of poly-dispersed acid-functionalized single-walled carbon nanotubes (AF-SWCNTs) was examined on lipid antigen presentation through CD1d pathway on three cell lines, LA4, MHS, and JAWSII used as prototype antigen presenting cells (APCs). CD1d molecule was expressed on 80-90% MHS (prototype macrophages) and JAWSII (prototype dendritic cells) cells whereas <5% LA4 cells (lung epithelial cells, non-classical APCs) expressed CD1d. Treatment with AF-SWCNTs but not with pristine SWCNTs resulted in a significant decline in the level of CD1d mRNA as well as mRNA levels of some other intracellular proteins involved in lipid antigen presentation pathway (MTP, ApoE, prosaposin, SR-BI and LDLr). Lipid antigen presentation was assessed by first incubating the cells with a prototype lipid antigen (?-Glactosylceramide or ?GC) and then staining with L363 monoclonal antibody that detects ?GC bound to CD1d molecule. While 100% MHS and JAWSII cells presented ?GC, only 20% LA4 cells presented the CD1d antigen. Treatment with AF-SWCNTs resulted in a 30-40% decrease in ?GC antigen presentation in all three cell lines. These results show that AF-SWCNT treatment down regulated the lipid antigen presentation pathway in all three cell lines and significantly lowered the ability of these cell lines to present ?GC antigen. PMID:25448806

  5. A Quantitative Study of Fixation Stability in Amblyopia

    PubMed Central

    Subramanian, Vidhya; Jost, Reed M.; Birch, Eileen E.

    2013-01-01

    Purpose. To determine whether fixation instability contributes to reduced visual acuity in amblyopia, we compared fixation instability, quantified by the Nidek MP-1 microperimeter, in amblyopic and nonamblyopic children. Methods. Participants were 89 children (5–17 years old) with strabismus (n = 31), anisometropia (n = 29), or both conditions (n = 29). Fixation instability was measured using the Nidek MP-1 microperimeter, which calculated horizontal and vertical eye position at 25 Hz as the child attempted steady fixation for 30 seconds. Fixation instability was quantified as the 95% bivariate contour ellipse area (95% BCEA), the best-fit ellipse within which 95% of fixation occurred during the 30-second test. BCEA was normalized by log transformation. Results. Children with amblyopia had significantly larger BCEAs for amblyopic eyes (mean = 0.56 log deg2) than fellow eyes (mean = 0.2 log deg2, P < 0.01) and right eyes of normal controls (mean = 0.12 log deg2, P ? 0.01). Fixation instability was significantly greater along the horizontal axis of the ellipse for amblyopic (mean = 3.53°) than fellow (mean = 1.98°, P = 0.008), and control (mean = 1.62°, P < 0.001) eyes. Conclusions. Fixation instability in amblyopic eyes of children with strabismus and/or anisometropia, and the associated poor stereoacuity probably is the consequence of decorrelated binocular experience early in life. Longer duration of decorrelated visual experience is associated with increased fixation instability, poorer stereoacuity, and more severe amblyopia. Treatments that minimize the duration of decorrelated visual experience may improve stereoacuity and decrease fixation instability. PMID:23372053

  6. Uncertainties of Nitrogen Fixation in a Dynamic Global Vegetation Model

    NASA Astrophysics Data System (ADS)

    Steinkamp, Joerg; Werner, Christian; Weber, Bettina; Hickler, Thomas

    2015-04-01

    Nitrogen is an essential nutrient for life on earth. However, most of it is in the form of dinitrogen (N2) unutilizable to life and only few organisms are able to break the triple bond, fix the nitrogen and thus make it available for cycling in the biosphere through "fixation". In most state-of-the-art dynamic global vegetation models (DGVMs) including a nitrogen cycle, N fixation is simulated by the Cleveland et al. (1999) algorithm (O-CN, LPJ-GUESS, CLM), that correlates annual N fixation to evapotranspiration rates or net primary production. Nevertheless, this algorithm has two major uncertainties, which are investigated by us: 1. The algorithm is based on annual fixation rates that are then applied uniformly throughout the year. However, in nature nitrogen fixation is an expensive process, which occurs only under favorable conditions. Here we compare the annual fixation values evenly distributed over the year with daily-derived fixation values based on a modified version of the Cleveland algorithm. We postulate that in higher latitudinal regions with seasonal climate as well as in regions with a distinct dry/wet season, modeled growth is enhanced by daily derived values compared to evenly distributed values, whereas in tropical regions hardly any difference will be visible. 2. One distinguishes between symbiotic and unsymbiotic nitrogen fixation, where the first one is associated with higher plants as symbionts supplying the fixers with carbohydrates, whereas the second, unsymbiotic is performed by so-called cryptogamic covers (CC). We found that the fixation by CC is underrepresented by the Cleveland algorithm, and a correction thus leads to enhanced growth in forested regions of higher latitudes that feature substantial CC fractions. Overall, the improvements of the algorithm proposed by us are expected to better reflect the reality of nitrogen fixation and cause an increased growth of vegetation, especially in higher northern latitudes.

  7. Biomechanical comparison of quadriceps tendon fixation with patellar tendon bone plug interference fixation in cruciate ligament reconstruction

    Microsoft Academic Search

    Jeff Brand; Doris Hamilton; Jeff Selby; David Pienkowski; David N. M. Caborn; Darren L. Johnson

    2000-01-01

    Purpose: The purpose of this study was to use current fixation techniques and compare the stiffness and ultimate tensile failure of the tendinous end of the quadriceps tendon (QT) with the bone plug end of the bone–patellar tendon–bone (BPTB) graft using current techniques of fixation. Type of Study: Randomized trial of elderly cadaver knees. Materials and Methods: Tibial and femoral

  8. Legumes, N2 fixation and the H2 cycle

    NASA Astrophysics Data System (ADS)

    Layzell, D. B.

    2004-12-01

    Legume plants such as soybean or pea can form symbiotic, N2 fixing associations with bacteria that exist in root nodules. For every N2 fixed, 1 to 3 H2 are produced as a by-product of the nitrogenase reaction. Therefore, a typical N2 fixing legume crop produces about 200,000 L H2 gas (at STP) per hectare per crop season. This paper will summarize our current understanding of the processes leading to H2 production in legumes, the magnitude of H2 production associated with global cropping systems, and the implications for its production and oxidation on both the legumes and the soils in which they grow. Specific points may include: ˜ In symbioses lacking uptake hydrogenase (HUP) activity (thought to be the majority of crop legumes), the H2 diffuses into the soil where it is oxidized by soil microbes that grow up around the legume nodules. The kinetic properties of these microbes are very different (higher Km and Vmax) from that of microbes in soils exposed to normal air (ca. 0.5 ppm H2); ˜ Laboratory studies indicate that 60% of the reducing power from H2 is coupled to O2 uptake, whereas 40% is coupled to autotrophic CO2 fixation. The latter process should increase soil carbon stocks by about 25 kg C/ha/yr; ˜ At the site of the nitrogenase enzyme, H2 production is autocatalytic such that the higher the H2 concentration, the more H2 is produced and the less N2 fixed. The variable O2 diffusion barrier in legumes can act to restrict H2 diffusion from the nodule, thereby increasing the relative magnitude of H2 production versus N2 fixation; ˜ Studies to understand why legume symbioses make such an energy investment in H2 production have led to the discovery that H2 treated soils have improved fertility, supporting the growth and yield of legume and non-legume crops. This observation may account for the benefits of legumes when used in rotation with cereal crops, a phenomenon that has been used by farmers for over 2000 years, but which has remained unexplained. An attempt will be made to position these results and insights in the context of the impact that a future H2 economy will have on the H2 cycle.

  9. A Meta-Analysis for Postoperative Complications in Tibial Plafond Fracture: Open Reduction and Internal Fixation Versus Limited Internal Fixation Combined With External Fixator.

    PubMed

    Wang, Dong; Xiang, Jian-Ping; Chen, Xiao-Hu; Zhu, Qing-Tang

    2015-01-01

    The treatment of tibial plafond fractures is challenging to foot and ankle surgeons. Open reduction and internal fixation and limited internal fixation combined with an external fixator are 2 of the most commonly used methods of tibial plafond fracture repair. However, conclusions regarding the superior choice remain controversial. The present meta-analysis aimed to quantitatively compare the postoperative complications between open reduction and internal fixation and limited internal fixation combined with an external fixator for tibial plafond fractures. Nine studies with 498 fractures in 494 patients were included in the present study. The meta-analysis found no significant differences in bone healing complications (risk ratio [RR] 1.17, 95% confidence interval [CI] 0.68 to 2.01, p = .58], nonunion (RR 1.09, 95% CI 0.51 to 2.36, p = .82), malunion or delayed union (RR 1.24, 95% CI 0.57 to 2.69, p = .59), superficial (RR 1.56, 95% CI 0.43 to 5.61, p = .50) and deep (RR 1.89, 95% CI 0.62 to 5.80) infections, arthritis symptoms (RR 1.20, 95% CI 0.92 to 1.58, p = .18), or chronic osteomyelitis (RR 0.31, 95% CI 0.05 to 1.84, p = .20) between the 2 groups. PMID:25128304

  10. A new concept for implant fixation: bone-to-bone biologic fixation.

    PubMed

    Kim, D Y; Kim, J R; Jang, K Y; Lee, K B

    2015-01-01

    Many attempts have been made to reduce complications of bone implant, such as pedicle screw loosening. To address this problem, the authors suggest a new concept of bone-to-bone biologic fixation using recombinant human bone morphogenetic protein-2 (rhBMP-2)-loaded cannulated pedicle screws. Recombinant human bone morphogenetic protein-2 is an osteoinductive cytokine. Four types of titanium pedicle screws were tested (uncannulated, cannulated with no loading, beta-tricalcium phosphate (TCP)-loaded, and TCP/BMP2 loaded) using 16 miniature pigs. Radiological evaluation was conducted to assess the fusion and loosening of pedicle screws. Twelve weeks after implantation, peak torsional extraction torque was measured, and the pedicle screw and bone interface was evaluated by micro-computed tomography (µCT) and histologic examination. The mean value of the radiological score was significantly greater in the TCP/BMP2 loaded group at 12 weeks post-operation compared to those in the other groups. CT images showed distinct bone formation surrounding TCP/BMP2 loaded cannulated pedicle screws compared to the other groups. Mean extraction torsional peak torque at 12 weeks postoperative was more than 10-fold higher in the TCP/BMP2 loaded pedicle screw group than in the other groups. Bone surface and bone volume, as quantitated through µCT, were higher in the TCP/BMP2 loaded group. Histologic examination revealed bone-to-bone fixation at the interface of pedicle screws and pre-existing bone. Bone-to-bone biologic fixation through the holes of TCP/BMP2 loaded pedicle screws significantly increased fixation strength and represents a novel method that can be applied to osteoporotic or tumour spine surgeries. PMID:25978116

  11. A Novel Role of Exogenous Carbon Monoxide on Protecting Cardiac Function and Improving Survival against Sepsis via Mitochondrial Energetic Metabolism Pathway

    PubMed Central

    Wang, Xu; Qin, Weiting; Qiu, Xuefeng; Cao, Jie; Liu, Dadong; Sun, Bingwei

    2014-01-01

    Septic cardiac dysfunction is the main cause of death in septic patients. Here we investigate whether exogenous carbon monoxide can protect cardiac function and improve survival against sepsis by interfering with mitochondrial energetic metabolism. Male C57BL/6 mice were subjected to cecal ligation and puncture to induce sepsis. Exogenous carbon monoxide delivered from Tricarbonyldichlororuthenium (II) dimer (carbon monoxide releasing molecule II, 8mg/kg) was used intravenously as intervention. We found that carbon monoxide significantly improved cardiac function (LVEF 80.26 ± 2.37% vs. 71.21 ± 1.37%, P < 0.001; LVFS 43.52 ± 1.92% vs. 34.93 ± 1.28%, P < 0.001) and increased survival rate of septic mice (63% vs. 25%, P < 0.01). This phenomenon might be owing to the beneficial effect of carbon monoxide on abolishing the elevation of cardiac enzyme activity, cytokines levels and apoptosis rate, then attenuating cardiac injury in septic mice. Meanwhile, carbon monoxide significantly reversed the loss of mitochondrial number, effectively inhibited cardiac mitochondrial damage in septic mice by modulating glucose uptake, adenosine triphosphate and lactate content. Furthermore upregulation of peroxisome proliferator-activated receptor-? coactivator-1?, nuclear respiratory factor 1 and mitochondrial transcription factor A genes in cardiac tissue were revealed in septic mice treated with carbon monoxide. Taken together, the results indicate that exogenous carbon monoxide effectively modulated mitochondrial energetic metabolisms by interfering with expression of peroxisome proliferator-activated receptor-? coactivator-1?, nuclear respiratory factor 1 and mitochondrial transcription factor A genes, consequently exerted an important improvement in sepsis-induced cardiac dysfunction. PMID:25076854

  12. Oxygen relations of nitrogen fixation in cyanobacteria.

    PubMed Central

    Fay, P

    1992-01-01

    The enigmatic coexistence of O2-sensitive nitrogenase and O2-evolving photosynthesis in diazotrophic cyanobacteria has fascinated researchers for over two decades. Research efforts in the past 10 years have revealed a range of O2 sensitivity of nitrogenase in different strains of cyanobacteria and a variety of adaptations for the protection of nitrogenase from damage by both atmospheric and photosynthetic sources of O2. The most complex and apparently most efficient mechanisms for the protection of nitrogenase are incorporated in the heterocysts, the N2-fixing cells of cyanobacteria. Genetic studies indicate that the controls of heterocyst development and nitrogenase synthesis are closely interrelated and that the expression of N2 fixation (nif) genes is regulated by pO2. Images PMID:1620069

  13. Cell Fixation in Zinc Salt Solution is Compatible with DNA Damage Response Detection by Phospho-Specific Antibodies

    PubMed Central

    Zhao, Hong; Li, Jiangwei; Traganos, Frank; Halicka, H. Dorota; Zarebski, Miroslaw; Dobrucki, Jurek; Darzynkiewicz, Zbigniew

    2011-01-01

    By virtue of superior preservation of proteins and nucleic acids the zinc salt-based fixatives (ZBF) has been proposed as an alternative to precipitants and cross-linking fixatives in histopathology. It was recently reported that ZBF is compatible with analysis of cell surface immunophenotype and detection of intracellular epitopes by flow cytometry. The aim of this study was to explore whether ZBF is also compatible with the detection of DNA damage response assessed by phospho-specific antibodies (Abs) detecting phosphorylation of the key proteins of that pathway. DNA damage in human pulmonary adenocarcinoma A549 cells was induced by treatment with the DNA topoisomerase I inhibitor camptothecin and phosphorylation of histone H2AX on Ser139 (?H2AX) and of ATM on Ser1981 was detected with phospho-specific Abs; cellular fluorescence was measured by laser scanning cytometry (LSC). The sensitivity and accuracy of detection of H2AX and ATM phosphorylation concurrent with the detection of DNA replication by EdU incorporation and “click chemistry” was found in ZBF fixed cells to be comparable to that of cell fixed in formaldehyde. The accuracy of DNA content measurement as evident from the resolution of DNA content frequency histograms of cells stained with DAPI was somewhat better in ZBF- than in formaldehyde-fixed cells. The pattern of chromatin condensation revealed by the intensity of maximal pixel of DAPI that allows one to identify mitotic and immediately post-mitotic cells by LSC was preserved after ZBF fixation. ZBF fixation was also compatible with the detection of ?H2AX foci considered to be the hallmarks of induction of DNA double-strand breaks. Analysis of cells by flow cytometry revealed that ZBF fixation of lymphoblastoid TK6 cells led to about 60 and 33% higher intensity of the side and forward light scatter, respectively, compared to formaldehyde fixed cells. PMID:21595014

  14. Amazon River enhances diazotrophy and carbon sequestration in the tropical North Atlantic Ocean

    E-print Network

    Subramaniam, Ajit

    #12;Amazon River enhances diazotrophy and carbon sequestration in the tropical North Atlantic Ocean in carbon sequestration. Here, we report that the Amazon River plume supports N2 fixation far from the mouth of atmospheric carbon to the deep ocean (3), or ``carbon sequestration'' (4). The Amazon River has the largest

  15. Deep-Sea Hydrocarbon Seep Communities: Evidence for Energy and Nutritional Carbon Sources

    Microsoft Academic Search

    James M. Brooks; M. C. II Kennicutt; C. R. Fisher; S. A. Macko; K. Cole; J. J. Childress; R. R. Bidigare; R. D. Vetter

    1987-01-01

    Mussels, clams, and tube worms collected in the vicinity of hydrocarbon seeps on the Louisiana slope contain mostly ``dead'' carbon, indicating that dietary carbon is largely derived from seeping oil and gas. Enzyme assays, elemental sulfur analysis, and carbon dioxide fixation studies demonstrate that vestimentiferan tube worms and three clam species contain intracellular, autotrophic sulfur bacterial symbionts. Carbon isotopic ratios

  16. Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca.

    PubMed

    Temme, Karsten; Zhao, Dehua; Voigt, Christopher A

    2012-05-01

    Bacterial genes associated with a single trait are often grouped in a contiguous unit of the genome known as a gene cluster. It is difficult to genetically manipulate many gene clusters because of complex, redundant, and integrated host regulation. We have developed a systematic approach to completely specify the genetics of a gene cluster by rebuilding it from the bottom up using only synthetic, well-characterized parts. This process removes all native regulation, including that which is undiscovered. First, all noncoding DNA, regulatory proteins, and nonessential genes are removed. The codons of essential genes are changed to create a DNA sequence as divergent as possible from the wild-type (WT) gene. Recoded genes are computationally scanned to eliminate internal regulation. They are organized into operons and placed under the control of synthetic parts (promoters, ribosome binding sites, and terminators) that are functionally separated by spacer parts. Finally, a controller consisting of genetic sensors and circuits regulates the conditions and dynamics of gene expression. We applied this approach to an agriculturally relevant gene cluster from Klebsiella oxytoca encoding the nitrogen fixation pathway for converting atmospheric N(2) to ammonia. The native gene cluster consists of 20 genes in seven operons and is encoded in 23.5 kb of DNA. We constructed a "refactored" gene cluster that shares little DNA sequence identity with WT and for which the function of every genetic part is defined. This work demonstrates the potential for synthetic biology tools to rewrite the genetics encoding complex biological functions to facilitate access, engineering, and transferability. PMID:22509035

  17. Effect of fixation on neovascularization during bone healing.

    PubMed

    Zhao, Feng; Zhou, Zhilun; Yan, Yang; Yuan, Zhen; Yang, Guanzhong; Yu, Hao; Su, Hao; Zhang, Tao; Fan, Yubo

    2014-11-01

    Fixation and vascularity after bone fracture are two critical factors for successful healing, and their influences on bone healing have been studied by many researchers. This research aims to obtain three-dimensional (3D) reconstruction images of neovascularization of the soft tissues surrounding the fracture with vascular perfusion and micro-computer tomography (micro-CT) imaging, and to investigate the effect of stable fixation on neovascularization and the pattern of vascularity during the process of bone healing. To accomplish this, 36 Sprague-Dawley (SD) rats underwent mid-shaft transverse osteotomy of the right tibia. Half of them received stable fixation with a newly custom-designed external fixator (FSF, the group of fracture with stable fixation), while the rest received no fixation (FNF, the group of fracture with no fixation). The results indicated that FNF samples had more transversal vascular distribution than FSF samples; FSF samples had more longitudinal vascular distribution than FNF samples; and the spatio-temporal pattern of vascularity in FSF samples was more similar to that in the control group (CON, the group without fracture) than that in FNF samples. At the time of 2 and 4 weeks postoperatively, FNF samples had significantly higher vessel volume ratio (VV/TV), larger vessel number (VN) and higher vessel surface density (VS/TV) than CON samples. At all sacrifice times, FSF samples contained significantly higher VV/TV, VN and VS/TV values compared with FNF samples. In summary, neovascularization and its pattern are obviously influenced by the mechanical fixation. Stable fixation can promote longitudinal vascularity pattern formation, which tends to be similar to the natural vascularity pattern, and this benefits the inter-fragmentary blood fluid connectivity during bone healing process. PMID:25080898

  18. Design and Optimization of Resorbable Silk Internal Fixation Devices

    NASA Astrophysics Data System (ADS)

    Haas, Dylan S.

    Limitations of current material options for internal fracture fixation devices have resulted in a large gap between user needs and hardware function. Metal systems offer robust mechanical strength and ease of implantation but require secondary surgery for removal and/or result in long-term complications (infection, palpability, sensitivity, etc.). Current resorbable devices eliminate the need for second surgery and long-term complications but are still associated with negative host response as well as limited functionality and more difficult implantation. There is a definitive need for orthopedic hardware that is mechanically capable of immediate fracture stabilization and fracture fixation during healing, can safely biodegrade while allowing complete bone remodeling, can be resterilized for reuse, and is easily implantable (self-tapping). Previous work investigated the use of silk protein to produce resorbable orthopedic hardware for non- load bearing fracture fixation. In this study, silk orthopedic hardware was further investigated and optimized in order to better understand the ability of silk as a fracture fixation system and more closely meet the unfulfilled market needs. Solvent-based and aqueous-based silk processing formulations were cross-linked with methanol to induce beta sheet structure, dried, autoclaved and then machined to the desired device/geometry. Silk hardware was evaluated for dry, hydrated and fatigued (cyclic) mechanical properties, in vitro degradation, resterilization, functionalization with osteoinductive molecules and implantation technique for fracture fixation. Mechanical strength showed minor improvements from previous results, but remains comparable to current resorbable fixation systems with the advantages of self-tapping ability for ease of implantation, full degradation in 10 months, ability to be resterilized and reused, and ability to release molecules for osteoinudction. In vivo assessment confirmed biocompatibility, showed improved bone deposition and remodeling with functionalization and showed promising feasibility of fracture fixations with minor adjustments to geometry. The proposed silk orthopedic hardware exhibits high potential as a resorbable fixation system that can bridge the gap between the current materials for internal fixation devices.

  19. Cowpea ratooning as affected by cultivar, cutting height, and time of cutting and its effect on nitrogen fixation 

    E-print Network

    Scheuring, Douglas Charles

    1990-01-01

    and Phillips (1982) found a nearly parallel response among ten cultivars of alfalfa for acetylene reduction, leaf area, and carbon exchange rates following shoot harvest. Carbon exchange rates declined by 99% and C2H2 reduction declined by 75% three days... DAC, and had declined again at 54 DAG Based on these studies, to maximize both ratoon and re-growth yields, cowpea should be cut no lower than the fourth node and plants cut in the dry-pod stage and N2 fixation rates in ratooning cowpea recovered...

  20. CO(2) uptake and fixation by a thermoacidophilic microbial community attached to precipitated sulfur in a geothermal spring.

    PubMed

    Boyd, Eric S; Leavitt, William D; Geesey, Gill G

    2009-07-01

    Carbon fixation at temperatures above 73 degrees C, the upper limit for photosynthesis, is carried out by chemosynthetic thermophiles. Yellowstone National Park (YNP), Wyoming possesses many thermal features that, while too hot for photosynthesis, presumably support chemosynthetic-based carbon fixation. To our knowledge, in situ rates of chemosynthetic reactions at these high temperatures in YNP or other high-temperature terrestrial geothermal springs have not yet been reported. A microbial community attached to precipitated elemental sulfur (S(o) floc) at the source of Dragon Spring (73 degrees C, pH 3.1) in Norris Geyser Basin, YNP, exhibited a maximum rate of CO(2) uptake of 21.3 +/- 11.9 microg of C 10(7) cells(-1) h(-1). When extrapolated over the estimated total quantity of S(o) floc at the spring's source, the S(o) floc-associated microbial community accounted for the uptake of 121 mg of C h(-1) at this site. On a per-cell basis, the rate was higher than that calculated for a photosynthetic mat microbial community dominated by Synechococcus spp. in alkaline springs at comparable temperatures. A portion of the carbon taken up as CO(2) by the S(o) floc-associated biomass was recovered in the cellular nucleic acid pool, demonstrating that uptake was coupled to fixation. The most abundant sequences in a 16S rRNA clone library of the S(o) floc-associated community were related to chemolithoautotrophic Hydrogenobaculum strains previously isolated from springs in the Norris Geyser Basin. These microorganisms likely contributed to the uptake and fixation of CO(2) in this geothermal habitat. PMID:19429558

  1. Mevalonate shunt pathway revisited

    SciTech Connect

    Watson, J.A.; Gonzalez-Pacanowska, D.; Havel, C.M.

    1987-05-01

    Full suppression of mammalian HMG-CoA reductase (HMGR) activity requires regulatory sterol and non-sterol products derived from mevalonate (MVA). The regulatory products identities are unknown. They have taken advantage of an established insect cell line (K/sub c/ cells) to identify the non-sterol isoprenoid regulatory signal (NSRS) molecule(s). Since K/sub c/ cells shunt minimally 40% of their MVA carbon, to non isoprenoid products, it is possible that the NSRS molecule(s) are also generated by this pathway. They report on investigations to elucidate the MVA shunt pathway. Intact K/sub c/ cells accumulate farnesol and geranylgeraniol with increasing exogenous MVA concentration. Supplemented K/sub c/ cells extracts rapidly convert (/sup 14/C) farnesol to ..cap alpha..,omega-dibasic prenoic acids (DCA) plus further degradation products. Two of the DCA products are 3,7-dimethyl 2,6-decadien 1,10-dioic acid and 3,7,11-trimethyl 2,6,10-dodecatrien 1,12-dioic acid. Similar acids are isolated from identical incubations with rat liver homogenates. Their results support MVA carbon being converted to non-isoprenoid products via polyprenols which in turn, are oxidatively catabolized, as DCAs, from the w-terminus. This metabolic capacity, exists in both mammalian and invertebrate cells and offers an alternative to shunt pathways proposed by other investigators.

  2. Di-nitrogen fixation in a eutrophic tropical bay

    NASA Astrophysics Data System (ADS)

    Mee, Laurence D.; Cortes-Altamirano, Roberto; Garcia-de-la-Parra, Luz-Maria

    1984-10-01

    Di-nitrogen fixation, measured in situ by the acetylene reduction technique, was shown to be associated with regular summer blooms of Oscillatoria erythraea in Mazatlán bay, a eutrophic tropical embayment on the Pacific Coast of Mexico. The Oscillatoria population density and the rate of di-nitrogen fixation per cell were of similar magnitude to those observed by other workers in the oligotrophic Caribbean Sea. Since the non-nitrogen limited fraction ( Oscillatoria) of the total population was generally less than 10% and the nutrient supply to the bay is relatively abundant, di-nitrogen fixation does not appear to play an important role in the eutrophication of the bay.

  3. Multifunctional Superhydrophobic Polymer/Carbon Nanocomposites: Graphene, Carbon Nanotubes, or Carbon Black?

    E-print Network

    Daraio, Chiara

    and macro scales4 and textiles5 to name a few. Superhydrophobicity provides a pathway toward protect- ingMultifunctional Superhydrophobic Polymer/Carbon Nanocomposites: Graphene, Carbon Nanotubes, Switzerland *S Supporting Information ABSTRACT: Superhydrophobic surfaces resisting water penetration

  4. Iron deficiency increases growth and nitrogen-fixation rates of phosphorus-deficient marine cyanobacteria.

    PubMed

    Garcia, Nathan S; Fu, Feixue; Sedwick, Peter N; Hutchins, David A

    2015-01-01

    Marine dinitrogen (N2)-fixing cyanobacteria have large impacts on global biogeochemistry as they fix carbon dioxide (CO2) and fertilize oligotrophic ocean waters with new nitrogen. Iron (Fe) and phosphorus (P) are the two most important limiting nutrients for marine biological N2 fixation, and their availabilities vary between major ocean basins and regions. A long-standing question concerns the ability of two globally dominant N2-fixing cyanobacteria, unicellular Crocosphaera and filamentous Trichodesmium, to maintain relatively high N2-fixation rates in these regimes where both Fe and P are typically scarce. We show that under P-deficient conditions, cultures of these two cyanobacteria are able to grow and fix N2 faster when Fe deficient than when Fe replete. In addition, growth affinities relative to P increase while minimum concentrations of P that support growth decrease at low Fe concentrations. In Crocosphaera, this effect is accompanied by a reduction in cell sizes and elemental quotas. Relatively high growth rates of these two biogeochemically critical cyanobacteria in low-P, low-Fe environments such as those that characterize much of the oligotrophic ocean challenge the common assumption that low Fe levels can have only negative effects on marine primary producers. The closely interdependent influence of Fe and P on N2-fixing cyanobacteria suggests that even subtle shifts in their supply ratio in the past, present and future oceans could have large consequences for global carbon and nitrogen cycles. PMID:24972068

  5. Mechanical testing of a device for subcutaneous internal anterior pelvic ring fixation versus external pelvic ring fixation

    PubMed Central

    2014-01-01

    Background Although useful in the emergency treatment of pelvic ring injuries, external fixation is associated with pin tract infections, the patient’s limited mobility and a restricted surgical accessibility to the lower abdomen. In this study, the mechanical stability of a subcutaneous internal anterior fixation (SIAF) system is investigated. Methods A standard external fixation and a SIAF system were tested on pairs of Polyoxymethylene testing cylinders using a universal testing machine. Each specimen was subjected to a total of 2000 consecutive cyclic loadings at 1 Hz with sinusoidal lateral compression/distraction (+/?50 N) and torque (+/? 0.5 Nm) loading alternating every 200 cycles. Translational and rotational stiffness were determined at 100, 300, 500, 700 and 900 cycles. Results There was no significant difference in translational stiffness between the SIAF and the standard external fixation when compared at 500 (p?=?.089), 700 (p?=?.081), and 900 (p?=?.266) cycles. Rotational stiffness observed for the SIAF was about 50 percent higher than the standard external fixation at 300 (p?=?.005), 500 (p?=?.020), and 900 (p?=?.005) cycles. No loosening or failure of the rod-pin/rod-screw interfaces was seen. Conclusions In comparison with the standard external fixation system, the tested device for subcutaneous internal anterior fixation (SIAF) in vitro has similar translational and superior rotational stiffness. PMID:24684828

  6. External fixation in comminuted, displaced intra-articular fractures of the distal radius: is it sufficient?

    Microsoft Academic Search

    J. Arora; A. C. Malik

    2005-01-01

    Introduction: External fixation has been extensively used to treat the intra-articular fractures of the distal radius and it has several distinct advantages over conventional POP cast and plate fixation. However, the limitation of external fixation to achieve articular congruity in the comminuted intra-articular fractures of the distal radius has been documented in the literature. This could be because external fixation

  7. Nitrogen fixation in freshwater, estuarine, and marine ecosystems. 1. Rates and importance

    Microsoft Academic Search

    ROBERT W. HOWARTH; ROXANNE MARINO; JONATHAN J. COLE

    1988-01-01

    Nitrogen fixation is mediated by a variety of autotrophic and heterotrophic bacteria. Cyano- bacteria appear responsible for most planktonic fixation in aquatic ecosystems, and rates of fixation are high only when thcsc organisms make up a major percentage of the planktonic biomass, Planktonic nitrogen fixation tends to be low in oligotrophic and mesotrophic lakes (generally

  8. The initial experience with closed interlocking intramedullary fixation.

    PubMed

    Grmela, M; Mihula, A; Fiala, O; D?dek, T; Záhorák, K

    1991-01-01

    Authors present the initial experience with the closed locked intramedullary fixation of long bones (mainly the tibial bone) in conditions of the Teaching Hospital. Possible improvisation is reported on when lacking the foreign osteosynthetical material. PMID:1815322

  9. 21 CFR 872.4880 - Intraosseous fixation screw or wire.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...4880 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Surgical Devices § 872.4880 Intraosseous fixation screw or wire. (a)...

  10. 21 CFR 872.4880 - Intraosseous fixation screw or wire.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...4880 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Surgical Devices § 872.4880 Intraosseous fixation screw or wire. (a)...

  11. Fixation of magnet assembly to denture base using alternative resins.

    PubMed

    Okayama, Shotaro; Suzuki, Yasunori; Shimpo, Hidemasa; Ohkubo, Chikahiro

    2015-06-01

    The fixation strengths between conventional/modified magnetic assemblies and denture base resins were evaluated using six alternative resins. Magnetic assemblies with three different undercut wings were prepared. Soft lining materials with added PMMA resin polymer, two photopolymerization denture relining resins, an experimental resin, and a temporary filling resin were used to fix the magnetic assemblies to the denture bases. As a control, a commercially available magnetic assembly without undercut wings and a conventional autopolymerized resin were also prepared. After surface treatments, the magnetic assemblies were fixed using fixation resins, and tensile strengths and attractive forces were measured using an autography. The experimental resin and the temporary filling resin showed retentive forces comparable to those of conventional autopolymerized resins. Although the experimental resin demonstrated satisfactory fixation strengths, it should be necessary to improve its mechanical strength. The temporary filling resin could be used as a permanent fixation material. PMID:25904166

  12. Technical tips: dualplate fixation technique for comminuted proximal humerus fractures.

    PubMed

    Choi, Sungwook; Kang, Hyunseong; Bang, Hyeongsig

    2014-08-01

    The authors report dualplate fixation technique for providing stable fixation in comminuted proximal humerus fractures. This technique has been used for proximal humerus fractures with metaphyseal comminution and provides excellent anatomical reduction and neck shaft angle (NSA). The recently locking plate is clinically more widely used due to its small size, low rigidity, high elasticity, and biomechanical properties such as fixed initial angle and rotational stability. However, in severely comminuted complex type proximal metaphyseal humerus fractures, the use of locking plate alone does not provide stable fixation, leading to complications such as varus collapse, anterior-posterior angulation, screw cutout, nonunion, malunion, and metal failure. Therefore, a more robust and enhanced fixation method, the dual plating technique using the locking compression plate (Proximal Humeral Internal Locking System and Variable Angle Locking Compression Plate) was developed. PMID:24813097

  13. The nitrogen fixation genes of Klebsiella pneumoniae: a model system.

    PubMed

    Drummond, M H

    1984-05-01

    The genetics of nitrogen fixation and its regulation has been intensively studied in Klebsiella pneumoniae. The resulting model, whilst not complete, is proving very useful in understanding this process in other organisms. PMID:6444092

  14. Our own method of fixation of biodegradable tracheal stent.

    PubMed

    Hytych, V; Horazdovsky, P; Stehlik, L; Pracharova, S; Pohnan, R; Lefnerova, S; Vasakova, M

    2015-01-01

    The authors present their own unique original method of fixation polydioxan biodegradable stents in the treatment of tracheal stenosis documented by pictures and video (Fig. 3, Ref. 12). PMID:25924646

  15. Biocompatibility of fixation materials in the brain.

    PubMed

    Mofid, M M; Thompson, R C; Pardo, C A; Manson, P N; Vander Kolk, C A

    1997-07-01

    Recent clinical reports documenting passive intracranial translocation of microplates and microscrews have prompted concerns regarding brain biocompatibility and neurotoxicity of fixation hardware used in craniofacial surgery. Although the effects of commercially pure titanium. Vitallium (cobalt-chromium-molybdenum), stainless steel, and various alloys have been well assessed in bone and soft tissues, there are no comprehensive studies of these materials in the brain. To investigate this, the biocompatibility of titanium, vitallium, and 316L stainless steel was evaluated in the rabbit brain and compared with silicone elastomer shunt tubing, a material that is used commonly as a neurosurgical implant material with well-established brain biocompatibility. Forty-eight juvenile New Zealand White rabbits were randomly assigned to one of three groups and underwent placement of either commercially pure titanium microscrews, vitallium microscrews, or 316L monofilament stainless steel wire into the parietal region. Silicone elastomer strips of similar size were implanted in the contralateral hemisphere of each rabbit. Animals were assessed daily for signs of neurotoxicity. Rabbits in each group were sacrificed at 2, 4, 8, and 26 weeks following implantation. Brains were sectioned at the implantation site and were examined by means of standard hematoxylin and eosin stains and with immunohistochemical markers sensitive to inflammatory changes in the brain. None of the animals showed any behavioral changes or neurologic deficits suggestive of either systemic or localized toxicity from the implant materials. Silicone clastomer was found to cause the least amount of inflammation relative to other materials tested at all sacrifice points, suggesting that as a standard neurosurgical implant material, it is an appropriate control for studies of brain biocompatibility. At 2 weeks, titanium was found to cause the largest inflammatory response in surrounding brain parenchyma based on analysis of markers for microglial proliferation, gliosis, and leukocyte infiltration. At the 26-week endpoint of our study, the biocompatibility of titanium was nearly equal to the biocompatibility of vitallium based on all studied markers of inflammation. A progressive increase in the inflammatory response surrounding stainless steel implants was noted at 8 and 26 weeks. Relative to all materials studied, at 26 weeks the greatest leukocyte response was found with stainless steel implants. Our results indicate that at the 26-week end-point of our study, titanium and vitallium incited a similar inflammatory response in the rabbit brain that was greater than the response found with silicone elastomer, a standard neurosurgical implant material, but less than that found with stainless steel wire, which is commonly recommended as an alternative fixation material. PMID:9207654

  16. Iliococcygeus or sacrospinous fixation for vaginal vault prolapse

    Microsoft Academic Search

    Christopher F Maher; Christine J Murray; Marcus P Carey; Peter L Dwyer; Antony M Ugoni

    2001-01-01

    Objective:To compare iliococcygeus (prespinous) and sacrospinous fixation for vaginal vault prolapse.Methods:Between 1994 and 1998, 78 women underwent sacrospinous colpopexy and 50 underwent iliococcygeus fixation for the management of symptomatic vaginal vault prolapse. A matched case-control study was designed to compare the two approaches. The matched variables included age, parity, body mass index, degree of vault prolapse, menopause, sexual activity, constipation,

  17. Arthroscopic-Assisted Fixation of Ideberg Type III Glenoid Fractures.

    PubMed

    Tao, Matthew A; Garrigues, Grant E

    2015-04-01

    Operative treatment of scapular fractures with extension into the glenoid can be a challenging clinical scenario. Though traditionally addressed in an open fashion, the morbidity of this approach, complemented by advancements in arthroscopic technique and instrumentation, has led to increasing use of arthroscopic-assisted fixation. We describe our technique, including pearls and pitfalls, for minimally invasive fixation of Ideberg type III glenoid fractures. This approach minimizes morbidity, allows optimal visualization and reduction, and provides good functional results. PMID:26052487

  18. Understanding the variability in soybean nitrogen fixation across agroecosystems

    Microsoft Academic Search

    M. E. Schipanski; L. E. Drinkwater; M. P. Russelle

    2010-01-01

    Legume-based cropping systems have the potential to internally regulate N cycling due to the suppressive effect of soil N\\u000a availability on biological nitrogen fixation. We used a gradient of endogenous soil N levels resulting from different management\\u000a legacies and soil textures to investigate the effects of soil organic matter dynamics and N availability on soybean (Glycine max) N2 fixation. Soybean

  19. An analysis of a biodegradable intramedullary fracture fixation system 

    E-print Network

    Smith, William Keith

    1991-01-01

    . The primary structural protein is collagen which forms fibrils which lend tensile strength to bone. The inorganic matrix is composed of mineral crystals of which calcium phosphate, in the form hydroxyapatite (Caip(PO4)6(OH), ), is the most prevalent.... Harry A. Hogan Biomechanical characterization of orthopedic fracture fixation devices is a difficult and challenging problem. A major method of internal fixation for repairing transverse fractures of long bones such as the femur is installing...

  20. Impact of Sulfur on N 2 Fixation of Legumes

    Microsoft Academic Search

    Heinrich W. Scherer

    The fact that crop deficiencies of sulfur (S) have been reported with increasing frequency over the past years has focused\\u000a on the importance of this element in plant nutrition. With legumes, limitation of S can reduce N2 fixation by affecting nodule development and function. The present report deals with the influence of S on yield formation\\u000a and N2 fixation of

  1. Mechanical properties of two canine iliac fracture fixation systems

    E-print Network

    VanGundy, Thomas Eugene

    1988-01-01

    to plate fixation for o lique canine iliac fracture fixation. The savings on implant fees and ease of lag screw application also may be a consideration for the veterinary surgeon. REFERENCES 1. Brinker WO, Piermattei DL, Flo GL. Handbook of Small..., for providng the funding that made this project possible. vi1 TABLE OF CONTENTS Page INTRODUCTION MATERIALS AND METHODS RESULTS Specimen Dimensions Static Testing Dynamic Testing DISCUSSION Pretesting Considerations Testing Considerations...

  2. Arthroscopic-Assisted Fixation of Ideberg Type III Glenoid Fractures

    PubMed Central

    Tao, Matthew A.; Garrigues, Grant E.

    2015-01-01

    Operative treatment of scapular fractures with extension into the glenoid can be a challenging clinical scenario. Though traditionally addressed in an open fashion, the morbidity of this approach, complemented by advancements in arthroscopic technique and instrumentation, has led to increasing use of arthroscopic-assisted fixation. We describe our technique, including pearls and pitfalls, for minimally invasive fixation of Ideberg type III glenoid fractures. This approach minimizes morbidity, allows optimal visualization and reduction, and provides good functional results. PMID:26052487

  3. Eye-Fixation-Related Potentials: Insight into Parafoveal Processing

    Microsoft Academic Search

    Thierry Baccino; Yves Manunta

    2005-01-01

    This paper presents a new methodology for studying cognition, which combines eye movements (EM) and event-related potentials (ERP) to track the cognitive processes that occur during a single eye fixation. This technique, called eye-fixation-related potentials (EFRP), has the advantage of coupling accurate time measures from ERPs and the location of the eye on the stimulus, so it can be used

  4. Nitrogen fixation in mixed Hylocomium splendens moss communities

    Microsoft Academic Search

    O. Zackrisson; T. H. DeLuca; F. Gentili; A. Sellstedt; A. Jäderlund

    2009-01-01

    The pleurocarpus feather moss, Hylocomium splendens, is one of two co-dominant moss species in boreal forest ecosystems and one of the most common mosses on earth, yet little\\u000a is known regarding its capacity to host cyanobacterial associates and thus contribute total ecosystem N. In these studies,\\u000a we evaluated the N-fixation potential of the H. splendens–cyanobacteria association and contrasted the N-fixation

  5. Fractures of the Proximal Fifth Metatarsal: Percutaneous Bicortical Fixation

    PubMed Central

    Mahajan, Vivek; Chung, Hyun Wook

    2011-01-01

    Background Displaced intraarticular zone I and displaced zone II fractures of the proximal fifth metatarsal bone are frequently complicated by delayed nonunion due to a vascular watershed. Many complications have been reported with the commonly used intramedullary screw fixation for these fractures. The optimal surgical procedure for these fractures has not been determined. All these observations led us to evaluate the effectiveness of percutaneous bicortical screw fixation for treating these fractures. Methods Twenty-three fractures were operatively treated by bicortical screw fixation. All the fractures were evaluated both clinically and radiologically for the healing. All the patients were followed at 2 or 3 week intervals till fracture union. The patients were followed for an average of 22.5 months. Results Twenty-three fractures healed uneventfully following bicortical fixation, with a mean healing time of 6.3 weeks (range, 4 to 10 weeks). The average American Orthopaedic Foot & Ankle Society (AOFAS) score was 94 (range, 90 to 99). All the patients reported no pain at rest or during athletic activity. We removed the implant in all cases at a mean of 23.2 weeks (range, 18 to 32 weeks). There was no refracture in any of our cases. Conclusions The current study shows the effectiveness of bicortical screw fixation for displaced intraarticular zone I fractures and displaced zone II fractures. We recommend it as one of the useful techniques for fixation of displaced zone I and II fractures. PMID:21629475

  6. Suture Bridge Fixation of a Femoral Condyle Traumatic Osteochondral Defect

    PubMed Central

    Bowers, Andrea L.

    2008-01-01

    Internal fixation of a traumatic osteochondral defect presents a challenge in terms of obtaining anatomic reduction, fixation, and adequate compression for healing. Fixation with countersunk intraarticular screws, Herbert screws, bioabsorbable screws and pins, mini-cancellous screws, and glue tissue adhesive have been reported with varying results. We present an alternative fixation method used in two patients for femoral condylar defects that achieved anatomic reduction with compression via a cruciate-shaped suture bridge construct tied down over a bony bridge. This fixation method allowed early passive range of motion and permitted high-quality MRI for followup of fracture healing and articular cartilage integrity. Arthroscopic examination of one of two patients at 6 months followup showed the gross appearance of a healed, anatomically reduced fracture. With 1 year followup for one patient and 2 years for the other, the patients have resumed activity as tolerated with full, painless range of motion at the knee. Longer-term outcomes are unknown. However, the suture bridge is an alternative means of fixation with encouraging early results for treatment of traumatic osteochondral fragments in the knee. Level of Evidence: Level IV, therapeutic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18584263

  7. Histomorphometric comparison after fixation with formaldehyde or glyoxal

    PubMed Central

    Wang, YN; Lee, K; Pai, S; Ledoux, WR

    2014-01-01

    Formaldehyde has long been the fixative of choice for histological examination of tissue. The use of alternatives to formaldehyde has grown, however, owing to the serious hazards associated with its use. Companies have striven to maintain the morphological characteristics of formaldehyde-fixed tissue when developing alternatives. Glyoxal-based fixatives now are among the most popular formaldehyde alternatives. Although there are many studies that compare staining quality and immunoreactivity, there have been no studies that quantify possible structural differences. Histomorphometric analysis commonly is used to evaluate diseased tissue. We compared fixation with formaldehyde and glyoxal with regard to the histomorphological properties of plantar foot tissue using a combination of stereological methods and quantitative morphology. We measured skin thickness, interdigitation index, elastic septa thickness, and adipocyte area and diameter. No significant differences were observed between formaldehyde and glyoxal fixation for any feature measured. The glyoxal-based fixative used therefore is a suitable fixative for structural evaluation of plantar soft tissue. Measurements obtained from the glyoxal-fixed tissue can be combined with data obtained from formalin-fixed for analysis. PMID:20854226

  8. COMPLEMENT FIXATION TEST IN EXPERIMENTAL CLINICAL AND SUBCLINICAL MELIOIDOSIS

    PubMed Central

    Nigg, Clara; Johnston, Margaret M.

    1961-01-01

    Nigg, Clara (University of California, Berkeley), and Margaret M. Johnston. Complement fixation test in experimental clinical and subclinical melioidosis. J. Bacteriol. 82:159–168. 1961.—Soluble stable antigens prepared from Pseudomonas pseudomallei gave 4+ complement fixation reactions in a dilution of 1 to 8,000 when tested with specific rabbit antiserum diluted 1 to 10,000. The complement fixation reaction was positive in 100% of experimentally infected rabbits 9 to 11 days postinfection. Infected guinea pigs and monkeys showed similar results. Monkeys inoculated with very small infecting doses of P. pseudomallei developed positive complement fixation reactions in the absence of clinical manifestation of infection. An anamnestic complement-fixing antibody response could be induced in such monkeys, after the titer had dropped to approximately the preinfection level, by inoculating very small doses of viable P. pseudomallei or larger doses of killed melioidosis vaccine. The complement fixation test described appeared to be both sensitive and specific, and should be of value in human melioidosis which cannot be diagnosed on the basis of clinical manifestations alone. It is suggested that subclinical infections may play a role in the epidemiology of human meliodosis. The potential application of the complement fixation test to serological surveys in areas where melioidosis occurs endemically is discussed. PMID:13729013

  9. Diel variation of nitrogen fixation in Lake Valencia, Venezuela

    SciTech Connect

    Levine, S.N.; Lewis, W.M. Jr.

    1984-07-01

    During 1981 the authors examined the diel variations of nitrogen fixation in Lake Valencia, Venezuela. Four species of heterocyst-bearing blue-green algae were common but subdominant in the phytoplankton. In samples taken from and incubated at 0.5 m, the rate of nitrogen fixation per unit volume of water was lowest at night, increased from dawn until early afternoon, and then diminished between late afternoon and the first hour of darkness. This pattern was caused partly by diel changes in light intensity and partly by diel migrations of heterocystous blue-green algae. The heterocyst-specific nitrogen fixation rates at 0.5 m were much less variable than the nitrogen fixation rates per unit volume of water. Heterocyst-specific rates rose rapidly in early morning and fell slowly in the evening, but were almost constant over much of the day. Heterocyst-specific nitrogen fixation rates were very close to those predicted by a model based on the light dependency of nitrogen fixation.

  10. Biodegradable interlocking nails for fracture fixation.

    PubMed

    van der Elst, M; Bramer, J A; Klein, C P; de Lange, E S; Patka, P; Haarman, H J

    1998-12-01

    Serious problems such as stress shielding, allergic reactions, and corrosion are associated with the use of metallic fracture fixation devices in fractured long bones. Metal implants often are removed during a second retrieval operation after fracture healing has completed. A biocompatible implant that degrades slowly during implantation would obviate the need for a second operation and save the patient from considerable physical, psychologic, and financial discomfort. The biodegradable implant must provide the fractured limb sufficient support for a certain time, allowing early loading. A gradual transfer of load from the biodegradable implant to the bone would result in a better product of bone healing and avoid stress shielding. In an animal model using adult sheep, two types of biodegradable polymer interlocking nails were tested in comparison with a stainless steel interlocking nail. Fracture healing, mechanical properties of the bones, degradation behavior in vivo and in vitro, and tissue response were monitored during a 2 1/2-year followup study. To detect shifts in acid base relations caused by the release of acid compounds, pH measurements were performed. Fracture healing was unimpaired, and the mechanical test results of all three groups were excellent. Histologic analysis showed a mild inflammatory response, but no pH shifts were observed. The results of this study justify additional research on these promising materials. PMID:9917717

  11. Unilateral Mydriasis After Mandibular Fracture Fixation Surgery

    PubMed Central

    Nesioonpour, Sholeh; Khiabani, Kazem; Hassanijirdehi, Marzieh

    2014-01-01

    Introduction: Unilateral mydriasis is a seriously significant finding in neurologic examinations indicating life-threatening conditions such as cerebral vascular injuries. Case Presentation: A 24 year old woman with mandibular trauma was referred to our center after five days for a reduction of the right mandibular angle fracture. The patient had no history of any loss of consciousness after the accident. Her physical examination showed no abnormalities, except those related to her mandibular fracture. The laboratory results were normal as well. At 8:30 am a general anesthesia was induced. The patient’s eyes were kept shut throughout the surgical procedure. The operation included an intraoral open reduction and fixation using two miniplates without any complications. After the operation, it was noticed that the left eye was completely dilated with no reaction to light, while the right eye was normal. The management and outcomes in this patient were described in the present case report. Conclusions: Evaluating the size of the patient’s pupils before, during and after the operation, careful history, consult, CT scan and MRI would help to diagnosis. Although no probable cause was found to explain the transient mydriasis in our patient. PMID:24829881

  12. Atlantoaxial rotatory fixation after ventriculoperitoneal shunting.

    PubMed

    Heary, R F; Reid, P; Carmel, P W

    2011-10-01

    Ventriculoperitoneal (VP) shunting is a common neurosurgical procedure in the pediatric population. Atlantoaxial rotatory fixation (AARF) is not uncommon in this same group. We present the first reported case of AARF following a VP shunt procedure. A 10-year-old boy, with hydrocephalus and a left temporal arachnoid cyst since birth, underwent a revision of his VP and cystoperitoneal shunts. A second operation was performed 2 days later to optimize catheter placement. Postoperative neck pain was attributed to tunneling of the subcutaneous catheter. 2 months after surgery, the child had minimal neck discomfort but maintained his head in a "cock-robin" position. Plain radiographs and computed tomographic (CT) images confirmed AARF. The child was admitted and placed in halo traction. After 3 days of traction, analgesics, sedation, and muscle relaxants, anatomic re-alignment of the C1-C2 vertebral complex was confirmed on CT scan. Following 3 months of immobilization in a halo-vest apparatus, the halo was removed. At 8-year follow-up, the clinical examination is normal and repeat imaging studies remain normal. Due to surgical positioning, and postoperative signs attributed to normal postoperative pain, an AARF was not initially recognized. This case represents the first time that AARF has been reported following a VP shunt procedure. PMID:21959746

  13. iTRAQ-based quantitative proteomics analysis of Brassica napus leaves reveals pathways associated with chlorophyll deficiency.

    PubMed

    Chu, Pu; Yan, Gui Xia; Yang, Qing; Zhai, Li Na; Zhang, Cheng; Zhang, Feng Qi; Guan, Rong Zhan

    2015-01-15

    Photosynthesis, the primary source of plant biomass, is important for plant growth and crop yield. Chlorophyll is highly abundant in plant leaves and plays essential roles in photosynthesis. We recently isolated a chlorophyll-deficient mutant (cde1) from ethyl methanesulfonate (EMS) mutagenized Brassica napus. Herein, quantitative proteomics analysis using the iTRAQ approach was conducted to investigate cde1-induced changes in the proteome. We identified 5069 proteins from B. napus leaves, of which 443 showed differential accumulations between the cde1 mutant and its corresponding wild-type. The differentially accumulated proteins were found to be involved in photosynthesis, porphyrin and chlorophyll metabolism, biosynthesis of secondary metabolites, carbon fixation, spliceosome, mRNA surveillance and RNA degradation. Our results suggest that decreased abundance of chlorophyll biosynthetic enzymes and photosynthetic proteins, impaired carbon fixation efficiency and disturbed redox homeostasis might account for the reduced chlorophyll contents, impaired photosynthetic capacity and increased lipid peroxidation in this mutant. Epigenetics was implicated in the regulation of gene expression in cde1, as proteins involved in DNA/RNA/histone methylation and methylation-dependent chromatin silencing were up-accumulated in the mutant. Biological significance Photosynthesis produces more than 90% of plant biomass and is an important factor influencing potential crop yield. The pigment chlorophyll plays essential roles in light harvesting and energy transfer during photosynthesis. Mutants deficient in chlorophyll synthesis have been used extensively to investigate the chlorophyll metabolism, development and photosynthesis. However, limited information is available with regard to the changes of protein profiles upon chlorophyll deficiency. Here, a combined physiological, histological, proteomics and molecular analysis revealed several important pathways associated with chlorophyll deficiency. This work provides new insights into the regulation of chlorophyll biosynthesis and photosynthesis in higher plants and these findings may be applied to genetic engineering for high photosynthetic efficiency in crops. PMID:25317966

  14. Glycolate Pathway in Green Algae 1

    PubMed Central

    Bruin, W. J.; Nelson, Edward B.; Tolbert, N. E.

    1970-01-01

    By three criteria, the glycolate pathway of metabolism is present in unicellular green algae. Exogenous glycolate-1-14C was assimilated and metabolized to glycine-1-14C and serine-1-14C. During photosynthetic 14CO2 fixation the distributions of 14C in glycolate and glycine were similar enough to suggest a product-precursor relationship. Five enzymes associated with the glycolate pathway were present in algae grown on air. These were P-glycolate phosphatase, glycolate dehydrogenase (glycolate:dichloroindophenol oxidoreductase), l-glutamate:glyoxylate aminotransferase, serine hydroxymethylase, and glycerate dehydrogenase. Properties of glycerate dehydrogenase and the aminotransferase were similar to those from leaf peroxisomes. The specific activity of glycolate dehydrogenase and serine hydroxymethylase in algae was 1/5 to 1/10 that of the other enzymes, and both these enzymes appear ratelimiting for the glycolate pathway. Labeling patterns for products of the glycolate pathway during 14CO2 fixation are not the same as those obtained with higher plants. In higher plants glycolate, glycine, and serine are uniformly labeled at shortest time periods. In algae, serine was predominately carboxyl-labeled, similarly to 3-phosphoglycerate. This result, plus the lower specific activity of serine hydroxymethylase, indicates that the glycine-serine interconversin in algae is slower than in plants. Initially (2 to 4 seconds) glycolate and glycine were more C-2 labeled. They rapidly became uniformly labeled, with glycine becoming uniformly labeled first. In the presence of isonicotinylhydrazide, labeled glycolate and glycine accumulated, and only a trace of serine-14C was detected. Then glycolate and glycine were initially carboxyl-labeled, and glycolate became uniformly labeled almost immediately and before glycine. These results suggest rapid metabolism of glycolate and glycine, in addition to the glycolate pathway. PMID:16657472

  15. Stable carbon isotopic evidence for carbon limitation in hydrothermal vent vestimentiferans.

    PubMed

    Fisher, C R; Kennicutt, M C; Brooks, J M

    1990-03-01

    Stable carbon isotope composition (delta(13)C values) can be used to evaluate an animal's source of nutritional carbon. Most animals with chemoautotrophic endosymbionts have quite negative tissue delta(13)C values due to discrimination against (13)C associated with chemoautotrophic assimilation of inorganic carbon. However, the delta(13)C values of hydrothermal vent (HTV) vestimentiferans are significantly higher than the values reported for non-HTV vestimentiferans or other invertebrates with chemoautotrophic endosymbionts. Tissue delta(13)C values of two species of HTV vestimentiferans increase with increasing size of the animals. This relation supports the hypothesis that the relatively high delta(13)C values are the result of inorganic carbon limitation during carbon fixation. A more favorable relation between gas exchange and carbon fixation in the smaller individuals is expected, due to differences in the geometric scaling of gas-exchange surfaces and trophosome volume. PMID:17800067

  16. Pathway Analysis

    Cancer.gov

    Projects such as The Cancer Genome Atlas have gathered enormous quantities of data from human tumor samples. Informaticians at the National Lab are looking within such data for insights about the influence of mutant RAS genes on signaling pathways in cancers. On a smaller scale, the RAS Initiative will use numerous experimental platforms to interrogate cell lines expressing mutant RAS genes.

  17. Co-occurrence of denitrification and nitrogen fixation in a meromictic lake, Lake Cadagno (Switzerland).

    PubMed

    Halm, Hannah; Musat, Niculina; Lam, Phyllis; Langlois, Rebecca; Musat, Florin; Peduzzi, Sandro; Lavik, Gaute; Schubert, Carsten J; Sinha, Bärbel; Singha, Bärbel; LaRoche, Julie; Kuypers, Marcel M M

    2009-08-01

    The nitrogen cycling of Lake Cadagno was investigated by using a combination of biogeochemical and molecular ecological techniques. In the upper oxic freshwater zone inorganic nitrogen concentrations were low (up to approximately 3.4 microM nitrate at the base of the oxic zone), while in the lower anoxic zone there were high concentrations of ammonium (up to 40 microM). Between these zones, a narrow zone was characterized by no measurable inorganic nitrogen, but high microbial biomass (up to 4 x 10(7) cells ml(-1)). Incubation experiments with (15)N-nitrite revealed nitrogen loss occurring in the chemocline through denitrification (approximately 3 nM N h(-1)). At the same depth, incubations experiments with (15)N(2)- and (13)C(DIC)-labelled bicarbonate, indicated substantial N(2) fixation (31.7-42.1 pM h(-1)) and inorganic carbon assimilation (40-85 nM h(-1)). Catalysed reporter deposition fluorescence in situ hybridization (CARD-FISH) and sequencing of 16S rRNA genes showed that the microbial community at the chemocline was dominated by the phototrophic green sulfur bacterium Chlorobium clathratiforme. Phylogenetic analyses of the nifH genes expressed as mRNA revealed a high diversity of N(2) fixers, with the highest expression levels right at the chemocline. The majority of N(2) fixers were related to Chlorobium tepidum/C. phaeobacteroides. By using Halogen In Situ Hybridization-Secondary Ion Mass Spectroscopy (HISH-SIMS), we could for the first time directly link Chlorobium to N(2) fixation in the environment. Moreover, our results show that N(2) fixation could partly compensate for the N loss and that both processes occur at the same locale at the same time as suggested for the ancient Ocean. PMID:19397681

  18. Asparagine: an amide of particular distinction in the regulation of symbiotic nitrogen fixation of legumes.

    PubMed

    Sulieman, Saad; Tran, Lam-Son Phan

    2013-09-01

    Symbiotic nitrogen fixation is tightly regulated by a range of fine processes at the nodule level, over which the host plant has overall control through the whole life of the plant. The operation of this control at the nodule level is not yet fully understood, but greater knowledge will ultimately lead to a better improvement of N2 fixation through the use of crop legumes and genetic engineering of crop plants for higher performance. It has been suggested that, nodule responses to the nutritional complexity of the rhizosphere environment involve a great deal of coordination of sensing and signal transduction. This regulation can be achieved through several mechanisms, including changes in carbon metabolism, oxygen supply and/or overproduction of reactive oxygen and nitrogen species. Recently, the cycling of amino acids observed between the plant and bacteroid fractions suggests a new and important regulatory mechanism involved in nodule responses. Most of the recent transcriptional findings are consistent with the earlier biochemical and physiological reports. Current research revealed unique advances for nodule metabolism, especially on the regulation of asparagine synthetase gene expression and the control of asparagine (ASN) to N2 fixing activity. A large amount of ASN is found accumulating in the root nodules of the symbiotic plants under restricted environments, such as drought, salinity and nutrient deficiency. Exceptionally, ASN phloem feeding has resulted in an increased concentration of the ASN amide in nodules followed by a remarkable decrease in nodule activity. In this review, recent progress concerning the possible role of ASN in whole-plant-based down-regulation of symbiotic N2 fixation will be reviewed. PMID:22793647

  19. De-inking sludge and phosphorus effects on growth and symbiotic dinitrogen fixation in forage legumes.

    PubMed

    Allahdadi, Iraj; Beauchamp, Chantal J; Califour, François P; Khalaj, Hamideh; Labafi, M R

    2007-07-15

    The de-inking process produces a waste by-product, called de-inking paper sludge (DS), that contains paper fibers, clay particles and inks and high carbon (C) concentrations combined with low nitrogen (N) and phosphorus (P) concentrations. The use of high rates of DS to increase the soil organic matter thus requires provision of high rates of N and P for adequate plant growth. Using dinitrogen (N2)-fixing forage legumes is an alternative to N fertilization under such circumstances. In a greenhouse study, DS rates of 0, 50 or 100 Mg ha(-1) and five rates of P (40, 80, 120, 160, or 200 kg P2O5 ha(-1)) were applied on two soil types, a clay loam (Pintendre) and a silty clay loam (St-Augustin). Nitrogen uptake and symbiotic N2 fixation (SNF) were estimated in alfalfa (Medicago sativa L.), sweetclover (Melilotus officinalis L.) and red clover (Trifolium pratense L.); Bromegrass (Bromus inermis L.) and alfalfa ineffective for N2 fixation were used as the reference (non-N2 fixing) crops. Atmospheric N2 fixation was estimated by natural abundance of 15N (815N). Under controlled conditions, high rates of DS substantially reduced delta15N values, particularly with high rates of P. In addition, N uptake of legumes generally increased with increased P concentrations and it peaked with 120 or 160 kg P2O5 ha(-1). Correlated with the trends observed with delta15N values and it peaked with 120 or 160 kg P2O5 ha(-1). Present results showed that under high rates of application of DS and adequate P supply, forage legumes fixed more atmospheric N2. delta15N can be a good indicator of SNF under the above-mentioned conditions. PMID:19070161

  20. Scleral- fixated intraocular lens implantation in microspherophakia

    PubMed Central

    Subbiah, Sujata; Thomas, Philip A; Jesudasan, CA Nelson

    2014-01-01

    Background: In microspherophakia, abnormal laxity of the lenticular zonules leads to development of a spherical lens and possible subluxation. We evaluated long-term results of lens removal with scleral-fixated intraocular lens (SFIOL) implantation in microspherophakia. Materials and Methods: Case series. SF IOLs were implanted in four consecutive patients with bilateral microspherophakia (eight eyes [three with pupillary block and secondary glaucoma who underwent immediate surgery and five with only subluxation who underwent elective surgery]). Post-operative best-corrected visual acuity (BCVA), intraocular pressure (IOP) and lens position were evaluated periodically from day 1 to 18 months. Results: All patients were females (mean age 28 ± 7.03 years). In group 1 eyes (three eyes that presented with pupillary block), the mean BCVA improved from 0.008 decimals (preoperative) to 0.50 decimals (final post-operative visit); in group 2 eyes (the other five eyes), the mean BCVA improved from 0.12 ± 0.21 decimals to 0.73 ± 0.14 decimals. The preoperative mean IOP (54.53 ± 7.33 mmHg) in group 1 eyes was significantly (P = 0.03) higher than that (16 ± 4.30 mm Hg) in group 2 eyes. At final post-operative visit, the mean IOP (11.67 ± 2.88 mmHg) in group 1 eyes was not significantly different from that in group 2 eyes (13.0 ± 3.08 mmHg). All SFIOLs were well- centred at the final visit. None of the patients encountered any peroperative or postoperative complications. Conclusions: SFIOLs may be an option for surgical management of microspherophakia. PMID:24881608

  1. Rerouting Carbon Flux To Enhance Photosynthetic Productivity

    PubMed Central

    Ducat, Daniel C.; Avelar-Rivas, J. Abraham; Way, Jeffrey C.

    2012-01-01

    The bioindustrial production of fuels, chemicals, and therapeutics typically relies upon carbohydrate inputs derived from agricultural plants, resulting in the entanglement of food and chemical commodity markets. We demonstrate the efficient production of sucrose from a cyanobacterial species, Synechococcus elongatus, heterologously expressing a symporter of protons and sucrose (cscB). cscB-expressing cyanobacteria export sucrose irreversibly to concentrations of >10 mM without culture toxicity. Moreover, sucrose-exporting cyanobacteria exhibit increased biomass production rates relative to wild-type strains, accompanied by enhanced photosystem II activity, carbon fixation, and chlorophyll content. The genetic modification of sucrose biosynthesis pathways to minimize competing glucose- or sucrose-consuming reactions can further improve sucrose production, allowing the export of sucrose at rates of up to 36.1 mg liter?1 h illumination?1. This rate of production exceeds that of previous reports of targeted, photobiological production from microbes. Engineered S. elongatus produces sucrose in sufficient quantities (up to ?80% of total biomass) such that it may be a viable alternative to sugar synthesis from terrestrial plants, including sugarcane. PMID:22307292

  2. Whole-lake experiments reveal the fate of terrestrial particulate organic carbon in benthic food webs of shallow lakes.

    PubMed

    Scharnweber, K; Syväranta, J; Hilt, S; Brauns, M; Vanni, M J; Brothers, S; Köhler, J; Knezevi?-Jari?, J; Mehner, T

    2014-06-01

    Lake ecosystems are strongly linked to their terrestrial surroundings by material and energy fluxes across ecosystem boundaries. However, the contribution of terrestrial particulate organic carbon (tPOC) from annual leaf fall to lake food webs has not yet been adequately traced and quantified. In this study, we conducted whole-lake experiments to trace artificially added tPOC through the food webs of two shallow lakes of similar eutrophic status, but featuring alternative stable regimes (macrophyte rich vs. phytoplankton dominated). Lakes were divided with a curtain, and maize (Zea mays) leaves were added, as an isotopically distinct tPOC source, into one half of each lake. To estimate the balance between autochthonous carbon fixation and allochthonous carbon input, primary production and tPOC and tDOC (terrestrial dissolved organic carbon) influx were calculated for the treatment sides. We measured the stable isotope ratios of carbon (delta13C) of about 800 samples from all trophic consumer levels and compared them between lake sides, lakes, and three seasons. Leaf litter bag experiments showed that added maize leaves were processed at rates similar to those observed for leaves from shoreline plants, supporting the suitability of maize leaves as a tracer. The lake-wide carbon influx estimates confirmed that autochthonous carbon fixation by primary production was the dominant carbon source for consumers in the lakes. Nevertheless, carbon isotope values of benthic macroinvertebrates were significantly higher with maize additions compared to the reference side of each lake. Carbon isotope values of omnivorous and piscivorous fish were significantly affected by maize additions only in the macrophyte-dominated lake and delta13C of zooplankton and planktivorous fish remained unaffected in both lakes. In summary, our results experimentally demonstrate that tPOC in form of autumnal litterfall is rapidly processed during the subsequent months in the food web of shallow lakes and is channeled to secondary and tertiary consumers predominantly via the benthic pathways. A more intense processing of tPOC seems to be connected to a higher structural complexity in littoral zones, and hence may differ between shallow lakes of alternative stable states. PMID:25039215

  3. Oligomerization pathways of dichlorodifluoromethane hydrodechlorination catalyzed by activated carbon supported Pt-Cu, Pt-Ag, PtFe, and Pt-Co

    Microsoft Academic Search

    Parag P. Kulkarni; Vladimir I. Kovalchuk; Julie L. d’Itri

    2002-01-01

    Activated carbon-supported Pt-Cu, Pt-Ag, Pt-Co, Pt-Fe, and Pt catalyze the formation of oligomerization products from CF2Cl2 and H2 mixture (1:1 ratio) at 523K. All catalysts deactivate with time on stream. The Pt-Co\\/C catalyst exhibits the highest selectivity toward C2–C3 hydrocarbons (?50%), whereas Pt-Cu\\/C is the most selective toward tetrafluoroethylene (?20%). The other catalysts (Pt, Pt-Ag, Pt-Fe) exhibit negligible oligomerization activity,

  4. Expanding Forces in Aqueous Outflow Pathways of a Nonaccommodating Mammal: An Approach via Comparative Dynamic Morphology

    Microsoft Academic Search

    F. Javier Carreras; David Porcel; Fernando González-Caballero

    1997-01-01

    Six dog eyes were fixed by intracameral perfusion of fixative at pressures of 0, 5, 10, 15, 20, and 25 cm of water. Eight dog eyes were fixed after the injection in both ocular chambers of a number of cholinergic agents, either singly or in combination. Under the effect of miotics and under increased ocular pressure, the aqueous pathways expand.

  5. Coexistence of fixation-off sensitivity and inverted fixation-off sensitivity in a female child with Panayiotopoulos syndrome: Video-electroencephalography documentation?

    PubMed Central

    Saadeldin, Imad Y.; Matlik, Hussein N.

    2015-01-01

    Fixation-off sensitivity (FOS) is a rare phenomenon elicited by elimination of central vision and fixation, which even in the presence of light induces occipital paroxysms or generalized paroxysmal discharges. It is most commonly encountered in patients with idiopathic childhood occipital epilepsies but may also be observed in cases of symptomatic focal and generalized epilepsies. We describe a female Emirati child with Panayiotopoulos syndrome who exhibited FOS in addition to the reverse phenomenon called “inverted fixation-off sensitivity,” in which the electroencephalographic discharges were suppressed by the absence of central vision or fixation and activated by central vision or fixation. PMID:26101745

  6. Role of nitrogen fixation in the autecology of Polaromonas naphthalenivorans in contaminated sediments.

    PubMed

    Hanson, Buck T; Yagi, Jane M; Jeon, Che Ok; Madsen, Eugene M

    2012-06-01

    Polaromonas naphthalenivorans strain CJ2 is a Gram-negative betaproteobacterium that was identified, using stable isotope probing in 2003, as a dominant in situ degrader of naphthalene in coal tar-contaminated sediments. The sequenced genome of strain CJ2 revealed several genes conferring nitrogen fixation within a 65.6?kb region of strain CJ2's chromosome that is absent in the genome of its closest sequenced relative Polaromonas sp. strain JS666. Laboratory growth and nitrogenase assays verified that these genes are functional, providing an alternative source of nitrogen in N-free media when using naphthalene or pyruvate as carbon sources. Knowing this, we investigated if nitrogen-fixation activity could be detected in microcosms containing sediments from the field site where strain CJ2 was isolated. Inducing nitrogen limitation with the addition of glucose or naphthalene stimulated nitrogenase activity in amended sediments, as detected using the acetylene reduction assay. With the use of fluorescence microscopy, we screened the microcosm sediments for the presence of active strain CJ2 cells using a dual-labelling approach. When we examined the carbon-amended microcosm sediments stained with both a strain CJ2-specific fluorescent in situ hybridization probe and a polyclonal fluorescently tagged antibody, we were able to detect dual-labelled active cells. In contrast, in sediments that received no carbon addition (showing no nitrogenase activity), no dual-labelled cells were detected. Furthermore, the naphthalene amendment enhanced the proportion of active strain CJ2 cells in the sediment relative to a glucose amendment. Field experiments performed in sediments where strain CJ2 was isolated showed nitrogenase activity in response to dosing with naphthalene. Dual-label fluorescence staining of these sediments showed a fivefold increase in active strain CJ2 in the sediments dosed with naphthalene over those dosed with deionized water. These experiments show that nitrogen fixation may play an important role in naphthalene biodegradation by strain CJ2 and contribute to its ecological success. PMID:22497673

  7. Nitrogen fixation in mixed Hylocomium splendens moss communities.

    PubMed

    Zackrisson, O; DeLuca, T H; Gentili, F; Sellstedt, A; Jäderlund, A

    2009-05-01

    The pleurocarpus feather moss, Hylocomium splendens, is one of two co-dominant moss species in boreal forest ecosystems and one of the most common mosses on earth, yet little is known regarding its capacity to host cyanobacterial associates and thus contribute total ecosystem N. In these studies, we evaluated the N-fixation potential of the H. splendens-cyanobacteria association and contrasted the N-fixation activity with that of the putative N-fixing moss-cyanobacteria association of Pleurozium schreberi. Studies were conducted to: quantify N-fixation in H. splendens and P. schreberi in sites ranging from southern to northern Fennoscandia; assess N and P availability as drivers of N-fixation rates; contrast season-long N-fixation rates for both mosses; and characterize the cyanobacteria that colonize shoots of H. splendens. Nitrogen-fixation rates were generally low at southern latitudes and higher at northern latitudes (64-69 degrees N) potentially related to anthropogenic N deposition across this gradient. Nitrogen fixation in H. splendens appeared to be less sensitive to N deposition than P. schreberi. The season-long assessment of N-fixation rates at a mixed feather moss site in northern Sweden showed that H. splendens fixed a substantial quantity of N, but about 50% less total N compared to the contribution from P. schreberi. In total, both species provided 1.6 kg fixed N ha(-1) year(-1). Interestingly, H. splendens demonstrated somewhat higher N-fixation rates at high fertility sites compared to P. schreberi. Nostoc spp. and Stigonema spp. were the primary cyanobacteria found to colonize H. splendens and P. schreberi. These results suggest that H. splendens with associated Nostoc or Stigonema communities contributes a significant quantity of N to boreal forest ecosystems, but the contribution is subordinate to that of P. schreberi at northern latitudes. Epiphytic cyanobacteria are likely a key factor determining the co-dominant presence of these two feather mosses across the boreal biome. PMID:19252932

  8. The metabolic significance of octulose phosphates in the photosynthetic carbon reduction cycle in spinach

    PubMed Central

    MacLeod, John K.

    2006-01-01

    14C-Labelled octulose phosphates were formed during photosynthetic 14CO2 fixation and were measured in spinach leaves and chloroplasts. Because mono- and bisphosphates of d-glycero-d-ido-octulose are the active 8-carbon ketosugar intermediates of the L-type pentose pathway, it was proposed that they may also be reactants in a modified Calvin–Benson–Bassham pathway reaction scheme. This investigation therefore initially focussed only on the ido-epimer of the octulose phosphates even though 14C-labelled d-glycero-d-altro-octulose mono- and bisphosphates were also identified in chloroplasts and leaves. 14CO2 predominantly labelled positions 5 and 6 of d-glycero-d-ido-octulose 1,8-P2 consistent with labelling predictions of the modified scheme. The kinetics of 14CO2 incorporation into ido-octulose was similar to its incorporation into some traditional intermediates of the path of carbon, while subsequent exposure to 12CO2 rapidly displaced the 14C isotope label from octulose with the same kinetics of label loss as some of the confirmed Calvin pathway intermediates. This is consistent with octulose phosphates having the role of cyclic intermediates rather than synthesized storage products. (Storage products don’t rapidly exchange isotopically labelled carbons with unlabelled CO2.) A spinach chloroplast extract, designated stromal enzyme preparation (SEP), catalysed and was used to measure rates of CO2 assimilation with Calvin cycle intermediates and octulose and arabinose phosphates. Only pentose (but not arabinose) phosphates and sedoheptulose 7-phosphate supported CO2 fixation at rates in excess of 120 ?mol h?1 mg?1 Chl. Rates for octulose, sedoheptulose and fructose bisphosphates, octulose, hexose and triose monophosphates were all notably less than the above rate and arabinose 5-phosphate was inactive. Altro-octulose phosphates were more active than phosphate esters of the ido-epimer. The modified scheme proposed a specific phosphotransferase and SEP unequivocally catalysed reversible phosphate transfer between sedoheptulose bisphosphate and d-glycero-d-ido-octulose 8-phosphate. It was also initially hypothesized that arabinose 5-phosphate, an L-Type pentose pathway reactant, may have a role in a modified Calvin pathway. Arabinose 5-phosphate is present in spinach chloroplasts and leaves. Radiochromatography showed that 14C-arabinose 5-phosphate with SEP, but only in the presence of an excess of unlabelled ribose 5-phosphate, lightly labelled ribulose 5-phosphate and more heavily labelled hexose and sedoheptulose mono- and bisphosphates. However, failure to demonstrate any CO2 fixation by arabinose 5-phosphate as sole substrate suggested that the above labelling may have no metabolic significance. Despite this arabinose and ribose 5-phosphates are shown to exhibit active roles as enzyme co-factors in transaldolase and aldolase exchange reactions that catalyse the epimeric interconversions of the phosphate esters of ido- and altro-octulose. Arabinose 5-phosphate is presented as playing this role in a New Reaction Scheme for the path of carbon, where it is concluded that slow reacting ido-octulose 1,8 bisphosphate has no role. The more reactive altro-octulose phosphates, which are independent of the need for phosphotransferase processing, are presented as intermediates in the new scheme. Moreover, using the estimates of phosphotransferase activity with altro-octulose monophosphate as substrate allowed calculation of the contributions of the new scheme, that ranged from 11% based on the intact chloroplast carboxylation rate to 80% using the carboxylation rate required for the support of octulose phosphate synthesis and its role in the phosphotransferase reaction. PMID:17160443

  9. Safe Osteocutaneous Radial Forearm Flap Harvest with Prophylactic Internal Fixation

    PubMed Central

    Shnayder, Yelizaveta; Tsue, Terance T.; Toby, E. Bruce; Werle, Andreas H.; Girod, Douglas A.

    2011-01-01

    We studied the efficacy of prophylactic plate fixation technique and a modified harvest of the osteocutaneous radial forearm free flap (OCRFFF) to minimize the incidence of postoperative donor radius pathological fracture. We retrospectively studied of the first 70 consecutive patients undergoing OCRFFF harvest by the University of Kansas Head and Neck Microvascular Reconstruction Team. Mean follow-up was 13 months. One of two patients undergoing OCRFFF harvest without prophylactic fixation developed a pathological radius fracture. The 68 subsequent OCRFFF patients underwent prophylactic fixation of the donor radius, and none developed a symptomatic radius fracture. Five of 68 patients did have a radiographically visible fracture requiring no intervention. The plate fixation technique was further modified to exclude monocortical screws in the radius bone donor defect (subsequent 39 patients), without any further fractures detected. One patient required forearm hardware removal for an attritional extensor tendon tear. The described modified OCRFFF harvest and prophylactic plate fixation technique may eliminate postoperative pathological fracture of the donor radius. Donor morbidity is similar to that of the fasciocutaneous radial forearm free flap , affording safe use of OCRFFF in head and neck reconstruction. PMID:22942941

  10. Safe osteocutaneous radial forearm flap harvest with prophylactic internal fixation.

    PubMed

    Shnayder, Yelizaveta; Tsue, Terance T; Toby, E Bruce; Werle, Andreas H; Girod, Douglas A

    2011-09-01

    We studied the efficacy of prophylactic plate fixation technique and a modified harvest of the osteocutaneous radial forearm free flap (OCRFFF) to minimize the incidence of postoperative donor radius pathological fracture. We retrospectively studied of the first 70 consecutive patients undergoing OCRFFF harvest by the University of Kansas Head and Neck Microvascular Reconstruction Team. Mean follow-up was 13 months. One of two patients undergoing OCRFFF harvest without prophylactic fixation developed a pathological radius fracture. The 68 subsequent OCRFFF patients underwent prophylactic fixation of the donor radius, and none developed a symptomatic radius fracture. Five of 68 patients did have a radiographically visible fracture requiring no intervention. The plate fixation technique was further modified to exclude monocortical screws in the radius bone donor defect (subsequent 39 patients), without any further fractures detected. One patient required forearm hardware removal for an attritional extensor tendon tear. The described modified OCRFFF harvest and prophylactic plate fixation technique may eliminate postoperative pathological fracture of the donor radius. Donor morbidity is similar to that of the fasciocutaneous radial forearm free flap , affording safe use of OCRFFF in head and neck reconstruction. PMID:22942941

  11. Impact of global climate change on ecosystem-level interactions among sympatric plants from all three photosynthetic pathways. Terminal report

    SciTech Connect

    Nobel, P.S.

    1997-12-17

    The proposed research will determine biochemical and physiological responses to variations in environmental factors for plants of all three photosynthetic pathways under competitive situations in the field. These responses will be used to predict the effects of global climatic change on an ecosystem in the northwestern Sonoran Desert where the C{sub 3} subshrub Encelia farinosa, the C{sub 4} bunchgrass Hilaria rigida, and the CAM succulent Agave deserti are co-dominants. These perennials are relatively short with overlapping shallow roots facilitating the experimental measurements as well as leading to competition for soil water. Net CO{sub 2} uptake over 24-h periods measured in the laboratory will be analyzed using an environmental productivity index (EPI) that can incorporate simultaneous effects of soil water, air temperature, and light. Based on EPI, net CO{sub 2} uptake and hence plant productivity will be predicted for the three species in the field under various treatments. Activity of the two CO{sub 2} fixation enzymes, Rubisco and PEPCase, will be determined for these various environmental conditions; also, partitioning of carbon to various organs will be measured based on {sup 14}CO{sub 2} labeling and dry weight analysis. Thus, enzymatic and partitioning controls on competition among sympatric model plants representing all three photosynthetic pathways will be investigated.

  12. Treatment Carbon Dioxide Using Atmospheric Non-thermal Plasma Produced by Surface Discharge

    Microsoft Academic Search

    Nobuya Hayashi; Hiroshi Yoshida; Saburoh Satoh; Chobei Yamabe

    2004-01-01

    Decomposition and fixation of carbon dioxide (CO_2) were studied using a non-thermal plasma produced by the surface discharge. The mixture gas of carbon dioxide and hydrogen or water vapor was introduced to a discharge reactor in order to deoxidize carbon dioxide and produce organic compounds. The effective condition of the treatment was investigated by controlling several parameters such as a

  13. Nitrogen fixation in the mucus of Red Sea corals.

    PubMed

    Grover, Renaud; Ferrier-Pagès, Christine; Maguer, Jean-François; Ezzat, Leila; Fine, Maoz

    2014-11-15

    Scleractinian corals are essential constituents of tropical reef ecological diversity. They live in close association with diazotrophs [dinitrogen (N2)-fixing microbes], which can fix high rates of N2. Whether corals benefit from this extrinsic nitrogen source is still under debate. Until now, N2 fixation rates have been indirectly estimated using the acetylene reduction assay, which does not permit assessment of the amount of nitrogen incorporated into the different compartments of the coral holobiont. In the present study, the (15)N2 technique was applied for the first time on three Red Sea coral species. Significant (15)N enrichment was measured in particles released by corals to the surrounding seawater. N2 fixation rates were species specific and as high as 1.6-2 ng N day(-1) l(-1). However, no significant enrichment was measured in the symbiotic dinoflagellates or the coral host tissues, suggesting that corals do not benefit from diazotrophic N2 fixation. PMID:25278474

  14. Management of equine skull fractures using fixation with polydioxanone sutures.

    PubMed

    Schaaf, K L; Kannegieter, N J; Lovell, D K

    2008-12-01

    Ten horses presented with severe distortion of the facial contour, crepitus on palpation and mild to moderate epistaxis. Individual horses also showed ocular damage, ptosis, severe dyspnoea and movement of the facial bones concurrent with respiration. The fracture fragments were exposed using a large curvilinear incision and elevated using a retractor, periosteal elevator, chisel or Steinmann pin. The fracture fragments were unstable following reduction and fixation was necessary. Stabilisation was achieved with polydioxanone sutures placed through holes drilled in opposing sides of the fracture lines. Polydioxanone sutures provided good stability and had better handling properties than wire. There was good apposition of fracture edges and minimal complications. Use of polydioxanone sutures can also avoid the expense and complexity of plate fixation in selected cases, and should be considered as an alternative to fixation with stainless steel wire in any facial fracture that adjoins stable bone. PMID:19076771

  15. Fixation properties of subdivided populations with balancing selection.

    PubMed

    Lombardo, Pierangelo; Gambassi, Andrea; Dall'Asta, Luca

    2015-03-01

    In subdivided populations, migration acts together with selection and genetic drift and determines their evolution. Building upon a recently proposed method, which hinges on the emergence of a time scale separation between local and global dynamics, we study the fixation properties of subdivided populations in the presence of balancing selection. The approximation implied by the method is accurate when the effective selection strength is small and the number of subpopulations is large. In particular, it predicts a phase transition between species coexistence and biodiversity loss in the infinite-size limit and, in finite populations, a nonmonotonic dependence of the mean fixation time on the migration rate. In order to investigate the fixation properties of the subdivided population for stronger selection, we introduce an effective coarser description of the dynamics in terms of a voter model with intermediate states, which highlights the basic mechanisms driving the evolutionary process. PMID:25871077

  16. Buckminsterfullerenes: a non-metal system for nitrogen fixation.

    PubMed

    Nishibayashi, Yoshiaki; Saito, Makoto; Uemura, Sakae; Takekuma, Shin-Ichi; Takekuma, Hideko; Yoshida, Zen-Ichi

    2004-03-18

    In all nitrogen-fixation processes known so far--including the industrial Haber-Bosch process, biological fixation by nitrogenase enzymes and previously described homogeneous synthetic systems--the direct transformation of the stable, inert dinitrogen molecule (N2) into ammonia (NH3) relies on the powerful redox properties of metals. Here we show that nitrogen fixation can also be achieved by using a non-metallic buckminsterfullerene (C60) molecule, in the form of a water-soluble C60:gamma-cyclodextrin (1:2) complex, and light under nitrogen at atmospheric pressure. This metal-free system efficiently fixes nitrogen under mild conditions by making use of the redox properties of the fullerene derivative. PMID:15029186

  17. Strength analysis of clavicle fracture fixation devices and fixation techniques using finite element analysis with musculoskeletal force input.

    PubMed

    Marie, Cronskär

    2015-08-01

    In the cases, when clavicle fractures are treated with a fixation plate, opinions are divided about the best position of the plate, type of plate and type of screw units. Results from biomechanical studies of clavicle fixation devices are contradictory, probably partly because of simplified and varying load cases used in different studies. The anatomy of the shoulder region is complex, which makes it difficult and expensive to perform realistic experimental tests; hence, reliable simulation is an important complement to experimental tests. In this study, a method for finite element simulations of stresses in the clavicle plate and bone is used, in which muscle and ligament force data are imported from a multibody musculoskeletal model. The stress distribution in two different commercial plates, superior and anterior plating position and fixation including using a lag screw in the fracture gap or not, was compared. Looking at the clavicle fixation from a mechanical point of view, the results indicate that it is a major benefit to use a lag screw to fixate the fracture. The anterior plating position resulted in lower stresses in the plate, and the anatomically shaped plate is more stress resistant and stable than a regular reconstruction plate. PMID:25850983

  18. The C4-pathway of photosynthesis. Evidence for an intermediate pool of carbon dioxide and the identity of the donor C4-dicarboxylic acid

    PubMed Central

    Hatch, M. D.

    1971-01-01

    1. Leaves were exposed to 14CO2 under steady-state conditions for photosynthesis. The kinetics of entry or loss of label in pools of CO2 and other compounds was examined during the period of the pulse and a `chase' with 12CO2. 2. With maize the kinetics of labelling of the major CO2 pool and of depletion of label during a `chase' was consistent with this pool being derived from the C-4 of malate and being the precursor of the C-1 of 3-phosphoglycerate. 3. Similar results were obtained for Amaranthus leaves except that the C-4 of aspartate rather than malate was apparently the primary source of CO2. 4. The size and turnover time of the CO2 and C4 acid pools was calculated. These results provided the basis for estimating the concentration of CO2 in the bundle-sheath cells or chloroplasts assuming the pool was largely restricted to one or other of these compartments. 5. These findings are considered in relation to current schemes for the C4-pathway and the operation of a CO2 concentrating mechanism to serve ribulose diphosphate carboxylase. PMID:5144745

  19. A metabolomic study in oats (Avena sativa) highlights a drought tolerance mechanism based upon salicylate signalling pathways and the modulation of carbon, antioxidant and photo-oxidative metabolism.

    PubMed

    Sánchez-Martín, Javier; Heald, Jim; Kingston-Smith, Alison; Winters, Ana; Rubiales, Diego; Sanz, Mariluz; Mur, Luis A J; Prats, Elena

    2015-07-01

    Although a wealth of information is available on the induction of one or several drought-related responses in different species, little is known of how their timing, modulation and crucially integration influence drought tolerance. Based upon metabolomic changes in oat (Avena sativa?L.), we have defined key processes involved in drought tolerance. During a time course of increasing water deficit, metabolites from leaf samples were profiled using direct infusion-electrospray mass spectroscopy (DI-ESI-MS) and high-performance liquid chromatography (HPLC) ESI-MS/MS and analysed using principal component analysis (PCA) and discriminant function analysis (DFA). The involvement of metabolite pathways was confirmed through targeted assays of key metabolites and physiological experiments. We demonstrate an early accumulation of salicylic acid (SA) influencing stomatal opening, photorespiration and antioxidant defences before any change in the relative water content. These changes are likely to maintain plant water status, with any photoinhibitory effect being counteracted by an efficient antioxidant capacity, thereby representing an integrated mechanism of drought tolerance in oats. We also discuss these changes in relation to those engaged at later points, consequence of the different water status in susceptible and resistant genotypes. PMID:25533379

  20. EFFECT OF NITROGEN AND METAL ADDITIONS ON NITROGEN FIXATION ACTIVITY IN BIOLOGICAL SOIL CRUSTS

    NASA Astrophysics Data System (ADS)

    Alexander, K.; Lui, D.; Anbar, A. D.; Garcia-Pichel, F.; Hartnett, H. E.

    2009-12-01

    Biological soil crusts (BSCs) are diverse consortia of microorganisms that live in intimate association with soils in arid environments. Also called cryptogamic or microbiotic crusts, these communities can include cyanobacteria, algae, heterotrophic bacteria, fungi, lichens, and mosses. Together, these organisms provide many services to their surrounding ecosystems, including reduction of water runoff, promotion of water infiltration, and prevention of soil erosion. The cyanobacteria and algae also provide fixed carbon (C) to the soil through photosynthesis, and because atmospheric deposition of nitrogen (N) in arid environments is low, the major input of biologically available N comes from cyanobacteria capable of converting nitrogen gas (N2) to ammonium (NH4+). Biological soil crusts are easily destroyed by livestock grazing, motor vehicle travel, and many forms of recreational and agricultural land use. Loss of BSC cover can leave the soil vulnerable to intense erosion that can remove the nutrients necessary to sustain plant and animal life, thus accelerating the process of desertification. In order to preserve existing crusts and encourage the development of new crusts, it is crucial to understand the nutrient requirements of metabolism and growth in these microbial communities. This study investigated the affect of nitrogen and metal additions on N2-fixation activity in cyanobacterially-dominated crusts from the Colorado Plateau near Moab, Utah. Although N2-fixation has been studied in this system before, the affect of nutrient additions on N2-fixation activity has not been documented. The goal of this work was to understand how N and metal supplementation affects crust N metabolism. Three experiments were conducted to observe how N2-fixation activity changed with the addition of N, molybdenum (Mo), and vanadium (V). Molybdenum and vanadium were chosen because they are most commonly found at the active site of the enzyme nitrogenase, the molecule responsible for the biological conversion of N2 to NH4+. The Mo-dependent version of the enzyme is the most efficient, and it is used by the majority of N2-fixing organisms. Elements were added as aqueous solutions of NH4NO3, Na2MoO4, and Na3VO4 respectively. Nitrogen fixation potential was assayed using a modified acetylene reduction technique. Results from the N-addition experiment show that when N is provided, BSC organisms stop N2-fixation activity. This confirms that under natural conditions, the community is limited with respect to N. In general, crusts under Mo-addition fix at higher rates than crusts with no added Mo. This implies that crusts may also be limited with respect to Mo. However, contrary to our expectations, crusts fix at lower rates when V is added as compared to a no-V control. It is possible that this is the result of V-toxicity, or that V competes with the uptake and utilization of available Mo, thus exacerbating Mo-limitation. Experiments are currently underway to investigate how the geochemistry of the soil porewater changes as a result of these nutrient additions.

  1. Subaxial subluxation after atlantoaxial transarticular screw fixation in rheumatoid patients

    PubMed Central

    Neo, Masashi; Sakamoto, Takeshi; Fujibayashi, Shunsuke; Yoshitomi, Hiroyuki; Nakamura, Takashi

    2009-01-01

    The most common cervical abnormality associated with rheumatoid arthritis (RA) is atlantoaxial subluxation, and atlantoaxial transarticular screw fixation has proved to be one of the most reliable, stable fixation techniques for treating atlantoaxial subluxation. Following C1–C2 fixation, however, subaxial subluxation reportedly can bring about neurological deterioration and require secondary operative interventions. Rheumatoid patients appear to have a higher risk, but there has been no systematic comparison between rheumatoid and non-rheumatoid patients. Contributing radiological factors to the subluxation have also not been evaluated. The objective of this study was to evaluate subaxial subluxation after atlantoaxial transarticular screw fixation in patients with and without RA and to find contributing factors. Forty-three patients who submitted to atlantoaxial transarticular screw fixation without any concomitant operation were followed up for more than 1 year. Subaxial subluxation and related radiological factors were evaluated by functional X-ray measurements. Statistical analyses showed that aggravations of subluxation of 2.5 mm or greater were more likely to occur in RA patients than in non-RA patients over an average of 4.2 years of follow-up, and postoperative subluxation occurred in the anterior direction in the upper cervical spine. X-ray evaluations revealed that such patients had a significantly smaller postoperative C2–C7 angle, and that the postoperative AA angle correlated negatively with this. Furthermore, anterior subluxation aggravation was significantly correlated with the perioperative atlantoaxial and C2–C7 angle changes, and these two changes were strongly correlated to each other. In conclusion, after atlantoaxial transarticular screw fixation, rheumatoid patients have a greater risk of developing subaxial subluxations. The increase of the atlantoaxial angel at the operation can lead to a decrease in the C2–C7 angle, followed by anterior subluxation of the upper cervical spine and possibly neurological deterioration. PMID:19337758

  2. Fixation Stability Measurement Using Two Types of Microperimetry Devices

    PubMed Central

    Liu, Hongting; Bittencourt, Millena G.; Sophie, Raafay; Sepah, Yasir J.; Hanout, Mostafa; Rentiya, Zubir; Annam, Rachel; Scholl, Hendrik P. N.; Nguyen, Quan Dong

    2015-01-01

    Purpose We compared the fixation stability measurements obtained with two microperimeters, the Micro Perimeter 1 (MP-1) and the Spectral OCT/SLO (OCT/SLO), in subjects with and without maculopathies. Methods A total of 41 eyes with no known ocular diseases and 45 eyes with maculopathies were enrolled in the study. Both eyes of each participant had a 20-second fixation test using the MP-1 and OCT/SLO. The bivariate contour ellipse area (BCEA) was used for fixation stability evaluation. Results In the normal group, BCEA was 2.93 ± 0.32 log minarc2 on OCT/SLO and 2.89 ± 0.30 log minarc2 on MP-1. In the maculopathy group, BCEA was 3.05 ± 0.41 log minarc2 on OCT/SLO and 3.15 ± 0.46 log minarc2 on MP-1. There was no statistically significant difference between the BCEA measured by OCT/SLO and by MP-1 in both groups. A moderate correlation was found between the two devices (r = 0.45, P < 0.001). The sample size during the fixation test was 535.5 ± 14.6 pairs of coordinates in the normal group and 530.7 ± 14.9 pairs in the maculopathy group with MP-1, while it was 72.3 ± 6.9 and 59.9 ± 10.1, respectively, with OCT/SLO. This was due to different tracking frequencies between the two microperimeters. Conclusion Fixation stability assessment yields similar results using the OCT/SLO and MP-1. A major difference in sampling rate between the two microperimeters does not significantly affect BCEA measurements. Translational Relevance Fixation stability assessments are comparable and interchangeable between the OCT/SLO and the MP-1. PMID:25774329

  3. Fixations on objects in natural scenes: dissociating importance from salience

    PubMed Central

    't Hart, Bernard M.; Schmidt, Hannah C. E. F.; Roth, Christine; Einhäuser, Wolfgang

    2013-01-01

    The relation of selective attention to understanding of natural scenes has been subject to intense behavioral research and computational modeling, and gaze is often used as a proxy for such attention. The probability of an image region to be fixated typically correlates with its contrast. However, this relation does not imply a causal role of contrast. Rather, contrast may relate to an object's “importance” for a scene, which in turn drives attention. Here we operationalize importance by the probability that an observer names the object as characteristic for a scene. We modify luminance contrast of either a frequently named (“common”/“important”) or a rarely named (“rare”/“unimportant”) object, track the observers' eye movements during scene viewing and ask them to provide keywords describing the scene immediately after. When no object is modified relative to the background, important objects draw more fixations than unimportant ones. Increases of contrast make an object more likely to be fixated, irrespective of whether it was important for the original scene, while decreases in contrast have little effect on fixations. Any contrast modification makes originally unimportant objects more important for the scene. Finally, important objects are fixated more centrally than unimportant objects, irrespective of contrast. Our data suggest a dissociation between object importance (relevance for the scene) and salience (relevance for attention). If an object obeys natural scene statistics, important objects are also salient. However, when natural scene statistics are violated, importance and salience are differentially affected. Object salience is modulated by the expectation about object properties (e.g., formed by context or gist), and importance by the violation of such expectations. In addition, the dependence of fixated locations within an object on the object's importance suggests an analogy to the effects of word frequency on landing positions in reading. PMID:23882251

  4. Suppression of spontaneous nystagmus during different visual fixation conditions.

    PubMed

    Hirvonen, Timo P; Juhola, Martti; Aalto, Heikki

    2012-07-01

    Analysis of spontaneous nystagmus is important in the evaluation of dizzy patients. The aim was to measure how different visual conditions affect the properties of nystagmus using three-dimensional video-oculography (VOG). We compared prevalence, frequency and slow phase velocity (SPV) of the spontaneous nystagmus with gaze fixation allowed, with Frenzel's glasses, and in total darkness. Twenty-five patients (35 measurements) with the peripheral vestibular pathologies were included. The prevalence of nystagmus with the gaze fixation was 40%, and it increased significantly to 66% with Frenzel's glasses and regular room lights on (p < 0.01). The prevalence increased significantly to 83% when the regular room lights were switched off (p = 0.014), and further to 100% in total darkness (p = 0.025). The mean SPV of nystagmus with visual fixation allowed was 1.0°/s. It increased to 2.4°/s with Frenzel's glasses and room lights on, and additionally to 3.1°/s, when the regular room lights were switched off. The mean SPV in total darkness was 6.9°/s. The difference was highly significant between all test conditions (p < 0.01). The frequency of nystagmus was 0.7 beats/s with gaze fixation, 0.8 beats/s in both the test conditions with Frenzel's glasses on, and 1.2 beats/s in total darkness. The frequency in total darkness was significantly higher (p < 0.05) than with Frenzel's glasses, and more so than with visual fixation (p = 0.003). The VOG in total darkness is superior in detecting nystagmus, since Frenzel's glasses allow visual suppression to happen, and this effect is reinforced with gaze fixation allowed. Strict control of visual surroundings is essential in interpreting peripheral nystagmus. PMID:22057154

  5. Ecosystem controls on nitrogen fixation in boreal feather moss communities.

    PubMed

    DeLuca, Thomas H; Zackrisson, Olle; Gentili, Francesco; Sellstedt, Anita; Nilsson, Marie-Charlotte

    2007-05-01

    N fixation in feather moss carpets is maximized in late secondary successional boreal forests; however, there is limited understanding of the ecosystem factors that drive cyanobacterial N fixation in feather mosses with successional stage. We conducted a reciprocal transplant experiment to assess factors in both early and late succession that control N fixation in feather moss carpets dominated by Pleurozium schreberi. In 2003, intact microplots of moss carpets (30 cm x 30 cm x 10-20 cm deep) were excavated from three early secondary successional (41-101 years since last fire) forest sites and either replanted within the same stand or transplanted into one of three late successional (241-356 years since last fire) forest sites and the transverse was done for late successional layers of moss. Moss plots were monitored for changes in N-fixation rates by acetylene reduction (June 2003-September 2005) and changes in the presence of cyanobacteria on moss shoots by microscopy (2004). Forest nutrient status was measured using ionic resin capsules buried in the humus layer. Late successional forests exhibit high rates of N fixation and consistently high numbers of cyanobacteria on moss shoots, but low levels of available N. Conversely, early successional forests have higher N availability and have low rates of N fixation and limited presence of cyanobacteria on moss shoots. Transplantation of moss carpets resulted in a significant shift in presence and activity of cyanobacteria 1 year after initiation of the experiment responding to N fertility differences in early versus late successional forests. PMID:17219131

  6. Lateral Mass Fixation in the Subaxial Cervical Spine.

    PubMed

    Kurd, Mark F; Millhouse, Paul W; Schroeder, Gregory D; Kepler, Christopher K; Vaccaro, Alexander R

    2015-08-01

    The use of lateral mass screws and rods in the subaxial spine has become the standard method of fixation for posterior cervical spine fusions. Multiple techniques have been described for the placement of lateral mass screws, including the Magerl, the Anderson, and the An techniques. While these techniques are all slightly different, the overall goal is to obtain solid bony fixation while avoiding the neurovascular structures. The use of lateral mass screws has been shown to be a safe and effective technique for achieving a posterior cervical fusion. PMID:26049972

  7. Pitfalls of formalin fixation for determination of antineutrophil cytoplasmic antibodies.

    PubMed Central

    Chowdhury, S M; Broomhead, V; Spickett, G P; Wilkinson, R

    1999-01-01

    Sera can produce nuclear or perinuclear immunofluorescence staining in neutrophils which may be caused by antibodies with differing antigenic specificities. These include perinuclear antineutrophil cytoplasmic antibodies (P-ANCA), granulocyte specific antinuclear antibody (GS-ANA), and antinuclear antibody (ANA). There is controversy over the value of formalin fixation of neutrophils in differentiating antibodies giving selective or preferential reaction with the nuclear or perinuclear area of neutrophils. In a comparative study of 77 sera, formalin fixation caused inconsistency, nonspecific effects, and false positivity owing to enhanced fluorescence. If formalin fixed neutrophils are used in the routine diagnostic laboratory, this will add confusion to the interpretation of the ANCA assay. PMID:10562820

  8. A finite element parametric study of clavicle fixation plates.

    PubMed

    Pendergast, Megan; Rusovici, Razvan

    2015-06-01

    A finite element simulation on a fracture fixated clavicle was performed to study the effects of different fracture fixation parameters on the callus region. Specifically, parameters such as plate material, thickness, plate/bone gap, screw length, and locking vs. non-locking screws were explored. Plate thickness and locking vs. non-locking screws were found to be influential to construct stiffness where plate/bone gap and number of screws were not as sensitive. Copyright © 2015 John Wiley & Sons, Ltd. PMID:25641811

  9. Prevention and management of external fixator pin track sepsis.

    PubMed

    Ferreira, Nando; Marais, Leonard Charles

    2012-08-01

    Pin track-associated complications are almost universal findings with the use of external fixation. These complications are catastrophic if it leads to the failure of the bone-pin interface and could lead to pin loosening, fracture non-union and chronic osteomyelitis. Strategies proposed for the prevention and management of pin track complications are diverse and constantly changing. Prevention of external fixation pin track infection is a complex and ongoing task that requires attention to detail, meticulous surgical technique and constant vigilance. PMID:22729940

  10. Iris-Fixated Intraocular Lenses for Ametropia and Aphakia

    PubMed Central

    Simões, Pedro S; Ferreira, Tiago B

    2014-01-01

    Implantation of intraocular lens with Iris-fixation is a safe, efficient and predictable surgical procedure, which empowers the refractive surgeon with singular capabilities. Among their advantages are the reversibility, preservation of accommodation and a broad spectrum of ametropic correction. This lens also appears to be a valid option, with a favorable complication rate, for the treatment of aphakic eyes without capsular support. This article is a review of iris-fixated intraocular lenses and considers their principal indications, complications, and outcomes. PMID:25756061

  11. Iris-fixated intraocular lenses for ametropia and aphakia.

    PubMed

    Simões, Pedro S; Ferreira, Tiago B

    2014-01-01

    Implantation of intraocular lens with Iris-fixation is a safe, efficient and predictable surgical procedure, which empowers the refractive surgeon with singular capabilities. Among their advantages are the reversibility, preservation of accommodation and a broad spectrum of ametropic correction. This lens also appears to be a valid option, with a favorable complication rate, for the treatment of aphakic eyes without capsular support. This article is a review of iris-fixated intraocular lenses and considers their principal indications, complications, and outcomes. PMID:25756061

  12. [Secondary intraocular lens implantation using scleral suture fixation].

    PubMed

    Szurman, P; Gekeler, K

    2014-03-01

    Scleral suture fixation is one of several techniques used for secondary lens implantation in cases of inadequate capsular support for which many variations have been published. A transscleral suture can be accomplished using either an external or internal approach. The lens can be implanted using an injector with large incisions for unfolding lenses or also via small self-sealing incisions. Episcleral fixation of the suture can be accomplished by protecting the knot under scleral flaps, intrascleral rotation of the knot and using sclerocorneal pockets or scleral grooves. The intrascleral Z-suture with five intrascleral passes of the suture is a knotless technique providing several advantages. PMID:24549682

  13. Implant materials for fracture fixation: a clinical perspective.

    PubMed

    Disegi, J A; Wyss, H

    1989-01-01

    The optimum management of traumatic skeletal fractures may involve the installation of high quality surgical implants by a skilled orthopedic surgeon. Satisfactory clinical results are very dependent on the ability to maintain stable fracture fixation. Well designed contemporary implants rely on precise control of material composition and properties to achieve a well tolerated level of biological response. Metallic materials, such as 316L stainless steel, pure titanium, and titanium alloys, demonstrate an acceptable combination of strength, ductility, corrosion resistance, and biocompatibility. Polymers, composites, and biodegradable materials may offer selected opportunities for fracture fixation. An understanding of relevant clinical factors is essential to evaluate potential applications for advanced materials. PMID:2915951

  14. The anhydrofructose pathway of glycogen catabolism.

    PubMed

    Yu, Shukun

    2008-12-01

    In many living forms, glucose is stored in the polymeric form of glycogen and starch as a source of carbon and energy. Upon need, these polymers are broken down to their building block glucose in the presence of water and hydrolases, and glucose 1-phosphate in the presence of phosphate and phosphorylase. In the last decade, we established an alternative glycogen catabolic pathway, the so-called Anhydrofructose (AF) pathway, the description of which was approved by IUBMB in 2006. It is a pathway on the formation of an array of secondary metabolites from glycogen via the central intermediate 1,5-anhydro-D-fructose (AF). Furthermore, we demonstrated the occurrence of this pathway in both eukaryota and prokaryota. Metabolites of this pathway have been identified in mammals including humans. In this review, the physiological and molecular functions of these metabolites in the AF pathway as well as its regulation are discussed. PMID:18785261

  15. Sources of organic carbon for Rimicaris hybisae: Tracing individual fatty acids at two hydrothermal vent fields in the Mid-Cayman rise

    NASA Astrophysics Data System (ADS)

    Streit, Kathrin; Bennett, Sarah A.; Van Dover, Cindy L.; Coleman, Max

    2015-06-01

    Hydrothermal vents harbor ecosystems mostly decoupled from organic carbon synthesized with the energy of sunlight (photosynthetic carbon source) but fueled instead by oxidation of reduced compounds to generate a chemosynthetic carbon source. Our study aimed to disentangle photosynthetic and chemosynthetic organic carbon sources for the shrimp species Rimicaris hybisae, a primary consumer presumed to obtain its organic carbon mainly from ectosymbiotic chemoautotrophic bacteria living on its gill cover membrane. To provide ectosymbionts with ideal conditions for chemosynthesis, these shrimp live in dense clusters around vent chimneys; they are, however, also found sparsely distributed adjacent to diffuse vent flows, where they might depend on alternative food sources. Densely and sparsely distributed shrimp were sampled and dissected into abdominal tissue and gill cover membrane, covered with ectosymbiotic bacteria, at two hydrothermal vent fields in the Mid-Cayman rise that differ in vent chemistry. Fatty acids (FA) were extracted from shrimp tissues and their carbon isotopic compositions assessed. The FA data indicate that adult R. hybisae predominantly rely on bacteria for their organic carbon needs. Their FA composition is dominated by common bacterial FA of the n7 family (~41%). Bacterial FA of the n4 FA family are also abundant and found to constitute good biomarkers for gill ectosymbionts. Sparsely distributed shrimp contain fractions of n4 FA in gill cover membranes ~4% lower than densely packed ones (~18%) and much higher fractions of photosynthetic FA in abdominal tissues, ~4% more (compared with 1.6%), suggesting replacement of ectosymbionts along with exoskeletons (molt), while they take up alternative diets of partly photosynthetic organic carbon. Abdominal tissues also contain photosynthetic FA from a second source taken up presumably during an early dispersal phase and still present to c. 3% in adult shrimp. The contribution of photosynthetic carbon to the FA pool of adult R. hybisae is, however, overall small (max. 8%). Significant differences in carbon isotopic values of chemosynthetically derived FA between vent fields suggest that different dominant C fixation pathways are being used.

  16. Torsion properties of biological fixation utilizing a plate with and without an intramedullary rod 

    E-print Network

    Keiser, Michael

    1995-01-01

    The goal of internal fixation procedures is the restoration of normal structure and function to the injured bone. Internal fixation devices are utilized to increase the stability of fracture segments, transfer loads across ...

  17. A novel fixation system for acetabular quadrilateral plate fracture: a comparative biomechanical study.

    PubMed

    Zha, Guo-Chun; Sun, Jun-Ying; Dong, Sheng-Jie; Zhang, Wen; Luo, Zong-Ping

    2015-01-01

    This study aims to assess the biomechanical properties of a novel fixation system (named AFRIF) and to compare it with other five different fixation techniques for quadrilateral plate fractures. This in vitro biomechanical experiment has shown that the multidirectional titanium fixation (MTF) and pelvic brim long screws fixation (PBSF) provided the strongest fixation for quadrilateral plate fracture; the better biomechanical performance of the AFRIF compared with the T-shaped plate fixation (TPF), L-shaped plate fixation (LPF), and H-shaped plate fixation (HPF); AFRIF gives reasonable stability of treatment for quadrilateral plate fracture and may offer a better solution for comminuted quadrilateral plate fractures or free floating medial wall fracture and be reliable in preventing protrusion of femoral head. PMID:25802849

  18. Torsion properties of biological fixation utilizing a plate with and without an intramedullary rod

    E-print Network

    Keiser, Michael

    1995-01-01

    The goal of internal fixation procedures is the restoration of normal structure and function to the injured bone. Internal fixation devices are utilized to increase the stability of fracture segments, transfer loads across the fracture site...

  19. Stable Isotope Ratios of Carbon and Nitrogen in Suspended Organic Matter: Seasonal and Spatial Dynamics Along the Changjiang (Yangtze River) Transport Pathway

    NASA Astrophysics Data System (ADS)

    Gao, L.; Li, D.

    2014-12-01

    Seven cruises were conducted in the Changjiang (Yangtze River) Estuary and the adjacent western East China Sea (ECS) from 2010 to 2012 to study the seasonal variations of ?13C and ?15N in suspended organic matter. In addition, two cruises in the northeastern ECS in July 2011 and in Tsushima Strait in July 2012 were conducted to evaluate the distribution patterns of these isotopes over the entire Changjiang transport pathway. In summer, the surface ?13C was lowest in the Changjiang Channel, increasing from land to sea, reaching highest values in the central ECS, and then decreasing and remaining relatively constant. In winter, the surface ?13C in the western ECS showed lower values with less variation in general. At most stations, ?13C increased from the sea surface to the seabed, reflecting the degradation of sinking organic matter; however, these trends could be changed in the summer by surface phytoplankton accumulation. Combining data from all the Changjiang Estuary and western ECS cruises revealed that when the suspended particulate matter (SPM) was > 135 mg/L, the ?13C values were fairly constant (-24.5‰ to -20.5‰); when the SPM was < 135 mg/L, the ?13C values showed much greater variability (-28.4‰ to -16.6‰). The surface ?15N also showed generally higher values in the central ECS in summer and lower values in winter. The seasonal variations of ?13C and ?15N were largely attributed to the SPM composition change: i.e., more phytoplankton cells in the summer whereas more resuspended sediment particles were present in winter.

  20. Variable pathways for oxygen atom insertion into metal-carbon bonds: the case of Cp*W(O)2(CH2SiMe3).

    PubMed

    Mei, Jiajun; Carsch, Kurtis M; Freitag, Cody R; Gunnoe, T Brent; Cundari, Thomas R

    2013-01-01

    Cp*W(O)(2)(CH(2)SiMe(3)) (1) (Cp* = ?(5)-pentamethylcyclopentadienyl) reacts with oxygen atom donors (e.g., H(2)O(2), PhIO, IO(4)(-)) in THF/water to produce TMSCH(2)OH (TMS = trimethylsilyl). For the reaction of 1 with IO(4)(-), the proposed pathway for alcohol formation involves coordination of IO(4)(-) to 1 followed by concerted migration of the -CH(2)TMS ligand to the coordinated oxygen of IO(4)(-) with concomitant dissociation of IO(3)(-) to produce Cp*W(O)(2)(OCH(2)SiMe(3)) (3), which undergoes protonolysis to yield free alcohol. In contrast to the reaction with IO(4)(-), the reaction of 1 with H(2)O(2) results in the formation of the ?(2)-peroxo complex Cp*W(O)(?(2)-O(2))(CH(2)SiMe(3)) (2). In the presence of acid (HCl) or base (NaOH), complex 2 produces TMSCH(2)OH. The conversion of 2 to TMSCH(2)OH catalyzed by Brønsted acid is proposed to occur through protonation of the ?(2)-peroxo ligand, which facilitates the transfer of the -CH(2)TMS ligand to a coordinated oxygen of the ?(2)-hydroperoxo ligand. In contrast, the hydroxide promoted conversion of 2 to TMSCH(2)OH is proposed to involve hydroxide coordination, followed by proton transfer from the hydroxide ligand to the peroxide ligand to yield a ?(1)-hydroperoxide intermediate. The migration of the -CH(2)TMS ligand to the coordinated oxygen of the ?(1)-hydroperoxo produces an alkoxide complex, which undergoes protonolysis to yield free alcohol. PMID:23259753

  1. Original article Insights into the regulation of nitrogen fixation in pea

    E-print Network

    Paris-Sud XI, Université de

    Original article Insights into the regulation of nitrogen fixation in pea nodules: lessons from and a subsequent impairment to bacteroid respiration. However, it has been recently shown that nitrogen fixation respiration des bactéroïdes. Cependant, il a été montré récemment que la fixation de l'azote est fortement

  2. Ethanol-Glycerin Fixation with Thymol Conservation: A Potential Alternative to Formaldehyde and Phenol Embalming

    ERIC Educational Resources Information Center

    Hammer, Niels; Loffler, Sabine; Feja, Christine; Sandrock, Mara; Schmidt, Wolfgang; Bechmann, Ingo; Steinke, Hanno

    2012-01-01

    Anatomical fixation and conservation are required to prevent specimens from undergoing autolysis and decomposition. While fixation is the primary arrest of the structures responsible for autolysis and decomposition, conservation preserves the state of fixation. Although commonly used, formaldehyde has been classified as carcinogenic to humans. For…

  3. Volar Fixed-Angle Fixation of Distal Radius Fractures: The DVR Plate

    Microsoft Academic Search

    Jorge Orbay; Alejandro Badia; Roger K. Khoury; Eduardo Gonzalez; Igor Indriago

    2004-01-01

    Volar fixed-angle fixation of distal radius fractures is a new method of treatment that provides the benefits of stable internal fixation without incurring the disadvan- tages of the dorsal approach. The DVR plate is a new fixation implant that was introduced specifically for the purpose of managing both dorsal and volar displaced fractures from the volar aspect. Experience gained ap-

  4. Calibration and standardization of microwave ovens for fixation of brain and peripheral nerve tissue.

    PubMed

    Login, G R; Leonard, J B; Dvorak, A M

    1998-06-01

    Rapid and reproducible fixation of brain and peripheral nerve tissue for light and electron microscopy studies can be done in a microwave oven. In this review we report a standardized nomenclature for diverse fixation techniques that use microwave heating: (1) microwave stabilization, (2) fast and ultrafast primary microwave-chemical fixation, (3) microwave irradiation followed by chemical fixation, (4) primary chemical fixation followed by microwave irradiation, and (5) microwave fixation used in various combinations with freeze fixation. All of these methods are well suited to fix brain tissue for light microscopy. Fast primary microwave-chemical fixation is best for immunoelectron microscopy studies. We also review how the physical characteristics of the microwave frequency and the dimensions of microwave oven cavities can compromise microwave fixation results. A microwave oven can be calibrated for fixation when the following parameters are standardized: irradiation time; water load volume, initial temperature, and placement within the oven; fixative composition, volume, and initial temperature; and specimen container shape and placement within the oven. Using two recently developed calibration tools, the neon bulb array and the agar-saline-Giemsa tissue phantom, we report a simple calibration protocol that identifies regions within a microwave oven for uniform microwave fixation. PMID:9654457

  5. “Biological” internal fixation of long bone fractures: a biomechanical study of a “noncontact” plate system

    Microsoft Academic Search

    I. A. Karnezis; A. W. Miles; J. L. Cunningham; I. D. Learmonth

    1998-01-01

    Based on existing knowledge of noncontact plates, an experimental prototype of a nonperiosteal contact internal fixation implant (“noncontact internal fixator”) has been designed. The construct rigidity of osteotomised synthetic composite femora, fixed with the noncontact fixator and a reamed, statically-locked intramedullary nail were compared in axial compression, two-plane bending and torsion in four types of diaphyseal fractures. With the exception

  6. Fixation Devices for Long Bone Fracture Reduction: An Overview and New Suggestions

    Microsoft Academic Search

    Raffaele Di Gregorio; Vincenzo Parenti-castelli

    2002-01-01

    External fixation devices for long bone fracture reduction are extensively used. Most of them are implemented by a trial and error process which alternates radiographs and fixation device adjustments in order to achieve a final correct positioning of the two bone segments. Fixation devices with less than six degrees of freedom are frequently used which can provide only an approximated

  7. Foreign gene recruitment to the fatty acid biosynthesis pathway in diatoms

    PubMed Central

    Chan, Cheong Xin; Baglivi, Francesca L; Jenkins, Christina E; Bhattacharya, Debashish

    2013-01-01

    Diatoms are highly successful marine and freshwater algae that contribute up to 20% of global carbon fixation. These species are leading candidates for biofuel production owing to ease of culturing and high fatty acid content. To assist in strain improvement and downstream applications for potential use as a biofuel, it is important to understand the evolution of lipid biosynthesis in diatoms. The evolutionary history of diatoms is however complicated by likely multiple endosymbioses involving the capture of foreign cells and horizontal gene transfer into the host genome. Using a phylogenomic approach, we assessed the evolutionary history of 12 diatom genes putatively encoding functions related to lipid biosynthesis. We found evidence of gene transfer likely from a green algal source for seven of these genes, with the remaining showing either vertical inheritance or evolutionary histories too complicated to interpret given current genome data. The functions of horizontally transferred genes encompass all aspects of lipid biosynthesis (initiation, biosynthesis, and desaturation of fatty acids) as well as fatty acid elongation, and are not restricted to plastid-targeted proteins. Our findings demonstrate that the transfer, duplication, and subfunctionalization of genes were key steps in the evolution of lipid biosynthesis in diatoms and other photosynthetic eukaryotes. This target pathway for biofuel research is highly chimeric and surprisingly, our results suggest that research done on related genes in green algae may have application to diatom models. PMID:24404416

  8. Determination of the rate constants for the carbon dioxide to bicarbonate inter-conversion in pH-buffered seawater systems

    Microsoft Academic Search

    K. G. Schulz; U. Riebesell; B. Rost; S. Thoms; R. E. Zeebe

    2006-01-01

    Experimental setups to study modes of inorganic carbon acquisition and fixation rates by marine phytoplankton commonly make use of so-called disequilibrium techniques. The chemical or isotopic disequilibrium, either caused by phytoplankton cells taking up inorganic carbon or by a small disturbance of the isotopic equilibrium in the carbonate system, requires to account for the relatively slow chemical interconversion of carbon

  9. External Fixation combined with Limited Internal Fixation versus Open Reduction Internal Fixation for Treating Ruedi-Allgower Type III Pilon Fractures

    PubMed Central

    Guo, Yongzhi; Tong, Liangyong; Li, Shaoguang; Liu, Zhi

    2015-01-01

    Background The optimal treatment of type III pilon fractures remains controversial. Hence, we performed this study to investigate whether open reduction and internal fixation (ORIF) is superior to external fixations combined with limited internal fixations (EFLIF). Material/Methods From January 2012 to October 2013, a total of 78 patients were included. Twenty-six patients underwent EFLIF and 52 patients underwent ORIF. All subjects were followed up at 1, 3, 6, and 12 months postoperatively. All outcomes and complications were recorded. Results No statistical differences were observed in Mazur score or ROM between the 2 groups. There were significant differences between the 2 groups in hospital stay (P<0.001), reduction results (P=0.019), screw loosening (P=0.025), and traumatic arthritis (P=0.037). Conclusions Similar functional outcomes were achieved in EFLIF and ORIF groups. Due to several limitations of this study, a well-designed randomized controlled trial involving more patients and long-term follow-up is needed to find an optimal treatment protocol. PMID:26050786

  10. External Fixation combined with Limited Internal Fixation versus Open Reduction Internal Fixation for Treating Ruedi-Allgower Type III Pilon Fractures.

    PubMed

    Guo, Yongzhi; Tong, Liangyong; Li, Shaoguang; Liu, Zhi

    2015-01-01

    BACKGROUND The optimal treatment of type III pilon fractures remains controversial. Hence, we performed this study to investigate whether open reduction and internal fixation (ORIF) is superior to external fixations combined with limited internal fixations (EFLIF). MATERIAL AND METHODS From January 2012 to October 2013, a total of 78 patients were included. Twenty-six patients underwent EFLIF and 52 patients underwent ORIF. All subjects were followed up at 1, 3, 6, and 12 months postoperatively. All outcomes and complications were recorded. RESULTS No statistical differences were observed in Mazur score or ROM between the 2 groups. There were significant differences between the 2 groups in hospital stay (P<0.001), reduction results (P=0.019), screw loosening (P=0.025), and traumatic arthritis (P=0.037). CONCLUSIONS Similar functional outcomes were achieved in EFLIF and ORIF groups. Due to several limitations of this study, a well-designed randomized controlled trial involving more patients and long-term follow-up is needed to find an optimal treatment protocol. PMID:26050786

  11. Unravelling the Carbon and Sulphur Metabolism in Coastal Soil Ecosystems Using Comparative Cultivation-Independent Genome-Level Characterisation of Microbial Communities

    PubMed Central

    Yousuf, Basit; Kumar, Raghawendra; Mishra, Avinash; Jha, Bhavanath

    2014-01-01

    Bacterial autotrophy contributes significantly to the overall carbon balance, which stabilises atmospheric CO2 concentration and decelerates global warming. Little attention has been paid to different modes of carbon/sulphur metabolism mediated by autotrophic bacterial communities in terrestrial soil ecosystems. We studied these pathways by analysing the distribution and abundance of the diagnostic metabolic marker genes cbbM, apsA and soxB, which encode for ribulose-1,5-bisphosphate carboxylase/oxygenase, adenosine phosphosulphate reductase and sulphate thiohydrolase, respectively, among different contrasting soil types. Additionally, the abundance of community members was assessed by quantifying the gene copy numbers for 16S rRNA, cbbL, cbbM, apsA and soxB. Distinct compositional differences were observed among the clone libraries, which revealed a dominance of phylotypes associated with carbon and sulphur cycling, such as Gammaproteobacteria (Thiohalomonas, Allochromatium, Chromatium, Thiomicrospira) and Alphaproteobacteria (Rhodopseudomonas, Rhodovulum, Paracoccus). The rhizosphere soil was devoid of sulphur metabolism, as the soxB and apsA genes were not observed in the rhizosphere metagenome, which suggests the absence or inadequate representation of sulphur-oxidising bacteria. We hypothesise that the novel Gammaproteobacteria sulphur oxidisers might be actively involved in sulphur oxidation and inorganic carbon fixation, particularly in barren saline soil ecosystems, suggesting their significant putative ecological role and contribution to the soil carbon pool. PMID:25225969

  12. Fixation behavior in observation and imitation of human movement

    Microsoft Academic Search

    Maja J. Mataric; Marc Pomplun

    1998-01-01

    This paper describes experiments performed with 40 subjects wearing an eye-tracker and watching and imitating videos of finger, hand, and arm movements. For all types of stimuli, the subjects tended to fixate on the hand, regardless of whether they were imitating or just watching. The results lend insight into the connection between visual perception and motor control, suggesting that: (1)

  13. Stephen Crews Lab February 21, 2009 Embryo Fixation

    E-print Network

    Crews, Stephen

    Stephen Crews Lab February 21, 2009 1 Embryo Fixation 1) Collect embryos on grape juice/agar plates 2) Rinse embryos with water (a squirt bottle works well) into a collection vial. We use collection. 3) Rinse the embryos well with water making sure to rid them of all yeast and other debris. 4

  14. Brief report Nitrogen fixation by reductively dechlorinating bacteria

    E-print Network

    Sun, Baolin

    Brief report Nitrogen fixation by reductively dechlorinating bacteria Xiongfei Ju, Liping Zhao in the ecology, physiology and genetics of reductively dechlorinating bacteria have revealed their important in symbiotic, associative and free-living bacteria. Here we show physiological and molecular evidence

  15. Fixational Eye Movements Are Not an Index of Covert Attention

    Microsoft Academic Search

    Todd S. Horowitz; Elisabeth M. Fine; David E. Fencsik; Sergey Yurgenson; Jeremy M. Wolfe

    2007-01-01

    The debate about the nature of fixational eye movements has revived recently with the claim that mi- crosaccades reflect the direction of attentional shifts. A number of studies have shown an association between the direction of attentional cues and the direction of micro- saccades. We sought to determine whether microsaccades in attentional tasks are causally related to behavior. Is reaction

  16. Evolution of photosynthesis and biospheric oxygenation contingent upon nitrogen fixation?

    NASA Astrophysics Data System (ADS)

    Grula, John W.

    2005-10-01

    How photosynthesis by Precambrian cyanobacteria oxygenated Earth's biosphere remains incompletely understood. Here it is argued that the oxic transition, which took place between approximately 2.3 and 0.5 Gyr ago, required a great proliferation of cyanobacteria, and this in turn depended on their ability to fix nitrogen via the nitrogenase enzyme system. However, the ability to fix nitrogen was not a panacea, and the rate of biospheric oxygenation may still have been affected by nitrogen constraints on cyanobacterial expansion. Evidence is presented for why cyanobacteria probably have a greater need for fixed nitrogen than other prokaryotes, underscoring the importance of their ability to fix nitrogen. The connection between nitrogen fixation and the evolution of photosynthesis is demonstrated by the similarities between nitrogenase and enzymes critical for the biosynthesis of (bacterio)chlorophyll. It is hypothesized that biospheric oxygenation would not have occurred if the emergence of cyanobacteria had not been preceded by the evolution of nitrogen fixation, and if these organisms had not also acquired the ability to fix nitrogen at the beginning of or very early in their history. The evolution of nitrogen fixation also appears to have been a precondition for the evolution of (bacterio)chlorophyll-based photosynthesis. Given that some form of chlorophyll is obligatory for true photosynthesis, and its light absorption and chemical properties make it a ‘universal pigment’, it may be predicted that the evolution of nitrogen fixation and photosynthesis are also closely linked on other Earth-like planets.

  17. Computer-Assisted Percutaneous Scaphoid Fixation: Concepts and Evolution

    PubMed Central

    Smith, Erin J.; Ellis, Randy E.; Pichora, David R.

    2013-01-01

    Background?The treatment for undisplaced scaphoid waist fractures has evolved from conventional cast immobilization to percutaneous screw insertion. Percutaneous fixation reduces some of the risks of open surgery, but can be technically demanding and carries the risk of radiation exposure. Recently, computer-assisted percutaneous scaphoid fixation (CAPSF) has been gaining interest. Materials and Methods?Conventional percutaneous scaphoid fixation is performed under fluoroscopic guidance and involves insertion of a guide wire along the length of the scaphoid to facilitate placement of a cannulated screw. Adapting computer-assisted techniques for scaphoid fixation poses several unique challenges including patient tracking and registration. Results?To date, five groups have successfully implemented systems for CAPSF. These systems have implemented wrist immobilization strategies to resolve the issue of patient tracking and have developed unique guidance techniques incorporating 2D fluoroscope, cone-beam CT, and ultrasound, to circumvent patient-based registration. Conclusions?Computer-aided percutaneous pinning of scaphoid waist fractures can significantly reduce radiation exposure and has the potential to improve the accuracy of this procedure. This article reviews the rationale for, and the evolution of, CAPSF and describes the key principles of computer-assisted technology. PMID:24436833

  18. Autistic Symptomatology, Face Processing Abilities, and Eye Fixation Patterns

    ERIC Educational Resources Information Center

    Kirchner, Jennifer C.; Hatri, Alexander; Heekeren, Hauke R.; Dziobek, Isabel

    2011-01-01

    Deviant gaze behavior is a defining characteristic of autism. Its relevance as a pathophysiological mechanism, however, remains unknown. In the present study, we compared eye fixations of 20 adults with autism and 21 controls while they were engaged in taking the Multifaceted Empathy Test (MET). Additional measures of face emotion and identity…

  19. An indirect reduction technique for percutaneous fixation of calcaneus fractures.

    PubMed

    Klima, Matthew; Vlasak, Richard; Sadasivan, Kalia

    2014-07-01

    We describe a positioning and indirect reduction method that allows for earlier fixation of some displaced calcaneus fractures. Minimally invasive surgery with this technique can provide good results in high-risk patients while minimizing soft-tissue complications. PMID:25046187

  20. RAPID GLUTARALDEHYDE FIXATION FOR COW MILK CELL COUNT

    E-print Network

    Paris-Sud XI, Université de

    ) is regarded as the reference method for counting somatic cells in cow milk. The use of an electronic particle by the for- maldehyde technique. Materials and Methods Somatic cell counts in 40 samples of milk were carriedRAPID GLUTARALDEHYDE FIXATION FOR COW MILK CELL COUNT BY COULTER COUNTER B. POUTREL G. DUBRAY INRA