Science.gov

Sample records for carbon fixation pathways

  1. Improving carbon fixation pathways

    SciTech Connect

    Ducat, DC; Silver, PA

    2012-08-01

    A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that novel pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials.

  2. Carbon dioxide fixation in 'Archaeoglobus lithotrophicus': are there multiple autotrophic pathways?

    PubMed

    Estelmann, Sebastian; Ramos-Vera, Walter Hugo; Gad'on, Nasser; Huber, Harald; Berg, Ivan A; Fuchs, Georg

    2011-06-01

    Several representatives of the euryarchaeal class Archaeoglobi are able to grow facultative autotrophically using the reductive acetyl-CoA pathway, with 'Archaeoglobus lithotrophicus' being an obligate autotroph. However, genome sequencing revealed that some species harbor genes for key enzymes of other autotrophic pathways, i.e. 4-hydroxybutyryl-CoA dehydratase of the dicarboxylate/hydroxybutyrate cycle and the hydroxypropionate/hydroxybutyrate cycle and ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) of the Calvin-Benson cycle. This raised the question of whether only one or multiple autotrophic pathways are operating in these species. We searched for the presence of enzyme activities specific for the dicarboxylate/hydroxybutyrate or the hydroxypropionate/hydroxybutyrate cycles in 'A. lithotrophicus', but such enzymes could not be detected. Low Rubisco activity was detected that could not account for the carbon dioxide (CO(2)) fixation rate; in addition, phosphoribulokinase activity was not found. The generation of ribulose 1,5-bisphosphate from 5-phospho-D-ribose 1-pyrophosphate was observed, but not from AMP; these sources for ribulose 1,5-bisphosphate have been proposed before. Our data indicate that the reductive acetyl-CoA pathway is the only functioning CO(2) fixation pathway in 'A. lithotrophicus'. PMID:21410513

  3. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

    PubMed Central

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker

    2012-01-01

    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  4. The Role of the C4 Pathway in Carbon Accumulation and Fixation in a Marine Diatom1

    PubMed Central

    Reinfelder, John R.; Milligan, Allen J.; Morel, François M.M.

    2004-01-01

    The role of a C4 pathway in photosynthetic carbon fixation by marine diatoms is presently debated. Previous labeling studies have shown the transfer of photosynthetically fixed carbon through a C4 pathway and recent genomic data provide evidence for the existence of key enzymes involved in C4 metabolism. Nonetheless, the importance of the C4 pathway in photosynthesis has been questioned and this pathway is seen as redundant to the known CO2 concentrating mechanism of diatoms. Here we show that the inhibition of phosphoenolpyruvate carboxylase (PEPCase) by 3,3-dichloro-2-dihydroxyphosphinoylmethyl-2-propenoate resulted in a more than 90% decrease in whole cell photosynthesis in Thalassiosira weissflogii cells acclimated to low CO2 (10 ?m), but had little effect on photosynthesis in the C3 marine Chlorophyte, Chlamydomonas sp. In 3,3-dichloro-2-dihydroxyphosphinoylmethyl-2-propenoate-treated T. weissflogii cells, elevated CO2 (150 ?m) or low O2 (80–180 ?m) restored photosynthesis to the control rate linking PEPCase inhibition with CO2 supply in this diatom. In C4 organic carbon-inorganic carbon competition experiments, the 12C-labeled C4 products of PEPCase, oxaloacetic acid and its reduced form malic acid suppressed the fixation of 14C-labeled inorganic carbon by 40% to 50%, but had no effect on O2 evolution in photosynthesizing diatoms. Oxaloacetic acid-dependent O2 evolution in T. weissflogii was twice as high in cells acclimated to 10 ?m rather than 22 ?m CO2, indicating that the use of C4 compounds for photosynthesis is regulated over the range of CO2 concentrations observed in marine surface waters. Short-term 14C uptake (silicone oil centrifugation) and CO2 release (membrane inlet mass spectrometry) experiments that employed a protein denaturing cell extraction solution containing the PEPCKase inhibitor mercaptopicolinic acid revealed that much of the carbon taken up by diatoms during photosynthesis is stored as organic carbon before being fixed in the Calvin cycle, as expected if the C4 pathway functions as a CO2 concentrating mechanism. Together these results demonstrate that the C4 pathway is important in carbon accumulation and photosynthetic carbon fixation in diatoms at low (atmospheric) CO2. PMID:15286292

  5. Widespread Occurrence of Two Carbon Fixation Pathways in Tubeworm Endosymbionts: Lessons from Hydrothermal Vent Associated Tubeworms from the Mediterranean Sea

    PubMed Central

    Thiel, Vera; Hügler, Michael; Blümel, Martina; Baumann, Heike I.; Gärtner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schönberg, Dieter; Petersen, Sven; Cowart, Dominique A.; Fisher, Charles R.; Imhoff, Johannes F.

    2012-01-01

    Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL – the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat. PMID:23248622

  6. Insights into the Autotrophic CO2 Fixation Pathway of the Archaeon Ignicoccus hospitalis: Comprehensive Analysis of the Central Carbon Metabolism?

    PubMed Central

    Jahn, Ulrike; Huber, Harald; Eisenreich, Wolfgang; Hügler, Michael; Fuchs, Georg

    2007-01-01

    Ignicoccus hospitalis is an autotrophic hyperthermophilic archaeon that serves as a host for another parasitic/symbiotic archaeon, Nanoarchaeum equitans. In this study, the biosynthetic pathways of I. hospitalis were investigated by in vitro enzymatic analyses, in vivo 13C-labeling experiments, and genomic analyses. Our results suggest the operation of a so far unknown pathway of autotrophic CO2 fixation that starts from acetyl-coenzyme A (CoA). The cyclic regeneration of acetyl-CoA, the primary CO2 acceptor molecule, has not been clarified yet. In essence, acetyl-CoA is converted into pyruvate via reductive carboxylation by pyruvate-ferredoxin oxidoreductase. Pyruvate-water dikinase converts pyruvate into phosphoenolpyruvate (PEP), which is carboxylated to oxaloacetate by PEP carboxylase. An incomplete citric acid cycle is operating: citrate is synthesized from oxaloacetate and acetyl-CoA by a (re)-specific citrate synthase, whereas a 2-oxoglutarate-oxidizing enzyme is lacking. Further investigations revealed that several special biosynthetic pathways that have recently been described for various archaea are operating. Isoleucine is synthesized via the uncommon citramalate pathway and lysine via the ?-aminoadipate pathway. Gluconeogenesis is achieved via a reverse Embden-Meyerhof pathway using a novel type of fructose 1,6-bisphosphate aldolase. Pentosephosphates are formed from hexosephosphates via the suggested ribulose-monophosphate pathway, whereby formaldehyde is released from C-1 of hexose. The organism may not contain any sugar-metabolizing pathway. This comprehensive analysis of the central carbon metabolism of I. hospitalis revealed further evidence for the unexpected and unexplored diversity of metabolic pathways within the (hyperthermophilic) archaea. PMID:17400748

  7. Potential role of multiple carbon fixation pathways during lipid accumulation in Phaeodactylum tricornutum

    PubMed Central

    2012-01-01

    Background Phaeodactylum tricornutum is a unicellular diatom in the class Bacillariophyceae. The full genome has been sequenced (<30?Mb), and approximately 20 to 30% triacylglyceride (TAG) accumulation on a dry cell basis has been reported under different growth conditions. To elucidate P. tricornutum gene expression profiles during nutrient-deprivation and lipid-accumulation, cell cultures were grown with a nitrate to phosphate ratio of 20:1 (N:P) and whole-genome transcripts were monitored over time via RNA-sequence determination. Results The specific Nile Red (NR) fluorescence (NR fluorescence per cell) increased over time; however, the increase in NR fluorescence was initiated before external nitrate was completely exhausted. Exogenous phosphate was depleted before nitrate, and these results indicated that the depletion of exogenous phosphate might be an early trigger for lipid accumulation that is magnified upon nitrate depletion. As expected, many of the genes associated with nitrate and phosphate utilization were up-expressed. The diatom-specific cyclins cyc7 and cyc10 were down-expressed during the nutrient-deplete state, and cyclin B1 was up-expressed during lipid-accumulation after growth cessation. While many of the genes associated with the C3 pathway for photosynthetic carbon reduction were not significantly altered, genes involved in a putative C4 pathway for photosynthetic carbon assimilation were up-expressed as the cells depleted nitrate, phosphate, and exogenous dissolved inorganic carbon (DIC) levels. P. tricornutum has multiple, putative carbonic anhydrases, but only two were significantly up-expressed (2-fold and 4-fold) at the last time point when exogenous DIC levels had increased after the cessation of growth. Alternative pathways that could utilize HCO3- were also suggested by the gene expression profiles (e.g., putative propionyl-CoA and methylmalonyl-CoA decarboxylases). Conclusions The results indicate that P. tricornutum continued carbon dioxide reduction when population growth was arrested and different carbon-concentrating mechanisms were used dependent upon exogenous DIC levels. Based upon overall low gene expression levels for fatty acid synthesis, the results also suggest that the build-up of precursors to the acetyl-CoA carboxylases may play a more significant role in TAG synthesis rather than the actual enzyme levels of acetyl-CoA carboxylases per se. The presented insights into the types and timing of cellular responses to inorganic carbon will help maximize photoautotrophic carbon flow to lipid accumulation. PMID:22672912

  8. CARBON DIOXIDE FIXATION.

    SciTech Connect

    FUJITA,E.

    2000-01-12

    Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO{sub 2} conversion. Recent achievements in the efficiency of solar energy conversion and in catalysis suggest that this approach holds a great deal of promise for contributing to future needs for fuels and chemicals.

  9. Structural studies of metalloenzyme complexes in acetogenic carbon fixation

    E-print Network

    Kung, Yan

    2011-01-01

    Acetogenic bacteria use the Wood-Ljungdahl carbon fixation pathway to produce cellular carbon from CO?. This process requires several metalloenzymes that employ transition metals such as iron, nickel, and cobalt towards ...

  10. Diurnal variations in pathways of photosynthetic carbon fixation in a freshwater cyanobacterium

    NASA Astrophysics Data System (ADS)

    Labiosa, R. G.; Arrigo, K. R.; Grossman, A.; Reddy, T. E.; Shrager, J.

    2003-04-01

    Understanding phytoplankton photosynthesis is critical to several fields including ecology and global biogeochemistry. The efficiency with which phytoplankton fix carbon depends upon the ambient light field, which is in turn dependent upon sun angle and the depth of mixing in the water column. In this pilot project, Synechocystis PCC 6803 was chosen as a model organism with which to study the molecular and physiological responses of phytoplankton to diurnal changes in light levels. Advantages of using this organism include that its genome has been sequenced, allowing the use of microarray technology, that it is readily grown as single colonies on plates and in liquid cultures, and that it is easy to manipulate genetically (generate and complement mutants). Axenic cultures of Synechocystis were grown under precisely controlled conditions in a "cyclodyne", a chemostat in which the light intensity cycles to mimic diurnal changes in light level, where the light consisted of sinusoidal daylight (400 ? mol photons m-2 s-1 at noon) followed by 12 hours of darkness for several weeks. After one week to allow the cells to acclimate to the light conditions, the cultures were sampled and extracted for RNA analysis every two hours over the course of several days. At these time points, absorption spectra, light scattering and chlorophyll a concentrations were determined. Initial results from Northern Blot hybridizations (examining RNA levels for individual genes) indicate that, the transcripts encoding photosynthetic proteins (i.e., PsbA2, PsaA and CpcB, in photosystem II, photosystem I, and phycobilisomes, respectively) are highest during the light. Initial results show that in the middle of the night, the psbA2 transcripts are 2-fold less while the psaA and cpcB are greater than 4-fold less than in the middle of the day. For the most part, the transcripts encoding photosynthetic proteins track the light cycle, although with different trends at daybreak and after night falls. Some increase more rapidly following daybreak than others and decrease at different rates after night fall. Early results from microarrays containing the full genome of the organism show that almost all genes display higher transcript abundances during the day (including photosynthetic genes), with a few notable exceptions, and a few others display higher transcript abundance at night than during the day.

  11. Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway

    SciTech Connect

    Hawkins, AB; Adams, MWW; Kelly, RM

    2014-03-25

    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73 degrees C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA beta-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula.

  12. Beyond the Calvin Cycle: Autotrophic Carbon Fixation in the Ocean

    NASA Astrophysics Data System (ADS)

    Hügler, Michael; Sievert, Stefan M.

    2011-01-01

    Organisms capable of autotrophic metabolism assimilate inorganic carbon into organic carbon. They form an integral part of ecosystems by making an otherwise unavailable form of carbon available to other organisms, a central component of the global carbon cycle. For many years, the doctrine prevailed that the Calvin-Benson-Bassham (CBB) cycle is the only biochemical autotrophic CO2 fixation pathway of significance in the ocean. However, ecological, biochemical, and genomic studies carried out over the last decade have not only elucidated new pathways but also shown that autotrophic carbon fixation via pathways other than the CBB cycle can be significant. This has ramifications for our understanding of the carbon cycle and energy flow in the ocean. Here, we review the recent discoveries in the field of autotrophic carbon fixation, including the biochemistry and evolution of the different pathways, as well as their ecological relevance in various oceanic ecosystems.

  13. Evidence of Carbon Fixation Pathway in a Bacterium from Candidate Phylum SBR1093 Revealed with Genomic Analysis

    PubMed Central

    Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

    2014-01-01

    Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30?50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30?80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere. PMID:25310003

  14. Evidence of carbon fixation pathway in a bacterium from candidate phylum SBR1093 revealed with genomic analysis.

    PubMed

    Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

    2014-01-01

    Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30?50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30?80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere. PMID:25310003

  15. De Novo Transcriptome Analysis of an Aerial Microalga Trentepohlia jolithus: Pathway Description and Gene Discovery for Carbon Fixation and Carotenoid Biosynthesis

    PubMed Central

    Li, Qianqian; Liu, Jianguo; Zhang, Litao; Liu, Qian

    2014-01-01

    Background Algae in the order Trentepohliales have a broad geographic distribution and are generally characterized by the presence of abundant ?-carotene. The many monographs published to date have mainly focused on their morphology, taxonomy, phylogeny, distribution and reproduction; molecular studies of this order are still rare. High-throughput RNA sequencing (RNA-Seq) technology provides a powerful and efficient method for transcript analysis and gene discovery in Trentepohlia jolithus. Methods/Principal Findings Illumina HiSeq 2000 sequencing generated 55,007,830 Illumina PE raw reads, which were assembled into 41,328 assembled unigenes. Based on NR annotation, 53.28% of the unigenes (22,018) could be assigned to gene ontology classes with 54 subcategories and 161,451 functional terms. A total of 26,217 (63.44%) assembled unigenes were mapped to 128 KEGG pathways. Furthermore, a set of 5,798 SSRs in 5,206 unigenes and 131,478 putative SNPs were identified. Moreover, the fact that all of the C4 photosynthesis genes exist in T. jolithus suggests a complex carbon acquisition and fixation system. Similarities and differences between T. jolithus and other algae in carotenoid biosynthesis are also described in depth. Conclusions/Significance This is the first broad transcriptome survey for T. jolithus, increasing the amount of molecular data available for the class Ulvophyceae. As well as providing resources for functional genomics studies, the functional genes and putative pathways identified here will contribute to a better understanding of carbon fixation and fatty acid and carotenoid biosynthesis in T. jolithus. PMID:25254555

  16. Enzyme Regulation& Catalysis in Carbon Fixation Metabolism

    SciTech Connect

    Henry M. Miziorko

    2004-12-14

    The overall long term goal of this program is the elucidation of molecular events in carbon assimilation. It has become axiomatic that control of flux through metabolic pathways is effectively imposed at irreversible reactions situated early in those pathways. The current focal point of this project is phosphoribulokinase (PRK), which catalyzes formation of the carbon dioxide acceptor, ribulose 1,5-bisphosphate. This reaction represents an early irreversible step unique to Calvin���¢��������s reductive pentose phosphate pathway. Predictably, the PRK reaction represents an important control point in carbon fixation, regulated by a light dependent thiol/disulfide exchange in eukaryotes and by allosteric effectors in prokaryotes. Characterization of naturally occurring mutants as well as gene knockout experiments substantiate the importance of PRK to in vivo control of carbon assimilation in both prokaryotes and eukaryotes. Thus, given the potential impact of enhancement or inhibition of PRK activity on energy (biomass/biofuel) production, elucidation of the molecular events that account for PRK activity is a significant scientific goal.

  17. Computation of metabolic fluxes and efficiencies for biological carbon dioxide fixation.

    PubMed

    Boyle, Nanette R; Morgan, John A

    2011-03-01

    With rising energy prices and concern over the environmental impact of fossil fuel consumption, the push to develop biomass derived fuels has increased significantly. Although most global carbon fixation occurs via the Calvin Benson Bassham cycle, there are currently five other known pathways for carbon fixation; the goal of this study was to determine the thermodynamic efficiencies of all six carbon fixation pathways for the production of biomass using flux balance analysis. The three chemotrophic pathways, the reductive acetyl-CoA pathway, the 3-hydroxypropionate/4-hydroxybutyrate cycle and the dicarboxylate/4-hydroxybutyrate cycle, were found to be more efficient than photoautotrophic carbon fixation pathways. However, as hydrogen is not freely available, the energetic cost of hydrogen production from sunlight was calculated and included in the overall energy demand, which results in a 5 fold increase in the energy demand of chemoautotrophic carbon fixation. Therefore, when the cost of hydrogen production is included, photoautotrophic pathways are more efficient. However, the energetic cost for the production of 12 metabolic precursors was found to vary widely across the different carbon fixation pathways; therefore, different pathways may be more efficient at producing products from a single precursor than others. The results of this study have significant impact on the selection or design of autotrophic organisms for biofuel or biochemical production. Overall biomass production from solar energy is most efficient in organisms using the reductive TCA cycle, however, products derived from one metabolic precursor may be more efficiently produced using other carbon fixation pathways. PMID:21276868

  18. ORIGINAL ARTICLE Sulfur oxidizers dominate carbon fixation

    E-print Network

    Hansell, Dennis

    ORIGINAL ARTICLE Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system

  19. Efficient CO2 Fixation Pathways: Energy Plant: High Efficiency Photosynthetic Organisms

    SciTech Connect

    2012-01-01

    PETRO Project: UCLA is redesigning the carbon fixation pathways of plants to make them more efficient at capturing the energy in sunlight. Carbon fixation is the key process that plants use to convert carbon dioxide (CO2) from the atmosphere into higher energy molecules (such as sugars) using energy from the sun. UCLA is addressing the inefficiency of the process through an alternative biochemical pathway that uses 50% less energy than the pathway used by all land plants. In addition, instead of producing sugars, UCLA’s designer pathway will produce pyruvate, the precursor of choice for a wide variety of liquid fuels. Theoretically, the new biochemical pathway will allow a plant to capture 200% as much CO2 using the same amount of light. The pathways will first be tested on model photosynthetic organisms and later incorporated into other plants, thus dramatically improving the productivity of both food and fuel crops.

  20. Carbon Dioxide Fixation in Cultured Animal Cells

    E-print Network

    Kyner, David Smith

    1969-01-01

    Plage ACKNOWIJBDOMElfTS ü TAB1E OF CONTENTS i ü LIST OF TABIÄS *i LIST OF FTOUKES l r l i i CHAPTER I. INTRODUCTION 1 EL HISTORICAL REVIEW 3 The Cultivation of Animal Cells in the Presence and Absence of Carbon Dioxide . * * • 3 Substitutions... for Carbon Dioxide 5 Some Physical and Chemical Characteristics of Carbon Dioxide and its Buffering Capacity 8 Qluooneoftenesis 10 Control of Oluconeogenesis • • • • 12 Oluooneogenesls and Carbon Dioxide Fixation Iii Effects of Olucose 15 Effects...

  1. Carbon fixation by basalt-hosted microbial communities

    PubMed Central

    Orcutt, Beth N.; Sylvan, Jason B.; Rogers, Daniel R.; Delaney, Jennifer; Lee, Raymond W.; Girguis, Peter R.

    2015-01-01

    Oceanic crust is a massive potential habitat for microbial life on Earth, yet our understanding of this ecosystem is limited due to difficulty in access. In particular, measurements of rates of microbial activity are sparse. We used stable carbon isotope incubations of crustal samples, coupled with functional gene analyses, to examine the potential for carbon fixation on oceanic crust. Both seafloor-exposed and subseafloor basalts were recovered from different mid-ocean ridge and hot spot environments (i.e., the Juan de Fuca Ridge, the Mid-Atlantic Ridge, and the Loihi Seamount) and incubated with 13C-labeled bicarbonate. Seafloor-exposed basalts revealed incorporation of 13C-label into organic matter over time, though the degree of incorporation was heterogeneous. The incorporation of 13C into biomass was inconclusive in subseafloor basalts. Translating these measurements into potential rates of carbon fixation indicated that 0.1–10 nmol C g-1rock d-1 could be fixed by seafloor-exposed rocks. When scaled to the global production of oceanic crust, this suggests carbon fixation rates of 109–1012 g C year-1, which matches earlier predictions based on thermodynamic calculations. Functional gene analyses indicate that the Calvin cycle is likely the dominant biochemical mechanism for carbon fixation in basalt-hosted biofilms, although the reductive acetyl-CoA pathway and reverse TCA cycle likely play some role in net carbon fixation. These results provide empirical evidence for autotrophy in oceanic crust, suggesting that basalt-hosted autotrophy could be a significant contributor of organic matter in this remote and vast environment. PMID:26441854

  2. Carbon fixation by basalt-hosted microbial communities.

    PubMed

    Orcutt, Beth N; Sylvan, Jason B; Rogers, Daniel R; Delaney, Jennifer; Lee, Raymond W; Girguis, Peter R

    2015-01-01

    Oceanic crust is a massive potential habitat for microbial life on Earth, yet our understanding of this ecosystem is limited due to difficulty in access. In particular, measurements of rates of microbial activity are sparse. We used stable carbon isotope incubations of crustal samples, coupled with functional gene analyses, to examine the potential for carbon fixation on oceanic crust. Both seafloor-exposed and subseafloor basalts were recovered from different mid-ocean ridge and hot spot environments (i.e., the Juan de Fuca Ridge, the Mid-Atlantic Ridge, and the Loihi Seamount) and incubated with (13)C-labeled bicarbonate. Seafloor-exposed basalts revealed incorporation of (13)C-label into organic matter over time, though the degree of incorporation was heterogeneous. The incorporation of (13)C into biomass was inconclusive in subseafloor basalts. Translating these measurements into potential rates of carbon fixation indicated that 0.1-10 nmol C g(-1) rock d(-1) could be fixed by seafloor-exposed rocks. When scaled to the global production of oceanic crust, this suggests carbon fixation rates of 10(9)-10(12) g C year(-1), which matches earlier predictions based on thermodynamic calculations. Functional gene analyses indicate that the Calvin cycle is likely the dominant biochemical mechanism for carbon fixation in basalt-hosted biofilms, although the reductive acetyl-CoA pathway and reverse TCA cycle likely play some role in net carbon fixation. These results provide empirical evidence for autotrophy in oceanic crust, suggesting that basalt-hosted autotrophy could be a significant contributor of organic matter in this remote and vast environment. PMID:26441854

  3. Dark Carbon Fixation: An Important Process in Lake Sediments

    PubMed Central

    Santoro, Ana Lúcia; Bastviken, David; Gudasz, Cristian; Tranvik, Lars; Enrich-Prast, Alex

    2013-01-01

    Close to redox boundaries, dark carbon fixation by chemoautotrophic bacteria may be a large contributor to overall carbon fixation. Still, little is known about the relative importance of this process in lake systems, in spite the potentially high chemoautotrophic potential of lake sediments. We compared rates of dark carbon fixation, bacterial production and oxygen consumption in sediments from four Swedish boreal and seven tropical Brazilian lakes. Rates were highly variable and dark carbon fixation amounted up to 80% of the total heterotrophic bacterial production. The results indicate that non-photosynthetic carbon fixation can represent a substantial contribution to bacterial biomass production, especially in sediments with low organic matter content. PMID:23776549

  4. Carbon fixation in oceanic crust: Does it happen, and is it important?

    NASA Astrophysics Data System (ADS)

    Orcutt, B.; Sylvan, J. B.; Rogers, D.; Lee, R.; Girguis, P. R.; Carr, S. A.; Jungbluth, S.; Rappe, M. S.

    2014-12-01

    The carbon sources supporting a deep biosphere in igneous oceanic crust, and furthermore the balance of heterotrophy and autotrophy, are poorly understood. When the large reservoir size of oceanic crust is considered, carbon transformations in this environment have the potential to significantly impact the global carbon cycle. Furthermore, igneous oceanic crust is the most massive potential habitat for life on Earth, so understanding the carbon sources for this potential biosphere are important for understanding life on Earth. Geochemical evidence suggests that warm and anoxic upper basement is net heterotrophic, but the balance of these processes in cooler and potentially oxic oceanic crust are poorly known. Here, we present data from stable carbon isotope tracer incubations to examine carbon fixation in basalts collected from the Loihi Seamount, the Juan de Fuca Ridge, and the western flank of the Mid-Atlantic Ridge, to provide a first order constraint on the rates of carbon fixation on basalts. These data will be compared to recently available assessments of carbon cycling rates in fluids from upper basement to synthesize our current state of understanding of the potential for carbon fixation and respiration in oceanic crust. Moreover, we will present new genomic data of carbon fixation genes observed in the basalt enrichments as well as from the subsurface of the Juan de Fuca Ridge flank, enabling identification of the microbes and metabolic pathways involved in carbon fixation in these systems.

  5. Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation.

    PubMed

    Könneke, Martin; Schubert, Daniel M; Brown, Philip C; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J; Stahl, David A; Berg, Ivan A

    2014-06-01

    Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

  6. Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation

    PubMed Central

    Könneke, Martin; Schubert, Daniel M.; Brown, Philip C.; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J.; Stahl, David A.; Berg, Ivan A.

    2014-01-01

    Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

  7. A global two component signal transduction system that integrates the control of photosynthesis, carbon dioxide assimilation, and nitrogen?fixation

    PubMed Central

    Joshi, Hemalata?M.; Tabita, F.?Robert

    1996-01-01

    Photosynthesis, biological nitrogen fixation, and carbon dioxide assimilation are three fundamental biological processes catalyzed by photosynthetic bacteria. In the present study, it is shown that mutant strains of the nonsulfur purple photosynthetic bacteria Rhodospirillum rubrum and Rhodobacter sphaeroides, containing a blockage in the primary CO2 assimilatory pathway, derepress the synthesis of components of the nitrogen fixation enzyme complex and abrogate normal control mechanisms. The absence of the Calvin–Benson–Bassham (CBB) reductive pentose phosphate CO2 fixation pathway removes an important route for the dissipation of excess reducing power. Thus, the mutant strains develop alternative means to remove these reducing equivalents, resulting in the synthesis of large amounts of nitrogenase even in the presence of ammonia. This response is under the control of a global two-component signal transduction system previously found to regulate photosystem biosynthesis and the transcription of genes required for CO2 fixation through the CBB pathway and alternative routes. In addition, this two-component system directly controls the ability of these bacteria to grow under nitrogen-fixing conditions. These results indicate that there is a molecular link between the CBB and nitrogen fixation process, allowing the cell to overcome powerful control mechanisms to remove excess reducing power generated by photosynthesis and carbon metabolism. Furthermore, these results suggest that the two-component system integrates the expression of genes required for the three processes of photosynthesis, nitrogen fixation, and carbon dioxide fixation. PMID:8962083

  8. A carbon sink pathway increases carbon productivity in cyanobacteria.

    PubMed

    Oliver, John W K; Atsumi, Shota

    2015-05-01

    The burning of fossil reserves, and subsequent release of carbon into the atmosphere is depleting the supply of carbon-based molecules used for synthetic materials including plastics, oils, medicines, and glues. To provide for future society, innovations are needed for the conversion of waste carbon (CO2) into organic carbon useful for materials. Chemical production directly from photosynthesis is a nascent technology, with great promise for capture of CO2 using sunlight. To improve low yields, it has been proposed that photosynthetic capacity can be increased by a relaxation of bottlenecks inherent to growth. The limits of carbon partitioning away from growth within the cell and the effect of partitioning on carbon fixation are not well known. Here we show that expressing genes in a pathway between carbon fixation and pyruvate increases partitioning to 2,3-butanediol (23BD) and leads to a 1.8-fold increase in total carbon yield in the cyanobacterium Synechococcus elongatus PCC 7942. Specific 2,3-butanediol production increases 2.4-fold. As partitioning increases beyond 30%, it leads to a steep decline in total carbon yield. The data suggests a local maximum for carbon partitioning from the Calvin Benson cycle that is scalable with light intensity. PMID:25777135

  9. Acetogenesis and the Wood-Ljungdahl Pathway of CO2 Fixation

    PubMed Central

    Ragsdale, Stephen W.; Pierce, Elizabeth

    2008-01-01

    I. Summary Conceptually, the simplest way to synthesize an organic molecule is to construct it one carbon at a time. The Wood-Ljungdahl pathway of CO2 fixation involves this type of stepwise process. The biochemical events that underlie the condensation of two one-carbon units to form the two-carbon compound, acetate, have intrigued chemists, biochemists, and microbiologists for many decades. We begin this review with a description of the biology of acetogenesis. Then, we provide a short history of the important discoveries that have led to the identification of the key components and steps of this usual mechanism of CO and CO2 fixation. In this historical perspective, we have included reflections that hopefully will sketch the landscape of the controversies, hypotheses, and opinions that led to the key experiments and discoveries. We then describe the properties of the genes and enzymes involved in the pathway and conclude with a section describing some major questions that remain unanswered. PMID:18801467

  10. Optimization of inorganic carbon sources to improve the carbon fixation efficiency of the non-photosynthetic microbial community with different electron donors.

    PubMed

    Wang, Ya-nan; Wang, Lei; Shan, Yi-na; Hu, Jiajun; Tsang, Yiufai; Hu, Yu; Fu, Xiaohua; Le, Yiquan

    2015-01-01

    As the non-photosynthetic microbial community (NPMC) isolated from seawaters utilized inorganic carbon sources for carbon fixation, the concentrations and ratios of Na2CO3, NaHCO3, and CO2 were optimized by response surface methodology design. With H2 as the electron donor, the optimal carbon sources were 270?mg/L Na2CO3, 580?mg/L NaHCO3, and 120?mg/L CO2. The carbon fixation efficiency in response to total organic carbon (TOC) was up to 30.59?mg/L with optimal carbon sources, which was about 50% higher than that obtained with CO2 as the sole carbon source. The mixture of inorganic carbon sources developed a buffer system to prevent acidification or alkalization of the medium caused by CO2 or Na2CO3, respectively. Furthermore, CO2 and HCO3(-), the starting points of carbon fixation in the pathways of Calvin-Benson-Bassham and 3-hydroxypropionate cycles, were provided by the carbon source structure to facilitate carbon fixation by NPMC. However, in the presence of mixed electron donors composed of 1.25% Na2S, 0.50% Na2S2O3, and 0.457% NaNO2, the carbon source structure did not exhibit significant improvement in the carbon fixation efficiency, when compared with that achieved with CO2 as the sole carbon source. The positive effect of mixed electron donors on inorganic carbon fixation was much higher than that of the carbon source structure. Nevertheless, the carbon source structure could be used as an alternative to CO2 when using NPMC to fix carbon in industrial processes. PMID:25367398

  11. Abundance and Distribution of Diagnostic Carbon Fixation Genes in a Deep-Sea Hydrothermal Gradient Ecosystem

    NASA Astrophysics Data System (ADS)

    Blumenfeld, H. N.; Kelley, D. S.; Girguis, P. R.; Schrenk, M. O.

    2010-12-01

    The walls of deep-sea hydrothermal vent chimneys sustain steep thermal and chemical gradients resulting from the mixing of hot (350°C+) hydrothermal fluids with cold, oxygenated seawater. The chemical disequilibrium generated from this process has the potential to drive numerous chemolithoautotrophic metabolisms, many of which have been demonstrated to be operative in microbial pure cultures. In addition to the well-known Calvin Cycle, at least five additional pathways have been discovered including the Reverse Tricarboxylic Acid Cycle (rTCA), the Reductive Acetyl-CoA pathway, and the 3-hydroxyproprionate pathway. Most of the newly discovered pathways have been found in thermophilic and hyperthermophilic Bacteria and Archaea, which are the well represented in microbial diversity studies of hydrothermal chimney walls. However, to date, little is known about the environmental controls that impact various carbon fixation pathways. The overlap of limited microbial diversity with distinct habitat conditions in hydrothermal chimney walls provides an ideal setting to explore these relationships. Hydrothermal chimney walls from multiple structures recovered from the Juan de Fuca Ridge in the northeastern Pacific were sub-sampled and analyzed using PCR-based assays. Earlier work showed elevated microbial abundances in the outer portions of mature chimney walls, with varying ratios of Archaea to Bacteria from the outer to inner portions of the chimneys. Common phylotypes identified in these regions included Epsilonproteobacteria, Gammaproteobacteria, and Desulfurococcales. Total genomic DNA was extracted from mineralogically distinct niches within these structures and queried for genes coding key regulatory enzymes for each of the well studied carbon fixation pathways. Preliminary results show the occurrence of genes representing rTCA cycle (aclB) and methyl coenzyme A reductase (mcrA) - a proxy for the Reductive Acetyl-CoA Pathway within interior portion of mature hydrothermal chimneys. Ongoing analyses are aimed at quantifying the abundances of these diagnostic carbon fixation genes within the hydrothermal chimney gradients. These data are being compared to a broad array of contextual data to provide insight into the environmental and biological controls that may impact the distribution of the various carbon fixation pathways. Application of genomic approaches to the hydrothermal chimney ecosystem will provide insight into the microbial ecology of such structures and refine our ability to measure autotrophy in hydrothermal habitats sustained by chemical energy.

  12. Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park

    SciTech Connect

    Jennings, Ryan; Whitmore, Laura M.; Moran, James J.; Kreuzer, Helen W.; Inskeep, William P.

    2014-05-01

    The fixation of inorganic carbon (as carbon dioxide) has been documented in all three domains of life and results in the biosynthesis of a diverse suite of organic compounds that support the growth of heterotrophic organisms. The primary aim of this study was to assess the importance of carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of one of the dominant Fe(II)-oxidizing organisms (Metallosphaera yellowstonensis strain MK1) present in situ. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon fixation pathway were identified in pure-cultures of M. yellowstonensis strain MK1. Metagenome sequencing from the same environments also revealed genes for the 3-HP/4-HB pathway belonging to M. yellowstonensis populations, as well as genes for a complete reductive TCA cycle from Hydrogenobaculum spp. (Aquificales). Stable isotope (13CO2) labeling was used to measure the fixation of CO2 by M. yellowstonensis strain MK1, and in ex situ assays containing live Fe(III)-oxide microbial mats. Results showed that M. yellowstonensis strain MK1 fixes CO2 via the 3-HP/4-HB pathway with a fractionation factor of ~ 2.5 ‰. Direct analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C and microbial mat C showed that mat C is comprised of both DIC and non-DIC sources. The estimated contribution of DIC carbon to biomass C (> ~ 35%) is reasonably consistent with the relative abundance of known chemolithoautotrophs and corresponding CO2 fixation pathways detected in metagenome sequence. The significance of DIC as a major source of carbon for Fe-oxide mat communities provides a foundation for examining microbial interactions in these systems that are dependent on the activity of autotrophic organisms such as Hydrogenobaculum and Metallosphaera spp.

  13. Isocyanate- and phosgene-free routes to polyfunctional cyclic carbonates and green polyurethanes by fixation of carbon dioxide.

    PubMed

    Blattmann, Hannes; Fleischer, Maria; Bähr, Moritz; Mülhaupt, Rolf

    2014-07-01

    The catalytic chemical fixation of carbon dioxide by carbonation of oxiranes, oxetanes, and polyols represents a very versatile green chemistry route to environmentally benign di- and polyfunctional cyclic carbonates as intermediates for the formation of non-isocyanate poly-urethane (NIPU). Two synthetic pathways lead to NIPU thermoplastics and thermosets: i) polycondensation of diacarbamates or acyclic dicarbonates with diols or diamines, respectively, and ii) polyaddition by ring-opening polymerization of di- and polyfunctional cyclic carbonates with di- and polyamines. The absence of hazardous and highly moisture-sensitive isocyanates as intermediates eliminates the need for special safety precautions, drying and handling procedures. Incorporated into polymer backbones and side chains, carbonate groups enable facile tailoring of a great variety of urethane-functional polymers. As compared with conventional polyurethanes, ring-opening polymerization of polyfunctional cyclic carbonates affords polyhydroxyurethanes with unconventional architectures including NIPUs containing carbohydrate segments. NIPU/epoxy hybrid coatings can be applied on wet surfaces and exhibit improved adhesion, thermal stability and wear resistance. Combining chemical with biological carbon dioxide fixation affords 100% bio-based NIPUs derived from plant oils, terpenes, carbohydrates, and bio polyols. Biocompatible and biodegradable NIPU as well as NIPU biocomposites hold great promise for biomedical applications. PMID:24979310

  14. A "footprint" of plant carbon fixation cycle functions during the development of a heterotrophic fungus.

    PubMed

    Lyu, Xueliang; Shen, Cuicui; Xie, Jiatao; Fu, Yanping; Jiang, Daohong; Hu, Zijin; Tang, Lihua; Tang, Liguang; Ding, Feng; Li, Kunfei; Wu, Song; Hu, Yanping; Luo, Lilian; Li, Yuanhao; Wang, Qihua; Li, Guoqing; Cheng, Jiasen

    2015-01-01

    Carbon fixation pathway of plants (CFPP) in photosynthesis converts solar energy to biomass, bio-products and biofuel. Intriguingly, a large number of heterotrophic fungi also possess enzymes functionally associated with CFPP, raising the questions about their roles in fungal development and in evolution. Here, we report on the presence of 17 CFPP associated enzymes (ten in Calvin-Benson-Basham reductive pentose phosphate pathway and seven in C4-dicarboxylic acid cycle) in the genome of Sclerotinia sclerotiorum, a heterotrophic phytopathogenic fungus, and only two unique enzymes: ribulose-1, 5-bisphosphate carboxylase-oxygenase (Rubisco) and phosphoribulokinase (PRK) were absent. This data suggested an incomplete CFPP-like pathway (CLP) in fungi. Functional profile analysis demonstrated that the activity of the incomplete CLP was dramatically regulated during different developmental stages of S. sclerotiorum. Subsequent experiments confirmed that many of them were essential to the virulence and/or sclerotial formation. Most of the CLP associated genes are conserved in fungi. Phylogenetic analysis showed that many of them have undergone gene duplication, gene acquisition or loss and functional diversification in evolutionary history. These findings showed an evolutionary links in the carbon fixation processes of autotrophs and heterotrophs and implicated the functions of related genes were in course of continuous change in different organisms in evolution. PMID:26263551

  15. A “footprint” of plant carbon fixation cycle functions during the development of a heterotrophic fungus

    PubMed Central

    Lyu, Xueliang; Shen, Cuicui; Xie, Jiatao; Fu, Yanping; Jiang, Daohong; Hu, Zijin; Tang, Lihua; Tang, Liguang; Ding, Feng; Li, Kunfei; Wu, Song; Hu, Yanping; Luo, Lilian; Li, Yuanhao; Wang, Qihua; Li, Guoqing; Cheng, Jiasen

    2015-01-01

    Carbon fixation pathway of plants (CFPP) in photosynthesis converts solar energy to biomass, bio-products and biofuel. Intriguingly, a large number of heterotrophic fungi also possess enzymes functionally associated with CFPP, raising the questions about their roles in fungal development and in evolution. Here, we report on the presence of 17 CFPP associated enzymes (ten in Calvin-Benson-Basham reductive pentose phosphate pathway and seven in C4-dicarboxylic acid cycle) in the genome of Sclerotinia sclerotiorum, a heterotrophic phytopathogenic fungus, and only two unique enzymes: ribulose-1, 5-bisphosphate carboxylase-oxygenase (Rubisco) and phosphoribulokinase (PRK) were absent. This data suggested an incomplete CFPP-like pathway (CLP) in fungi. Functional profile analysis demonstrated that the activity of the incomplete CLP was dramatically regulated during different developmental stages of S. sclerotiorum. Subsequent experiments confirmed that many of them were essential to the virulence and/or sclerotial formation. Most of the CLP associated genes are conserved in fungi. Phylogenetic analysis showed that many of them have undergone gene duplication, gene acquisition or loss and functional diversification in evolutionary history. These findings showed an evolutionary links in the carbon fixation processes of autotrophs and heterotrophs and implicated the functions of related genes were in course of continuous change in different organisms in evolution. PMID:26263551

  16. Bioengineering of carbon fixation, biofuels, and biochemicals in cyanobacteria and plants.

    PubMed

    Rosgaard, Lisa; de Porcellinis, Alice Jara; Jacobsen, Jacob H; Frigaard, Niels-Ulrik; Sakuragi, Yumiko

    2012-11-30

    Development of sustainable energy is a pivotal step towards solutions for today's global challenges, including mitigating the progression of climate change and reducing dependence on fossil fuels. Biofuels derived from agricultural crops have already been commercialized. However the impacts on environmental sustainability and food supply have raised ethical questions about the current practices. Cyanobacteria have attracted interest as an alternative means for sustainable energy productions. Being aquatic photoautotrophs they can be cultivated in non-arable lands and do not compete for land for food production. Their rich genetic resources offer means to engineer metabolic pathways for synthesis of valuable bio-based products. Currently the major obstacle in industrial-scale exploitation of cyanobacteria as the economically sustainable production hosts is low yields. Much effort has been made to improve the carbon fixation and manipulating the carbon allocation in cyanobacteria and their evolutionary photosynthetic relatives, algae and plants. This review aims at providing an overview of the recent progress in the bioengineering of carbon fixation and allocation in cyanobacteria; wherever relevant, the progress made in plants and algae is also discussed as an inspiration for future application in cyanobacteria. PMID:22677697

  17. Computational protein design enables a novel one-carbon assimilation pathway.

    PubMed

    Siegel, Justin B; Smith, Amanda Lee; Poust, Sean; Wargacki, Adam J; Bar-Even, Arren; Louw, Catherine; Shen, Betty W; Eiben, Christopher B; Tran, Huu M; Noor, Elad; Gallaher, Jasmine L; Bale, Jacob; Yoshikuni, Yasuo; Gelb, Michael H; Keasling, Jay D; Stoddard, Barry L; Lidstrom, Mary E; Baker, David

    2015-03-24

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway. PMID:25775555

  18. Computational protein design enables a novel one-carbon assimilation pathway

    PubMed Central

    Siegel, Justin B.; Smith, Amanda Lee; Poust, Sean; Wargacki, Adam J.; Bar-Even, Arren; Louw, Catherine; Shen, Betty W.; Eiben, Christopher B.; Tran, Huu M.; Noor, Elad; Gallaher, Jasmine L.; Bale, Jacob; Yoshikuni, Yasuo; Gelb, Michael H.; Keasling, Jay D.; Stoddard, Barry L.; Lidstrom, Mary E.; Baker, David

    2015-01-01

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway. PMID:25775555

  19. Computational protein design enables a novel one-carbon assimilation pathway

    SciTech Connect

    Siegel, JB; Smith, AL; Poust, S; Wargacki, AJ; Bar-Even, A; Louw, C; Shen, BW; Eiben, CB; Tran, HM; Noor, E; Gallaher, JL; Bale, J; Yoshikuni, Y; Gelb, MH; Keasling, JD; Stoddard, BL; Lidstrom, ME; Baker, D

    2015-03-09

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway.

  20. CbbR, the Master Regulator for Microbial Carbon Dioxide Fixation.

    PubMed

    Dangel, Andrew W; Tabita, F Robert

    2015-11-15

    Biological carbon dioxide fixation is an essential and crucial process catalyzed by both prokaryotic and eukaryotic organisms to allow ubiquitous atmospheric CO2 to be reduced to usable forms of organic carbon. This process, especially the Calvin-Bassham-Benson (CBB) pathway of CO2 fixation, provides the bulk of organic carbon found on earth. The enzyme ribulose 1,5-bisphosphate (RuBP) carboxylase/oxygenase (RubisCO) performs the key and rate-limiting step whereby CO2 is reduced and incorporated into a precursor organic metabolite. This is a highly regulated process in diverse organisms, with the expression of genes that comprise the CBB pathway (the cbb genes), including RubisCO, specifically controlled by the master transcriptional regulator protein CbbR. Many organisms have two or more cbb operons that either are regulated by a single CbbR or employ a specific CbbR for each cbb operon. CbbR family members are versatile and accommodate and bind many different effector metabolites that influence CbbR's ability to control cbb transcription. Moreover, two members of the CbbR family are further posttranslationally modified via interactions with other transcriptional regulator proteins from two-component regulatory systems, thus augmenting CbbR-dependent control and optimizing expression of specific cbb operons. In addition to interactions with small effector metabolites and other regulator proteins, CbbR proteins may be selected that are constitutively active and, in some instances, elevate the level of cbb expression relative to wild-type CbbR. Optimizing CbbR-dependent control is an important consideration for potentially using microbes to convert CO2 to useful bioproducts. PMID:26324454

  1. Diffusional Contribution to Carbon Isotope Fractionation during Dark CO2 Fixation in CAM Plants 1

    PubMed Central

    O'Leary, Marion H.; Osmond, C. Barry

    1980-01-01

    A mathematical model is developed which can be used to predict in vivo carbon isotope fractionations associated with carbon fixation in plants in terms of diffusion, CO2 hydration, and carboxylation components. This model also permits calculation of internal CO2 concentration for comparison with results of gas-exchange experiments. The isotope fractionations associated with carbon fixation in Kalanchoë daigremontiana and Bryophyllum tubiflorum have been measured by isolation of malic acid following dark fixation and enzymic determination of the isotopic composition of carbon-4 of this material. Corrections are made for residual malic acid, fumarase activity, and respiration. Comparison of these data with calculations from the model indicates that the rate of carbon fixation is limited principally by diffusion, rather than by carboxylation. Processes subsequent to the initial carboxylation also contribute to the over-all isotopic composition of the plant. PMID:16661555

  2. Carbon Dioxide Fixation by Metallosphaera yellowstonensis and Acidothermophilic Iron-Oxidizing Microbial Communities from Yellowstone National Park

    PubMed Central

    Jennings, Ryan M.; Whitmore, Laura M.; Moran, James J.

    2014-01-01

    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope (13CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ?2.5‰. Analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  3. Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park.

    PubMed

    Jennings, Ryan M; Whitmore, Laura M; Moran, James J; Kreuzer, Helen W; Inskeep, William P

    2014-05-01

    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope ((13)CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ?2.5‰. Analysis of the (13)C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  4. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge.

    PubMed

    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide

    2015-01-01

    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2-0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology. PMID:26439402

  5. A Simple Demonstration of Carbon Dioxide Fixation and Acid Production in CAM Plants

    ERIC Educational Resources Information Center

    Walker, John R. L.; McWha, James A.

    1976-01-01

    Described is an experiment investigating carbon dioxide fixation in the dark and the diurnal rhythm of acid production in plants exhibiting Crassulacean Acid Metabolism. Included are suggestions for four further investigations. (SL)

  6. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge

    PubMed Central

    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide

    2015-01-01

    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2?0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology. PMID:26439402

  7. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge

    NASA Astrophysics Data System (ADS)

    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide

    2015-10-01

    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2-0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology.

  8. Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

    SciTech Connect

    Feist, AM; Nagarajan, H; Rotaru, AE; Tremblay, PL; Zhang, T; Nevin, KP; Lovley, DR; Zengler, K

    2014-04-24

    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. Author Summary The ability of microorganisms to exchange electrons directly with their environment has large implications for our knowledge of industrial and environmental processes. For decades, it has been known that microbes can use electrodes as electron acceptors in microbial fuel cell settings. Geobacter metallireducens has been one of the model organisms for characterizing microbe-electrode interactions as well as environmental processes such as bioremediation. Here, we significantly expand the knowledge of metabolism and energetics of this model organism by employing constraint-based metabolic modeling. Through this analysis, we build the metabolic pathways necessary for carbon fixation, a desirable property for industrial chemical production. We further discover a novel growth condition which enables the characterization of autotrophic (i.e., carbon-fixing) metabolism in Geobacter. Importantly, our systems-level modeling approach helped elucidate the key metabolic pathways and the energetic cost associated with extracellular electron transfer. This model can be applied to characterize and engineer the metabolism and electron transfer capabilities of Geobacter for biotechnological applications.

  9. Dark inorganic carbon fixation sustains the functioning of benthic deep-sea ecosystems

    NASA Astrophysics Data System (ADS)

    Molari, Massimiliano; Manini, Elena; Dell'Anno, Antonio

    2013-01-01

    studies have provided evidence that dark inorganic carbon fixation is an important process for the functioning of the ocean interior. However, its quantitative relevance and ecological significance in benthic deep-sea ecosystems remain unknown. We investigated the rates of inorganic carbon fixation together with prokaryotic abundance, biomass, assemblage composition, and heterotrophic carbon production in surface sediments of different benthic deep-sea systems along the Iberian margin (northeastern Atlantic Ocean) and in the Mediterranean Sea. Inorganic carbon fixation rates in these surface deep-sea sediments did not show clear depth-related patterns, and, on average, they accounted for 19% of the total heterotrophic biomass production. The incorporation rates of inorganic carbon were significantly related to the abundance of total Archaea (as determined by catalyzed reporter deposition fluorescence in situ hybridization) and completely inhibited using an inhibitor of archaeal metabolism, N1-guanyl-1,7-diaminoheptane. This suggests a major role of the archaeal assemblages in inorganic carbon fixation. We also show that benthic archaeal assemblages contribute approximately 25% of the total 3H-leucine incorporation. Inorganic carbon fixation in surface deep-sea sediments appears to be dependent not only upon chemosynthetic processes but also on heterotrophic/mixotrophic metabolism, as suggested by estimates of the chemolithotrophic energy requirements and the enhanced inorganic carbon fixation due to the increase in the availability of organic trophic resources. Overall, our data suggest that archaeal assemblages of surface deep-sea sediments are responsible for the high rates of inorganic carbon incorporation and thereby sustain the functioning of the food webs as well as influence the carbon cycling of benthic deep-sea ecosystems.

  10. Community structure and soil pH determine chemoautotrophic carbon dioxide fixation in drained paddy soils.

    PubMed

    Long, Xi-En; Yao, Huaiying; Wang, Juan; Huang, Ying; Singh, Brajesh K; Zhu, Yong-Guan

    2015-06-16

    Previous studies suggested that microbial photosynthesis plays a potential role in paddy fields, but little is known about chemoautotrophic carbon fixers in drained paddy soils. We conducted a microcosm study using soil samples from five paddy fields to determine the environmental factors and quantify key functional microbial taxa involved in chemoautotrophic carbon fixation. We used stable isotope probing in combination with phospholipid fatty acid (PLFA) and molecular approaches. The amount of microbial (13)CO2 fixation was determined by quantification of (13)C-enriched fatty acid methyl esters and ranged from 21.28 to 72.48 ng of (13)C (g of dry soil)(-1), and the corresponding ratio (labeled PLFA-C:total PLFA-C) ranged from 0.06 to 0.49%. The amount of incorporationof (13)CO2 into PLFAs significantly increased with soil pH except at pH 7.8. PLFA and high-throughput sequencing results indicated a dominant role of Gram-negative bacteria or proteobacteria in (13)CO2 fixation. Correlation analysis indicated a significant association between microbial community structure and carbon fixation. We provide direct evidence of chemoautotrophic C fixation in soils with statistical evidence of microbial community structure regulation of inorganic carbon fixation in the paddy soil ecosystem. PMID:25989872

  11. [Regulation of alternative CO[sub 2] fixation pathways in procaryotic and eucaryotic photosynthetic organisms

    SciTech Connect

    Not Available

    1992-01-01

    The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.

  12. Carbon and energy fixation of great duckweed Spirodela polyrhiza growing in swine wastewater.

    PubMed

    Wang, Wenguo; Yang, Chuang; Tang, Xiaoyu; Zhu, Qili; Pan, Ke; Cai, Denggao; Hu, Qichun; Ma, Danwei

    2015-10-01

    The ability to fix carbon and energy in swine wastewater of duckweeds was investigated using Spirodela polyrhiza as the model species. Cultures of S. polyrhiza were grown in dilutions of both original swine wastewater (OSW) and anaerobic digestion effluent (ADE) based on total ammonia nitrogen (TAN). Results showed that elevated concentrations of TAN caused decreased growth, carbon fixation, and energy production rates, particularly just after the first rise in two types of swine wastewater. Also, OSW was more suitable for S. polyrhiza cultivation than ADE. Maximum carbon and energy fixation were achieved at OSW-TAN concentrations of 12.08 and 13.07 mg L(-1), respectively. Photosynthetic activity of S. polyrhiza could be inhibited by both nutrient stress (in high-concentration wastewater) and nutrient limitation (in low-concentration wastewater), affecting its growth and ability for carbon-energy fixation. PMID:26036587

  13. A model for diurnal patterns of carbon fixation in a Precambrian microbial mat based on a modern analog

    NASA Technical Reports Server (NTRS)

    Rothschild, L. J.

    1991-01-01

    Microbial mat communities are one of the first and most prevalent biological communities known from the Precambrian fossil record. These fossil mat communities are found as laminated sedimentary rock structures called stromatolites. Using a modern microbial mat as an analog for Precambrian stromatolites, a study of carbon fixation during a diurnal cycle under ambient conditions was undertaken. The rate of carbon fixation depends primarily on the availability of light (consistent with photosynthetic carbon fixation) and inorganic carbon, and not nitrogen or phosphorus. Atmospheric PCO2 is thought to have decreased from 10 bars at 4 Ga (10(9) years before present) to approximately 10(-4) bars today, implying a change in the availability of inorganic carbon for carbon fixation. Experimental manipulation of levels of inorganic carbon to levels that may have been available to Precambrian mat communities resulted in increased levels of carbon fixation during daylight hours. Combining these data with models of daylength during the Precambrian, models are derived for diurnal patterns of photosynthetic carbon fixation in a Precambrian microbial mat community. The models suggest that, even in the face of shorter daylengths during the Precambrian, total daily carbon fixation has been declining over geological time, with most of the decrease having occurred during the Precambrian.

  14. Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

    PubMed Central

    Feist, Adam M.; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P.; Lovley, Derek R.; Zengler, Karsten

    2014-01-01

    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. PMID:24762737

  15. Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean

    PubMed Central

    Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M

    2013-01-01

    Bacteria and archaea in the dark ocean (>200?m) comprise 0.3–1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

  16. Carbon sequestration in soybean crop soils: the role of hydrogen-coupled CO2 fixation

    NASA Astrophysics Data System (ADS)

    Graham, A.; Layzell, D. B.; Scott, N. A.; Cen, Y.; Kyser, T. K.

    2011-12-01

    Conversion of native vegetation to agricultural land in order to support the world's growing population is a key factor contributing to global climate change. However, the extent to which agricultural activities contribute to greenhouse gas emissions compared to carbon storage is difficult to ascertain, especially for legume crops, such as soybeans. Soybean establishment often leads to an increase in N2O emissions because N-fixation leads to increased soil available N during decomposition of the low C:N legume biomass. However, soybean establishment may also reduce net greenhouse gas emissions by increasing soil fertility, plant growth, and soil carbon storage. The mechanism behind increased carbon storage, however, remains unclear. One explanation points to hydrogen coupled CO2 fixation; the process by which nitrogen fixation releases H2 into the soil system, thereby promoting chemoautotrophic carbon fixation by soil microbes. We used 13CO2 as a tracer to track the amount and fate of carbon fixed by hydrogen coupled CO2 fixation during one-year field and laboratory incubations. The objectives of the research are to 1) quantify rates of 13CO2 fixation in soil collected from a field used for long-term soybean production 2) examine the impact of H2 gas concentration on rates of 13CO2 fixation, and 3) measure changes in ?13C signature over time in 3 soil fractions: microbial biomass, light fraction, and acid stable fraction. If this newly-fixed carbon is incorporated into the acid-stable soil C fraction, it has a good chance of contributing to long-term soil C sequestration under soybean production. Soil was collected in the field both adjacent to root nodules (nodule soil) and >3cm away (root soil) and labelled with 13CO2 (1% v/v) in the presence and absence of H2 gas. After a two week labelling period, ?13C signatures already revealed differences in the four treatments of bulk soil: -17.1 for root, -17.6 for nodule, -14.2 for root + H2, and -6.1 for nodule + H2. Labelled soil was then placed in nylon mesh bags and buried in the field at a depth of 15cm in a soybean field at the Central Experiment Farm in Ottawa, Ontario. Samples will be removed at intervals of 1,2,3,6,9,12, and 15 months, and the ?13C of three soil fractions will be examined to reveal changes in carbon storage over time. Our results will provide insights into the fate of carbon fixed during hydrogen coupled CO2 fixation, and demonstrate whether this CO2 fixation can contribute to the long-term greenhouse gas balance of soybean production systems.

  17. Slow carboxylation of Rubisco constrains the rate of carbon fixation during Antarctic phytoplankton blooms.

    PubMed

    Young, Jodi N; Goldman, Johanna A L; Kranz, Sven A; Tortell, Philippe D; Morel, Francois M M

    2015-01-01

    High-latitude oceans are areas of high primary production despite temperatures that are often well below the thermal optima of enzymes, including the key Calvin Cycle enzyme, Ribulose 1,5 bisphosphate carboxylase oxygenase (Rubisco). We measured carbon fixation rates, protein content and Rubisco abundance and catalytic rates during an intense diatom bloom in the Western Antarctic Peninsula (WAP) and in laboratory cultures of a psychrophilic diatom (Fragilariopsis cylindrus). At -1°C, the Rubisco turnover rate, kcat (c) , was 0.4 C s(-1) per site and the half saturation constant for CO2 was 15 ?M (vs c. 3 C s(-1) per site and 50 ?M at 20°C). To achieve high carboxylation rates, psychrophilic diatoms increased Rubisco abundance to c. 8% of biomass (vs c. 0.6% at 20°C), along with their total protein content, resulting in a low carbon : nitrogen ratio of c. 5. In psychrophilic diatoms, Rubisco must be almost fully active and near CO2 saturation to achieve carbon fixation rates observed in the WAP. Correspondingly, total protein concentrations were close to the highest ever measured in phytoplankton and likely near the maximum possible. We hypothesize that this high protein concentration, like that of Rubisco, is necessitated by slow enzyme rates, and that carbon fixation rates in the WAP are near a theoretical maximum. PMID:25283055

  18. Metal-complex/semiconductor hybrids for carbon dioxide fixation

    NASA Astrophysics Data System (ADS)

    Maeda, Kazuhiko; Kuriki, Ryo; Sekizawa, Keita; Ishitani, Osamu

    2015-09-01

    A hybrid photocatalyst consisting of a catalytic Ru complex and polymeric carbon nitride (band gap, 2.7 eV) was capable of reducing CO2 into HCOOH with ~80% selectivity under visible light (? > 420 nm) in the presence of a suitable electron donor. Introduction of mesoporosity into the graphitic carbon nitride structure to increase the specific surface area was essential to enhancing the activity. However, higher surface area (in other words, lower crystallinity) that originated from excessively introduced mesopores had a negative impact on activity. Promoting electron injection from carbon nitride to the catalytic Ru unit as well as strengthening the electronic interactions between the two units improved the activity. Under the optimal condition, a turnover number (TON, with respect to the Ru complex used) greater than 1000 and an apparent quantum yield of 5.7% (at 400 nm) were obtained, which are the greatest among heterogeneous photocatalysts for visible-light CO2 reduction ever reported.

  19. Chemoautotrophic carbon fixation rates and active bacterial communities in intertidal marine sediments.

    PubMed

    Boschker, Henricus T S; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W C; Moodley, Leon

    2014-01-01

    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, The Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m(-2) d(-1). Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)(-1), which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  20. Comparative Shotgun Proteomic Analysis of Wastewater-Cultured Microalgae: Nitrogen Sensing and Carbon Fixation for Growth and Nutrient Removal in Chlamydomonas reinhardtii.

    PubMed

    Patel, Anil K; Huang, Eric L; Low-Décarie, Etienne; Lefsrud, Mark G

    2015-08-01

    Chlamydomonas reinhardtii was batch-cultured for 12 days under continuous illumination to investigate nitrogen uptake and metabolic responses to wastewater processing. Our approach compared two conditions: (1) artificial wastewater containing nitrate and ammonia and (2) nutrient-sufficient control containing nitrate as sole form of nitrogen. Treatments did not differ in final biomass; however, comparison of group proteomes revealed significant differences. Label-free shotgun proteomic analysis identified 2358 proteins, of which 92 were significantly differentially abundant. Wastewater cells showed higher relative abundances of photosynthetic antenna proteins, enzymes related to carbon fixation, and biosynthesis of amino acids and secondary metabolites. Control cells showed higher abundances of enzymes and proteins related to nitrogen metabolism and assimilation, synthesis and utilization of starch, amino acid recycling, evidence of oxidative stress, and little lipid biosynthesis. This study of the eukaryotic microalgal proteome response to nitrogen source, availability, and switching highlights tightly controlled pathways essential to the maintenance of culture health and productivity in concert with light absorption and carbon assimilation. Enriched pathways in artificial wastewater, notably, photosynthetic carbon fixation and biosynthesis of plant hormones, and those in nitrate only control, most notably, nitrogen, amino acid, and starch metabolism, represent potential targets for genetic improvement requiring targeted elucidation. PMID:25997359

  1. Irreversibly increased nitrogen fixation in Trichodesmium experimentally adapted to elevated carbon dioxide

    NASA Astrophysics Data System (ADS)

    Hutchins, David A.; Walworth, Nathan G.; Webb, Eric A.; Saito, Mak A.; Moran, Dawn; McIlvin, Matthew R.; Gale, Jasmine; Fu, Fei-Xue

    2015-09-01

    Nitrogen fixation rates of the globally distributed, biogeochemically important marine cyanobacterium Trichodesmium increase under high carbon dioxide (CO2) levels in short-term studies due to physiological plasticity. However, its long-term adaptive responses to ongoing anthropogenic CO2 increases are unknown. Here we show that experimental evolution under extended selection at projected future elevated CO2 levels results in irreversible, large increases in nitrogen fixation and growth rates, even after being moved back to lower present day CO2 levels for hundreds of generations. This represents an unprecedented microbial evolutionary response, as reproductive fitness increases acquired in the selection environment are maintained after returning to the ancestral environment. Constitutive rate increases are accompanied by irreversible shifts in diel nitrogen fixation patterns, and increased activity of a potentially regulatory DNA methyltransferase enzyme. High CO2-selected cell lines also exhibit increased phosphorus-limited growth rates, suggesting a potential advantage for this keystone organism in a more nutrient-limited, acidified future ocean.

  2. Irreversibly increased nitrogen fixation in Trichodesmium experimentally adapted to elevated carbon dioxide

    PubMed Central

    Hutchins, David A.; Walworth, Nathan G.; Webb, Eric A.; Saito, Mak A.; Moran, Dawn; McIlvin, Matthew R.; Gale, Jasmine; Fu, Fei-Xue

    2015-01-01

    Nitrogen fixation rates of the globally distributed, biogeochemically important marine cyanobacterium Trichodesmium increase under high carbon dioxide (CO2) levels in short-term studies due to physiological plasticity. However, its long-term adaptive responses to ongoing anthropogenic CO2 increases are unknown. Here we show that experimental evolution under extended selection at projected future elevated CO2 levels results in irreversible, large increases in nitrogen fixation and growth rates, even after being moved back to lower present day CO2 levels for hundreds of generations. This represents an unprecedented microbial evolutionary response, as reproductive fitness increases acquired in the selection environment are maintained after returning to the ancestral environment. Constitutive rate increases are accompanied by irreversible shifts in diel nitrogen fixation patterns, and increased activity of a potentially regulatory DNA methyltransferase enzyme. High CO2-selected cell lines also exhibit increased phosphorus-limited growth rates, suggesting a potential advantage for this keystone organism in a more nutrient-limited, acidified future ocean. PMID:26327191

  3. [Regulation of alternative CO{sub 2} fixation pathways in procaryotic and eucaryotic photosynthetic organisms]. Progress report

    SciTech Connect

    Not Available

    1992-12-31

    The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.

  4. Carboxysomal carbonic anhydrases: Structure and role in microbial CO2 fixation

    SciTech Connect

    Cannon, Gordon C.; Heinhorst, Sabine; Kerfeld, Cheryl A.

    2010-06-23

    Cyanobacteria and some chemoautotrophic bacteria are able to grow in environments with limiting CO2 concentrations by employing a CO2-concentrating mechanism (CCM) that allows them to accumulate inorganic carbon in their cytoplasm to concentrations several orders of magnitude higher than that on the outside. The final step of this process takes place in polyhedral protein microcompartments known as carboxysomes, which contain the majority of the CO2-fixing enzyme, RubisCO. The efficiency of CO2 fixation by the sequestered RubisCO is enhanced by co-localization with a specialized carbonic anhydrase that catalyzes dehydration of the cytoplasmic bicarbonate and ensures saturation of RubisCO with its substrate, CO2. There are two genetically distinct carboxysome types that differ in their protein composition and in the carbonic anhydrase(s) they employ. Here we review the existing information concerning the genomics, structure and enzymology of these uniquely adapted carbonic anhydrases, which are of fundamental importance in the global carbon cycle.

  5. PH-NEUTRAL CONCRETE FOR ATTACHED MICROALGAE AND ENHANCED CARBON DIOXIDE FIXATION - PHASE I

    SciTech Connect

    Kerry M. Dooley; F. Carl Knopf; Robert P. Gambrell

    1999-05-31

    The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SC-CO {sub 2})-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resistance) cement-based products. SC-CO{sub 2} can rapidly convert the calcium hydroxide in cured cement to calcium carbonate, which increases the density and unconfined compressive strength in the treated region. In cured concrete, this treated region is typically a several-mm thick layer (generally <{approx}5mm, unless treatment time is excessive). However, we have found that by treating the entire cement matrix with SC-CO{sub 2} as part of the curing process, we can carbonate it rapidly, regardless of the thickness. By ''rapidly'' we mean simultaneous carbonation/curing in < 5 ks even for large cement forms, compared to typical carbonation times of several days or even years at low pressures. Carbonation changes the pH in the treated region from {approx}13 to {approx}8, almost exactly compatible with seawater. Therefore the leaching rates from these cements is reduced. These cement improvements are directed to the development of strong but thin artificial reefs, to which can be attached microalgae used for the enhanced fixation of CO{sub 2}. It is shown below that attached microalgae, as algal beds or reefs, are more efficient for CO{sub 2} fixation by a factor of 20, compared to the open ocean on an area basis. We have performed preliminary tests of the pH-neutral cements of our invention for attachment of microalgae populations. We have found pH-neutral materials which attach microalgae readily. These include silica-enriched (pozzolanic) cements, blast-furnace slags and fly ash, which are also silica-rich. We have already developed technology to simultaneously foam, carbonate and cure the cements; this foaming process further increases cement surface areas for microalgae attachment, in some cases to >10 m{sup 2}/g internal surface area. This project involves a team of researchers with backgrounds in cement technology, supercritical fluid technology, materials science, oceanography, and wetland biogeochemistry.

  6. Genomic signatures of fifth autotrophic carbon assimilation pathway in bathypelagic Crenarchaeota.

    PubMed

    La Cono, Violetta; Smedile, Francesco; Ferrer, Manuel; Golyshin, Peter N; Giuliano, Laura; Yakimov, Michail M

    2010-09-01

    Marine Crenarchaeota, ubiquitous and abundant organisms in the oceans worldwide, remain metabolically uncharacterized, largely due to their low cultivability. Identification of candidate genes for bicarbonate fixation pathway in the Cenarchaeum symbiosum A was an initial step in understanding the physiology and ecology of marine Crenarchaeota. Recent cultivation and genome sequencing of obligate chemoautotrophic Nitrosopumilus maritimus SCM1 were a major breakthrough towards understanding of their functioning and provide a valuable model for experimental validation of genomic data. Here we present the identification of multiple key components of 3-hydroxipropionate/4-hydroxybutyrate cycle, the fifth pathway in carbon fixation, found in data sets of environmental sequences representing uncultivated superficial and bathypelagic Crenarchaeota from Sargasso sea (GOS data set) and KM3 (Mediterranean Sea) and ALOHA (Atlantic ocean) stations. These organisms are likely to use acetyl-CoA/propionyl-CoA carboxylase(s) as CO?-fixing enzyme(s) to form succinyl-CoA, from which one molecule of acetyl-CoA is regenerated via 4-hydroxybutyrate cleavage and another acetyl-CoA to be the pathway product. The genetic distinctiveness and matching sympatric abundance imply that marine crenarchaeal genotypes from the three different geographic sites share similar ecophysiological properties, and therefore may represent fundamental units of marine ecosystem functioning. To couple results of sequence comparison with the dark ocean primary production, dissolved inorganic carbon fixation rates were measured at KM3 Station (3000 m depth, Eastern Mediterranean Sea), i.e. at the same site and depth used for metagenomic library construction. PMID:21255356

  7. P700 Activity and Chlorophyll Content of Plants with Different Photosynthetic Carbon Dioxide Fixation Cycles 1

    PubMed Central

    Black, C. C.; Mayne, B. C.

    1970-01-01

    Representative plants containing either the reductive pentose phosphate cycle or the C4 dicarboxylic acid cycle of photosynthetic carbon dioxide fixation have distinctly different contents of P700 and chlorophylls a and b. With leaf extracts and isolated chloroplasts from C4 cycle plants, the mean value of the relative ratio of P700 to total chlorophyll was 1.83 and the mean value of the ratio of chlorophyll a to b was 3.89. The respective values in similar extracts and chloroplasts from pentose cycle plants are 1.2 and 2.78. It seems likely that these results are indicative of a more active Photosystem I or a different size photosynthetic unit in C4 cycle plants than in the reductve pentose phosphate cycle plants. PMID:16657384

  8. Creation of active sites by impregnation of carbon fibers: application to the fixation of hydrogen sulfide.

    PubMed

    Meljac, Laure; Perier-Camby, Laurent; Thomas, Gérard

    2004-06-01

    Activated carbon fibers, which exhibit high specific area and numerous active surface sites, constitute very powerful adsorbents and are widely used in filtration to eliminate pollutants from liquid or gaseous effluents. The fibers studied in this work are devoted to the filtration of gaseous effluent containing very small amounts (few vpm) of hydrogen sulfide. Preliminary experiments evidenced that these fibers weakly adsorb hydrogen sulfide. To improve their fixation capacity toward H(2)S the activated fibers are impregnated in an aqueous solution of potassium hydroxide. The impregnation treatment usually takes place before activation but in this work it occurs at room temperature after activation of the fibers. A further thermal treatment is performed to increase the efficiency of the system. The overall treatment leads to the creation of basic sites showing a great activity for H(2)S gas in the presence of water vapor. The mechanism has been established by a series of characterizations before, during, and after the different operation units. The KOH deposited after impregnation is carbonated into KHCO(3) at room temperature and then decomposed into K(2)CO(3) during the thermal treatment. K(2)CO(3) and H(2)S dissolve in a liquid aqueous solution formed on the fiber surface. Then carbonate ions and H(2)S molecules react together almost completely to yield HS(-) species. As a consequence the sorption capacities of hydrogen sulfide on the impregnated fibers are much higher, even for small hydrogen sulfide volume fractions. PMID:15120288

  9. The Majority of Free-Living Autotrophic Bacteria use the Reductive TCA Cycle for Carbon Fixation at Deep-Sea Hydrothermal Vents

    NASA Astrophysics Data System (ADS)

    Campbell, B. J.; Cary, C.

    2003-12-01

    Deep-sea hydrothermal vents support large micro and macroscopic communities, without the input of photosynthesis. Autotrophic production at these vents is based on hydrothermal vent fluid chemistry. Primary production has been thought to occur mainly via hydrogen sulfide oxidation through the Calvin-Benson pathway, as measured by the presence of Rubisco in endosymbionts of several invertebrate hosts. Recently, we characterized two fosmids from a large insert library of the epsilon Proteobacterial episymbionts of Alvinella pompejana. Both contained sequences encoding ATP citrate lyase, a key enzyme in the reverse TCA cycle, an alternate carbon dioxide fixation pathway. Previous investigators have demonstrated the dominance of the epsilon subdivision in the free-living bacterial communities at hydrothermal vents. Based on these results, our working hypothesis is: The rTCA cycle is the dominant pathway for carbon fixation in the free-living bacterial communities at hydrothermal vents. A selection of free-living bacterial communities from various geographic locations (9N, East Pacific Rise and Guaymas Basin) were screened for the presence, diversity and expression (via RT-PCR) of Rubisco (forms I and II) and ATP citrate lyase. Our results indicate that the ATP citrate lyase gene is diverse and is consistently expressed in several types of vent communities. The two forms of Rubisco are not consistently present or expressed in the same environments. These results indicate that chemoautotrophic production in the free-living bacterial communities at deep-sea hydrothermal vents is dominated by bacteria that utilize the rTCA cycle, and parallels the phylogenetic dominance of members of the epsilon subdivision of Proteobacteria.

  10. Induction of Photosynthetic Carbon Fixation in Anoxia Relies on Hydrogenase Activity and Proton-Gradient Regulation-Like1-Mediated Cyclic Electron Flow in Chlamydomonas reinhardtii.

    PubMed

    Godaux, Damien; Bailleul, Benjamin; Berne, Nicolas; Cardol, Pierre

    2015-06-01

    The model green microalga Chlamydomonas reinhardtii is frequently subject to periods of dark and anoxia in its natural environment. Here, by resorting to mutants defective in the maturation of the chloroplastic oxygen-sensitive hydrogenases or in Proton-Gradient Regulation-Like1 (PGRL1)-dependent cyclic electron flow around photosystem I (PSI-CEF), we demonstrate the sequential contribution of these alternative electron flows (AEFs) in the reactivation of photosynthetic carbon fixation during a shift from dark anoxia to light. At light onset, hydrogenase activity sustains a linear electron flow from photosystem II, which is followed by a transient PSI-CEF in the wild type. By promoting ATP synthesis without net generation of photosynthetic reductants, the two AEF are critical for restoration of the capacity for carbon dioxide fixation in the light. Our data also suggest that the decrease in hydrogen evolution with time of illumination might be due to competition for reduced ferredoxins between ferredoxin-NADP(+) oxidoreductase and hydrogenases, rather than due to the sensitivity of hydrogenase activity to oxygen. Finally, the absence of the two alternative pathways in a double mutant pgrl1 hydrogenase maturation factor G-2 is detrimental for photosynthesis and growth and cannot be compensated by any other AEF or anoxic metabolic responses. This highlights the role of hydrogenase activity and PSI-CEF in the ecological success of microalgae in low-oxygen environments. PMID:25931521

  11. High cell-specific rates of nitrogen and carbon fixation by the cyanobacterium Aphanizomenon sp. at low temperatures in the Baltic Sea.

    PubMed

    Svedén, Jennie B; Adam, Birgit; Walve, Jakob; Nahar, Nurun; Musat, Niculina; Lavik, Gaute; Whitehouse, Martin J; Kuypers, Marcel M M; Ploug, Helle

    2015-12-01

    Aphanizomenon is a widespread genus of nitrogen (N2)-fixing cyanobacteria in lakes and estuaries, accounting for a large fraction of the summer N2-fixation in the Baltic Sea. However, information about its cell-specific carbon (C)- and N2-fixation rates in the early growth season has not previously been reported. We combined various methods to study N2-fixation, photosynthesis and respiration in field-sampled Baltic Sea Aphanizomenon sp. during early summer at 10°C. Stable isotope incubations at in situ light intensities during 24 h combined with cell-specific secondary ion mass spectrometry showed an average net N2-fixation rate of 55 fmol N cell(-1) day(-1). Dark net N2-fixation rates over a course of 12 h were 20% of those measured in light. C-fixation, but not N2-fixation, was inhibited by high ambient light intensities during daytime. Consequently, the C:N fixation ratio varied substantially over the diel cycle. C- and N2-fixation rates were comparable to those reported for Aphanizomenon sp. in August at 19°C, using the same methods. High respiration rates (23% of gross photosynthesis) were measured with (14)C-incubations and O2-microsensors, and presumably reflect the energy needed for high N2-fixation rates. Hence, Aphanizomenon sp. is an important contributor to N2-fixation at low in situ temperatures in the early growth season. PMID:26511856

  12. Volatile organic compound emissions in relation to plant carbon fixation and the terrestrial carbon budget

    NASA Astrophysics Data System (ADS)

    Kesselmeier, Jürgen; Ciccioli, Paolo; Kuhn, Uwe; Stefani, Paolo; Biesenthal, Thomas; Rottenberger, Stefanie; Wolf, Annette; Vitullo, Marina; Valentini, Ricardo; Nobre, Antonio; Kabat, Pavel; Andreae, Meinrat O.

    2002-12-01

    A substantial amount of carbon is emitted by terrestrial vegetation as biogenic volatile organic compounds (VOC), which contributes to the oxidative capacity of the atmosphere, to particle production and to the carbon cycle. With regard to the carbon budget of the terrestrial biosphere, a release of these carbon compounds is regarded as a loss of photosynthetically fixed carbon. The significance of this loss for the regional and global carbon cycles is controversial. We estimate the amount of VOC carbon emitted in relation to the CO2 taken up, based on our own enclosure and micrometeorological flux measurements of VOC emissions and CO2 exchange within the Mediterranean area and the tropical rainforest in Amazonia and on literature data. While VOC flux estimates are small in relation to net primary productivity and gross primary productivity, the amount of carbon lost as VOC emissions can be highly significant relative to net ecosystem productivity. In fact, VOC losses are of the same order of magnitude as net biome productivity. Although we must assume that large amounts of these reemissions are recycled within the biosphere, a substantial part can be assumed to be lost into longer-lived oxidation products that are lost from the terrestrial biosphere by transport. However, our current knowledge does not allow a reliable estimation of this carbon loss.

  13. Phytoplankton Productivity in an Arctic Fjord (West Greenland): Estimating Electron Requirements for Carbon Fixation and Oxygen Production

    PubMed Central

    Hancke, Kasper; Dalsgaard, Tage; Sejr, Mikael Kristian; Markager, Stiig; Glud, Ronnie Nøhr

    2015-01-01

    Accurate quantification of pelagic primary production is essential for quantifying the marine carbon turnover and the energy supply to the food web. Knowing the electron requirement (?) for carbon (C) fixation (?C) and oxygen (O2) production (?O2), variable fluorescence has the potential to quantify primary production in microalgae, and hereby increasing spatial and temporal resolution of measurements compared to traditional methods. Here we quantify ?C and ?O2 through measures of Pulse Amplitude Modulated (PAM) fluorometry, C fixation and O2 production in an Arctic fjord (Godthåbsfjorden, W Greenland). Through short- (2h) and long-term (24h) experiments, rates of electron transfer (ETRPSII), C fixation and/or O2 production were quantified and compared. Absolute rates of ETR were derived by accounting for Photosystem II light absorption and spectral light composition. Two-hour incubations revealed a linear relationship between ETRPSII and gross 14C fixation (R2 = 0.81) during light-limited photosynthesis, giving a ?C of 7.6 ± 0.6 (mean ± S.E.) mol é (mol C)?1. Diel net rates also demonstrated a linear relationship between ETRPSII and C fixation giving a ?C of 11.2 ± 1.3 mol é (mol C)?1 (R2 = 0.86). For net O2 production the electron requirement was lower than for net C fixation giving 6.5 ± 0.9 mol é (mol O2)?1 (R2 = 0.94). This, however, still is an electron requirement 1.6 times higher than the theoretical minimum for O2 production [i.e. 4 mol é (mol O2)?1]. The discrepancy is explained by respiratory activity and non-photochemical electron requirements and the variability is discussed. In conclusion, the bio-optical method and derived electron requirement support conversion of ETR to units of C or O2, paving the road for improved spatial and temporal resolution of primary production estimates. PMID:26218096

  14. Carbon and nitrogen fixation differ between successional stages of biological soil crusts in the Colorado Plateau and Chihuahuan Desert

    USGS Publications Warehouse

    Housman, D.C.; Powers, H.H.; Collins, A.D.; Belnap, J.

    2006-01-01

    Biological soil crusts (cyanobacteria, mosses and lichens collectively) perform essential ecosystem services, including carbon (C) and nitrogen (N) fixation. Climate and land-use change are converting later successional soil crusts to early successional soil crusts with lower C and N fixation rates. To quantify the effect of such conversions on C and N dynamics in desert ecosystems we seasonally measured diurnal fixation rates in different biological soil crusts. We classified plots on the Colorado Plateau (Canyonlands) and Chihuahuan Desert (Jornada) as early (Microcoleus) or later successional (Nostoc/Scytonema or Placidium/Collema) and measured photosynthesis (Pn), nitrogenase activity (NA), and chlorophyll fluorescence (Fv/Fm) on metabolically active (moist) soil crusts. Later successional crusts typically had greater Pn, averaging 1.2-1.3-fold higher daily C fixation in Canyonlands and 2.4-2.8-fold higher in the Jornada. Later successional crusts also had greater NA, averaging 1.3-7.5-fold higher daily N fixation in Canyonlands and 1.3-25.0-fold higher in the Jornada. Mean daily Fv/Fm was also greater in later successional Canyonlands crusts during winter, and Jornada crusts during all seasons except summer. Together these findings indicate conversion of soil crusts back to early successional stages results in large reductions of C and N inputs into these ecosystems.

  15. Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5?-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

    PubMed Central

    Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

    2013-01-01

    Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5?- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae. PMID:23585853

  16. Insights into hydrogen bond donor promoted fixation of carbon dioxide with epoxides catalyzed by ionic liquids.

    PubMed

    Liu, Mengshuai; Gao, Kunqi; Liang, Lin; Wang, Fangxiao; Shi, Lei; Sheng, Li; Sun, Jianmin

    2015-02-28

    Catalytic coupling of carbon dioxide with epoxides to obtain cyclic carbonates is an important reaction that has been receiving renewed interest. In this contribution, the cycloaddition reaction in the presence of various hydrogen bond donors (HBDs) catalyzed by hydroxyl/carboxyl task-specific ionic liquids (ILs) is studied in detail. It was found that the activity of ILs could be significantly enhanced in the presence of ethylene glycol (EG), and EG/HEBimBr were the most efficient catalysts for the CO2 cycloaddition to propylene oxide. Moreover, the binary catalysts were also efficiently versatile for the CO2 cycloaddition to less active epoxides such as styrene oxide and cyclohexene oxide. Besides, the minimum energy paths for this hydrogen bond-promoted catalytic reaction were calculated using the density functional theory (DFT) method. The DFT results suggested that the ring-closing reaction was the rate-determining step in the HEBimBr-catalyzed cycloaddition reaction but the EG addition could remarkably reduce its energy barrier as the formation of a hydrogen bond between EG and the oxygen atom of epoxides led this process along the standard SN2 mechanism. As a result, the ring-opening reaction became the rate-determining step in the EG/HEBimBr-catalyzed cycloaddition reaction. The work reported herein helped the understanding and design of catalysts for efficient fixation of CO2 to epoxides via hydrogen bond activation. PMID:25639733

  17. Carbon-Fixation Rates and Associated Microbial Communities Residing in Arid and Ephemerally Wet Antarctic Dry Valley Soils

    PubMed Central

    Niederberger, Thomas D.; Sohm, Jill A.; Gunderson, Troy; Tirindelli, Joëlle; Capone, Douglas G.; Carpenter, Edward J.; Cary, S. Craig

    2015-01-01

    Carbon-fixation is a critical process in severely oligotrophic Antarctic Dry Valley (DV) soils and may represent the major source of carbon in these arid environments. However, rates of C-fixation in DVs are currently unknown and the microorganisms responsible for these activities unidentified. In this study, C-fixation rates measured in the bulk arid soils (<5% moisture) ranged from below detection limits to ?12 nmol C/cc/h. Rates in ephemerally wet soils ranged from ?20 to 750 nmol C/cc/h, equating to turnover rates of ?7–140 days, with lower rates in stream-associated soils as compared to lake-associated soils. Sequencing of the large subunit of RuBisCO (cbbL) in these soils identified green-type sequences dominated by the 1B cyanobacterial phylotype in both arid and wet soils including the RNA fraction of the wet soil. Red-type cbbL genes were dominated by 1C actinobacterial phylotypes in arid soils, with wetted soils containing nearly equal proportions of 1C (actinobacterial and proteobacterial signatures) and 1D (algal) phylotypes. Complementary 16S rRNA and 18S rRNA gene sequencing also revealed distinct differences in community structure between biotopes. This study is the first of its kind to examine C-fixation rates in DV soils and the microorganisms potentially responsible for these activities. PMID:26696969

  18. Carbon-Fixation Rates and Associated Microbial Communities Residing in Arid and Ephemerally Wet Antarctic Dry Valley Soils.

    PubMed

    Niederberger, Thomas D; Sohm, Jill A; Gunderson, Troy; Tirindelli, Joëlle; Capone, Douglas G; Carpenter, Edward J; Cary, S Craig

    2015-01-01

    Carbon-fixation is a critical process in severely oligotrophic Antarctic Dry Valley (DV) soils and may represent the major source of carbon in these arid environments. However, rates of C-fixation in DVs are currently unknown and the microorganisms responsible for these activities unidentified. In this study, C-fixation rates measured in the bulk arid soils (<5% moisture) ranged from below detection limits to ?12 nmol C/cc/h. Rates in ephemerally wet soils ranged from ?20 to 750 nmol C/cc/h, equating to turnover rates of ?7-140 days, with lower rates in stream-associated soils as compared to lake-associated soils. Sequencing of the large subunit of RuBisCO (cbbL) in these soils identified green-type sequences dominated by the 1B cyanobacterial phylotype in both arid and wet soils including the RNA fraction of the wet soil. Red-type cbbL genes were dominated by 1C actinobacterial phylotypes in arid soils, with wetted soils containing nearly equal proportions of 1C (actinobacterial and proteobacterial signatures) and 1D (algal) phylotypes. Complementary 16S rRNA and 18S rRNA gene sequencing also revealed distinct differences in community structure between biotopes. This study is the first of its kind to examine C-fixation rates in DV soils and the microorganisms potentially responsible for these activities. PMID:26696969

  19. Evolution and Adaptation of Phytoplankton Photosynthetic Pathways to perturbations of the geological carbon system

    NASA Astrophysics Data System (ADS)

    Rickaby, R. E.; Young, J. N.; Hermoso, M.; Heureux, A.; McCLelland, H.; Lee, R.; Eason Hubbard, M.

    2012-12-01

    The ocean and atmosphere carbon system has varied greatly over geological history both in response to initial evolutionary innovation, and as a driver of adaptive change. Here we establish that positive selection in Rubisco, the most abundant enzyme on the Earth responsible for all photosynthetic carbon fixation, occurred early in Earth's history, and basal to the radiation of the modern marine algal groups. Our signals of positive selection appear to be triggered by changing intracellular concentrations of carbon dioxide (CO2) due to the emergence of carbon concentrating mechanisms between 1.56 and 0.41 Ba in response to declining atmospheric CO2 . We contend that, at least in terms of carbon, phytoplankton generally were well poised to manage subsequent abrupt carbon cycle perturbations. The physiological pathways for optimising carbon acquisition across a wide range of ambient carbon dioxide concentrations had already been established and were genetically widespread across open ocean phytoplankton groups. We will further investigate some case studies from the Mesozoic and Cenozoic abrupt carbon cycle excursions using isotopic tools to probe the community photosynthetic response and demonstrate the flexibility of phytoplankton photosynthesis in the face of major perturbations. In particular, an unprecedented resolution record across the Toarcian (Early Jurassic) carbon isotope excursion in the Paris Basin reveals a selection and evolution towards a community reliant solely on diffusive carbon dioxide supply for photosynthesis at the height of the excursion at 1500-2500 ppm CO2. The continued flourishing of the phytoplankton biological pump throughout this excursion was able to remove the excess carbon injected into the water column in less than 45 kyrs.

  20. Fixation stability dictates the differentiation pathway of periosteal progenitor cells in fracture repair.

    PubMed

    Hagiwara, Yusuke; Dyment, Nathaniel A; Jiang, Xi; Jiang Ping, Huang; Ackert-Bicknell, Cheryl; Adams, Douglas J; Rowe, David W

    2015-07-01

    This study compared fracture repair stabilized by intramedullary pin (IMP) or external fixation (EF) in GFP reporter mice. A modified IMP was used as control while EF utilized six needles inserted transversely through the tibia and into a segment of a syringe barrel. X-rays taken at days 0, 14, and 35 showed that IMP resulted in significant three-dimensional deformity with a large callus while EF showed minimal deformity and callus formation. Cryohistological analysis of IMP at day 14 confirmed a large ColX-RFPchry+ callus surrounded by woven bone (Col3.6-GFPcyan) and TRAP+ osteoclasts with mature bone (hOC-GFPtpz) at the base. By day 35, cartilaginous components had been resorbed and an outer cortical shell (OCS) showed evidence of inward modeling. In contrast, the EF at day 14 showed no evidence of cartilage formation. Instead, periosteal-derived osteoblasts (Col3.6-GFPcyan) entered the fracture cleft and formed woven bone that spanned the marrow space. By day 35, mature bone had formed that was contiguous with the opposing cortical bone. Fracture site stability greatly affects the cellular response during repair and must be considered in the preclinical models that test therapies for improving fracture healing. PMID:25639792

  1. Biology of a widespread uncultivated archaeon that contributes to carbon fixation in the subsurface.

    PubMed

    Probst, Alexander J; Weinmaier, Thomas; Raymann, Kasie; Perras, Alexandra; Emerson, Joanne B; Rattei, Thomas; Wanner, Gerhard; Klingl, Andreas; Berg, Ivan A; Yoshinaga, Marcos; Viehweger, Bernhard; Hinrichs, Kai-Uwe; Thomas, Brian C; Meck, Sandra; Auerbach, Anna K; Heise, Matthias; Schintlmeister, Arno; Schmid, Markus; Wagner, Michael; Gribaldo, Simonetta; Banfield, Jillian F; Moissl-Eichinger, Christine

    2014-01-01

    Subsurface microbial life contributes significantly to biogeochemical cycling, yet it remains largely uncharacterized, especially its archaeal members. This 'microbial dark matter' has been explored by recent studies that were, however, mostly based on DNA sequence information only. Here, we use diverse techniques including ultrastuctural analyses to link genomics to biology for the SM1 Euryarchaeon lineage, an uncultivated group of subsurface archaea. Phylogenomic analyses reveal this lineage to belong to a widespread group of archaea that we propose to classify as a new euryarchaeal order ('Candidatus Altiarchaeales'). The representative, double-membraned species 'Candidatus Altiarchaeum hamiconexum' has an autotrophic metabolism that uses a not-yet-reported Factor420-free reductive acetyl-CoA pathway, confirmed by stable carbon isotopic measurements of archaeal lipids. Our results indicate that this lineage has evolved specific metabolic and structural features like nano-grappling hooks empowering this widely distributed archaeon to predominate anaerobic groundwater, where it may represent an important carbon dioxide sink. PMID:25425419

  2. Carbon Dioxide Fixation in the Light and in the Dark by Isolated Spinach Chloroplasts 1

    PubMed Central

    Avron, Mordhay; Gibbs, Martin

    1974-01-01

    Factors affecting CO2 fixation in the spinach (Spinacia oleracea) chloroplast were investigated. Free magnesium ions are shown to be highly inhibitory for photosynthetic CO2 fixation in isolated intact spinach chloroplasts. The pH optimum for CO2 fixation is about 8.5 but is dependent upon the reaction medium. Conditions are defined under which chloroplasts illuminated in the absence of CO2 accumulate ribulose 1,5-diphosphate, and fix CO2 in a subsequent dark period when high magnesium ion concentrations are provided. The regulation of photosynthetic CO2 assimilation by these factors is discussed. PMID:16658664

  3. Pathways of anthropogenic carbon subduction in the global ocean

    NASA Astrophysics Data System (ADS)

    Bopp, L.; Lévy, M.; Resplandy, L.; Sallée, J. B.

    2015-08-01

    The oceanic uptake of anthropogenic carbon is tightly coupled to carbon subduction, i.e., the physical carbon transfer from the well-ventilated surface ocean to its interior. Despite their importance, pathways of anthropogenic carbon subduction are poorly understood. Here we use an ocean carbon cycle model to quantify the mechanisms controlling this subduction. Over the last decade, 90% of the oceanic anthropogenic carbon is subducted at the base of the seasonally varying mixed layer. Vertical diffusion is the primary mechanism of this subduction (contributing 65% of total subduction), despite very low local fluxes. In contrast, advection drives the spatial patterns of subduction, with high positive and negative local fluxes. Our results suggest that vertical diffusion could have a leading role in anthropogenic carbon subduction, which highlights the need for an accurate estimate of vertical diffusion intensity in the upper ocean to further constrain estimates of the future evolution of carbon uptake.

  4. Diurnal variation in the coupling of photosynthetic electron transport and carbon fixation in iron-limited phytoplankton in the NE subarctic Pacific

    NASA Astrophysics Data System (ADS)

    Schuback, N.; Flecken, M.; Maldonado, M. T.; Tortell, P. D.

    2015-10-01

    Active chlorophyll a fluorescence approaches, including fast repetition rate fluorometry (FRRF), have the potential to provide estimates of phytoplankton primary productivity at unprecedented spatial and temporal resolution. FRRF-derived productivity rates are based on estimates of charge separation at PSII (ETRRCII), which must be converted into ecologically relevant units of carbon fixation. Understanding sources of variability in the coupling of ETRRCII and carbon fixation provides physiological insight into phytoplankton photosynthesis, and is critical for the application of FRRF as a primary productivity measurement tool. In the present study, we simultaneously measured phytoplankton carbon fixation and ETRRCII in the iron-limited NE subarctic Pacific, over the course of a diurnal cycle. We show that rates of ETRRCII are closely tied to the diurnal cycle in light availability, whereas rates of carbon fixation appear to be influenced by endogenous changes in metabolic energy allocation under iron-limited conditions. Unsynchronized diurnal oscillations of the two rates led to 3.5 fold changes in the conversion factor coupling ETRRCII and carbon fixation (?e:C / nPSII). Consequently, diurnal variability in phytoplankton carbon fixation cannot be adequately captured with FRRF approaches if a constant conversion factor is applied. Utilizing several auxiliary photophysiological measurements, we observed that a high conversion factor is associated with conditions of excess light, and correlates with the expression of non-photochemical quenching (NPQ) in the pigment antenna, as derived from FRRF measurements. The observed correlation between NPQ and the conversion factor ?e:C / nPSII has the potential to improve estimates of phytoplankton carbon fixation rates from FRRF measurements alone.

  5. Enhancing Carbon Fixation by Metabolic Engineering: A Model System of Complex Network Modulation

    SciTech Connect

    Dr. Gregory Stephanopoulos

    2008-04-10

    In the first two years of this research we focused on the development of a DNA microarray for transcriptional studies in the photosynthetic organism Synechocystis and the elucidation of the metabolic pathway for biopolymer synthesis in this organism. In addition we also advanced the molecular biological tools for metabolic engineering of biopolymer synthesis in Synechocystis and initiated a series of physiological studies for the elucidation of the carbon fixing pathways and basic central carbon metabolism of these organisms. During the last two-year period we focused our attention on the continuation and completion of the last task, namely, the development of tools for basic investigations of the physiology of these cells through, primarily, the determination of their metabolic fluxes. The reason for this decision lies in the importance of fluxes as key indicators of physiology and the high level of information content they carry in terms of identifying rate limiting steps in a metabolic pathway. While flux determination is a well-advanced subject for heterotrophic organisms, for the case of autotrophic bacteria, like Synechocystis, some special challenges had to be overcome. These challenges stem mostly from the fact that if one uses {sup 13}C labeled CO{sub 2} for flux determination, the {sup 13}C label will mark, at steady state, all carbon atoms of all cellular metabolites, thus eliminating the necessary differentiation required for flux determination. This peculiarity of autotrophic organisms makes it imperative to carry out flux determination under transient conditions, something that had not been accomplished before. We are pleased to report that we have solved this problem and we are now able to determine fluxes in photosynthetic organisms from stable isotope labeling experiments followed by measurements of label enrichment in cellular metabolites using Gas Chromatography-Mass Spectrometry. We have conducted extensive simulations to test the method and also are presently validating it experimentally using data generated in collaboration with a research group at Purdue University. As result of these studies we can now determine, for the first time, fluxes in photosynthetic organisms and, eventually, in plants.

  6. Simultaneous Quantification of Active Carbon- and Nitrogen-Fixing Communities and Estimation of Fixation Rates Using Fluorescence In Situ Hybridization and Flow Cytometry

    PubMed Central

    Shepard, Alicia K.; Raes, Eric J.; Waite, Anya M.; Quigg, Antonietta

    2014-01-01

    Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and 14C/15N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

  7. Engineering the Cyanobacterial Carbon Concentrating Mechanism for Enhanced CO2 Capture and Fixation

    SciTech Connect

    Sandh, Gustaf; Cai, Fei; Shih, Patrick; Kinney, James; Axen, Seth; Salmeen, Annette; Zarzycki, Jan; Sutter, Markus; Kerfeld, Cheryl

    2011-06-02

    In cyanobacteria CO2 fixation is localized in a special proteinaceous organelle, the carboxysome. The CO2 fixation enzymes are encapsulated by a selectively permeable protein shell. By structurally and functionally characterizing subunits of the carboxysome shell and the encapsulated proteins, we hope to understand what regulates the shape, assembly and permeability of the shell, as well as the targeting mechanism and organization of the encapsulated proteins. This knowledge will be used to enhance CO2 fixation in both cyanobacteria and plants through synthetic biology. The same strategy can also serve as a template for the production of modular synthetic bacterial organelles. Our research is conducted using a variety of techniques such as genomic sequencing and analysis, transcriptional regulation, DNA synthesis, synthetic biology, protein crystallization, Small Angle X-ray Scattering (SAXS), protein-protein interaction assays and phenotypic characterization using various types of cellular imaging, e.g. fluorescence microscopy, Transmission Electron Microscopy (TEM), and Soft X-ray Tomography (SXT).

  8. Phosphoketolase pathway engineering for carbon-efficient biocatalysis.

    PubMed

    Henard, Calvin Andrew; Freed, Emily Frances; Guarnieri, Michael Thomas

    2015-12-01

    Recent advances in metabolic engineering have facilitated the development of microbial biocatalysts capable of producing an array of bio-products, ranging from fuels to drug molecules. These bio-products are commonly generated through an acetyl-CoA intermediate, which serves as a key precursor in the biological conversion of carbon substrates. Conventional biocatalytic upgrading strategies proceeding through this route are limited by low carbon efficiencies, in large part due to carbon losses associated with pyruvate decarboxylation to acetyl-CoA. Bypass of pyruvate decarboxylation offers a means to dramatically enhance carbon yields and, in turn, bioprocess economics. Herein, we discuss recent advances and prospects for employing the phosphoketolase pathway for direct biosynthesis of acetyl-CoA from carbon substrates, and phosphoketolase-based metabolic engineering strategies for carbon efficient biocatalysis. PMID:26360872

  9. Ammonia fixation by humic substances: A nitrogen-15 and carbon-13 NMR study

    USGS Publications Warehouse

    Thorn, K.A.; Mikita, M.A.

    1992-01-01

    The process of ammonia fixation has been studied in three well characterized and structurally diverse fulvic and humic acid samples. The Suwannee River fulvic acid, and the IHSS peat and leonardite humic acids, were reacted with 15N-labelled ammonium hydroxide, and analyzed by liquid phase 15N NMR spectrometry. Elemental analyses and liquid phase 13C NMR spectra also were recorded on the samples before and after reaction with ammonium hydroxide. The largest increase in percent nitrogen occurred with the Suwannee River fulvic acid, which had a nitrogen content of 0.88% before fixation and 3.17% after fixation. The 15N NMR spectra revealed that ammonia reacted similarly with all three samples, indicating that the functional groups which react with ammonia exist in structural configurations common to all three samples. The majority of nitrogcn incorporated into the samples appears to be in the form of indole and pyrrole nitrogen, followed by pyridine, pyrazine, amide and aminohydroquinone nitrogen. Chemical changes in the individual samples upon fixation could not be discerned from the 13C NMR spectra.

  10. CO2 Fixation, Lipid Production, and Power Generation by a Novel Air-Lift-Type Microbial Carbon Capture Cell System.

    PubMed

    Hu, Xia; Liu, Baojun; Zhou, Jiti; Jin, Ruofei; Qiao, Sen; Liu, Guangfei

    2015-09-01

    An air-lift-type microbial carbon capture cell (ALMCC) was constructed for the first time by using an air-lift-type photobioreactor as the cathode chamber. The performance of ALMCC in fixing high concentration of CO2, producing energy (power and biodiesel), and removing COD together with nutrients was investigated and compared with the traditional microbial carbon capture cell (MCC) and air-lift-type photobioreactor (ALP). The ALMCC system produced a maximum power density of 972.5 mW·m(-3) and removed 86.69% of COD, 70.52% of ammonium nitrogen, and 69.24% of phosphorus, which indicate that ALMCC performed better than MCC in terms of power generation and wastewater treatment efficiency. Besides, ALMCC demonstrated 9.98- and 1.88-fold increases over ALP and MCC in the CO2 fixation rate, respectively. Similarly, the ALMCC significantly presented a higher lipid productivity compared to those control reactors. More importantly, the preliminary analysis of energy balance suggested that the net energy of the ALMCC system was significantly superior to other systems and could theoretically produce enough energy to cover its consumption. In this work, the established ALMCC system simultaneously achieved the high level of CO2 fixation, energy recycle, and municipal wastewater treatment effectively and efficiently. PMID:26270956

  11. Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use

    SciTech Connect

    Kleiner, Manuel; Wentrop, C.; Lott, C.; Teeling, Hanno; Wetzel, Silke; Young, Jacque C; Chang, Y.; Shah, Manesh B; Verberkmoes, Nathan C; Zarzycki, Jan; Fuchs, Georg; Markert, Stephanie; Hempel, Kristina

    2012-01-01

    Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such as sulfide and CO2. Remarkably little is known about the physiological strategies that enable chemosynthetic symbioses to colonize oligotrophic environments. In this study, we used metaproteomics and metabolomics to investigate the intricate network of metabolic interactions in the chemosynthetic association between Olavius algarvensis, a gutless marine worm, and its bacterial symbionts. We propose novel pathways for coping with energy and nutrient limitation, some of which may be widespread in both free-living and symbiotic bacteria. These include (i) a pathway for symbiont assimilation of the host waste products acetate, propionate, succinate and malate, (ii) the potential use of carbon monoxide as an energy source, a substrate previously not known to play a role in marine invertebrate symbioses, (iii) the potential use of hydrogen as an energy source, (iv) the strong expression of high affinity uptake transporters, and (v) novel energy efficient steps in CO2 fixation and sulfate reduction. The high expression of proteins involved in pathways for energy and carbon uptake and conservation in the O. algarvensis symbiosis indicates that the oligotrophic nature of its environment exerted a strong selective pressure in shaping these associations.

  12. A novel operon encoding formaldehyde fixation: the ribulose monophosphate pathway in the gram-positive facultative methylotrophic bacterium Mycobacterium gastri MB19.

    PubMed

    Mitsui, R; Sakai, Y; Yasueda, H; Kato, N

    2000-02-01

    A 4.2-kb PstI fragment harboring the gene cluster of the ribulose monophosphate (RuMP) pathway for formaldehyde fixation was identified in the chromosome of a gram-positive, facultative methylotroph, Mycobacterium gastri MB19, by using the coding region of 3-hexulose-6-phosphate synthase (HPS) as the hybridization probe. The PstI fragment contained three complete open reading frames (ORFs) which encoded from the 5' end, a DNA-binding regulatory protein (rmpR), 6-phospho-3-hexuloisomerase (PHI; rmpB), and HPS (rmpA). Sequence analysis suggested that rmpA and rmpB constitute an operon, and Northern blot analysis of RNA extracted from bacteria grown under various conditions suggested that the expression of the two genes is similarly regulated at the transcriptional level. A similarity search revealed that the proteins encoded by rmpA and rmpB in M. gastri MB19 show high similarity to the unidentified proteins of nonmethylotrophic prokaryotes, including bacteria and anaerobic archaea. The clusters in the phylogenetic tree of the HPS protein of M. gastri MB19 and those in the phylogenetic tree of the PHI protein were nearly identical, which implies that these two formaldehyde-fixing genes evolved as a pair. These findings give new insight into the acquisition of the formaldehyde fixation pathway during the evolution of diverse microorganisms. PMID:10648518

  13. A Novel Operon Encoding Formaldehyde Fixation: the Ribulose Monophosphate Pathway in the Gram-Positive Facultative Methylotrophic Bacterium Mycobacterium gastri MB19

    PubMed Central

    Mitsui, Ryoji; Sakai, Yasuyoshi; Yasueda, Hisashi; Kato, Nobuo

    2000-01-01

    A 4.2-kb PstI fragment harboring the gene cluster of the ribulose monophosphate (RuMP) pathway for formaldehyde fixation was identified in the chromosome of a gram-positive, facultative methylotroph, Mycobacterium gastri MB19, by using the coding region of 3-hexulose-6-phosphate synthase (HPS) as the hybridization probe. The PstI fragment contained three complete open reading frames (ORFs) which encoded from the 5? end, a DNA-binding regulatory protein (rmpR), 6-phospho-3-hexuloisomerase (PHI; rmpB), and HPS (rmpA). Sequence analysis suggested that rmpA and rmpB constitute an operon, and Northern blot analysis of RNA extracted from bacteria grown under various conditions suggested that the expression of the two genes is similarly regulated at the transcriptional level. A similarity search revealed that the proteins encoded by rmpA and rmpB in M. gastri MB19 show high similarity to the unidentified proteins of nonmethylotrophic prokaryotes, including bacteria and anaerobic archaea. The clusters in the phylogenetic tree of the HPS protein of M. gastri MB19 and those in the phylogenetic tree of the PHI protein were nearly identical, which implies that these two formaldehyde-fixing genes evolved as a pair. These findings give new insight into the acquisition of the formaldehyde fixation pathway during the evolution of diverse microorganisms. PMID:10648518

  14. Photosynthetic carbon metabolism in seagrasses C-labeling evidence for the c(3) pathway.

    PubMed

    Andrews, T J; Abel, K M

    1979-04-01

    The delta(13)C values of several seagrasses were considerably less negative than those of terrestrial C(3) plants and tended toward those of terrestrial C(4) plants. However, for Thalassia hemprichii (Ehrenb.) Aschers and Halophila spinulosa (R. Br.) Aschers, phosphoglycerate and other C(3) cycle intermediates predominated among the early labeled products of photosynthesis in (14)C-labeled seawater (more than 90% at the earliest times) and the labeling pattern at longer times was brought about by the operation of the C(3) pathway. Malate and aspartate together accounted for only a minor fraction of the total fixed label at all times and the kinetic data of this labeling were not at all consistent with these compounds being early intermediates in seagrass photosynthesis. Pulse-chase (14)C-labeling studies further substantiated these conclusions. Significant labeling of photorespiratory intermediates was observed in all experiments. The kinetics of total fixation of label during some steady-state and pulse-chase experiments suggested that there may be an intermediate pool of inorganic carbon of variable size closely associated with the leaves, either externally or internally. Such a pool may be one cause for the C(4)-like carbon isotope ratios of seagrasses. PMID:16660784

  15. Carbon mineralization pathways and bioturbation in coastal Brazilian sediments

    PubMed Central

    Quintana, Cintia O.; Shimabukuro, Maurício; Pereira, Camila O.; Alves, Betina G. R.; Moraes, Paula C.; Valdemarsen, Thomas; Kristensen, Erik; Sumida, Paulo Y. G.

    2015-01-01

    Carbon mineralization processes and their dependence on environmental conditions (e.g. through macrobenthic bioturbation) have been widely studied in temperate coastal sediments, but almost nothing is known about these processes in subtropical coastal sediments. This study investigated pathways of organic carbon mineralization and associated effects of macrobenthic bioturbation in winter and summer (September 2012 and February 2014) at the SE Brazilian coast. Iron reduction (FeR) was responsible for 73–81% of total microbial carbon mineralization in September 2012 and 32–61% in February 2014. Similar high rates of FeR have only been documented a few times in coastal sediments and can be sustained by the presence of large bioturbators. Denitrification accounted for 5–27% of total microbial carbon mineralization while no SO42? reduction was detected in any season. Redox profiles suggested that conditions were less reduced in February 2014 than in September 2012, probably associated with low reactivity of the organic matter, higher rates of aerobic respiration and bioirrigation by the higher density of small-macrofauna. Bioturbation by small macrofauna may maintain the sediment oxidized in summer, while large-sized species stimulate the reoxidation of reduced compounds throughout the year. Therefore, bioturbation seems to have an important role modulating the pathways of carbon mineralization in the area. PMID:26525137

  16. Role of Intracellular Carbon Metabolism Pathways in Shigella flexneri Virulence

    PubMed Central

    Waligora, E. A.; Fisher, C. R.; Hanovice, N. J.; Rodou, A.; Wyckoff, E. E.

    2014-01-01

    Shigella flexneri, which replicates in the cytoplasm of intestinal epithelial cells, can use the Embden-Meyerhof-Parnas, Entner-Doudoroff, or pentose phosphate pathway for glycolytic carbon metabolism. To determine which of these pathways is used by intracellular S. flexneri, mutants were constructed and tested in a plaque assay for the ability to invade, replicate intracellularly, and spread to adjacent epithelial cells. Mutants blocked in the Embden-Meyerhof-Parnas pathway (pfkAB and pykAF mutants) invaded the cells but formed very small plaques. Loss of the Entner-Doudoroff pathway gene eda resulted in small plaques, but the double eda edd mutant formed normal-size plaques. This suggested that the plaque defect of the eda mutant was due to buildup of the toxic intermediate 2-keto-3-deoxy-6-phosphogluconic acid rather than a specific requirement for this pathway. Loss of the pentose phosphate pathway had no effect on plaque formation, indicating that it is not critical for intracellular S. flexneri. Supplementation of the epithelial cell culture medium with pyruvate allowed the glycolysis mutants to form larger plaques than those observed with unsupplemented medium, consistent with data from phenotypic microarrays (Biolog) indicating that pyruvate metabolism was not disrupted in these mutants. Interestingly, the wild-type S. flexneri also formed larger plaques in the presence of supplemental pyruvate or glucose, with pyruvate yielding the largest plaques. Analysis of the metabolites in the cultured cells showed increased intracellular levels of the added compound. Pyruvate increased the growth rate of S. flexneri in vitro, suggesting that it may be a preferred carbon source inside host cells. PMID:24733092

  17. RuBP limitation of photosynthetic carbon fixation during NH sub 3 assimilation: Interactions between photosynthesis, respiration, and ammonium assimilation in N-limited green algae

    SciTech Connect

    Elrifi, I.R.; Holmes, J.J.; Weger, H.G.; Mayo, W.P.; Turpin, D.H. )

    1988-06-01

    The effects of ammonium assimilation on photosynthetic carbon fixation and O{sub 2} exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP) concentration and the RuBP binding site density of ribulose bisphosphate carboxylase/oxygenase (Rubisco). In both species, ammonium assimilation resulted in a decrease in RuBP concentration. In S. minutum the concentration fell below the RuBP binding site density of Rubisco, indicating RuBP limitation of carboxylation. In contrast, RuBP concentration remained above the binding site density in C. pyrenoidosa. Compromising RuBP regeneration in C. pyrenoidosa with low light resulted in an ammonium-induced decrease in RuBP concentration below the RuBP binding site density of Rubisco. This resulted in a decrease in photosynthetic carbon fixation. In both species, ammonium assimilation resulted in a larger decrease in net O{sub 2} evolution than in carbon fixation. Mass spectrometric analysis shows this to be a result of an increase in the rate of mitochondrial respiration in the light.

  18. Activity of carbon dioxide fixation by anthers and leaves of cereal grains

    SciTech Connect

    Kirichenko, E.B.; Chernyad'ev, I.I.; Doman, N.G.; Talibullina, K.K.; Voronkova, T.V.

    1986-05-01

    This paper gives a comparative evaluation of the photosynthetic activity of anthers and flag leaves in winter wheat, rye, and triticale. The content of chlorophylls in anthers and leaves was determined. The activity of /sup 14/CO/sub 2/ fixation by anthers and leaf disks was determined by the radiometric method in a chamber floating on mercury under standard exposure conditions (0.1% concentration of /sup 14/CO/sub 2/, illumination of 15,000 1x, temperature of 23 C). Analyses were conducted in three replications and the results of typical biological experiments are cited. Data show that chlorophyll is actively synthesized in the anthers of cereal grains.

  19. Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L

    SciTech Connect

    Singal, H.R.; Sheoran, I.S.; Singh, R.

    1987-04-01

    Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwall and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.

  20. Pathways of organic carbon oxidation in three continental margin sediments

    NASA Technical Reports Server (NTRS)

    Canfield, D. E.; Jorgensen, B. B.; Fossing, H.; Glud, R.; Gundersen, J.; Ramsing, N. B.; Thamdrup, B.; Hansen, J. W.; Nielsen, L. P.; Hall, P. O.

    1993-01-01

    We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and Mn reduction) has probably been well underestimated.

  1. Pathways to Adoption of Carbon Capture and Sequestration in India: Technologies and Policies

    E-print Network

    Pathways to Adoption of Carbon Capture and Sequestration in India: Technologies and Policies, Technology and Policy Program #12;2 #12;Pathways to Carbon Capture and Sequestration in India: Technologies to control India's emissions will have to be a global priority. Carbon capture and sequestration (CCS) can

  2. N2 Fixation, Carbon Metabolism, and Oxidative Damage in Nodules of Dark-Stressed Common Bean Plants.

    PubMed Central

    Gogorcena, Y.; Gordon, A. J.; Escuredo, P. R.; Minchin, F. R.; Witty, J. F.; Moran, J. F.; Becana, M.

    1997-01-01

    Common beans (Phaseolus vulgaris L.) were exposed to continuous darkness to induce nodule senescence, and several nodule parameters were investigated to identify factors that may be involved in the initial loss of N2 fixation. After only 1 d of darkness, total root respiration decreased by 76% and in vivo nitrogenase (N2ase) activity decreased by 95%. This decline coincided with the almost complete depletion (97%) of sucrose and fructose in nodules. At this stage, the O2 concentration in the infected zone increased to 1%, which may be sufficient to inactivate N2ase; however, key enzymes of carbon and nitrogen metabolism were still active. After 2 d of dark stress there was a significant decrease in the level of N2ase proteins and in the activities of enzymes involved in carbon and nitrogen assimilation. However, the general collapse of nodule metabolism occurred only after 4 d of stress, with a large decline in leghemoglobin and antioxidants. At this final senescent stage, there was an accumulation of oxidatively modified proteins. This oxidative stress may have originated from the decrease in antioxidant defenses and from the Fe-catalyzed generation of activated oxygen due to the increased availability of catalytic Fe and O2 in the infected region. PMID:12223669

  3. Enantioselective small molecule synthesis by carbon dioxide fixation using a dual Brønsted acid/base organocatalyst.

    PubMed

    Vara, Brandon A; Struble, Thomas J; Wang, Weiwei; Dobish, Mark C; Johnston, Jeffrey N

    2015-06-17

    Carbon dioxide exhibits many of the qualities of an ideal reagent: it is nontoxic, plentiful, and inexpensive. Unlike other gaseous reagents, however, it has found limited use in enantioselective synthesis. Moreover, unprecedented is a tool that merges one of the simplest biological approaches to catalysis-Brønsted acid/base activation-with this abundant reagent. We describe a metal-free small molecule catalyst that achieves the three component reaction between a homoallylic alcohol, carbon dioxide, and an electrophilic source of iodine. Cyclic carbonates are formed enantioselectively. PMID:26039818

  4. Mesaconyl-Coenzyme A Hydratase, a New Enzyme of Two Central Carbon Metabolic Pathways in Bacteria?

    PubMed Central

    Zarzycki, Jan; Schlichting, Ansgar; Strychalsky, Nina; Müller, Michael; Alber, Birgit E.; Fuchs, Georg

    2008-01-01

    The coenzyme A (CoA)-activated C5-dicarboxylic acids mesaconyl-CoA and ?-methylmalyl-CoA play roles in two as yet not completely resolved central carbon metabolic pathways in bacteria. First, these compounds are intermediates in the 3-hydroxypropionate cycle for autotrophic CO2 fixation in Chloroflexus aurantiacus, a phototrophic green nonsulfur bacterium. Second, mesaconyl-CoA and ?-methylmalyl-CoA are intermediates in the ethylmalonyl-CoA pathway for acetate assimilation in various bacteria, e.g., in Rhodobacter sphaeroides, Methylobacterium extorquens, and Streptomyces species. In both cases, mesaconyl-CoA hydratase was postulated to catalyze the interconversion of mesaconyl-CoA and ?-methylmalyl-CoA. The putative genes coding for this enzyme in C. aurantiacus and R. sphaeroides were cloned and heterologously expressed in Escherichia coli, and the proteins were purified and studied. The recombinant homodimeric 80-kDa proteins catalyzed the reversible dehydration of erythro-?-methylmalyl-CoA to mesaconyl-CoA with rates of 1,300 ?mol min?1 mg protein?1. Genes coding for similar enzymes with two (R)-enoyl-CoA hydratase domains are present in the genomes of Roseiflexus, Methylobacterium, Hyphomonas, Rhodospirillum, Xanthobacter, Caulobacter, Magnetospirillum, Jannaschia, Sagittula, Parvibaculum, Stappia, Oceanicola, Loktanella, Silicibacter, Roseobacter, Roseovarius, Dinoroseobacter, Sulfitobacter, Paracoccus, and Ralstonia species. A similar yet distinct class of enzymes containing only one hydratase domain was found in various other bacteria, such as Streptomyces species. The role of this widely distributed new enzyme is discussed. PMID:18065535

  5. Regulation of photosynthetic carbon fixation on the ocean margins. Final report

    SciTech Connect

    Paul, J.H.

    1997-06-01

    The US Department of Energy is concerned with the fate of energy-related materials, including carbon dioxide, in the marine environment. Using laboratory studies, as well as field studies, an attempt was made to understand the molecular regulation of photosynthetic carbon reduction. The objectives were: to determine the mechanism of regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBPCase) in phytoplankton in response to changes in light fields; and to determine regulation of (RuBPCase) in response to light under nutrient deprivation.

  6. Nitrogen-Dependent Carbon Fixation by Picoplankton In Culture and in the Mississippi River

    SciTech Connect

    Aubrey Smith; Marguerite W. Coomes; Thomas E. Smith

    2005-04-30

    The pepc gene, which encodes phosphoenolpyruvate carboxylase (PEPC), of the marine cyanobacterium Synechococcus PCC 7002, was isolated and sequenced. PEPC is an anaplerotic enzyme, but it may also contribute to overall CO2 fixation through β-carboxylation reactions. A consensus sequence generated by aligning the pepc genes of Anabaena variabilis, Anacystis nidulans and Synechocystis PCC 6803 was used to design two sets of primers that were used to amplify segments of Synechococcus PCC 7002 pepc. In order to isolate the gene, the sequence of the PCR product was used to search for the pepc nucleotide sequence from the publicly available genome of Synechococcus PCC 7002. At the time, the genome for this organism had not been completed although sequences of a significant number of its fragments are available in public databases. Thus, the major challenge was to find the pepc gene among those fragments and to complete gaps as necessary. Even though the search did not yield the complete gene, PCR primers were designed to amplify a DNA fragment using a high fidelity thermostable DNA polymerase. An open reading frame (ORF) consisting of 2988 base pairs coding for 995 amino acids was found in the 3066 bp PCR product. The pepc gene had a GC content of 52% and the deduced protein had a calculated molecular mass of 114,049 Da. The amino acid sequence was closely related to that of PEPC from other cyanobacteria, exhibiting 59-61% identity. The sequence differed significantly from plant and E. coli PEPC with only 30% homology. However, comparing the Synechococcus PCC 7002 sequence to the recently resolved E. coli PEPC revealed that most of the essential domains and amino acids involved in PEPC activity were shared by both proteins. The recombinant Synechococcus PCC 7002 PEPC was expressed in E. coli.

  7. Soybean Photosynthetic Rate and Carbon Fixation at Early and Late Planting Dates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Early planting (late April to early May) is recommended for increasing soybean yield but a full understanding of the physiological response is lacking. This study was conducted to determine whether carbon dioxide exchange rate (CER) could explain this yield difference. A study with five (2007) and s...

  8. Carbonate hydroxyapatite functionalization: a comparative study towards (bio)molecules fixation

    PubMed Central

    Russo, Laura; Taraballi, Francesca; Lupo, Cristina; Poveda, Ana; Jiménez-Barbero, Jesús; Sandri, Monica; Tampieri, Anna; Nicotra, Francesco; Cipolla, Laura

    2014-01-01

    Different methods for the functionalization of carbonate hydroxyapatite granules with free amine groups by reaction with (3-aminopropyl)triethoxysilane (APTES) have been compared in order to improve the potential for tethering of bioactive molecules to bioceramics. The combined use of tetraethoxyorthosilicate and APTES with acid catalysis resulted in an evident increase in amine surface grafting. PMID:24501671

  9. Serine Biosynthesis with One Carbon Catabolism and the Glycine Cleavage System Represents a Novel Pathway for

    E-print Network

    Vazquez, Alexei

    Serine Biosynthesis with One Carbon Catabolism and the Glycine Cleavage System Represents a Novel with One Carbon Catabolism and the Glycine Cleavage System Represents a Novel Pathway for ATP Generation

  10. Influence of the CO2 absorbent monoethanolamine on growth and carbon fixation by the green alga Scenedesmus sp.

    PubMed

    Choi, Wookjin; Kim, Garam; Lee, Kisay

    2012-09-01

    The influence of monoethanolamine (MEA) as a CO(2) absorbent on photoautotrophic culture of CO(2)-fixing microalgae was investigated. When 300 ppm MEA (4.92 mM) was added to blank culture medium, the dissolved inorganic carbon and the molar absorption ratio increased to 51.0mg/L and 0.34 mol CO2 = mol MEA, respectively, which was an almost 6-fold increase in CO(2) solubility. When free MEA up to 300 mg/L was added to a green alga Scenedesmus sp. culture that was supplied 5% (v/v) CO(2) at 0.1 vvm, both cell growth rate and final cell density were enhanced compared to when no MEA was added. The cell growth rate reached 288.6 mg/L/d, which was equivalent to 539.6 mg-CO(2)/L/d as a CO(2)-fixation rate and enhancement of about 63.0% compared to not adding MEA. Chlorophyll-a content and nitrate consumption rate increased correspondingly. MEA doses higher than 400mg/L inhibited cell growth, probably due to toxicity of the carbamate intermediate. PMID:22771020

  11. Carbon Dioxide Fixation and Sulfate Sequestration by a Supramolecular Trigonal Bipyramid.

    PubMed

    Browne, Colm; Ramsay, William J; Ronson, Tanya K; Medley-Hallam, John; Nitschke, Jonathan R

    2015-09-14

    The subcomponent self-assembly of a bent dialdehyde ligand and different cationic and anionic templates led to the formation of two new metallosupramolecular architectures: a Fe(II) 4 L6 molecular rectangle was isolated following reaction of the ligand with iron(II) tetrafluoroborate, and a M5 L6 trigonal bipyramidal structure was constructed from either zinc(II) tetrafluoroborate or cadmium(II) trifluoromethanesulfonate. The spatially constrained arrangement of the three equatorial metal ions in the M5 L6 structures was found to induce small-molecule transformations. Atmospheric carbon dioxide was fixed as carbonate and bound to the equatorial metal centers in both the Zn5 L6 and Cd5 L6 assemblies, and sulfur dioxide was hydrated and bound as the sulfite dianion in the Zn5 L6 structure. Subsequent in situ oxidation of the sulfite dianion resulted in a sulfate dianion bound within the supramolecular pocket. PMID:26235039

  12. Biochemistry and control of the reductive tricarboxylic acid pathway of CO2 fixation and physiological role of the RubisCO-like protein

    SciTech Connect

    Tabita, F Robert

    2008-12-04

    During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris. 1. Reductive TCA pathway of CO2 assimilation Many diverse microorganisms use the reductive TCA (RTCA) pathway for CO2 assimilation. Included are photoautotrophic and chemoautotrophic organisms that occupy important niches in various ecosystems. Inasmuch as the biochemistry and regulation of the RTCA pathway has been virtually neglected, especially in comparison to the Calvin-Benson-Bassham (CBB) reductive pentose pathway of CO2 fixation, we sought to develop a system that would allow for detailed biochemical analysis of the RTCA enzymes and associated proteins, along with the genes that encode these proteins. We have focused on the green sulfur photosynthetic bacterium Chlorobium tepidum, a fast growing moderate thermophile originally isolated by Professor Mike Madigan and colleagues. Because of its rapid growth and relative ease to produce massive cell amounts via high-density fermentator vessels, C. tepidum has become the organism of choice for investigators interested in studying all aspects of the physiology and biochemistry of green sulfur bacteria. Moreover, this organism possesses a very convenient natural transformation system that allows routine genetic transfer and the generation of knockout mutations via homologous recombination at specific genetic loci. The first such mutations were generated in our laboratory [Hanson & Tabita, PNAS USA, 98 (2001), 4397-4402], such that these protocols have now become relatively routine. Moreover, the genome of C. tepidum was recently sequenced. Thus, all the tools are in place for productive analysis of key processes catalyzed by this organism, in particular for analysis of the RTCA pathway and the rather unique RubisCO-like protein (RLP) that we first discovered during the last grant period of this project [Hanson & Tabita, 2001]. We have concentrated on the enzymology of the key proteins of this pathway, in particular pyruvate synthase (PS), ?-ketoglutarate synthase (KGS), and ATP-citrate lyase (ACL). In addition, we have also focused on key electron transfer proteins that must provide needed reducing equivalents to PS and KGS, including two separate ferredoxins that were shown to be abundantly produced by this organism. 2. Physiological/biochemical/genetic studies on the RubisCO-like Protein (RLP) During the prior grant period we identified what we believe is an evolutional precursor to bona fide RubisCO in C. tepidum, the RubisCO-like protein (RLP) [Hanson & Tabita, 2001]. Typical bioinformatics software incorrectly indicates that RLP is RubisCO, however our previous experience with RubisCO enabled us to establish that C. tepidum RLP has substitutions in 9 out of the 19 residues known to be important for RubisCO-catalyzed CO2 fixation. After purifying recombinant RLP, we showed that the RLP is not a bona fide RubisCO that catalyzes RuBP-dependent CO2 fixation, but appears to function in some aspect of the oxidation of reduced sulfur compounds by this organism. More recent studies [Hanson & Tabita, Photosynth. Res. 78 (2003) 231-248] during the past grant period have established that this effect is related to some aspect of thiosulfate oxidation in the reduced sulfur compound oxidation pathway, as sulfide oxidation was not affected. When we first discovered the RLP, we noted that RLP homologs were also found in other organisms, including heterotrophic bacteria and at least one archaeon [Hanson & Tabita, 2001, 2003]. Finally, as long-time Rubiscologists we have always been intrigued with how the active site of RubisCO might have evolved for its key functional role in metabolizing CO2 and O2 [Tabita, Photosynth. Res. 60 (1999) 1-

  13. Urea Uptake and Carbon Fixation by Marine Pelagic Bacteria and Archaea during the Arctic Summer and Winter Seasons

    PubMed Central

    Connelly, Tara L.; Baer, Steven E.; Cooper, Joshua T.; Bronk, Deborah A.

    2014-01-01

    How Arctic climate change might translate into alterations of biogeochemical cycles of carbon (C) and nitrogen (N) with respect to inorganic and organic N utilization is not well understood. This study combined 15N uptake rate measurements for ammonium, nitrate, and urea with 15N- and 13C-based DNA stable-isotope probing (SIP). The objective was to identify active bacterial and archeal plankton and their role in N and C uptake during the Arctic summer and winter seasons. We hypothesized that bacteria and archaea would successfully compete for nitrate and urea during the Arctic winter but not during the summer, when phytoplankton dominate the uptake of these nitrogen sources. Samples were collected at a coastal station near Barrow, AK, during August and January. During both seasons, ammonium uptake rates were greater than those for nitrate or urea, and nitrate uptake rates remained lower than those for ammonium or urea. SIP experiments indicated a strong seasonal shift of bacterial and archaeal N utilization from ammonium during the summer to urea during the winter but did not support a similar seasonal pattern of nitrate utilization. Analysis of 16S rRNA gene sequences obtained from each SIP fraction implicated marine group I Crenarchaeota (MGIC) as well as Betaproteobacteria, Firmicutes, SAR11, and SAR324 in N uptake from urea during the winter. Similarly, 13C SIP data suggested dark carbon fixation for MGIC, as well as for several proteobacterial lineages and the Firmicutes. These data are consistent with urea-fueled nitrification by polar archaea and bacteria, which may be advantageous under dark conditions. PMID:25063662

  14. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco.

    PubMed

    Simkin, Andrew J; McAusland, Lorna; Headland, Lauren R; Lawson, Tracy; Raines, Christine A

    2015-07-01

    Over the next 40 years it has been estimated that a 50% increase in the yield of grain crops such as wheat and rice will be required to meet the food and fuel demands of the increasing world population. Transgenic tobacco plants have been generated with altered combinations of sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and the cyanobacterial putative-inorganic carbon transporter B, ictB, of which have all been identified as targets to improve photosynthesis based on empirical studies. It is shown here that increasing the levels of the three proteins individually significantly increases the rate of photosynthetic carbon assimilation, leaf area, and biomass yield. Furthermore, the daily integrated measurements of photosynthesis showed that mature plants fixed between 12-19% more CO2 than the equivalent wild-type plants. Further enhancement of photosynthesis and yield was observed when sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and ictB were over-expressed together in the same plant. These results demonstrate the potential for the manipulation of photosynthesis, using multigene-stacking approaches, to increase crop yields. PMID:25956882

  15. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco

    PubMed Central

    Simkin, Andrew J.; McAusland, Lorna; Headland, Lauren R.; Lawson, Tracy; Raines, Christine A.

    2015-01-01

    Over the next 40 years it has been estimated that a 50% increase in the yield of grain crops such as wheat and rice will be required to meet the food and fuel demands of the increasing world population. Transgenic tobacco plants have been generated with altered combinations of sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and the cyanobacterial putative-inorganic carbon transporter B, ictB, of which have all been identified as targets to improve photosynthesis based on empirical studies. It is shown here that increasing the levels of the three proteins individually significantly increases the rate of photosynthetic carbon assimilation, leaf area, and biomass yield. Furthermore, the daily integrated measurements of photosynthesis showed that mature plants fixed between 12–19% more CO2 than the equivalent wild-type plants. Further enhancement of photosynthesis and yield was observed when sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and ictB were over-expressed together in the same plant. These results demonstrate the potential for the manipulation of photosynthesis, using multigene-stacking approaches, to increase crop yields. PMID:25956882

  16. Lanthanide Complexes with Multidentate Oxime Ligands as Single-Molecule Magnets and Atmospheric Carbon Dioxide Fixation Systems.

    PubMed

    Ho?y?ska, Ma?gorzata; Clérac, Rodolphe; Rouzières, Mathieu

    2015-09-14

    The synthesis, structure, and magnetic properties of five lanthanide complexes with multidentate oxime ligands are described. Complexes 1 and 2 (1: [La2 (pop)2 (acac)4 (CH3 OH)], 2: [Dy2 (pop)(acac)5 ]) are synthesized from the 2-hydroxyimino-N-[1-(2-pyridyl)ethylidene]propanohydrazone (Hpop) ligand, while 3, 4, and 5 (3: [Dy2 (naphthsaoH)2 (acac)4 H(OH)]?0.85?CH3 CN?1.58?H2 O; 4: [Tb2 (naphthsaoH)2 (acac)4 H(OH)]?0.52?CH3 CN?1.71?H2 O; 5: [La6 (CO3 )2 (naphthsao)5 (naphthsaoH)0.5 (acac)8 (CO3 )0.5 (CH3 OH)2.76 H5.5 (H2 O)1.24 ]?2.39?CH3 CN?0.12?H2 O) contain 1-(1-hydroxynaphthalen-2-yl)-ethanone oxime (naphthsaoH2 ). In 1-4, dinuclear [Ln2 ] complexes crystallize, whereas hexanuclear La(III) complex 5 is formed after fixation of atmospheric carbon dioxide. Dy(III) -based complexes 2 and 3 display single-molecule-magnet properties with energy barriers of 27 and 98?K, respectively. The presence of a broad and unsymmetrical relaxation mode observed in the ac susceptibility data for 3 suggest two different dynamics of the magnetization which might be a consequence of independent relaxation processes of the two different Dy(3+) ions. PMID:26230414

  17. How sensitive are estimates of carbon fixation in agricultural models to input data?

    PubMed Central

    2012-01-01

    Background Process based vegetation models are central to understand the hydrological and carbon cycle. To achieve useful results at regional to global scales, such models require various input data from a wide range of earth observations. Since the geographical extent of these datasets varies from local to global scale, data quality and validity is of major interest when they are chosen for use. It is important to assess the effect of different input datasets in terms of quality to model outputs. In this article, we reflect on both: the uncertainty in input data and the reliability of model results. For our case study analysis we selected the Marchfeld region in Austria. We used independent meteorological datasets from the Central Institute for Meteorology and Geodynamics and the European Centre for Medium-Range Weather Forecasts (ECMWF). Land cover / land use information was taken from the GLC2000 and the CORINE 2000 products. Results For our case study analysis we selected two different process based models: the Environmental Policy Integrated Climate (EPIC) and the Biosphere Energy Transfer Hydrology (BETHY/DLR) model. Both process models show a congruent pattern to changes in input data. The annual variability of NPP reaches 36% for BETHY/DLR and 39% for EPIC when changing major input datasets. However, EPIC is less sensitive to meteorological input data than BETHY/DLR. The ECMWF maximum temperatures show a systematic pattern. Temperatures above 20°C are overestimated, whereas temperatures below 20°C are underestimated, resulting in an overall underestimation of NPP in both models. Besides, BETHY/DLR is sensitive to the choice and accuracy of the land cover product. Discussion This study shows that the impact of input data uncertainty on modelling results need to be assessed: whenever the models are applied under new conditions, local data should be used for both input and result comparison. PMID:22296931

  18. Oxygen Pathways and Carbon Dioxide Utilization in Methane Partial Oxidation in Ambient Temperature

    E-print Network

    Mallinson, Richard

    Oxygen Pathways and Carbon Dioxide Utilization in Methane Partial Oxidation in Ambient Temperature and lower environmental impacts make this the carbon-based fuel of choice well into the twenty-first century into enhance- ment of the carbon balance of methane conversion by reforming with CO2 in order to "recycle

  19. sup 14 C fixation by leaves and leaf cell protoplasts of the submerged aquatic angiosperm Potamogeton lucens: Carbon dioxide or bicarbonate

    SciTech Connect

    Staal, M.; Elzenga, J.T.M.; Prins, H.B.A. )

    1989-07-01

    Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant.

  20. Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata

    PubMed Central

    Ponsard, Julie; Cambon-Bonavita, Marie-Anne; Zbinden, Magali; Lepoint, Gilles; Joassin, André; Corbari, Laure; Shillito, Bruce; Durand, Lucile; Cueff-Gauchard, Valérie; Compère, Philippe

    2013-01-01

    The shrimp Rimicaris exoculata dominates several hydrothermal vent ecosystems of the Mid-Atlantic Ridge and is thought to be a primary consumer harbouring a chemoautotrophic bacterial community in its gill chamber. The aim of the present study was to test current hypotheses concerning the epibiont's chemoautotrophy, and the mutualistic character of this association. In-vivo experiments were carried out in a pressurised aquarium with isotope-labelled inorganic carbon (NaH13CO3 and NaH14CO3) in the presence of two different electron donors (Na2S2O3 and Fe2+) and with radiolabelled organic compounds (14C-acetate and 3H-lysine) chosen as potential bacterial substrates and/or metabolic by-products in experiments mimicking transfer of small biomolecules from epibionts to host. The bacterial epibionts were found to assimilate inorganic carbon by chemoautotrophy, but many of them (thick filaments of epsilonproteobacteria) appeared versatile and able to switch between electron donors, including organic compounds (heterotrophic acetate and lysine uptake). At least some of them (thin filamentous gammaproteobacteria) also seem capable of internal energy storage that could supply chemosynthetic metabolism for hours under conditions of electron donor deprivation. As direct nutritional transfer from bacteria to host was detected, the association appears as true mutualism. Import of soluble bacterial products occurs by permeation across the gill chamber integument, rather than via the digestive tract. This first demonstration of such capabilities in a decapod crustacean supports the previously discarded hypothesis of transtegumental absorption of dissolved organic matter or carbon as a common nutritional pathway. PMID:22914596

  1. Simulation of permeability evolution of leakage pathway in carbonate-rich caprocks in carbon sequestration

    NASA Astrophysics Data System (ADS)

    Guo, B.; Fitts, J. P.; Dobossy, M. E.; Peters, C. A.

    2013-12-01

    Geologic carbon sequestration in deep saline aquifers is a promising strategy for mitigating climate change. A major concern is the possibility of brine and CO2 migration through the caprock such as through fractures and faults. In this work, we examine the extent to which mineral dissolution will substantially alter the porosity and permeability of caprock leakage pathways as CO2-acidified brine flows through them. Three models were developed. Firstly, a reactive transport model, Permeability Evolution of Leakage pathway (PEL), was developed to simulate permeability evolution of a leakage pathway during the injection period, and assumes calcite is the only reactive mineral. The system domain is a 100 m long by 0.2 m diameter cylindrical flow path with fixed boundaries containing a rock matrix with an initial porosity of 30% and initial permeability of 1×10-13 m2. One example result is for an initial calcite volume fraction (CVF) of 0.20, in which all the calcite is dissolved after 50 years and the permeability reaches 3.2×10-13 m2. For smaller values of CVF, the permeability reaches its final value earlier but the increase in permeability is minimal. For a large value of CVF such as 0.50, the permeability could eventually reach 1×10-12 m2, but the large amount of dissolved calcium buffers the solution and slows the reaction. After 50 years the permeability change is negligible. Thus, there is a non-monotonic relationship between the amount of calcite in the rock and the resulting permeability change because of the competing dynamics of calcite dissolution and alkalinity build-up. In the second model, PEL was coupled to an existing basin-scale multiphase flow model, Princeton's Estimating Leakage Semi-Analytical (ELSA) model. The new model, ELSA-PEL, estimates the brine and CO2 leakage rates during the injection period under conditions of permeability evolution. The scenario considered in this work is for 50 years of CO2 injection into the Mt. Simon formation in the Michigan basin at an injection rate of 1 Mt/y. As an example, for a CVF value of 5%, the brine leakage rate after fifty years for a leakage pathway 1,000 m distance from the injection well is 0.88 kg/s, which is 2.4% larger than if there were no geochemical evolution of the permeability. In a sensitivity analysis with regard to the distance between the leakage pathway and the injection well, it was found that the cumulative leakage first increases with the distance and the relationship reverses after a certain distance. When the leakage pathway is farther away, the pressure increment drops leading to less acid brine flow; meanwhile, the time before the CO2 plume reaches the pathway is longer and this lengthens the reaction time with brine. Thirdly, we explored the role that SO2 would play if it were present as a co-injectant in carbon sequestration. The reaction considered is SO2 hydrolysis to form sulfurous acid. We expect the sulfurous acid will erode the calcite faster than carbonic acid because it is a stronger acid. Contrary to intuition, the simulation results showed a decrease in permeability due to CaSO3 precipitation in replacement of CaCO3, as CaSO3 has a larger molar volume.

  2. Modelling Urban scale Retrofit, Pathways to 2050 Low Carbon Residential Building Stock 

    E-print Network

    Lannon, Simon; Georgakaki, Aliki; Macdonald, Stuart

    A bottom up engineering modelling approach has been used to investigate the pathways to 2050 low carbon residential building stock. The impact of housing retrofit, renewable technologies, occupant behaviour, and grid decarbonisation is measured at a...

  3. Two-dimensional isobutyl acetate production pathways to improve carbon yield

    PubMed Central

    Tashiro, Yohei; Desai, Shuchi H.; Atsumi, Shota

    2015-01-01

    For an economically competitive biological process, achieving high carbon yield of a target chemical is crucial. In biochemical production, pyruvate and acetyl-CoA are primary building blocks. When sugar is used as the sole biosynthetic substrate, acetyl-CoA is commonly generated by pyruvate decarboxylation. However, pyruvate decarboxylation during acetyl-CoA formation limits the theoretical maximum carbon yield (TMCY) by releasing carbon, and in some cases also leads to redox imbalance. To avoid these problems, we describe here the construction of a metabolic pathway that simultaneously utilizes glucose and acetate. Acetate is utilized to produce acetyl-CoA without carbon loss or redox imbalance. We demonstrate the utility of this approach for isobutyl acetate (IBA) production, wherein IBA production with glucose and acetate achieves a higher carbon yield than with either sole carbon source. These results highlight the potential for this multiple carbon source approach to improve the TMCY and balance redox in biosynthetic pathways. PMID:26108471

  4. C3 and C4 Pathways of Photosynthetic Carbon Assimilation in Marine Diatoms Are under Genetic, Not Environmental, Control1[W][OA

    PubMed Central

    Roberts, Karen; Granum, Espen; Leegood, Richard C.; Raven, John A.

    2007-01-01

    Marine diatoms are responsible for up to 20% of global CO2 fixation. Their photosynthetic efficiency is enhanced by concentrating CO2 around Rubisco, diminishing photorespiration, but the mechanism is yet to be resolved. Diatoms have been regarded as C3 photosynthesizers, but recent metabolic labeling and genome sequencing data suggest that they perform C4 photosynthesis. We studied the pathways of photosynthetic carbon assimilation in two diatoms by short-term metabolic 14C labeling. In Thalassiosira weissflogii, both C3 (glycerate-P and triose-P) and C4 (mainly malate) compounds were major initial (2–5 s) products, whereas Thalassiosira pseudonana produced mainly C3 and C6 (hexose-P) compounds. The data provide evidence of C3-C4 intermediate photosynthesis in T. weissflogii, but exclusively C3 photosynthesis in T. pseudonana. The labeling patterns were the same for cells grown at near-ambient (380 ?L L?1) and low (100 ?L L?1) CO2 concentrations. The lack of environmental modulation of carbon assimilatory pathways was supported in T. pseudonana by measurements of gene transcript and protein abundances of C4-metabolic enzymes (phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase) and Rubisco. This study suggests that the photosynthetic pathways of diatoms are diverse, and may involve combined CO2-concentrating mechanisms. Furthermore, it emphasizes the requirement for metabolic and functional genetic and enzymic analyses before accepting the presence of C4-metabolic enzymes as evidence for C4 photosynthesis. PMID:17644625

  5. Mobilization pathways of organic carbon from permafrost to arctic rivers in a changing climate

    E-print Network

    Guo, Laodong

    Mobilization pathways of organic carbon from permafrost to arctic rivers in a changing climate to arctic rivers in a changing climate, Geophys. Res. Lett., 34, L13603, doi:10.1029/2007GL030689. 1]. The difficulty in understanding the consequences of projected Arctic climate change for the organic carbon cycle

  6. Root Carbon Dioxide Fixation by Phosphorus-Deficient Lupinus albus (Contribution to Organic Acid Exudation by Proteoid Roots).

    PubMed Central

    Johnson, J. F.; Allan, D. L.; Vance, C. P.; Weiblen, G.

    1996-01-01

    When white lupin (Lupinus albus L.) is subjected to P deficiency lateral root development is altered and densely clustered, tertiary lateral roots (proteoid roots) are initiated. These proteoid roots exude large amounts of citrate, which increases P solubilization. In the current study plants were grown with either 1 mM P (+P-treated) or without P (-P-treated). Shoots or roots of intact plants from both P treatments were labeled independently with 14CO2 to compare the relative contribution of C fixed in each with the C exuded from roots as citrate and other organic acids. About 25-fold more acid-stable 14C, primarily in citrate and malate, was recovered in exudates from the roots of -P-treated plants compared with +P-treated plants. The rate of in vivo C fixation in roots was about 4-fold higher in -P-treated plants than in +P-treated plants. Evidence from labeling intact shoots or roots indicates that synthesis of citrate exuded by -P-treated roots is directly related to nonphotosynthetic C fixation in roots. C fixed in roots of -P-treated plants contributed about 25 and 34% of the C exuded as citrate and malate, respectively. Nonphotosynthetic C fixation in white lupin roots is an integral component in the exudation of large amounts of citrate and malate, thus increasing the P available to the plant. PMID:12226371

  7. Carbon Assimilation Pathways, Water Relationships and Plant Ecology.

    ERIC Educational Resources Information Center

    Etherington, John R.

    1988-01-01

    Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

  8. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    NASA Astrophysics Data System (ADS)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.

    2011-02-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the theoretical acidic conditions of these soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. Regarding the carbonate flux, another direct consequence of wood feeding is a concomitant flux of carbonate formed in wood tissues, which is not consumed by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter. Therefore, an oxalate pool is formed on the forest ground. Then, wood rotting gents (mainly termites, fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition some of these gents are themselves producers of oxalate (fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with ?13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as define by the ecological theory.

  9. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    NASA Astrophysics Data System (ADS)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.

    2011-07-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. In addition, a concomitant flux of carbonate formed in wood tissues contributes to the carbonate flux and is identified as a direct consequence of wood feeding by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter, and an oxalate pool is formed on the forest ground. Then, wood rotting agents (mainly termites, saprophytic fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition, some of these agents are themselves producers of oxalate (e.g. fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can then start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with ?13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as defined by ecological theory.

  10. Mechanistic models of oceanic nitrogen fixation

    E-print Network

    Monteiro, Fanny

    2009-01-01

    Oceanic nitrogen fixation and biogeochemical interactions between the nitrogen, phosphorus and iron cycles have important implications for the control of primary production and carbon storage in the ocean. The biological ...

  11. Molybdenum Trafficking for Nitrogen Fixation

    PubMed Central

    Hernandez, Jose A.; George, Simon J.; Rubio, Luis M.

    2009-01-01

    The molybdenum nitrogenase is responsible for most biological nitrogen fixation, a prokaryotic metabolic process that determines the global biogeochemical cycles of nitrogen and carbon. Here we describe the trafficking of molybdenum for nitrogen fixation in the model diazotrophic bacterium Azotobacter vinelandii. The genes and proteins involved in molybdenum uptake, homeostasis, storage, regulation, and nitrogenase cofactor biosynthesis are reviewed. Molybdenum biochemistry in A. vinelandii reveals unexpected mechanisms and a new role for iron-sulfur clusters in the sequestration and delivery of molybdenum. PMID:19772354

  12. Metabolome analysis and pathway abundance profiling of Yarrowia lipolytica cultivated on different carbon sources.

    PubMed

    Zhao, Chen; Gu, Deqing; Nambou, Komi; Wei, Liujing; Chen, Jun; Imanaka, Tadayuki; Hua, Qiang

    2015-07-20

    Yarrowia lipolytica, a model microorganism of oleaginous yeasts with developed sophisticated genetic tools, is able to metabolize a wide range of substrates and accumulate large amounts of lipids. However, there is a lack of literature reporting the metabolic characteristics of Y. lipolytica metabolizing these substrates in a systematic view. In this study, Y. lipolytica was cultivated on a variety of carbon sources, among which cell growth and production characteristics on two representative substrates (glucose and oleic acid) were investigated in detail at metabolomic level. Metabolic pathway abundance was computed to interpret the metabolome data in a straightforward way. The results showed that most pathway abundances decreased in the shift from growth to production phase. Specifically, when cultivated on glucose, abundances of twelve pathways decreased markedly between the growth and lipid production phases, while thirteen pathways reduced and only three pathways increased significantly in abundances on oleic acid. In comparison, for the same cultivation phase only a few pathways exhibited significant changes between glucose-grown and oleic acid-grown cells. This study revealed that the pathway abundance could be used to effectively show the activity changes of pathways, providing a new perspective to employ metabolomics data for understanding cell metabolism and enhancing the production of target metabolites. PMID:25912211

  13. Zonal and meridional patterns of phytoplankton biomass and carbon fixation in the Equatorial Pacific Ocean, between 110°W and 140°W

    NASA Astrophysics Data System (ADS)

    Balch, W. M.; Poulton, A. J.; Drapeau, D. T.; Bowler, B. C.; Windecker, L. A.; Booth, E. S.

    2011-03-01

    Primary production (P prim) and calcification (C calc) were measured in the eastern and central Equatorial Pacific during December 2004 and September 2005, between 110°W and 140°W. The design of the field sampling allowed partitioning of P prim and total chlorophyll a (B) between large (>3 ?m) and small (0.45-3 ?m) phytoplankton cells. The station locations allowed discrimination of meridional and zonal patterns. The cruises coincided with a warm El Niño Southern Oscillation (ENSO) phase and ENSO-neutral phase, respectively, which proved to be the major factors relating to the patterns of productivity. Production and biomass of large phytoplankton generally covaried with that of small cells; large cells typically accounted for 20-30% of B and 20% of P prim. Elevated biomass and primary production of all size fractions were highest along the equator as well as at the convergence zone between the North Equatorial Counter Current and the South Equatorial Current. C calc by >0.4 ?m cells was 2-3% of P prim by the same size fraction, for both cruises. Biomass-normalized P prim values were, on average, slightly higher during the warm-phase ENSO period, inconsistent with a "bottom-up" control mechanism (such as nutrient supply). Another source of variability along the equator was Tropical Instability Waves (TIWs). Zonal variance in integrated phytoplankton biomass (along the equator, between 110° and 140°) was almost the same as the meridional variance across it (between 4° N and 4° S). However, the zonal variance in integrated P prim was half the variance observed meridionally. The variance in integrated C calc along the equator was half that seen meridionally during the warm ENSO phase cruise whereas during the ENSO-neutral period, it was identical. No relation could be observed between the patterns of integrated carbon fixation (P prim or C calc) and integrated nutrients (nitrate, ammonium, silicate or dissolved iron). This suggests that the factors controlling integrated P prim or C calc are more complex than a simple bottom-up supply model and likely also will involve a top-down grazer-control component, as well. The carbon fixation within the Equatorial Pacific is well balanced with diatom and coccolithophore production contributing a relatively steady proportion of the total primary production. This maintains a steady balance between organic and inorganic production, relevant to the ballasting of organic matter and the export flux of carbon from this important upwelling region.

  14. In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways.

    PubMed

    Dey, Swati; North, Justin A; Sriram, Jaya; Evans, Bradley S; Tabita, F Robert

    2015-12-25

    All organisms possess fundamental metabolic pathways to ensure that needed carbon and sulfur compounds are provided to the cell in the proper chemical form and oxidation state. For most organisms capable of using CO2 as sole source of carbon, ribulose-1,5-bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) catalyzes primary carbon dioxide assimilation. In addition, sulfur salvage pathways are necessary to ensure that key sulfur-containing compounds are both available and, where necessary, detoxified in the cell. Using knock-out mutations and metabolomics in the bacterium Rhodospirillum rubrum, we show here that Rubisco concurrently catalyzes key and essential reactions for seemingly unrelated but physiologically essential central carbon and sulfur salvage metabolic pathways of the cell. In this study, complementation and mutagenesis studies indicated that representatives of all known extant functional Rubisco forms found in nature are capable of simultaneously catalyzing reactions required for both CO2-dependent growth as well as growth using 5-methylthioadenosine as sole sulfur source under anaerobic photosynthetic conditions. Moreover, specific inactivation of the CO2 fixation reaction did not affect the ability of Rubisco to support anaerobic 5-methylthioadenosine metabolism, suggesting that the active site of Rubisco has evolved to ensure that this enzyme maintains both key functions. Thus, despite the coevolution of both functions, the active site of this protein may be differentially modified to affect only one of its key functions. PMID:26511314

  15. Pathways and Bioenergetics of Anaerobic Carbon Monoxide Fermentation

    PubMed Central

    Diender, Martijn; Stams, Alfons J. M.; Sousa, Diana Z.

    2015-01-01

    Carbon monoxide can act as a substrate for different modes of fermentative anaerobic metabolism. The trait of utilizing CO is spread among a diverse group of microorganisms, including members of bacteria as well as archaea. Over the last decade this metabolism has gained interest due to the potential of converting CO-rich gas, such as synthesis gas, into bio-based products. Three main types of fermentative CO metabolism can be distinguished: hydrogenogenesis, methanogenesis, and acetogenesis, generating hydrogen, methane and acetate, respectively. Here, we review the current knowledge on these three variants of microbial CO metabolism with an emphasis on the potential enzymatic routes and bio-energetics involved. PMID:26635746

  16. Incomplete Wood–Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi

    PubMed Central

    Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L.; Feng, Xueyang; Men, Yujie; Conrad, Mark E.; Tang, Yinjie J.; Alvarez-Cohen, Lisa

    2014-01-01

    The acetyl-CoA “Wood–Ljungdahl” pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood–Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood–Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

  17. Pathways of carbon assimilation and ammonia oxidation suggested by environmental genomic analyses of marine Crenarchaeota.

    PubMed

    Hallam, Steven J; Mincer, Tracy J; Schleper, Christa; Preston, Christina M; Roberts, Katie; Richardson, Paul M; DeLong, Edward F

    2006-04-01

    Marine Crenarchaeota represent an abundant component of oceanic microbiota with potential to significantly influence biogeochemical cycling in marine ecosystems. Prior studies using specific archaeal lipid biomarkers and isotopic analyses indicated that planktonic Crenarchaeota have the capacity for autotrophic growth, and more recent cultivation studies support an ammonia-based chemolithoautotrophic energy metabolism. We report here analysis of fosmid sequences derived from the uncultivated marine crenarchaeote, Cenarchaeum symbiosum, focused on the reconstruction of carbon and energy metabolism. Genes predicted to encode multiple components of a modified 3-hydroxypropionate cycle of autotrophic carbon assimilation were identified, consistent with utilization of carbon dioxide as a carbon source. Additionally, genes predicted to encode a near complete oxidative tricarboxylic acid cycle were also identified, consistent with the consumption of organic carbon and in the production of intermediates for amino acid and cofactor biosynthesis. Therefore, C. symbiosum has the potential to function either as a strict autotroph, or as a mixotroph utilizing both carbon dioxide and organic material as carbon sources. From the standpoint of energy metabolism, genes predicted to encode ammonia monooxygenase subunits, ammonia permease, urease, and urea transporters were identified, consistent with the use of reduced nitrogen compounds as energy sources fueling autotrophic metabolism. Homologues of these genes, recovered from ocean waters worldwide, demonstrate the conservation and ubiquity of crenarchaeal pathways for carbon assimilation and ammonia oxidation. These findings further substantiate the likely global metabolic importance of Crenarchaeota with respect to key steps in the biogeochemical transformation of carbon and nitrogen in marine ecosystems. PMID:16533068

  18. Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor

    SciTech Connect

    Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A; Beste, Ariana; Naskar, Amit K

    2013-01-01

    Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. We observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.

  19. High-Gravity Carbonation Process for Enhancing CO2 Fixation and Utilization Exemplified by the Steelmaking Industry.

    PubMed

    Pan, Shu-Yuan; Chen, Yi-Hung; Chen, Chun-Da; Shen, Ai-Lin; Lin, Michael; Chiang, Pen-Chi

    2015-10-20

    The high-gravity carbonation process for CO2 mineralization and product utilization as a green cement was evaluated using field operation data from the steelmaking industry. The effect of key operating factors, including rotation speed, liquid-to-solid ratio, gas flow rate, and slurry flow rate, on CO2 removal efficiency was studied. The results indicated that a maximal CO2 removal of 97.3% was achieved using basic oxygen furnace slag at a gas-to-slurry ratio of 40, with a capture capacity of 165 kg of CO2 per day. In addition, the product with different carbonation conversions (i.e., 0%, 17%, and 48%) was used as supplementary cementitious materials in blended cement at various substitution ratios (i.e., 0%, 10%, and 20%). The performance of the blended cement mortar, including physicochemical properties, morphology, mineralogy, compressive strength, and autoclave soundness, was evaluated. The results indicated that the mortar with a high carbonation conversion of slag exhibited a higher mechanical strength in the early stage than pure portland cement mortar, suggesting its suitability for use as a high early strength cement. It also possessed superior soundness compared to the mortar using fresh slag. Furthermore, the optimal operating conditions of the high-gravity carbonation were determined by response surface models for maximizing CO2 removal efficiency and minimizing energy consumption. PMID:26397167

  20. A critical knowledge pathway to low-carbon, sustainable futures: Integrated understanding of urbanization, urban areas, and carbon

    NASA Astrophysics Data System (ADS)

    Romero-Lankao, Patricia; Gurney, Kevin R.; Seto, Karen C.; Chester, Mikhail; Duren, Riley M.; Hughes, Sara; Hutyra, Lucy R.; Marcotullio, Peter; Baker, Lawrence; Grimm, Nancy B.; Kennedy, Christopher; Larson, Elisabeth; Pincetl, Stephanie; Runfola, Dan; Sanchez, Landy; Shrestha, Gyami; Feddema, Johannes; Sarzynski, Andrea; Sperling, Joshua; Stokes, Eleanor

    2014-10-01

    Independent lines of research on urbanization, urban areas, and carbon have advanced our understanding of some of the processes through which energy and land uses affect carbon. This synthesis integrates some of these diverse viewpoints as a first step toward a coproduced, integrated framework for understanding urbanization, urban areas, and their relationships to carbon. It suggests the need for approaches that complement and combine the plethora of existing insights into interdisciplinary explorations of how different urbanization processes, and socio-ecological and technological components of urban areas, affect the spatial and temporal patterns of carbon emissions, differentially over time and within and across cities. It also calls for a more holistic approach to examining the carbon implications of urbanization and urban areas, based not only on demographics or income but also on other interconnected features of urban development pathways such as urban form, economic function, economic-growth policies, and other governance arrangements. It points to a wide array of uncertainties around the urbanization processes, their interactions with urban socio-institutional and built environment systems, and how these impact the exchange of carbon flows within and outside urban areas. We must also understand in turn how carbon feedbacks, including carbon impacts and potential impacts of climate change, can affect urbanization processes. Finally, the paper explores options, barriers, and limits to transitioning cities to low-carbon trajectories, and suggests the development of an end-to-end, coproduced and integrated scientific understanding that can more effectively inform the navigation of transitional journeys and the avoidance of obstacles along the way.

  1. Lung Macrophages “Digest” Carbon Nanotubes Using a Superoxide/Peroxynitrite Oxidative Pathway

    PubMed Central

    2015-01-01

    In contrast to short-lived neutrophils, macrophages display persistent presence in the lung of animals after pulmonary exposure to carbon nanotubes. While effective in the clearance of bacterial pathogens and injured host cells, the ability of macrophages to “digest” carbonaceous nanoparticles has not been documented. Here, we used chemical, biochemical, and cell and animal models and demonstrated oxidative biodegradation of oxidatively functionalized single-walled carbon nanotubes via superoxide/NO* ? peroxynitrite-driven oxidative pathways of activated macrophages facilitating clearance of nanoparticles from the lung. PMID:24871084

  2. The major DNA repair pathway after both proton and carbon-ion radiation is NHEJ, but the HR pathway is more relevant in carbon ions.

    PubMed

    Gerelchuluun, Ariungerel; Manabe, Eri; Ishikawa, Takaaki; Sun, Lue; Itoh, Kazuya; Sakae, Takeji; Suzuki, Kenshi; Hirayama, Ryoichi; Asaithamby, Aroumougame; Chen, David J; Tsuboi, Koji

    2015-03-01

    The purpose of this study was to identify the roles of non-homologous end-joining (NHEJ) or homologous recombination (HR) pathways in repairing DNA double-strand breaks (DSBs) induced by exposure to high-energy protons and carbon ions (C ions) versus gamma rays in Chinese hamster cells. Two Chinese hamster cell lines, ovary AA8 and lung fibroblast V79, as well as various mutant sublines lacking DNA-PKcs (V3), X-ray repair cross-complementing protein-4 [XRCC4 (XR1), XRCC3 (irs1SF) and XRCC2 (irs1)] were exposed to gamma rays ((137)Cs), protons (200 MeV; 2.2 keV/?m) and C ions (290 MeV; 50 keV/?m). V3 and XR1 cells lack the NHEJ pathway, whereas irs1 and irs1SF cells lack the HR pathway. After each exposure, survival was measured using a clonogenic survival assay, in situ DSB induction was evaluated by immunocytochemical analysis of histone H2AX phosphorylation at serine 139 (?-H2AX foci) and chromosome aberrations were examined using solid staining. The findings from this study showed that clonogenic survival clearly depended on the NHEJ and HR pathway statuses, and that the DNA-PKcs(-/-) cells (V3) were the most sensitive to all radiation types. While protons and ? rays yielded almost the same biological effects, C-ion exposure greatly enhanced the sensitivity of wild-type and HR-deficient cells. However, no significant enhancement of sensitivity in cell killing was seen after C-ion irradiation of NHEJ deficient cells. Decreases in the number of ?-H2AX foci after irradiation occurred more slowly in the NHEJ deficient cells. In particular, V3 cells had the highest number of residual ?-H2AX foci at 24 h after C-ion irradiation. Chromosomal aberrations were significantly higher in both the NHEJ- and HR-deficient cell lines than in wild-type cell lines in response to all radiation types. Protons and gamma rays induced the same aberration levels in each cell line, whereas C ions introduced higher but not significantly different aberration levels. Our results suggest that the NHEJ pathway plays an important role in repairing DSBs induced by both clinical proton and C-ion beams. Furthermore, in C ions the HR pathway appears to be involved in the repair of DSBs to a greater extent compared to gamma rays and protons. PMID:25738894

  3. Photosynthetic carbon reduction pathway is absent in chloroplasts of Vicia faba guard cells

    PubMed Central

    Outlaw, William H.; Manchester, Jill; DiCamelli, Cynthia A.; Randall, Douglas D.; Rapp, Barbara; Veith, George M.

    1979-01-01

    Four cell types from Vicia faba Linnaeus “Long Pod” leaflets were assayed for three enzymes unique to the photosynthetic carbon reduction pathway. The enzymes were ribulosebisphosphate carboxylase [3-phospho-D-glycerate carboxy-lyase (dimerizing), EC 4.1.1.39], phosphoribulokinase (ATP:D-ribulose-5-phosphate 1-phosphotransferase, EC 2.7.1.19), and glyceraldehyde-phosphate dehydrogenase (NADP+) (phosphorylating) [D-glyceraldehyde-3-phosphate:NADP+ oxidoreductase (phosphorylating), EC 1.2.1.13]. On a dry weight basis, these enzyme activities were about twice as high in palisade as in spongy parenchyma. Two of the enzymes were not detected in epidermal cells and the other was present in only a trace amount. In guard cells, these enzyme activities were absent or present at les than 1% of the amount in palisade cells. Immunoelectrophoresis showed that ribulosebisphosphate carboxylase was absent in extracts of guard cell protoplasts. Microscopy confirmed the abundance of typical guard cell chloroplasts. These results demonstrate the absence of the photosynthetic carbon reduction pathway in guard cell chloroplasts. This is the only chloroplast type known to be deficient in this pathway in plants whose primary CO2 acceptor is ribulose bisphosphate. Possible reasons for the absence of this pathway in guard cells are discussed. Images PMID:16592740

  4. Soil temperature and water content drive microbial carbon fixation in grassland of permafrost area on the Tibetan plateau

    NASA Astrophysics Data System (ADS)

    Kong, W.; Guo, G.; Liu, J.

    2014-12-01

    Soil microbial communities underpin terrestrial biogeochemical cycles and are greatly influenced by global warming and global-warming-induced dryness. However, the response of soil microbial community function to global change remains largely uncertain, particularly in the ecologically vulnerable Tibetan plateau permafrost area with large carbon storage. With the concept of space for time substitution, we investigated the responses of soil CO2-fixing microbial community and its enzyme activity to climate change along an elevation gradient (4400-5100 m) of alpine grassland on the central Tibetan plateau. The elevation gradient in a south-facing hill slope leads to variation in climate and soil physicochemical parameters. The autotrophic microbial communities were characterized by quantitative PCR (qPCR), terminal restriction fragment length polymorphism analysis (T-RFLP) and cloning/sequencing targeting the CO2-fixing gene (RubisCO). The results demonstrated that the autotrophic microbial community abundance, structure and its enzyme activity were mainly driven by soil temperature and water content. Soil temperature increase and water decrease dramatically reduced the abundance of the outnumbered form IC RubisCO-containing microbes, and significantly changed the structure of form IC, IAB and ID RubisCO-containing microbial community. Structural equation model revealed that the RubisCO enzyme was directly derived from RubisCO-containing microbes and its activity was significantly reduced by soil temperature increase and water content decrease. Thus our results provide a novel positive feedback loop of climate warming and warming-induced dryness by that soil microbial carbon fixing potential will reduce by 3.77%-8.86% with the soil temperature increase of 1.94oC and water content decrease of 60%-70%. This positive feedback could be capable of amplifying the climate change given the significant contribution of soil microbial CO2-fixing up to 4.9% of total soil organic carbon.

  5. Carbon Metabolic Pathways in Phototrophic Bacteria and Their Broader Evolutionary Implications

    PubMed Central

    Tang, Kuo-Hsiang; Tang, Yinjie J.; Blankenship, Robert Eugene

    2011-01-01

    Photosynthesis is the biological process that converts solar energy to biomass, bio-products, and biofuel. It is the only major natural solar energy storage mechanism on Earth. To satisfy the increased demand for sustainable energy sources and identify the mechanism of photosynthetic carbon assimilation, which is one of the bottlenecks in photosynthesis, it is essential to understand the process of solar energy storage and associated carbon metabolism in photosynthetic organisms. Researchers have employed physiological studies, microbiological chemistry, enzyme assays, genome sequencing, transcriptomics, and 13C-based metabolomics/fluxomics to investigate central carbon metabolism and enzymes that operate in phototrophs. In this report, we review diverse CO2 assimilation pathways, acetate assimilation, carbohydrate catabolism, the tricarboxylic acid cycle and some key, and/or unconventional enzymes in central carbon metabolism of phototrophic microorganisms. We also discuss the reducing equivalent flow during photoautotrophic and photoheterotrophic growth, evolutionary links in the central carbon metabolic network, and correlations between photosynthetic and non-photosynthetic organisms. Considering the metabolic versatility in these fascinating and diverse photosynthetic bacteria, many essential questions in their central carbon metabolism still remain to be addressed. PMID:21866228

  6. Integrated carbon dioxide/sludge gasification using waste heat from hot slags: syngas production and sulfur dioxide fixation.

    PubMed

    Sun, Yongqi; Zhang, Zuotai; Liu, Lili; Wang, Xidong

    2015-04-01

    The integrated CO2/sludge gasification using the waste heat in hot slags, was explored with the aim of syngas production, waste heat recovery and sewage sludge disposal. The results demonstrated that hot slags presented multiple roles on sludge gasification, i.e., not only a good heat carrier (500-950 °C) but also an effective desulfurizer (800-900 °C). The total gas yields increased from 0.022 kg/kgsludge at 500 °C to 0.422 kg/kgsludge at 900 °C; meanwhile, the SO2 concentration at 900 °C remarkably reduced from 164 ppm to 114 ppm by blast furnace slags (BFS) and 93 ppm by steel slags (SS), respectively. A three-stage reaction was clarified including volatile release, char transformation and fixed carbon using Gaussian fittings and the kinetic model was analyzed. Accordingly, a decline process using the integrated method was designed and the optimum slag/sludge ratio was deduced. These deciphered results appealed potential ways of reasonable disposal of sewage sludge and efficient recovery of waste heat from hot slags. PMID:25647028

  7. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.

    2015-04-01

    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher ?13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of ?13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ?31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of ?13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic compounds is critical for understanding deep subsurface ecosystems and the origin of organic compounds on Mars and other planets.

  8. Methanotrophy Induces Nitrogen Fixation in Boreal Mosses

    NASA Astrophysics Data System (ADS)

    Tiirola, M. A.

    2014-12-01

    Many methanotrophic bacterial groups fix nitrogen in laboratory conditions. Furthermore, nitrogen (N) is a limiting nutrient in many environments where methane concentrations are highest. Despite these facts, methane-induced N fixation has previously been overlooked, possibly due to methodological problems. To study the possible link between methanotrophy and diazotrophy in terrestrial and aquatic habitats, we measured the co-occurrence of these two processes in boreal forest, peatland and stream mosses using a stable isotope labeling approach (15 N2 and 13 CH4 double labeling) and sequencing of the nifH gene marker. N fixation associated with forest mosses was dependent on the annual N deposition, whereas methane stimulate N fixation neither in high (>3 kg N ha -1 yr -1) nor low deposition areas, which was in accordance with the nifH gene sequencing showing that forest mosses (Pleurozium schreberi and Hylocomium splendens ) carried mainly cyanobacterial N fixers. On the other extreme, in stream mosses (Fontinalis sp.) methane was actively oxidized throughout the year, whereas N fixation showed seasonal fluctuation. The co-occurrence of the two processes in single cell level was proven by co-localizing both N and methane-carbon fixation with the secondary ion mass spectrometry (SIMS) approach. Methanotrophy and diazotrophy was also studied in peatlands of different primary successional stages in the land-uplift coast of Bothnian Bay, in the Siikajoki chronosequence, where N accumulation rates in peat profiles indicate significant N fixation. Based on experimental evidence it was counted that methane-induced N fixation explained over one-third of the new N input in the younger peatland successional stages, where the highest N fixation rates and highest methane oxidation activities co-occurred in the water-submerged Sphagnum moss vegetation. The linkage between methanotrophic carbon cycling and N fixation may therefore constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. It is still an open issue whether methanotrophy induces N fixation directly or by enhancing phototrophic or heterotrophic N fixation.

  9. A Central Role for Carbon-Overflow Pathways in the Modulation of Bacterial Cell Death

    PubMed Central

    Thomas, Vinai Chittezham; Sadykov, Marat R.; Chaudhari, Sujata S.; Jones, Joselyn; Endres, Jennifer L.; Widhelm, Todd J.; Ahn, Jong-Sam; Jawa, Randeep S.; Zimmerman, Matthew C.; Bayles, Kenneth W.

    2014-01-01

    Similar to developmental programs in eukaryotes, the death of a subpopulation of cells is thought to benefit bacterial biofilm development. However mechanisms that mediate a tight control over cell death are not clearly understood at the population level. Here we reveal that CidR dependent pyruvate oxidase (CidC) and ?-acetolactate synthase/decarboxylase (AlsSD) overflow metabolic pathways, which are active during staphylococcal biofilm development, modulate cell death to achieve optimal biofilm biomass. Whereas acetate derived from CidC activity potentiates cell death in cells by a mechanism dependent on intracellular acidification and respiratory inhibition, AlsSD activity effectively counters CidC action by diverting carbon flux towards neutral rather than acidic byproducts and consuming intracellular protons in the process. Furthermore, the physiological features that accompany metabolic activation of cell death bears remarkable similarities to hallmarks of eukaryotic programmed cell death, including the generation of reactive oxygen species and DNA damage. Finally, we demonstrate that the metabolic modulation of cell death not only affects biofilm development but also biofilm-dependent disease outcomes. Given the ubiquity of such carbon overflow pathways in diverse bacterial species, we propose that the metabolic control of cell death may be a fundamental feature of prokaryotic development. PMID:24945831

  10. A thermodynamic solution model for calcium carbonate: Towards an understanding of multi-equilibria precipitation pathways.

    PubMed

    Donnet, Marcel; Bowen, Paul; Lemaître, Jacques

    2009-12-15

    Thermodynamic solubility calculations are normally only related to thermodynamic equilibria in solution. In this paper, we extend the use of such solubility calculations to help elucidate possible precipitation reaction pathways during the entire reaction. We also estimate the interfacial energy of particles using only solubility data by a modification of Mersmann's approach. We have carried this out by considering precipitation reactions as a succession of small quasi-equilibrium states. Thus possible equilibrium precipitation pathways can be evaluated by calculating the evolution of surface charge, particle size and/or interfacial energy during the ongoing reaction. The approach includes the use of the Kelvin's law to express the influence of particle size on the solubility constant of precipitates, the use of Nernst's law to calculate surface potentials from solubility calculations and relate this to experimentally measured zeta potentials. Calcium carbonate precipitation and zeta potential measurements of well characterised high purity calcite have been used as a model system to validate the calculated values. The clarification of the change in zeta potential on titration illustrates the power of this approach as a tool for reaction pathway prediction and hence knowledge based tailoring of precipitation reactions. PMID:19815226

  11. Amino Acid Biosynthesis Pathways in Diatoms

    PubMed Central

    Bromke, Mariusz A.

    2013-01-01

    Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

  12. Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria

    SciTech Connect

    Ferry, J.G.

    1991-01-01

    Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

  13. Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria

    SciTech Connect

    Ferry, J.G.

    1991-12-31

    Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

  14. Carbon and chlorine isotope analysis to identify abiotic degradation pathways of 1,1,1-trichloroethane.

    PubMed

    Palau, Jordi; Shouakar-Stash, Orfan; Hunkeler, Daniel

    2014-12-16

    This study investigates dual C-Cl isotope fractionation during 1,1,1-TCA transformation by heat-activated persulfate (PS), hydrolysis/dehydrohalogenation (HY/DH) and Fe(0). Compound-specific chlorine isotope analysis of 1,1,1-TCA was performed for the first time, and transformation-associated isotope fractionation ? bulk C and ? bulk Cl values were -4.0 ± 0.2‰ and no chlorine isotope fractionation with PS, -1.6 ± 0.2‰ and -4.7 ± 0.1‰ for HY/DH, -7.8 ± 0.4‰ and -5.2 ± 0.2‰ with Fe(0). Distinctly different dual isotope slopes (??13C/??37Cl): ? with PS, 0.33 ± 0.04 for HY/DH and 1.5 ± 0.1 with Fe(0) highlight the potential of this approach to identify abiotic degradation pathways of 1,1,1-TCA in the field. The trend observed with PS agreed with a C-H bond oxidation mechanism in the first reaction step. For HY/DH and Fe(0) pathways, different slopes were obtained although both pathways involve cleavage of a C-Cl bond in their initial reaction step. In contrast to the expected larger primary carbon isotope effects relative to chlorine for C-Cl bond cleavage, ? bulk C < ? bulk Cl was observed for HY/DH and in a similar range for reduction by Fe(0), suggesting the contribution of secondary chlorine isotope effects. Therefore, different magnitude of secondary chlorine isotope effects could at least be partly responsible for the distinct slopes between HY/DH and Fe(0) pathways. Following this dual isotope approach, abiotic transformation processes can unambiguously be identified and quantified. PMID:25379605

  15. New Pathways and Metrics for Enhanced, Reversible Hydrogen Storage in Boron-Doped Carbon Nanospaces

    SciTech Connect

    Pfeifer, Peter; Wexler, Carlos; Hawthorne, M. Frederick; Lee, Mark W.; Jalistegi, Satish S.

    2014-08-14

    This project, since its start in 2007—entitled “Networks of boron-doped carbon nanopores for low-pressure reversible hydrogen storage” (2007-10) and “New pathways and metrics for enhanced, reversible hydrogen storage in boron-doped carbon nanospaces” (2010-13)—is in support of the DOE's National Hydrogen Storage Project, as part of the DOE Hydrogen and Fuel Cells Program’s comprehensive efforts to enable the widespread commercialization of hydrogen and fuel cell technologies in diverse sectors of the economy. Hydrogen storage is widely recognized as a critical enabling technology for the successful commercialization and market acceptance of hydrogen powered vehicles. Storing sufficient hydrogen on board a wide range of vehicle platforms, at energy densities comparable to gasoline, without compromising passenger or cargo space, remains an outstanding technical challenge. Of the main three thrust areas in 2007—metal hydrides, chemical hydrogen storage, and sorption-based hydrogen storage—sorption-based storage, i.e., storage of molecular hydrogen by adsorption on high-surface-area materials (carbons, metal-organic frameworks, and other porous organic networks), has emerged as the most promising path toward achieving the 2017 DOE storage targets of 0.055 kg H2/kg system (“5.5 wt%”) and 0.040 kg H2/liter system. The objective of the project is to develop high-surface-area carbon materials that are boron-doped by incorporation of boron into the carbon lattice at the outset, i.e., during the synthesis of the material. The rationale for boron-doping is the prediction that boron atoms in carbon will raise the binding energy of hydro- gen from 4-5 kJ/mol on the undoped surface to 10-14 kJ/mol on a doped surface, and accordingly the hydro- gen storage capacity of the material. The mechanism for the increase in binding energy is electron donation from H2 to electron-deficient B atoms, in the form of sp2 boron-carbon bonds. Our team is proud to have demonstrated the predicted increase in binding energy experimentally, currently at ~10 kJ/mol. The synthetic route for incorporation of boron at the outset is to create appropriately designed copoly- mers, with a boron-free and a boron-carrying monomer, followed by pyrolysis of the polymer, yielding a bo- ron-substituted carbon scaffold in which boron atoms are bonded to carbon atoms by synthesis. This is in contrast to a second route (funded by DE-FG36-08GO18142) in which first high-surface area carbon is cre- ated and doped by surface vapor deposition of boron, with incorporation of the boron into the lattice the final step of the fabrication. The challenge in the first route is to create high surface areas without compromising sp2 boron-carbon bonds. The challenge in the second route is to create sp2 boron-carbon bonds without com- promising high surface areas.

  16. The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast

    SciTech Connect

    Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

    2007-08-08

    The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates.

  17. C1 metabolism in Corynebacterium glutamicum: an endogenous pathway for oxidation of methanol to carbon dioxide.

    PubMed

    Witthoff, Sabrina; Mühlroth, Alice; Marienhagen, Jan; Bott, Michael

    2013-11-01

    Methanol is considered an interesting carbon source in "bio-based" microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert (13)C-labeled methanol to (13)CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

  18. C1 Metabolism in Corynebacterium glutamicum: an Endogenous Pathway for Oxidation of Methanol to Carbon Dioxide

    PubMed Central

    Witthoff, Sabrina; Mühlroth, Alice

    2013-01-01

    Methanol is considered an interesting carbon source in “bio-based” microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert 13C-labeled methanol to 13CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

  19. Tight coupling of root-associated nitrogen fixation and plant photosynthesis in the salt marsh Spartina alterniflora and carbon dioxide enhancement of Nitrogenase activity

    SciTech Connect

    Whiting, G.J.; Gandy, E.L.; Yoch, D.C.

    1986-07-01

    The coupling of root-associated nitrogen fixation and plant photosynthesis was examined in the salt marsh grass Spartina alterniflora. In both field experiments and hydroponic assay chambers, nitrogen fixation associated with the roots was rapidly enhanced by stimulating plant photosynthesis. A kinetic analysis of acetylene reduction activity (ARA) showed that a five-to-sixfold stimulation occurred within 10 to 60 min after the plant leaves were exposed to light or increase CO/sub 2/ concentrations (with the light held constant). In field experiments, CO/sub 2/ enrichment increased plant-associated ARA by 27%. Further evidence of the dependence of ARA on plant photosynthate was obtained when activity in excised roots was shown to decrease after young greenhouse plants were placed in the dark. Seasonal variation in the ARA of excised plant roots from field cores appears to be related to the annual cycle of net photosynthesis in S. alterniflora.

  20. Using Phospholipids and Stable Carbon Isotopes to Assess Microbial Community Structures and Carbon Cycle Pathways in Kamchatka Hot Springs

    NASA Astrophysics Data System (ADS)

    Zhao, W.; Romanek, C. S.; Burgess, E. A.; Wiegel, J.; Mills, G.; Zhang, C. L.

    2006-12-01

    Phospholipid fatty acid (PLFA) and stable carbon isotopes were used to assess the microbial community structures in Kamchatka hot springs. Eighteen mats or surface sediments were collected from hot springs having temperatures of 31 to 91°C and pHs of 4.9 to 8.5. These samples were clearly separated into three groups according to the bacterial PLFA: 1) those dominated by terminally branched odd-numbered fatty acids, 2) those dominated by C18:1 and 3) those dominated by C20:1. With support from other minor PLFA components, group 2 may be used as biomarkers for Chloroflexales or other phototrophic bacteria and group 3 for Aquificales, respectively. Among the sampled hot springs, the Arkashin pool represents the simplest microbial structure with members of Aquificales being the dominant primary producers. On the other hand, the Zavarzin pool may represent the most heterogeneous pool that may include members of Chloroflexales and Aquificales as primary producers. Bacterial 16S rDNA clone libraries confirmed the presence of these microbial groups in the two pools. Results of stable carbon isotope fractionation between CO2 source, bulk biomass and total PLFA showed that primary producers in the Arkashin pool primarily used the reductive tricarboxylic acid (rTCA) cycle (e.g., members of Aquificales); whereas the Zavarzin pool may be a mixture of the 3-hydroxypropionate (3-HP) pathway (e.g. members of Chloroflexales) and the rTCA cycle. Bacterial contribution using the Calvin cycle was not significant and may be less important in Kamchatka hot springs.

  1. Carbon Nanotube Degradation in Macrophages: Live Nanoscale Monitoring and Understanding of Biological Pathway.

    PubMed

    Elgrabli, Dan; Dachraoui, Walid; Ménard-Moyon, Cécilia; Liu, Xiao Jie; Bégin, Dominique; Bégin-Colin, Sylvie; Bianco, Alberto; Gazeau, Florence; Alloyeau, Damien

    2015-10-27

    Despite numerous applications, the cellular-clearance mechanism of multiwalled carbon nanotubes (MWCNTs) has not been clearly established yet. Previous in vitro studies showed the ability of oxidative enzymes to induce nanotube degradation. Interestingly, these enzymes have the common capacity to produce reactive oxygen species (ROS). Here, we combined material and life science approaches for revealing an intracellular way taken by macrophages to degrade carbon nanotubes. We report the in situ monitoring of ROS-mediated MWCNT degradation by liquid-cell transmission electron microscopy. Two degradation mechanisms induced by hydroxyl radicals were extracted from these unseen dynamic nanoscale investigations: a non-site-specific thinning process of the walls and a site-specific transversal drilling process on pre-existing defects of nanotubes. Remarkably, similar ROS-induced structural injuries were observed on MWCNTs after aging into macrophages from 1 to 7 days. Beside unraveling oxidative transformations of MWCNT structure, we elucidated an important, albeit not exclusive, biological pathway for MWCNT degradation in macrophages, involving NOX2 complex activation, superoxide production, and hydroxyl radical attack, which highlights the critical role of oxidative stress in cellular processing of MWCNTs. PMID:26331631

  2. Temporal and Spatial Deployment of Carbon Dioxide Capture and Storage Technologies across the Representative Concentration Pathways

    SciTech Connect

    Dooley, James J.; Calvin, Katherine V.

    2011-04-18

    The Intergovernmental Panel on Climate Change’s (IPCC) Fifth Assessment (to be published in 2013-2014) will to a significant degree be built around four Representative Concentration Pathways (RCPs) that are intended to represent four scenarios of future development of greenhouse gas emissions, land use, and concentrations that span the widest range of potential future atmospheric radiative forcing. Under the very stringent climate policy implied by the 2.6 W/m2 overshoot scenario, all electricity is eventually generated from low carbon sources. However, carbon dioxide capture and storage (CCS) technologies never comprise more than 50% of total electricity generation in that very stringent scenario or in any of the other cases examined here. There are significant differences among the cases studied here in terms of how CCS technologies are used, with the most prominent being is the significant expansion of biomass+CCS as the stringency of the implied climate policy increases. Cumulative CO2 storage across the three cases that imply binding greenhouse gas constraints ranges by nearly an order of magnitude from 170GtCO2 (radiative forcing of 6.0W/m2 in 2100) to 1600GtCO2 (2.6W/m2 in 2100) over the course of this century. This potential demand for deep geologic CO2 storage is well within published estimates of total global CO2 storage capacity.

  3. Linearly Polymerized Benzene Arrays As Intermediates, Tracing Pathways to Carbon Nanothreads.

    PubMed

    Chen, Bo; Hoffmann, Roald; Ashcroft, N W; Badding, John; Xu, Enshi; Crespi, Vincent

    2015-11-18

    How might fully saturated benzene polymers of composition [(CH)6]n form under high pressure? In the first approach to answering this question, we examine the stepwise increase in saturation of a one-dimensional stack of benzene molecules by enumerating the partially saturated polymer intermediates, subject to constraints of unit cell size and energy. Defining the number of four-coordinate carbon atoms per benzene formula unit as the degree of saturation, a set of isomers for degree-two and degree-four polymers can be generated by either thinking of the propagation of partially saturated building blocks or by considering a sequence of cycloadditions. There is also one 4 + 2 reaction sequence that jumps directly from a benzene stack to a degree-four polymer. The set of degree-two polymers provides several useful signposts toward achieving full saturation: chiral versus achiral building blocks, certain forms of conformational freedom, and also dead ends to further saturation. These insights allow us to generate a larger set of degree-four polymers and enumerate the many pathways that lead from benzene stacks to completely saturated carbon nanothreads. PMID:26488180

  4. Dual Pathways of Carbon Monoxide-Mediated Vasoregulation: Modulation by Redox Mechanisms

    PubMed Central

    Lamon, Brian D.; Zhang, Frank F.; Puri, Nitin; Brodsky, Sergey V.; Goligorsky, Michael S.; Nasjletti, Alberto

    2009-01-01

    Rationale Vascular tissues produce carbon monoxide (CO) via HO-dependent and HO-independent mechanisms; the former in tandem with biliverdin and iron and the latter as a lone product. CO has been shown to function as both a vasoconstrictor and vasodilator, however, factors that dictate the vasoregulatory phenotype of this gas are unknown. Objective Herein, we demonstrate that CO-mediated vasoconstriction is mechanistically linked to enhanced reactive oxygen species (ROS) production that masks vasodilatory pathways. Methods and Results Sprague Dawley rat interlobar and interlobular arteries were examined in terms of superoxide (O2-) generation and vascular reactivity in the absence and presence of antioxidants. Both authentic CO and the CO-releasing molecule (CORM)-3 constricted renal arteries and increased O2- production in a dose-dependent manner. Antioxidants tempol, ebselen and deferoxamine inhibited CO-induced O2- production and converted CO from constrictor to dilator. CO-induced O2- generation was found to involve the activity of multiple oxidases including nitric oxide synthase, NADPH-oxidase, xanthine oxidase and complex IV of the mitochondrial electron chain. Furthermore, inhibition of these enzymes converted CO from constrictor to dilator. Similarly, biliverdin and bilirubin inhibited CO-induced O2- production and vasoconstriction, allowing for a vasodilatory response to CO to be expressed. CO-induced vasoconstriction was dependent on a non-thromboxane agonist of the thromboxane receptor, while vasodilatory mechanisms of CO relied on the activation of soluble guanylate cyclase and calcium-gated potassium channels. Conclusions CO-induced vasoconstriction involves the generation of ROS which, when negated, allows for the expression of vasodilatory pathways which are masked by the primary oxidative stress response to this gas. PMID:19745167

  5. Nitrogen fixation in peanut nodules during dark periods and detopped conditions with special reference to lipid bodies

    SciTech Connect

    Siddique, A.M.; Bal, A.K. )

    1991-03-01

    The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of {beta}-oxidation pathway and glyoxylate cycle is shown by the release of {sup 14}CO{sub 2} from {sup 14}C lineoleoyl coenzyme A by the nodule homogenate.

  6. Oxidation state, bioavailability & biochemical pathway define the fate of carbon in soil

    NASA Astrophysics Data System (ADS)

    Kuzyakov, Yakov; Apostel, Carolin; Gunina, Anna; Herrmann, Anke M.; Dippold, Michaela

    2015-04-01

    Numerous experiments under laboratory and field conditions analyzed microbial utilization and mean residence time (MRT) of carbon (C) from plant and microbial residues as well as root exudates in soil. Most of these studies tested the effects of various environmental factors, such as temperature, soil moisture, texture etc. on these parameters. However, only a few studies compared the properties of the substances themselves and there is no conceptual framework based on biochemical pathways. We hypothesize that the fate of C from organic substances in soil strongly depends on the first step of their microbial utilization, specifically, on biochemical pathway and initial C oxidation state, as well as its bioavailability in soils, defined by its hydrophobicity and molecular weight. Here we introduce and evaluate a new conceptual framework based on the following parameters: 1) C oxidation state, 2) molecular weight and hydrophobicity, 3) initial biochemical pathway of a substance class in microbial cells. To assess these parameters, two databases were prepared based on the literature and own studies. The first database included only the studies with 14C or 13C position specific labeled sugars, amino acids, carboxylic acids, phenols and lipids in soil. This database allowed us to analyze microbial utilization and mineralization of organics to CO2 depending on their C oxidation state (OS) and on functional groups. Additionally, we calculated data on the bond electronegativity of all compounds investigated in these studies. The second data base included the results of 14C and 13C studies with uniformly labeled substances of various classes. This database considered the free enthalpie (Delta H) per C unit from a variety of substrates differing in their aromaticity, hydrophobicity/electronegativity and location of the substance on the van Krevelen diagram. In addition, we calculated the hydrophobicity from the electronegativity of the individual bonds and recorded their molecular weight in our databases. For both data bases the decomposition rates and the MRT of C remaining in soil were calculated by the double first-order kinetics and related to the four parameter groups. The first database showed high correlation of mineralization rates to CO2 with the C oxidation state and biochemical pathway. Carboxyl group (OS = +3) was split at first from the skeleton of nearly all substances. In contrast, the methyl group (OS = -3) was mineralized as the slowest and after incorporation into microbial cells remained the longest period in soil. This general pattern reflects a clear preferential oxidation of already highly oxidized, polar functional groups. The initial use of substances within glucolysis (e.g. sugars) lead to a higher portion of remaining C in soil compared to C introduced via citric acid cycle (e.g. carboxylic acids). Concerning substance groups, the mineralization rates were the fastest for amino acids and sugars and the slowest for of the lipids - corresponding to their molecular weight and hydropobicity. This corresponded well with localization of the substance classes on the van Krevelen diagram. Generally, high oxidation state of the initial substance and consequently its low free enthalpy content lead to faster decomposition. In contrast, low oxidation state (e.g. lipids, aromatics) corresponds to high hydrophobicity and so, slow uptake from soil solution and utilization within microbial cells. Consequently, the optimum for microbial biomass utilization in soil and use for anabolic processes is common for sugars that have the oxidation state close to 0, have medium energy content and are hydrophilic. We conclude that from the tested substance properties, the oxidation state and biochemical pathway explained well the initial fate of C in soil, i.e. its mineralization to CO2 and incorporation into microbial biomass. Because the first step and microbial cycling are crucial for its further transformations, the same criteria are pivotal for C stabilization in soil.

  7. Integrated carboxylic carbon nanotube pathways with membranes for voltage-activated humidity detection and microclimate regulation.

    PubMed

    Pingitore, V; Miriello, D; Drioli, E; Gugliuzza, A

    2015-06-14

    This work describes some single walled carboxylic carbon nanotubes with outstanding transport properties when assembled in a 3D microarray working like a humidity membrane-sensor and an adjustable moisture regulator. Combined nano-assembly approaches are used to build up a better quality pathway through which assisted-charge and mass transport synchronically takes place. The structure-electrical response relationship is found, while controllable and tunable donor-acceptor interactions established at material interfaces are regarded as key factors for the accomplishment of charge transportation, enhanced electrical responses and adjustable moisture exchange. Raman and infrared spectroscopy provides indications about the fine structural and chemical features of the hybrid-composite membranes, resulting in perfect agreement with related morphology and electrical properties. Enhanced and modular electrical response to changes in the surrounding atmosphere is concerned with doping events, while assisted moisture regulation is discussed in relation to swelling and hopping actions. The electro-activated hybrid-composite membrane proposed in this work can be regarded as an attractive 'sense-to-act' precursor for smart long-distance monitoring systems with capability to adapt itself and provide local comfortable microenvironments. PMID:25939404

  8. Carbonic Anhydrase-8 Regulates Inflammatory Pain by Inhibiting the ITPR1-Cytosolic Free Calcium Pathway

    PubMed Central

    Zhuang, Gerald Z.; Keeler, Benjamin; Grant, Jeff; Bianchi, Laura; Fu, Eugene S.; Zhang, Yan Ping; Erasso, Diana M.; Cui, Jian-Guo; Wiltshire, Tim; Li, Qiongzhen; Hao, Shuanglin; Sarantopoulos, Konstantinos D.; Candiotti, Keith; Wishnek, Sarah M.; Smith, Shad B.; Maixner, William; Diatchenko, Luda; Martin, Eden R.; Levitt, Roy C.

    2015-01-01

    Calcium dysregulation is causally linked with various forms of neuropathology including seizure disorders, multiple sclerosis, Huntington’s disease, Alzheimer’s, spinal cerebellar ataxia (SCA) and chronic pain. Carbonic anhydrase-8 (Car8) is an allosteric inhibitor of inositol trisphosphate receptor-1 (ITPR1), which regulates intracellular calcium release fundamental to critical cellular functions including neuronal excitability, neurite outgrowth, neurotransmitter release, mitochondrial energy production and cell fate. In this report we test the hypothesis that Car8 regulation of ITPR1 and cytoplasmic free calcium release is critical to nociception and pain behaviors. We show Car8 null mutant mice (MT) exhibit mechanical allodynia and thermal hyperalgesia. Dorsal root ganglia (DRG) from MT also demonstrate increased steady-state ITPR1 phosphorylation (pITPR1) and cytoplasmic free calcium release. Overexpression of Car8 wildtype protein in MT nociceptors complements Car8 deficiency, down regulates pITPR1 and abolishes thermal and mechanical hypersensitivity. We also show that Car8 nociceptor overexpression alleviates chronic inflammatory pain. Finally, inflammation results in downregulation of DRG Car8 that is associated with increased pITPR1 expression relative to ITPR1, suggesting a possible mechanism of acute hypersensitivity. Our findings indicate Car8 regulates the ITPR1-cytosolic free calcium pathway that is critical to nociception, inflammatory pain and possibly other neuropathological states. Car8 and ITPR1 represent new therapeutic targets for chronic pain. PMID:25734498

  9. Potential release pathways, environmental fate, and ecological risks of carbon nanotubes.

    PubMed

    Petersen, Elijah J; Zhang, Liwen; Mattison, Nikolai T; O'Carroll, Denis M; Whelton, Andrew J; Uddin, Nasir; Nguyen, Tinh; Huang, Qingguo; Henry, Theodore B; Holbrook, R David; Chen, Kai Loon

    2011-12-01

    Carbon nanotubes (CNTs) are currently incorporated into various consumer products, and numerous new applications and products containing CNTs are expected in the future. The potential for negative effects caused by CNT release into the environment is a prominent concern and numerous research projects have investigated possible environmental release pathways, fate, and toxicity. However, this expanding body of literature has not yet been systematically reviewed. Our objective is to critically review this literature to identify emerging trends as well as persistent knowledge gaps on these topics. Specifically, we examine the release of CNTs from polymeric products, removal in wastewater treatment systems, transport through surface and subsurface media, aggregation behaviors, interactions with soil and sediment particles, potential transformations and degradation, and their potential ecotoxicity in soil, sediment, and aquatic ecosystems. One major limitation in the current literature is quantifying CNT masses in relevant media (polymers, tissues, soils, and sediments). Important new directions include developing mechanistic models for CNT release from composites and understanding CNT transport in more complex and environmentally realistic systems such as heteroaggregation with natural colloids and transport of nanoparticles in a range of soils. PMID:21988187

  10. Update: Biological Nitrogen Fixation.

    ERIC Educational Resources Information Center

    Wiseman, Alan; And Others

    1985-01-01

    Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,…

  11. The Fixation of Nitrogen.

    ERIC Educational Resources Information Center

    Andrew, S. P. S.

    1978-01-01

    Discusses the fixation of atmospheric nitrogen in the form of ammonia as one of the foundations of modern chemical industry. The article describes ammonia production and synthesis, purifying the hydrogen-nitrogen mix, nitric acid production, and its commericial plant. (HM)

  12. Soil Carbon Dynamics Along the Pathway From Diverse Microbial Carbon to Humus in a Temperate and Tropical Forest

    NASA Astrophysics Data System (ADS)

    Throckmorton, H. M.; Bird, J. A.; Firestone, M. K.; Horwath, W. R.

    2008-12-01

    This research investigates the importance of microbial biochemistry to humification pathways in two climatically different forest ecosystems; Blodgett forest (BF), a temperate forest in the Sierra Nevada and Luquillo forest (LF), a tropical forest in Puerto Rico. Non-living 13C enriched temperate and tropical microorganisms from four biochemically contrasting microbial groups (fungi, actinomycetes, bacteria gram (+), and bacteria gram (-)) were separately added to soil at both sites in a reciprocal transplant experiment. Decomposition rates were substantially greater at LF than BF for all microbial inputs. Although there were initial differences in microbial C turnover and recovery within the soil microbial biomass and dissolved organic carbon pools for unique microbial C inputs at both sites, over time treatment differences converge within each site and the quality of input microbial C becomes less important to C remaining and maintained within these soil C pools. Physical soil fractionation revealed important trends which illustrate the role of the soil mineral matrix to protect and stabilize C in soil. Results indicate different C turnover rates associated with the light, aggregate- occluded, and mineral-associated soil fractions at both sites. At BF input C recovered within the light and mineral-associated fractions decreased substantially over time (1 to 13 months), while C occluded within aggregates only slightly decreased. Similarly, LF soils exhibit only a slight decrease in aggregate-occluded C over time (0.5 to 3.5 months), while C recovered within the light fraction decreased substantially; however, unlike BF, LF soils exhibited only a slight decrease in C recovered within the mineral fraction. The distribution of total C among these physical soil pools differs substantially for either site, suggesting differences in the relative importance of the mineral matrix to protect and stabilize C. Preliminary compound-specific isotope analyses employing pyrolysis gas chromatography mass spectrometry and isotope ratio spectrometry (Py-GC-MS/IRMS) for temperate BF soils treated with 13C enriched temperate fungal residues indicates a substantial enrichment of low molecular weight (MW) compounds from microbial additions after 1 month in the field; however, after 5 months in the field the 13C enrichment shifts to higher MW compounds. These trends suggest higher MW compounds are formed through humification as synthesis or condensation products, which highlights the importance of monitoring biogeochemical transformations of unique sources of C over time. Future and ongoing work examines specific compounds associated with these high 13C enrichment values in an effort to understand the link between microbial C quality and humification products.

  13. Measurement of black carbon at Syowa station, Antarctica: seasonal variation, transport processes and pathways

    NASA Astrophysics Data System (ADS)

    Hara, K.; Osada, K.; Yabuki, M.; Hayashi, M.; Yamanouchi, T.; Shiobara, M.; Wada, M.

    2008-05-01

    Measurement of black carbon (BC) was carried out at Syowa station Antarctica (69° S, 39° E) from February 2004 until January 2007. The BC concentration at Syowa ranged from below detection to 176 ng m-3 during the measurements. Higher BC concentrations were observed mostly under strong wind (blizzard) conditions due to the approach of a cyclone and blocking event. The BC-rich air masses traveled from the lower troposphere of the Atlantic and Indian Oceans to Syowa (Antarctic coast). During the summer (November-February), the BC concentration showed a diurnal variation together with surface wind speed and increased in the katabatic wind from the Antarctic continent. Considering the low BC source strength in the Antarctic continent, the higher BC concentration in the continental air (katabatic wind) might be caused by long range transport of BC via the free troposphere from mid- and low- latitudes. The seasonal variation of BC at Syowa had a maximum in August, while at the other coastal stations (Halley, Neumayer, and Ferraz) and the continental station (Amundsen-Scott), the maximum occurred in October. This difference may result from different transport pathways and scavenging of BC by precipitation during the transport from the source regions. During the austral summer, long-range transport of BC via the free troposphere is likely to make an important contribution to the ambient BC concentration. The BC transport flux indicated that BC injection into the Antarctic region strongly depended on the frequency of storm (blizzard) conditions. The seasonal variation of BC transport flux increased by 290 mg m-2 month-1 in winter-spring when blizzards frequently occurred, whereas the flux decreased to lower than 50 mg m-2 month-1 in the summer with infrequent blizzards.

  14. Heme oxygenase/carbon monoxide pathway inhibition plays a role in ameliorating fibrosis following splenectomy.

    PubMed

    Wang, Qiu-Ming; Duan, Zhi-Jun; Du, Jian-Ling; Guo, Shi-Bin; Sun, Xiao-Yu; Liu, Zhen

    2013-05-01

    Splenectomy is a recognized therapy for liver cirrhosis with splenomegaly, since it decreases free iron concentration that accompanies the destruction of red blood cells. Heme oxygenase (HO)-1 and its by-products, iron and carbon monoxide (CO), play crucial roles in hepatic fibrosis. The aim of the present study was to determine whether splenectomy in cirrhotic rats induced by bile duct ligation (BDL), through the HO/CO pathway, could slow down the development of liver fibrosis. Male Sprague-Dawley rats were divided randomly into the sham, BDL, splenectomy, Fe, zinc protoporphyrin (Znpp) and cobalt protoporphyrin (Copp) treatment groups, for inhibiting and inducing HO-1 expression. The level of HO-1 was detected by western blot analysis and reverse transcription-polymerase chain reaction. Serum carboxyhemoglobin (COHb), iron and portal vein pressure (PVP) were also quantified. Liver iron was measured by atomic absorption spectrometry with acetylene-air flame atomization. HO-1 and ?-smooth muscle actin (?-SMA) were localized by immunohistochemistry. Liver and spleen iron were visualized by Perls' Prussian blue staining. Hepatic fibrosis was assessed using hematoxylin and eosin (H&E) staining. Enzyme-linked immunosorbent assay (ELISA) was used to detect serum transforming growth factor-?1 (TGF-?1). The results showed that liver, spleen and serum levels of HO-1, COHb and iron were greatly enhanced in the BDL group compared with the sham group; they were reduced following splenectomy and Znpp treatment, but were elevated in the Copp and Fe groups. Hydroxyproline, TGF-?1, ?-SMA, PVP and malonaldehyde levels were lower in the splenectomy and Znpp groups compared to BDL, while higher levels were observed in the Copp and Fe-treated groups. Our study shows that splenectomy reduces iron and CO levels in part by reducing HO-1 expression, and it decreases portal pressure and slightly decreases hepatic fibroproliferation. PMID:23525258

  15. Elementary Flux Mode Analysis Revealed Cyclization Pathway as a Powerful Way for NADPH Regeneration of Central Carbon Metabolism.

    PubMed

    Rui, Bin; Yi, Yin; Shen, Tie; Zheng, Meijuan; Zhou, Wenwei; Du, Honglin; Fan, Yadong; Wang, Yongkang; Zhang, Zhengdong; Xu, Shengsheng; Liu, Zhijie; Wen, Han; Xie, Xiaoyao

    2015-01-01

    NADPH regeneration capacity is attracting growing research attention due to its important role in resisting oxidative stress. Besides, NADPH availability has been regarded as a limiting factor in production of industrially valuable compounds. The central carbon metabolism carries the carbon skeleton flux supporting the operation of NADPH-regenerating enzyme and offers flexibility in coping with NADPH demand for varied intracellular environment. To acquire an insightful understanding of its NADPH regeneration capacity, the elementary mode method was employed to compute all elementary flux modes (EFMs) of a network representative of central carbon metabolism. Based on the metabolic flux distributions of these modes, a cluster analysis of EFMs with high NADPH regeneration rate was conducted using the self-organizing map clustering algorithm. The clustering results were used to study the relationship between the flux of total NADPH regeneration and the flux in each NADPH producing enzyme. The results identified several reaction combinations supporting high NADPH regeneration, which are proven to be feasible in cells via thermodynamic analysis and coincident with a great deal of previous experimental report. Meanwhile, the reaction combinations showed some common characteristics: there were one or two decarboxylation oxidation reactions in the combinations that produced NADPH and the combination constitution included certain gluconeogenesis pathways. These findings suggested cyclization pathways as a powerful way for NADPH regeneration capacity of bacterial central carbon metabolism. PMID:26086807

  16. Elementary Flux Mode Analysis Revealed Cyclization Pathway as a Powerful Way for NADPH Regeneration of Central Carbon Metabolism

    PubMed Central

    Shen, Tie; Zheng, Meijuan; Zhou, Wenwei; Du, Honglin; Fan, Yadong; Wang, Yongkang; Zhang, Zhengdong; Xu, Shengsheng; Liu, Zhijie; Wen, Han; Xie, Xiaoyao

    2015-01-01

    NADPH regeneration capacity is attracting growing research attention due to its important role in resisting oxidative stress. Besides, NADPH availability has been regarded as a limiting factor in production of industrially valuable compounds. The central carbon metabolism carries the carbon skeleton flux supporting the operation of NADPH-regenerating enzyme and offers flexibility in coping with NADPH demand for varied intracellular environment. To acquire an insightful understanding of its NADPH regeneration capacity, the elementary mode method was employed to compute all elementary flux modes (EFMs) of a network representative of central carbon metabolism. Based on the metabolic flux distributions of these modes, a cluster analysis of EFMs with high NADPH regeneration rate was conducted using the self-organizing map clustering algorithm. The clustering results were used to study the relationship between the flux of total NADPH regeneration and the flux in each NADPH producing enzyme. The results identified several reaction combinations supporting high NADPH regeneration, which are proven to be feasible in cells via thermodynamic analysis and coincident with a great deal of previous experimental report. Meanwhile, the reaction combinations showed some common characteristics: there were one or two decarboxylation oxidation reactions in the combinations that produced NADPH and the combination constitution included certain gluconeogenesis pathways. These findings suggested cyclization pathways as a powerful way for NADPH regeneration capacity of bacterial central carbon metabolism. PMID:26086807

  17. A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime

    NASA Technical Reports Server (NTRS)

    Carr, Mary-Elena

    1998-01-01

    A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

  18. Novel posterior fixation keratoprosthesis

    NASA Astrophysics Data System (ADS)

    Lacombe, Emmanuel

    1992-08-01

    The keratoprosthesis is the last solution for corneally blind patients that cannot benefit from corneal transplants. Keratoprostheses that have been designed to be affixed anteriorly usually necessitate multi-step surgical procedures and are continuously subjected to the extrusion forces generated by the positive intraocular pressure; therefore, clinical results in patients prove inconsistent. We proposed a novel keratoprosthesis concept that utilizes posterior corneal fixation which `a priori' minimizes the risk of aqueous leakage and expulsion. This prosthesis is implanted in a single procedure thereby reducing the number of surgical complications normally associated with anterior fixation devices. In addition, its novel design makes this keratoprosthesis implantable in phakic eyes. With an average follow-up of 13 months (range 3 to 25 months), our results on 21 cases are encouraging. Half of the keratoprostheses were implanted in severe burn cases, with the remainder in cases of pseudo- pemphigus. Good visual results and cosmetic appearance were obtained in 14 of 21 eyes.

  19. Regulation of Development and Nitrogen Fixation in Anabaena

    SciTech Connect

    James W Golden

    2004-08-05

    The nitrogen-fixing filamentous cyanobacterium Anabaena sp. strain PCC 7120 is being used as a simple model of microbial development and pattern formation in a multicellular prokaryotic organism. Anabaena reduces atmospheric nitrogen to ammonia in highly specialized, terminally differentiated cells called heterocysts. Anabaena is an important model system because of the multicellular growth pattern, the suspected antiquity of heterocyst development, and the contribution of fixed nitrogen to the environment. We are especially interested in understanding the molecular signaling pathways and genetic regulation that control heterocyst development. In the presence of an external source of reduced nitrogen, the differentiation of heterocysts is inhibited. When Anabaena is grown on dinitrogen, a one-dimensional developmental pattern of single heterocysts separated by approximately ten vegetative cells is established to form a multicellular organism composed of two interdependent cell types. The goal of this project is to understand the signaling and regulatory pathways that commit a vegetative cell to terminally differentiate into a nitrogen-fixing heterocyst. Several genes identified by us and by others were chosen as entry points into the regulatory network. Our research, which was initially focused on transcriptional regulation by group 2 sigma factors, was expanded to include group 3 sigma factors and their regulators after the complete Anabaena genome sequence became available. Surprisingly, no individual sigma factor is essential for heterocyst development. We have used the isolation of extragenic suppressors to study genetic interactions between key regulatory genes such as patS, hetR, and hetC in signaling and developmental pathways. We identified a hetR R223W mutation as a bypass suppressor of patS overexpression. Strains containing the hetR R223W allele fail to respond to pattern formation signals and overexpression of this allele results in a lethal phenotype because all cells differentiate a few days after nitrogen step-down. Our continued analysis of these genes will provide a better understanding of how a simple prokaryotic organism can perform both photosynthetic carbon fixation and nitrogen fixation simultaneously by separating these processes in different cell types.

  20. A batch study on the bio-fixation of carbon dioxide in the absorbed solution from a chemical wet scrubber by hot spring and marine algae.

    PubMed

    Hsueh, H T; Chu, H; Yu, S T

    2007-01-01

    Carbon dioxide mass transfer is a key factor in cultivating micro-algae except for the light limitation of photosynthesis. It is a novel idea to enhance mass transfer with the cyclic procedure of absorbing CO(2) with a high performance alkaline abosorber such as a packed tower and regenerating the alkaline solution with algal photosynthesis. Hence, the algae with high affinity for alkaline condition must be purified. In this study, a hot spring alga (HSA) was purified from an alkaline hot spring (pH 9.3, 62 degrees C) in Taiwan and grows well over pH 11.5 and 50 degrees C. For performance of HSA, CO(2) removal efficiencies in the packed tower increase about 5-fold in a suitable growth condition compared to that without adding any potassium hydroxide. But ammonia solution was not a good choice for this system with regard to carbon dioxide removal efficiency because of its toxicity on HSA. In addition, HSA also exhibits a high growth rate under the controlled pHs from 7 to 11. Besides, a well mass balance of carbon and nitrogen made sure that less other byproducts formed in the procedure of carboxylation. For analysis of some metals in HSA, such as Mg, Mn, Fe, Zn, related to the photosynthesis increased by a rising cultivated pH and revealed that those metals might be accumulated under alkaline conditions but the growth rate was still limited by the ratio of bicarbonate (useful carbon source) and carbonate. Meanwhile, Nannochlopsis oculta (NAO) was also tested under different additional carbon sources. The results revealed that solutions of sodium/potassium carbonate are better carbon sources than ammonia carbonate/bicarbonate for the growth of NAO. However, pH 9.6 of growth limitation based on sodium was lower than one of HSA. The integrated system is, therefore, more feasible to treat CO(2) in the flue gases using the algae with higher alkaline affinity such as HSA in small volume bioreactors. PMID:16860839

  1. Ammonia oxidation coupled to CO2 fixation by archaea and bacteria in an agricultural soil.

    PubMed

    Pratscher, Jennifer; Dumont, Marc G; Conrad, Ralf

    2011-03-01

    Ammonia oxidation is an essential part of the global nitrogen cycling and was long thought to be driven only by bacteria. Recent findings expanded this pathway also to the archaea. However, most questions concerning the metabolism of ammonia-oxidizing archaea, such as ammonia oxidation and potential CO(2) fixation, remain open, especially for terrestrial environments. Here, we investigated the activity of ammonia-oxidizing archaea and bacteria in an agricultural soil by comparison of RNA- and DNA-stable isotope probing (SIP). RNA-SIP demonstrated a highly dynamic and diverse community involved in CO(2) fixation and carbon assimilation coupled to ammonia oxidation. DNA-SIP showed growth of the ammonia-oxidizing bacteria but not of archaea. Furthermore, the analysis of labeled RNA found transcripts of the archaeal acetyl-CoA/propionyl-CoA carboxylase (accA/pccB) to be expressed and labeled. These findings strongly suggest that ammonia-oxidizing archaeal groups in soil autotrophically fix CO(2) using the 3-hydroxypropionate-4-hydroxybutyrate cycle, one of the two pathways recently identified for CO(2) fixation in Crenarchaeota. Catalyzed reporter deposition (CARD)-FISH targeting the gene encoding subunit A of ammonia monooxygenase (amoA) mRNA and 16S rRNA of archaea also revealed ammonia-oxidizing archaea to be numerically relevant among the archaea in this soil. Our results demonstrate a diverse and dynamic contribution of ammonia-oxidizing archaea in soil to nitrification and CO(2) assimilation and that their importance to the overall archaeal community might be larger than previously thought. PMID:21368116

  2. Understanding Nitrogen Fixation

    SciTech Connect

    Paul J. Chirik

    2012-05-25

    The purpose of our program is to explore fundamental chemistry relevant to the discovery of energy efficient methods for the conversion of atmospheric nitrogen (N{sub 2}) into more value-added nitrogen-containing organic molecules. Such transformations are key for domestic energy security and the reduction of fossil fuel dependencies. With DOE support, we have synthesized families of zirconium and hafnium dinitrogen complexes with elongated and activated N-N bonds that exhibit rich N{sub 2} functionalization chemistry. Having elucidated new methods for N-H bond formation from dihydrogen, C-H bonds and Broensted acids, we have since turned our attention to N-C bond construction. These reactions are particularly important for the synthesis of amines, heterocycles and hydrazines with a range of applications in the fine and commodity chemicals industries and as fuels. One recent highlight was the discovery of a new N{sub 2} cleavage reaction upon addition of carbon monoxide which resulted in the synthesis of an important fertilizer, oxamide, from the diatomics with the two strongest bonds in chemistry. Nitrogen-carbon bonds form the backbone of many important organic molecules, especially those used in the fertilizer and pharamaceutical industries. During the past year, we have continued our work in the synthesis of hydrazines of various substitution patterns, many of which are important precursors for heterocycles. In most instances, the direct functionalization of N{sub 2} offers a more efficient synthetic route than traditional organic methods. In addition, we have also discovered a unique CO-induced N{sub 2} bond cleavage reaction that simultaneously cleaves the N-N bond of the metal dinitrogen compound and assembles new C-C bond and two new N-C bonds. Treatment of the CO-functionalized core with weak Broensted acids liberated oxamide, H{sub 2}NC(O)C(O)NH{sub 2}, an important slow release fertilizer that is of interest to replace urea in many applications. The synthesis of ammonia, NH{sub 3}, from its elements, H{sub 2} and N{sub 2}, via the venerable Haber-Bosch process is one of the most significant technological achievements of the past century. Our research program seeks to discover new transition metal reagents and catalysts to disrupt the strong N {triple_bond} N bond in N{sub 2} and create new, fundamental chemical linkages for the construction of molecules with application as fuels, fertilizers and fine chemicals. With DOE support, our group has discovered a mild method for ammonia synthesis in solution as well as new methods for the construction of nitrogen-carbon bonds directly from N{sub 2}. Ideally these achievements will evolve into more efficient nitrogen fixation schemes that circumvent the high energy demands of industrial ammonia synthesis. Industrially, atmospheric nitrogen enters the synthetic cycle by the well-established Haber-Bosch process whereby N{sub 2} is hydrogenated to ammonia at high temperature and pressure. The commercialization of this reaction represents one of the greatest technological achievements of the 20th century as Haber-Bosch ammonia is responsible for supporting approximately 50% of the world's population and serves as the source of half of the nitrogen in the human body. The extreme reaction conditions required for an economical process have significant energy consequences, consuming 1% of the world's energy supply mostly in the form of pollution-intensive coal. Moreover, industrial H{sub 2} synthesis via the water gas shift reaction and the steam reforming of methane is fossil fuel intensive and produces CO{sub 2} as a byproduct. New synthetic methods that promote this thermodynamically favored transformation ({Delta}G{sup o} = -4.1 kcal/mol) under milder conditions or completely obviate it are therefore desirable. Most nitrogen-containing organic molecules are derived from ammonia (and hence rely on the Haber-Bosch and H{sub 2} synthesis processes) and direct synthesis from atmospheric nitrogen could, in principle, be more energy-efficient. This is particularly attractive giv

  3. A Dynamic Pathway for Stone-Wales Bond Rotation on Carbon Nanotubes through Diamond-Like Bonds

    NASA Technical Reports Server (NTRS)

    Wei, Chen-Yu; Srivastava, Deepak; Cho, Kyeong-Jae; Menon, Madhu

    2003-01-01

    A new lower energy barrier with a two-step pathway of Stone-Wales (SW) ,ond rotation on carbon nanotubes (CNTs) is found through molecular dynamics (MD) simulations of CNTs under tension. The first step involves going over to a stable sp3-like metastable configuration with half rotated and partially tilted C-C bond. The second step involves going over to the fully rotated C-C bond with the formation of a SW defect in the nanotube. The energy barrier for this two-step dynamic pathway is significantly lower than the previously known static barrier for in-plane rotation of the C-C bond on a tensile strained (> 4%) CNT.

  4. Microbial fixation of CO2 in water bodies and in drylands to combat climate change, soil loss and desertification.

    PubMed

    Rossi, Federico; Olguín, Eugenia J; Diels, Ludo; De Philippis, Roberto

    2015-01-25

    The growing concern for the increase of the global warming effects due to anthropogenic activities raises the challenge of finding novel technological approaches to stabilize CO2 emissions in the atmosphere and counteract impinging interconnected issues such as desertification and loss of biodiversity. Biological-CO2 mitigation, triggered through biological fixation, is considered a promising and eco-sustainable method, mostly owing to its downstream benefits that can be exploited. Microorganisms such as cyanobacteria, green algae and some autotrophic bacteria could potentially fix CO2 more efficiently than higher plants, due to their faster growth. Some examples of the potential of biological-CO2 mitigation are reported and discussed in this paper. In arid and semiarid environments, soil carbon sequestration (CO2 fixation) by cyanobacteria and biological soil crusts is considered an eco-friendly and natural process to increase soil C content and a viable pathway to soil restoration after one disturbance event. Another way for biological-CO2 mitigation intensively studied in the last few years is related to the possibility to perform carbon dioxide sequestration using microalgae, obtaining at the same time bioproducts of industrial interest. Another possibility under study is the exploitation of specific chemotrophic bacteria, such as Ralstonia eutropha (or picketii) and related organisms, for CO2 fixation coupled with the production chemicals such as polyhydroxyalkanoates (PHAs). In spite of the potential of these processes, multiple factors still have to be optimized for maximum rate of CO2 fixation by these microorganisms. The optimization of culture conditions, including the optimal concentration of CO2 in the provided gas, the use of metabolic engineering and of dual purpose systems for the treatment of wastewater and production of biofuels and high value products within a biorefinery concept, the design of photobioreactors in the case of phototrophs are some of the issues that, among others, have to be addressed and tested for cost-effective CO2 sequestration. PMID:24355428

  5. Exploring the Altered Dynamics of Mammalian Central Carbon Metabolic Pathway in Cancer Cells: A Classical Control Theoretic Approach

    PubMed Central

    Paul, Debjyoti; Dasgupta, Abhijit; De, Rajat K.

    2015-01-01

    Background In contrast with normal cells, most of the cancer cells depend on aerobic glycolysis for energy production in the form of adenosine triphosphate (ATP) bypassing mitochondrial oxidative phosphorylation. Moreover, compared to normal cells, cancer cells exhibit higher consumption of glucose with higher production of lactate. Again, higher rate of glycolysis provides the necessary glycolytic intermediary precursors for DNA, protein and lipid synthesis to maintain high active proliferation of the tumor cells. In this scenario, classical control theory based approach may be useful to explore the altered dynamics of the cancer cells. Since the dynamics of the cancer cells is different from that of the normal cells, understanding their dynamics may lead to development of novel therapeutic strategies. Method We have developed a model based on the state space equations of classical control theory along with an order reduction technique to mimic the actual dynamic behavior of mammalian central carbon metabolic (CCM) pathway in normal cells. Here, we have modified Michaelis Menten kinetic equation to incorporate feedback mechanism along with perturbations and cross talks associated with a metabolic pathway. Furthermore, we have perturbed the proposed model to reduce the mitochondrial oxidative phosphorylation. Thereafter, we have connected proportional-integral (PI) controller(s) with the model for tuning it to behave like the CCM pathway of a cancer cell. This methodology allows one to track the altered dynamics mediated by different enzymes. Results and Discussions The proposed model successfully mimics all the probable dynamics of the CCM pathway in normal cells. Moreover, experimental results demonstrate that in cancer cells, a coordination among enzymes catalyzing pentose phosphate pathway and intermediate glycolytic enzymes along with switching of pyruvate kinase (M2 isoform) plays an important role to maintain their altered dynamics. PMID:26367460

  6. Nitrogen fixation apparatus

    DOEpatents

    Chen, Hao-Lin (Walnut Creek, CA)

    1984-01-01

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

  7. Regulation of autotrophic CO2 fixation in the archaeon Thermoproteus neutrophilus.

    PubMed

    Ramos-Vera, W Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

    2010-10-01

    Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO(2) fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes. PMID:20693323

  8. Rapid methods for the high yield synthesis of carbon-13 enriched intermediates of the pentose-phosphate pathway.

    PubMed

    Arora, K K; Collins, J G; MacLeod, J K; Williams, J F

    1988-07-01

    Methods for the synthesis of carbon-13 enriched substrates, intermediates and products of the pentose-phosphate pathway, viz. ribose, arabinose, xylulose and ribulose 5-phosphates, sedoheptulose mono- and bisphosphates, octulose (both the ido- and altro-epimers) mono- and bisphosphates, are described. The procedure of the classical Kiliani synthesis was adopted for the preparation of the two starting compounds, [1-13C]ribose and [1-13C]arabinose 5-phosphates. Using these initial reactants and enzymic methods involving the group-transferring enzymes, transketolase, aldolase and transaldolase, a variety of specifically 13C-labelled five-, six-, seven- and eight-carbon sugar phosphates were synthesized in high yield and purity. The isolation and authenticity of each of the 13C-labelled sugars were established by column, paper and thin layer chromatographic methods and specific enzymic assays. The purity and positional isotopic analysis of these sugar-P's were confirmed by 13C-NMR spectroscopy. These specifically 13C-enriched compounds are required for enzymatic, mechanistic and quantitative investigations of pentose-pathway reactions in animal, plant and tumour tissues in vitro and in vivo. PMID:3223986

  9. Eighth international congress on nitrogen fixation

    SciTech Connect

    Not Available

    1990-01-01

    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  10. Surgical rib fixation - technical aspects.

    PubMed

    Marasco, Silvana; Saxena, Pankaj

    2015-05-01

    Surgical rib fixation (SRF) for severe rib fracture injuries is increasingly becoming an accepted treatment modality. There is now adequate evidence in randomised controlled trials that rib fixation in flail chest patients reduces ventilator times, intensive care stay and costs of treatment in ventilator dependent patients [1-3]. Despite this, rib fixation has not become standard of care for these patients and remains a treatment modality practised by few centres, usually those with large trauma loads who see high volumes of severe rib fracture injury patients. The purpose of this article is to outline the available prostheses, indications, operative planning and techniques of rib fixation. Surgical approaches to rib fractures in anterior, lateral and posterior positions are described as are the use of currently available cortical and medullary fixation prostheses. PMID:25624272

  11. The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast

    NASA Astrophysics Data System (ADS)

    Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

    2008-01-01

    The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates. Using 7Be and 234Th XS, the sediment-mixing coefficient ( Db) was 4.3 ± 1.8 cm 2 y -1, a value that lies at the lower limit for marine environments, indicating that mixing was not important in these sediments at this time. Sediment accumulation rates ( Sa), estimated using 137Cs and 210Pb XS, were 0.16 ± 0.02 g cm -2 y -1. The supply rate of organic carbon to the sediment-water interface was 30 ± 3.9 mmol C m -2 d -1, of which ˜10% or 2.9 ± 0.44 mmol C m -2 d -1was lost from the system through burial below the 1-cm thick surface mixed layer. Measured fluxes of O 2 were 26 ± 3.8 mmol m -2 d -1 and equated to a carbon oxidation rate of 20 ± 3.3 mmol C m -2 d -1, which is an upper limit due to the potential for oxidation of additional reduced species. Using organic carbon gradients in the surface mixed layer, carbon oxidation was estimated at 2.6 ± 1.1 mmol C m -2 d -1. Independent estimates made using pore water concentration gradients of ammonium and C:N stoichiometry, equaled 2.8 ± 0.46 mmol C m -2 d -1. The flux of DOC out of the sediments (DOC efflux) was 5.6 ± 1.3 mmol C m -2 d -1. In general, while mass balance was achieved indicating the sediments were at steady state during this time, changes in environmental conditions within the bay and the surrounding area, mean this conclusion might not always hold. These results show that the majority of carbon oxidation occurred at the sediment-water interface, via O 2 reduction. This likely results from the high frequency of sediment resuspension events combined with the shallow sediment mixing zone, leaving anaerobic oxidants responsible for only ˜10-15% of the carbon oxidized in these sediments.

  12. Mimicking a natural pathway for de novo biosynthesis: natural vanillin production from accessible carbon sources

    PubMed Central

    Ni, Jun; Tao, Fei; Du, Huaiqing; Xu, Ping

    2015-01-01

    Plant secondary metabolites have been attracting people’s attention for centuries, due to their potentials; however, their production is still difficult and costly. The rich diversity of microbes and microbial genome sequence data provide unprecedented gene resources that enable to develop efficient artificial pathways in microorganisms. Here, by mimicking a natural pathway of plants using microbial genes, a new metabolic route was developed in E. coli for the synthesis of vanillin, the most widely used flavoring agent. A series of factors were systematically investigated for raising production, including efficiency and suitability of genes, gene dosage, and culture media. The metabolically engineered strain produced 97.2?mg/L vanillin from l-tyrosine, 19.3?mg/L from glucose, 13.3?mg/L from xylose and 24.7?mg/L from glycerol. These results show that the metabolic route enables production of natural vanillin from low-cost substrates, suggesting that it is a good strategy to mimick natural pathways for artificial pathway design. PMID:26329726

  13. Trophic structure and pathways of biogenic carbon flow in the eastern North Water Polynya

    NASA Astrophysics Data System (ADS)

    Tremblay, Jean-Éric; Hattori, Hiroshi; Michel, Christine; Ringuette, Marc; Mei, Zhi-Ping; Lovejoy, Connie; Fortier, Louis; Hobson, Keith A.; Amiel, David; Cochran, Kirk

    2006-10-01

    In the eastern North Water, most of the estimated annual new and net production of carbon (C) occurred during the main diatom bloom in 1998. During the bloom, at least 30% of total and new phytoplankton production occurred as dissolved organic carbon (DOC) and was unavailable for short-term assimilation into the herbivorous food web or sinking export. Based on particle interceptor traps and 234Th deficits, 27% of the particulate primary production (PP) sank out of the upper 50 m, with only 7% and 1% of PP reaching the benthos at shallow (?200 m) and deep (?500 m) sites, respectively. Mass balance calculations and grazing estimates agree that ?79% of PP was ingested by pelagic consumers between April and July. During this period, the vertical flux of biogenic silica (BioSi) at 50 m was equivalent to the total BioSi produced, indicating that all of the diatom production was removed from the euphotic zone as intact cells (direct sinking) or empty frustules (grazing or lysis). The estimated flux of empty frustules was consistent with rates of herbivory by the large, dominant copepods and appendicularians during incubations. Since the carbon demand of the dominant planktivorous bird, Alle alle, amounted to ?2% of the biomass synthesized by its main prey, the large copepod Calanus hyperboreus, most of the secondary carbon production was available to pelagic carnivores. Stable isotopes indicated that the biomass of predatory amphipods, polar cod and marine mammals was derived from these herbivores, but corresponding carbon fluxes were not quantified. Our analysis shows that a large fraction of PP in the eastern North Water was ingested by consumers in the upper 50 m, leading to substantial carbon respiration and DOC accumulation in surface waters. An increasingly early and prolonged opening of the Artic Ocean is likely to promote the productivity of the herbivorous food web, but not the short-term efficiency of the particulate, biological CO 2 pump.

  14. Carbon Supported Polyaniline as Anode Catalyst: Pathway to Platinum-Free Fuel Cells

    E-print Network

    Zabrodskii, A G; Malyshkin, V G; Sapurina, I Y

    2006-01-01

    The effectiveness of carbon supported polyaniline as anode catalyst in a fuel cell (FC) with direct formic acid electrooxidation is experimentally demonstrated. A prototype FC with such a platinum-free composite anode exhibited a maximum room-temperature specific power of about 5 mW/cm2

  15. Pathways and transformations of dissolved methane and dissolved inorganic carbon in Arctic tundra soils: Evidence from analysis of stable isotopes

    NASA Astrophysics Data System (ADS)

    Throckmorton, H.; Perkins, G.; Muss, J. D.; Smith, L. J.; Conrad, M. E.; Torn, M. S.; Heikoop, J. M.; Newman, B. D.; Wilson, C. J.; Wullschleger, S. D.

    2014-12-01

    Arctic soils contain a large pool of terrestrial C and are of great interest because of their potential for releasing significant amounts of carbon dioxide (CO2) and methane (CH4) to the atmosphere. Few attempts have been made, however, to derive quantitative budgets of CO2 and CH4 budgets for high-latitude ecosystems. Therefore, this study used naturally occurring geochemical and isotopic tracers to estimate production pathways and transformations of dissolved inorganic carbon (DIC = ? (total) dissolved CO2) and dissolved CH4 in soil pore waters from 17 locations (drainages) in Barrow, Alaska (USA) in July and September, 2013; and to approximate a complete balance of belowground C cycling at our sampling locations. Results suggest that CH4 was primarily derived from biogenic acetate fermentation, with a shift at 4 locations from July to September towards CO2 reduction as the dominant methanogenic pathway. A large majority of CH4 produced at the frost table methane was transferred directly to the atmosphere via plant roots and ebullition (94.0 ± 1.4% and 96.6 ± 5.0% in July and September). A considerable fraction of the remaining CH4 was oxidized to CO2 during upward diffusion in July and September, respectively. Methane oxidization produced <1% of CO2 relative to alternative production mechanisms in deep subsurface pore waters. The majority of subsurface CO2 was produced from anaerobic respiration, likely due to reduction of Fe oxides and humics (52 ± 6 to 100 ± 13%, on average) while CO2 produced from methanogenesis accounted for the remainder (0 ± 13% to 47 ± 6%, on average) for July and September, respectively. Dissolved CH4 and dissolved CO2 concentrations correlated with thaw depth, suggesting that Arctic ecosystems will likely produce and release a greater amount of greenhouse gasses under projected warming and deepening of active layer thaw depth under future climate change scenarios.

  16. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    SciTech Connect

    Snyder-Talkington, Brandi N.; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R.; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L.

    2013-10-15

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 ?g MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung inflammation and fibrosis were revealed. • Two functional, representative genes, ccl2 and vegfa, were validated in vitro.

  17. Multi-Walled Carbon Nanotubes Promote Cementoblast Differentiation and Mineralization through the TGF-?/Smad Signaling Pathway

    PubMed Central

    Li, Lu; Zhu, Zhimin; Xiao, Weixiong; Li, Lei

    2015-01-01

    Excretion of cementum by cementoblasts on the root surface is a process indispensable for the formation of a functional periodontal ligament. This study investigated whether carboxyl group-functionalized multi-walled carbon nanotubes (MWCNT-COOH) could enhance differentiation and mineralization of mammalian cementoblasts (OCCM-30) and the possible signaling pathway involved in this process. Cementoblasts were incubated with various doses of MWCNT-COOH suspension. Cell viability was detected, and a scanning electron microscopy (SEM) observed both the nanomaterials and the growth of cells cultured with the materials. Alizarin red staining was used to investigate the formation of calcium deposits. Real-time PCR and western blot were used to detect cementoblast differentiation and the underlying mechanisms through the expression of the osteogenic genes and the downstream effectors of the TGF-?/Smad signaling. The results showed that 5 µg/mL MWCNT-COOH had the most obvious effects on promoting differentiation without significant toxicity. Alp, Ocn, Bsp, Opn, Col1 and Runx2 gene expression was up-regulated. Smad2 and Smad3 mRNA was up-regulated, while Smad7 was first down-regulated on Day 3 and later up-regulated on Day 7. The elevated levels of phospho-Smad2/3 were also confirmed by western blot. In sum, the MWCNT-COOH promoted cementoblast differentiation and mineralization, at least partially, through interactions with the TGF-?/Smad pathway. PMID:25648319

  18. Delayed Turnover of Unphosphorylated Ssk1 during Carbon Stress Activates the Yeast Hog1 Map Kinase Pathway

    PubMed Central

    Vallejo, Milene Carmes; Mayinger, Peter

    2015-01-01

    In Saccharomyces cerevisiae, the Hog1 mitogen-activated protein kinase (MAPK) pathway coordinates the adaptation to osmotic stress and was recently reported to respond to acute changes in glucose levels. Similarly as in osmotic stress, glucose starvation leads to a transient accumulation of Hog1 in the nucleus. However, the kinetics and the mechanism of Hog1 activation are different for these stress conditions. During osmotic shock the activation of Hog1 can be transduced by either the Sho1 or the Sln1/Ypd1/Ssk1 branch. During glucose starvation the phosphorylation of Hog1 is slower and is completely dependent on Ssk1, but independent of Sho1. To characterize the mechanism of activation of Hog1 during carbon stress, we examined the turnover of Ssk1 protein levels upon glucose starvation in the presence of cycloheximide and monitored protein levels by western blotting. Our data demonstrate that unphosphorylated Ssk1 was quickly degraded during exponential growth and after osmotic stress but remained remarkably stable during glucose limitation. We conclude that glucose starvation induces a delay in the turnover of unphosphorylated Ssk1, which is sufficient to activate the Hog1 MAPK pathway. Although unphosphorylated Ssk1 is known to be degraded by the proteasome, its stabilization is apparently not due to changes in cellular localization or decrease in ubiquitination levels during glucose limitation. PMID:26340004

  19. Carbon nanotubes enhance intercalated disc assembly in cardiac myocytes via the ?1-integrin-mediated signaling pathway.

    PubMed

    Sun, Hongyu; Lü, Shuanghong; Jiang, Xiao-Xia; Li, Xia; Li, Hong; Lin, Qiuxia; Mou, Yongchao; Zhao, Yuwei; Han, Yao; Zhou, Jin; Wang, Changyong

    2015-07-01

    Carbon nanotubes (CNTs) offer a new paradigm for constructing functional cardiac patches and repairing myocardial infarction (MI). However, little is known about how CNTs enhance the mechanical integrity and electrophysiological function of cardiac myocytes. To address this issue, we investigated the regularity and precise mechanism of the influence of CNTs on the assembly of intercalated disc (IDs). Here, single walled CNTs incorporated into collagen substrates were utilized as growth supports for neonatal cardiomyocytes, which enhanced cardiomyocyte adhesion and maturation. Furthermore, through the use of immunohistochemical staining, western blotting, transmission electron microscopy, and intracellular calcium transient measurement, we discovered that the addition of CNTs remarkably increased ID-related protein expression and enhanced ID assembly and functionality. On that basis, we further explored the underlying mechanism for how CNTs enhanced ID assembly through the use of immunohistochemical staining and western blotting. We found that the ?1-integrin-mediated signaling pathway mediated CNT-induced upregulation of electrical and mechanical junction proteins. Notably, CNTs remarkably accelerated gap junction formation via activation of the ?1-integrin-mediated FAK/ERK/GATA4 pathway. These findings provide valuable insight into the mechanistic effects that CNTs have on neonatal cardiomyocyte performance and will have a significant impact on the future of nanomedical research. PMID:25934454

  20. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    SciTech Connect

    John J. Kilbane III

    2003-12-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage pathway. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum.

  1. Molecular Biology of Nitrogen Fixation

    ERIC Educational Resources Information Center

    Shanmugam, K. T.; Valentine, Raymond C.

    1975-01-01

    Reports that as a result of our increasing knowledge of the molecular biology of nitrogen fixation it might eventually be possible to increase the biological production of nitrogenous fertilizer from atmospheric nitrogen. (GS)

  2. Evaluation of Bone Fixation Implants 

    E-print Network

    Perkins, Luke 1990-

    2012-12-10

    This research investigates the effects of the human body on the mechanical, chemical, and morphological properties of the surface of internal fixation devices. Stainless steel and titanium devices that had failed were provided from the Shandong...

  3. Genetic regulation of nitrogen fixation in rhizobia.

    PubMed Central

    Fischer, H M

    1994-01-01

    This review presents a comparison between the complex genetic regulatory networks that control nitrogen fixation in three representative rhizobial species, Rhizobium meliloti, Bradyrhizobium japonicum, and Azorhizobium caulinodans. Transcription of nitrogen fixation genes (nif and fix genes) in these bacteria is induced primarily by low-oxygen conditions. Low-oxygen sensing and transmission of this signal to the level of nif and fix gene expression involve at least five regulatory proteins, FixL, FixJ, FixK, NifA, and RpoN (sigma 54). The characteristic features of these proteins and their functions within species-specific regulatory pathways are described. Oxygen interferes with the activities of two transcriptional activators, FixJ and NifA. FixJ activity is modulated via phosphorylation-dephosphorylation by the cognate sensor hemoprotein FixL. In addition to the oxygen responsiveness of the NifA protein, synthesis of NifA is oxygen regulated at the level of transcription. This type of control includes FixLJ in R. meliloti and FixLJ-FixK in A. caulinodans or is brought about by autoregulation in B. japonicum. NifA, in concert with sigma 54 RNA polymerase, activates transcription from -24/-12-type promoters associated with nif and fix genes and additional genes that are not directly involved in nitrogen fixation. The FixK proteins constitute a subgroup of the Crp-Fnr family of bacterial regulators. Although the involvement of FixLJ and FixK in nifA regulation is remarkably different in the three rhizobial species discussed here, they constitute a regulatory cascade that uniformly controls the expression of genes (fixNOQP) encoding a distinct cytochrome oxidase complex probably required for bacterial respiration under low-oxygen conditions. In B. japonicum, the FixLJ-FixK cascade also controls genes for nitrate respiration and for one of two sigma 54 proteins. Images PMID:7968919

  4. Carbon Fluxes between Primary Metabolism and Phenolic Pathway in Plant Tissues under Stress

    PubMed Central

    Caretto, Sofia; Linsalata, Vito; Colella, Giovanni; Mita, Giovanni; Lattanzio, Vincenzo

    2015-01-01

    Higher plants synthesize an amazing diversity of phenolic secondary metabolites. Phenolics are defined secondary metabolites or natural products because, originally, they were considered not essential for plant growth and development. Plant phenolics, like other natural compounds, provide the plant with specific adaptations to changing environmental conditions and, therefore, they are essential for plant defense mechanisms. Plant defensive traits are costly for plants due to the energy drain from growth toward defensive metabolite production. Being limited with environmental resources, plants have to decide how allocate these resources to various competing functions. This decision brings about trade-offs, i.e., promoting some functions by neglecting others as an inverse relationship. Many studies have been carried out in order to link an evaluation of plant performance (in terms of growth rate) with levels of defense-related metabolites. Available results suggest that environmental stresses and stress-induced phenolics could be linked by a transduction pathway that involves: (i) the proline redox cycle; (ii) the stimulated oxidative pentose phosphate pathway; and, in turn, (iii) the reduced growth of plant tissues. PMID:26556338

  5. Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds

    SciTech Connect

    John J. Kilbane II

    2005-10-01

    The objective of the project is to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. The selective cleavage of the second C-N bond has been challenging, and efforts to overcome that challenge have been the focus of recent research in this project. Enrichment culture experiments succeeded in isolating bacterial cultures that can metabolize 2-aminobiphenyl, but no enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl has been identified. Aniline is very similar to the structure of 2-aminobiphenyl and aniline dioxygenase catalyzes the conversion of aniline to catechol and ammonia. For the remainder of the project the emphasis of research will be to simultaneously express the genes for carbazole dioxygenase and for aniline dioxygenase in the same bacterial host and then to select for derivative cultures capable of using carbazole as the sole source of nitrogen.

  6. Carbon Fluxes between Primary Metabolism and Phenolic Pathway in Plant Tissues under Stress.

    PubMed

    Caretto, Sofia; Linsalata, Vito; Colella, Giovanni; Mita, Giovanni; Lattanzio, Vincenzo

    2015-01-01

    Higher plants synthesize an amazing diversity of phenolic secondary metabolites. Phenolics are defined secondary metabolites or natural products because, originally, they were considered not essential for plant growth and development. Plant phenolics, like other natural compounds, provide the plant with specific adaptations to changing environmental conditions and, therefore, they are essential for plant defense mechanisms. Plant defensive traits are costly for plants due to the energy drain from growth toward defensive metabolite production. Being limited with environmental resources, plants have to decide how allocate these resources to various competing functions. This decision brings about trade-offs, i.e., promoting some functions by neglecting others as an inverse relationship. Many studies have been carried out in order to link an evaluation of plant performance (in terms of growth rate) with levels of defense-related metabolites. Available results suggest that environmental stresses and stress-induced phenolics could be linked by a transduction pathway that involves: (i) the proline redox cycle; (ii) the stimulated oxidative pentose phosphate pathway; and, in turn, (iii) the reduced growth of plant tissues. PMID:26556338

  7. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    SciTech Connect

    John J. Kilbane II

    2004-10-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project was focused on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate deaminase. The objective of the final phase of the project will be to develop derivative C-N bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments resulted in the isolation of microbial cultures that utilize aromatic amides as sole nitrogen sources, several amidase genes were cloned and were included in directed evolution experiments to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. During the second year of the project (October, 2003-September, 2004) enrichment culture experiments succeeded in isolating a mixed bacterial culture that can utilize 2-aminobiphenyl as a sole nitrogen source, directed evolution experiments were focused on the aniline dioxygenase enzyme that is capable of deaminating aniline, and expression vectors were constructed to enable the expression of genes encoding C-N bond cleaving enzymes in Rhodococcus hosts. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum. Aromatic compounds such as carbazole are representative of the difficult-to-treat organonitrogen compounds most commonly encountered in petroleum. There are two C-N bonds in carbazole and the construction of a metabolic pathway for the removal of nitrogen from carbazole will require enzymes capable cleaving both C-N bonds. A multi-component enzyme, carbazole dioxygenase, which can selectively cleave the first C-N bond has been identified and the genes that encode this enzyme have been cloned, sequenced, and are being expressed in Rhodococcus erythropolis, a bacterial culture that tolerates exposure to petroleum. An enzyme capable of selectively cleaving the second C-N bond in carbazole has not yet been identified, but enrichment culture experiments have recently succeeded in isolating a bacterial culture that is a likely candidate and may possess a suitable enzyme. Research in the near future will verify if a suitable enzyme for the cleavage of the second C-N bond in carbazole has indeed been found, then the genes encoding a suitable enzyme will be identified, cloned, and sequenced. Ultimately genes encoding enzymes for selective cleavage of both C-N bonds in carbazole will be assembled into a new metabolic pathway and the ability of the resulting bacterial culture to remove nitrogen from petroleum will be determined.

  8. Specific inhibitors for identifying pathways for methane production from carbon monoxide by a nonadapted anaerobic mixed culture.

    PubMed

    Navarro, Silvia Sancho; Cimpoia, Ruxandra; Bruant, Guillaume; Guiot, Serge R

    2014-06-01

    Specific inhibitors such as 2-bromoethanesulfonate (BES) and vancomycin were employed in activity batch tests to decipher metabolic pathways that are preferentially used by a mixed anaerobic consortium (sludge from an anaerobic digester) to transform carbon monoxide (CO) into methane (CH4). We first evaluated the inhibitory effect of both BES and vancomycin on the microbial community, as well as the efficiency and stability of vancomycin at 35 °C, over time. The activity tests with CO2-H2, CO, glucose, acetate, formate, propionate, butyrate, methanol, and ethanol showed that vancomycin does not inhibit some Gram-negative bacteria, and 50 mmol/L BES effectively blocks CH4 production in the sludge. However, when sludge was incubated with propionate, butyrate, methanol, or ethanol as the sole energy and carbon source, methanogenesis was only partially inhibited by BES. Separate tests showed that 0.07 mmol/L vancomycin is enough to maintain its inhibitory efficiency and stability in the population for at least 32 days at 35 °C. Using the inhibitors above, it was demonstrated that CO conversion to CH4 is an indirect, 2-step process, in which the CO is converted first to acetate and subsequently to CH4. PMID:24896194

  9. Carbon isotopic composition of individual Precambrian microfossils

    NASA Technical Reports Server (NTRS)

    House, C. H.; Schopf, J. W.; McKeegan, K. D.; Coath, C. D.; Harrison, T. M.; Stetter, K. O.

    2000-01-01

    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

  10. Carbon isotopic composition of individual Precambrian microfossils

    NASA Astrophysics Data System (ADS)

    House, Christopher H.; Schopf, J. William; McKeegan, Kevin D.; Coath, Christopher D.; Harrison, T. Mark; Stetter, Karl O.

    2000-08-01

    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the ˜850 Ma Bitter Springs Formation, Australia, and the ˜2100 Ma Gunflint Formation, Canada. The ?13CPDB values from individual microfossils of the Bitter Springs Formation ranged from -21.3 ± 1.7‰ to -31.9 ± 1.2‰, and the ?13CPDB values from microfossils of the Gunflint Formation ranged from -32.4 ± 0.7‰ to -45.4 ± 1.2‰. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

  11. Carbon monoxide alleviates ethanol-induced oxidative damage and inflammatory stress through activating p38 MAPK pathway

    SciTech Connect

    Li, Yanyan; Gao, Chao; Shi, Yanru; Tang, Yuhan; Liu, Liang; Xiong, Ting; Du, Min; Xing, Mingyou; Liu, Liegang; Yao, Ping

    2013-11-15

    Stress-inducible protein heme oxygenase-1(HO-1) is well-appreciative to counteract oxidative damage and inflammatory stress involving the pathogenesis of alcoholic liver diseases (ALD). The potential role and signaling pathways of HO-1 metabolite carbon monoxide (CO), however, still remained unclear. To explore the precise mechanisms, ethanol-dosed adult male Balb/c mice (5.0 g/kg.bw.) or ethanol-incubated primary rat hepatocytes (100 mmol/L) were pretreated by tricarbonyldichlororuthenium (II) dimmer (CORM-2, 8 mg/kg for mice or 20 ?mol/L for hepatocytes), as well as other pharmacological reagents. Our data showed that CO released from HO-1 induction by quercetin prevented ethanol-derived oxidative injury, which was abolished by CO scavenger hemoglobin. The protection was mimicked by CORM-2 with the attenuation of GSH depletion, SOD inactivation, MDA overproduction, and the leakage of AST, ALT or LDH in serum and culture medium induced by ethanol. Moreover, CORM-2 injection or incubation stimulated p38 phosphorylation and suppressed abnormal Tnfa and IL-6, accompanying the alleviation of redox imbalance induced by ethanol and aggravated by inflammatory factors. The protective role of CORM-2 was abolished by SB203580 (p38 inhibitor) but not by PD98059 (ERK inhibitor) or SP600125 (JNK inhibitor). Thus, HO-1 released CO prevented ethanol-elicited hepatic oxidative damage and inflammatory stress through activating p38 MAPK pathway, suggesting a potential therapeutic role of gaseous signal molecule on ALD induced by naturally occurring phytochemicals. - Highlights: • CO alleviated ethanol-derived liver oxidative and inflammatory stress in mice. • CO eased ethanol and inflammatory factor-induced oxidative damage in hepatocytes. • The p38 MAPK is a key signaling mechanism for the protective function of CO in ALD.

  12. N2 fixation in eddies of the eastern tropical South Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Löscher, C. R.; Bourbonnais, A.; Dekaezemacker, J.; Charoenpong, C. N.; Altabet, M. A.; Bange, H. W.; Czeschel, R.; Hoffmann, C.; Schmitz, R. A.

    2015-11-01

    Mesoscale eddies play a major role in controlling ocean biogeochemistry. By impacting nutrient availability and water column ventilation, they are of critical importance for oceanic primary production. In the eastern tropical South Pacific Ocean off Peru, where a large and persistent oxygen deficient zone is present, mesoscale processes have been reported to occur frequently. However, investigations on their biological activity are mostly based on model simulations, and direct measurements of carbon and dinitrogen (N2) fixation are scarce. We examined an open ocean cyclonic eddy and two anticyclonic mode water eddies: a coastal one and an open ocean one in the waters off Peru along a section at 16° S in austral summer 2012. Molecular data and bioassay incubations point towards a difference between the active diazotrophic communities present in the cyclonic eddy and the anticyclonic mode water eddies. In the cyclonic eddy, highest rates of N2 fixation were measured in surface waters but no N2 fixation signal was detected at intermediate water depths. In contrast, both anticyclonic mode water eddies showed pronounced maxima in N2 fixation below the euphotic zone as evidenced by rate measurements and geochemical data. N2 fixation and carbon (C) fixation were higher in the young coastal mode water eddy compared to the older offshore mode water eddy. A co-occurrence between N2 fixation and biogenic N2, an indicator for N loss, indicated a link between N loss and N2 fixation in the mode water eddies, which was not observed for the cyclonic eddy. The comparison of two consecutive surveys of the coastal mode water eddy in November and December 2012 revealed also a reduction of N2 and C fixation at intermediate depths along with a reduction in chlorophyll by half, mirroring an aging effect in this eddy. Our data indicate an important role for anticyclonic mode water eddies in stimulating N2 fixation and thus supplying N offshore.

  13. Hydrogen coupled CO2 fixation in legume cropping systems

    NASA Astrophysics Data System (ADS)

    Philpott, T.; Cen, Y.; Layzell, D. B.; Kyser, K.; Scott, N. A.

    2009-05-01

    Electron flow from oxidation of excess H2 released by root nodules was shown to contribute to microbial CO2 fixation in soybean crops. This discovery has important implications for carbon storage in soils used to grow legumes; however, further research is needed to understand the fate and turnover time of this H2-coupled CO2 fixation. Isotopic labeling of soil through incubation with 13CO2 was used to elucidate movement of sequestered carbon into soil carbon pools. Measurement of isotopic shifts was determined using Isotope Ratio Mass Spectrometry. Preliminary experiments have confirmed CO2 uptake through an isotopic shift (?13C -20.4 to -14.5 ‰) in 24 hour incubated soils labeled with 13CO2 (1% v/v, 99.5 Atom%) under elevated H2 concentration (6000 ppm). Other incubation experiments have confirmed the biotic nature of observed CO2 uptake by comparing isotopic shifts in oven dried and autoclaved soils to moist soil. Under an elevated H2 atmosphere, no significant isotopic shift was observed in dry and autoclaved soils whereas moist soil showed an isotopic shift of ?13C -21.9 to 11.4 ‰ over 48 hours. Future experiments will involve longer incubations (7 days) and will be aimed at determining isotopic shifts within soil carbon pools. Samples will be incubated and fractionated into microbial biomass, light fraction carbon, and acid stable carbon and subsequent isotopic analysis will be carried out. This will help determine the distribution of H2- coupled fixed CO2 within soil carbon pools and the turnover time of sequestered carbon. This and further research may lead to modification of greenhouse gas coefficients for leguminous crops that includes a CO2 fixation component.

  14. Liquiritigenin Protects Rats from Carbon Tetrachloride Induced Hepatic Injury through PGC-1? Pathway.

    PubMed

    Zhang, Yiping; He, Yuanqiao; Yu, Hongbo; Ma, Fuying; Wu, Jianguo; Zhang, Xiaoyu

    2015-01-01

    The lack of effective treatment for liver cirrhosis and hepatocellular carcinomas imposes serious challenges to the healthcare system. Here, we investigated the efficacy and mechanism of liquiritigenin involved in preventing or retarding the progression of liver diseases in a rat model with chronic carbon tetrachloride (CCl4) exposure. Sprague Dawley rats were given CCl4 and lliquiritigenin alone or simultaneously for 8 weeks before liver was harvested to check histological changes by Hematoxylin and Eosin (H&E) staining, apoptosis by TUNEL assay, ROS by dihydroethidium staining, antioxidant enzyme activities and malondialdehyde using specific kits, and gene expression by quantitative real-time PCR and western blot. Chronic CCl4 exposure caused profound changes in liver histology with extensive hepatocyte death (necrosis and apoptosis), fat accumulation, and infiltration of inflammatory cells, accompanied by depressed activities of antioxidant enzymes, increased oxidative stress, elevated expression of inflammation and fibrotic genes, and downregulation of PGC-1?, ND1, and Bcl-x in rat liver. All these changes were abolished or alleviated by lliquiritigenin. The results demonstrated that liquiritigenin is effective in protecting liver from injury or treating chronic liver diseases. The modulation of PGC-1? and its downstream genes might play a critical role in relieving CCl4-induced hepatic pathogenesis by liquiritigenin. PMID:26199636

  15. Liquiritigenin Protects Rats from Carbon Tetrachloride Induced Hepatic Injury through PGC-1? Pathway

    PubMed Central

    Zhang, Yiping; He, Yuanqiao; Yu, Hongbo; Ma, Fuying; Wu, Jianguo; Zhang, Xiaoyu

    2015-01-01

    The lack of effective treatment for liver cirrhosis and hepatocellular carcinomas imposes serious challenges to the healthcare system. Here, we investigated the efficacy and mechanism of liquiritigenin involved in preventing or retarding the progression of liver diseases in a rat model with chronic carbon tetrachloride (CCl4) exposure. Sprague Dawley rats were given CCl4 and lliquiritigenin alone or simultaneously for 8 weeks before liver was harvested to check histological changes by Hematoxylin and Eosin (H&E) staining, apoptosis by TUNEL assay, ROS by dihydroethidium staining, antioxidant enzyme activities and malondialdehyde using specific kits, and gene expression by quantitative real-time PCR and western blot. Chronic CCl4 exposure caused profound changes in liver histology with extensive hepatocyte death (necrosis and apoptosis), fat accumulation, and infiltration of inflammatory cells, accompanied by depressed activities of antioxidant enzymes, increased oxidative stress, elevated expression of inflammation and fibrotic genes, and downregulation of PGC-1?, ND1, and Bcl-x in rat liver. All these changes were abolished or alleviated by lliquiritigenin. The results demonstrated that liquiritigenin is effective in protecting liver from injury or treating chronic liver diseases. The modulation of PGC-1? and its downstream genes might play a critical role in relieving CCl4-induced hepatic pathogenesis by liquiritigenin. PMID:26199636

  16. Levels of Daily Light Doses Under Changed Day-Night Cycles Regulate Temporal Segregation of Photosynthesis and N2 Fixation in the Cyanobacterium Trichodesmium erythraeum IMS101

    PubMed Central

    Cai, Xiaoni; Gao, Kunshan

    2015-01-01

    While the diazotrophic cyanobacterium Trichodesmium is known to display inverse diurnal performances of photosynthesis and N2 fixation, such a phenomenon has not been well documented under different day-night (L-D) cycles and different levels of light dose exposed to the cells. Here, we show differences in growth, N2 fixation and photosynthetic carbon fixation as well as photochemical performances of Trichodesmium IMS101 grown under 12L:12D, 8L:16D and 16L:8D L-D cycles at 70 ?mol photons m-2 s-1 PAR (LL) and 350 ?mol photons m-2 s-1 PAR (HL). The specific growth rate was the highest under LL and the lowest under HL under 16L:8D, and it increased under LL and decreased under HL with increased levels of daytime light doses exposed under the different light regimes, respectively. N2 fixation and photosynthetic carbon fixation were affected differentially by changes in the day-night regimes, with the former increasing directly under LL with increased daytime light doses and decreased under HL over growth-saturating light levels. Temporal segregation of N2 fixation from photosynthetic carbon fixation was evidenced under all day-night regimes, showing a time lag between the peak in N2 fixation and dip in carbon fixation. Elongation of light period led to higher N2 fixation rate under LL than under HL, while shortening the light exposure to 8 h delayed the N2 fixation peaking time (at the end of light period) and extended it to night period. Photosynthetic carbon fixation rates and transfer of light photons were always higher under HL than LL, regardless of the day-night cycles. Conclusively, diel performance of N2 fixation possesses functional plasticity, which was regulated by levels of light energy supplies either via changing light levels or length of light exposure. PMID:26258473

  17. Photochemical reaction pathways of carbon tetrabromide in solution probed by picosecond X-ray diffraction.

    PubMed

    Kong, Qingyu; Wulff, Michael; Lee, Jae Hyuk; Bratos, Savo; Ihee, Hyotcherl

    2007-11-01

    We report a liquid-phase time-resolved X-ray diffraction study that resolves the molecular structures of the short-lived intermediates formed in the photodissociation of tetrabromomethane in methanol. Time-resolved X-ray diffraction can detect all chemical species simultaneously, and the diffraction signal from each chemical species can be quantitatively calculated from molecular structures and compared with experimental data with high accuracy and precision. The photochemistry of carbon tetrahalides has long been explored to describe their reactions in the natural environment due to its relevance to ozone depletion. Excited with an ultraviolet optical pulse, the complicated photodissociation dynamics of CBr4 was followed in a wide temporal range from picoseconds up to microseconds and associated rate coefficients were determined by analyzing time-resolved diffraction patterns accumulated from 100 ps X-ray pulses. The homolytic cleavage of one C-Br bond in the parent CBr4 molecule yields the CBr3 and Br radicals, which escape from the solvent cage and combine nongeminately to form C2Br6 and Br2, respectively. C2Br6 eventually decays to give C2Br4 and Br2 as final stable products. Our diffraction data at the current signal-to-noise ratio could not provide any evidence for the geminate recombination of the CBr3 and Br radicals to form the Br2CBr-Br isomer or the solvated ion pair, implying that their formation is a minor channel compared with those observed clearly by time-resolved diffraction in this work. PMID:17939658

  18. Cognitive deficits induced by multi-walled carbon nanotubes via the autophagic pathway.

    PubMed

    Gao, Jing; Zhang, Xiaochen; Yu, Mei; Ren, Guogang; Yang, Zhuo

    2015-11-01

    Multi-walled carbon nanotubes (MWCNTs) have shown potential applications in many fields, especially in the field of biomedicine. Several studies have reported that MWCNTs induce apoptosis and oxidative damage in nerve cells during in vitro experiments. However, there are few studies focused on the neurotoxicity of MWCNTs used in vivo. Many studies have reported that autophagy, a cellular stress response to degrade damaged cell components, can be activated by diverse nanoparticles. In this study, we investigated the neurotoxic effects of MWCNTs on hippocampal synaptic plasticity and spatial cognition in rats. Then, we used an inhibitor of autophagy called chloroquine (CQ) to examine whether autophagy plays an important role in hippocampal synaptic plasticity, since this was damaged by MWCNTs. In this study, adult male Wister rats were randomly divided into three groups: a control group, a group treated with MWCNTs (2.5mg/kg/day) and a group treated with MWCNTs+CQ (20mg/kg/day). After two-weeks of intraperitoneal (i.p.) injections, rats were subjected to the Morris water maze (MWM) test, and the long-term potentiation (LTP) and other biochemical parameters were determined. Results showed that MWCNTs could induce cognitive deficits, histopathological alteration and changes of autophagy level (increased the ratio of LC3 II /LC3 I and the expression of Beclin-1). Furthermore, we found that CQ could suppress MWCNTs-induced autophagic flux and partly rescue the synapse deficits, which occurred with the down-regulation of NR2B (a subunit of NMDA receptor) and synaptophysin (SYP) in the hippocampus. Our results suggest that MWCNTs could induce cognitive deficits in vivo via the increased autophagic levels, and provide a potential strategy to avoid the adverse effects of MWCNTs. PMID:26327526

  19. NCI-Frederick PHL - Fixatives and Solutions

    Cancer.gov

    Services Price List Courier Services & Shipment Procedures Scheduling Contact Information Related Links Establishing an Account PHL Forms Staff Publications PHL Portal Fixatives and Solutions Routine fixatives: 10% Neutral Buffered Formalin (NBF) 37

  20. Missing nitrogen fixation in the Benguela region

    NASA Astrophysics Data System (ADS)

    Wasmund, Norbert; Struck, Ulrich; Hansen, Anja; Flohr, Anita; Nausch, Günther; Grüttmüller, Annett; Voss, Maren

    2015-12-01

    Opposing opinions on the importance of nitrogen fixation in the northern Benguela upwelling region provoked us to investigate the magnitude of nitrogen fixation in front of northern Namibia and southern Angola. Measurements of nitrogen fixation rates using the 15N method at 66 stations during seven cruises from 2008 to 2014 showed that, in general, the 15N content in the biomass did not increase after tracer incubation with 15N2, indicating that no nitrogen fixation occurred. Correspondingly, the filamentous nitrogen-fixing cyanobacterium Trichodesmium was almost not present. The abundant picocyanobacteria did obviously not perform nitrogen fixation to a significant degree. The artificial improvement of conditions for nitrogen fixation in mesocosm experiments, including phosphate and iron additions and a warmer temperature, failed to induce nitrogen fixation. A plausible explanation of these findings is a lack of conditioned cells for nitrogen fixation in the Benguela region.

  1. Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre

    PubMed Central

    Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel MM

    2012-01-01

    Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N2-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N2-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200?m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of 15N-labeled ammonium and leucine in our incubation experiments. N2-fixation was detectable throughout the upper 200?m at most stations, with rates ranging from 0.001 to 0.19?nM?N?h?1. N2-fixation in the SPG may account for the production of 8–20% of global oceanic new nitrogen. Interestingly, comparable 15N2-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

  2. Changes in North Atlantic nitrogen fixation controlled by ocean circulation.

    PubMed

    Straub, Marietta; Sigman, Daniel M; Ren, Haojia; Martínez-García, Alfredo; Meckler, A Nele; Hain, Mathis P; Haug, Gerald H

    2013-09-12

    In the ocean, the chemical forms of nitrogen that are readily available for biological use (known collectively as 'fixed' nitrogen) fuel the global phytoplankton productivity that exports carbon to the deep ocean. Accordingly, variation in the oceanic fixed nitrogen reservoir has been proposed as a cause of glacial-interglacial changes in atmospheric carbon dioxide concentration. Marine nitrogen fixation, which produces most of the ocean's fixed nitrogen, is thought to be affected by multiple factors, including ocean temperature and the availability of iron and phosphorus. Here we reconstruct changes in North Atlantic nitrogen fixation over the past 160,000?years from the shell-bound nitrogen isotope ratio ((15)N/(14)N) of planktonic foraminifera in Caribbean Sea sediments. The observed changes cannot be explained by reconstructed changes in temperature, the supply of (iron-bearing) dust or water column denitrification. We identify a strong, roughly 23,000-year cycle in nitrogen fixation and suggest that it is a response to orbitally driven changes in equatorial Atlantic upwelling, which imports 'excess' phosphorus (phosphorus in stoichiometric excess of fixed nitrogen) into the tropical North Atlantic surface. In addition, we find that nitrogen fixation was reduced during glacial stages 6 and 4, when North Atlantic Deep Water had shoaled to become glacial North Atlantic intermediate water, which isolated the Atlantic thermocline from excess phosphorus-rich mid-depth waters that today enter from the Southern Ocean. Although modern studies have yielded diverse views of the controls on nitrogen fixation, our palaeobiogeochemical data suggest that excess phosphorus is the master variable in the North Atlantic Ocean and indicate that the variations in its supply over the most recent glacial cycle were dominated by the response of regional ocean circulation to the orbital cycles. PMID:23965620

  3. Tissue fixation and the effect of molecular fixatives on downstream staining procedures

    PubMed Central

    Howat, William J.; Wilson, Beverley A.

    2014-01-01

    It is impossible to underplay the importance of fixation in histopathology. Whether the scientist is interested in the extraction of information on lipids, proteins, RNA or DNA, fixation is critical to this extraction. This review aims to give a brief overview of the current “state of play” in fixation and focus on the effect fixation, and particularly the effect of the newer brand of “molecular fixatives” have on morphology, histochemistry, immunohistochemistry and RNA/DNA analysis. A methodology incorporating the creation of a fixation tissue microarray for the study of the effect of fixation on histochemistry is detailed. PMID:24561827

  4. Binocular Fixation Disparity in Single Word Displays

    ERIC Educational Resources Information Center

    Paterson, Kevin B.; Jordan, Timothy R.; Kurtev, Stoyan

    2009-01-01

    It has been claimed that the recognition of words displayed in isolation is affected by the precise location at which they are fixated. However, this putative role for fixation location has yet to be reconciled with the finding from reading research that binocular fixations are often misaligned and, therefore, more than 1 location in a word is…

  5. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A fixation device is an AC-powered device intended for...

  6. Weakly Supervised Human Fixations Prediction.

    PubMed

    Zhang, Luming; Li, Xuelong; Nie, Liqiang; Yang, Yi; Xia, Yingjie

    2016-01-01

    Automatically predicting human eye fixations is a useful technique that can facilitate many multimedia applications, e.g., image retrieval, action recognition, and photo retargeting. Conventional approaches are frustrated by two drawbacks. First, psychophysical experiments show that an object-level interpretation of scenes influences eye movements significantly. Most of the existing saliency models rely on object detectors, and therefore, only a few prespecified categories can be discovered. Second, the relative displacement of objects influences their saliency remarkably, but current models cannot describe them explicitly. To solve these problems, this paper proposes weakly supervised fixations prediction, which leverages image labels to improve accuracy of human fixations prediction. The proposed model hierarchically discovers objects as well as their spatial configurations. Starting from the raw image pixels, we sample superpixels in an image, thereby seamless object descriptors termed object-level graphlets (oGLs) are generated by random walking on the superpixel mosaic. Then, a manifold embedding algorithm is proposed to encode image labels into oGLs, and the response map of each prespecified object is computed accordingly. On the basis of the object-level response map, we propose spatial-level graphlets (sGLs) to model the relative positions among objects. Afterward, eye tracking data is employed to integrate these sGLs for predicting human eye fixations. Thorough experiment results demonstrate the advantage of the proposed method over the state-of-the-art. PMID:26168451

  7. Transit Fixatives: An Innovative Study

    PubMed Central

    A, Ravi Prakash; G, Sreenath; JK, Sonia Bai; NDVN, Shyam

    2015-01-01

    Background: Universally accepted fixative is 10% formalin which has been used for preserving the tissues and their architecture. In certain conditions, formalin might not be readily available for immediate fixation. We here by explore more economical, eco-friendly and easily available solutions that can be used as transit media/ transporting media for tissue specimens. Materials and Methods: The study included commonly available solutions like Spirit, Saline, Betadine solution, Hydrogen peroxide (H2O2), Local anesthesia (L.A), Rose water, Coconut oil, Coconut water, Ice cold water, Honey and Milk while keeping formalin as control. The fresh tissue sample was cut into multiple bits and placed in different containers for a period of 8 hours before transferring to formalin solution. Conclusion: Transit fixatives are very important in certain situations where formalin is not readily available. These fixatives can be used to fix the tissues for a period of at least 8 hours without causing any damage or distortion before they are fixed in formalin solution. PMID:25954725

  8. Complications of Rigid Internal Fixation

    PubMed Central

    Campbell, Chris A.; Lin, Kant Y.

    2009-01-01

    Over the past 20 years, there have been many advances in the development of bone fixation systems used in the practice of craniomaxillofacial surgery. As surgical practices have evolved, the complications of each technologic advance have changed accordingly. Interfragmentary instability of interosseous wiring has been replaced by the risk of exposure, infection, and palpability of plate and screw fixation systems. The improved rigidity of plate fixation requires anatomic alignment of fracture fragments. Failure to obtain proper alignment has led to the phenomenon known as “open internal fixation” of fracture fragments without proper reduction. The size of the plates has decreased to minimize palpability and exposure. However limitations in their application have been encountered due to the physiologic forces of the muscles of mastication and bone healing. In the pediatric population, the long-standing presence of plates in the cranial vault resulted in reports of transcranial migration and growth restriction. These findings led to the development of resorbable plating systems, which are associated with self-limited plate palpability and soft tissue inflammatory reactions. Any rigid system including these produces growth restriction in varying amounts. In this discussion, we review the reported complication rates of miniplating and microplating systems as well as absorptive plating systems in elective and traumatic craniofacial surgery. PMID:22110796

  9. N? fixation by subsurface populations of Trichodesmium : an important source of new nitrogen to the North Atlantic Ocean

    E-print Network

    Heithoff, Abigail

    2011-01-01

    Trichodesmium, a genus of diazotrophic cyanobacteria, is an important contributor to the marine nitrogen (N) and carbon (C) cycles. The extent to which Trichodesmium dinitrogen (N2) fixation contributes to the marine N ...

  10. OVEREXPRESSION OF A NODULE-ENHANCED MALATE DEHYDROGENASE INCREASES NITROGEN FIXATION IN ALFALFA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Malate is crucial for symbiotic dinitrogen (N2) fixation, occurring in high concentrations in N2-fixing nodules as the major carbon source for bacteroid respiration. Malate also provides carbon skeletons for the assimilation of fixed nitrogen from ammonia into amino acids and is proposed to be invol...

  11. Options for acetabular fixation surfaces.

    PubMed

    Klika, Alison K; Murray, Trevor G; Darwiche, Hussein; Barsoum, Wael K

    2007-01-01

    Aseptic loosening is the most common cause for revision total hip arthroplasty (THA). Due to poor long-term results with cemented acetabular components, cementless implants that rely on biologic fixation became popular in the United States for both primary and revision procedures in the early 1980s. Cementless acetabular components used in THA have been reported to have superior radiographic performance compared with cemented fixation, although the optimal method of acetabular fixation remains controversial. Cementless acetabular components require initial implant stability to allow for bone ingrowth and remodeling into the acetabular shell, providing long-term durability of the prosthesis. Many improved implant materials are available to facilitate bone growth and remodeling, including the 3 most common surface treatments; fibermesh, sintered beads, and plasma spray coatings. Recently added to these are porous metal surfaces, which have increased porosity and optimal pore sizes when compared with titanium fibermesh. The most studied of these materials is the titanium fibermesh fixation surface, which has demonstrated a mechanical failure rate of 1% at 10 to 15 years. This technology utilizes the diffusion bonding process to attach fiber metal pads to a titanium substrate using heat and pressure. The sintered bead fixation surface offers a porous coating of various sizes of spherical beads, achieved by the sintering process, and has been shown to provide long-term fixation. While there are less long-term published data regarding the titanium plasma spray surface, its early results have provided evidence of its durability, even in the face of significant osteolysis. The most recently added alternative fixation surface is porous tantalum metal, which offers potentially greater bone ingrowth and bone graft incorporation due to its high porosity (80%) and low modulus of elasticity (3 MPa). Porous tantalum implants have shown early favorable clinical results and have been reported to have excellent bone graft incorporation of the acetabular component based on serial radiograph data at a minimum 1-year follow-up. Tritanium is a porous metal, which has emerged as a promising new surface technology for acetabular shells. While no clinical data are yet available, basic science research has demonstrated enhanced bone ingrowth and mechanical strength. PMID:19023943

  12. Analysis of gene expression profiles in healing rat fractures treated with nail and plate fixation.

    PubMed

    Wang, S D; Li, X L; Liu, H P

    2014-01-01

    To compare fracture healing therapies, the gene expression profiles of rat fracture samples treated with nail and plate fixation were analyzed at 1 day, 3 days, 1 week, 2 weeks, 4 weeks, and 6 weeks after surgery. The gene expression profiles GSE1685, which include 19 samples, were downloaded from the Gene Expression Omnibus database. After preprocessing, the gene expression profiles were subjected to time series analysis using the Short Time-series Expression Miner software, and the significantly differentially expressed gene (DEG) sets were selected. Further, the distributions of those DEG sets on the corresponding chromosomes were identified using the functional classification tool. Finally, the DEGs were subjected to function and pathway enrichment analysis. DEG analysis indicated that the number of DEGs (854 genes) from nail fixation was significantly lower than that of DEGs (1029 genes) from plate fixation. The DEGs were mainly enriched in cell proliferation, cellular localization, and response to wounding functions. Several critical DEGs expressed during the fracture healing process were screened, and 2 common pathways were enriched for the DEGs in the nail fixation and plate fixation. These DEGs and pathways may be potential targets or predictive markers during fracture healing. PMID:25366739

  13. Evolution of fracture and fault-controlled fluid pathways in carbonates of the Albanides fold-thrust belt

    USGS Publications Warehouse

    Graham, Wall B.R.; Girbacea, R.; Mesonjesi, A.; Aydin, A.

    2006-01-01

    The process of fracture and fault formation in carbonates of the Albanides fold-thrust belt has been systematically documented using hierarchical development of structural elements from hand sample, outcrop, and geologic-map scales. The function of fractures and faults in fluid migration was elucidated using calcite cement and bitumen in these structures as a paleoflow indicator. Two prefolding pressure-solution and vein assemblages were identified: an overburden assemblage and a remote tectonic stress assemblage. Sheared layer-parallel pressure-solution surfaces of the overburden assemblage define mechanical layers. Shearing of mechanical layers associated with folding resulted in the formation of a series of folding assemblage fractures at different orientations, depending on the slip direction of individual mechanical layers. Prefolding- and folding-related fracture assemblages together formed fragmentation zones in mechanical layers and are the sites of incipient fault localization. Further deformation along these sites was accommodated by rotation and translation of fragmented rock, which formed breccia and facilitated fault offset across multiple mechanical layers. Strike-slip faults formed by this process are organized in two sets in an apparent conjugate pattern. Calcite cement and bitumen that accumulated along fractures and faults are evidence of localized fluid flow along fault zones. By systematic identification of fractures and faults, their evolution, and their fluid and bitumen contents, along with subsurface core and well-log data, we identify northeast-southwest-trending strike-slip faults and the associated structures as dominant fluid pathways in the Albanides fold-thrust belt. Copyright ?? 2006. The American Association of Petroleum Geologists. All rights reserved.

  14. Determination of pathways of glycogen synthesis and the dilution of the three-carbon pool with (U- sup 13 C)glucose

    SciTech Connect

    Katz, J.; Wals, P.A. ); Lee, W.N.P. )

    1991-03-15

    Rats were infused with glucose at 30 mg/min, containing 18% enriched (U-{sup 13}C)glucose and (1-{sup 14}C)- and (3-{sup 3}H)glucose and liver glycogen were determined by gas chromatography/mass spectroscopy. The contribution of the direct pathway to glycogen was calculated from the three tracers, and the values by all three were nearly identical, about 50%. The {sup 14}C specific activity in carbon 6 of glycogen glucose was about 6% that of carbon 1. The ({sup 3}H)glucose/(1-{sup 14}C)glucose ratio in glycogen was 80-90% that is blood glucose. The enrichment of {sup 13}C and the specific activity of {sup 14}C in glycogen formed by the indirect path were 20-25% of glycogen formed directly from glucose. The dilution is of two kinds: (1) an exchange of labeled carbon with unlabeled carbon in the tricarboxylic acid cycle and (2) dilution by unlabeled nonglucose carbon. Methods to calculate the two types of dilution are presented. In rate preinjected with glucagon, the dilution through the tricarboxylic acid cycle was unaffected but that by nonglucose carbon was decreased.

  15. External fixation in the elderly.

    PubMed

    Andruszkow, Hagen; Pfeifer, Roman; Horst, Klemens; Hildebrand, Frank; Pape, Hans-Christoph

    2015-09-01

    Orthopaedic trauma is an increasingly common problem in geriatric patients. As demands of daily life and recreational activities are increasing in these patients, surgeons need to be able to manage geriatric fractures to achieve good functional results. Reduced bone quality in the elderly presents a considerable challenge and may preclude the use of established surgical stabilisation techniques that are performed in younger trauma patients. Furthermore, pre-existing medical conditions and considerable comorbidities in the elderly could complicate standard surgical procedures that younger patients would be offered. In this respect, application of external fixators represents a validated, minimally-invasive treatment opportunity. This review article summarises the use of external fixation in geriatric trauma patients for wrist fractures, proximal femoral fractures, pelvic fractures, and ankle fractures. Modern modifications, like pin coating with hydroxyapatite, and aspects of pin care will be discussed. PMID:26458299

  16. Fixation strategies for retinal immunohistochemistry.

    PubMed

    Stradleigh, Tyler W; Ishida, Andrew T

    2015-09-01

    Immunohistochemical and ex vivo anatomical studies have provided many glimpses of the variety, distribution, and signaling components of vertebrate retinal neurons. The beauty of numerous images published to date, and the qualitative and quantitative information they provide, indicate that these approaches are fundamentally useful. However, obtaining these images entailed tissue handling and exposure to chemical solutions that differ from normal extracellular fluid in composition, temperature, and osmolarity. Because the differences are large enough to alter intercellular and intracellular signaling in neurons, and because retinae are susceptible to crush, shear, and fray, it is natural to wonder if immunohistochemical and anatomical methods disturb or damage the cells they are designed to examine. Tissue fixation is typically incorporated to guard against this damage and is therefore critically important to the quality and significance of the harvested data. Here, we describe mechanisms of fixation; advantages and disadvantages of using formaldehyde and glutaraldehyde as fixatives during immunohistochemistry; and modifications of widely used protocols that have recently been found to improve cell shape preservation and immunostaining patterns, especially in proximal retinal neurons. PMID:25892361

  17. Investigations of potential microbial methanogenic and carbon monoxide utilization pathways in ultra-basic reducing springs associated with present-day continental serpentinization: the Tablelands, NL, CAN

    PubMed Central

    Morrill, Penny L.; Brazelton, William J.; Kohl, Lukas; Rietze, Amanda; Miles, Sarah M.; Kavanagh, Heidi; Schrenk, Matthew O.; Ziegler, Susan E.; Lang, Susan Q.

    2014-01-01

    Ultra-basic reducing springs at continental sites of serpentinization act as portals into the biogeochemistry of a subsurface environment with H2 and CH4 present. Very little, however, is known about the carbon substrate utilization, energy sources, and metabolic pathways of the microorganisms that live in this ultra-basic environment. The potential for microbial methanogenesis with bicarbonate, formate, acetate, and propionate precursors and carbon monoxide (CO) utilization pathways were tested in laboratory experiments by adding substrates to water and sediment from the Tablelands, NL, CAD, a site of present-day continental serpentinization. Microbial methanogenesis was not observed after bicarbonate, formate, acetate, or propionate addition. CO was consumed in the live experiments but not in the killed controls and the residual CO in the live experiments became enriched in 13C. The average isotopic enrichment factor resulting from this microbial utilization of CO was estimated to be 11.2 ± 0.2‰. Phospholipid fatty acid concentrations and ?13C values suggest limited incorporation of carbon from CO into microbial lipids. This indicates that in our experiments, CO was used primarily as an energy source, but not for biomass growth. Environmental DNA sequencing of spring fluids collected at the same time as the addition experiments yielded a large proportion of Hydrogenophaga-related sequences, which is consistent with previous metagenomic data indicating the potential for these taxa to utilize CO. PMID:25431571

  18. Determination of methanogenic pathways through carbon isotope (?13C) analysis for the two-stage anaerobic digestion of high-solids substrates.

    PubMed

    Gehring, Tito; Klang, Johanna; Niedermayr, Andrea; Berzio, Stephan; Immenhauser, Adrian; Klocke, Michael; Wichern, Marc; Lübken, Manfred

    2015-04-01

    This study used carbon isotope (?(13)C)-based calculations to quantify the specific methanogenic pathways in a two-stage experimental biogas plant composed of three thermophilic leach bed reactors (51-56 °C) followed by a mesophilic (36.5 °C) anaerobic filter. Despite the continuous dominance of the acetoclastic Methanosaeta in the anaerobic filter, the methane (CH4) fraction derived from carbon dioxide reduction (CO2), fmc, varied significantly over the investigation period of 200 days. At organic loading rates (OLRs) below 6.0 gCOD L(-1) d(-1), the average fmc value was 33%, whereas at higher OLRs, with a maximum level of 17.0 gCOD L(-1) d(-1), the fmc values reached 47%. The experiments allowed for a clear differentiation of the isotope fractionation related to the formation and consumption of acetate in both stages of the plant. Our data indicate constant carbon isotope fractionation for acetate formation at different OLRs within the thermophilic leach bed reactors as well as a negligible contribution of homoacetogenesis. These results present the first quantification of methanogenic pathway (fmc values) dynamics for a continually operated mesophilic bioreactor and highlight the enormous potential of ?(13)C analysis for a more comprehensive understanding of the anaerobic degradation processes in CH4-producing biogas plants. PMID:25741999

  19. Overcoming fixation with repeated memory suppression.

    PubMed

    Angello, Genna; Storm, Benjamin C; Smith, Steven M

    2015-01-01

    Fixation (blocks to memories or ideas) can be alleviated not only by encouraging productive work towards a solution, but, as the present experiments show, by reducing counterproductive work. Two experiments examined relief from fixation in a word-fragment completion task. Blockers, orthographically similar negative primes (e.g., ANALOGY), blocked solutions to word fragments (e.g., A_L_ _GY) in both experiments. After priming, but before the fragment completion test, participants repeatedly suppressed half of the blockers using the Think/No-Think paradigm, which results in memory inhibition. Inhibiting blockers did not alleviate fixation in Experiment 1 when conscious recollection of negative primes was not encouraged on the fragment completion test. In Experiment 2, however, when participants were encouraged to remember negative primes at fragment completion, relief from fixation was observed. Repeated suppression may nullify fixation effects, and promote creative thinking, particularly when fixation is caused by conscious recollection of counterproductive information. PMID:24575886

  20. Fixational eye movements and binocular vision

    PubMed Central

    Otero-Millan, Jorge; Macknik, Stephen L.; Martinez-Conde, Susana

    2014-01-01

    During attempted visual fixation, small involuntary eye movements–called fixational eye movements–continuously change of our gaze’s position. Disagreement between the left and right eye positions during such motions can produce diplopia (double vision). Thus, the ability to properly coordinate the two eyes during gaze fixation is critical for stable perception. For the last 50 years, researchers have studied the binocular characteristics of fixational eye movements. Here we review classical and recent studies on the binocular coordination (i.e., degree of conjugacy) of each fixational eye movement type: microsaccades, drift and tremor, and its perceptual contribution to increasing or reducing binocular disparity. We also discuss how amblyopia and other visual pathologies affect the binocular coordination of fixational eye movements. PMID:25071480

  1. Carbon-Isotope Fractionations of Autotrophic Bacteria: Relevance to Primary Production and Microbial Evolution in Hot Springs and Hydrothermal Vents

    NASA Astrophysics Data System (ADS)

    Zhang, C. L.; Romanek, C. S.; Mills, G.

    2004-12-01

    Terrestrial hot springs and marine hydrothermal vents are often dominated by autotrophic microorganisms. Species of the Bacteria Domain in these environments are known to use different pathways for CO2 fixation. These may include the Calvin cycle, the Acetyl CoA pathway, the reverse TCA cycle, and the 3-HP pathway. Each cycle or pathway may be characterized by distinct patterns of carbon isotope fractionation. This presentation will summarize isotope fractionation patterns associated with known autotrophic bacteria and to use these patterns for interpreting natural isotopic variations. Examples will include hot springs from the Yellowstone National Park and Nevada desert, USA and Kamchatka, Russia, and hydrothermal vents from the East Pacific Rise. An attempt will be made to discuss isotopic variations within a particular pathway in the context of species evolution through horizontal gene transfer.

  2. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-09-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (?D, ?13C, and ?15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ?13C and increasing ?D with increasing carbon number in the ?-H, ?-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light ?13C signatures for ?-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-?-amino acids). Higher deuterium enrichments are observed in ?-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  3. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-01-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  4. External fixation in contemporary fracture management

    PubMed Central

    McCoy, G F; Orr, J F; Templeton, J

    1987-01-01

    Important advances have been made within the last two decades in the field of fracture management. The development of the AO internal fixation system and the advances in cast bracing techniques are but two of the improvements worthy of mention. It is, however, in the field of external fixation of fractures that the greatest advances have been made. This paper traces the history of external fixation up to the present day and discusses, with examples, the application of external fixation in the management of complex limb fractures. ImagesFig 3Fig 4Fig 5Fig 6Fig 7Fig 8Fig 9 PMID:3328364

  5. Do Fixation Cues Ensure Fixation Accuracy in Split-Fovea Studies of Word Recognition?

    ERIC Educational Resources Information Center

    Jordan, Timothy R.; Paterson, Kevin B.; Kurtev, Stoyan; Xu, Mengyun

    2009-01-01

    Many studies have claimed that hemispheric processing is split precisely at the foveal midline and so place great emphasis on the precise location at which words are fixated. These claims are based on experiments in which a variety of fixation procedures were used to ensure fixation accuracy but the effectiveness of these procedures is unclear. We…

  6. From chemolithoautotrophs to electrolithoautotrophs: CO2 fixation by Fe(II)-oxidizing bacteria coupled with direct uptake of electrons from solid electron sources

    PubMed Central

    Ishii, Takumi; Kawaichi, Satoshi; Nakagawa, Hirotaka; Hashimoto, Kazuhito; Nakamura, Ryuhei

    2015-01-01

    At deep-sea vent systems, hydrothermal emissions rich in reductive chemicals replace solar energy as fuels to support microbial carbon assimilation. Until recently, all the microbial components at vent systems have been assumed to be fostered by the primary production of chemolithoautotrophs; however, both the laboratory and on-site studies demonstrated electrical current generation at vent systems and have suggested that a portion of microbial carbon assimilation is stimulated by the direct uptake of electrons from electrically conductive minerals. Here we show that chemolithoautotrophic Fe(II)-oxidizing bacterium, Acidithiobacillus ferrooxidans, switches the electron source for carbon assimilation from diffusible Fe2+ ions to an electrode under the condition that electrical current is the only source of energy and electrons. Site-specific marking of a cytochrome aa3 complex (aa3 complex) and a cytochrome bc1 complex (bc1 complex) in viable cells demonstrated that the electrons taken directly from an electrode are used for O2 reduction via a down-hill pathway, which generates proton motive force that is used for pushing the electrons to NAD+ through a bc1 complex. Activation of carbon dioxide fixation by a direct electron uptake was also confirmed by the clear potential dependency of cell growth. These results reveal a previously unknown bioenergetic versatility of Fe(II)-oxidizing bacteria to use solid electron sources and will help with understanding carbon assimilation of microbial components living in electronically conductive chimney habitats. PMID:26500609

  7. From chemolithoautotrophs to electrolithoautotrophs: CO2 fixation by Fe(II)-oxidizing bacteria coupled with direct uptake of electrons from solid electron sources.

    PubMed

    Ishii, Takumi; Kawaichi, Satoshi; Nakagawa, Hirotaka; Hashimoto, Kazuhito; Nakamura, Ryuhei

    2015-01-01

    At deep-sea vent systems, hydrothermal emissions rich in reductive chemicals replace solar energy as fuels to support microbial carbon assimilation. Until recently, all the microbial components at vent systems have been assumed to be fostered by the primary production of chemolithoautotrophs; however, both the laboratory and on-site studies demonstrated electrical current generation at vent systems and have suggested that a portion of microbial carbon assimilation is stimulated by the direct uptake of electrons from electrically conductive minerals. Here we show that chemolithoautotrophic Fe(II)-oxidizing bacterium, Acidithiobacillus ferrooxidans, switches the electron source for carbon assimilation from diffusible Fe(2+) ions to an electrode under the condition that electrical current is the only source of energy and electrons. Site-specific marking of a cytochrome aa3 complex (aa3 complex) and a cytochrome bc1 complex (bc1 complex) in viable cells demonstrated that the electrons taken directly from an electrode are used for O2 reduction via a down-hill pathway, which generates proton motive force that is used for pushing the electrons to NAD(+) through a bc1 complex. Activation of carbon dioxide fixation by a direct electron uptake was also confirmed by the clear potential dependency of cell growth. These results reveal a previously unknown bioenergetic versatility of Fe(II)-oxidizing bacteria to use solid electron sources and will help with understanding carbon assimilation of microbial components living in electronically conductive chimney habitats. PMID:26500609

  8. Nitrogen fixation method and apparatus

    DOEpatents

    Chen, H.L.

    1983-08-16

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O[sub 2]/cm promotes the formation of vibrationally excited N[sub 2]. Atomic oxygen interacts with vibrationally excited N[sub 2] at a much quicker rate than unexcited N[sub 2], greatly improving the rate at which NO is formed. 1 fig.

  9. Nitrogen fixation method and apparatus

    DOEpatents

    Chen, Hao-Lin (Walnut Creek, CA)

    1983-01-01

    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

  10. The effects of folate intake on DNA and single-carbon pathway metabolism in the fruit fly Drosophila melanogaster compared to mammals.

    PubMed

    Blatch, Sydella A; Stabler, Sally P; Harrison, Jon F

    2015-11-01

    Mechanisms of vitamin function in non-mammals are poorly understood, despite being essential for development. Folate and cobalamin are B-vitamin cofactors with overlapping roles in transferring various single-carbon units. In mammals, one or both is needed for nucleotide synthesis, DNA methylation, amino acid conversions and other reactions. However, there has been little investigation of the response to folate or cobalamin in insects. Here, we manipulated folate intake and potentially cobalamin levels in the fruit fly Drosophila melanogaster with chemically-defined diets, an antibiotic to reduce bacterially-derived vitamins, and the folate-interfering pharmaceutical methotrexate, to see if single-carbon metabolites and DNA synthesis rates would be affected. We found that similar to mammals with low folate intake, fruit fly larvae had significantly slower growth and DNA synthesis rates. But changes to single carbon-metabolites did not mirror that of mammals with abnormal folate or given MTX. Five of the nine metabolites measured were not significantly affected (methionine, serine, glycine, methylglycine, and dimethylglycine) and three (cystathionine, methylgycine, and methylmalonic acid) were only decreased in larvae consuming methotrexate. Metabolites expected to be elevated if flies used cobalamin from microbial symbionts were not affected by dietary sulfaquinoxaline. Our data support the role of folate in nucleotide synthesis in D. melanogaster and that microbial symbionts provide functioning folates. We could not confirm how folate intake affects single carbon pathway metabolites, nor whether Drososphila use microbially-derived cobalamin. Further work should explore which cofactors are used in fruit flies in these important and potentially novel pathways. PMID:26219578

  11. Elementary Flux Mode Analysis of Acetyl-CoA Pathway in Carboxydothermus hydrogenoformans Z-2901

    PubMed Central

    Chinnasamy Perumal, Rajadurai; Selvaraj, Ashok; Ramesh Kumar, Gopal

    2014-01-01

    Carboxydothermus hydrogenoformans is a carboxydotrophic hydrogenogenic bacterium species that produces hydrogen molecule by utilizing carbon monoxide (CO) or pyruvate as a carbon source. To investigate the underlying biochemical mechanism of hydrogen production, an elementary mode analysis of acetyl-CoA pathway was performed to determine the intermediate fluxes by combining linear programming (LP) method available in CellNetAnalyzer software. We hypothesized that addition of enzymes necessary for carbon monoxide fixation and pyruvate dissimilation would enhance the theoretical yield of hydrogen. An in silico gene knockout of pyk, pykC, and mdh genes of modeled acetyl-CoA pathway allows the maximum theoretical hydrogen yield of 47.62?mmol/gCDW/h for 1 mole of carbon monoxide (CO) uptake. The obtained hydrogen yield is comparatively two times greater than the previous experimental data. Therefore, it could be concluded that this elementary flux mode analysis is a crucial way to achieve efficient hydrogen production through acetyl-CoA pathway and act as a model for strain improvement. PMID:24822064

  12. UNDERSTANDING THE KINETICS AND DYNAMICS OF RADIATION-INDUCED REACTION PATHWAYS IN CARBON MONOXIDE ICE AT 10 K

    E-print Network

    Kaiser, Ralf I.

    (Chiar et al. 1998), the surfaces of comets (Mumma et al. 2003), and on such planetary bodies as Pluto (Grundy & Buie 2001) and Triton (Quirico et al. 1999), Neptune's largest moon. In the solid phase, carbon by Lacy et al. (1984), solid carbon monoxide has been observed along several lines of sight in interstel

  13. COMPLEMENT FIXATION IN DISEASED TISSUES

    PubMed Central

    Burkholder, Peter M.

    1961-01-01

    An immunohistologic complement fixation test has been used in an effort to detect immune complexes in sections of kidney from rats injected with rabbit anti-rat kidney serum and in sections of biopsied kidneys from four humans with membranous glomerulonephritis. Sections of the rat and human kidneys were treated with fluorescein-conjugated anti-rabbit globulin or antihuman globulin respectively. Adjacent sections in each case were incubated first with fresh guinea pig serum and then in a second step were treated with fluorescein-conjugated antibodies against fixed guinea pig complement to detect sites of fixation of the complement. It was demonstrated that the sites of rabbit globulin in glomerular capillary walls of the rat kidneys and the sites of localized human globulin in thickened glomerular capillary walls and swollen glomerular endothelial cells of the human kidneys were the same sites in which guinea pig complement was fixed in vitro. It was concluded from these studies that rabbit nephrotoxic antibodies localize in rat glomeruli in complement-fixing antigen-antibody complexes. Furthermore, it was concluded that the deposits of human globulin in the glomeruli of the human kidneys behaved like antibody globulin in complement-fixing antigen-antibody complexes. The significance of demonstrating complement-fixing immune complexes in certain diseased tissues is discussed in regard to determination of the causative role of allergic reactions in disease. PMID:19867205

  14. Regulation of Carbon Flow by Nitrogen and Light in the Red Alga, Gelidium coulteri.

    PubMed

    Macler, B A

    1986-09-01

    The red alga Gelidium coulteri Harv. photosynthetically fixed [(14)C] bicarbonate at high rates under defined conditions in unialgal laboratory culture. The fixation rate and flow of photosynthate into various end products were dependent on the nitrogen status of the tissue. Plants fed luxury levels of nitrogen (approximately 340 micromolar) showed fixation rates several-fold higher than those seen for plants starved for nitrogen. The addition of NO(3) (-) or NH(4) (+) to such starved plants further inhibited fixation over at least the first several hours after addition. The majority of (14)C after incubations of 30 minutes to 8 hours was found in the compounds floridoside, agar and floridean starch. In addition, amino acids and intermediate compounds of the reductive pentose phosphate pathway, glycolytic pathway and tricarboxylic acid cycle were detected. Nitrogen affected the partitioning of labeled carbon into these compounds. Plants under luxury nitrogen conditions had higher floridoside levels and markedly lower amounts of agar and starch than found in plants limited for nitrogen. Amino acid, phycobiliprotein and chlorophyll levels were also significantly higher in nitrogen-enriched plants. Addition of NO(3) (-) to starved plants led to an increase in floridoside, tricarboxylic acid cycle intermediates and amino acids within 1 hour and inhibited carbon flow into agar and starch. Carbon fixation in the dark was only 1 to 7% of that seen in the light. Dark fixation of [(14)C]bicarbonate yielded label primarily in tricarboxylic acid cycle intermediates, amino acids and polysaccharides. Nitrogen stimulated amino acid synthesis at the expense of agar and starch. Floridoside was only a minor component in the dark. Pulse-chase experiments, designed to show carbon turnover, indicated a 2-fold increase in labeling of agar over 96 hours of chase in the light. No increases were seen in the dark. Low molecular weight pools, including floridoside, decreased 2- to 5-fold over this period under both light and dark conditions. Nitrogen status did not influence turnover. There was little or no organic carbon released into the culture medium over this period. The results are consistent with biosynthetic pathways to floridoside and agar that share the common intermediate UDP-d-galactose. It is hypothesized that synthesis of floridoside is regulated by nitrogen and light at the enzymic level. PMID:16664980

  15. Regulation of Carbon Flow by Nitrogen and Light in the Red Alga, Gelidium coulteri1

    PubMed Central

    Macler, Bruce A.

    1986-01-01

    The red alga Gelidium coulteri Harv. photosynthetically fixed [14C] bicarbonate at high rates under defined conditions in unialgal laboratory culture. The fixation rate and flow of photosynthate into various end products were dependent on the nitrogen status of the tissue. Plants fed luxury levels of nitrogen (approximately 340 micromolar) showed fixation rates several-fold higher than those seen for plants starved for nitrogen. The addition of NO3? or NH4+ to such starved plants further inhibited fixation over at least the first several hours after addition. The majority of 14C after incubations of 30 minutes to 8 hours was found in the compounds floridoside, agar and floridean starch. In addition, amino acids and intermediate compounds of the reductive pentose phosphate pathway, glycolytic pathway and tricarboxylic acid cycle were detected. Nitrogen affected the partitioning of labeled carbon into these compounds. Plants under luxury nitrogen conditions had higher floridoside levels and markedly lower amounts of agar and starch than found in plants limited for nitrogen. Amino acid, phycobiliprotein and chlorophyll levels were also significantly higher in nitrogen-enriched plants. Addition of NO3? to starved plants led to an increase in floridoside, tricarboxylic acid cycle intermediates and amino acids within 1 hour and inhibited carbon flow into agar and starch. Carbon fixation in the dark was only 1 to 7% of that seen in the light. Dark fixation of [14C]bicarbonate yielded label primarily in tricarboxylic acid cycle intermediates, amino acids and polysaccharides. Nitrogen stimulated amino acid synthesis at the expense of agar and starch. Floridoside was only a minor component in the dark. Pulse-chase experiments, designed to show carbon turnover, indicated a 2-fold increase in labeling of agar over 96 hours of chase in the light. No increases were seen in the dark. Low molecular weight pools, including floridoside, decreased 2- to 5-fold over this period under both light and dark conditions. Nitrogen status did not influence turnover. There was little or no organic carbon released into the culture medium over this period. The results are consistent with biosynthetic pathways to floridoside and agar that share the common intermediate UDP-d-galactose. It is hypothesized that synthesis of floridoside is regulated by nitrogen and light at the enzymic level. PMID:16664980

  16. Eighth international congress on nitrogen fixation. Final program

    SciTech Connect

    Not Available

    1990-12-31

    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  17. Diallyl disulfide attenuated carbon ion irradiation-induced apoptosis in mouse testis through changing the ratio of Tap73/?Np73 via mitochondrial pathway

    PubMed Central

    Di, Cui-xia; Han, Lu; Zhang, Hong; Xu, Shuai; Mao, Ai-hong; Sun, Chao; Liu, Yang; Si, Jing; Li, Hong-yan; Zhou, Xin; Liu, Bing; Miao, Guo-ying

    2015-01-01

    Diallyl disulfide (DADS), a major organosulfur compound derived from garlic, has various biological properties, including anti-cancer effects. However, the protective mechanism of DADS against radiation-induced mouse testis cell apoptosis has not been elucidated. In this study, the magnitude of radiation effects evoked by carbon ion irradiation was marked by morphology changes, significant rise in apoptotic cells, activation expression of p53, up regulation the ratio of pro-apoptotic Tap73/anti-apoptotic ?Np73, as well as alterations of crucial mediator of the mitochondrial pathway. Interestingly, pretreatment with DADS attenuated carbon ion irradiation-induced morphology damages and apoptotic cells. Additionally, DADS elevated radiation-induced p53 and p21 expression, suggesting that p53 might be involved in the inhibition of cell cycle progression through up regulation of p21. Furthermore, administration with DADS prevented radiation-induced Tap73/?Np73 expression and consequently down regulated Bax/Bcl-2 ratio, cytochrome c release and caspase-3 expression, indicating that the balance between Tap73 and ?Np73 had potential to activate p53 responsive genes. Thus, our results showed that radio protection effect of DADS on mouse testis is mediated by blocking apoptosis through changing the ratio of Tap73/?Np73 via mitochondrial pathway, suggesting that DADS could be used as a potential radio protection agent for the testis against heavy-ion radiation. PMID:26526304

  18. Diallyl disulfide attenuated carbon ion irradiation-induced apoptosis in mouse testis through changing the ratio of Tap73/?Np73 via mitochondrial pathway.

    PubMed

    Di, Cui-Xia; Han, Lu; Zhang, Hong; Xu, Shuai; Mao, Ai-Hong; Sun, Chao; Liu, Yang; Si, Jing; Li, Hong-Yan; Zhou, Xin; Liu, Bing; Miao, Guo-Ying

    2015-01-01

    Diallyl disulfide (DADS), a major organosulfur compound derived from garlic, has various biological properties, including anti-cancer effects. However, the protective mechanism of DADS against radiation-induced mouse testis cell apoptosis has not been elucidated. In this study, the magnitude of radiation effects evoked by carbon ion irradiation was marked by morphology changes, significant rise in apoptotic cells, activation expression of p53, up regulation the ratio of pro-apoptotic Tap73/anti-apoptotic ?Np73, as well as alterations of crucial mediator of the mitochondrial pathway. Interestingly, pretreatment with DADS attenuated carbon ion irradiation-induced morphology damages and apoptotic cells. Additionally, DADS elevated radiation-induced p53 and p21 expression, suggesting that p53 might be involved in the inhibition of cell cycle progression through up regulation of p21. Furthermore, administration with DADS prevented radiation-induced Tap73/?Np73 expression and consequently down regulated Bax/Bcl-2 ratio, cytochrome c release and caspase-3 expression, indicating that the balance between Tap73 and ?Np73 had potential to activate p53 responsive genes. Thus, our results showed that radio protection effect of DADS on mouse testis is mediated by blocking apoptosis through changing the ratio of Tap73/?Np73 via mitochondrial pathway, suggesting that DADS could be used as a potential radio protection agent for the testis against heavy-ion radiation. PMID:26526304

  19. INVESTIGATION Population Growth Enhances the Mean Fixation

    E-print Network

    Waxman, David

    INVESTIGATION Population Growth Enhances the Mean Fixation Time of Neutral Mutations of population genetics states that a new mutation, at an unlinked neutral locus in a randomly mating diploid population, has a mean time of fixation of 4Ne generations, where Ne is the effective population size

  20. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  1. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  2. Whole Animal Perfusion Fixation for Rodents

    PubMed Central

    Gage, Gregory J.; Kipke, Daryl R.; Shain, William

    2012-01-01

    The goal of fixation is to rapidly and uniformly preserve tissue in a life-like state. While placing tissue directly in fixative works well for small pieces of tissue, larger specimens like the intact brain pose a problem for immersion fixation because the fixative does not reach all regions of the tissue at the same rate 5,7. Often, changes in response to hypoxia begin before the tissue can be preserved 12. The advantage of directly perfusing fixative through the circulatory system is that the chemical can quickly reach every corner of the organism using the natural vascular network. In order to utilize the circulatory system most effectively, care must be taken to match physiological pressures 3. It is important to note that physiological pressures are dependent on the species used. Techniques for perfusion fixation vary depending on the tissue to be fixed and how the tissue will be processed following fixation. In this video, we describe a low-cost, rapid, controlled and uniform fixation procedure using 4% paraformaldehyde perfused via the vascular system: through the heart of the rat to obtain the best possible preservation of the brain for immunohistochemistry. The main advantage of this technique (vs. gravity-fed systems) is that the circulatory system is utilized most effectively. PMID:22871843

  3. Biochemical Approaches to Improved Nitrogen Fixation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Improving symbiotic nitrogen fixation by legumes has emerged again as an important topic on the world scene due to the energy crisis and lack of access to nitrogen fertilizer in developing countries. We have taken a biochemical genomics approach to improving symbiotic nitrogen fixation in legumes. L...

  4. The ecology and genomics of C02 fixation in oceanic river plumes

    SciTech Connect

    F. Robert Tabita

    2008-09-12

    The ocean/atmosphere interface is the major conduit for the entry of atmospheric CO2 into oceanic carbon pools that can lead to sequestration or recycled release. The surface layers of the temperate and tropical oceans are often too oligotrophic to result in significant primary production that might lead to carbon sequestration. However, nutrient-rich river plumes can alter the primary production schemes of oligotrophic ocean basins, resulting in increased phytoplankton biomass and carbon fixation. The ultimate goal of this proposal is to understand these carbon cycling processes in major river plumes from the molecular processes involved in biological DIC uptake to contribution to basin-wide production and potential sequestration. Our research efforts include a field component to answer the questions raised concerning DIC in plumes entering ocean basins and an intensive genomics approach to understanding these processes on the cellular level using genomic fragments obtained from plume biota. This project is actually composed of 3 separate PI-initiated projects, including projects at the University of South Florida (USF) College of Marine Science, the University of Puerto Rico, and The Ohio State University. This report concerns research conducted at The Ohio State University and studies performed in collaboration with USF. In order to understand what might occur in the field, two model sysytems were studied in the laboratory. Carbon fixation in the unicellular cyanobacterium Synechococcus sp Strain PCC 7002 took place mainly through the CBB pathway. Nitrogen nutrition in cyanobacteria is regulated by NtcA, a transcriptional regulatory protein. We show that the rubisco activity and gene (rbcL) expression were not affected when cells were exposed to prolonged periods of nitrogen stress, however cells appear to use intracellular nitrogen reserves during nitrogen starvation. Transcripts of the global transcriptional regulator NtcA are expressed under nitrogen starved and nitrogen replete (nitrate or ammonia) growth conditions, with slight decrease in transcription in the presence of ammonia. These results suggest that intracellular levels of NtcA do not directly affect carbon metabolism. Gene expression of the other nitrogen regulatory signal transducer, encoded by glnB was also studied. The glnB gene was highly transcribed in nitrogen-limited cells compared to nitrogen depleted growth conditions. Therefore in the cyanobacterium Synechococcus sp PCC 7002, nitrogen does not affect the metabolic potential and carbon fixation. The NtcA regulator behaved differently and studies indicate that the product of the ntcA gene (NtcA) has an indirect effect on ca rbon assimilation and the genes involved in the carbon concentrating mechanism of strain 7002. The product of the ccmM gene plays an important role in carboxysome assembly and inorganic carbon transport within the cell. We hypothesized that under nitrogen limiting conditions the transcriptional regulator NtcA binds at the region upstream of ccmM, near the transcription start site, and blocks the transcription of ccmM. This hypothesis was experimentally proven. In another study, with USF researchers, we performed experiments in situ on RubisCO espression. To determine the relationship between expression of the major gene in carbon fixation, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO2 in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30–32) stations were dominated by rbcL mRNA concentrations from heterokonts; i.e., diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, a-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34–36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO2. While Prochlorococcus cells did not exhibit a large difference between low and high pCO2

  5. Stability of unicortical locked fixation versus bicortical non-locked fixation for forearm fractures.

    PubMed

    Pater, Timothy J; Grindel, Steve I; Schmeling, Gregory J; Wang, Mei

    2014-01-01

    Locking plate fixation is being widely applied for fixation of forearm fractures and has many potential advantages, such as fixed angle fixation and improved construct stability, especially in osteoporotic bone. Biomechanical data comparing locking devices to commonly used Low Contact Dynamic Compression (LCDCP) plates for the fixation of forearm fractures has been lacking. The purpose of this study was to compare the fixation stability of a 3.5-mm unicortical locked plate with bicortical non-locked LCDCP plates. Six matched pairs of fresh frozen cadaveric forearms were randomly assigned to unicortical locked and bicortical unlocked groups. Non-destructive four-point bending and torsional test was performed on the ulna and radius separately, using a servohydraulic testing system to obtain construct stiffness of the intact specimens and specimens after osteotomy and plating. The specimens were then loaded to failure to test the fixation strength. The locked unicortical fixation showed significantly higher bending stiffness than the unlocked bicortical fixation, but with significantly lower stiffness and strength in torsion. Fixation strength was comparable between the two groups under bending, but significantly greater in the bicortical non-locked group under torsion. Findings from this study suggest that postoperative rehabilitation protocols may need modification to limit torsional loading in the early stage when using locked unicortical fixation. The study also points out the potential advantage of a hybrid fixation that combines locked unicortical and unlocked bicortical screws. PMID:26273524

  6. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...Prosthetic Devices § 888.3050 Spinal interlaminal fixation orthosis. (a) Identification. A spinal interlaminal fixation orthosis...spondylolisthesis (a dislocation of the spinal column), and lower back syndrome....

  7. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...Prosthetic Devices § 888.3050 Spinal interlaminal fixation orthosis. (a) Identification. A spinal interlaminal fixation orthosis...spondylolisthesis (a dislocation of the spinal column), and lower back syndrome....

  8. Autotrophic Microbe Metagenomes and Metabolic Pathways Differentiate Adjacent Red Sea Brine Pools

    PubMed Central

    Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

    2013-01-01

    In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens. PMID:23624511

  9. Carbon and nitrogen cycling in thermally heated sediments

    NASA Astrophysics Data System (ADS)

    Meyer-Dombard, D. R.; Burton, M.; Vennelakanti, S.; Havig, J. R.; Shock, E.

    2009-12-01

    Hydrothermally heated sediment environments, such as are found in abundance throughout Yellowstone National Park, host fully functional microbial ecosystems. As with any ecosystem, both sources and sinks of carbon, nitrogen, and a myriad of other nutrients and energy-driving factors must be supplied. While we know microbial communities in hydrothermal environments can be surprisingly diverse, we know little about basic ecological functions such as carbon and nitrogen cycling. Previous work has shown that carbon cycling in one hot spring in Yellowstone National Park [“Bison Pool”] and its associated runoff channel functions as a complex system. Analysis of carbon and nitrogen isotopes in sediments and biofilms across a temperature and chemical gradient at this location revealed that the four best studied carbon fixation pathways [Calvin, reverse tricarboxylic acid, acetyl-CoA, 3-hydroxypropionate cycles] may all be functioning in this system, and nitrogen fixation varies across the chemosynthetic/photosynthetic ecotone [1]. Microcosm experiments using biofilms from this hot spring as inoculae with 13C labeled carbon substrates indicate heterotrophic growth [2]. In addition, metagenomic analysis of environmental DNA has indicated the presence of genes involved in carbon fixation [both phototrophic and autotrophic], and heterotrophy, as well as nitrogen fixation [3]. Studies from other Yellowstone locations have also found genetic evidence for carbon and nitrogen fixation [4, 5]. Of particular interest is the role of individuals in carbon and nitrogen cycling as environmental conditions suitable for chemosynthetic and photosynthetic growth vary. This study explores the diversity of cbbM/cbbL [Calvin cycle], aclB/oor/porA [rTCA cycle], nifH [nitrogen fixation], nirK [nitrite reduction] and amoA [ammonia oxidation] genes across a variety of Yellowstone environments. The transition of genetic diversity within sediments and biofilms is focused on the chemosynthetic/photosynthetic ecotone from a variety of hot springs spanning a range of pH and geochemical conditions. By sampling across this ecotone, changes in carbon and nitrogen fixation as a function of changing community structure become apparent. Environmental DNA was extracted from these samples, and the presence/absence of Bacteria and Archaea determined by PCR. In addition, PCR-directed screens reveal the presence or absence of the aforementioned functional genes. Further, comparison across a broad spectrum of environmental conditions supplies context for phylogenetic analysis of diversity. [1] Havig, J.R., 2009. Geochemistry of Hydrothermal Biofilms: Composition of Biofilms in Siliceous Sinter-Deposting Hot Springs. Doctoral Dissertation, Arizona State University. [2] Meyer-Dombard et al., 2007. Microbial Diversity and SIP Investigations of Streamer Biofilm Communities in Yellowstone. Goldschmidt Geochemical Conference. [3] Raymond et al., 2008. EOS Trans AGU. Abstract B14A-03. [4] Hall et al., 2008. AEM 74:4910-4922. [5] Steunou et al., 2006. PNAS 103:2398-2403.

  10. Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}

    NASA Astrophysics Data System (ADS)

    Thomas, P. J.; Boller, A. J.; Zhao, Z.; Tabita, F. R.; Cavanaugh, C. M.; Scott, K. M.

    2006-12-01

    Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (?13C = {[13C/12Csample/13C/12Cstandard] - 1} × 1000). Five different forms of RubisCO (IA, IB, IC, ID, and II) are utilized by algae and autotrophic bacteria reliant on the Calvin-Benson cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs, and their ? values (={[12k/13k] - 1} × 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, explaining the variation in biomass ?13C values of autotrophs utilizing these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides and Ralstonia eutropha. The purpose of this work was to determine the ? values for form IC RubisCO enzymes from R. sphaeroides and R. eutropha. Recombinant form IC RubisCOs were purified by conventional column chromatography procedures. Assay conditions (pH, dissolved inorganic carbon concentration) were tested to determine which parameters were conducive to the high rates of carbon fixation necessary for ? determination. Under standard conditions (pH 8.5 and 5 mM DIC), form IC RubisCO activities were sufficient for ? determination. Experiments are currently being conducted to measure the ? values of these enzymes. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of ?13C values of organisms fixing carbon via the Calvin-Benson cycle. These results are critical for determining the degree to which Calvin cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.

  11. Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria

    PubMed Central

    Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M.; Pinhassi, Jarone

    2014-01-01

    Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light—but only in Ala—contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy. PMID:25136122

  12. Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria.

    PubMed

    Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M; Pinhassi, Jarone

    2014-09-01

    Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light--but only in Ala--contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy. PMID:25136122

  13. Laboratory studies of carbon kinetic isotope effects on the production mechanism of particulate phenolic compounds formed by toluene photooxidation: a tool to constrain reaction pathways.

    PubMed

    Irei, Satoshi; Rudolph, Jochen; Huang, Lin; Auld, Janeen; Collin, Fabrice; Hastie, Donald

    2015-01-01

    In this study, we examined compound-specific stable carbon isotope ratios for phenolic compounds in secondary organic aerosol (SOA) formed by photooxidation of isotope-label-free toluene. SOA generated by photooxidation of toluene using a continuous-flow reactor and an 8 m(3) indoor smog chamber was collected on filters, which were extracted with acetonitrile for compound-specific analysis. Eight phenolic compounds were identified in the extracts using a gas chromatograph coupled with a mass spectrometer, and their compound-specific stable carbon isotope ratios were determined using a gas chromatograph coupled with a combustion furnace followed by an isotope ratio mass spectrometer. The majority of products, including methylnitrophenols and methylnitrocatechols, were isotopically depleted by 5-6‰ compared to the initial isotope ratio of toluene, whereas the isotope ratio for 4-nitrophenol remained identical to that of toluene. On the basis of the reaction mechanisms proposed in previous reports, stable carbon isotope ratios of these products were calculated. By comparing the observed isotope ratios with the predicted isotope ratios, we explored possible production pathways for the particulate phenolic compounds. PMID:25490235

  14. Requirement of carbon dioxide for initial growth of facultative methylotroph, Acidomonas methanolica MB58.

    PubMed

    Mitsui, Ryoji; Katayama, Hiroko; Tanaka, Mitsuo

    2015-07-01

    The facultative methylotrophic bacterium Acidomonas methanolica MB58 can utilize C1 compounds via the ribulose monophosphate pathway. A large gene cluster comprising three components related to C1 metabolism was found in the genome. From upstream, the first was an mxa cluster encoding proteins for oxidation of methanol to formaldehyde; the second was the rmp cluster encoding enzymes for formaldehyde fixation; and the third was the cbb gene cluster encoding proteins for carbon dioxide (CO2) fixation. Examination of CO2 requirements for growth of A. methanolica MB58 cells demonstrated that it did not grow on any carbon source under CO2-free conditions. Measurement of ribulose-1,5-bisphosphate carboxylase activity and RT-PCR analysis demonstrated enzymatic activity was detected in A. methanolica MB58 at growth phase, regardless of carbon sources. However, methanol dehydrogenase and 3-hexlose-6-phosphate synthase expression was regulated by methanol or formaldehyde; it were detected during growth and apparently differed from ribulose-1,5-bisphosphate carboxylase expression. These results suggested that A. methanolica MB58 may be initially dependent on autotrophic growth and that carbon assimilation was subsequently coupled with the ribulose monophosphate pathway at early- to mid-log phases during methylotrophic growth. PMID:25511787

  15. Distal Humerus Fractures: Open Reduction Internal Fixation.

    PubMed

    Mighell, Mark A; Stephens, Brent; Stone, Geoffrey P; Cottrell, Benjamin J

    2015-11-01

    Distal humerus fractures are challenging injuries for the upper extremity surgeon. However, recent techniques in open reduction internal fixation have been powerful tools in getting positive outcomes. To get such results, the surgeon must be aware of how to properly use these techniques in their respective practices. The method of fixation depends on the fracture, taking the degree of comminution and the restoration of the columns and articular surface into account. This article helps surgeons understand the concepts behind open reduction internal fixation of the distal humerus and makes them aware of pitfalls that may lead to negative results. PMID:26498548

  16. Collaborative regulation of CO2 transport and fixation during succinate production in Escherichia coli

    PubMed Central

    Zhu, Li-Wen; Zhang, Lei; Wei, Li-Na; Li, Hong-Mei; Yuan, Zhan-Peng; Chen, Tao; Tang, Ya-Ling; Liang, Xin-Hua; Tang, Ya-Jie

    2015-01-01

    In Escherichia coli, succinic acid is synthesized by CO2 fixation-based carboxylation of C3 metabolites. A two-step process is involved in CO2 integration: CO2 uptake into the cell and CO2 fixation by carboxylation enzymes. The phosphoenolpyruvate (PEP) carboxylase (PPC) and carboxykinase (PCK) are two important carboxylation enzymes within the succinate synthetic pathway, while SbtA and BicA are two important bicarbonate transporters. In this study, we employed a dual expression system, in which genes regulating both CO2 uptake and fixation were co-overexpressed, or overexpressed individually to improve succinate biosynthesis. Active CO2 uptake was observed by the expression of SbtA or/and BicA, but the succinate biosynthesis was decreased. The succinate production was significantly increased only when a CO2 fixation gene (ppc or pck) and a CO2 transport gene (sbtA or bicA) were co-expressed. Co-expression of pck and sbtA provided the best succinate production among all the strains. The highest succinate production of 73.4?g L?1 was 13.3%, 66.4% or 15.0% higher than that obtained with the expression of PCK, SbtA alone, or with empty plasmids, respectively. We believe that combined regulation of CO2 transport and fixation is critical for succinate production. Imbalanced gene expression may disturb the cellular metabolism and succinate production. PMID:26626308

  17. Collaborative regulation of CO2 transport and fixation during succinate production in Escherichia coli.

    PubMed

    Zhu, Li-Wen; Zhang, Lei; Wei, Li-Na; Li, Hong-Mei; Yuan, Zhan-Peng; Chen, Tao; Tang, Ya-Ling; Liang, Xin-Hua; Tang, Ya-Jie

    2015-01-01

    In Escherichia coli, succinic acid is synthesized by CO2 fixation-based carboxylation of C3 metabolites. A two-step process is involved in CO2 integration: CO2 uptake into the cell and CO2 fixation by carboxylation enzymes. The phosphoenolpyruvate (PEP) carboxylase (PPC) and carboxykinase (PCK) are two important carboxylation enzymes within the succinate synthetic pathway, while SbtA and BicA are two important bicarbonate transporters. In this study, we employed a dual expression system, in which genes regulating both CO2 uptake and fixation were co-overexpressed, or overexpressed individually to improve succinate biosynthesis. Active CO2 uptake was observed by the expression of SbtA or/and BicA, but the succinate biosynthesis was decreased. The succinate production was significantly increased only when a CO2 fixation gene (ppc or pck) and a CO2 transport gene (sbtA or bicA) were co-expressed. Co-expression of pck and sbtA provided the best succinate production among all the strains. The highest succinate production of 73.4?g L(-1) was 13.3%, 66.4% or 15.0% higher than that obtained with the expression of PCK, SbtA alone, or with empty plasmids, respectively. We believe that combined regulation of CO2 transport and fixation is critical for succinate production. Imbalanced gene expression may disturb the cellular metabolism and succinate production. PMID:26626308

  18. HOPE-fixation of lung tissue allows retrospective proteome and phosphoproteome studies.

    PubMed

    Shevchuk, Olga; Abidi, Nada; Klawonn, Frank; Wissing, Josef; Nimtz, Manfred; Kugler, Christian; Steinert, Michael; Goldmann, Torsten; Jänsch, Lothar

    2014-11-01

    Hepes-glutamic acid buffer-mediated organic solvent protection effect (HOPE)-fixation has been introduced as an alternative to formalin fixation of clinical samples. Beyond preservation of morphological structures for histology, HOPE-fixation was demonstrated to be compatible with recent methods for RNA and DNA sequencing. However, the suitability of HOPE-fixed materials for the inspection of proteomes by mass spectrometry so far remained undefined. This is of particular interest, since proteins constitute a prime resource for drug research and can give valuable insights into the activity status of signaling pathways. In this study, we extracted proteins from human lung tissue and tested HOPE-treated and snap-frozen tissues comparatively by proteome and phosphoproteome analyses. High confident data from accurate mass spectrometry allowed the identification of 2603 proteins and 3036 phosphorylation sites. HOPE-fixation did not hinder the representative extraction of proteins, and investigating their biochemical properties, covered subcellular localizations, and cellular processes revealed no bias caused by the type of fixation. In conclusion, proteome as well as phosphoproteome data of HOPE lung samples were qualitatively equivalent to results obtained from snap-frozen tissues. Thus, HOPE-treated tissues match clinical demands in both histology and retrospective proteome analyses of patient samples by proteomics. PMID:24702127

  19. Glutaraldehyde fixation of sodium transport in dog red blood cells

    SciTech Connect

    Parker, J.C.

    1984-11-01

    The large increase in passive Na flux that occurs when dog red blood cells are caused to shrink is amiloride sensitive and inhibited when Cl is replaced by nitrate or thiocyanate. Activation and deactivation of this transport pathway by manipulation of cell volume is reversible. Brief treatment of the cells with 0.01-0.03% glutaraldehyde can cause the shrinkage-activated transporter to become irreversibly activated or inactivated, depending on the volume of the cells at the time of glutaraldehyde exposure. Thus, if glutaraldehyde is applied when the cells are shrunken, the amiloride-sensitive Na transporter is activated and remains so regardless of subsequent alterations in cell volume. If the fixative is applied to swollen cells, no amount of subsequent shrinkage will turn on the Na pathway. In its fixed state, the activated transporter is fully amiloride sensitive, but it is no longer inhibited when Cl is replaced by thiocyanate. The action of glutaraldehyde thus allows one to dissect the response to cell shrinkage into two phases. Activation of the pathway is affected by anions and is not prevented by amiloride. Once activated and fixed, the anion requirement disappears. Amiloride inhibits movement of Na through the activated transporter. These experiments demonstrate how a chemical cross-linking agent may be used to study the functional properties of a regulable transport pathway.

  20. Neural correlates of fixation duration in natural reading: Evidence from fixation-related fMRI.

    PubMed

    Henderson, John M; Choi, Wonil; Luke, Steven G; Desai, Rutvik H

    2015-10-01

    A key assumption of current theories of natural reading is that fixation duration reflects underlying attentional, language, and cognitive processes associated with text comprehension. The neurocognitive correlates of this relationship are currently unknown. To investigate this relationship, we compared neural activation associated with fixation duration in passage reading and a pseudo-reading control condition. The results showed that fixation duration was associated with activation in oculomotor and language areas during text reading. Fixation duration during pseudo-reading, on the other hand, showed greater involvement of frontal control regions, suggesting flexibility and task dependency of the eye movement network. Consistent with current models, these results provide support for the hypothesis that fixation duration in reading reflects attentional engagement and language processing. The results also demonstrate that fixation-related fMRI provides a method for investigating the neurocognitive bases of natural reading. PMID:26151101

  1. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

    2014-08-01

    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multi-year mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) build-up and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  2. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.

    2014-12-01

    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and Arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multiyear mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) buildup and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  3. A simple and inexpensive external fixator.

    PubMed

    Noor, M A

    1988-11-01

    A simple and inexpensive external fixator has been designed. It is constructed of galvanized iron pipe and mild steel bolts and nuts. It can easily be manufactured in a hospital workshop with a minimum of tools. PMID:3267638

  4. An examination of fixation in brainstorming 

    E-print Network

    Kohn, Nicholas William

    2009-05-15

    Shortcomings....................................................... 5 ttempts to Eliminate Brainstorming Deficits...............................16 Use of Stimuli and Analogies When Problem Solving.................. 21 Fixation in Individual Problem Solving... in Brainstorming.......................................... Productivity Deficit........................................109 Temporal Findings......................................... 110 Incubation Effects..........................................111...

  5. Single-walled carbon nanotube exposure induces membrane rearrangement and suppression of receptor-mediated signalling pathways in model mast cells

    PubMed Central

    Umemoto, Eric Y.; Speck, Mark; Shimoda, Lori M.N.; Kahue, Kara; Sung, Carl; Stokes, Alexander J.; Turner, Helen

    2014-01-01

    Carbon nanotubes (CNT) are environmental challenges to the respiratory and gastrointestinal mucosa, and to the dermal immune system. Mast cells (MC) are pro-inflammatory immunocytes that reside at these interfaces with the environment. Mast cells are sources of pro-inflammatory mediators (histamine, serotonin, matrix-active proteases, eicosanoids, prostanoids, cytokines and chemokines), which are released in a calcium-dependent manner following immunological challenge or physico-chemical stimulation. Since C-60 fullerenes, which share geometry with CNT, are suppressive of mast cell-driven inflammatory responses, we explored the effects of unmodified SWCNT aggregates on mast cell signaling pathways, phenotype and pro-inflammatory function. We noted SWCNT suppression of antigen-induced signalling pathways and pro-inflammatory degranulation responses. Mast cells recognize unmodified SWCNT by remodeling the plasma membrane, disaggregating the cortical actin cytoskeleton and relocalizing clathrin. Clathrin was also identified as a component of an affinity-purified ‘interactome’ isolated from MC using an SWCNT affinity matrix for mast cell lysates. Together these data are consistent with the ability of SWCNT to suppress mast cell pro-inflammatory function via a novel recognition mechanism. PMID:24910985

  6. Gaze shifts and fixations dominate gaze behavior of walking cats

    PubMed Central

    Rivers, Trevor J.; Sirota, Mikhail G.; Guttentag, Andrew I.; Ogorodnikov, Dmitri A.; Shah, Neet A.; Beloozerova, Irina N.

    2014-01-01

    Vision is important for locomotion in complex environments. How it is used to guide stepping is not well understood. We used an eye search coil technique combined with an active marker-based head recording system to characterize the gaze patterns of cats walking over terrains of different complexity: (1) on a flat surface in the dark when no visual information was available, (2) on the flat surface in light when visual information was available but not required, (3) along the highly structured but regular and familiar surface of a horizontal ladder, a task for which visual guidance of stepping was required, and (4) along a pathway cluttered with many small stones, an irregularly structured surface that was new each day. Three cats walked in a 2.5 m corridor, and 958 passages were analyzed. Gaze activity during the time when the gaze was directed at the walking surface was subdivided into four behaviors based on speed of gaze movement along the surface: gaze shift (fast movement), gaze fixation (no movement), constant gaze (movement at the body’s speed), and slow gaze (the remainder). We found that gaze shifts and fixations dominated the cats’ gaze behavior during all locomotor tasks, jointly occupying 62–84% of the time when the gaze was directed at the surface. As visual complexity of the surface and demand on visual guidance of stepping increased, cats spent more time looking at the surface, looked closer to them, and switched between gaze behaviors more often. During both visually guided locomotor tasks, gaze behaviors predominantly followed a repeated cycle of forward gaze shift followed by fixation. We call this behavior “gaze stepping”. Each gaze shift took gaze to a site approximately 75–80 cm in front of the cat, which the cat reached in 0.7–1.2 s and 1.1–1.6 strides. Constant gaze occupied only 5–21% of the time cats spent looking at the walking surface. PMID:24973656

  7. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion

    PubMed Central

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

    2013-01-01

    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C?C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

  8. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion

    NASA Astrophysics Data System (ADS)

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

    2013-07-01

    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C-C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion.

  9. Fixational eye movements predict visual sensitivity.

    PubMed

    Scholes, Chris; McGraw, Paul V; Nyström, Marcus; Roach, Neil W

    2015-10-22

    During steady fixation, observers make small fixational saccades at a rate of around 1-2 per second. Presentation of a visual stimulus triggers a biphasic modulation in fixational saccade rate-an initial inhibition followed by a period of elevated rate and a subsequent return to baseline. Here we show that, during passive viewing, this rate signature is highly sensitive to small changes in stimulus contrast. By training a linear support vector machine to classify trials in which a stimulus is either present or absent, we directly compared the contrast sensitivity of fixational eye movements with individuals' psychophysical judgements. Classification accuracy closely matched psychophysical performance, and predicted individuals' threshold estimates with less bias and overall error than those obtained using specific features of the signature. Performance of the classifier was robust to changes in the training set (novel subjects and/or contrasts) and good prediction accuracy was obtained with a practicable number of trials. Our results indicate a tight coupling between the sensitivity of visual perceptual judgements and fixational eye control mechanisms. This raises the possibility that fixational saccades could provide a novel and objective means of estimating visual contrast sensitivity without the need for observers to make any explicit judgement. PMID:26468244

  10. Effects of soil structure destruction on methane production and carbon partitioning between methanogenic pathways in tropical rain forest soils

    NASA Astrophysics Data System (ADS)

    Teh, Yit Arn; Silver, Whendee L.

    2006-03-01

    Controls on methanogenesis are often determined from laboratory incubations of soils converted to slurries. Destruction of soil structure during slurry conversion may disrupt syntrophic associations, kill methanogens, and/or alter the microsite distribution of methanogenic activity, suppressing CH4 production. The effects of slurry conversion on methanogenesis were investigated to determine if disruption of aggregate structure impacted methanogenesis, substrate utilization, and C partitioning between methanogenic pathways. Soils were collected from the tropical rain forest life zone of the Luquillo Experimental Forest, Puerto Rico, and exposed to different physical disturbances, including flooding and physical homogenization. Slurry conversion negatively impacted methanogenesis. Rates of CH4 production declined by a factor of 17 after well-aggregated soils were converted to slurries. Significantly more 13C-acetate was recovered in CO2 compared to CH4 after slurry conversion, suggesting that methanogens consumed less acetate after slurry conversion and may have competed less effectively with other anaerobes for acetate. Isotopic data indicate that the relative partitioning of C between aceticlastic and hydrogenotrophic pathways was unchanged after slurry conversion. These data suggest that experiments which destroy soil structure may significantly underestimate methanogenesis and overestimate the potential for other microorganisms to compete with methanogens for organic substrates. Current knowledge of the factors that regulate methanogenesis in soil may be biased by the findings of slurry-based experiments, that do not accurately represent the complex, spatially heterogeneous conditions found in well-aggregated soils.

  11. Carbon metabolism in legume nodules. Progress report, July 1982-July 1983

    SciTech Connect

    LaRue, T.A.

    1983-01-01

    The goal is to understand how the legume nodule metabolizes carbohydrate to provide energy and reductant for symbiotic fixation. The working hypothesis has been that the plant cytosol is microacrobic and that some carbon metabolism may be via anaerobic pathways similar to those in roots of flood tolerant plants. A method of analyzing redox changes in intact mitochondria, bacteroids or bacteria was adapted; a method of manipulating nitrogenase activity by oxygen inhibition was developed; the production of alcohol by soybean nodules was studied; and enzymes metabolizing alcohol/aldehyde were found in other nitrogen fixing systems. (ACR)

  12. Cost of external fixation vs external fixation then nailing in bone infection

    PubMed Central

    Emara, Khaled Mohamed; Diab, Ramy Ahmed; Ghafar, Khaled Abd EL

    2015-01-01

    AIM: To study the cost benefit of external fixation vs external fixation then nailing in treatment of bone infection by segment transfer. METHODS: Out of 71 patients with infected nonunion tibia treated between 2003 and 2006, 50 patients fitted the inclusion criteria (26 patients were treated by external fixation only, and 24 patients were treated by external fixation early removal after segment transfer and replacement by internal fixation). Cost of inpatient treatment, total cost of inpatient and outpatient treatment till full healing, and the weeks of absence from school or work were calculated and compared between both groups. RESULTS: The cost of hospital stay and surgery in the group of external fixation only was 22.6 ± 3.3 while the cost of hospital stay and surgery in the group of early external fixation removal and replacement by intramedullary nail was 26.0 ± 3.2. The difference was statistically significant regarding the cost of hospital stay and surgery in favor of the group of external fixation only. The total cost of medical care (surgery, hospital stay, treatment outside the hospital including medications, dressing, physical therapy, outpatient laboratory work, etc.) in group of external fixation only was 63.3 ± 15.1, and total absence from work was 38.6 ± 6.6 wk. While the group of early removal of external fixation and replacement by IM nail, total cost of medical care was 38.3 ± 6.4 and total absence from work or school was 22.7 ± 4.1. The difference was statistically significant regarding the total cost and absence from work in favor of the group of early removal and replacement by IM nail. CONCLUSION: Early removal of external fixation and replacement by intramedullary nail in treatment of infected nonunion showed more cost effectiveness. Orthopaedic society needs to show the cost effectiveness of different procedures to the community, insurance, and health authorities. PMID:25621219

  13. Contribution of dinitrogen fixation to bacterial and primary productivity in the Gulf of Aqaba (Red Sea)

    NASA Astrophysics Data System (ADS)

    Rahav, E.; Herut, B.; Mulholland, M. R.; Voß, B.; Stazic, D.; Steglich, C.; Hess, W. R.; Berman-Frank, I.

    2013-06-01

    We evaluated the seasonal contribution of heterotrophic and autotrophic diazotrophy to the total dinitrogen (N2) fixation in a representative pelagic station in the northern Gulf of Aqaba in early spring when the water column was mixed and during summer under full thermal stratification. N2 fixation rates were low during the mixed period (˜ 0.1 nmol N L-1 d-1) and were significantly coupled with both primary and bacterial productivity. During the stratified period N2 fixation rates were four-fold higher (˜ 0.4 nmol N L-1 d-1) and were significantly correlated solely with bacterial productivity. Furthermore, while experimental enrichment of seawater by phosphorus (P) enhanced bacterial productivity and N2 fixation rates during both seasons primary productivity was stimulated by P only in the early spring. Metatranscriptomic analyses from the stratified period identified the major diazotrophic contributors as related to heterotrophic prokaryotes from the Euryarchaeota and Desulfobacterales (Deltaproteobacteria) or Chlorobiales (Chlorobia). Moreover, during this season, experimental amendments to seawater applying a combination of the photosynthetic inhibitor 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and a mixture of amino acids increased both bacterial productivity and N2 fixation rates. Our findings from the northern Gulf of Aqaba indicate a~shift in the diazotrophic community from phototrophic and heterotrophic populations, including small blooms of the cyanobacterium Trichodesmium, in winter/early spring, to predominantly heterotrophic diazotrophs in summer that may be both P and carbon limited as the additions of P and amino acids illustrated.

  14. Significant CO2 fixation by small prymnesiophytes in the subtropical and tropical northeast Atlantic Ocean.

    PubMed

    Jardillier, Ludwig; Zubkov, Mikhail V; Pearman, John; Scanlan, David J

    2010-09-01

    Global estimates indicate the oceans are responsible for approximately half of the carbon dioxide fixed on Earth. Organisms < or =5 microm in size dominate open ocean phytoplankton communities in terms of abundance and CO(2) fixation, with the cyanobacterial genera Prochlorococcus and Synechococcus numerically the most abundant and more extensively studied compared with small eukaryotes. However, the contribution of specific taxonomic groups to marine CO(2) fixation is still poorly known. In this study, we show that among the phytoplankton, small eukaryotes contribute significantly to CO(2) fixation (44%) because of their larger cell volume and thereby higher cell-specific CO(2) fixation rates. Within the eukaryotes, two groups, herein called Euk-A and Euk-B, were distinguished based on their flow cytometric signature. Euk-A, the most abundant group, contained cells 1.8+/-0.1 microm in size while Euk-B was the least abundant but cells were larger (2.8+/-0.2 microm). The Euk-B group comprising prymnesiophytes (73+/-13%) belonging largely to lineages with no close cultured counterparts accounted for up to 38% of the total primary production in the subtropical and tropical northeast Atlantic Ocean, suggesting a key role of this group in oceanic CO(2) fixation. PMID:20393575

  15. Proteomic Analysis of Carbon Concentrating Chemolithotrophic Bacteria Serratia sp. for Sequestration of Carbon Dioxide

    PubMed Central

    Bharti, Randhir K.; Srivastava, Shaili; Thakur, Indu Shekhar

    2014-01-01

    A chemolithotrophic bacterium enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was identified as Serratia sp. by 16S rRNA sequencing. Carbon dioxide sequestering capacity of bacterium was detected by carbonic anhydrase enzyme and ribulose-1, 5- bisphosphate carboxylase/oxygenase (RuBisCO). The purified carbonic anhydrase showed molecular weight of 29 kDa. Molecular weight of RuBisCO was 550 kDa as determined by fast protein liquid chromatography (FPLC), however, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) showed presence of two subunits whose molecular weights were 56 and 14 kDa. The Western blot analysis of the crude protein and purified sample cross reacted with RuBisCO large-subunit polypeptides antibodies showed strong band pattern at molecular weight around 56 kDa regions. Whole cell soluble proteins of Serratia sp. grown under autotrophic and heterotrophic conditions were resolved by two-dimensional gel electrophoresis and MALDI-TOF/MS for differential expression of proteins. In proteomic analysis of 63 protein spots, 48 spots were significantly up-regulated in the autotrophically grown cells; seven enzymes showed its utilization in autotrophic carbon fixation pathways and other metabolic activities of bacterium including lipid metabolisms indicated sequestration potency of carbon dioxide and production of biomaterials. PMID:24619032

  16. Diazotrophy in the Deep: Measuring Rates and Identifying Biological Mediators of N2 fixation in Deep-Sea Sediments

    NASA Astrophysics Data System (ADS)

    Dekas, A. E.; Fike, D. A.; Chadwick, G.; Connon, S. A.; Orphan, V. J.

    2013-12-01

    Biological N2 fixation (the conversion of N2 to NH3) is the largest natural source of bioavailable nitrogen to the biosphere, and dictates the rate of community productivity in many nitrogen-limited environments. Deep-sea sediments are traditionally not thought to host N2 fixation, however evidence from a metagenomics dataset targeting deep-sea methanotrophic archaea (ANME) suggested their ability to fix N2 (Pernthaler, et al., PNAS 2008). Using stable isotope labeling experiments and FISH-NanoSIMS, a technique which allows the visualization of isotopic composition within phylogenetically identified cells on the nanometer scale, we demonstrated that the ANME are capable of N2 fixation (Dekas et al., Science 2009). In the present work, we use FISH-NanoSIMS and bulk Isotope Ratio Mass Spectrometry (IRMS) to show that the ANME are the most significant source of new nitrogen at a Costa Rican methane seep. This suggests that the ANME may play a significant role in N2 fixation in methane seeps worldwide. We expand our investigation of deep-sea diazotrophy to include diverse habitats, including sulfide- and carbon-rich whalefalls, and observe that N2 fixation is widespread in sediments on the seafloor. Outside of methane seeps, N2 fixation appears to be mediated by a diversity of anaerobic microbes potentially including methanogens and sulfate reducing bacteria. Interestingly, deep-sea N2 fixation often occurs in the presence of high levels of NH4+. Our observations challenge long-held hypotheses about where and when N2 fixation occurs, and suggest a bigger role for N2 fixation on the seafloor - and potentially the deep-biosphere - than previously realized.

  17. Quantum Chemistry Study of Cycloaddition Pathways for the Reaction of o-Benzyne with Fullerenes and Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Jaffe, Richard; Han, Jie; Langhoff, Stephen R. (Technical Monitor)

    1997-01-01

    Functionalization of fullerenes via the [2+2] cycloaddition reaction with o-benzyne has been demonstrated in the laboratory. In contrast, [2+4) cycloaddition products are formed when benzyne reacts with planar polycyclic aromatic hydrocarbons. Using density functional theory (DFT) calculations with Becke's hybrid functional and small contracted gaussian basis sets, we are able to reproduce these product preferences. The objective of this work is to explore the functionalization of carbon nanotubes. We have studied o-benzyne cycloaddition products with a [14,0] single-walled nanotube. We find both the [2+2] and [2+4] adducts to be stable, with the latter product being somewhat favored.

  18. [Visual fixation features after treatment of exudative age macular degeneration].

    PubMed

    Surguch, V K; Surnina, Z V; Sizova, M V

    2011-01-01

    Changes of visual fixation in patients with choroidal neovascularitation (CNV) associated with age macular degeneration (AMD) after bevacizumab are studied. 45 patients (45 eyes) with active CNV treated with intravitreal bevacizumab were enrolled into the study. Visual fixation was studied before and 3-6 months after treatment using original method that included fundus foto and fluorescein angiography. Fixation relative to fovea and lesion was evaluated. Foveal fixation beyond lesion was found in 9%, foveal fixation within lesion--in 47%, extrafoveal fixation beyond lesion--in 18%, extrafoveal fixation within lesion--in 26% of patients. Changes of fixation localization after treatment was found in 24% patients. Examination of visual fixation may be useful for prognosis of anti-VEGF treatment efficacy in patients with CNV. PMID:21721271

  19. Biological construction of single-walled carbon nanotube electron transfer pathways in dye-sensitized solar cells.

    PubMed

    Inoue, Ippei; Watanabe, Kiyoshi; Yamauchi, Hirofumi; Ishikawa, Yasuaki; Yasueda, Hisashi; Uraoka, Yukiharu; Yamashita, Ichiro

    2014-10-01

    We designed and mass-produced a versatile protein supramolecule that can be used to manufacture a highly efficient dye-sensitized solar cell (DSSC). Twelve single-walled carbon-nanotube (SWNT)-binding and titanium-mineralizing peptides were genetically integrated on a cage-shaped dodecamer protein (CDT1). A process involving simple mixing of highly conductive SWNTs with CDT1 followed by TiO2 biomineralization produces a high surface-area/weight TiO2 -(anatase)-coated intact SWNT nanocomposite under environmentally friendly conditions. A DSSC with a TiO2 photoelectrode containing 0.2?wt?% of the SWNT-TiO2 nanocomposite shows a current density improvement by 80% and a doubling of the photoelectric conversion efficiency. The SWNT-TiO2 nanocomposite transfers photon-generated electrons from dye molecules adsorbed on the TiO2 to the anode electrode swiftly. PMID:25111295

  20. Thermus oshimai JL-2 and T. thermophilus JL-18 genome analysis illuminates pathways for carbon, nitrogen, and sulfur cycling.

    PubMed

    Murugapiran, Senthil K; Huntemann, Marcel; Wei, Chia-Lin; Han, James; Detter, J C; Han, Cliff; Erkkila, Tracy H; Teshima, Hazuki; Chen, Amy; Kyrpides, Nikos; Mavrommatis, Konstantinos; Markowitz, Victor; Szeto, Ernest; Ivanova, Natalia; Pagani, Ioanna; Pati, Amrita; Goodwin, Lynne; Peters, Lin; Pitluck, Sam; Lam, Jenny; McDonald, Austin I; Dodsworth, Jeremy A; Woyke, Tanja; Hedlund, Brian P

    2013-01-01

    The complete genomes of Thermus oshimai JL-2 and T. thermophilus JL-18 each consist of a circular chromosome, 2.07 Mb and 1.9 Mb, respectively, and two plasmids ranging from 0.27 Mb to 57.2 kb. Comparison of the T. thermophilus JL-18 chromosome with those from other strains of T. thermophilus revealed a high degree of synteny, whereas the megaplasmids from the same strains were highly plastic. The T. oshimai JL-2 chromosome and megaplasmids shared little or no synteny with other sequenced Thermus strains. Phylogenomic analyses using a concatenated set of conserved proteins confirmed the phylogenetic and taxonomic assignments based on 16S rRNA phylogenetics. Both chromosomes encode a complete glycolysis, tricarboxylic acid (TCA) cycle, and pentose phosphate pathway plus glucosidases, glycosidases, proteases, and peptidases, highlighting highly versatile heterotrophic capabilities. Megaplasmids of both strains contained a gene cluster encoding enzymes predicted to catalyze the sequential reduction of nitrate to nitrous oxide; however, the nitrous oxide reductase required for the terminal step in denitrification was absent, consistent with their incomplete denitrification phenotypes. A sox gene cluster was identified in both chromosomes, suggesting a mode of chemolithotrophy. In addition, nrf and psr gene clusters in T. oshmai JL-2 suggest respiratory nitrite ammonification and polysulfide reduction as possible modes of anaerobic respiration. PMID:24019992

  1. Nitrite fixation by humic substances: Nitrogen-15 nuclear magnetic resonance evidence for potential intermediates in chemodenitrification

    USGS Publications Warehouse

    Thorn, K.A.; Mikita, M.A.

    2000-01-01

    Studies have suggested that NO2/-, produced during nitrification and denitrification, can become incorporated into soil organic matter and, in one of the processes associated with chemodenitrification, react with organic matter to form trace N gases, including N2O. To gain an understanding of the nitrosation chemistry on a molecular level, soil and aquatic humic substances were reacted with 15N-labeled NaNO2, and analyzed by liquid phase 15N and 13C nuclear magnetic resonance (NMR). The International Humic Substances Society (IHSS) Pahokee peat and peat humic acid were also reacted with Na15NO2 and analyzed by solid-state 15N NMR. In Suwannee River, Armadale, and Laurentian fulvic acids, phenolic rings and activated methylene groups underwent nitrosation to form nitrosophenols (quinone monoximes) and ketoximes, respectively. The oximes underwent Beckmann rearrangements to 2??amides, and Beckmann fragmentations to nitriles. The nitriles in turn underwent hydrolysis to 1??amides. Peaks tentatively identified as imine, indophenol, or azoxybenzene nitrogens were clearly present in spectra of samples nitrosated at pH 6 but diminished at pH 3. The 15N NMR spectrum of the peat humic acid exhibited peaks corresponding with N-nitroso groups in addition to nitrosophenols, ketoximes, and secondary Beckmann reaction products. Formation of N-nitroso groups was more significant in the whole peat compared with the peat humic acid. Carbon-13 NMR analyses also indicated the occurrence of nitrosative demethoxylation in peat and soil humic acids. Reaction of 15N-NH3 fixated fulvic acid with unlabeled NO2/- resulted in nitrosative deamination of aminohydroquinone N, suggesting a previously unrecognized pathway for production of N2 gas in soils fertilized with NH3.Studies have suggested that NO2-, produced during nitrification and denitrification, can become incorporated into soil organic matter and, in one of the processes associated with chemodenitrification, react with organic matter to form trace N gases, including N2O. To gain an understanding of the nitrosation chemistry on a molecular level, soil and aquatic humic substances were reacted with 15N-labeled NaNO2, and analyzed by liquid phase 15N and 13C nuclear magnetic resonance (NMR). The International Humic Substances Society (IHSS) Pahokee peat and peat humic acid were also reacted with Na15NO2 and analyzed by solid-state 15N NMR. In Suwannee River, Armadale, and Laurentian fulvic acids, phenolic rings and activated methylene groups underwent nitrosation to form nitrosophenols (quinone monoximes) and ketoximes, respectively. The oximes underwent Beckmann rearrangements to 2?? amides, and Beckmann fragmentations to nitriles. The nitriles in turn underwent hydrolysis to 1?? amides. Peaks tentatively identified as imine, indophenol, or azoxybenzene nitrogens were dearly present in spectra of samples nitrosated at pH 6 but diminished at pH 3. The 15N NMR spectrum of the peat humic acid exhibited peaks corresponding with N-nitroso groups in addition to nitrosophenols, ketoximes, and secondary Beckmann reaction products. Formation of N-nitroso groups was more significant in the whole peat compared with the peat humic acid. Carbon-13 NMR analyses also indicated the occurrence of nitrosative demethoxylation in peat and soil humic acids. Reaction of 15N-NH3 fixated fulvic acids with unlabeled NO2- resulted in nitrosative deamination of aminohydroquinone N, suggesting a previously unrecognized pathway for production of N2 gas in soils fertilized with NH3.

  2. Wire-free fixation of jaw fractures.

    PubMed

    Cousin, G C S

    2009-10-01

    Stainless steel wire is often used in the management of jaw fractures to provide intraoperative or postoperative intermaxillary fixation (IMF). Wiring of the jaws is time-consuming, a second procedure is needed to remove it, and needlestick injuries occur during placement. We report on 151 consecutive patients who had wire-free fixation of jaw fractures, and outline the value of a system of plastic anchorage points applied to individual teeth in both jaws that allows for wire-free IMF when they are linked by elastics (Rapid IMF, Synthes, PA, USA). A total of 150 successive patients had wire-free fixation of 146 mandibular and 5 maxillary fractures. Ninety-eight were hand-held in occlusion, and 52 were treated using Rapid IMF. There were few complications. PMID:19608310

  3. Surface circulation patterns and the pathways of sea surface carbon dioxide (CO2) off northern Chile (~27.5° S) between 30 and 10 kyr BP: global and/or local forcing?

    NASA Astrophysics Data System (ADS)

    Placencia, J. A.; Harada, N.; Torres, R.; Lange, C. B.; Hebbeln, D.

    2010-03-01

    We present a reconstruction of past changes in partial pressure of CO2 (pCO2) from northern Chile (~27° S), between 10 and 30 kyr BP, based on carbon isotope composition of C37:2-alkenone. The high-pCO2 during the entire time series indicates that northern Chile upwelling system has been a permanent source of CO2 to the atmosphere. The multiproxy reconstruction suggests that the CO2 outgassing and sequestration pathways were modulated by local and global mechanisms. During global glacial conditions, an enhanced coastal upwelling forcing resulted in high-availability of deep water macronutrients and a CO2-supersaturated water column, which combined with high-inputs of iron from the continent, intensified the carbon sequestration pathway of the biological pump, through diatom biomass export. During the deglacial, a decrease in the upwelling forcing, an increment in water column stability and reduced continental inputs of iron are consistent with a larger role of calcifying organisms in the plankton assemblage in terms of carbon sequestration pathway through the carbonate system.

  4. Differential Translocation of Host Cellular Materials into the Chlamydia trachomatis Inclusion Lumen during Chemical Fixation

    PubMed Central

    Kokes, Marcela; Valdivia, Raphael H.

    2015-01-01

    Chlamydia trachomatis manipulates host cellular pathways to ensure its proliferation and survival. Translocation of host materials into the pathogenic vacuole (termed ‘inclusion’) may facilitate nutrient acquisition and various organelles have been observed within the inclusion, including lipid droplets, peroxisomes, multivesicular body components, and membranes of the endoplasmic reticulum (ER). However, few of these processes have been documented in living cells. Here, we survey the localization of a broad panel of subcellular elements and find ER, mitochondria, and inclusion membranes within the inclusion lumen of fixed cells. However, we see little evidence of intraluminal localization of these organelles in live inclusions. Using time-lapse video microscopy we document ER marker translocation into the inclusion lumen during chemical fixation. These intra-inclusion ER elements resist a variety of post-fixation manipulations and are detectable via immunofluorescence microscopy. We speculate that the localization of a subset of organelles may be exaggerated during fixation. Finally, we find similar structures within the pathogenic vacuole of Coxiella burnetti infected cells, suggesting that fixation-induced translocation of cellular materials may occur into the vacuole of a range of intracellular pathogens. PMID:26426122

  5. Effects of 18?-glycyrrhizin on TGF-?1/Smad signaling pathway in rats with carbon tetrachloride-induced liver fibrosis

    PubMed Central

    Qu, Ying; Zong, Lei; Xu, Mingyi; Dong, Yuwei; Lu, Lungen

    2015-01-01

    Background: Glycyrrhizin has various pharmacological effects including hepato-protection. This study aimed to investigate the potential mechanism underlying the protective effects of 18?-glycyrrhizin (18?-GL) in rats with carbon tetrachloride (CCl4) induced liver fibrosis. Methods: Male Sprague-Dawley (SD) rats were randomly divided into control group, fibrosis group, 25 mg/kg 18?-GL group and 12.5 mg/kg 18?-GL group. Rats in experimental groups were subcutaneously injected with 40% CCl4 twice weekly for 8 weeks. Immunohistochemical examination was carried out to detect the protein expressions of collagen I, collagen III, TGF-?1, p-Smad2, p-Smad3, Smad 7 and SP-1, in the liver, and the mRNA and protein expressions of these genes were determined in the liver by real time PCR and Western blot assay, respectively. Results: 18?-GL ameliorated histological changes and significantly suppressed collagen deposition. 18?-GL significantly decreased the mRNA expressions of TGF-?1, Smad2, Smad3 and SP-1 in the liver. Immunohistochemical staining revealed that TGF-?1, p-Smad2, p-Smad3 and SP-1 expressions reduced following 18?-GL therapy. Western blot assay showed p-Smad2, p-Smad3, smad2 and smad3 expressions decreased after 18?-GL treatment. The mRNA and protein expression of Smad7 remained unchanged. Conclusion: 18?-GL is able to attenuate CCl4 induced liver fibrosis in rat. PMID:25973013

  6. Bacterial N2-fixation in mangrove ecosystems: insights from a diazotroph–mangrove interaction

    PubMed Central

    Alfaro-Espinoza, Gabriela; Ullrich, Matthias S.

    2015-01-01

    Mangrove forests are highly productive ecosystems but represent low nutrient environments. Nitrogen availability is one of the main factors limiting mangrove growth. Diazotrophs have been identified as key organisms that provide nitrogen to these environments. N2-fixation by such organisms was found to be higher in the mangrove roots than in surrounding rhizosphere. Moreover, previous studies showed that mangroves grew better in the presence of N2-fixers indicating a potentially mutualistic relationship. However, the molecular signals and mechanisms that govern these interactions are still poorly understood. Here we present novel insights in the interaction of a diazotroph with a mangrove species to improve our understanding of the molecular and ecophysiological relationship between these two organisms under controlled conditions. Our results showed that Marinobacterium mangrovicola is a versatile organism capable of competing with other organisms to survive for long periods in mangrove soils. N2-fixation by this bacterium was up-regulated in the presence of mangrove roots, indicating a possible beneficial interaction. The increase in N2-fixation was limited to cells of the exponential growth phase suggesting that N2-fixation differs over the bacterial growth cycle. Bacterial transformants harboring a transcriptional nifH::gusA fusion showed that M. mangrovicola successfully colonized mangrove roots and simultaneously conducted N2-fixation. The colonization process was stimulated by the lack of an external carbon source suggesting a possible mutualistic relationship. M. mangrovicola represents an interesting genetically accessible diazotroph, which colonize mangrove roots and exhibit higher N2-fixation in the presence of mangrove roots. Consequently, we propose this microorganism as a tool to study molecular interactions between N2-fixers and mangrove plants and to better understand how changes in the environment could impact these important and relatively unknown interactions. PMID:26029186

  7. Physical forcing of nitrogen fixation and diazotroph community structure in the North Pacific subtropical gyre

    NASA Astrophysics Data System (ADS)

    Church, Matthew J.; Mahaffey, Claire; Letelier, Ricardo M.; Lukas, Roger; Zehr, Jonathan P.; Karl, David M.

    2009-06-01

    Dinitrogen (N2) fixing microorganisms (termed diazotrophs) exert important control on the ocean carbon cycle. However, despite increased awareness on the roles of these microorganisms in ocean biogeochemistry and ecology, the processes controlling variability in diazotroph distributions, abundances, and activities remain largely unknown. In this study, we examine 3 years (2004-2007) of approximately monthly measurements of upper ocean diazotroph community structure and rates of N2 fixation at Station ALOHA (22°45'N, 158°W), the field site for the Hawaii Ocean Time-series program in the central North Pacific subtropical gyre (NPSG). The structure of the N2-fixing microorganism assemblage varied widely in time with unicellular N2-fixing microorganisms frequently dominating diazotroph abundances in the late winter and early spring, while filamentous microorganisms (specifically various heterocyst-forming cyanobacteria and Trichodesmium spp.) fluctuated episodically during the summer. On average, a large fraction (˜80%) of the daily N2 fixation was partitioned into the biomass of <10 ?m microorganisms. Rates of N2 fixation were variable in time, with peak N2 fixation frequently coinciding with periods when heterocystous N2-fixing cyanobacteria were abundant. During the summer months when sea surface temperatures exceeded 25.2°C and concentrations of nitrate plus nitrite were at their annual minimum, rates of N2 fixation often increased during periods of positive sea surface height anomalies, as reflected in satellite altimetry. Our results suggest mesoscale physical forcing may comprise an important control on variability in N2 fixation and diazotroph community structure in the NPSG.

  8. 21 CFR 888.3020 - Intramedullary fixation rod.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3020 Intramedullary fixation rod. ...An intramedullary fixation rod is a device intended to be implanted that consists of a rod made of alloys such as...

  9. 21 CFR 888.3020 - Intramedullary fixation rod.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3020 Intramedullary fixation rod. ...An intramedullary fixation rod is a device intended to be implanted that consists of a rod made of alloys such as...

  10. THE CONUNDRUM OF MARINE N2 FIXATION CLAIRE MAHAFFEY

    E-print Network

    Capone, Douglas G.

    -sea partitioning of CO2 on climate time-scales. The question remains: does the importance of marine N2 fixation estimates of N2 fixation, largely of the planktonic cyanobacte- rium, Trichodesmium, can account for only

  11. Between Linguistic Attention and Gaze Fixations in Multimodal Conversational Interfaces

    E-print Network

    Between Linguistic Attention and Gaze Fixations in Multimodal Conversational Interfaces Rui Fang attention in multimodal conversational interfaces. To address this issue, we conducted a preliminary Linguistic Attention, Gaze Fixation, Multimodal Conversational Interfaces 1. INTRODUCTION In human machine

  12. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  13. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  14. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  15. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3060 Spinal intervertebral body fixation...fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are...

  16. Genetic variation of folate-mediated one-carbon transfer pathway predicts susceptibility to choline deficiency in humans

    PubMed Central

    Kohlmeier, Martin; da Costa, Kerry-Ann; Fischer, Leslie M.; Zeisel, Steven H.

    2005-01-01

    Choline is a required nutrient, and some humans deplete quickly when fed a low-choline diet, whereas others do not. Endogenous choline synthesis can spare some of the dietary requirement and requires one-carbon groups derived from folate metabolism. We examined whether major genetic variants of folate metabolism modify susceptibility of humans to choline deficiency. Fifty-four adult men and women were fed diets containing adequate choline and folate, followed by a diet containing almost no choline, with or without added folate, until they were clinically judged to be choline-deficient, or for up to 42 days. Criteria for clinical choline deficiency were a more than five times increase in serum creatine kinase activity or a >28% increase of liver fat after consuming the low-choline diet that resolved when choline was returned to the diet. Choline deficiency was observed in more than half of the participants, usually within less than a month. Individuals who were carriers of the very common 5,10-methylenetetrahydrofolate dehydrogenase-1958A gene allele were more likely than noncarriers to develop signs of choline deficiency (odds ratio, 7.0; 95% confidence interval, 2.0-25; P < 0.01) on the low-choline diet unless they were also treated with a folic acid supplement. The effects of the C677T and A1298C polymorphisms of the 5,10-methylene tetrahydrofolate reductase gene and the A80C polymorphism of the reduced folate carrier 1 gene were not statistically significant. The most remarkable finding was the strong association in premenopausal women of the 5,10-methylenetetrahydrofolate dehydrogenase-1958A gene allele polymorphism with 15 times increased susceptibility to developing organ dysfunction on a low-choline diet. PMID:16236726

  17. Multiwalled carbon nanotube buckypaper induces cell cycle arrest and apoptosis in human leukemia cell lines through modulation of AKT and MAPK signaling pathways.

    PubMed

    Dinicola, Simona; Masiello, Maria Grazia; Proietti, Sara; Coluccia, Pierpaolo; Fabrizi, Gianmarco; Palombo, Alessandro; Micciulla, Federico; Bistarelli, Silvia; Ricci, Giulia; Catizone, Angela; De Toma, Giorgio; Bizzarri, Mariano; Bellucci, Stefano; Cucina, Alessandra

    2015-10-01

    MWCNT buckypaper (BP) shows physico-chemical and mechanical properties that make it potentially useful as a substrate in nano-bio interface research including in tissue engineering. When used as a scaffold material, BP comes into contact with host cells and surrounding tissues; therefore it is critical to determine its biocompatibility and interaction with living systems. The aim of this study was to investigate BP effects on cell growth, apoptosis and reactive oxygen species (ROS) production in three human leukemia cell lines HL-60, U-937 and K-562. BP was able to induce both the reduction of cell proliferation, associated with an arrest in G0/G1 phase of cell cycle and the increase of apoptosis in leukemic cell lines, thus exerting both cytostatic and cytotoxic effects. The growth inhibitory effect was likely mediated by the decrease of cyclins D, E, A, B1 levels and CDK4 expression; meanwhile, the apoptotic effect, not mediated by ROS production, was presumably due to the combined action of the survival and pro-apoptotic AKT and MAPK signal transduction pathways. These results raised the issue of biocompatibility of MWCNT BP for the creation of carbon nanotubes based scaffolds to utilize as prostheses in tissue engineering. PMID:25998161

  18. Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change

    PubMed Central

    Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

    2014-01-01

    Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of “new” nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review. PMID:24967086

  19. Investigation of the medical applications of the unique biocarbons developed by NASA. [compatibility of percutaneous prosthetic carbon devices

    NASA Technical Reports Server (NTRS)

    Mooney, V.

    1973-01-01

    The biocompatibility of percutaneous endoskeletal fixation devices made from carbon compounds, and their applications are considered. The clinical application of these carbons to solve human problems is demonstrated and the nature of myoelectric simulation by carbon implants is studied.

  20. Molecular Basis of Microbial One-Carbon Metabolism 2008 Gordon Research Conference (July 20-25, 2008)

    SciTech Connect

    Stephen W. Ragsdale

    2009-08-12

    One-carbon (C-1) compounds play a central role in microbial metabolism. C-1 compounds include methane, carbon monoxide, CO2, and methanol as well as coenzyme-bound one-carbon compounds (methyl-B12, CH3-H4folate, etc). Such compounds are of broad global importance because several C-1 compounds (e.g., CH4) are important energy sources, some (e.g., CO2 and CH4) are potent greenhouse gases, and others (e.g., CH2Cl2) are xenobiotics. They are central in pathways of energy metabolism and carbon fixation by microbes and many are of industrial interest. Research on the pathways of one-carbon metabolism has added greatly to our understanding of evolution, structural biology, enzyme mechanisms, gene regulation, ecology, and applied biology. The 2008 meeting will include recent important findings in the following areas: (a) genomics, metagenomics, and proteomic studies that have expanded our understanding of autotrophy and C-1 metabolism and the evolution of these pathways; (b) redox regulation of carbon cycles and the interrelationship between the carbon cycle and other biogeochemical cycles (sulfur, nitrogen, oxygen); (c) novel pathways for carbon assimilation; (d) biotechnology related to C-1 metabolism; (e) novel enzyme mechanisms including channeling of C-1 intermediates during metabolism; and (f) the relationship between metal homeostasis and the global carbon cycle. The conference has a diverse and gender-balanced slate of speakers and session leaders. The wide variety of disciplines brought to the study of C-1 metabolism make the field an excellent one in which to train young researchers.

  1. Genetic polymorphisms in the one-carbon metabolism pathway genes and susceptibility to non-Hodgkin lymphoma.

    PubMed

    Suthandiram, Sujatha; Gan, Gin-Gin; Mohd Zain, Shamsul; Bee, Ping-Chong; Lian, Lay-Hoong; Chang, Kian-Meng; Ong, Tee-Chuan; Mohamed, Zahurin

    2015-03-01

    Corroborating evidence related to the role of aberrations on one-carbon metabolism (OCM) genes has been inconsistent. We evaluated the association between polymorphisms in 12 single nucleotide polymorphisms (SNPs) in 8 OCM genes (CBS, FPGS, FTHFD, MTRR, SHMT1, SLC19A1, TCN1, and TYMS), and non-Hodgkin lymphoma (NHL) risk in a multi-ethnic population which includes Malay, Chinese and Indian ethnic subgroups. Cases (N?=?372) and controls (N?=?722) were genotyped using the Sequenom MassARRAY platform. Our results of the pooled subjects showed a significantly enhanced NHL risk for CBS Ex9?+?33C?>?T (T versus C: OR 1.55, 95% CI 1.22-1.96, P?=?0.0003), CBS Ex18-319G?>?A (A versus G: OR 1.15, 95% CI 1.14-1.83; P?=?0.002), SHMT1 Ex12?+?236 T?>?C (T versus C: OR 1.44, 95% CI 1.15-1.81, P?=?0.002), and TYMS Ex8?+?157C?>?T (T versus C: OR 1.29, 95% CI 1.06-1.57, P?=?0.01). Haplotype analysis for CBS SNPs showed a significantly decreased risk of NHL in subjects with haplotype CG (OR 0.69, 95% CI 0.56-0.86, P?=?<0.001). The GG haplotype for the FTHFD SNPs showed a significant increased risk of NHL (OR 1.40, 95% CI 1.12-1.76, P?=?0.002). For the TYMS gene, haplotype CAT at TYMS (OR 0.67, 95% CI 0.49-0.90, P?=?0.007) was associated with decreased risk of NHL, while haplotype TAC (OR 1.29, 95% CI 1.05-1.58, P?=?0.01) was found to confer increased risk of NHL. Our study suggests that variation in several OCM genes (CBS, FTHFD, SHMT1, TCN1, and TYMS) may influence susceptibility to NHL. PMID:25384508

  2. 21 CFR 872.4880 - Intraosseous fixation screw or wire.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Intraosseous fixation screw or wire. 872.4880... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Surgical Devices § 872.4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended to be...

  3. 21 CFR 872.4880 - Intraosseous fixation screw or wire.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Intraosseous fixation screw or wire. 872.4880... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Surgical Devices § 872.4880 Intraosseous fixation screw or wire. (a) Identification. An intraosseous fixation screw or wire is a metal device intended to be...

  4. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Spinal intervertebral body fixation orthosis. 888.3060 Section 888.3060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... body fixation orthosis. (a) Identification. A spinal intervertebral body fixation orthosis is a...

  5. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Spinal intervertebral body fixation orthosis. 888.3060 Section 888.3060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... body fixation orthosis. (a) Identification. A spinal intervertebral body fixation orthosis is a...

  6. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Spinal intervertebral body fixation orthosis. 888.3060 Section 888.3060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... body fixation orthosis. (a) Identification. A spinal intervertebral body fixation orthosis is a...

  7. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Spinal intervertebral body fixation orthosis. 888.3060 Section 888.3060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... body fixation orthosis. (a) Identification. A spinal intervertebral body fixation orthosis is a...

  8. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Spinal intervertebral body fixation orthosis. 888.3060 Section 888.3060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... body fixation orthosis. (a) Identification. A spinal intervertebral body fixation orthosis is a...

  9. 21 CFR 868.5770 - Tracheal tube fixation device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... (CONTINUED) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5770 Tracheal tube fixation device. (a) Identification. A tracheal tube fixation device is a device used to hold a tracheal tube in... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Tracheal tube fixation device. 868.5770...

  10. 21 CFR 868.5770 - Tracheal tube fixation device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... (CONTINUED) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5770 Tracheal tube fixation device. (a) Identification. A tracheal tube fixation device is a device used to hold a tracheal tube in... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Tracheal tube fixation device. 868.5770...

  11. FLOODING STRESS Dinitrogen Fixation by Winter Chickpea Across Scales in

    E-print Network

    van Kessel, Chris

    FLOODING STRESS Dinitrogen Fixation by Winter Chickpea Across Scales in Waterlogged Soil a single tillage management system, however, considerable variation in N2 fixation by Keywords chickpea fixation by rain-fed chickpea (Cicer arietinum L.) at the field- and micro-scales (0.15 m spacing) after

  12. Unfixing Design Fixation: From Cause to Computer Simulation

    ERIC Educational Resources Information Center

    Dong, Andy; Sarkar, Somwrita

    2011-01-01

    This paper argues that design fixation, in part, entails fixation at the level of meta-representation, the representation of the relation between a representation and its reference. In this paper, we present a mathematical model that mimics the idea of how fixation can occur at the meta-representation level. In this model, new abstract concepts…

  13. The biodiversity of carbon assimilation.

    PubMed

    Kroth, Peter G

    2015-01-01

    As all plastids that have been investigated so far can be traced back to endosymbiotic uptake of cyanobacteria by heterotrophic host cells, they accordingly show a high similarity regarding photosynthesis, which includes both the photosystems and the biochemical reactions around the CO2 fixation via the Calvin-Bassham cycle. Major differences between the different algal and plant groups may include the presence or absence of carbon concentrating mechanisms, pyrenoids, Rubisco activases, carbonic anhydrases as well as differences in the regulation of the Calvin-Bassham cycle. This review describes the diversity of primary carbon fixation steps in algae and plants and the respective regulatory mechanisms. PMID:25239594

  14. Trichodesmium and nitrogen fixation in the Kuroshio

    NASA Astrophysics Data System (ADS)

    Shiozaki, T.; Takeda, S.; Itoh, S.; Kodama, T.; Liu, X.; Hashihama, F.; Furuya, K.

    2015-07-01

    Nitrogen fixation in the Kuroshio influences nitrogen balance in the North Pacific Ocean. The genus Trichodesmium is recognized as a major diazotroph in the Kuroshio. Although its abundance is higher in the Kuroshio than in adjacent waters, the reason for this difference remains unclear. The present study investigated the abundance of Trichodesmium spp. and nitrogen fixation together with concentrations of dissolved iron and phosphate, whose availabilities potentially control diazotrophy, in the Kuroshio and its marginal seas. We performed the observations near the Miyako Islands, which form part of the Ryukyu Islands, situated along the Kuroshio, since satellite analysis suggested that material transport could occur from the islands to the Kuroshio. Trichodesmium spp. bloomed (> 20 000 filaments L-1) near the Miyako Islands, and the abundance was high in the Kuroshio and the Kuroshio bifurcation region of the East China Sea, but was low in the Philippine Sea. The abundance of Trichodesmium spp. was significantly correlated with the total nitrogen fixation activity. The surface concentrations of dissolved iron (0.19-0.89 nM) and phosphate (< 3-36 nM) were similar for all of the study areas, indicating that the nutrient distribution could not explain the spatial differences in Trichodesmium spp. abundance and nitrogen fixation. We used a numerical model to simulate the transportation of water around the Ryukyu Islands to the Kuroshio. Our results indicate that Trichodesmium growing around the islands situated along the Kuroshio is potentially important for determining diazotrophy in this region.

  15. Treating Somatic Fixation: A Biopsychosocial Approach

    PubMed Central

    McDaniel, Susan H.; Campbell, Thomas; Seaburn, David

    1991-01-01

    Somatic fixation occurs when the patient or physician focuses exclusively on the biomedical aspects of a complex illness. Individual, family, and cultural factors promote the expression of emotional experience through physical symptoms. The physician or treatment team establishes a collaborative relationship with the patient and family, integrating biomedical and psychosocial evaluations and respecting the patient's defenses. PMID:21228995

  16. Biological nitrogen fixation in Louisiana sugarcane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nitrogen (N) is a major input for sugarcane with crops in Louisiana receiving between 90 and 180 kg/ha with the cost of N increasing 75% in the last decade. Biological N fixation (BNF) may be a viable alternative to fertilizer N. The process relies on endophytic bacteria (bacteria that live among th...

  17. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...device intended for use as a fixation target for the patient during ophthalmological examination. The patient directs his or her gaze so that the visual image of the object falls on the fovea centralis (the center of the macular retina of the eye.)...

  18. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...device intended for use as a fixation target for the patient during ophthalmological examination. The patient directs his or her gaze so that the visual image of the object falls on the fovea centralis (the center of the macular retina of the eye.)...

  19. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...device intended for use as a fixation target for the patient during ophthalmological examination. The patient directs his or her gaze so that the visual image of the object falls on the fovea centralis (the center of the macular retina of the eye.)...

  20. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...device intended for use as a fixation target for the patient during ophthalmological examination. The patient directs his or her gaze so that the visual image of the object falls on the fovea centralis (the center of the macular retina of the eye.)...

  1. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...device intended for use as a fixation target for the patient during ophthalmological examination. The patient directs his or her gaze so that the visual image of the object falls on the fovea centralis (the center of the macular retina of the eye.)...

  2. The Involvement of Hydrogen-producing and ATP-dependent NADPH-consuming Pathways in Setting the Redox Poise in the

    E-print Network

    The Involvement of Hydrogen-producing and ATP-dependent NADPH-consuming Pathways in Setting pathways. Conclusion: The two mains pathways are the ATP-dependent CO2 fixation pathway and the ATP either by the light-induced synthe- sis of ATP, which promotes the consumption of reducing equiv- alents

  3. Mechanical performance of Ilizarov circular external fixators in comparison with other external fixators.

    PubMed

    Podolsky, A; Chao, E Y

    1993-08-01

    The fundamental difference of the Ilizarov fixator is the type of pins used for bone fixation, i.e., Kirschner wires 1.5 mm and 1.8 mm in diameter, pretensioned from 50 to 130 kg before being affixed to the rings that are connected and fixed by threaded rods. The mechanical characteristics of external fixators may influence the biologic environment at the fracture site and ultimately decide the outcome of a surgical procedure. Thus, knowledge of the mechanical properties of the Ilizarov fixator is essential to a surgeon using it in clinical practice. The main objective of this study was to quantitate the mechanical behavior of the standard Ilizarov fixator under different loading conditions and fixator frame/wire configurations. The fixator was found to have a nonlinear stiffness behavior under axial compression. The nonlinearity in axial stiffness also varied with wire pretension. Such characteristics, however, were not as pronounced under torsion and bending loads within the test range studied. Besides the wire pretension, the most important factor affecting the structural stiffness of the Ilizarov device was the diameter of the wire. Offset bone position provided greater stiffness in loads up to 45 kg in axial compression, in torsion up to 5 degrees of rotation, and in the final loading range under bending. Fixators with wires crossing at 45 degrees had significantly greater stiffness in torsion as compared with 90 degrees crossing wires, but the opposite was true in axial compression. Torsional stiffness increased significantly under coupled axial compression applied through the bone ends. All four-point bending tests demonstrated two distinct stiffness curves that were probably due to slippage of the bone model on the wires. This information should help to understand the mechanical behavior of the Ilizarov device and thereby improve its clinical performance. PMID:8339510

  4. Renewable Hydrogen Carrier Carbohydrate: Constructing the Carbon-Neutral Carbohydrate Economy

    SciTech Connect

    Zhang, Y.-H. Percival; Mielenz, Jonathan R

    2011-01-01

    Abstract The hydrogen economy presents an appealing energy future but its implementation must solve numerous problems ranging from low-cost sustainable production, high-density storage, costly infrastructure, to eliminating safety concern. The use of renewable carbohydrate as a high-density hydrogen carrier and energy source for hydrogen production is possible due to emerging cell-free synthetic biology technology called cell-free synthetic pathway biotransformation (SyPaB). Assembly of numerous enzymes and co-enzymes in vitro can create complicated set of biological reactions or pathways that microorganisms cannot complete, for example, C6H10O5 (aq) + 7 H2O (l) 12 H2 (g) + 6 CO2 (g) (PLoS One 2007, 2:e456). Thanks to 100% selectivity of enzymes, modest reaction conditions, and high-purity of generated hydrogen, carbohydrate is a promising hydrogen carrier for end users. Gravimetric density of carbohydrate is 14.8 H2 mass% if water can be recycled from PEM fuel cells or 8.33% H2 mass% without water recycling. Renewable carbohydrate can be isolated from plant biomass or would be produced from a combination of solar electricity/hydrogen and carbon dioxide fixation mediated by high-efficiency artificial photosynthesis mediated by SyPaB. The construction of this carbon-neutral carbohydrate economy would address numerous sustainability challenges, such as electricity and hydrogen storage, CO2 fixation and long-term storage, water conservation, transportation fuel production, plus feed and food production.

  5. Nitrogen Fixation By Sulfate-Reducing Bacteria in Coastal and Deep-Sea Sediments

    NASA Astrophysics Data System (ADS)

    Bertics, V. J.; Löscher, C.; Salonen, I.; Schmitz-Streit, R.; Lavik, G.; Kuypers, M. M.; Treude, T.

    2011-12-01

    Sulfate-reducing bacteria (SRB) can greatly impact benthic nitrogen (N) cycling, by for instance inhibiting coupled denitrification-nitrification through the production of sulfide or by increasing the availability of fixed N in the sediment via dinitrogen (N2)-fixation. Here, we explored several coastal and deep-sea benthic habitats within the Atlantic Ocean and Baltic Sea, for the occurrence of N2-fixation mediated by SRB. A combination of different methods including microbial rate measurements of N2-fixation and sulfate reduction, geochemical analyses (porewater nutrient profiles, mass spectrometry), and molecular analyses (CARD-FISH, HISH-SIMS, "nested" PCR, and QPCR) were applied to quantify and identify the responsible processes and organisms, respectively. Furthermore, we looked deeper into the question of whether the observed nitrogenase activity was associated with the final incorporation of N into microbial biomass or whether the enzyme activity served another purpose. At the AGU Fall Meeting, we will present and compare data from numerous stations with different water depths, temperatures, and latitudes, as well as differences in key geochemical parameters, such as organic carbon content and oxygen availability. Current metabolic and molecular data indicate that N2-fixation is occurring in many of these benthic environments and that a large part of this activity may linked to SRB.

  6. Molecular basis of a microbe-mediated enhancement of symbiotic N/sub 2/-fixation. [Rhizobium meliloti; Pseudomonas syringae pv. tabaci

    SciTech Connect

    Unkefer, P.J.; Knight, T.J.

    1987-04-01

    Improvement of biological nitrogen fixation represents a potential source of both increased food production and decreased dependence on costly chemical fertilizer. They report the results of an investigation of the molecular basis of a unique, microbial-mediated mechanism for increased growth and nitrogen fixation rates in alfalfa. Inoculation of alfalfa plants with both Rhizobium meliloti and Pseudomonas syringae pv tabaci provides increased growth and N/sub 2/-fixation rates of alfalfa. Tabaci produces tabtoxinine-..beta..-lactam (T..beta..L), an exocellular product and glutamine synthetase (GS) inhibitor. The association of this pathogen with nodulating alfalfa plants appears to alter the normal regulation of nitrogen fixation such that nitrogenase activity is stimulated and GS activity is inhibited. Studies of the soluble amino acids in these nodules and the activities of the ammonia assimilatory enzymes indicate alternative pathways of ammonia assimilation are being employed.

  7. Microarray and bioinformatic analyses suggest models for carbon metabolism in the autotroph Acidithiobacillus ferrooxidans

    SciTech Connect

    C. Appia-ayme; R. Quatrini; Y. Denis; F. Denizot; S. Silver; F. Roberto; F. Veloso; J. Valdes; J. P. Cardenas; M. Esparza; O. Orellana; E. Jedlicki; V. Bonnefoy; D. Holmes

    2006-09-01

    Acidithiobacillus ferrooxidans is a chemolithoautotrophic bacterium that uses iron or sulfur as an energy and electron source. Bioinformatic analysis was used to identify putative genes and potential metabolic pathways involved in CO2 fixation, 2P-glycolate detoxification, carboxysome formation and glycogen utilization in At. ferrooxidans. Microarray transcript profiling was carried out to compare the relative expression of the predicted genes of these pathways when the microorganism was grown in the presence of iron versus sulfur. Several gene expression patterns were confirmed by real-time PCR. Genes for each of the above predicted pathways were found to be organized into discrete clusters. Clusters exhibited differential gene expression depending on the presence of iron or sulfur in the medium. Concordance of gene expression within each cluster, suggested that they are operons Most notably, clusters of genes predicted to be involved in CO2 fixation, carboxysome formation, 2P-glycolate detoxification and glycogen biosynthesis were up-regulated in sulfur medium, whereas genes involved in glycogen utilization were preferentially expressed in iron medium. These results can be explained in terms of models of gene regulation that suggest how A. ferrooxidans can adjust its central carbon management to respond to changing environmental conditions.

  8. Fructose Alters Intermediary Metabolism of Glucose in Human Adipocytes and Diverts Glucose to Serine Oxidation in the One–Carbon Cycle Energy Producing Pathway

    PubMed Central

    Varma, Vijayalakshmi; Boros, László G.; Nolen, Greg T.; Chang, Ching-Wei; Wabitsch, Martin; Beger, Richard D.; Kaput, Jim

    2015-01-01

    Increased consumption of sugar and fructose as sweeteners has resulted in the utilization of fructose as an alternative metabolic fuel that may compete with glucose and alter its metabolism. To explore this, human Simpson-Golabi-Behmel Syndrome (SGBS) preadipocytes were differentiated to adipocytes in the presence of 0, 1, 2.5, 5 or 10 mM of fructose added to a medium containing 5 mM of glucose representing the normal blood glucose concentration. Targeted tracer [1,2-13C2]-d-glucose fate association approach was employed to examine the influence of fructose on the intermediary metabolism of glucose. Increasing concentrations of fructose robustly increased the oxidation of [1,2-13C2]-d-glucose to 13CO2 (p < 0.000001). However, glucose-derived 13CO2 negatively correlated with 13C labeled glutamate, 13C palmitate, and M+1 labeled lactate. These are strong markers of limited tricarboxylic acid (TCA) cycle, fatty acid synthesis, pentose cycle fluxes, substrate turnover and NAD+/NADP+ or ATP production from glucose via complete oxidation, indicating diminished mitochondrial energy metabolism. Contrarily, a positive correlation was observed between glucose-derived 13CO2 formed and 13C oleate and doses of fructose which indicate the elongation and desaturation of palmitate to oleate for storage. Collectively, these results suggest that fructose preferentially drives glucose through serine oxidation glycine cleavage (SOGC pathway) one-carbon cycle for NAD+/NADP+ production that is utilized in fructose-induced lipogenesis and storage in adipocytes. PMID:26087138

  9. Fructose Alters Intermediary Metabolism of Glucose in Human Adipocytes and Diverts Glucose to Serine Oxidation in the One-Carbon Cycle Energy Producing Pathway.

    PubMed

    Varma, Vijayalakshmi; Boros, László G; Nolen, Greg T; Chang, Ching-Wei; Wabitsch, Martin; Beger, Richard D; Kaput, Jim

    2015-01-01

    Increased consumption of sugar and fructose as sweeteners has resulted in the utilization of fructose as an alternative metabolic fuel that may compete with glucose and alter its metabolism. To explore this, human Simpson-Golabi-Behmel Syndrome (SGBS) preadipocytes were differentiated to adipocytes in the presence of 0, 1, 2.5, 5 or 10 mM of fructose added to a medium containing 5 mM of glucose representing the normal blood glucose concentration. Targeted tracer [1,2-13C2]-d-glucose fate association approach was employed to examine the influence of fructose on the intermediary metabolism of glucose. Increasing concentrations of fructose robustly increased the oxidation of [1,2-13C2]-d-glucose to 13CO2 (p < 0.000001). However, glucose-derived 13CO2 negatively correlated with 13C labeled glutamate, 13C palmitate, and M+1 labeled lactate. These are strong markers of limited tricarboxylic acid (TCA) cycle, fatty acid synthesis, pentose cycle fluxes, substrate turnover and NAD+/NADP+ or ATP production from glucose via complete oxidation, indicating diminished mitochondrial energy metabolism. Contrarily, a positive correlation was observed between glucose-derived 13CO2 formed and 13C oleate and doses of fructose which indicate the elongation and desaturation of palmitate to oleate for storage. Collectively, these results suggest that fructose preferentially drives glucose through serine oxidation glycine cleavage (SOGC pathway) one-carbon cycle for NAD+/NADP+ production that is utilized in fructose-induced lipogenesis and storage in adipocytes. PMID:26087138

  10. Application of alternative fixatives to formalin in diagnostic pathology.

    PubMed

    Benerini Gatta, L; Cadei, M; Balzarini, P; Castriciano, S; Paroni, R; Verzeletti, A; Cortellini, V; De Ferrari, F; Grigolato, P

    2012-01-01

    Fixation is a critical step in the preparation of tissues for histopathology. The objective of this study was to investigate the effects of different fixatives vs formalin on proteins and DNA, and to evaluate alternative fixation for morphological diagnosis and nucleic acid preservation for molecular methods. Forty tissues were fixed for 24 h with six different fixatives: the gold standard fixative formalin, the historical fixatives Bouin and Hollande, and the alternative fixatives Greenfix, UPM and CyMol. Tissues were stained (Haematoxylin-Eosin, Periodic Acid Schiff, Trichromic, Alcian-blue, High Iron Diamine), and their antigenicity was determined by immunohistochemistry (performed with PAN-CK, CD31, Ki-67, S100, CD68, AML antibodies). DNA extraction, KRAS sequencing, FISH for CEP-17, and flow cytometry analysis of nuclear DNA content were applied. For cell morphology the alternative fixatives (Greenfix, UPM, CyMol) were equivalent to formalin. As expected, Hollande proved the best fixative for morphology. The morphology obtained with Bouin was comparable to that with formalin. Hollande was the best fixative for histochemistry. Bouin proved equivalent to formalin. The alternative fixatives were equivalent to formalin, although with greater variability in haematoxylin-eosin staining. It proved possible to obtain immunohistochemical staining largely equivalent to that following formalin-fixation with the following fixatives: Greenfix, Hollande, UPM and CyMol. The tissues fixed in Bouin did not provide results comparable to those obtained with formalin. The DNA extracted from samples fixed with alternative fixatives was found to be suitable for molecular analysis. PMID:22688293

  11. The penny drops: change blindness at fixation.

    PubMed

    Smith, Tim J; Lamont, Peter; Henderson, John M

    2012-01-01

    Our perception of the visual world is fallible. Unattended objects may change without us noticing as long as the change does not capture attention (change blindness). However, it is often assumed that changes to a fixated object will be noticed if it is attended. In this experiment we demonstrate that participants fail to detect a change in identity of a coin during a magic trick even though eyetracking indicates that the coin is tracked by the eyes throughout the trick. The change is subsequently detected when participants are instructed to look for it. These results suggest that during naturalistic viewing, attention can be focused on an object at fixation without including all of its features. PMID:22896921

  12. Lagged Syndesmotic Fixation: Our Clinical Experience.

    PubMed

    Kwaadu, Kwasi Yiadom; Fleming, Justin James; Salmon, Trudy

    2015-01-01

    Ankle fractures are very common, and although algorithms are in place for osseous management, consensus has not been reached regarding treatment of associated ligamentous injuries. Although tibiofibular syndesmotic stabilization can be done using different forms of fixation, the biomedical literature has long emphasized the risk of long-term restriction of ankle mobility with the use of lagged transfixation. However, when reduction cannot be maintained with positional fixation, we found that lagging the syndesmotic screw helped to maintain the reduction without causing functional restriction. In this report, we describe our experience with patients who had undergone lagged tibiofibular transfixation and were available for short- to intermediate-term follow-up to assess ankle function. A total of 31 patients (32.63% of 95 consecutive patients) were available at a mean of 34.87 (range 18 to 52) months to complete the American Orthopedic Foot and Ankle Society ankle-hindfoot questionnaire. The mean score was 88.38 (range 42 to 100) points at a mean follow-up interval of 34.87 (range 18 to 52) months. Of 31 patients, 19 had an AOFAS score of 90 points, 9 an AOFAS score of 80 to 89 points, 2 an AOFAS score of 60 to 69 points, and 1 an AOFAS score of <60 points. Because all syndesmotic screws were placed using the lag technique, unrestricted motion compared with the uninjured limb was used as the endpoint. All subjects had unrestricted motion compared with the uninjured limb, refuting the assertion that lagged syndesmotic screw fixation confers more restriction in ankle kinematics than positional syndesmotic fixation. PMID:25736445

  13. Definitive fixation of tibial plateau fractures.

    PubMed

    Yoon, Richard S; Liporace, Frank A; Egol, Kenneth A

    2015-07-01

    Tibial plateau fractures present in a wide spectrum of injury severity and pattern, each requiring a different approach and strategy to achieve good clinical outcomes. Achieving those outcomes starts with a thorough evaluation and preoperative planning period, which leads to choosing the most appropriate surgical approach and fixation strategy. Through a case-based approach, this article presents the necessary pearls, techniques, and strategies to maximize outcomes and minimize complications for some of the more commonly presenting plateau fracture patterns. PMID:26043050

  14. Nitrogen fixation in distinct microbial niches within a chemoautotrophy-driven cave ecosystem

    PubMed Central

    Desai, Mahesh S; Assig, Karoline; Dattagupta, Sharmishtha

    2013-01-01

    Microbial sulfur and carbon cycles in ecosystems driven by chemoautotrophy—present at deep-sea hydrothermal vents, cold seeps and sulfidic caves—have been studied to some extent, yet little is known about nitrogen fixation in these systems. Using a comprehensive approach comprising of 15N2 isotope labeling, acetylene reduction assay and nitrogenase gene expression analyses, we investigated nitrogen fixation in the sulfide-rich, chemoautotrophy-based Frasassi cave ecosystem (Italy). Nitrogen fixation was examined in three different microbial niches within the cave waters: (1) symbiotic bacterial community of Niphargus amphipods, (2) Beggiatoa-dominated biofilms, which occur at the sulfide–oxygen interface, and (3) sulfidic sediment. We found evidence for nitrogen fixation in all the three niches, and the nitrogenase gene (homologs of nifH) expression data clearly show niche differentiation of diazotrophic Proteobacteria within the water streams. The nifH transcript originated from the symbiotic community of Niphargus amphipods might belong to the Thiothrix ectosymbionts. Two abundantly expressed nifH genes in the Beggiatoa-dominated biofilms are closely related to those from Beggiatoa- and Desulfovibrio-related bacteria. These two diazotrophs were consistently found in Beggiatoa-dominated biofilms collected at various time points, thus illustrating species-specific associations of the diazotrophs in biofilm formation, and micron-scale niche partitioning of sulfur-oxidizing and sulfate-reducing bacteria driven by steep redox gradients within the biofilm. Finally, putative heterotrophs (Geobacter, Azoarcus and Desulfovibrio related) were the active diazotrophs in the sulfidic sediment. Our study is the first to shed light on nitrogen fixation in permanently dark caves and suggests that diazotrophy may be widespread in chemosynthetic communities. PMID:23924780

  15. Anaerobic CO2 fixation by the acetogenic bacterium Moorella thermoacetica

    SciTech Connect

    Hu, P; Rismani-Yazdi, H; Stephanopoulos, G

    2013-05-16

    Anaerobic bacteria such as Moorella thermoacetica have the capacity of fixing carbon dioxide with carbon monoxide and hydrogen for the production of ethanol, acetic acid, and other useful chemicals. In this study, we evaluated the fixation of CO2 for the production of acetic acid, as a product in its own right but also as precursor for lipid synthesis by oleaginous organisms. We achieved maximum cell optical density of 11.3, acetic acid titer of 31 g/L, and productivity of 0.55 g/L-h at CO mass-transfer rate of 83 mM/h. We also showed electron availability by CO mass transfer limited the process at CO mass transfer rates lower than 30 mM/h. Further enhancement of mass-transfer rate removed such limitations in favor of biological kinetics as main limitation. This work underlines the potential of microbial processes for converting syngas to fuel and chemical products in processes suitable for distributed feedstock utilization. (c) 2013 American Institute of Chemical Engineers AIChE J, 59: 3176-3183, 2013

  16. Influence of light, temperature and salinity on dissolved organic carbon exudation rates in Zostera marina L.

    EPA Science Inventory

    Seagrass carbon budgets provide valuable insight on the minimum requirements needed to maintain this valuable resource. Carbon budgets are a balance between C fixation, storage and loss rates, most of which are well characterized. However, relatively few measurements of dissolv...

  17. Flux balance analysis reveals acetate metabolism modulates cyclic electron flow and alternative glycolytic pathways in Chlamydomonas reinhardtii

    PubMed Central

    Chapman, Stephen P.; Paget, Caroline M.; Johnson, Giles N.; Schwartz, Jean-Marc

    2015-01-01

    Cells of the green alga Chlamydomonas reinhardtii cultured in the presence of acetate perform mixotrophic growth, involving both photosynthesis and organic carbon assimilation. Under such conditions, cells exhibit a reduced capacity for photosynthesis but a higher growth rate, compared to phototrophic cultures. Better understanding of the down regulation of photosynthesis would enable more efficient conversion of carbon into valuable products like biofuels. In this study, Flux Balance Analysis (FBA) and Flux Variability Analysis (FVA) have been used with a genome scale model of C. reinhardtii to examine changes in intracellular flux distribution in order to explain their changing physiology. Additionally, a reaction essentiality analysis was performed to identify which reaction subsets are essential for a given growth condition. Our results suggest that exogenous acetate feeds into a modified tricarboxylic acid (TCA) cycle, which bypasses the CO2 evolution steps, explaining increases in biomass, consistent with experimental data. In addition, reactions of the oxidative pentose phosphate and glycolysis pathways, inactive under phototrophic conditions, show substantial flux under mixotrophic conditions. Importantly, acetate addition leads to an increased flux through cyclic electron flow (CEF), but results in a repression of CO2 fixation via Rubisco, explaining the down regulation of photosynthesis. However, although CEF enhances growth on acetate, it is not essential—impairment of CEF results in alternative metabolic pathways being increased. We have demonstrated how the reactions of photosynthesis interconnect with carbon metabolism on a global scale, and how systems approaches play a viable tool in understanding complex relationships at the scale of the organism. PMID:26175742

  18. Weigners fixative-an alternative to formalin fixation for histology with improved preservation of nucleic acids.

    PubMed

    Klopfleisch, R; von Deetzen, M; Weiss, A Th; Weigner, J; Weigner, F; Plendl, J; Gruber, A D

    2013-01-01

    Formalin fixation and paraffin embedding (FFPE) is the standard method for tissue storage in histopathology. However, FFPE has disadvantages in terms of user health, environment, and nucleic acid integrity. Weigners fixative has been suggested as an alternative for embalming cadavers in human and veterinary anatomy. The present study tested the applicability of Weigners for histology and immunohistochemistry and the preservation of nucleic acids. To this end, a set of organs was fixed for 2 days and up to 6 months in Weigners (WFPE) or formalin. WFPE tissues from the skin, brain, lymphatic tissues, liver, and muscle had good morphologic preservation, comparable to formalin fixation. The quality of kidney and lung samples was inferior to FFPE material due to less accentuated nuclear staining and retention of proteinaceous interstitial fluids. Azan, Turnbull blue, toluidin, and immunohistochemical stainings for CD79a, cytokeratin, vimentin, and von Willebrand factor led to comparable results with both fixates. Of note, immunohistochemical detection of CD3 was possible after 6 months in WFPE but not in FFPE tissues. mRNA, miRNA, and DNA from WFPE tissues had superior quality and allowed for amplification of miRNA, 400-bp-long mRNA, and 1000-bp-long DNA fragments after 6 months of fixation in WFPE. In summary, Weigners fixative is a nonhazardous alternative to formalin, which provides a good morphologic preservation of most organs, a similar sensitivity for protein detection, and a superior preservation of nucleic acids. Weigners may therefore be a promising alternative to cryopreservation and may be embraced by people affected by formalin allergies. PMID:22539409

  19. Energetic factors affecting carbon dioxide fixation in isolated chloroplasts

    SciTech Connect

    Slovacek, R.E.; Hind, G.

    1980-03-01

    Light- and HCO/sub 3/-saturated (10 millimolar) rates of O/sub 2/ evolution (120 to 220 micromoles O/sub 2/ per milligram chlorophyll per hour), obtained with intact spinach chloroplasts, are decreased up to 3-fold by changes in assay conditions such as omission of catalase from the medium, the use of high (greater than or equal to 1 millimolar) inorganic phosphate, inclusion of NO/sub 2/- as an electron acceptor, or bright illumination at low partial pressures of O/sub 2/. These inhibitions may be reversed by addition of uncoupling levels of NH/sub 4/Cl or of antimycin concentrations that partially block cyclic electron transfer between cytochrome b/sub 6/ and cytochrome f. Measurements of the pH gradient across the thylakoid membrane with the fluorescent probe, 9-aminoacridine, indicate that changes in ..delta..pH are sufficient to account for both the inhibited and restored rates of electron transport. It follows that the rate of HCO/sub 3/-saturated photosynthesis may be restricted by a proton gradient back pressure under these conditions. The rate of O/sub 2/ evolution is also decreased 3-fold when ambient CO/sub 2/ (0.63 millimolar HCO/sub 3/- at pH 8.1) is used in place of saturating HCO/sub 3/- and chloroplasts are illuminated aerobically with catalase and a low level (0.25 millimolar) of K/sub 2/HPO/sub 4/. Only inhibitory effects are observed with additions of antimycin or NH/sub 4/Cl. Under these conditions, excessive photophosphorylation or a large pH gradient does not limit the rate of photosynthesis.

  20. Autotrophy of green non-sulphur bacteria in hot spring microbial mats: biological explanations for isotopically heavy organic carbon in the geological record

    NASA Technical Reports Server (NTRS)

    van der Meer, M. T.; Schouten, S.; de Leeuw, J. W.; Ward, D. M.

    2000-01-01

    Inferences about the evidence of life recorded in organic compounds within the Earth's ancient rocks have depended on 13C contents low enough to be characteristic of biological debris produced by the well-known CO2 fixation pathway, the Calvin cycle. 'Atypically' high values have been attributed to isotopic alteration of sedimentary organic carbon by thermal metamorphism. We examined the possibility that organic carbon characterized by a relatively high 13C content could have arisen biologically from recently discovered autotrophic pathways. We focused on the green non-sulphur bacterium Chloroflexus aurantiacus that uses the 3-hydroxypropionate pathway for inorganic carbon fixation and is geologically significant as it forms modern mat communities analogous to stromatolites. Organic matter in mats constructed by Chloroflexus spp. alone had relatively high 13C contents (-14.9%) and lipids diagnostic of Chloroflexus that were also isotopically heavy (-8.9% to -18.5%). Organic matter in mats constructed by Chloroflexus in conjunction with cyanobacteria had a more typical Calvin cycle signature (-23.5%). However, lipids diagnostic of Chloroflexus were isotopically enriched (-15.1% to -24.1%) relative to lipids typical of cyanobacteria (-33.9% to -36.3%). This suggests that, in mats formed by both cyanobacteria and Chloroflexus, autotrophy must have a greater effect on Chloroflexus carbon metabolism than the photoheterotrophic consumption of cyanobacterial photosynthate. Chloroflexus cell components were also selectively preserved. Hence, Chloroflexus autotrophy and selective preservation of its products constitute one purely biological mechanism by which isotopically heavy organic carbon could have been introduced into important Precambrian geological features.

  1. Using an Explicit Emission Tagging Method in Global Modeling of Source-Receptor Relationships for Black Carbon in the Arctic: Variations, Sources and Transport Pathways

    SciTech Connect

    Wang, Hailong; Rasch, Philip J.; Easter, Richard C.; Singh, Balwinder; Zhang, Rudong; Ma, Po-Lun; Qian, Yun; Ghan, Steven J.; Beagley, Nathaniel

    2014-11-27

    We introduce an explicit emission tagging technique in the Community Atmosphere Model to quantify source-region-resolved characteristics of black carbon (BC), focusing on the Arctic. Explicit tagging of BC source regions without perturbing the emissions makes it straightforward to establish source-receptor relationships and transport pathways, providing a physically consistent and computationally efficient approach to produce a detailed characterization of the destiny of regional BC emissions and the potential for mitigation actions. Our analysis shows that the contributions of major source regions to the global BC burden are not proportional to the respective emissions due to strong region-dependent removal rates and lifetimes, while the contributions to BC direct radiative forcing show a near-linear dependence on their respective contributions to the burden. Distant sources contribute to BC in remote regions mostly in the mid- and upper troposphere, having much less impact on lower-level concentrations (and deposition) than on burden. Arctic BC concentrations, deposition and source contributions all have strong seasonal variations. Eastern Asia contributes the most to the wintertime Arctic burden. Northern Europe emissions are more important to both surface concentration and deposition in winter than in summer. The largest contribution to Arctic BC in the summer is from Northern Asia. Although local emissions contribute less than 10% to the annual mean BC burden and deposition within the Arctic, the per-emission efficiency is much higher than for major non-Arctic sources. The interannual variability (1996-2005) due to meteorology is small in annual mean BC burden and radiative forcing but is significant in yearly seasonal means over the Arctic. When a slow aging treatment of BC is introduced, the increase of BC lifetime and burden is source-dependent. Global BC forcing-per-burden efficiency also increases primarily due to changes in BC vertical distributions. The relative contribution from major non-Arctic sources to the Arctic BC burden increases only slightly, although the contribution of Arctic local sources is reduced by a factor of 2 due to the slow aging treatment.

  2. Arthroscopic Bony Bankart Fixation Using a Modified Sugaya Technique

    PubMed Central

    Gupta, Anil K.; McCormick, Frank M.; Abrams, Geoffrey D.; Harris, Joshua D.; Bach, Bernard R.; Romeo, Anthony A.; Verma, Nikhil N.

    2013-01-01

    Arthroscopic fixation of bony Bankart lesions in the setting of anterior shoulder instability has had successful long-term results. Key factors such as patient positioning, portal placement, visualization, mobilization of bony/soft tissues, and anatomic reduction and fixation are crucial to yield such results. We present a modified Sugaya technique that is reproducible and based on such key principles. This technique facilitates ease of anchor and suture placement to allow for anatomic reduction and fixation. PMID:24265994

  3. Plate Versus Intramedullary Fixation Care of Displaced Midshaft Clavicular Fractures

    PubMed Central

    Wang, Xin-Hua; Cheng, Lin; Guo, Wei-Jun; Li, A-Bing; Cheng, Guang-Jun; Lei, Tao; Zhao, You-Ming

    2015-01-01

    Abstract In recent decades, there has been a growing trend to the operative treatment of displaced midshaft clavicular fractures. Open reduction and internal plate fixation, and intramedullary nailing fixation are 2 of the widely used techniques for operative treatment, but the optimal fixation method for these types of fractures remains a topic of debate. The objective of this study was to determine the effectiveness of plate fixation versus intramedullary nailing fixation for displaced midshaft clavicle fractures by comparing their clinical results. Literature searches of the Pubmed, EMBASE, and Web of Science were performed from 1966 to April, 2015. Only randomized controlled clinical trials comparing plate and intramedullary nailing treatment for displaced midshaft clavicle fractures were included. Literature was screened, data were extracted, and methodological quality of the eligible trials was assessed by 2 independent reviewers accordingly. Seven randomized controlled trials involving 421 patients were included. Compared to intramedullary nailing fixation, plate fixation had a relatively longer mean surgical time and a trend towards a faster functional improvement during the first 6 months after surgery; apart from this, the pooled results revealed no significant differences in functional scores after 6 months postoperatively, complication rate and patients’ satisfaction between plate fixation and intramedullary fixation. Our results demonstrated that these 2 methods were comparable and safe in the treatment of displaced midshaft clavicle fractures. We advocate both techniques for the treatment of displaced midshaft clavicle fractures, and the superior surgical technique was those that the surgeon was originally trained to perform. PMID:26469924

  4. Nitrogen fixation in moss-cyanobacteria associations in boreal forest ecosystems

    NASA Astrophysics Data System (ADS)

    Rousk, Kathrin

    2014-05-01

    Nitrogen (N) limits the productivity in boreal forests. A major source of 'new' N for these forests is the fixation of atmospheric N2 preformed by cyanobacteria living in association with mosses and lichens. Mosses are a dominant feature in boreal forests, accounting for 60-90% of the groundcover in pristine boreal forests and have been found to be colonized by several N2-fixing cyanobacteria. Given the ubiquitous nature of mosses in these forests, their association with N2-fixing cyanobacteria could characterize the N cycle in these ecosystems. For instance, the feather moss Pleurozium schreberi with its associated cyanobacteria fixes 1-2 kg N ha-1 yr-1, which equals the amount that enters northern boreal forests via atmospheric N deposition. Nitrogen fixation in moss-cyanobacteria associations is affected by numerous abiotic factors that could modulate the N input to the system via the moss-cyanobacteria pathway. For instance, high N availability and dry conditions inhibit N2 fixation in moss-cyanobacteria associations while phosphorus availability and moist conditions promote N2 fixation. Further, N2fixation in moss-cyanobacteria associations is resilient, and can recover from increased N inputs (12 - 15 kg N ha-1 yr-1) as well as from drought stress (moss < 9% field moisture) upon removal of these stressors. Nevertheless, the question as to how important the N2 fixing capability of moss-cyanobacteria associations is as a source of 'new' N for the N cycle in boreal forests remains. For instance, mosses can retain acquired N over long periods of time (> 1 year) and the transfer of N from moss to soil in the short-term has so far only been shown to occur after disturbances (e.g. drying rewetting events, fires). I will present results from laboratory as well as field experiments aimed to elucidate the role moss-cyanobacteria associations play for the N cycle in boreal forests and how abiotic factors control the fixation of atmospheric N2.

  5. Will rising CO2 influence how nutrients interact to control tropical N2-fixation?

    NASA Astrophysics Data System (ADS)

    Trierweiler, A.; Winter, K.; Wright, S. J.; Wurzburger, N.; Hedin, L.

    2013-12-01

    The response of terrestrial tropical carbon sinks to increasing CO2 is a pressing question in biogeochemistry. Limitation of nutrients such as N may constrain these sinks. Biological N2-fixation, an important biogeochemical process that provides new nitrogen to ecosystems, potentially plays an important role in supporting tropical carbon sinks. Despite the importance of N2-fixation to the linked nitrogen and carbon cycles, we know little about how nutrient limitation of the process of biological N2-fixation, itself, will affect tropical fixation and N2-fixing plants. While rising CO2 levels may increase tree growth and N2-fixation when nutrients are abundant, at the same time, the increased growth may force N2-fixing plants into phosphorus (P) and molybdenum (Mo) limitation, both elements that are scarce in tropical forests and critical to N2-fixers. This study improves our understanding on what controls fixation through a series of greenhouse and in situ field experiments. First, we used a greenhouse experiment where we manipulated CO2 levels combined with a field study in forest gaps. In the greenhouse study we grew a N2-fixing seedling and a non-fixing seedling at pre-industrial (280 ppm), current (400 ppm), and double (800 ppm) CO2 concentrations with and without P, Mo, or both. In the year-long field study, we applied the same nutrient treatments to seedlings planting in natural light gaps and ambient CO2. To supplement our year-long seedling experiment, we also examined 11 years of growth data from a long-term N x P x K factorial fertilization experiment also on the Gigante Peninsula. In the greenhouse study, we found nutrient limitation was minimal at pre-industrial CO2 levels, but that limitation appeared with increasing CO2. Phosphorus limitation of tree growth and N2-fixation significantly increased with higher CO2. The additions of Mo and P together allowed for even greater growth and fixation, suggesting Mo-P co-limitation at elevated CO2. Compared to the control, the phosphorus addition treatment grew ~50% faster and fixed 10-15x more N2 at the present day and doubled CO2 levels. When plants received both P and Mo, they grew 66- 200% more, and fixed up to 25 times more N2. In the year-long field study, we did not find significant differences between nutrient treatments, but there was a correlation with canopy openness. In the long-term fertilization study, we found N2-fixing trees to be marginally limited by P. These experiments illustrate both hypothetical limitations at future higher global CO2 levels as well as the difficulty in scaling up to natural forests where herbivory and competition for light and nutrients confound clear treatment effects.

  6. The L-arginine/NO pathway, homoarginine, and nitrite-dependent renal carbonic anhydrase activity in young people with type 1 diabetes mellitus.

    PubMed

    Carmann, Christina; Lilienthal, Eggert; Weigt-Usinger, Katharina; Schmidt-Choudhury, Anjona; Hörster, Irina; Kayacelebi, Arslan Arinc; Beckmann, Bibiana; Chobanyan-Jürgens, Kristine; Tsikas, Dimitrios; Lücke, Thomas

    2015-09-01

    High circulating levels of asymmetric dimethylarginine (ADMA) and low circulating levels of homoarginine (hArg) are known cardiovascular risk factors in adults. While in adults with type 1 diabetes mellitus (T1DM) circulating ADMA is significantly elevated, in children and adolescents the reported ADMA data are contradictory. In 102 children with T1DM and 95 healthy controls (HC) serving as controls, we investigated the L-arginine (Arg)/nitric oxide (NO) pathway. Children with T1DM were divided into two groups, i.e., in children with newly diagnosed diabetes mellitus [T1DM-ND; n = 10; age, 8.8 (4.4-11.2) years; HbA1c, 13 (8.9-13.9) %] and in those with long-term treatment [T1DM-T; n = 92; age, 12.5 (10.5-15.4) years; HbA1c, 8.0 (7.2-8.6) %]. The age of the HC was 11.3 (8-13.3) years. Amino acids and NO metabolites of the Arg/NO pathway, creatinine and the oxidative stress biomarker malondialdehyde (MDA) were measured by GC-MS or GC-MS/MS. Plasma hArg, ADMA and the hArg/ADMA molar ratio did not differ between the T1DM and HC groups. There was a significant difference between T1DM-T and HC with regard to plasma nitrite [0.53 (0.48-0.61) vs 2.05 (0.86-2.36) µM, P < 0.0001] as well as to urinary nitrite [0.09 (0.06-0.17) vs 0.22 (0.13-0.37) ?mol/mmol creatinine, P < 0.0001]. Plasma, but not urinary nitrite, differed between T1DM-ND and HC [0.55 (0.50-0.66) vs 2.05 (0.86-2.36) µM, P < 0.0001]. Plasma MDA did not differ between the groups. The urinary nitrate-to-nitrite molar ratio (UNOXR), a measure of nitrite-dependent renal carbonic anhydrase (CA) activity, was higher in T1DM-T [1173 (738-1481), P < 0.0001] and T1DM-ND [1341 (1117-1615), P = 0.0007] compared to HC [540 (324-962)], but did not differ between T1DM-T and T1DM-ND (P = 0.272). The lower nitrite excretion in the children with T1DM may indicate enhanced renal CA-dependent nitrite reabsorption compared with healthy children. Yet, lower plasma nitrite concentration in the T1DM patients may have also contributed to the higher UNOXR. Patients' age correlated positively with plasma hArg and hArg/ADMA and urinary DMA/ADMA. Plasma ADMA and urinary ADMA, DMA, nitrite and nitrate correlated negatively with age of the T1DM-T children. Significant correlations were found between plasma hArg and plasma Arg (r = 0.468, P < 0.0001), and urinary DMA (r = -0.426, P = 0.0001), ADMA (r = -0.266, P = 0.021) and nitrate (r = -0.234, P = 0.043). Plasma hArg correlated positively with age at diagnosis (r = +0.337, P = 0.002). ADMA, but not hArg, correlated with HbA1c in T1DM-T (r = -0.418, P < 0.0001) and T1DM-ND (r = +0.879, P = 0.0016). The greatest differences between T1DM-T and T1DM-ND were observed for urinary ADMA, DMA/ADMA ratio, nitrite and nitrate. The Arg/NO pathway is altered in T1DM in childhood and adolescence, yet the role and the importance of hArg and ADMA in T1DM remain to be elucidated. In young T1DM patients, oxidative stress (lipid peroxidation) is not elevated. PMID:26123986

  7. Mechanical comparison of cortical screw fixation versus locking plate fixation in first metatarsal base osteotomy.

    PubMed

    Smith, Kevin; Lidtke, Roy H; Oliver, Noah G; Maker, Jared M

    2014-01-01

    The oblique closing base wedge osteotomy has been used for surgical treatment of moderate to severe hallux valgus deformities with an intermetatarsal angle typically greater than 15°. Several postoperative complications have been identified that relate to failure of the fixation construct used to fixate the osteotomy, especially when that construct has been subjected to a vertical load. We performed a mechanical analysis comparing 2 constructs used to fixate oblique osteotomies of the first metatarsal using composite first metatarsals. An oblique base osteotomy was uniformly performed on 40 composite first metatarsals. Of the 40 specimens, 20 were fixated with a locking plate construct and 18 with a cortical screw construct, consisting of an anchor and compression screw (2 specimens from the latter group were excluded because of hinge fracture). Each specimen was loaded in a materials testing machine to measure the maximum load at construct failure when a vertical force was applied to the plantar aspect of the metatarsal head. The mean load to failure for the locking plate construct was significantly greater than the cortical screw construct (190.0 ± 70 N versus 110.3 ± 20.3 N, p < .001). Our study results have demonstrated that the locking plate construct was able to withstand a significantly greater vertical load before failure than was the 2-cortical screw construct in oblique osteotomies performed at the base of composite first metatarsals. PMID:24954919

  8. Titanium alloys for fracture fixation implants.

    PubMed

    Disegi, J A

    2000-12-01

    This paper is intended to provide an overview of the composition, mechanical properties, biocompatibility, and clinical applications for titanium alloys that are used for fracture fixation implants. A new class of titanium implant alloys has emerged in recent years that exhibits a beta microstructure and a unique combination of mechanical properties. Important information regarding notch sensitivity testing and clinical significance is also discussed. Attributes such as stress corrosion cracking resistance, fatigue strength, and wear characteristics are also essential for specific clinical applications, but are beyond the scope of this presentation. PMID:11270074

  9. Open Reduction and Internal Fixation of Mandibular Fracture without Rigid Maxillomandibular Fixation

    PubMed Central

    El-Anwar, Mohammad Waheed; Sayed El-Ahl, Magdy Abdalla; Amer, Hazem Saed

    2015-01-01

    Introduction?The ability to treat fracture with open reduction and internal fixation (OR/IF) has dramatically revolutionized the approach to mandible fracture. With OR/IF, the postoperative role of rigid maxillomandibular fixation (MMF) has declined, but it is used to maintain proper occlusion until internal fixation of the fracture is achieved. Objective?To assess intraoperative manual MMF during OR/IF of selected cases of mandibular fractures. Methods?This prospective study was conducted on 80 patients with isolated mandibular fractures managed by OR/IF using two titanium miniplates. The patients were classified into two groups: a control group (40 patients) treated by OR/IF after intraoperative rigid MMF followed by immediate MMF removal, and a study group (40 patients) treated by rigid MMF, which was replaced by temporary intraoperative manual MMF (3MF) until plate fixation. Results?There were no significant differences of the postoperative complication and dental occlusion, although a highly significant reduction of operative time was achieved in the 3MF group. Patient who received the 3MF technique had statistically significantly better average intrinsic vertical mouth opening in the early postoperative period (1?week after surgery), and normal mouth opening could be achieved in all cases in both groups 8 weeks after surgery. Conclusions?Intraoperative rigid MMF is not mandatory and can be replaced in selected cases of fracture mandible by manual maintenance of proper dental occlusion until hardware fixation, gaining the advantages of shorter operative time and less risk of blood-transmitted diseases to the surgical team and the patient in addition to the benefits of immediate postoperative mandible mobilization. PMID:26491477

  10. Mechanistical studies on the formation and destruction of carbon monoxide (CO), carbon dioxide (CO2), and carbon trioxide (CO3)

    E-print Network

    Kaiser, Ralf I.

    Mechanistical studies on the formation and destruction of carbon monoxide (CO), carbon dioxide (CO2 monoxide (CO), carbon dioxide (CO2), and molecular oxygen (O2) with varying carbon-to-oxygen ratios from 1 and destruction pathways of carbon monoxide (CO), carbon dioxide (CO2), and carbon trioxide (CO3

  11. Biological nitrogen fixation and biomass accumulation within poplar clones as a result of inoculations with diazotrophic

    E-print Network

    Doty, Sharon Lafferty

    Biological nitrogen fixation and biomass accumulation within poplar clones as a result: biomass, diazotrophic endophytes, nitrogen (N) -fixation, phenotypic plasticity, poplar. Summary the enhancement of biological nitrogen fixation (BNF). Endophytes isolated from native poplar growing in nutrient

  12. Effects of Boron Nutrition and Water Stress on Nitrogen Fixation, Seed ?15N and ?13C Dynamics, and Seed Composition in Soybean Cultivars Differing in Maturities

    PubMed Central

    Bellaloui, Nacer; Mengistu, Alemu

    2015-01-01

    Therefore, the objective of the current research was to investigate the effects of foliar B nutrition on seed protein, oil, fatty acids, and sugars under water stress conditions. A repeated greenhouse experiment was conducted using different maturity group (MG) cultivars. Plants were well-watered with no foliar B (W ? B), well-watered with foliar B (W + B), water-stressed with no foliar B (WS ? B), and water-stressed with foliar B (WS + B). Foliar B was applied at rate of 0.45?kg·ha?1 and was applied twice at flowering and at seed-fill stages. The results showed that seed protein, sucrose, fructose, and glucose were higher in W + B treatment than in W ? B, WS + B, and WS ? B. The increase in protein in W + B resulted in lower seed oil, and the increase of oleic in WS ? B or WS + B resulted in lower linolenic acid. Foliar B resulted in higher nitrogen fixation and water stress resulted in seed ?15N and ?13C alteration. Increased stachyose indicated possible physiological and metabolic changes in carbon and nitrogen pathways and their sources under water stress. This research is beneficial to growers for fertilizer management and seed quality and to breeders to use 15N/14N and 13C/12C ratios and stachyose to select for drought tolerance soybean. PMID:25667936

  13. Accumulation of terrestrial organic carbon on an active continental margin offshore southwestern Taiwan: Source-to-sink pathways of river-borne organic particles

    NASA Astrophysics Data System (ADS)

    Hsu, Feng-Hsin; Su, Chih-Chieh; Wang, Chung-Ho; Lin, Saulwood; Liu, James; Huh, Chih-An

    2014-09-01

    Sediment samples (213 sites) collected from the tectonic-active continental margin, offshore southwestern Taiwan were analyzed for grain sizes, organic carbon, nitrogen and carbon isotopic composition to obtain mass accumulation rate of terrestrial organic carbon and carbon budget to evaluate fate of terrestrial organic carbon from small mountainous rivers on the continental margin offshore southwestern Taiwan. Terrestrial organic carbon accumulation rates range from 0.29 to 45.6 g C m-2 yr-1 with a total accumulation budget of 0.063 Mt yr-1, which accounts for less than 13% of total river particulate organic carbon loads exported from the adjacent rivers, the Gaoping (a.k.a., Kaoping), Erhjen and Tsengwen rivers. This low burial efficiency of terrestrial organic carbon demonstrated that a majority of river-borne particles together with organic materials was moved away from the study area. For the river-borne particles from the Gaoping river, a pair of depocenters in the upper slope flanking the Gaoping submarine canyon are the locations where the maximum TCorg accumulation rate were observed which hold up to 45% (0.016 Mt yr-1) of the calculated accumulation found in the study region. On the other hand, the occurrence of higher-fraction terrestrial organic carbon in the upper and middle Gaoping submarine canyon suggests that a majority of particulate organic carbon of the Gaoping river was transported directly into the deep-sea basin through the Gaoping submarine canyon. Our results demonstrated that active margin with narrow shelf and slope is not an efficient sink for the large amount of terrigenous organic carbon supplied by the small rivers, but, a transient environment for these river derived particles.

  14. Hiatus Hernia Repair with Bilateral Oesophageal Fixation

    PubMed Central

    Martin, David

    2015-01-01

    Background. Despite advances in surgical repair of hiatus hernias, there remains a high radiological recurrence rate. We performed a novel technique incorporating bilateral oesophageal fixation and evaluated outcomes, principally symptom improvement and hernia recurrence. Methods. A retrospective study was performed on a prospective database of patients undergoing hiatus hernia repair with bilateral oesophageal fixation. Retrospective and prospective quality of life (QOL), PPI usage, and patient satisfaction data were obtained. Hernia recurrence was assessed by either barium swallow or gastroscopy. Results. 87 patients were identified in the database with a minimum of 3 months followup. There were significant improvements in QOL scores including GERD HRQL (29.13 to 4.38, P < 0.01), Visick (3 to 1), and RSI (17.45 to 5, P < 0.01). PPI usage decreased from a median of daily to none, and there was high patient satisfaction (94%). 57 patients were assessed for recurrence with either gastroscopy or barium swallow, and one patient had evidence of recurrence on barium swallow at 45 months postoperatively. There was an 8% complication rate and no mortality or oesophageal perforation. Conclusions. This study demonstrates that our technique is both safe and effective in symptom control, and our recurrence investigations demonstrate at least short term durability. PMID:26065030

  15. Fixation of basicervical and related fractures

    PubMed Central

    2009-01-01

    We prospectively studied 42 patients in order to identify a group of proximal femoral fractures having liability for axial and rotational instability, and to present results of their fixation using the dynamic hip screw (DHS) with derotation screw (DRS). At 12 months postoperatively, patients were functionally evaluated and the radiological outcome was analysed. All fractures united within an average period of 11.5 weeks. The mean sliding distance was 5.5 mm and mean shortening of the limbs was 2 mm. According to the criteria of Kyle et al. (J Bone Joint Surg [Am] 61-A:216–221), 39 patients obtained excellent results, two good and one fair. We conclude that the AO types B2.1, A1.1, A2.1, A2.2 and A2.3 have a common instability denominator and therefore should be treated alike. The sliding component of the DHS allows solid fixation of the two major fragments in two planes and the DRS in the third plane. PMID:19475407

  16. Metal/metalloid fixation by litter during decomposition affected by silicon availability during plant growth.

    PubMed

    Schaller, Jörg

    2013-03-01

    Organic matter is known to accumulate high amounts of metals/metalloids, enhanced during the process of decomposition by heterotrophic biofilms (with high fixation capacity for metals/metalloids). The colonization by microbes and the decay rate of the organic matter depends on different litter properties. Main litter properties affecting the decomposition of organic matter such as the nutrient ratios and the content of cellulose, lignin and phenols are currently described to be changed by silicon availability. But less is known about the impact of silicon availability during plant growth on elemental fixation during decay. Hence, this research focuses on the impact of silicon availability during plant growth on fixation of 42 elements during litter decay, by controlling the litter properties. The results of this experiment are a significantly higher metal/metalloid accumulation during decomposition of plant litter grown under low silicon availability. This may be explained by the altered litter properties (mainly nutrient content) affecting the microbial decomposition of the litter, the microbial growth on the litter and possibly by the silicon double layer, which is evident in leaf litter with high silicon content and reduces the binding sites for metals/metalloids. Furthermore, this silicon double layer may also reduce the growing biofilm by reducing the availability of carbon compounds at the litter surface and has to be elucidated in further research. Hence, low silicon availability during plant growth enhances the metal/metalloid accumulation into plant litter during aquatic decomposition. PMID:23228909

  17. Cultivar effects on nitrogen fixation in peas and lentils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Increasing nitrogen fixation in legume crops could increase cropping productivity and reduce nitrogen fertilizer use. Studies have found that crop genotype, rhizobial strain, and occasionally genotype-specific interactions affect N fixation, but this knowledge has not yet been used to evaluate or br...

  18. Identifying Fixations and Saccades in Eye-Tracking Protocols

    E-print Network

    Salvucci, Dario D.

    Identifying Fixations and Saccades in Eye-Tracking Protocols Dario D. Salvucci Nissan Cambridge identification--separating and labeling fixations and saccades in eye-tracking protocols--is an essential part algorithms in terms of how they utilize spatial and temporal information in eye-tracking protocols. Using

  19. Humor Preference as a Function of Preoedipal Fixation.

    ERIC Educational Resources Information Center

    Juni, Samuel

    1982-01-01

    Psychoanalytic theory predicts that humor preference is a derivative of unresolved childhood conflicts. Analyzed students' (N=104) Rorschach protocols to yield measures of preoedipal fixation. Students ranked jokes from most to least funny. Results showed that the ranking of jokes was a function of the fixation measures for women only. (Author/RC)

  20. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false External facial fracture fixation appliance. 878.3250 Section 878.3250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... External facial fracture fixation appliance. (a) Identification. An external facial fracture...

  1. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false External facial fracture fixation appliance. 878.3250 Section 878.3250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... External facial fracture fixation appliance. (a) Identification. An external facial fracture...

  2. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false External facial fracture fixation appliance. 878.3250 Section 878.3250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... External facial fracture fixation appliance. (a) Identification. An external facial fracture...

  3. FIXATION OF FISH TISSUES. IN: THE LABORATORY FISH.

    EPA Science Inventory

    This chapter deals with the fixation of fish tissues and whole fish. Traditionally, fixation has been applied to animal tissues mainly for histological or pathological studies. Development of new molecular and immunologic tools now allows tissue and cellular localization of nucle...

  4. ORIGINAL PAPER Biological nitrogen fixation by common beans

    E-print Network

    Lehmann, Johannes

    ORIGINAL PAPER Biological nitrogen fixation by common beans (Phaseolus vulgaris L.) increases biological N2 fixation (BNF) by common beans (Phaseolus vulgaris L.) through bio-char additions (charcoal- tox cropped to a potentially nodulating bean variety (CIAT BAT 477) in comparison to its non

  5. Overcoming Organizational Fixation: Creating and Sustaining an Innovation Culture

    ERIC Educational Resources Information Center

    Stempfle, Joachim

    2011-01-01

    Fixation on established paradigms and practices can severely limit the capability of organizations to change, thereby jeopardizing the ability of organizations to keep up with changes in their environment and new technological developments. Overcoming organizational fixation is therefore a requirement for any organization that strives to achieve…

  6. Characteristics of Fixational Eye Movements in People With Macular Disease

    PubMed Central

    Kumar, Girish; Chung, Susana T. L.

    2014-01-01

    Purpose. Fixation stability is known to be poor for people with macular disease and has been suggested as a contributing factor for the poor visual performance of these individuals. In this study, we examined the characteristics of the different components of fixational eye movements and determined the component that plays a major role in limiting fixation stability in people with macular disease. Methods. Sixteen observers with macular disease and 14 older adults with normal vision (control observers) monocularly fixated a small cross presented using a Rodenstock scanning laser ophthalmoscope, for trials of 30 seconds. The retinal image and the position of the cross on the retina were recorded digitally. Eye movements were extracted from the recorded videos at a sampling rate of 540 Hz using a cross-correlation technique. A velocity criterion of 8°/s was used to differentiate between slow drifts and microsaccades. Results. Observers with macular disease demonstrated higher fixation instability, larger amplitudes of slow drifts and microsaccades, and lower drift velocities, when compared with older adults with normal vision. The velocity and the rate of microsaccades were comparable between the two groups of observers. Multiple linear regression analysis showed that the amplitude of microsaccades, and to a smaller extent, the amplitude of slow drifts, play a major role in limiting fixation stability. Conclusions. Fixation stability in people with macular disease is primarily limited by the amplitude of microsaccades, implying that rehabilitative strategies targeted at reducing the amplitude of microsaccades should improve fixation stability, and may lead to improved visual functions. PMID:25074769

  7. CRISP: A Computational Model of Fixation Durations in Scene Viewing

    ERIC Educational Resources Information Center

    Nuthmann, Antje; Smith, Tim J.; Engbert, Ralf; Henderson, John M.

    2010-01-01

    Eye-movement control during scene viewing can be represented as a series of individual decisions about where and when to move the eyes. While substantial behavioral and computational research has been devoted to investigating the placement of fixations in scenes, relatively little is known about the mechanisms that control fixation durations.…

  8. 21 CFR 868.5770 - Tracheal tube fixation device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tracheal tube fixation device. 868.5770 Section 868.5770 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5770 Tracheal tube fixation device. (a) Identification. A tracheal tube...

  9. Application of monorail fixator for femoral gap nonunion.

    PubMed

    Agrawal, Hemendra-Kumar; Jaiman, Ashish; Khatkar, Vipin; Sharma, Vinod-Kumar

    2014-01-01

    Difficult femoral nonunion takes account of infective nonunion and aseptic gap nonunion. Limb length discrepancy and nonunion need to be tackled simultaneously. Conventionally Ilizarov ring fixator is in vogue but it has some limitations. To overcome these, monorail fixator is an effective alternative. Persistent good results can be obtained if we can get a perfect anatomical alignment and good regeneration. PMID:25098853

  10. Ancestral recombination-selection graph and fixation probability

    E-print Network

    Leclercq, Remi

    Ancestral recombination-selection graph and fixation probability Application to the Hill;Ancestral recombination-selection graph and fixation probability Application to the Hill-Robertson effect;Recombination #12;Recombination T Negative linkage disequilibrium D Recombination T Negative linkage

  11. Growth condition study of algae function in ecosystem for CO2 bio-fixation.

    PubMed

    Tsai, David Dah-Wei; Ramaraj, Rameshprabu; Chen, Paris Honglay

    2012-02-01

    Algae niche play a crucial role on carbon cycle and have great potential for CO(2) sequestration. This study was to investigate the CO(2) bio-fixation by the high rate pond (HRP) to mimic the algae function of nature. All the reactors can keep CO(2) consumption efficiencies over 100%. The statistical analyses proved HRPs were close to the natural system from all the growth conditions. The HRP could show the "natural optimization as nature" to perform as well as the artificial reactor of continuously stirred tank reactor (CSTR). In the nutrition study, the carbon mass balance indicated CO(2) was the main carbon source. Accordingly, the HRPs can keep a neutral pH range to provide dissolved oxygen (DO), to promote total nitrogen (TN)/total phosphorous (TP) removal efficiencies and to demonstrate self-purification process. Furthermore, the observations of different nitrogen species in the reactors demonstrated that the major nitrogen source was decided by pH. This finding logically explained the complex nitrogen uptake by algae in nature. Consequently, this study took advantage of HRP to explore the processes of efficient CO(2) uptake with the corresponding growth condition in the ecosystem. Those results contributed the further understanding of the role of CO(2) bio-fixation in nature and demonstrated HRP could be a potential ecological engineering alternative. PMID:22196805

  12. Effects of formalin fixation on tissue optical polarization properties

    NASA Astrophysics Data System (ADS)

    Wood, M. F. G.; Vurgun, N.; Wallenburg, M. A.; Vitkin, I. A.

    2011-04-01

    Formalin fixation is a preparation method widely used in handling tissue specimens, such as biopsies, specifically in optical studies such as microscopy. In this note, we examine how formalin fixation affects the polarization properties of porcine myocardium and liver as assessed by optical polarimetry. Spatial maps of linear retardance and depolarization were derived from four myocardial and four liver samples before and after formalin fixation. Overall, linear retardance and depolarization increased after fixation for both myocardium (15% and 23% increase, respectively) and liver (38% and 51%, respectively). The relative increase in retardance was greater in liver compared to myocardium, although the absolute increase in retardance was comparable for both. The effect of fixation on bulk optical properties was also investigated for myocardium where the scattering coefficient increased from 92 to 132 cm-1 and the absorption coefficient remained constant at 1.1 cm-1.

  13. Increasing subtropical North Pacific Ocean nitrogen fixation since the Little Ice Age.

    PubMed

    Sherwood, Owen A; Guilderson, Thomas P; Batista, Fabian C; Schiff, John T; McCarthy, Matthew D

    2014-01-01

    The North Pacific subtropical gyre (NPSG) plays a major part in the export of carbon and other nutrients to the deep ocean. Primary production in the NPSG has increased in recent decades despite a reduction in nutrient supply to surface waters. It is thought that this apparent paradox can be explained by a shift in plankton community structure from mostly eukaryotes to mostly nitrogen-fixing prokaryotes. It remains uncertain, however, whether the plankton community domain shift can be linked to cyclical climate variability or a long-term global warming trend. Here we analyse records of bulk and amino-acid-specific (15)N/(14)N isotopic ratios (?(15)N) preserved in the skeletons of long-lived deep-sea proteinaceous corals collected from the Hawaiian archipelago; these isotopic records serve as a proxy for the source of nitrogen-supported export production through time. We find that the recent increase in nitrogen fixation is the continuation of a much larger, centennial-scale trend. After a millennium of relatively minor fluctuation, ?(15)N decreases between 1850 and the present. The total shift in ?(15)N of -2 per mil over this period is comparable to the total change in global mean sedimentary ?(15)N across the Pleistocene-Holocene transition, but it is happening an order of magnitude faster. We use a steady-state model and find that the isotopic mass balance between nitrate and nitrogen fixation implies a 17 to 27 per cent increase in nitrogen fixation over this time period. A comparison with independent records suggests that the increase in nitrogen fixation might be linked to Northern Hemisphere climate change since the end of the Little Ice Age. PMID:24336216

  14. Increasing subtropical North Pacific Ocean nitrogen fixation since the Little Ice Age

    NASA Astrophysics Data System (ADS)

    Sherwood, Owen A.; Guilderson, Thomas P.; Batista, Fabian C.; Schiff, John T.; McCarthy, Matthew D.

    2014-01-01

    The North Pacific subtropical gyre (NPSG) plays a major part in the export of carbon and other nutrients to the deep ocean. Primary production in the NPSG has increased in recent decades despite a reduction in nutrient supply to surface waters. It is thought that this apparent paradox can be explained by a shift in plankton community structure from mostly eukaryotes to mostly nitrogen-fixing prokaryotes. It remains uncertain, however, whether the plankton community domain shift can be linked to cyclical climate variability or a long-term global warming trend. Here we analyse records of bulk and amino-acid-specific 15N/14N isotopic ratios (?15N) preserved in the skeletons of long-lived deep-sea proteinaceous corals collected from the Hawaiian archipelago; these isotopic records serve as a proxy for the source of nitrogen-supported export production through time. We find that the recent increase in nitrogen fixation is the continuation of a much larger, centennial-scale trend. After a millennium of relatively minor fluctuation, ?15N decreases between 1850 and the present. The total shift in ?15N of -2 per mil over this period is comparable to the total change in global mean sedimentary ?15N across the Pleistocene-Holocene transition, but it is happening an order of magnitude faster. We use a steady-state model and find that the isotopic mass balance between nitrate and nitrogen fixation implies a 17 to 27 per cent increase in nitrogen fixation over this time period. A comparison with independent records suggests that the increase in nitrogen fixation might be linked to Northern Hemisphere climate change since the end of the Little Ice Age.

  15. Crystal Engineering of an nbo Topology Metal-?Organic Framework for Chemical Fixation of CO? under Ambient Conditions

    SciTech Connect

    Gao, Wen-Yang; Chen, Yao; Niu, Youhong; Williams, Kia; Cash, Lindsay; Perez, Pastor J.; Wojtas, Lukasz; Cai, Jianfeng; Chen, Yu-Sheng; Ma, Shengqian

    2014-03-03

    Crystal engineering of the nbo metal–organic framework (MOF) platform MOF-505 with a custom-designed azamacrocycle ligand (1,4,7,10-tetrazazcyclododecane-N,N',N'',N'''-tetra-p-methylbenzoic acid) leads to a high density of well-oriented Lewis active sites within the cuboctahedral cage in MMCF-2, [Cu?(Cu-tactmb)(H?O)?(NO?)?]. This MOF demonstrates high catalytic activity for the chemical fixation of CO? into cyclic carbonates at room temperature under 1 atm pressure.

  16. Uncertainties of Nitrogen Fixation in a Dynamic Global Vegetation Model

    NASA Astrophysics Data System (ADS)

    Steinkamp, Joerg; Werner, Christian; Weber, Bettina; Hickler, Thomas

    2015-04-01

    Nitrogen is an essential nutrient for life on earth. However, most of it is in the form of dinitrogen (N2) unutilizable to life and only few organisms are able to break the triple bond, fix the nitrogen and thus make it available for cycling in the biosphere through "fixation". In most state-of-the-art dynamic global vegetation models (DGVMs) including a nitrogen cycle, N fixation is simulated by the Cleveland et al. (1999) algorithm (O-CN, LPJ-GUESS, CLM), that correlates annual N fixation to evapotranspiration rates or net primary production. Nevertheless, this algorithm has two major uncertainties, which are investigated by us: 1. The algorithm is based on annual fixation rates that are then applied uniformly throughout the year. However, in nature nitrogen fixation is an expensive process, which occurs only under favorable conditions. Here we compare the annual fixation values evenly distributed over the year with daily-derived fixation values based on a modified version of the Cleveland algorithm. We postulate that in higher latitudinal regions with seasonal climate as well as in regions with a distinct dry/wet season, modeled growth is enhanced by daily derived values compared to evenly distributed values, whereas in tropical regions hardly any difference will be visible. 2. One distinguishes between symbiotic and unsymbiotic nitrogen fixation, where the first one is associated with higher plants as symbionts supplying the fixers with carbohydrates, whereas the second, unsymbiotic is performed by so-called cryptogamic covers (CC). We found that the fixation by CC is underrepresented by the Cleveland algorithm, and a correction thus leads to enhanced growth in forested regions of higher latitudes that feature substantial CC fractions. Overall, the improvements of the algorithm proposed by us are expected to better reflect the reality of nitrogen fixation and cause an increased growth of vegetation, especially in higher northern latitudes.

  17. Significant nonsymbiotic nitrogen fixation in Patagonian ombrotrophic bogs.

    PubMed

    Knorr, Klaus-Holger; Horn, Marcus A; Borken, Werner

    2015-06-01

    Nitrogen (N) nutrition in pristine peatlands relies on the natural input of inorganic N through atmospheric deposition or biological dinitrogen (N2 ) fixation. However, N2 fixation and its significance for N cycling, plant productivity, and peat buildup are mostly associated with the presence of Sphagnum mosses. Here, we report high nonsymbiotic N2 -fixation rates in two pristine Patagonian bogs with diversified vegetation and natural N deposition. Nonsymbiotic N2 fixation was measured in samples from 0 to 10, 10 to 20, and 40 to 50 cm depth using the (15) N2 assay as well as the acetylene reduction assay (ARA). The ARA considerably underestimated N2 fixation and can thus not be recommended for peatland studies. Based on the (15) N2 assay, high nonsymbiotic N2 -fixation rates of 0.3-1.4 ?mol N2  g(-1)  day(-1) were found down to 50 cm under micro-oxic conditions (2 vol.%) in samples from plots covered by Sphagnum magellanicum or by vascular cushion plants, latter characterized by dense and deep aerenchyma roots. Peat N concentrations point to greater potential of nonsymbiotic N2 fixation under cushion plants, likely because of the availability of easily decomposable organic compounds and oxic conditions in the rhizosphere. In the Sphagnum plots, high N2 fixation below 10 cm depth rather reflects the potential during dry periods or low water level when oxygen penetrates the top peat layer and triggers peat mineralization. Natural abundance of the (15) N isotope of live Sphagnum (5.6 ?‰) from 0 to 10 cm points to solely N uptake from atmospheric deposition and nonsymbiotic N2 fixation. A mean (15) N signature of -0.7 ?‰ of peat from the cushion plant plots indicates additional N supply from N mineralization. Our findings suggest that nonsymbiotic N2 fixation overcomes N deficiency in different vegetation communities and has great significance for N cycling and peat accumulation in pristine peatlands. PMID:25545459

  18. Neural Correlates of Fixation Duration during Real-world Scene Viewing: Evidence from Fixation-related (FIRE) fMRI.

    PubMed

    Henderson, John M; Choi, Wonil

    2015-06-01

    During active scene perception, our eyes move from one location to another via saccadic eye movements, with the eyes fixating objects and scene elements for varying amounts of time. Much of the variability in fixation duration is accounted for by attentional, perceptual, and cognitive processes associated with scene analysis and comprehension. For this reason, current theories of active scene viewing attempt to account for the influence of attention and cognition on fixation duration. Yet almost nothing is known about the neurocognitive systems associated with variation in fixation duration during scene viewing. We addressed this topic using fixation-related fMRI, which involves coregistering high-resolution eye tracking and magnetic resonance scanning to conduct event-related fMRI analysis based on characteristics of eye movements. We observed that activation in visual and prefrontal executive control areas was positively correlated with fixation duration, whereas activation in ventral areas associated with scene encoding and medial superior frontal and paracentral regions associated with changing action plans was negatively correlated with fixation duration. The results suggest that fixation duration in scene viewing is controlled by cognitive processes associated with real-time scene analysis interacting with motor planning, consistent with current computational models of active vision for scene perception. PMID:25436668

  19. Monitoring CO[subscript 2] Fixation Using GC-MS Detection of a [superscript 13]C-Label

    ERIC Educational Resources Information Center

    Hammond, Daniel G.; Bridgham, April; Reichert, Kara; Magers, Martin

    2010-01-01

    Much of our understanding of metabolic pathways has resulted from the use of chemical and isotopic labels. In this experiment, a heavy isotope of carbon, [superscript 13]C, is used to label the product of the well-known RuBisCO enzymatic reaction. This is a key reaction in photosynthesis that converts inorganic carbon to organic carbon; a process…

  20. Oxygen relations of nitrogen fixation in cyanobacteria.

    PubMed Central

    Fay, P

    1992-01-01

    The enigmatic coexistence of O2-sensitive nitrogenase and O2-evolving photosynthesis in diazotrophic cyanobacteria has fascinated researchers for over two decades. Research efforts in the past 10 years have revealed a range of O2 sensitivity of nitrogenase in different strains of cyanobacteria and a variety of adaptations for the protection of nitrogenase from damage by both atmospheric and photosynthetic sources of O2. The most complex and apparently most efficient mechanisms for the protection of nitrogenase are incorporated in the heterocysts, the N2-fixing cells of cyanobacteria. Genetic studies indicate that the controls of heterocyst development and nitrogenase synthesis are closely interrelated and that the expression of N2 fixation (nif) genes is regulated by pO2. Images PMID:1620069

  1. Hot Topics in Biomechanics: Hip Fracture Fixation.

    PubMed

    Olson, Steven A; Schemitsch, Geoffrey; Morwood, Michael; Schemitsch, Emil; Russell, Thomas A; Latta, Loren L

    2015-12-01

    Geriatric hip fractures continue to increase in frequency as the population ages, and intertrochanteric femur fractures are a significant part of these injuries. Plate fixation for intertrochanteric fractures of the proximal femur has been in use for many years, and application of the sliding hip screw has also been a mainstay of treatment. Recent data suggest there may be a benefit to using implants that add rotational stability to the proximal intertrochanteric fragment. Although preliminary data are promising, there is need for improved investigation to demonstrate the benefit of these new implant designs. In this era of increasing emphasis on cost, quality, and value, better data are needed to help clinicians determine the best therapy for their patients. PMID:26584258

  2. Phase-contrast Hounsfield units of fixated and non-fixated soft-tissue samples

    SciTech Connect

    Willner, Marian; Fior, Gabriel; Marschner, Mathias; Birnbacher, Lorenz; Schock, Jonathan; Braun, Christian; Fingerle, Alexander A.; Noël, Peter B.; Rummeny, Ernst J.; Pfeiffer, Franz; Herzen, Julia; Rozhkova, Elena A.

    2015-08-31

    X-ray phase-contrast imaging is a novel technology that achieves high soft-tissue contrast. Although its clinical impact is still under investigation, the technique may potentially improve clinical diagnostics. In conventional attenuation-based X-ray computed tomography, radiological diagnostics are quantified by Hounsfield units. Corresponding Hounsfield units for phase-contrast imaging have been recently introduced, enabling a setup-independent comparison and standardized interpretation of imaging results. Thus far, the experimental values of few tissue types have been reported; these values have been determined from fixated tissue samples. This study presents phase-contrast Hounsfield units for various types of non-fixated human soft tissues. A large variety of tissue specimens ranging from adipose, muscle and connective tissues to liver, kidney and pancreas tissues were imaged by a grating interferometer with a rotating-anode X-ray tube and a photon-counting detector. In addition, we investigated the effects of formalin fixation on the quantitative phase-contrast imaging results.

  3. Phase-Contrast Hounsfield Units of Fixated and Non-Fixated Soft-Tissue Samples

    PubMed Central

    Willner, Marian; Fior, Gabriel; Marschner, Mathias; Birnbacher, Lorenz; Schock, Jonathan; Braun, Christian; Fingerle, Alexander A.; Noël, Peter B.; Rummeny, Ernst J.; Pfeiffer, Franz; Herzen, Julia

    2015-01-01

    X-ray phase-contrast imaging is a novel technology that achieves high soft-tissue contrast. Although its clinical impact is still under investigation, the technique may potentially improve clinical diagnostics. In conventional attenuation-based X-ray computed tomography, radiological diagnostics are quantified by Hounsfield units. Corresponding Hounsfield units for phase-contrast imaging have been recently introduced, enabling a setup-independent comparison and standardized interpretation of imaging results. Thus far, the experimental values of few tissue types have been reported; these values have been determined from fixated tissue samples. This study presents phase-contrast Hounsfield units for various types of non-fixated human soft tissues. A large variety of tissue specimens ranging from adipose, muscle and connective tissues to liver, kidney and pancreas tissues were imaged by a grating interferometer with a rotating-anode X-ray tube and a photon-counting detector. Furthermore, we investigated the effects of formalin fixation on the quantitative phase-contrast imaging results. PMID:26322638

  4. Phase-contrast Hounsfield units of fixated and non-fixated soft-tissue samples

    DOE PAGESBeta

    Willner, Marian; Fior, Gabriel; Marschner, Mathias; Birnbacher, Lorenz; Schock, Jonathan; Braun, Christian; Fingerle, Alexander A.; Noël, Peter B.; Rummeny, Ernst J.; Pfeiffer, Franz; et al

    2015-08-31

    X-ray phase-contrast imaging is a novel technology that achieves high soft-tissue contrast. Although its clinical impact is still under investigation, the technique may potentially improve clinical diagnostics. In conventional attenuation-based X-ray computed tomography, radiological diagnostics are quantified by Hounsfield units. Corresponding Hounsfield units for phase-contrast imaging have been recently introduced, enabling a setup-independent comparison and standardized interpretation of imaging results. Thus far, the experimental values of few tissue types have been reported; these values have been determined from fixated tissue samples. This study presents phase-contrast Hounsfield units for various types of non-fixated human soft tissues. A large variety of tissuemore »specimens ranging from adipose, muscle and connective tissues to liver, kidney and pancreas tissues were imaged by a grating interferometer with a rotating-anode X-ray tube and a photon-counting detector. In addition, we investigated the effects of formalin fixation on the quantitative phase-contrast imaging results.« less

  5. Making a living while starving in the dark: metagenomic insights into the energy dynamics of a carbonate cave

    PubMed Central

    Ortiz, Marianyoly; Legatzki, Antje; Neilson, Julia W; Fryslie, Brandon; Nelson, William M; Wing, Rod A; Soderlund, Carol A; Pryor, Barry M; Maier, Raina M

    2014-01-01

    Carbonate caves represent subterranean ecosystems that are largely devoid of phototrophic primary production. In semiarid and arid regions, allochthonous organic carbon inputs entering caves with vadose-zone drip water are minimal, creating highly oligotrophic conditions; however, past research indicates that carbonate speleothem surfaces in these caves support diverse, predominantly heterotrophic prokaryotic communities. The current study applied a metagenomic approach to elucidate the community structure and potential energy dynamics of microbial communities, colonizing speleothem surfaces in Kartchner Caverns, a carbonate cave in semiarid, southeastern Arizona, USA. Manual inspection of a speleothem metagenome revealed a community genetically adapted to low-nutrient conditions with indications that a nitrogen-based primary production strategy is probable, including contributions from both Archaea and Bacteria. Genes for all six known CO2-fixation pathways were detected in the metagenome and RuBisCo genes representative of the Calvin–Benson–Bassham cycle were over-represented in Kartchner speleothem metagenomes relative to bulk soil, rhizosphere soil and deep-ocean communities. Intriguingly, quantitative PCR found Archaea to be significantly more abundant in the cave communities than in soils above the cave. MEtaGenome ANalyzer (MEGAN) analysis of speleothem metagenome sequence reads found Thaumarchaeota to be the third most abundant phylum in the community, and identified taxonomic associations to this phylum for indicator genes representative of multiple CO2-fixation pathways. The results revealed that this oligotrophic subterranean environment supports a unique chemoautotrophic microbial community with potentially novel nutrient cycling strategies. These strategies may provide key insights into other ecosystems dominated by oligotrophy, including aphotic subsurface soils or aquifers and photic systems such as arid deserts. PMID:24030597

  6. Bioabsorbable expansion bolt fixation in anterior cruciate ligament reconstruction.

    PubMed

    Piltz, S; Steinbauer, T; Meyer, L; Plitz, W; Andress, H J; Lob, G

    2004-01-01

    The current study evaluated initial fixation strength of a bioabsorbable expansion bolt compared with interference screw fixation in anterior cruciate ligament reconstruction using a bone-patellar tendon-bone graft. Thirty calf tibial plateaus with adjacent patella and extensor ligaments were used. Bioabsorbable poly-L-lactide interference screws were used for graft fixation in Group I, titanium screws in Group II, and bioabsorbable poly-DL-lactide expansion bolts were used in Group III. The mean force-to-failure (+/- standard deviation) in the three groups was 487 +/- 205 N, 713 +/- 218 N, and 594 +/- 224 N, respectively. The differences between Groups I and II were significant. No statistical differences were found regarding stiffness. Graft damage was significantly less in Group III compared with screw fixation. The fixation concept of an expansion bolt shows similar fixation strength and less graft damage compared with the established interference screw fixation. Because of the total absence of torque forces in contrast to bioabsorbable screws, the risk of implant breakage is minimized. PMID:15043122

  7. External fixation for displaced 2-part proximal humeral fractures.

    PubMed

    Benetos, Ioannis S; Karampinas, Panayiotis K; Mavrogenis, Andreas F; Romoudis, Pavlos; Pneumaticos, Spiros G; Vlamis, John

    2012-12-01

    Studies have reported conflicting results regarding external fixation for displaced proximal humeral fractures. Compared with open reduction and internal fixation, external fixation for displaced proximal humeral fractures avoids dissection and soft tissue stripping and leads to higher union rates, a lower incidence of avascular necrosis, less scaring of the scapulohumeral interface, and faster rehabilitation. Some authors have reported good or excellent results and minimum complications compared with open reduction and internal fixation; however, others have reported that external fixation does not ensure acceptable reduction and fracture stability, especially in patients with osteoporosis.This article describes 18 patients with displaced 2-part fractures of the surgical neck of the humerus treated with closed reduction and external fixation using the Tension Guide Fixator (Gexfix SA, Carouge, Switzerland) external fixation system between 2010 and 2011. The patients included 14 women and 4 men with a mean age of 39 years. Mean follow-up was 18 months (range, 15-24 months). Fracture union; function using the Constant score, University of California Los Angeles score, Oxford score, and Quick Disabilities of the Arm, Shoulder and Hand shoulder score; and complications were evaluated. All patients experienced fracture union at a mean of 11 weeks (range, 9-13 weeks). The Tension Guide Fixator was removed without anesthesia at the outpatient clinic at a mean of 6 weeks (range, 4-8 weeks) with no loss of reduction or secondary displacement after removal. At 1-year follow-up, mean Constant and University of California Los Angeles scores were excellent, mean Oxford score showed satisfactory joint function, and mean Quick Disabilities of the Arm, Shoulder and Hand score showed minimal pain with no disability. PMID:23218629

  8. CO(2) uptake and fixation by a thermoacidophilic microbial community attached to precipitated sulfur in a geothermal spring.

    PubMed

    Boyd, Eric S; Leavitt, William D; Geesey, Gill G

    2009-07-01

    Carbon fixation at temperatures above 73 degrees C, the upper limit for photosynthesis, is carried out by chemosynthetic thermophiles. Yellowstone National Park (YNP), Wyoming possesses many thermal features that, while too hot for photosynthesis, presumably support chemosynthetic-based carbon fixation. To our knowledge, in situ rates of chemosynthetic reactions at these high temperatures in YNP or other high-temperature terrestrial geothermal springs have not yet been reported. A microbial community attached to precipitated elemental sulfur (S(o) floc) at the source of Dragon Spring (73 degrees C, pH 3.1) in Norris Geyser Basin, YNP, exhibited a maximum rate of CO(2) uptake of 21.3 +/- 11.9 microg of C 10(7) cells(-1) h(-1). When extrapolated over the estimated total quantity of S(o) floc at the spring's source, the S(o) floc-associated microbial community accounted for the uptake of 121 mg of C h(-1) at this site. On a per-cell basis, the rate was higher than that calculated for a photosynthetic mat microbial community dominated by Synechococcus spp. in alkaline springs at comparable temperatures. A portion of the carbon taken up as CO(2) by the S(o) floc-associated biomass was recovered in the cellular nucleic acid pool, demonstrating that uptake was coupled to fixation. The most abundant sequences in a 16S rRNA clone library of the S(o) floc-associated community were related to chemolithoautotrophic Hydrogenobaculum strains previously isolated from springs in the Norris Geyser Basin. These microorganisms likely contributed to the uptake and fixation of CO(2) in this geothermal habitat. PMID:19429558

  9. Mechanical testing of a device for subcutaneous internal anterior pelvic ring fixation versus external pelvic ring fixation

    PubMed Central

    2014-01-01

    Background Although useful in the emergency treatment of pelvic ring injuries, external fixation is associated with pin tract infections, the patient’s limited mobility and a restricted surgical accessibility to the lower abdomen. In this study, the mechanical stability of a subcutaneous internal anterior fixation (SIAF) system is investigated. Methods A standard external fixation and a SIAF system were tested on pairs of Polyoxymethylene testing cylinders using a universal testing machine. Each specimen was subjected to a total of 2000 consecutive cyclic loadings at 1 Hz with sinusoidal lateral compression/distraction (+/?50 N) and torque (+/? 0.5 Nm) loading alternating every 200 cycles. Translational and rotational stiffness were determined at 100, 300, 500, 700 and 900 cycles. Results There was no significant difference in translational stiffness between the SIAF and the standard external fixation when compared at 500 (p?=?.089), 700 (p?=?.081), and 900 (p?=?.266) cycles. Rotational stiffness observed for the SIAF was about 50 percent higher than the standard external fixation at 300 (p?=?.005), 500 (p?=?.020), and 900 (p?=?.005) cycles. No loosening or failure of the rod-pin/rod-screw interfaces was seen. Conclusions In comparison with the standard external fixation system, the tested device for subcutaneous internal anterior fixation (SIAF) in vitro has similar translational and superior rotational stiffness. PMID:24684828

  10. Tibial Fixation Properties of a Continuous-Loop ACL Hamstring Graft Construct with Suspensory Fixation in Porcine Bone.

    PubMed

    Smith, Patrick A; DeBerardino, Thomas M

    2015-12-01

    The aim of this article is to compare tibial fixation strength of suspensory fixation for a quadrupled semitendinosus continuous loop all-inside anterior cruciate ligament (ACL) construct versus a doubled semitendinosus and gracilis graft fixated with an interference screw. Biomechanical testing was conducted using human hamstring allografts and porcine tibias. Constructs were cycled from 50 to 250?N for 500 cycles followed by a pull to failure. The average load to failure of tibial suspensory fixation of the all-inside continuous loop construct (1,012 N) was statistically different compared with the tibial interference screw group (612 N) (p?fixation of a novel all-inside continuous loop hamstring graft provided suitable strength for tibial fixation for ACL reconstruction. The continuous loop construct had a significantly higher load to failure compared with the use of an interference screw, and cyclic loading was comparable. Use of hamstring soft tissue grafts is very common for ACL reconstruction. An all-inside ACL reconstruction is based on a continuous loop construct utilizing a single semitendinosus graft that is quadrupled employing suspensory fixation on both the femoral and tibial side. Suspensory fixation on the femoral side been previously reported, but this is the first report of strength of this method of suspensory fixation on the tibia. PMID:25347056

  11. The Role of Fixation and Visual Attention in Object Recognition

    E-print Network

    Ratan, Aparna Lakshmi

    1995-07-21

    This research project is a study of the role of fixation and visual attention in object recognition. In this project, we build an active vision system which can recognize a target object in a cluttered scene efficiently ...

  12. 21 CFR 888.3060 - Spinal intervertebral body fixation orthosis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...orthosis. (a) Identification. A spinal intervertebral body fixation orthosis is a device intended to be implanted made of titanium. It consists of various vertebral plates that are punched into each of a series of vertebral bodies. An eye-type...

  13. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3050 Spinal interlaminal...fixation orthosis is a device intended to be implanted made of an alloy, such as stainless...compression or distraction rod. The device is implanted, usually across three...

  14. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3050 Spinal interlaminal...fixation orthosis is a device intended to be implanted made of an alloy, such as stainless...compression or distraction rod. The device is implanted, usually across three...

  15. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES GENERAL AND PLASTIC SURGERY DEVICES Prosthetic Devices § 878.3250 External facial fracture fixation appliance. (a) Identification. An external...

  16. 21 CFR 888.3050 - Spinal interlaminal fixation orthosis.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3050 Spinal interlaminal...fixation orthosis is a device intended to be implanted made of an alloy, such as stainless...compression or distraction rod. The device is implanted, usually across three...

  17. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES GENERAL AND PLASTIC SURGERY DEVICES Prosthetic Devices § 878.3250 External facial fracture fixation appliance. (a) Identification. An external...

  18. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES GENERAL AND PLASTIC SURGERY DEVICES Prosthetic Devices § 878.3250 External facial fracture fixation appliance. (a) Identification. An external...

  19. Threat and trait anxiety affect stability of gaze fixation.

    PubMed

    Laretzaki, Georgia; Plainis, Sotiris; Vrettos, Ioannis; Chrisoulakis, Anna; Pallikaris, Ioannis; Bitsios, Panos

    2011-03-01

    Threat accelerates early visual information processing, as shown by shorter P100 latencies of pattern Visual Evoked Potentials in subjects with low trait anxiety, but the opposite is true for high anxious subjects. We sought to determine if, and how, threat and trait anxiety interact to affect stability of gaze fixation. We used video oculography to record gaze position in the presence and in the absence of a fixational stimulus, in a safe and a verbal threat condition in subjects characterised for their trait anxiety. Trait anxiety significantly predicted fixational instability in the threat condition. An extreme tertile analysis revealed that fixation was less stable in the high anxiety group, especially under threat or in the absence of a stimulus. The effects of anxiety extend to perceptual and sensorimotor processes. These results have implications for the understanding of individual differences in occulomotor planning and visually guided behavior. PMID:21277935

  20. Technical tips: dualplate fixation technique for comminuted proximal humerus fractures.

    PubMed

    Choi, Sungwook; Kang, Hyunseong; Bang, Hyeongsig

    2014-08-01

    The authors report dualplate fixation technique for providing stable fixation in comminuted proximal humerus fractures. This technique has been used for proximal humerus fractures with metaphyseal comminution and provides excellent anatomical reduction and neck shaft angle (NSA). The recently locking plate is clinically more widely used due to its small size, low rigidity, high elasticity, and biomechanical properties such as fixed initial angle and rotational stability. However, in severely comminuted complex type proximal metaphyseal humerus fractures, the use of locking plate alone does not provide stable fixation, leading to complications such as varus collapse, anterior-posterior angulation, screw cutout, nonunion, malunion, and metal failure. Therefore, a more robust and enhanced fixation method, the dual plating technique using the locking compression plate (Proximal Humeral Internal Locking System and Variable Angle Locking Compression Plate) was developed. PMID:24813097

  1. Carbon remineralization in a north Florida swamp forest: Effects of water level on the pathways and rates of soil organic matter decomposition

    NASA Astrophysics Data System (ADS)

    Happell, James D.; Chanton, Jeffrey P.

    1993-09-01

    Water level controlled gas emissions from North Florida swamp forests. Under flooded conditions, CO2 and CH4 were the principle carbon gases transported to the atmosphere by bubble ebullition and molecular diffusion. The respective emission rates were for CO2, 29.3 ± 16.4 (13% by means of ebullition, 87% by means of diffusion, error is ± 1 standard deviation throughout) and for CH4, 2.16 ± 2.24 (45% by means of ebullition, 55% by means of diffusion) mol m-2 yr-1. Methane emissions were significantly attenuated by CH4 oxidation which occurred primarily at the sediment-water interface. Forty-six ± 22 % (n=19) of the belowground CH4 diffusing to this interface was oxidized before it could escape to the atmosphere. Under dry conditions, CO2 was the principle carbon gas released and atmospheric CH4 was consumed by microbes in the soil. The respective rates were 101.2 ± 26.80 and -0.015 ± 0.005 mol mr-2 yr-1. A carbon budget for the degradation of soil organic matter was developed for a swamp forest site under flooded and dry conditions. Assuming that live root respiration accounted for 67% (value determined in a swamp forest and is at the upper range of literature values) of the total CO2 emissions (given above), we calculate that under flooded conditions carbon remineralization proceeded at a total rate of 11.9 mol C m-2 yr-1. Forty-nine percent of the remineralization was by means of nonmethanogenic processes which produce CO2; the balance was by means of methanogenic processes, which produce both CH4 and CO2. Under dry conditions, remineralization was dominated by aerobic processes at a rate of 33.7 mol C m-2 yr-1. Carbon inputs to the soil occurred by aboveground and belowground production. Aboveground litter production contributed 25.6 mol C m-2 yr-1. If belowground production contributed an equal amount, then over the course of this study organic carbon accumulated in the soils at rates of 39.3 and 17.5 mol C m-2 yr-1 under flooded and dry conditions, respectively. If root respiration accounted for only 6% (lowest value in literature) of the total CO2 emissions, organic carbon would accumulate in the soil at a rate of 21.6 mol C m-2 d-1 under flooded conditions and be lost from the soil at a rate of 43.8 mol C m-2 d-1 under dry conditions.

  2. Dinitrogen fixation and dissolved organic nitrogen fueled primary production and particulate export during the VAHINE mesocosm experiment (New Caledonia lagoon)

    NASA Astrophysics Data System (ADS)

    Berthelot, H.; Moutin, T.; L'Helguen, S.; Leblanc, K.; Hélias, S.; Grosso, O.; Leblond, N.; Charrière, B.; Bonnet, S.

    2015-07-01

    In the oligotrophic ocean characterized by nitrate (NO3-) depletion in surface waters, dinitrogen (N2) fixation and dissolved organic nitrogen (DON) can represent significant nitrogen (N) sources for the ecosystem. In this study, we deployed large in situ mesocosms in New Caledonia in order to investigate (1) the contribution of N2 fixation and DON use to primary production (PP) and particle export and (2) the fate of the freshly produced particulate organic N (PON), i.e., whether it is preferentially accumulated and recycled in the water column or exported out of the system. The mesocosms were fertilized with phosphate (PO43-) in order to prevent phosphorus (P) limitation and promote N2 fixation. The diazotrophic community was dominated by diatom-diazotroph associations (DDAs) during the first part of the experiment for 10 days (P1) followed by the unicellular N2-fixing cyanobacteria UCYN-C for the last 9 days (P2) of the experiment. N2 fixation rates averaged 9.8 ± 4.0 and 27.7 ± 8.6 nmol L-1 d-1 during P1 and P2, respectively. NO3- concentrations (< 0.04 ?mol L-1) in the mesocosms were a negligible source of N, indicating that N2 fixation was the main driver of new production throughout the experiment. The contribution of N2 fixation to PP was not significantly different (p > 0.05) during P1 (9.0 ± 3.3 %) and P2 (12.6 ± 6.1 %). However, the e ratio that quantifies the efficiency of a system to export particulate organic carbon (POCexport) compared to PP (e ratio = POCexport/PP) was significantly higher (p < 0.05) during P2 (39.7 ± 24.9 %) than during P1 (23.9 ± 20.2 %), indicating that the production sustained by UCYN-C was more efficient at promoting C export than the production sustained by DDAs. During P1, PON was stable and the total amount of N provided by N2 fixation (0.10 ± 0.02 ?mol L-1) was not significantly different (p > 0.05) from the total amount of PON exported (0.10 ± 0.04 ?mol L-1), suggesting a rapid and probably direct export of the recently fixed N2 by the DDAs. During P2, both PON concentrations and PON export increased in the mesocosms by a factor 1.5-2. Unlike in P1, this PON production was not totally explained by the new N provided by N2 fixation. The use of DON, whose concentrations decreased significantly (p < 0.05) from 5.3 ± 0.5 ?mol L-1 to 4.4 ± 0.5 ?mol L-1, appeared to be the missing N source. The DON consumption (~ 0.9 ?mol L-1) during P2 is higher than the total amount of new N brought by N2 fixation (~ 0.25 ?mol L-1) during the same period. These results suggest that while DDAs mainly rely on N2 fixation for their N requirements, both N2 fixation and DON can be significant N sources for primary production and particulate export following UCYN-C blooms in the New Caledonia lagoon and by extension in the N-limited oceans where similar events are likely to occur.

  3. Dyslexic children are confronted with unstable binocular fixation while reading.

    PubMed

    Jainta, Stephanie; Kapoula, Zoï

    2011-01-01

    Reading requires three-dimensional motor control: saccades bring the eyes from left to right, fixating word after word; and oblique saccades bring the eyes to the next line of the text. The angle of vergence of the two optic axes should be adjusted to the depth of the book or screen and--most importantly--should be maintained in a sustained manner during saccades and fixations. Maintenance of vergence is important as it is a prerequisite for a single clear image of each word to be projected onto the fovea of the eyes. Deficits in the binocular control of saccades and of vergence in dyslexics have been reported previously but only for tasks using single targets. This study examines saccades and vergence control during real text reading. Thirteen dyslexic and seven non-dyslexic children read the French text "L'Allouette" in two viewing distances (40 cm vs. 100 cm), while binocular eye movements were measured with the Chronos Eye-tracking system. We found that the binocular yoking of reading saccades was poor in dyslexic children (relative to non-dyslexics) resulting in vergence errors; their disconjugate drift during fixations was not correlated with the disconjugacy during their saccades, causing considerable variability of vergence angle from fixation to fixation. Due to such poor oculomotor adjustments during reading, the overall fixation disparity was larger for dyslexic children, putting larger demand on their sensory fusion processes. Moreover, for dyslexics the standard deviation of fixation disparity was larger particularly when reading at near distance. We conclude that besides documented phoneme processing disorders, visual/ocular motor imperfections may exist in dyslexics that lead to fixation instability and thus, to instability of the letters or words during reading; such instability may perturb fusional processes and might--in part--complicate letter/word identification. PMID:21494641

  4. Effects of size, fixation location, and inversion on face identification.

    PubMed

    Sekuler, Allison; Pachai, Matthew; Hashemi, Ali; Bennett, Patrick

    2015-09-01

    One possible explanation for the face inversion effect (FIE) is that inversion swaps the eye and mouth locations relative to fixation, and attention typically is directed to the top of a stimulus for faces. As the eye region is the most informative for face discrimination, automatically attending to the upper-half of a face would cause observers to use less diagnostic regions for inverted faces. Consistent with this hypothesis, cueing attention to the eyes modulates the FIE measured both behaviourally (Hills et al. , JEP: HPP 2011) and with EEG (de Lissa et al., Neuropsychologia 2014). However, past studies used old/new recognition or gender discrimination tasks rather than identification tasks, and they did not consider the effects of stimulus size. The size manipulation is interesting in light of a recent suggestion that specialized face processing is engaged only by large stimuli (Yang et al., J Vis 2014). To address these issues, we measured accuracy and ERPs in a 6-AFC identification task that varied fixation location (center, left eye, right eye, mouth), orientation (upright or inverted), and face width (3.2 or 8.1 deg). Behavioural results showed significant main effects of: i) face size (higher accuracy for large faces), ii) fixation location (lower accuracy for mouth fixations), and iii) orientation (lower accuracy for inverted faces). However, we observed no fixation x orientation interaction, thus fixation location did not modulate the FIE. The size x orientation interaction also was not significant, which is inconsistent with the suggestion that small and large faces differentially recruit face-specific mechanisms. Finally, we found a significant N170 latency FIE that, consistent with previous studies, was larger with eye fixations. Together, these results clarify the roles of size and fixation in identification tasks, and further implicate the eyes in both behavioural and electrophysiological markers of face processing. Meeting abstract presented at VSS 2015. PMID:26326382

  5. Fixation Stability and Scotoma Mapping for Patients with Low Vision

    PubMed Central

    Elsner, Ann E.; Petrig, Benno L.; Papay, Joel A.; Kollbaum, Elli J.; Clark, Christopher A.; Muller, Matthew S.

    2013-01-01

    Purpose To develop a simplified device that performs fundus perimetry techniques, such as fixation mapping and kinetic perimetry. Methods We added visual stimulation to a near infrared retinal imager, the Laser Scanning Digital Camera (LSDC). This device uses slit scanning illumination combined with a 2 dimensional CMOS detector, with continuous viewing of the retina. The CMOS read-out was synchronized with the slit scanning, thereby serving as a confocal aperture to reduce stray light in retinal images. Series of retinal images of 36 deg were automatically aligned to provide data for fixation maps and quantification of fixation stability. The LSDC and alignment techniques also provided fundus viewing with retinal location correction for scotoma mapping. Results First, fixation mapping was readily performed in patients with central scotoma or amblyopia. The automatic alignment algorithm allowed quantification of fixation stability in patients with macular pathologies that did not cause scotoma. Second, fixation stability was rapidly and quantitatively assessed by the automatic registration of a series of retina images. There was no significant difference in the fixation stability with automatic vs. manual alignment. Kinetic perimetry demonstrated that fundus imaging helped reduce the variability of perimetric data by identifying and preventing false positives due to eye motion. We found that the size of the blind spot was significantly larger for dark targets on brighter backgrounds than when the contrast was reversed (p < 0.045). This is consistent with incremental targets being detected partially or wholly due to scattered light falling on more sensitive retinal locations. Conclusions Fundus perimetry with the LSDC allows for a wide range of fixation and perimetry tasks. PMID:23334309

  6. Arthroscopic-Assisted Fixation of Ideberg Type III Glenoid Fractures

    PubMed Central

    Tao, Matthew A.; Garrigues, Grant E.

    2015-01-01

    Operative treatment of scapular fractures with extension into the glenoid can be a challenging clinical scenario. Though traditionally addressed in an open fashion, the morbidity of this approach, complemented by advancements in arthroscopic technique and instrumentation, has led to increasing use of arthroscopic-assisted fixation. We describe our technique, including pearls and pitfalls, for minimally invasive fixation of Ideberg type III glenoid fractures. This approach minimizes morbidity, allows optimal visualization and reduction, and provides good functional results. PMID:26052487

  7. Effects of Prism Eyeglasses on Objective and Subjective Fixation Disparity

    PubMed Central

    Schroth, Volkhard; Joos, Roland; Jaschinski, Wolfgang

    2015-01-01

    In optometry of binocular vision, the question may arise whether prisms should be included in eyeglasses to compensate an oculomotor and/or sensory imbalance between the two eyes. The corresponding measures of objective and subjective fixation disparity may be reduced by the prisms, or the adaptability of the binocular vergence system may diminish effects of the prisms over time. This study investigates effects of wearing prisms constantly for about 5 weeks in daily life. Two groups of 12 participants received eyeglasses with prisms having either a base-in direction or a base-out direction with an amount up to 8 prism diopters. Prisms were prescribed based on clinical fixation disparity test plates at 6 m. Two dependent variables were used: (1) subjective fixation disparity was indicated by a perceived offset of dichoptic nonius lines that were superimposed on the fusion stimuli and (2) objective fixation disparity was measured with a video based eye tracker relative to monocular calibration. Stimuli were presented at 6 m and included either central or more peripheral fusion stimuli. Repeated measurements were made without the prisms and with the prisms after about 5 weeks of wearing these prisms. Objective and subjective fixation disparity were correlated, but the type of fusion stimulus and the direction of the required prism may play a role. The prisms did not reduce the fixation disparity to zero, but induced significant changes in fixation disparity with large effect sizes. Participants receiving base-out prisms showed hypothesized effects, which were concurrent in both types of fixation disparity. In participants receiving base-in prisms, the individual effects of subjective and objective effects were negatively correlated: the larger the subjective (sensory) effect, the smaller the objective (motor) effect. This response pattern was related to the vergence adaptability, i.e. the individual fusional vergence reserves. PMID:26431525

  8. Effects of Prism Eyeglasses on Objective and Subjective Fixation Disparity.

    PubMed

    Schroth, Volkhard; Joos, Roland; Jaschinski, Wolfgang

    2015-01-01

    In optometry of binocular vision, the question may arise whether prisms should be included in eyeglasses to compensate an oculomotor and/or sensory imbalance between the two eyes. The corresponding measures of objective and subjective fixation disparity may be reduced by the prisms, or the adaptability of the binocular vergence system may diminish effects of the prisms over time. This study investigates effects of wearing prisms constantly for about 5 weeks in daily life. Two groups of 12 participants received eyeglasses with prisms having either a base-in direction or a base-out direction with an amount up to 8 prism diopters. Prisms were prescribed based on clinical fixation disparity test plates at 6 m. Two dependent variables were used: (1) subjective fixation disparity was indicated by a perceived offset of dichoptic nonius lines that were superimposed on the fusion stimuli and (2) objective fixation disparity was measured with a video based eye tracker relative to monocular calibration. Stimuli were presented at 6 m and included either central or more peripheral fusion stimuli. Repeated measurements were made without the prisms and with the prisms after about 5 weeks of wearing these prisms. Objective and subjective fixation disparity were correlated, but the type of fusion stimulus and the direction of the required prism may play a role. The prisms did not reduce the fixation disparity to zero, but induced significant changes in fixation disparity with large effect sizes. Participants receiving base-out prisms showed hypothesized effects, which were concurrent in both types of fixation disparity. In participants receiving base-in prisms, the individual effects of subjective and objective effects were negatively correlated: the larger the subjective (sensory) effect, the smaller the objective (motor) effect. This response pattern was related to the vergence adaptability, i.e. the individual fusional vergence reserves. PMID:26431525

  9. Reward associations slow the release of visual fixation.

    PubMed

    Raymond, Jane; Murphy, Sandra

    2015-09-01

    When rapid orienting to brief visual targets is reliably rewarded, associations between targets (cues) and orienting responses become established via learning processes. An important question is whether such learning is limited to the specific stimulus-response associations acquired during learning or is more abstract, allowing modulation of other oculomotor behaviours not specifically reinforced during learning. To investigate, we briefly (250 ms) presented three different Japanese letters (hiragana) in pairs and differentially reinforced choice; different items led to a monetary win, loss, or nothing. Half of participants (n = 24) were asked to choose the optimal hiragana; others actively rejected the non-optimal item, thus learning different cue-response associations but the same cue-value associations. After learning, each hiragana served as a fixation stimulus in a simple saccadic reaction time (SRT) task requiring speeded saccades to a left or right peripheral (4 deg) dot target (no rewards provided). Fixation stimuli either remained visible for 200 ms after the target appeared (overlap condition) or offset 200 ms prior to the target's appearance (gap condition). SRTs are typically slower in the overlap versus gap conditions because fixation stimuli activate inhibitory 'fixation neurons' in the superior colliculus that prevent reflexive saccades during fixation. If learning builds cue-value associations (not just cue-response associations) and thus makes items more attractive, then SRTs should be slower in the overlap condition when the fixation stimulus is win (versus loss or zero) associated regardless of the task used during learning. Indeed, SRTs for both groups were significantly slowed (by 27 ms) with win versus zero (or loss) fixation stimuli in the overlap condition; no value effects in the gap condition were found, ruling out a strategic account. These results show that fixation neurons can be modulated by prior value-learning, and that cue-value associations can influence oculomotor behaviours not specifically reinforced during learning. Meeting abstract presented at VSS 2015. PMID:26326474

  10. Endosseous Fixation Device for Lapidus Arthrodesis: Technique, Early Experience, and Comparison With Crossed Screw Fixation.

    PubMed

    Zelent, Marek E; Neese, David J; Peterson, Paul H

    2015-01-01

    First metatarsal cuneiform joint arthrodesis has been commonly used since the early 1900s for definitive treatment of a variety of conditions involving the medial column of the foot. Early applications of this procedure resulted in a relatively high rate of complications, including malunion and nonunion. We retrospectively examined a novel method of fixation involving an endosseous implant with a nonporous, rough exterior surface and compared it with the traditional crossed screw fixation, considered the standard of care for the procedure. Twenty-one feet in 19 patients served as the control group with crossed screws, and 18 feet in 17 patients served as the trial group using the study device. Null hypothesis testing was used to compare the outcomes parameters between the comparative groups. Postoperatively, the patients were allowed to walk in a prefabricated, removable, below-the-knee cast boot at a mean of 48.3 ± 8.2 days in the control group and 24.4 ± 9.7 days in the trial group. These differences were highly significant (p < .0001). Postoperatively, the patients were allowed to walk in a stiff-soled shoe at a mean of 65.2 ± 8.4 days in the control group and 49.7 ± 19.2 days in the trial group. These differences were also statistically significant (p = .0020). The patients in the control group required revision surgery in 7 of 21 procedures (33%), with 2 patients developing nonunion (9.5%). Only 1 patient in the trial group required revision surgery (5.8%), and no patient developed nonunion. From these results, we believe that the endosseous trial implant is a reliable option for fixation of the first metatarsal cuneiform arthrodesis procedure and might allow for earlier weightbearing with fewer postoperative complications. PMID:26364702

  11. Pathway Analysis

    Cancer.gov

    Projects such as The Cancer Genome Atlas have gathered enormous quantities of data from human tumor samples. Informaticians at the National Lab are looking within such data for insights about the influence of mutant RAS genes on signaling pathways in cancers. On a smaller scale, the RAS Initiative will use numerous experimental platforms to interrogate cell lines expressing mutant RAS genes.

  12. Atlantoaxial rotatory fixation after ventriculoperitoneal shunting.

    PubMed

    Heary, R F; Reid, P; Carmel, P W

    2011-10-01

    Ventriculoperitoneal (VP) shunting is a common neurosurgical procedure in the pediatric population. Atlantoaxial rotatory fixation (AARF) is not uncommon in this same group. We present the first reported case of AARF following a VP shunt procedure. A 10-year-old boy, with hydrocephalus and a left temporal arachnoid cyst since birth, underwent a revision of his VP and cystoperitoneal shunts. A second operation was performed 2 days later to optimize catheter placement. Postoperative neck pain was attributed to tunneling of the subcutaneous catheter. 2 months after surgery, the child had minimal neck discomfort but maintained his head in a "cock-robin" position. Plain radiographs and computed tomographic (CT) images confirmed AARF. The child was admitted and placed in halo traction. After 3 days of traction, analgesics, sedation, and muscle relaxants, anatomic re-alignment of the C1-C2 vertebral complex was confirmed on CT scan. Following 3 months of immobilization in a halo-vest apparatus, the halo was removed. At 8-year follow-up, the clinical examination is normal and repeat imaging studies remain normal. Due to surgical positioning, and postoperative signs attributed to normal postoperative pain, an AARF was not initially recognized. This case represents the first time that AARF has been reported following a VP shunt procedure. PMID:21959746

  13. Fixation probabilities on superstars, revisited and revised.

    PubMed

    Jamieson-Lane, Alastair; Hauert, Christoph

    2015-10-01

    Population structures can be crucial determinants of evolutionary processes. For the Moran process on graphs certain structures suppress selective pressure, while others amplify it (Lieberman et al., 2005). Evolutionary amplifiers suppress random drift and enhance selection. Recently, some results for the most powerful known evolutionary amplifier, the superstar, have been invalidated by a counter example (Díaz et al., 2013). Here we correct the original proof and derive improved upper and lower bounds, which indicate that the fixation probability remains close to 1-1/(r(4)H) for population size N?? and structural parameter H?1. This correction resolves the differences between the two aforementioned papers. We also confirm that in the limit N,H?? superstars remain capable of eliminating random drift and hence of providing arbitrarily strong selective advantages to any beneficial mutation. In addition, we investigate the robustness of amplification in superstars and find that it appears to be a fragile phenomenon with respect to changes in the selection or mutation processes. PMID:26122591

  14. Histomorphometric comparison after fixation with formaldehyde or glyoxal

    PubMed Central

    Wang, YN; Lee, K; Pai, S; Ledoux, WR

    2014-01-01

    Formaldehyde has long been the fixative of choice for histological examination of tissue. The use of alternatives to formaldehyde has grown, however, owing to the serious hazards associated with its use. Companies have striven to maintain the morphological characteristics of formaldehyde-fixed tissue when developing alternatives. Glyoxal-based fixatives now are among the most popular formaldehyde alternatives. Although there are many studies that compare staining quality and immunoreactivity, there have been no studies that quantify possible structural differences. Histomorphometric analysis commonly is used to evaluate diseased tissue. We compared fixation with formaldehyde and glyoxal with regard to the histomorphological properties of plantar foot tissue using a combination of stereological methods and quantitative morphology. We measured skin thickness, interdigitation index, elastic septa thickness, and adipocyte area and diameter. No significant differences were observed between formaldehyde and glyoxal fixation for any feature measured. The glyoxal-based fixative used therefore is a suitable fixative for structural evaluation of plantar soft tissue. Measurements obtained from the glyoxal-fixed tissue can be combined with data obtained from formalin-fixed for analysis. PMID:20854226

  15. Anterior subcutaneous internal fixation for treatment of unstable pelvic fractures

    PubMed Central

    2014-01-01

    Background Fractures of the pelvic ring including disruption of the posterior elements in high-energy trauma have both high morbidity and mortality rates. For some injury pattern part of the initial resuscitation includes either external fixation or plate fixation to close the pelvic ring and decrease blood loss. In certain situations – especially when associated with abdominal trauma and the need to perform laparotomies – both techniques may put the patient at risk of either pintract or deep plate infections. We describe an operative approach to percutaneously close and stabilize the pelvic ring using spinal implants as an internal fixator and report the results in a small series of patients treated with this technique during the resuscitation phase. Findings Four patients were treated by subcutaneous placement of an internal fixator. Screw fixation was carried out by minimally invasive placement of two supra-acetabular iliac screws. Afterwards, a subcutaneous transfixation rod was inserted and attached to the screws after reduction of the pelvic ring. All patients were allowed to fully weight-bear. No losses of reduction or deep infections occurred. Fracture healing was uneventful in all cases. Conclusion Minimally invasive fixation is an alternative technique to stabilize the pelvic ring. The clinical results illustrate that this technique is able to achieve good results in terms of maintenance of reduction the pelvic ring. Also, abdominal surgeries no longer put the patient at risk of infected pins or plates. PMID:24606833

  16. Axial loading cross screw fixation for the Austin bunionectomy.

    PubMed

    Rigby, Ryan B; Fallat, Lawrence M; Kish, John P

    2011-01-01

    The Austin procedure has become a common method of osteotomy for the correction of hallux abductovalgus when indicated. The V-type configuration is intrinsically stable but not without complications. One complication encountered is rotation and/or displacement of the capital fragment. We present the use of an axial loading screw in conjunction with a dorsally placed compression screw. The benefit to this technique lies in the orientation of the axial loading screw, because it is directed to resist the ground reactive forces while also providing a second point of fixation in a crossing screw design. In a head-to-head biomechanical comparison, we tested single dorsal screw fixation versus double screw fixation, including both the dorsal and the axial loading screws in 10 metatarsal Sawbones(®) (Pacific Research Laboratories Inc, Vashon, WA). Five metatarsals received single dorsal screw fixation and five received the dorsal screw and the additional axial loading screw. The metatarsals were analyzed on an Instron compression device for comparison; 100% of the single screw fixation osteotomies failed with compression at an average peak load of 205 N. Four of five axial loading double screw fixation osteotomies did not fail. This finding suggests that the addition of an axial loading screw providing cross screw orientation significantly increases the stability of the Austin osteotomy, ultimately decreasing the likelihood of displacement encountered in the surgical repair of hallux abductovalgus. PMID:21621434

  17. Diurnal rhythm of a unicellular diazotrophic cyanobacterium under mixotrophic conditions and elevated carbon dioxide.

    PubMed

    Gaudana, Sandeep B; Alagesan, Swathi; Chetty, Madhu; Wangikar, Pramod P

    2013-11-01

    Mixotrophic cultivation of cyanobacteria in wastewaters with flue gas sparging has the potential to simultaneously sequester carbon content from gaseous and aqueous streams and convert to biomass and biofuels. Therefore, it was of interest to study the effect of mixotrophy and elevated CO2 on metabolism, morphology and rhythm of gene expression under diurnal cycles. We chose a diazotrophic unicellular cyanobacterium Cyanothece sp. ATCC 51142 as a model, which is a known hydrogen producer with robust circadian rhythm. Cyanothece 51142 grows faster with nitrate and/or an additional carbon source in the growth medium and at 3 % CO2. Intracellular glycogen contents undergo diurnal oscillations with greater accumulation under mixotrophy. While glycogen is exhausted by midnight under autotrophic conditions, significant amounts remain unutilized accompanied by a prolonged upregulation of nifH gene under mixotrophy. This possibly supports nitrogen fixation for longer periods thereby leading to better growth. To gain insights into the influence of mixotrophy and elevated CO2 on circadian rhythm, transcription of core clock genes kaiA, kaiB1 and kaiC1, the input pathway, cikA, output pathway, rpaA and representatives of key metabolic pathways was analyzed. Clock genes' transcripts were lower under mixotrophy suggesting a dampening effect exerted by an external carbon source such as glycerol. Nevertheless, the genes of the clock and important metabolic pathways show diurnal oscillations in expression under mixotrophic and autotrophic growth at ambient and elevated CO2, respectively. Taken together, the results indicate segregation of light and dark associated reactions even under mixotrophy and provide important insights for further applications. PMID:23881383

  18. Late Glacial Tropical Savannas in Sundaland Inferred From Stable Carbon Isotope Records of Cave Guano

    NASA Astrophysics Data System (ADS)

    Wurster, C. M.; Bird, M. I.; Bull, I.; Dungait, J.; Bryant, C. L.; Ertunç, T.; Hunt, C.; Lewis, H. A.; Paz, V.

    2008-12-01

    During the Last Glacial Period (LGP), reduced global sea level exposed the continental shelf south of Thailand to Sumatra, Java, and Borneo to form the contiguous continent of Sundaland. However, the type and extent of vegetation that existed on much of this exposed landmass during the LGP remains speculative. Extensive bird and bat guano deposits in caves throughout this region span beyond 40,000 yr BP, and contain a wealth of untapped stratigraphic palaeoenvironmental information. Stable carbon isotope ratios of insectivorous bird and bat guano contain a reliable record of the animal's diet and, through non-specific insect predation, reflect the relative abundance of major physiological pathways in plants. Various physiological pathways of carbon fixation in plants yield differing stable carbon isotope ratios. Stable carbon isotope values of C3 plants are lower than C4 vegetation due to different enzymatic discriminations of the heavy isotope through the carbon fixing pathways. In tropical locales, grasses nearly always follow the C4 photosynthetic pathway, whereas tropical rainforest uses C3 photosynthesis, providing a proxy for vegetation and therefore climate change in the past. Here we discuss four guano stable-isotope records, based on insect cuticle and n-alkane analysis, supplemented by pollen analysis. All sites suggest a C3 dominated ecosystem for the Holocene, consistent with the wet tropical forest vegetation present at all locations. Two sites from Palawan Island, Philippines, record stable carbon isotope values of guano that document a drastic change from C3 (forest) to C4 (savanna) dominated ecosystems during the Last Glacial Maximum (LGM). A third location, at Niah Great Cave, Malaysia, indicates C3-dominant vegetation throughout the record, but does display variation in stable carbon isotope values likely linked to humidity changes. A fourth location, Batu Caves in Peninsular Malaysia, also indicates open vegetation during the LGM. Vegetation models disagree as to the nature of vegetation during the LGM in Sundaland, but our results suggest major contraction of forest area with significant implications for carbon storage during the LGM and also for understanding the development of modern biogeographic and genetic patterns in the region. Additional cave guano sites will provide further constraints on the nature of environmental change in the region over the last glacial cycle.

  19. Scleral fixation of Ahmed glaucoma valve tube tip for adjustment of cornea-touching malposition

    PubMed Central

    Ma, K T; Kim, J H; Seong, G J; Jang, D S; Kim, C Y

    2014-01-01

    Purpose Tube-corneal touch occurring after Ahmed glaucoma valve (AGV) implantation is conventionally treated by tube cutting or tube transposition from the original pathway. However, in some cases, tube cutting is insufficient, and rearranging the pathway of the tube through a new sclera tunnel, ciliary sulcus, or pars plana is not feasible, as the conjunctiva and sclera covering the tube are difficult to be redissected. So, we propose a novel technique that repositions malpositioned AGV tube using scleral fixation and its successful applications in two patients with tube-corneal touch. Methods (A) A scleral flap is made at the point for scleral fixation. (B) The anterior chamber is maintained using an anterior chamber maintainer. The incision is made immediately above the tube entering the anterior chamber and the tube end is flipped out using a Sinskey. (C) A double-armed 10/0 prolene straight needle is penetrated through the tube end. The leading needle enters the anterior chamber through the previously made incision and is pulled through the scleral flap. (D) The tube tip and the second needle of the double-armed 10/0 prolene straight needle also enter the anterior chamber through the previously made incision and the second needle is pulled through the scleral flap. The tube end is extended to be parallel to the cornea surface. Results Patients maintained good tube positioning without any serious complications during average of 15 months of follow-up after operation. Conclusion We believe that our method is a simple and minimally invasive surgical method for treating AGV tube touching of the corneal endothelium. However, considering the limited number of cases studied and the short follow-up period, a larger group with a longer follow-up period is necessary. PMID:24097119

  20. A delta13C-based carbon flux model for the hydrothermal vent chemoautotrophic symbiosis Riftia pachyptila predicts sizeable CO(2) gradients at the host-symbiont interface.

    PubMed

    Scott, Kathleen M

    2003-05-01

    The chemoautotrophic symbiosis Riftia pachyptila has extremely 13C-enriched delta13C values. Neither isotopic discrimination by the RubisCO enzyme of their bacterial endosymbionts, nor the delta13C value of CO2 at their hydrothermal vent habitat, suffice to explain biomass delta13C values in this organism, which range from - 9 to - 16 per thousand. However, these 13C-enriched delta13C values are consistent with the presence of 13C-enriched CO2 within the symbiont cytoplasm. Such a 13C-enriched pool of CO2 is expected when the rate of CO2 fixation by RubisCO, which fixes 12CO2 more rapidly than 13CO2, approaches the rate of exchange between intracellular and extracellular CO2 pools. Rapid CO2 fixation rates will also generate concentration gradients between these two pools. In order to estimate the size of these concentration gradients, an equation was derived, which describes the delta13C of tubeworm biomass in terms of the size of the CO2 gradient between the hydrothermal vent environment and the symbiont cytoplasm. Using mass balance equations for CO2 exchange and fixation by the symbionts and the tubeworm host, this model predicts that a CO2 concentration gradient of up to 17-fold between the symbiont cytoplasm and the environment is sufficient to explain even the most 13C-enriched R. pachyptila biomass. This model illustrates how both physical and enzymatic factors can act to influence the delta13C of intracellular CO2, which, in turn, highlights the danger of assigning a carbon fixation pathway to an autotroph based solely on its biomass delta13C value. PMID:12713468

  1. A phylogenetic approach to the early evolution of autotrophy: the case of the reverse TCA and the reductive acetyl-CoA pathways.

    PubMed

    Becerra, Arturo; Rivas, Mario; García-Ferris, Carlos; Lazcano, Antonio; Peretó, Juli

    2014-06-01

    In recent decades, a number of hypotheses on the autotrophic origin of life have been presented. These proposals invoke the emergence of reaction networks leading from CO or CO? to the organic molecules required for life. It has also been suggested that the last (universal) common ancestor (LCA or LUCA) of all extant cell lineages was a chemolitho-autotrophic thermophilic anaerobe. The antiquity of some carbon fixation pathways, the phylogenetic basal distribution of some autotrophic organisms, and the catalytic properties of iron-sulfur minerals have been advanced in support of these ideas. Here we critically examine the phylogenetic distribution and evolution of enzymes that are essential for two of the most ancient autotrophic means of metabolism: the reductive tricarboxylic acid (rTCA) cycle and the reductive acetyl-CoA pathway. Phylogenetic analysis of citryl-CoA synthetase and of citryl-CoA lyase, key enzymatic components of the rTCA cycle, and of CO dehydrogenase/acetyl-CoA synthase, a key enzyme in the reductive acetyl-CoA pathway, revealed that all three enzymes have undergone major lateral transfer events and therefore cannot be used as proof of the LCA's metabolic abilities nor as evidence of an autotrophic origin of life. [Int Microbiol 2014; 17(2):91-97]. PMID:26418853

  2. Strontium-impregnated bioabsorbable composite for osteoporotic fracture fixation.

    PubMed

    Wu, Chang-Chin; Kuo, Chih-Lin; Fan, Fang-Yu; Yang, Kai-Chiang

    2015-10-01

    Osteoporosis impairs the bone-healing process as well as bone fracture fixation. The intervention of osteoporosis is considered to be one part of bone fracture treatment. Thus, orthopedic fixators impregnated with antiosteoporosis regimens will improve fracture fixation in osteoporotic bone. In this study, the strontium (Sr) and calcium phosphate ceramic (CPC) were mixed first and then mixed with poly(?-caprolactone) (PCL) to fabricate a bioactive and bioabsorbable bone fixators. The prepared Sr-CPC/PCL screws were implanted into the distal femur of ovariectomized rabbits. The results showed that Sr-CPC/PCL composite had the appropriate mechanical properties, good biocompatibility, and radio-opacity. The Sr addition created a porous structure and accelerated the degradation of bone screws, but the degradation products did not acidify the surrounding environment. For osteoporotic animals, favorable osteointegration around the Sr-CPC/PCL screws was found, and the total porosity of trabecular bone was decreased under the inspections of micro-computerized tomography. Compared with PCL or CPC/PCL screw, animals which received Sr-CPC/PCL were found to have better results in terms of trabecular number, thickness, and separation. This study reveals that the Sr-impregnated bone fixator improves osseointegration in osteoporotic animals. Sr-CPC/PCL composite is a good candidate material for osteofixation in osteoporotic patients. PMID:25847487

  3. Effect of fixation positions on perception of lightness

    NASA Astrophysics Data System (ADS)

    Toscani, Matteo; Valsecchi, Matteo; Gegenfurtner, Karl R.

    2015-03-01

    Visual acuity, luminance sensitivity, contrast sensitivity, and color sensitivity are maximal in the fovea and decrease with retinal eccentricity. Therefore every scene is perceived by integrating the small, high resolution samples collected by moving the eyes around. Moreover, when viewing ambiguous figures the fixated position influences the dominance of the possible percepts. Therefore fixations could serve as a selection mechanism whose function is not confined to finely resolve the selected detail of the scene. Here this hypothesis is tested in the lightness perception domain. In a first series of experiments we demonstrated that when observers matched the color of natural objects they based their lightness judgments on objects' brightest parts. During this task the observers tended to fixate points with above average luminance, suggesting a relationship between perception and fixations that we causally proved using a gaze contingent display in a subsequent experiment. Simulations with rendered physical lighting show that higher values in an object's luminance distribution are particularly informative about reflectance. In a second series of experiments we considered a high level strategy that the visual system uses to segment the visual scene in a layered representation. We demonstrated that eye movement sampling mediates between the layer segregation and its effects on lightness perception. Together these studies show that eye fixations are partially responsible for the selection of information from a scene that allows the visual system to estimate the reflectance of a surface.

  4. Vergence errors: some hitherto unreported aspects of fixation disparity.

    PubMed

    Reading, R W

    1992-07-01

    Measurement of the monocular components of fixation disparity indicated a higher prevalence of asymmetric contributions to the total deviation than previously reported. Furthermore, the exact proportion varied from moment to moment. Two of six subjects showed significant changes in fixation disparity over a period of 1 week. For all six subjects the changes in fixation deviation of one eye were virtually independent of those changes occurring in the other eye. In other words, these monocular variances were uncorrelated. Settings of the monocular components of binocular fixation disparity were accomplished at an accuracy close to that achieved by using a monocular vernier technique. The remaining differences appeared to be due to occasional instabilities during binocular viewing. The usual method of clinical measurement in which only one element is moved is not always equivalent to that determined by summing the two monocular components. The principal process measured by subjective fixation disparity appears to be either oculomotor or localized directional shifts of a monocular nature. PMID:1635757

  5. Invertebrate grazers affect metal/metalloid fixation during litter decomposition.

    PubMed

    Schaller, Jörg; Brackhage, Carsten

    2015-01-01

    Plant litter and organic sediments are main sinks for metals and metalloids in aquatic ecosystems. The effect of invertebrates as key species in aquatic litter decomposition on metal/metalloid fixation by organic matter is described only for shredders, but for grazers as another important animal group less is known. Consequently, a laboratory batch experiment was conducted to examine the effect of invertebrate grazers (Lymnaea stagnalis L.) on metal/metalloid fixation/remobilization during aquatic litter decomposition. It could be shown that invertebrate grazers facilitate significantly the formation of smaller sizes of particulate organic matter (POM), as shown previously for invertebrate shredders. The metal/metalloid binding capacity of these smaller particles of POM is higher compared to leaf litter residuals. But element enrichment is not as high as shown previously for the effect by invertebrate shredders. Invertebrate grazers enhance also the mobilization of selected elements to the water, in the range also proven for invertebrate shredders but different for the different elements. Nonetheless invertebrate grazers activity during aquatic litter decomposition leads to a metal/metalloid fixation into leaf litter as part of sediment organic matter. Hence, the effect of invertebrate grazers on metal/metalloid fixation/remobilization contrasts partly with former assessments revealing the possibility of an enhanced metal/metalloid fixation. PMID:25063962

  6. Dinitrogen fixation in a unicellular chlorophyll d-containing cyanobacterium

    PubMed Central

    Pfreundt, Ulrike; Stal, Lucas J; Voß, Björn; Hess, Wolfgang R

    2012-01-01

    Marine cyanobacteria of the genus Acaryochloris are the only known organisms that use chlorophyll d as a photosynthetic pigment. However, based on chemical sediment analyses, chlorophyll d has been recognized to be widespread in oceanic and lacustrine environments. Therefore it is highly relevant to understand the genetic basis for different physiologies and possible niche adaptation in this genus. Here we show that unlike all other known isolates of Acaryochloris, the strain HICR111A, isolated from waters around Heron Island, Great Barrier Reef, possesses a unique genomic region containing all the genes for the structural and enzymatically active proteins of nitrogen fixation and cofactor biosynthesis. Their phylogenetic analysis suggests a close relation to nitrogen fixation genes from certain other marine cyanobacteria. We show that nitrogen fixation in Acaryochloris sp. HICR111A is regulated in a light–dark-dependent fashion. We conclude that nitrogen fixation, one of the most complex physiological traits known in bacteria, might be transferred among oceanic microbes by horizontal gene transfer more often than anticipated so far. Our data show that the two powerful processes of oxygenic photosynthesis and nitrogen fixation co-occur in one and the same cell also in this branch of marine microbes and characterize Acaryochloris as a physiologically versatile inhabitant of an ecological niche, which is primarily driven by the absorption of far-red light. PMID:22237545

  7. An integrative approach to energy, carbon, and redox metabolism in the cyanobacterium Synechocystis sp. PCC 6803

    SciTech Connect

    Vermaas, Willem F.J.

    2006-03-14

    The broader goal of this project was to merge knowledge from genomic, metabolic, ultrastructural and other perspectives to understand how cyanobacteria live, adapt and are regulated. This understanding aids in metabolic engineering and synthetic biology efforts using this group of organisms that contribute greatly to global photosynthetic CO2 fixation and that are closely related to the ancestors of chloroplasts. This project focused on photosynthesis and respiration in the cyanobacterium Synechocystis sp. PCC 6803, which is spontaneously transformable and has a known genome sequence. Modification of these fundamental processes in this organism can lead to improved carbon sequestration and hydrogen production, as well as to generation of high-quality biomass. In our GTL-supported studies at Arizona State University we focus on cell structure and cell physiology in Synechocystis, with particular emphasis on thylakoid membrane formation and on metabolism related to photosynthesis and respiration. Results on (a) thylakoid membrane biogenesis, (b) fluxes through central carbon utilization pathways, and (c) distribution mechanisms between carbon storage compounds are presented. Together, these results help pave the way for metabolic engineering efforts that are likely to result in improved solar-powered carbon sequestration and bioenergy conversion. Fueled by the very encouraging results obtained in this project, we already have attracted interest from major companies in the use of cyanobacteria for biofuel production.

  8. Rerouting Carbon Flux To Enhance Photosynthetic Productivity

    SciTech Connect

    Ducat, DC; Avelar-Rivas, JA; Way, JC; Silver, PA

    2012-03-23

    The bioindustrial production of fuels, chemicals, and therapeutics typically relies upon carbohydrate inputs derived from agricultural plants, resulting in the entanglement of food and chemical commodity markets. We demonstrate the efficient production of sucrose from a cyanobacterial species, Synechococcus elongatus, heterologously expressing a symporter of protons and sucrose (cscB). cscB-expressing cyanobacteria export sucrose irreversibly to concentrations of >10 mM without culture toxicity. Moreover, sucrose-exporting cyanobacteria exhibit increased biomass production rates relative to wild-type strains, accompanied by enhanced photosystem II activity, carbon fixation, and chlorophyll content. The genetic modification of sucrose biosynthesis pathways to minimize competing glucose-or sucrose-consuming reactions can further improve sucrose production, allowing the export of sucrose at rates of up to 36.1 mg liter(-1) h illumination(-1). This rate of production exceeds that of previous reports of targeted, photobiological production from microbes. Engineered S. elongatus produces sucrose in sufficient quantities (up to similar to 80% of total biomass) such that it may be a viable alternative to sugar synthesis from terrestrial plants, including sugarcane.

  9. Artificial photosynthesis on tree trunk derived alkaline tantalates with hierarchical anatomy: towards CO2 photo-fixation into CO and CH4.

    PubMed

    Zhou, Han; Li, Peng; Guo, Jianjun; Yan, Runyu; Fan, Tongxiang; Zhang, Di; Ye, Jinhua

    2015-01-01

    Artificial photosynthesis, the photochemical fixation and recycling of CO2 back to hydrocarbon fuels using sunlight and water, is both a significant challenge and an opportunity that, if realized, could have a revolutionary impact on our energy system. Herein, we demonstrate one of the first examples using biomass derived hierarchical porous photocatalysts for CO2 photo-fixation into sustainable hydrocarbon fuels. A generic method is proposed to build a series of alkaline tantalates MTaO3 (M = Li, Na, K) with hierarchical anatomy from macro- to nanoscales using activated carbonized tree trunks as templates. Artificial photosynthesis is carried out on MTaO3 series using only artificial sunlight, water, and carbon dioxide as inputs to produce carbon monoxide and methane as the main outputs. The CO2 photo-fixation performance can be enhanced by introducing a macropore network, which mainly enhances light transfer and accelerates gas diffusion. The research provides prototype models that integrate individual nanoscale components into higher level macroscopic artificial photosynthetic systems for better solar-to-fuel conversion efficiencies. This work would have potential significance for the ultimate construction of "artificial trees" and provide envisions creating "forests" of these CO2-capturing artificial trees to remove carbon dioxide from the atmosphere and convert it into sustainable fuels. PMID:25300496

  10. Impact of global climate change on ecosystem-level interactions among sympatric plants from all three photosynthetic pathways. Terminal report

    SciTech Connect

    Nobel, P.S.

    1997-12-17

    The proposed research will determine biochemical and physiological responses to variations in environmental factors for plants of all three photosynthetic pathways under competitive situations in the field. These responses will be used to predict the effects of global climatic change on an ecosystem in the northwestern Sonoran Desert where the C{sub 3} subshrub Encelia farinosa, the C{sub 4} bunchgrass Hilaria rigida, and the CAM succulent Agave deserti are co-dominants. These perennials are relatively short with overlapping shallow roots facilitating the experimental measurements as well as leading to competition for soil water. Net CO{sub 2} uptake over 24-h periods measured in the laboratory will be analyzed using an environmental productivity index (EPI) that can incorporate simultaneous effects of soil water, air temperature, and light. Based on EPI, net CO{sub 2} uptake and hence plant productivity will be predicted for the three species in the field under various treatments. Activity of the two CO{sub 2} fixation enzymes, Rubisco and PEPCase, will be determined for these various environmental conditions; also, partitioning of carbon to various organs will be measured based on {sup 14}CO{sub 2} labeling and dry weight analysis. Thus, enzymatic and partitioning controls on competition among sympatric model plants representing all three photosynthetic pathways will be investigated.

  11. Two-dimensional electronic spectroscopy reveals the dynamics of phonon-mediated excitation pathways in semiconducting single-walled carbon nanotubes.

    PubMed

    Graham, Matt W; Calhoun, Tessa R; Green, Alexander A; Hersam, Mark C; Fleming, Graham R

    2012-02-01

    Electronic two-dimensional Fourier transform (2D-FT) spectroscopy is applied to semiconducting single-walled carbon nanotubes and provides a spectral and time-domain map of exciton-phonon assisted excitations. Using 12 fs long pulses, we resolve side-bands above the E(22) transition that correspond with the RBM, G, G', 2G and other multiphonon modes. The appearance of 2D-FT spectral cross-peaks explicitly resolves discrete phonon assisted population transfer that scatters excitations to the E(22) (?-pt) state, often through a second-order exciton-phonon coupling process. All 2D-FT peaks exhibit a strong peak amplitude modulation at the G-band period (21 fs) which we show originates from an impulsive stimulated Raman process that populates a ground-state G-band vibrational coherence over a 1.3 ps phonon lifetime. PMID:22214398

  12. Two-dimensional electronic spectroscopy reveals the dynamics of phonon-mediated excitation pathways in semiconducting single-walled carbon nanotubes.

    TOXLINE Toxicology Bibliographic Information

    Graham MW; Calhoun TR; Green AA; Hersam MC; Fleming GR

    2012-02-08

    Electronic two-dimensional Fourier transform (2D-FT) spectroscopy is applied to semiconducting single-walled carbon nanotubes and provides a spectral and time-domain map of exciton-phonon assisted excitations. Using 12 fs long pulses, we resolve side-bands above the E(22) transition that correspond with the RBM, G, G', 2G and other multiphonon modes. The appearance of 2D-FT spectral cross-peaks explicitly resolves discrete phonon assisted population transfer that scatters excitations to the E(22) (?-pt) state, often through a second-order exciton-phonon coupling process. All 2D-FT peaks exhibit a strong peak amplitude modulation at the G-band period (21 fs) which we show originates from an impulsive stimulated Raman process that populates a ground-state G-band vibrational coherence over a 1.3 ps phonon lifetime.

  13. A metabolomic study in oats (Avena sativa) highlights a drought tolerance mechanism based upon salicylate signalling pathways and the modulation of carbon, antioxidant and photo-oxidative metabolism.

    PubMed

    Sánchez-Martín, Javier; Heald, Jim; Kingston-Smith, Alison; Winters, Ana; Rubiales, Diego; Sanz, Mariluz; Mur, Luis A J; Prats, Elena

    2015-07-01

    Although a wealth of information is available on the induction of one or several drought-related responses in different species, little is known of how their timing, modulation and crucially integration influence drought tolerance. Based upon metabolomic changes in oat (Avena sativa L.), we have defined key processes involved in drought tolerance. During a time course of increasing water deficit, metabolites from leaf samples were profiled using direct infusion-electrospray mass spectroscopy (DI-ESI-MS) and high-performance liquid chromatography (HPLC) ESI-MS/MS and analysed using principal component analysis (PCA) and discriminant function analysis (DFA). The involvement of metabolite pathways was confirmed through targeted assays of key metabolites and physiological experiments. We demonstrate an early accumulation of salicylic acid (SA) influencing stomatal opening, photorespiration and antioxidant defences before any change in the relative water content. These changes are likely to maintain plant water status, with any photoinhibitory effect being counteracted by an efficient antioxidant capacity, thereby representing an integrated mechanism of drought tolerance in oats. We also discuss these changes in relation to those engaged at later points, consequence of the different water status in susceptible and resistant genotypes. PMID:25533379

  14. Open reduction-fixation of mandibular subcondylar fractures. A review.

    PubMed

    MacArthur, C J; Donald, P J; Knowles, J; Moore, H C

    1993-04-01

    From 1973 to 1990, 392 mandibular subcondylar fractures were treated at the University of California, Davis, by the Otolaryngology Department. Of these, 17% were handled by open reduction and internal fixation. Twenty-one patients from this group were located for follow-up at an average interval of 64 months. Retrospective review shows the operation to be safe, with few complications and no permanent sequelae. Patient examination often revealed abnormalities of occlusion and mandibular function; however, these objective findings did not correlate well with patients' relative lack of subjective complaints. An 86% incidence of roentgenographic evidence of condylar disease after open reduction and internal fixation was found. We question the long-term efficacy of open reduction and internal fixation in restoring fracture alignment and maintaining mandibular height given the high rate (86%) of condylar disease in our patient population. PMID:8457303

  15. The use of silk-based devices for fracture fixation

    NASA Astrophysics Data System (ADS)

    Perrone, Gabriel S.; Leisk, Gary G.; Lo, Tim J.; Moreau, Jodie E.; Haas, Dylan S.; Papenburg, Bernke J.; Golden, Ethan B.; Partlow, Benjamin P.; Fox, Sharon E.; Ibrahim, Ahmed M. S.; Lin, Samuel J.; Kaplan, David L.

    2014-03-01

    Metallic fixation systems are currently the gold standard for fracture fixation but have problems including stress shielding, palpability and temperature sensitivity. Recently, resorbable systems have gained interest because they avoid removal and may improve bone remodelling due to the lack of stress shielding. However, their use is limited to paediatric craniofacial procedures mainly due to the laborious implantation requirements. Here we prepare and characterize a new family of resorbable screws prepared from silk fibroin for craniofacial fracture repair. In vivo assessment in rat femurs shows the screws to be self-tapping, remain fixed in the bone for 4 and 8 weeks, exhibit biocompatibility and promote bone remodelling. The silk-based devices compare favourably with current poly-lactic-co-glycolic acid fixation systems, however, silk-based devices offer numerous advantages including ease of implantation, conformal fit to the repair site, sterilization by autoclaving and minimal inflammatory response.

  16. Early Experience with Biodegradable Fixation of Pediatric Mandibular Fractures.

    PubMed

    Mazeed, Ahmed Salah; Shoeib, Mohammed Abdel-Raheem; Saied, Samia Mohammed Ahmed; Elsherbiny, Ahmed

    2015-09-01

    This clinical study aims to evaluate the stability and efficiency of biodegradable self-reinforced poly-l/dl-lactide (SR-PLDLA) plates and screws for fixation of pediatric mandibular fractures. The study included 12 patients (3-12 years old) with 14 mandibular fractures. They were treated by open reduction and internal fixation by SR-PLDLA plates and screws. Maxillomandibular fixation was maintained for 1?week postoperatively. Clinical follow-up was performed at 1?week, 6 weeks, 3 months, and 12 months postoperatively. Radiographs were done at 1?week, 3 months, and 12 months postoperatively to observe any displacement and fracture healing. All fractures healed both clinically and radiologically. No serious complications were reported in the patients. Normal occlusion was achieved in all cases. Biodegradable osteofixation of mandibular fractures offers a valuable clinical solution for pediatric patients getting the benefit of avoiding secondary surgery to remove plates, decreasing the hospital stay, further painful procedures, and psychological impact. PMID:26269728

  17. Strength analysis of clavicle fracture fixation devices and fixation techniques using finite element analysis with musculoskeletal force input.

    PubMed

    Marie, Cronskär

    2015-08-01

    In the cases, when clavicle fractures are treated with a fixation plate, opinions are divided about the best position of the plate, type of plate and type of screw units. Results from biomechanical studies of clavicle fixation devices are contradictory, probably partly because of simplified and varying load cases used in different studies. The anatomy of the shoulder region is complex, which makes it difficult and expensive to perform realistic experimental tests; hence, reliable simulation is an important complement to experimental tests. In this study, a method for finite element simulations of stresses in the clavicle plate and bone is used, in which muscle and ligament force data are imported from a multibody musculoskeletal model. The stress distribution in two different commercial plates, superior and anterior plating position and fixation including using a lag screw in the fracture gap or not, was compared. Looking at the clavicle fixation from a mechanical point of view, the results indicate that it is a major benefit to use a lag screw to fixate the fracture. The anterior plating position resulted in lower stresses in the plate, and the anatomically shaped plate is more stress resistant and stable than a regular reconstruction plate. PMID:25850983

  18. Contribution of carbon fixed by Rubisco and PEPC to phloem export in the Crassulacean acid metabolism plant Kalanchoe daigremontiana.

    PubMed

    Wild, Birgit; Wanek, Wolfgang; Postl, Wolfgang; Richter, Andreas

    2010-03-01

    Crassulacean acid metabolism (CAM) plants exhibit a complex interplay between CO(2) fixation by phosphoenolpyruvate carboxylase (PEPC) and ribulose-1,5-bisphosphate carboxylase oxygenase (Rubisco), and carbon demand for CAM maintenance and growth. This study investigated the flux of carbon from PEPC and direct Rubisco fixation to different leaf carbon pools and to phloem sap over the diurnal cycle. Concentrations and carbon isotope compositions of starch, soluble sugars, and organic acids were determined in leaves and phloem exudates of Kalanchoë daigremontiana Hamet et Perr., and related to CO(2) fixation by PEPC and Rubisco. Three types of leaf carbon pools could be distinguished. (i) Starch and malate pools were dominant and showed a pattern of reciprocal mobilization and accumulation (85/54 and 13/48 mg C g(-1) DW, respective, at the beginning/end of phase I). The carbon isotope composition of these pools was compatible with predominant PEPC fixation (delta(13)C values of -13 and -11 per thousand for starch and malate compared to -11 per thousand of PEPC fixed carbon). (ii) Isotopic composition (-17 per thousand and -14 per thousand) and concentration of glucose and fructose (2 and 3 mg C g(-1) DW, respectively) were not affected by diurnal metabolism, suggesting a low turnover. (iii) Sucrose (1-3 mg C g(-1) DW), in contrast, exhibited large diurnal changes in delta(13)C values (from -17 per thousand in the evening to -12 per thousand in the morning), which were not matched by net changes in sucrose concentration. This suggests a high sucrose turnover, fed by nocturnal starch degradation and direct Rubisco fixation during the day. A detailed dissection of the carbon fixation and mobilization pattern in K. daigremontiana revealed that direct fixation of Rubisco during the light accounted for 30% of phloem sucrose, but only 15% of fixed carbon, indicating that carbon from direct Rubisco fixation was preferentially used for leaf export. PMID:20159885

  19. Predicting eye fixations with higher-level visual features.

    PubMed

    Liang, Ming; Hu, Xiaolin

    2015-03-01

    Saliency map and object map are the two contrasting hypotheses for the mechanisms utilized by the visual system to guide eye fixations when humans are freely viewing natural images. Most computational studies define saliency as outliers of distributions of low-level features, and propose saliency as an important factor for predicting eye fixations. Psychophysical studies, however, suggest that high-level objects predict eye fixations more accurately and the early saliency only has a minor effect. But this view has been challenged by a study which shows opposite results, suggesting that the role of object-level features needs further investigations. In addition, little is known about the role of intermediate features between the low-level and the object-level features. In this paper, we construct two models based on mid-level and object-level features, respectively, and compare their performances against those based on low-level features. Quantitative evaluation on three benchmark natural image fixation data sets demonstrates that the mid-level model outperforms the state-of-the-art low-level models by a significant margin and the object-level model is inferior to most low-level models. Quantitative evaluation on a video fixation data set demonstrates that both the mid-level and object-level models outperform the state-of-the-art low-level models, and the latter performs better under three out of four standard metrics. When combined together the two proposed models achieve even higher performance. However, incorporating the best low-level model yields negligible improvements on all of the data sets. Taken together, these results indicate that higher level features may be more effective than low-level features for predicting eye fixations on natural images in the free viewing condition. PMID:25622314

  20. EFFECT OF NITROGEN AND METAL ADDITIONS ON NITROGEN FIXATION ACTIVITY IN BIOLOGICAL SOIL CRUSTS

    NASA Astrophysics Data System (ADS)

    Alexander, K.; Lui, D.; Anbar, A. D.; Garcia-Pichel, F.; Hartnett, H. E.

    2009-12-01

    Biological soil crusts (BSCs) are diverse consortia of microorganisms that live in intimate association with soils in arid environments. Also called cryptogamic or microbiotic crusts, these communities can include cyanobacteria, algae, heterotrophic bacteria, fungi, lichens, and mosses. Together, these organisms provide many services to their surrounding ecosystems, including reduction of water runoff, promotion of water infiltration, and prevention of soil erosion. The cyanobacteria and algae also provide fixed carbon (C) to the soil through photosynthesis, and because atmospheric deposition of nitrogen (N) in arid environments is low, the major input of biologically available N comes from cyanobacteria capable of converting nitrogen gas (N2) to ammonium (NH4+). Biological soil crusts are easily destroyed by livestock grazing, motor vehicle travel, and many forms of recreational and agricultural land use. Loss of BSC cover can leave the soil vulnerable to intense erosion that can remove the nutrients necessary to sustain plant and animal life, thus accelerating the process of desertification. In order to preserve existing crusts and encourage the development of new crusts, it is crucial to understand the nutrient requirements of metabolism and growth in these microbial communities. This study investigated the affect of nitrogen and metal additions on N2-fixation activity in cyanobacterially-dominated crusts from the Colorado Plateau near Moab, Utah. Although N2-fixation has been studied in this system before, the affect of nutrient additions on N2-fixation activity has not been documented. The goal of this work was to understand how N and metal supplementation affects crust N metabolism. Three experiments were conducted to observe how N2-fixation activity changed with the addition of N, molybdenum (Mo), and vanadium (V). Molybdenum and vanadium were chosen because they are most commonly found at the active site of the enzyme nitrogenase, the molecule responsible for the biological conversion of N2 to NH4+. The Mo-dependent version of the enzyme is the most efficient, and it is used by the majority of N2-fixing organisms. Elements were added as aqueous solutions of NH4NO3, Na2MoO4, and Na3VO4 respectively. Nitrogen fixation potential was assayed using a modified acetylene reduction technique. Results from the N-addition experiment show that when N is provided, BSC organisms stop N2-fixation activity. This confirms that under natural conditions, the community is limited with respect to N. In general, crusts under Mo-addition fix at higher rates than crusts with no added Mo. This implies that crusts may also be limited with respect to Mo. However, contrary to our expectations, crusts fix at lower rates when V is added as compared to a no-V control. It is possible that this is the result of V-toxicity, or that V competes with the uptake and utilization of available Mo, thus exacerbating Mo-limitation. Experiments are currently underway to investigate how the geochemistry of the soil porewater changes as a result of these nutrient additions.

  1. Transscleral suture fixation following recurrent toric intraocular lens rotation.

    PubMed

    Arjmand, Parnian; Chan, Toby Y B; Ahmed, Iqbal Ike K

    2015-05-01

    We describe a surgical technique of transscleral suture fixation for recurrent rotation of a double-loop hydrophilic acrylic toric intraocular lens (IOL) in the capsular bag. Two 9-0 polypropylene sutures are placed in the proximal and distal angulations of 1 of the IOL haptics through the capsular bag. The clockwise and counterclockwise traction provided by these sutures prevents rotation of the IOL in either direction. This technique can be used in cases of spontaneous postoperative IOL rotation to achieve stabilization. In the case we describe, the IOL remained stable 11 months following transscleral suture fixation at the desired axis. PMID:25956713

  2. Dynamic Distraction External Fixation for Contracture of the Metacarpophalangeal Joint.

    PubMed

    Seigerman, Daniel A; Tan, Virak

    2015-12-01

    Metacarpophalangeal (MP) joint contractures are common after traumatic injury, and can be difficult to manage. After surgical capsulectomy, it remains challenging to maintain motion that was obtained at the time of surgery. Our group uses a novel, prefabricated digital external fixator to provide both distraction, and motion therapy across the MP joint after surgical treatment of MP contracture. The purpose of this technique is to demonstrate the effectiveness of an adjunctive dynamic distraction external fixator for the maintenance of joint motion after surgical treatment of MP contractures of the border digits. PMID:26280472

  3. Iris-Fixated Intraocular Lenses for Ametropia and Aphakia

    PubMed Central

    Simões, Pedro S; Ferreira, Tiago B

    2014-01-01

    Implantation of intraocular lens with Iris-fixation is a safe, efficient and predictable surgical procedure, which empowers the refractive surgeon with singular capabilities. Among their advantages are the reversibility, preservation of accommodation and a broad spectrum of ametropic correction. This lens also appears to be a valid option, with a favorable complication rate, for the treatment of aphakic eyes without capsular support. This article is a review of iris-fixated intraocular lenses and considers their principal indications, complications, and outcomes. PMID:25756061

  4. Analytical calculation of average fixation time in evolutionary graphs

    NASA Astrophysics Data System (ADS)

    Askari, Marziyeh; Samani, Keivan Aghababaei

    2015-10-01

    The ability of a mutant individual to overtake the whole of a population is one of the fundamental problems in evolutionary dynamics. Fixation probability and Average Fixation Time (AFT) are two important parameters to quantify this ability. In this paper we introduce an analytical approach for exact calculation of AFT. Using this method we obtain AFT for two types of evolutionary graphs: cycle graph, as a highly homogeneous graph and star graph, as a highly heterogeneous graph. We use symmetries of these graphs to calculate AFT. Analytical results are confirmed with simulation. We also examine the effect of adding some random edges to each of these structures.

  5. Lateral Mass Fixation in the Subaxial Cervical Spine.

    PubMed

    Kurd, Mark F; Millhouse, Paul W; Schroeder, Gregory D; Kepler, Christopher K; Vaccaro, Alexander R

    2015-08-01

    The use of lateral mass screws and rods in the subaxial spine has become the standard method of fixation for posterior cervical spine fusions. Multiple techniques have been described for the placement of lateral mass screws, including the Magerl, the Anderson, and the An techniques. While these techniques are all slightly different, the overall goal is to obtain solid bony fixation while avoiding the neurovascular structures. The use of lateral mass screws has been shown to be a safe and effective technique for achieving a posterior cervical fusion. PMID:26049972

  6. Stable Isotope Ratios of Carbon and Nitrogen in Suspended Organic Matter: Seasonal and Spatial Dynamics Along the Changjiang (Yangtze River) Transport Pathway

    NASA Astrophysics Data System (ADS)

    Gao, L.; Li, D.

    2014-12-01

    Seven cruises were conducted in the Changjiang (Yangtze River) Estuary and the adjacent western East China Sea (ECS) from 2010 to 2012 to study the seasonal variations of ?13C and ?15N in suspended organic matter. In addition, two cruises in the northeastern ECS in July 2011 and in Tsushima Strait in July 2012 were conducted to evaluate the distribution patterns of these isotopes over the entire Changjiang transport pathway. In summer, the surface ?13C was lowest in the Changjiang Channel, increasing from land to sea, reaching highest values in the central ECS, and then decreasing and remaining relatively constant. In winter, the surface ?13C in the western ECS showed lower values with less variation in general. At most stations, ?13C increased from the sea surface to the seabed, reflecting the degradation of sinking organic matter; however, these trends could be changed in the summer by surface phytoplankton accumulation. Combining data from all the Changjiang Estuary and western ECS cruises revealed that when the suspended particulate matter (SPM) was > 135 mg/L, the ?13C values were fairly constant (-24.5‰ to -20.5‰); when the SPM was < 135 mg/L, the ?13C values showed much greater variability (-28.4‰ to -16.6‰). The surface ?15N also showed generally higher values in the central ECS in summer and lower values in winter. The seasonal variations of ?13C and ?15N were largely attributed to the SPM composition change: i.e., more phytoplankton cells in the summer whereas more resuspended sediment particles were present in winter.

  7. A Novel Fixation System for Acetabular Quadrilateral Plate Fracture: A Comparative Biomechanical Study

    PubMed Central

    Zha, Guo-Chun; Sun, Jun-Ying; Dong, Sheng-Jie; Zhang, Wen; Luo, Zong-Ping

    2015-01-01

    This study aims to assess the biomechanical properties of a novel fixation system (named AFRIF) and to compare it with other five different fixation techniques for quadrilateral plate fractures. This in vitro biomechanical experiment has shown that the multidirectional titanium fixation (MTF) and pelvic brim long screws fixation (PBSF) provided the strongest fixation for quadrilateral plate fracture; the better biomechanical performance of the AFRIF compared with the T-shaped plate fixation (TPF), L-shaped plate fixation (LPF), and H-shaped plate fixation (HPF); AFRIF gives reasonable stability of treatment for quadrilateral plate fracture and may offer a better solution for comminuted quadrilateral plate fractures or free floating medial wall fracture and be reliable in preventing protrusion of femoral head. PMID:25802849

  8. Torsion properties of biological fixation utilizing a plate with and without an intramedullary rod 

    E-print Network

    Keiser, Michael

    1995-01-01

    failure. The research reported here analyzed this biological fixation technique during torsional loading. The strain values on the surface of the plate alone were compared to those of a plate with an intramedullary rod during simulated fracture fixation...

  9. Synchronizing timelines: relations between fixation durations and N400 amplitudes during sentence reading.

    PubMed

    Dambacher, Michael; Kliegl, Reinhold

    2007-06-25

    We examined relations between eye movements (single-fixation durations) and RSVP-based event-related potentials (ERPs; N400s) recorded during reading the same sentences in two independent experiments. Longer fixation durations correlated with larger N400 amplitudes. Word frequency and predictability of the fixated word as well as the predictability of the upcoming word accounted for this covariance in a path-analytic model. Moreover, larger N400 amplitudes entailed longer fixation durations on the next word, a relation accounted for by word frequency. This pattern offers a neurophysiological correlate for the lag-word frequency effect on fixation durations: word processing is reliably expressed not only in fixation durations on currently fixated words, but also in those on subsequently fixated words. PMID:17499223

  10. Carbon concentration variations in the roots, stem and crown of mature Pinus pinaster (Ait.)

    E-print Network

    Bert, Didier

    Carbon concentration variations in the roots, stem and crown of mature Pinus pinaster (Ait.) Didier. Evaluations of carbon fixation and storage in this forest are facilitated by its general homogeneity for expansion factors and carbon concentration in the biomass, and more accurate results could be obtained

  11. Crystal engineering of an nbo topology metal-organic framework for chemical fixation of CO2 under ambient conditions.

    PubMed

    Gao, Wen-Yang; Chen, Yao; Niu, Youhong; Williams, Kia; Cash, Lindsay; Perez, Pastor J; Wojtas, Lukasz; Cai, Jianfeng; Chen, Yu-Sheng; Ma, Shengqian

    2014-03-01

    Crystal engineering of the nbo metal-organic framework (MOF) platform MOF-505 with a custom-designed azamacrocycle ligand (1,4,7,10-tetrazazcyclododecane-N,N',N'',N'''-tetra-p-methylbenzoic acid) leads to a high density of well-oriented Lewis active sites within the cuboctahedral cage in MMCF-2, [Cu2(Cu-tactmb)(H2O)3(NO3)2]. This MOF demonstrates high catalytic activity for the chemical fixation of CO2 into cyclic carbonates at room temperature under 1?atm pressure. PMID:24497432

  12. Metabolic turnover analysis by a combination of in vivo 13C-labelling from 13CO2 and metabolic profiling with CE-MS/MS reveals rate-limiting steps of the C3 photosynthetic pathway in Nicotiana tabacum leaves

    PubMed Central

    Hasunuma, Tomohisa; Harada, Kazuo; Miyazawa, Shin-Ichi; Kondo, Akihiko; Fukusaki, Eiichiro; Miyake, Chikahiro

    2010-01-01

    Understanding of the control of metabolic pathways in plants requires direct measurement of the metabolic turnover rate. Sugar phosphate metabolism, including the Calvin cycle, is the primary pathway in C3 photosynthesis, the dynamic status of which has not been assessed quantitatively in the leaves of higher plants. Since the flux of photosynthetic carbon metabolism is affected by the CO2 fixation rate in leaves, a novel in vivo 13C-labelling system was developed with 13CO2 for the kinetic determination of metabolic turnover that was the time-course of the 13C-labelling ratio in each metabolite. The system is equipped with a gas-exchange chamber that enables real-time monitoring of the CO2 fixation rate and a freeze-clamp that excises a labelled leaf concurrently with quenching the metabolic reactions by liquid nitrogen within the photosynthesis chamber. Kinetic measurements were performed by detecting mass isotopomer abundance with capillary electrophoresis-tandem mass spectrometry. The multiple reaction monitoring method was optimized for the determination of each compound for sensitive detection because the amount of some sugar phosphates in plant cells is extremely small. Our analytical system enabled the in vivo turnover of sugar phosphates to be monitored in fresh tobacco (Nicotiana tabacum) leaves, which revealed that the turnover rate of glucose-1-phosphate (G1P) was significantly lower than that of other sugar phosphates, including glucose-6-phosphate (G6P). The pool size of G1P is 12 times lower than that of G6P. These results indicate that the conversion of G6P to G1P is one of the rate-limiting steps in the sugar phosphate pathway. PMID:20026474

  13. 21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Smooth or threaded metallic bone fixation fastener... SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation...

  14. 21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Smooth or threaded metallic bone fixation fastener... SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation...

  15. 21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Smooth or threaded metallic bone fixation fastener... SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation...

  16. 21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Smooth or threaded metallic bone fixation fastener... SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation...

  17. 21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Smooth or threaded metallic bone fixation fastener... SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3040 Smooth or threaded metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation...

  18. Eye Movement Control during Scene Viewing: Immediate Effects of Scene Luminance on Fixation Durations

    ERIC Educational Resources Information Center

    Henderson, John M.; Nuthmann, Antje; Luke, Steven G.

    2013-01-01

    Recent research on eye movements during scene viewing has primarily focused on where the eyes fixate. But eye fixations also differ in their durations. Here we investigated whether fixation durations in scene viewing are under the direct and immediate control of the current visual input. Subjects freely viewed photographs of scenes in preparation…

  19. Symbiotic nitrogen fixation in legumes Define: the process by which molecular nitrogen (N2) is

    E-print Network

    Constabel, Peter

    Symbiotic nitrogen fixation in legumes Define: the process by which molecular nitrogen (N2 input Why is N fixation important? - net nitrogen input into soil 5-10 % - model system for plant-Rhizobium symbiosis: i) formation of nodules ii) plant-bacterium communication iii) biochemistry of nitrogen fixation

  20. Ethanol-Glycerin Fixation with Thymol Conservation: A Potential Alternative to Formaldehyde and Phenol Embalming

    ERIC Educational Resources Information Center

    Hammer, Niels; Loffler, Sabine; Feja, Christine; Sandrock, Mara; Schmidt, Wolfgang; Bechmann, Ingo; Steinke, Hanno

    2012-01-01

    Anatomical fixation and conservation are required to prevent specimens from undergoing autolysis and decomposition. While fixation is the primary arrest of the structures responsible for autolysis and decomposition, conservation preserves the state of fixation. Although commonly used, formaldehyde has been classified as carcinogenic to humans. For…

  1. 21 CFR 878.3250 - External facial fracture fixation appliance.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false External facial fracture fixation appliance. 878.3250 Section 878.3250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES GENERAL AND PLASTIC SURGERY DEVICES Prosthetic Devices §...

  2. Tracking eye fixations with electroocular and electroencephalographic recordings

    E-print Network

    Gorodnitsky, Irina

    Tracking eye fixations with electroocular and electroencephalographic recordings CARRIE A. JOYCE may find this method a simple and inexpensive means of tracking eye movements and a useful complement. Descriptors: Eye tracking, Electrooculogram, Event-related brain potentials There is ample evidence that much

  3. Depth Estimation during Fixational Head Movements in a Humanoid Robot

    E-print Network

    Rucci, Michele

    are critical in many computer vision tasks, from vi- suomotor control of robots to object recognition are interpreted by means of a kinematic model of the robot to compute the velocity of the camera. The resultingDepth Estimation during Fixational Head Movements in a Humanoid Robot Marco Antonelli1 , Angel P

  4. Sulcus Fixation of Foldable Intraocular Lenses Guided by Ultrasound Biomicroscopy

    PubMed Central

    Gao, Shasha; Qin, Tingyu; Wang, Shengnan; Lu, Yong

    2015-01-01

    Background. To evaluate the clinical efficacy of suture fixation of foldable intraocular lens (IOL) in ciliary sulcus guided by ultrasound biomicroscopy (UBM). Methods. Thirty-five eyes of 32 cases needing suture fixation of foldable IOL in ciliary sulcus in our hospital were collected and divided into two groups: group A and group B. In group A, UBM was performed on 19 eyes of 17 cases before surgery to locate the projection position of ciliary sulcus in iris surface. In group B, the traditional sulcus fixation of IOL was performed on 16 eyes of 15 cases. The inserting position of needles, the haptics position of IOL and the IOL tilt, and decentration were observed by UBM examination 3 months after the surgery. Meanwhile, the vision and contrast sensitivity were analysed. Results. The differences in inserting position of the needle, the IOL tilt and decentration, the ratio of IOL haptics in sulcus, and uncorrected visual acuity were statistically significant (P < 0.05). The differences in best corrected visual acuity (BCVA) and contrast sensitivity were not statistically significant (P > 0.05). Conclusions. Sulcus fixation of foldable IOL aided by UBM can increase the accuracy of IOL haptics implanted into ciliary sulcus and reduce the IOL tilt and decentration. PMID:26413317

  5. Application of magnetic rods for fixation in orthopedic treatments.

    PubMed

    Shelyakova, Tatiana; Russo, Alessandro; Visani, Andrea; Dediu, Valentin Alek; Marcacci, Maurilio

    2015-06-01

    Achieving an efficient fixation for complicated fractures and scaffold application treatments is a challenging surgery problem. Although many fixation approaches have been advanced and actively pursued, the optimal solution for long bone defects has not yet been defined. This paper promotes an innovative fixation method based on application of magnetic forces. The efficiency of this approach was investigated on the basis of finite element modeling for scaffold application and analytical calculations for diaphyseal fractures. Three different configurations have been analyzed including combinations of small cylindrical permanent magnets or stainless steel rods, inserted rigidly in the bone intramedullary canals and in the scaffold. It was shown that attractive forces as high as 75 N can be achieved. While these forces do not reach the strength of mechanical forces in traditional fixators, the employment of magnetic rods is expected to be beneficial by reducing considerably the interface micromotions. It can additionally support magneto-mechanical stimulations as well as enabling a magnetically assisted targeted delivery of drugs and other bio-agents. PMID:25880709

  6. Fixation and Commitment while Designing and Its Measurement

    ERIC Educational Resources Information Center

    Gero, John S.

    2011-01-01

    This paper introduces the notion that fixation and commitment while designing can be measured by studying the protocol of the design session. It is hypothesized that the dynamic entropy of the linkograph of the protocol provides the basis for such a measurement. The hypothesis is empirically tested using a design protocol and the results…

  7. Pulsed lavage improves fixation strength of cemented tibial components.

    PubMed

    Schlegel, Ulf J; Siewe, Jan; Delank, Karl S; Eysel, Peer; Püschel, Klaus; Morlock, Michael M; de Uhlenbrock, Anne Gebert

    2011-08-01

    Pulsatile lavage is purported to improve radiographic survival in cemented total knee arthroplasty (TKA). Similarly, a potential improvement of fixation strength of the tibial tray has been assumed based on the increased cement penetration. In this study, the influence of pulsed lavage on fixation strength of the tibial component and bone cement penetration was evaluated in six pairs of cadaveric specimens. Following surgical preparation, the tibial surface was irrigated using pulsatile lavage on one side of a pair, while on the other side syringe lavage was applied. All tibial components were implanted using the same cementing technique. Cement penetration and bone mineral density was assessed based on computed tomography data. Fixation strength of the tibial trays was determined by a pull-out test with a material testing machine. Median pull-out forces and cement penetration were significantly (p?=?0.031) improved in the pulsed lavage group as compared to the syringe lavage group. Enhanced fixation strength is suggested as being a key to improved survival of the implant. Consequently, pulsatile lavage should be considered as a mandatory preparation step when cementing tibial components in TKA. PMID:20953784

  8. Autistic Symptomatology, Face Processing Abilities, and Eye Fixation Patterns

    ERIC Educational Resources Information Center

    Kirchner, Jennifer C.; Hatri, Alexander; Heekeren, Hauke R.; Dziobek, Isabel

    2011-01-01

    Deviant gaze behavior is a defining characteristic of autism. Its relevance as a pathophysiological mechanism, however, remains unknown. In the present study, we compared eye fixations of 20 adults with autism and 21 controls while they were engaged in taking the Multifaceted Empathy Test (MET). Additional measures of face emotion and identity…

  9. On artifacts appearing in the histochemical fixation of glycogen.

    PubMed

    TAKAHASHI, K; IWASE, S

    1955-09-25

    1. Fixation artifacts associated with glycogen translocation are prevalent in tissues of parenchymatous type and scarce or non-existent in tissues of loose type. 2. Liver tissue treated with M/3 NaOH solution before fixation did not show an uneven distribution of glycogen. This was interpreted as indicating that the liver, a tissue of parenchymatous type, was changed, so to speak, into a loose type of tissue by alkali treatment. 3. The so called Alkohol-flucht of glycogen was produced in Yoshida's ascites tumor cells by a procedure which changed a loose type of tissue into a parenchymatous one, that is, by packing the tumor cells tightly. 4. The translocation of glycogen in cells appeared to occur when the fixatives penetrated the cells rapidly from a single direction, but failed to occur when the cells were attacked by the fixative from all directions. 5. In dried smears of Yoshida's ascites tumor cells and bone marrow cells, the glycogen particles are translocated to the peripheral regions of the cells, and coalesce there. The production of these artifacts is related in some way to the physicochemical properties of the protoplasm and plasma membrane of the cells. PMID:13263328

  10. Suture Bridge Fixation Technique for Posterior Cruciate Ligament Avulsion Fracture

    PubMed Central

    Lee, Kwang Won; Lee, Gyu Sang; Choy, Won Sik

    2015-01-01

    We presented a surgical technique including a suture bridge technique with relatively small incision for the reduction and fixation of posterior ligament avulsion fractures. A suture anchor was used to hold the avulsed fragment and a knotless anchor was used to continuously compress the bony fragment into the fracture site, thereby maintaining reduction during healing. PMID:26640635

  11. Nitrogen fixation potential in global chickpea mini-core collection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Biological nitrogen fixation (BNF) is a sustainable alternative for nitrogen supply to agriculture worldwide. One approach to increasing BNF in agriculture is to breed and use legumes with greater BNF capacity. To assess the capacity for BNF in chickpea (Cicer arietinum) global germplasm, a genetica...

  12. Evolution of Photosynthesis and Biospheric Oxygenation Contingent Upon Nitrogen Fixation?

    E-print Network

    John W. Grula

    2006-05-12

    How photosynthesis by Precambrian cyanobacteria oxygenated Earth's biosphere remains incompletely understood. Here it is argued that the oxic transition, which took place between approximately 2.3 and 0.5 Gyr ago, required a great proliferation of cyanobacteria, and this in turn depended on their ability to fix nitrogen via the nitrogenase enzyme system. However, the ability to fix nitrogen was not a panacea, and the rate of biospheric oxygenation may still have been affected by nitrogen constraints on cyanobacterial expansion. Evidence is presented for why cyanobacteria probably have a great need for fixed nitrogen than other prokaryotes, underscoring the importance of their ability to fix nitrogen. The connection between nitrogen fixation and the evoluti