Sample records for carbon fixation pathways

  1. Improving Carbon Fixation Pathways

    PubMed Central

    Ducat, Daniel C.


    A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that alternative pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials. PMID:22647231

  2. Improving carbon fixation pathways

    SciTech Connect

    Ducat, DC; Silver, PA


    A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that novel pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials.

  3. Design and analysis of synthetic carbon fixation pathways

    PubMed Central

    Bar-Even, Arren; Noor, Elad; Lewis, Nathan E.; Milo, Ron


    Carbon fixation is the process by which CO2 is incorporated into organic compounds. In modern agriculture in which water, light, and nutrients can be abundant, carbon fixation could become a significant growth-limiting factor. Hence, increasing the fixation rate is of major importance in the road toward sustainability in food and energy production. There have been recent attempts to improve the rate and specificity of Rubisco, the carboxylating enzyme operating in the CalvinBenson cycle; however, they have achieved only limited success. Nature employs several alternative carbon fixation pathways, which prompted us to ask whether more efficient novel synthetic cycles could be devised. Using the entire repertoire of approximately 5,000 metabolic enzymes known to occur in nature, we computationally identified alternative carbon fixation pathways that combine existing metabolic building blocks from various organisms. We compared the natural and synthetic pathways based on physicochemical criteria that include kinetics, energetics, and topology. Our study suggests that some of the proposed synthetic pathways could have significant quantitative advantages over their natural counterparts, such as the overall kinetic rate. One such cycle, which is predicted to be two to three times faster than the CalvinBenson cycle, employs the most effective carboxylating enzyme, phosphoenolpyruvate carboxylase, using the core of the naturally evolved C4 cycle. Although implementing such alternative cycles presents daunting challenges related to expression levels, activity, stability, localization, and regulation, we believe our findings suggest exciting avenues of exploration in the grand challenge of enhancing food and renewable fuel production via metabolic engineering and synthetic biology. PMID:20410460

  4. An ancient pathway combining carbon dioxide fixation with the generation and utilization of a sodium ion gradient for ATP synthesis.


    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K; Gottschalk, Gerhard; Müller, Volker


    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  5. Widespread Occurrence of Two Carbon Fixation Pathways in Tubeworm Endosymbionts: Lessons from Hydrothermal Vent Associated Tubeworms from the Mediterranean Sea

    PubMed Central

    Thiel, Vera; Hgler, Michael; Blmel, Martina; Baumann, Heike I.; Grtner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schnberg, Dieter; Petersen, Sven; Cowart, Dominique A.; Fisher, Charles R.; Imhoff, Johannes F.


    Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat. PMID:23248622


    SciTech Connect



    Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO{sub 2} conversion. Recent achievements in the efficiency of solar energy conversion and in catalysis suggest that this approach holds a great deal of promise for contributing to future needs for fuels and chemicals.

  7. Potential role of multiple carbon fixation pathways during lipid accumulation in Phaeodactylum tricornutum

    PubMed Central


    Background Phaeodactylum tricornutum is a unicellular diatom in the class Bacillariophyceae. The full genome has been sequenced (<30?Mb), and approximately 20 to 30% triacylglyceride (TAG) accumulation on a dry cell basis has been reported under different growth conditions. To elucidate P. tricornutum gene expression profiles during nutrient-deprivation and lipid-accumulation, cell cultures were grown with a nitrate to phosphate ratio of 20:1 (N:P) and whole-genome transcripts were monitored over time via RNA-sequence determination. Results The specific Nile Red (NR) fluorescence (NR fluorescence per cell) increased over time; however, the increase in NR fluorescence was initiated before external nitrate was completely exhausted. Exogenous phosphate was depleted before nitrate, and these results indicated that the depletion of exogenous phosphate might be an early trigger for lipid accumulation that is magnified upon nitrate depletion. As expected, many of the genes associated with nitrate and phosphate utilization were up-expressed. The diatom-specific cyclins cyc7 and cyc10 were down-expressed during the nutrient-deplete state, and cyclin B1 was up-expressed during lipid-accumulation after growth cessation. While many of the genes associated with the C3 pathway for photosynthetic carbon reduction were not significantly altered, genes involved in a putative C4 pathway for photosynthetic carbon assimilation were up-expressed as the cells depleted nitrate, phosphate, and exogenous dissolved inorganic carbon (DIC) levels. P. tricornutum has multiple, putative carbonic anhydrases, but only two were significantly up-expressed (2-fold and 4-fold) at the last time point when exogenous DIC levels had increased after the cessation of growth. Alternative pathways that could utilize HCO3- were also suggested by the gene expression profiles (e.g., putative propionyl-CoA and methylmalonyl-CoA decarboxylases). Conclusions The results indicate that P. tricornutum continued carbon dioxide reduction when population growth was arrested and different carbon-concentrating mechanisms were used dependent upon exogenous DIC levels. Based upon overall low gene expression levels for fatty acid synthesis, the results also suggest that the build-up of precursors to the acetyl-CoA carboxylases may play a more significant role in TAG synthesis rather than the actual enzyme levels of acetyl-CoA carboxylases per se. The presented insights into the types and timing of cellular responses to inorganic carbon will help maximize photoautotrophic carbon flow to lipid accumulation. PMID:22672912

  8. Robust Control of PEP Formation Rate in the Carbon Fixation Pathway of C4 Plants by a Bi-functional Enzyme

    PubMed Central


    Background C4 plants such as corn and sugarcane assimilate atmospheric CO2 into biomass by means of the C4 carbon fixation pathway. We asked how PEP formation rate, a key step in the carbon fixation pathway, might work at a precise rate, regulated by light, despite fluctuations in substrate and enzyme levels constituting and regulating this process. Results We present a putative mechanism for robustness in C4 carbon fixation, involving a key enzyme in the pathway, pyruvate orthophosphate dikinase (PPDK), which is regulated by a bifunctional enzyme, Regulatory Protein (RP). The robust mechanism is based on avidity of the bifunctional enzyme RP to its multimeric substrate PPDK, and on a product-inhibition feedback loop that couples the system output to the activity of the bifunctional regulator. The model provides an explanation for several unusual biochemical characteristics of the system and predicts that the system's output, phosphoenolpyruvate (PEP) formation rate, is insensitive to fluctuations in enzyme levels (PPDK and RP), substrate levels (ATP and pyruvate) and the catalytic rate of PPDK, while remaining sensitive to the system's input (light levels). Conclusions The presented PPDK mechanism is a new way to achieve robustness using product inhibition as a feedback loop on a bifunctional regulatory enzyme. This mechanism exhibits robustness to protein and metabolite levels as well as to catalytic rate changes. At the same time, the output of the system remains tuned to input levels. PMID:22024416

  9. Photosynthesis of Grass Species Differing in Carbon Dioxide Fixation Pathways 1

    PubMed Central

    Bouton, Joseph H.; Brown, R. Harold; Bolton, Jacqueline K.; Campagnoli, Raymond P.


    Panicum species of the Laxa group were investigated in a series of published reports and were found to possess C4, C3, and intermediate photosynthetic characteristics. Taxonomic and other relationships among these plants, however, are not clear. It was the objective of this investigation to document chromosome number, metaphase I chromosome behavior, and mode of reproduction, including abnormalities in the embryo sac, for these species. Chromosome counts showed a basic number (x) of 10 and ploidy levels of diploid (2n = 2x = 20), tetraploid (2n = 4x = 40), and hexaploid (2n = 6x = 60) in this group of Panicum. One diploid and one tetraploid accession of the C4 species, Panicum prionitis Griseb., were obtained. Of the intermediate species, Panicum milioides Nees ex Trin. was diploid, Panicum schenckii Hack. was hexaploid, and Panicum decipiens Nees, ex Trin. was found to possess two ploidy levels, one accession being diploid and the other accession being hexaploid. All the C3 species, which included two accessions of Panicum laxum Sw., three accessions of Panicum hylaeicum Mez., and one accession of Panicum rivulare Trin., were tetraploid. Meiosis was regular with primarily bivalent pairing at metaphase I in all species except the tetraploid accession of P. prionitis which possessed from 4 to 10 tetravalents. Stainable pollen was high in all species, ranging from 70 to 99%. Embryo sac analyses showed a single sac in all plants except the tetraploid accession of P. prionitis, which was found to possess an additional sac at anthesis. An additional sac was also observed in some ovaries of the P. schenckii accession. Self-pollinated seed set was high in all accessions except the diploid accession of P. prionitis and one accession of P. laxum where no seed was set under bagged conditions. This information establishes, within the limits of this collection, a base for future studies on genetic, taxonomic, photosynthetic, and evolutionary relationships among these plants. Possession of the same basic chromosome number, regular meiotic pairing, a high degree of stainable pollen, and good seed set in most of the plants studied indicate possible success in making hybrids for a genetic study of photosynthetic pathways in Panicum. Images PMID:16661689

  10. Diurnal variations in pathways of photosynthetic carbon fixation in a freshwater cyanobacterium

    NASA Astrophysics Data System (ADS)

    Labiosa, R. G.; Arrigo, K. R.; Grossman, A.; Reddy, T. E.; Shrager, J.


    Understanding phytoplankton photosynthesis is critical to several fields including ecology and global biogeochemistry. The efficiency with which phytoplankton fix carbon depends upon the ambient light field, which is in turn dependent upon sun angle and the depth of mixing in the water column. In this pilot project, Synechocystis PCC 6803 was chosen as a model organism with which to study the molecular and physiological responses of phytoplankton to diurnal changes in light levels. Advantages of using this organism include that its genome has been sequenced, allowing the use of microarray technology, that it is readily grown as single colonies on plates and in liquid cultures, and that it is easy to manipulate genetically (generate and complement mutants). Axenic cultures of Synechocystis were grown under precisely controlled conditions in a "cyclodyne", a chemostat in which the light intensity cycles to mimic diurnal changes in light level, where the light consisted of sinusoidal daylight (400 ? mol photons m-2 s-1 at noon) followed by 12 hours of darkness for several weeks. After one week to allow the cells to acclimate to the light conditions, the cultures were sampled and extracted for RNA analysis every two hours over the course of several days. At these time points, absorption spectra, light scattering and chlorophyll a concentrations were determined. Initial results from Northern Blot hybridizations (examining RNA levels for individual genes) indicate that, the transcripts encoding photosynthetic proteins (i.e., PsbA2, PsaA and CpcB, in photosystem II, photosystem I, and phycobilisomes, respectively) are highest during the light. Initial results show that in the middle of the night, the psbA2 transcripts are 2-fold less while the psaA and cpcB are greater than 4-fold less than in the middle of the day. For the most part, the transcripts encoding photosynthetic proteins track the light cycle, although with different trends at daybreak and after night falls. Some increase more rapidly following daybreak than others and decrease at different rates after night fall. Early results from microarrays containing the full genome of the organism show that almost all genes display higher transcript abundances during the day (including photosynthetic genes), with a few notable exceptions, and a few others display higher transcript abundance at night than during the day.

  11. Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway

    PubMed Central

    Hawkins, Aaron B.; Adams, Michael W. W.


    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA ?-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula. PMID:24532060

  12. Conversion of 4-hydroxybutyrate to acetyl coenzyme A and its anapleurosis in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate carbon fixation pathway.


    Hawkins, Aaron B; Adams, Michael W W; Kelly, Robert M


    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA ?-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula. PMID:24532060

  13. Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway

    SciTech Connect

    Hawkins, AB; Adams, MWW; Kelly, RM


    The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73 degrees C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA beta-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula.

  14. De Novo Transcriptome Analysis of an Aerial Microalga Trentepohlia jolithus: Pathway Description and Gene Discovery for Carbon Fixation and Carotenoid Biosynthesis

    PubMed Central

    Li, Qianqian; Liu, Jianguo; Zhang, Litao; Liu, Qian


    Background Algae in the order Trentepohliales have a broad geographic distribution and are generally characterized by the presence of abundant β-carotene. The many monographs published to date have mainly focused on their morphology, taxonomy, phylogeny, distribution and reproduction; molecular studies of this order are still rare. High-throughput RNA sequencing (RNA-Seq) technology provides a powerful and efficient method for transcript analysis and gene discovery in Trentepohlia jolithus. Methods/Principal Findings Illumina HiSeq 2000 sequencing generated 55,007,830 Illumina PE raw reads, which were assembled into 41,328 assembled unigenes. Based on NR annotation, 53.28% of the unigenes (22,018) could be assigned to gene ontology classes with 54 subcategories and 161,451 functional terms. A total of 26,217 (63.44%) assembled unigenes were mapped to 128 KEGG pathways. Furthermore, a set of 5,798 SSRs in 5,206 unigenes and 131,478 putative SNPs were identified. Moreover, the fact that all of the C4 photosynthesis genes exist in T. jolithus suggests a complex carbon acquisition and fixation system. Similarities and differences between T. jolithus and other algae in carotenoid biosynthesis are also described in depth. Conclusions/Significance This is the first broad transcriptome survey for T. jolithus, increasing the amount of molecular data available for the class Ulvophyceae. As well as providing resources for functional genomics studies, the functional genes and putative pathways identified here will contribute to a better understanding of carbon fixation and fatty acid and carotenoid biosynthesis in T. jolithus. PMID:25254555

  15. Enzyme Regulation& Catalysis in Carbon Fixation Metabolism

    SciTech Connect

    Henry M. Miziorko


    The overall long term goal of this program is the elucidation of molecular events in carbon assimilation. It has become axiomatic that control of flux through metabolic pathways is effectively imposed at irreversible reactions situated early in those pathways. The current focal point of this project is phosphoribulokinase (PRK), which catalyzes formation of the carbon dioxide acceptor, ribulose 1,5-bisphosphate. This reaction represents an early irreversible step unique to Calvin’s reductive pentose phosphate pathway. Predictably, the PRK reaction represents an important control point in carbon fixation, regulated by a light dependent thiol/disulfide exchange in eukaryotes and by allosteric effectors in prokaryotes. Characterization of naturally occurring mutants as well as gene knockout experiments substantiate the importance of PRK to in vivo control of carbon assimilation in both prokaryotes and eukaryotes. Thus, given the potential impact of enhancement or inhibition of PRK activity on energy (biomass/biofuel) production, elucidation of the molecular events that account for PRK activity is a significant scientific goal.

  16. Computation of metabolic fluxes and efficiencies for biological carbon dioxide fixation.


    Boyle, Nanette R; Morgan, John A


    With rising energy prices and concern over the environmental impact of fossil fuel consumption, the push to develop biomass derived fuels has increased significantly. Although most global carbon fixation occurs via the Calvin Benson Bassham cycle, there are currently five other known pathways for carbon fixation; the goal of this study was to determine the thermodynamic efficiencies of all six carbon fixation pathways for the production of biomass using flux balance analysis. The three chemotrophic pathways, the reductive acetyl-CoA pathway, the 3-hydroxypropionate/4-hydroxybutyrate cycle and the dicarboxylate/4-hydroxybutyrate cycle, were found to be more efficient than photoautotrophic carbon fixation pathways. However, as hydrogen is not freely available, the energetic cost of hydrogen production from sunlight was calculated and included in the overall energy demand, which results in a 5 fold increase in the energy demand of chemoautotrophic carbon fixation. Therefore, when the cost of hydrogen production is included, photoautotrophic pathways are more efficient. However, the energetic cost for the production of 12 metabolic precursors was found to vary widely across the different carbon fixation pathways; therefore, different pathways may be more efficient at producing products from a single precursor than others. The results of this study have significant impact on the selection or design of autotrophic organisms for biofuel or biochemical production. Overall biomass production from solar energy is most efficient in organisms using the reductive TCA cycle, however, products derived from one metabolic precursor may be more efficiently produced using other carbon fixation pathways. PMID:21276868

  17. Distribution of CO(2) fixation and acetate mineralization pathways in microorganisms from extremophilic anaerobic biotopes.


    Montoya, Lilia; Celis, Lourdes B; Razo-Flores, Elas; Alpuche-Sols, Angel G


    Extremophilic anaerobes are widespread in saline, acid, alkaline, and high or low temperature environments. Carbon is essential to living organisms and its fixation, degradation, or mineralization is driven by, up to now, six metabolic pathways. Organisms using these metabolisms are known as autotrophs, acetotrophs or carbon mineralizers, respectively. In anoxic and extreme environments, besides the well-studied Calvin-Benson-Bassham cycle, there are other five carbon fixation pathways responsible of autotrophy. Moreover, regarding carbon mineralization, two pathways perform this key process for carbon cycling. We might imagine that all the pathways can be found evenly distributed in microbial biotopes; however, in extreme environments, this does not occur. This manuscript reviews the most commonly reported anaerobic organisms that fix carbon and mineralize acetate in extreme anoxic habitats. Additionally, an inventory of autotrophic extremophiles by biotope is presented. PMID:23065059

  18. Efficient CO2 Fixation Pathways: Energy Plant: High Efficiency Photosynthetic Organisms

    SciTech Connect


    PETRO Project: UCLA is redesigning the carbon fixation pathways of plants to make them more efficient at capturing the energy in sunlight. Carbon fixation is the key process that plants use to convert carbon dioxide (CO2) from the atmosphere into higher energy molecules (such as sugars) using energy from the sun. UCLA is addressing the inefficiency of the process through an alternative biochemical pathway that uses 50% less energy than the pathway used by all land plants. In addition, instead of producing sugars, UCLA’s designer pathway will produce pyruvate, the precursor of choice for a wide variety of liquid fuels. Theoretically, the new biochemical pathway will allow a plant to capture 200% as much CO2 using the same amount of light. The pathways will first be tested on model photosynthetic organisms and later incorporated into other plants, thus dramatically improving the productivity of both food and fuel crops.

  19. Carbon fixation by basalt-hosted microbial communities.


    Orcutt, Beth N; Sylvan, Jason B; Rogers, Daniel R; Delaney, Jennifer; Lee, Raymond W; Girguis, Peter R


    Oceanic crust is a massive potential habitat for microbial life on Earth, yet our understanding of this ecosystem is limited due to difficulty in access. In particular, measurements of rates of microbial activity are sparse. We used stable carbon isotope incubations of crustal samples, coupled with functional gene analyses, to examine the potential for carbon fixation on oceanic crust. Both seafloor-exposed and subseafloor basalts were recovered from different mid-ocean ridge and hot spot environments (i.e., the Juan de Fuca Ridge, the Mid-Atlantic Ridge, and the Loihi Seamount) and incubated with (13)C-labeled bicarbonate. Seafloor-exposed basalts revealed incorporation of (13)C-label into organic matter over time, though the degree of incorporation was heterogeneous. The incorporation of (13)C into biomass was inconclusive in subseafloor basalts. Translating these measurements into potential rates of carbon fixation indicated that 0.1-10 nmol C g(-1) rock d(-1) could be fixed by seafloor-exposed rocks. When scaled to the global production of oceanic crust, this suggests carbon fixation rates of 10(9)-10(12) g C year(-1), which matches earlier predictions based on thermodynamic calculations. Functional gene analyses indicate that the Calvin cycle is likely the dominant biochemical mechanism for carbon fixation in basalt-hosted biofilms, although the reductive acetyl-CoA pathway and reverse TCA cycle likely play some role in net carbon fixation. These results provide empirical evidence for autotrophy in oceanic crust, suggesting that basalt-hosted autotrophy could be a significant contributor of organic matter in this remote and vast environment. PMID:26441854

  20. Carbon fixation by basalt-hosted microbial communities

    PubMed Central

    Orcutt, Beth N.; Sylvan, Jason B.; Rogers, Daniel R.; Delaney, Jennifer; Lee, Raymond W.; Girguis, Peter R.


    Oceanic crust is a massive potential habitat for microbial life on Earth, yet our understanding of this ecosystem is limited due to difficulty in access. In particular, measurements of rates of microbial activity are sparse. We used stable carbon isotope incubations of crustal samples, coupled with functional gene analyses, to examine the potential for carbon fixation on oceanic crust. Both seafloor-exposed and subseafloor basalts were recovered from different mid-ocean ridge and hot spot environments (i.e., the Juan de Fuca Ridge, the Mid-Atlantic Ridge, and the Loihi Seamount) and incubated with 13C-labeled bicarbonate. Seafloor-exposed basalts revealed incorporation of 13C-label into organic matter over time, though the degree of incorporation was heterogeneous. The incorporation of 13C into biomass was inconclusive in subseafloor basalts. Translating these measurements into potential rates of carbon fixation indicated that 0.1–10 nmol C g-1rock d-1 could be fixed by seafloor-exposed rocks. When scaled to the global production of oceanic crust, this suggests carbon fixation rates of 109–1012 g C year-1, which matches earlier predictions based on thermodynamic calculations. Functional gene analyses indicate that the Calvin cycle is likely the dominant biochemical mechanism for carbon fixation in basalt-hosted biofilms, although the reductive acetyl-CoA pathway and reverse TCA cycle likely play some role in net carbon fixation. These results provide empirical evidence for autotrophy in oceanic crust, suggesting that basalt-hosted autotrophy could be a significant contributor of organic matter in this remote and vast environment. PMID:26441854

  1. Dark Carbon Fixation: An Important Process in Lake Sediments

    PubMed Central

    Santoro, Ana Lcia; Bastviken, David; Gudasz, Cristian; Tranvik, Lars; Enrich-Prast, Alex


    Close to redox boundaries, dark carbon fixation by chemoautotrophic bacteria may be a large contributor to overall carbon fixation. Still, little is known about the relative importance of this process in lake systems, in spite the potentially high chemoautotrophic potential of lake sediments. We compared rates of dark carbon fixation, bacterial production and oxygen consumption in sediments from four Swedish boreal and seven tropical Brazilian lakes. Rates were highly variable and dark carbon fixation amounted up to 80% of the total heterotrophic bacterial production. The results indicate that non-photosynthetic carbon fixation can represent a substantial contribution to bacterial biomass production, especially in sediments with low organic matter content. PMID:23776549

  2. Carbon Cycling: Molecular Regulation of Photosynthetic Carbon Fixation




    Photosynthetic carbon fixation by phytoplankton is a key component of the global carbon cycle. Our understanding of the types of picoplankton and ultraphytoplankton involved in this process is evolving. However, mechanisms of regulation of photosynthetic carbon fixation in the oceans are poorly understood. All phytoplankton fix CO2 by reductive carboxylation employing the enzyme ribulose bisphosphate carboxylase (RuBPCase). The sequence of the gene encoding the large subunit of the enzyme (rbcL) has been relatively conserved, with two major evolutionary groups among oxygenic photoautrotrophs: the cyanobacteria/green algae/higher plants and the chromophytic algae. Gene probes made from representative members of these groups have been used to study the transcriptional regulation of RuBPCase in natural phytoplankton populations. Levels of rbcL mRNA correlated with rates of photosynthetic carbon fixation. A diel pattern in both carbon fixation and levels of rbcL mRNA was observed, with greatest values for both during daylight hours. This data supports transcriptional regulation as a major mechanism for regulation of carbon fixation in the oceans. This approach can be used to measure expression of conserved genes encoding other important geochemical functions. PMID:8849420

  3. Channeling of carbon monoxide during anaerobic carbon dioxide fixation.


    Seravalli, J; Ragsdale, S W


    Carbon monoxide is an intermediate in carbon dioxide fixation by diverse microbes that inhabit anaerobic environments including the human colon. These organisms fix CO(2) by the Wood-Ljungdahl pathway of acetyl-CoA biosynthesis. The bifunctional CO dehydrogenase/acetyl-CoA synthase (CODH/ACS) catalyzes several key steps in this pathway. CO(2) is reduced to CO at a nickel iron-sulfur cluster called cluster C located in the CODH subunit. Then, CO is condensed with a methyl group and coenzyme A at cluster A, another nickel iron-sulfur cluster in the ACS subunit. Spectroscopic studies indicate that clusters A and C are at least 10-15 A apart. To gain a better understanding of how CO production and utilization are coordinated, we have studied an isotopic exchange reaction between labeled CO(2) and the carbonyl group of acetyl-CoA with the CODH/ACS from Clostridium thermoaceticum. When solution CO is provided at saturating levels, only CO(2)-derived CO is incorporated into the carbonyl group of acetyl-CoA. Furthermore, when high levels of hemoglobin or myoglobin are added to remove CO from solution, there is only partial inhibition of the incorporation of CO(2)-derived CO into acetyl-CoA. These results provide strong evidence for the existence of a CO channel between cluster C in the CODH subunit and cluster A in the ACS subunit. The existence of such a channel would tightly couple CO production and utilization and help explain why high levels of this toxic gas do not escape into the environment. Instead, microbes sequester this energy-rich carbon source for metabolic reactions. PMID:10684606

  4. Further studies on a new pathway of photosynthetic carbon dioxide fixation in sugar-cane and its occurrence in other plant species

    PubMed Central

    Hatch, M. D.; Slack, C. R.; Johnson, Hilary S.


    1. The pathway of photosynthesis in sugar-cane, which gives most of the radio-activity fixed during short periods in 14CO2 in C-4 of oxaloacetate, malate and aspartate, was examined under varied conditions. 2. The pattern of labelling was essentially the same with leaves of different ages and with leaves equilibrated at carbon dioxide concentrations in the range 038% (v/v) and light-intensities in the range 14009000ft.-candles before adding 14CO2. 3. Radioactive products were examined after exposing leaves of 33 different plant species to 14CO2 for 4sec. under standard conditions. 4. A labelling pattern typical of sugar-cane was found in several species of Gramineae but not in others. Of 16 species from other Families only a species of Cyperaceae contained a large proportion of the fixed radioactivity in oxaloacetate, malate and aspartate. PMID:6029601

  5. Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation.


    Könneke, Martin; Schubert, Daniel M; Brown, Philip C; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J; Stahl, David A; Berg, Ivan A


    Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

  6. Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation

    PubMed Central

    Knneke, Martin; Schubert, Daniel M.; Brown, Philip C.; Hgler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J.; Stahl, David A.; Berg, Ivan A.


    Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

  7. Acetogenesis and the Wood-Ljungdahl Pathway of CO2 Fixation

    PubMed Central

    Ragsdale, Stephen W.; Pierce, Elizabeth


    I. Summary Conceptually, the simplest way to synthesize an organic molecule is to construct it one carbon at a time. The Wood-Ljungdahl pathway of CO2 fixation involves this type of stepwise process. The biochemical events that underlie the condensation of two one-carbon units to form the two-carbon compound, acetate, have intrigued chemists, biochemists, and microbiologists for many decades. We begin this review with a description of the biology of acetogenesis. Then, we provide a short history of the important discoveries that have led to the identification of the key components and steps of this usual mechanism of CO and CO2 fixation. In this historical perspective, we have included reflections that hopefully will sketch the landscape of the controversies, hypotheses, and opinions that led to the key experiments and discoveries. We then describe the properties of the genes and enzymes involved in the pathway and conclude with a section describing some major questions that remain unanswered. PMID:18801467

  8. A carbon sink pathway increases carbon productivity in cyanobacteria.


    Oliver, John W K; Atsumi, Shota


    The burning of fossil reserves, and subsequent release of carbon into the atmosphere is depleting the supply of carbon-based molecules used for synthetic materials including plastics, oils, medicines, and glues. To provide for future society, innovations are needed for the conversion of waste carbon (CO2) into organic carbon useful for materials. Chemical production directly from photosynthesis is a nascent technology, with great promise for capture of CO2 using sunlight. To improve low yields, it has been proposed that photosynthetic capacity can be increased by a relaxation of bottlenecks inherent to growth. The limits of carbon partitioning away from growth within the cell and the effect of partitioning on carbon fixation are not well known. Here we show that expressing genes in a pathway between carbon fixation and pyruvate increases partitioning to 2,3-butanediol (23BD) and leads to a 1.8-fold increase in total carbon yield in the cyanobacterium Synechococcus elongatus PCC 7942. Specific 2,3-butanediol production increases 2.4-fold. As partitioning increases beyond 30%, it leads to a steep decline in total carbon yield. The data suggests a local maximum for carbon partitioning from the Calvin Benson cycle that is scalable with light intensity. PMID:25777135

  9. Carbon Dioxide Fixation in Soybean Roots and Nodules

    PubMed Central

    Coker, George T.; Schubert, Karel R.


    These studies demonstrate that soybean (Merr) roots and nodules possess an active system for fixing CO2. The maximum rates of CO2 fixation observed for roots and nodules of intact plants were 120 and 110 nanomoles CO2 fixed per milligram dry weight per hour, respectively. Results of labeling studies suggest a primary role for phosphoenolpyruvate carboxylase in CO2 assimilation in these tissues. After pulse-labeling with 14CO2 for 2 minutes, 70% of the total radioactivity was lost within 18 minutes via respiration and/or translocation out of nodules. During the vegetative stages of growth of soybeans grown symbiotically, CO2 fixation in nodules increased at the onset of N2 fixation but declined to a lower level prior to the decrease in N2 fixation. This decrease coincided with a decrease in the transport of amino acids, especially asparagine, and an increase in the export of ureides. These findings are consistent with a dual role for CO2 fixation, providing substrates for energy-yielding metabolism and supplying carbon skeletons for NH4+ assimilation and amino acid biosynthesis. PMID:16661737

  10. Optimization of inorganic carbon sources to improve the carbon fixation efficiency of the non-photosynthetic microbial community with different electron donors.


    Wang, Ya-nan; Wang, Lei; Shan, Yi-na; Hu, Jiajun; Tsang, Yiufai; Hu, Yu; Fu, Xiaohua; Le, Yiquan


    As the non-photosynthetic microbial community (NPMC) isolated from seawaters utilized inorganic carbon sources for carbon fixation, the concentrations and ratios of Na2CO3, NaHCO3, and CO2 were optimized by response surface methodology design. With H2 as the electron donor, the optimal carbon sources were 270?mg/L Na2CO3, 580?mg/L NaHCO3, and 120?mg/L CO2. The carbon fixation efficiency in response to total organic carbon (TOC) was up to 30.59?mg/L with optimal carbon sources, which was about 50% higher than that obtained with CO2 as the sole carbon source. The mixture of inorganic carbon sources developed a buffer system to prevent acidification or alkalization of the medium caused by CO2 or Na2CO3, respectively. Furthermore, CO2 and HCO3(-), the starting points of carbon fixation in the pathways of Calvin-Benson-Bassham and 3-hydroxypropionate cycles, were provided by the carbon source structure to facilitate carbon fixation by NPMC. However, in the presence of mixed electron donors composed of 1.25% Na2S, 0.50% Na2S2O3, and 0.457% NaNO2, the carbon source structure did not exhibit significant improvement in the carbon fixation efficiency, when compared with that achieved with CO2 as the sole carbon source. The positive effect of mixed electron donors on inorganic carbon fixation was much higher than that of the carbon source structure. Nevertheless, the carbon source structure could be used as an alternative to CO2 when using NPMC to fix carbon in industrial processes. PMID:25367398

  11. Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park

    SciTech Connect

    Jennings, Ryan; Whitmore, Laura M.; Moran, James J.; Kreuzer, Helen W.; Inskeep, William P.


    The fixation of inorganic carbon (as carbon dioxide) has been documented in all three domains of life and results in the biosynthesis of a diverse suite of organic compounds that support the growth of heterotrophic organisms. The primary aim of this study was to assess the importance of carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of one of the dominant Fe(II)-oxidizing organisms (Metallosphaera yellowstonensis strain MK1) present in situ. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon fixation pathway were identified in pure-cultures of M. yellowstonensis strain MK1. Metagenome sequencing from the same environments also revealed genes for the 3-HP/4-HB pathway belonging to M. yellowstonensis populations, as well as genes for a complete reductive TCA cycle from Hydrogenobaculum spp. (Aquificales). Stable isotope (13CO2) labeling was used to measure the fixation of CO2 by M. yellowstonensis strain MK1, and in ex situ assays containing live Fe(III)-oxide microbial mats. Results showed that M. yellowstonensis strain MK1 fixes CO2 via the 3-HP/4-HB pathway with a fractionation factor of ~ 2.5 ‰. Direct analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C and microbial mat C showed that mat C is comprised of both DIC and non-DIC sources. The estimated contribution of DIC carbon to biomass C (> ~ 35%) is reasonably consistent with the relative abundance of known chemolithoautotrophs and corresponding CO2 fixation pathways detected in metagenome sequence. The significance of DIC as a major source of carbon for Fe-oxide mat communities provides a foundation for examining microbial interactions in these systems that are dependent on the activity of autotrophic organisms such as Hydrogenobaculum and Metallosphaera spp.

  12. Phytoplankton plasticity drives large variability in carbon fixation efficiency

    NASA Astrophysics Data System (ADS)

    Ayata, Sakina-Dorothée.; Lévy, Marina; Aumont, Olivier; Resplandy, Laure; Tagliabue, Alessandro; Sciandra, Antoine; Bernard, Olivier


    Phytoplankton C:N stoichiometry is highly flexible due to physiological plasticity, which could lead to high variations in carbon fixation efficiency (carbon consumption relative to nitrogen). However, the magnitude, as well as the spatial and temporal scales of variability, remains poorly constrained. We used a high-resolution biogeochemical model resolving various scales from small to high, spatially and temporally, in order to quantify and better understand this variability. We find that phytoplankton C:N ratio is highly variable at all spatial and temporal scales (5-12 molC/molN), from mesoscale to regional scale, and is mainly driven by nitrogen supply. Carbon fixation efficiency varies accordingly at all scales (±30%), with higher values under oligotrophic conditions and lower values under eutrophic conditions. Hence, phytoplankton plasticity may act as a buffer by attenuating carbon sequestration variability. Our results have implications for in situ estimations of C:N ratios and for future predictions under high CO2 world.

  13. Isocyanate- and phosgene-free routes to polyfunctional cyclic carbonates and green polyurethanes by fixation of carbon dioxide.


    Blattmann, Hannes; Fleischer, Maria; Bähr, Moritz; Mülhaupt, Rolf


    The catalytic chemical fixation of carbon dioxide by carbonation of oxiranes, oxetanes, and polyols represents a very versatile green chemistry route to environmentally benign di- and polyfunctional cyclic carbonates as intermediates for the formation of non-isocyanate poly-urethane (NIPU). Two synthetic pathways lead to NIPU thermoplastics and thermosets: i) polycondensation of diacarbamates or acyclic dicarbonates with diols or diamines, respectively, and ii) polyaddition by ring-opening polymerization of di- and polyfunctional cyclic carbonates with di- and polyamines. The absence of hazardous and highly moisture-sensitive isocyanates as intermediates eliminates the need for special safety precautions, drying and handling procedures. Incorporated into polymer backbones and side chains, carbonate groups enable facile tailoring of a great variety of urethane-functional polymers. As compared with conventional polyurethanes, ring-opening polymerization of polyfunctional cyclic carbonates affords polyhydroxyurethanes with unconventional architectures including NIPUs containing carbohydrate segments. NIPU/epoxy hybrid coatings can be applied on wet surfaces and exhibit improved adhesion, thermal stability and wear resistance. Combining chemical with biological carbon dioxide fixation affords 100% bio-based NIPUs derived from plant oils, terpenes, carbohydrates, and bio polyols. Biocompatible and biodegradable NIPU as well as NIPU biocomposites hold great promise for biomedical applications. PMID:24979310

  14. Molecular Regulation of Photosynthetic Carbon Dioxide Fixation in Nonsulfur Purple Bacteria

    SciTech Connect

    Tabita, Fred Robert


    The overall objective of this project is to determine the mechanism by which a transcriptional activator protein affects CO2 fixation (cbb) gene expression in nonsulfur purple photosynthetic bacteria, with special emphasis to Rhodobacter sphaeroides and with comparison to Rhodopseudomonas palustris. These studies culminated in several publications which indicated that additional regulators interact with the master regulator CbbR in both R. sphaeroides and R. palustris. In addition, the interactive control of the carbon and nitrogen assimilatory pathways was studied and unique regulatory signals were discovered.

  15. A "footprint" of plant carbon fixation cycle functions during the development of a heterotrophic fungus.


    Lyu, Xueliang; Shen, Cuicui; Xie, Jiatao; Fu, Yanping; Jiang, Daohong; Hu, Zijin; Tang, Lihua; Tang, Liguang; Ding, Feng; Li, Kunfei; Wu, Song; Hu, Yanping; Luo, Lilian; Li, Yuanhao; Wang, Qihua; Li, Guoqing; Cheng, Jiasen


    Carbon fixation pathway of plants (CFPP) in photosynthesis converts solar energy to biomass, bio-products and biofuel. Intriguingly, a large number of heterotrophic fungi also possess enzymes functionally associated with CFPP, raising the questions about their roles in fungal development and in evolution. Here, we report on the presence of 17 CFPP associated enzymes (ten in Calvin-Benson-Basham reductive pentose phosphate pathway and seven in C4-dicarboxylic acid cycle) in the genome of Sclerotinia sclerotiorum, a heterotrophic phytopathogenic fungus, and only two unique enzymes: ribulose-1, 5-bisphosphate carboxylase-oxygenase (Rubisco) and phosphoribulokinase (PRK) were absent. This data suggested an incomplete CFPP-like pathway (CLP) in fungi. Functional profile analysis demonstrated that the activity of the incomplete CLP was dramatically regulated during different developmental stages of S. sclerotiorum. Subsequent experiments confirmed that many of them were essential to the virulence and/or sclerotial formation. Most of the CLP associated genes are conserved in fungi. Phylogenetic analysis showed that many of them have undergone gene duplication, gene acquisition or loss and functional diversification in evolutionary history. These findings showed an evolutionary links in the carbon fixation processes of autotrophs and heterotrophs and implicated the functions of related genes were in course of continuous change in different organisms in evolution. PMID:26263551

  16. In-situ carbon dioxide fixation on Mars

    NASA Technical Reports Server (NTRS)

    Hepp, Aloysius F.; Landis, Geoffrey A.; Kubiak, Clifford P.


    The authors examine several novel proposals for CO2 fixation through chemical, photochemical, and photoelectrochemical means. For example, the reduction of CO2 to hydrocarbons such as acetylene (C2H2) can be accomplished with hydrogen. Acetylene has a theoretical vacuum specific impulse of about 375 s. The authors also examine potential uses of CO, as obtained or further reduced to carbon, as a reducing agent in metal oxide processing to form metals or metal carbides for use as structural or power materials. The CO2 can be recycled to generate O2 and CO. In this study, the authors examine reaction schemes for processing in situ resources. The authors highlight chemistry with hydrogen and carbon monoxide to produce propellants and other necessities of manned exploration.

  17. Bioengineering of carbon fixation, biofuels, and biochemicals in cyanobacteria and plants.


    Rosgaard, Lisa; de Porcellinis, Alice Jara; Jacobsen, Jacob H; Frigaard, Niels-Ulrik; Sakuragi, Yumiko


    Development of sustainable energy is a pivotal step towards solutions for today's global challenges, including mitigating the progression of climate change and reducing dependence on fossil fuels. Biofuels derived from agricultural crops have already been commercialized. However the impacts on environmental sustainability and food supply have raised ethical questions about the current practices. Cyanobacteria have attracted interest as an alternative means for sustainable energy productions. Being aquatic photoautotrophs they can be cultivated in non-arable lands and do not compete for land for food production. Their rich genetic resources offer means to engineer metabolic pathways for synthesis of valuable bio-based products. Currently the major obstacle in industrial-scale exploitation of cyanobacteria as the economically sustainable production hosts is low yields. Much effort has been made to improve the carbon fixation and manipulating the carbon allocation in cyanobacteria and their evolutionary photosynthetic relatives, algae and plants. This review aims at providing an overview of the recent progress in the bioengineering of carbon fixation and allocation in cyanobacteria; wherever relevant, the progress made in plants and algae is also discussed as an inspiration for future application in cyanobacteria. PMID:22677697

  18. Carbohydrate Metabolism and Carbon Fixation in Roseobacter denitrificans OCh114

    PubMed Central

    Tang, Kuo-Hsiang; Feng, Xueyang; Tang, Yinjie J.; Blankenship, Robert E.


    The Roseobacter clade of aerobic marine proteobacteria, which compose 1025% of the total marine bacterial community, has been reported to fix CO2, although it has not been determined what pathway is involved. In this study, we report the first metabolic studies on carbohydrate utilization, CO2 assimilation, and amino acid biosynthesis in the phototrophic Roseobacter clade bacterium Roseobacter denitrificans OCh114. We develop a new minimal medium containing defined carbon source(s), in which the requirements of yeast extract reported previously for the growth of R. denitrificans can be replaced by vitamin B12 (cyanocobalamin). Tracer experiments were carried out in R. denitrificans grown in a newly developed minimal medium containing isotopically labeled pyruvate, glucose or bicarbonate as a single carbon source or in combination. Through measurements of 13C-isotopomer labeling patterns in protein-derived amino acids, gene expression profiles, and enzymatic activity assays, we report that: (1) R. denitrificans uses the anaplerotic pathways mainly via the malic enzyme to fix 1015% of protein carbon from CO2; (2) R. denitrificans employs the Entner-Doudoroff (ED) pathway for carbohydrate metabolism and the non-oxidative pentose phosphate pathway for the biosynthesis of histidine, ATP, and coenzymes; (3) the Embden-Meyerhof-Parnas (EMP, glycolysis) pathway is not active and the enzymatic activity of 6-phosphofructokinase (PFK) cannot be detected in R. denitrificans; and (4) isoleucine can be synthesized from both threonine-dependent (20% total flux) and citramalate-dependent (80% total flux) pathways using pyruvate as the sole carbon source. PMID:19794911

  19. Recovering of carbon fixation in a eucalyptus site after felling

    NASA Astrophysics Data System (ADS)

    Rodrigues, A. M.; Pita, G. P. A.; Mateus, A.; Santos Pereira, J.


    Espirra site (38°38'N,8°36'W) is located in a 300ha Eucalyptus globulus plantation, with a Mediterranean type climate with a mean annual precipitation of 709mm and a mean annual air temperature of 15.9°C. The plantation was established in 1986 with about 1100 trees ha-1. A 33m observation tower was installed in 2002, with an ultrasonic Gill anemometer R2, an open path analyzer IRGA LI-7500 and a microclimate unit at its top. A harvesting of trees was made at the end of the 2nd rotation period, from November to December 2006. During the last four years of the second rotation the coppice were 20m height. Harvesting was planned in order to initiate a new 12 year productive cycle. In October 2008 a first thinning was made in three fourths of emerging stems from stumps. At this stage the forest trees had a mean height of 6m. For the 2002-2006 period, mean annual values of carbon net ecosystem exchange (NEE), gross production(GPP) and ecosystem respiration(Reco) were -533.3 gCm-2, 1628.6 gCm-2 and 1095.2 gCm-2. Seasonal patterns of carbon fixation for the five years showed a decrease in July-August periods due to highest air temperatures, atmospheric water vapour deficits and stomata partial closure to prevent water transpiration losses. For the period 2002-2006, the dry year of 2005 with a precipitation of about 390 mm, corresponded to the smaller carbon fixation of 390 gCm-2. Similarly, values of Reco, GPP and estimated leaf area index (less than three) were also minimal in 2005. Water use efficiency, WUE (ratio GPP/precipitation) was maximum in summer periods and in driest years, reaching values of about 12g/L-1. Recovery of carbon sink capacity, after the felling, begun after August 2007. The 2007 and 2008 annual NEE values were respectively 105.8 gCm-2 and -35.78 gCm-2. This negative value of NEE for 2008 is indicative of a carbon sink recovery. Annual Reco values for 2007 and 2008 were respectively 1059.03 gCm-2 and 1148.21 gCm-2. For GPP the annual values of 2007 and 2008 were respectively 953.24 gCm-2 and 1148.10 gCm-2. After the felling, stems rapidly grew and monthly GPP increased from 32 gCm-2 to 114 gCm-2 from January to October 2007. In November and December 2007, GPP decreased as a consequence of less solar radiation and frost in the young plants. In 2008 monthly GPP increased again till September. In the last three months of 2008, GPP diminished as a consequence of lack of water loss by evapotranspiration and the thinning. The results showed a chronological tendency for carbon fixation of the eucalyptus site according to physiological status of plants, concerning age and physical environmental factors.

  20. Photosynthetic Carbon Fixation in Guard Cell Protoplasts of Vicia faba L. 1

    PubMed Central

    Gotow, Kiyoshi; Taylor, Scott; Zeiger, Eduardo


    Photosynthetic carbon fixation in guard cells was reexamined in experiments with highly purified guard cell protoplasts from Vicia faba L. irradiated with red light. The fate of 14CO2 (4.8 microcuries of NaHCO3; final concentration: 100 micromolar) supplied to these preparations was investigated with two-dimensional paper, and thin layer chromatography. Rates of CO2 fixation were 5- to 8-fold higher in the light than in darkness. Separation of acid-stable products into water-insoluble, neutral, and anionic fractions showed that more radioactivity was incorporated into the neutral fraction in the light than in the dark. In the dark, malate and aspartate comprised 90% of the radiolabel found in the anionic fraction, whereas in the light, radioactivity was also found in 3-phosphoglyceric acid (PGA), sugar monophosphates, sugar diphosphates, and triose phosphates. Phosphorylated compounds contained up to 60% of the label in the light-treated anionic fraction. Phosphatase treatment and rechromatography of labeled sugar diphosphate showed the presence of ribulose, a specific metabolite of the photosynthetic carbon reduction pathway (PCRP). In time-course experiments, labeled PGA was detected within 5 seconds. With time, the percentage of label in PGA decreased and that in sugar monophosphate increased. We conclude that PGA is a primary carboxylation product of the PCRP in guard cells and that the activity of the PCRP, and phosphoenolpyruvate-carboxylase is metabolically regulated. PMID:16665973

  1. CbbR, the Master Regulator for Microbial Carbon Dioxide Fixation.


    Dangel, Andrew W; Tabita, F Robert


    Biological carbon dioxide fixation is an essential and crucial process catalyzed by both prokaryotic and eukaryotic organisms to allow ubiquitous atmospheric CO2 to be reduced to usable forms of organic carbon. This process, especially the Calvin-Bassham-Benson (CBB) pathway of CO2 fixation, provides the bulk of organic carbon found on earth. The enzyme ribulose 1,5-bisphosphate (RuBP) carboxylase/oxygenase (RubisCO) performs the key and rate-limiting step whereby CO2 is reduced and incorporated into a precursor organic metabolite. This is a highly regulated process in diverse organisms, with the expression of genes that comprise the CBB pathway (the cbb genes), including RubisCO, specifically controlled by the master transcriptional regulator protein CbbR. Many organisms have two or more cbb operons that either are regulated by a single CbbR or employ a specific CbbR for each cbb operon. CbbR family members are versatile and accommodate and bind many different effector metabolites that influence CbbR's ability to control cbb transcription. Moreover, two members of the CbbR family are further posttranslationally modified via interactions with other transcriptional regulator proteins from two-component regulatory systems, thus augmenting CbbR-dependent control and optimizing expression of specific cbb operons. In addition to interactions with small effector metabolites and other regulator proteins, CbbR proteins may be selected that are constitutively active and, in some instances, elevate the level of cbb expression relative to wild-type CbbR. Optimizing CbbR-dependent control is an important consideration for potentially using microbes to convert CO2 to useful bioproducts. PMID:26324454

  2. Diffusional Contribution to Carbon Isotope Fractionation during Dark CO2 Fixation in CAM Plants 1

    PubMed Central

    O'Leary, Marion H.; Osmond, C. Barry


    A mathematical model is developed which can be used to predict in vivo carbon isotope fractionations associated with carbon fixation in plants in terms of diffusion, CO2 hydration, and carboxylation components. This model also permits calculation of internal CO2 concentration for comparison with results of gas-exchange experiments. The isotope fractionations associated with carbon fixation in Kalancho daigremontiana and Bryophyllum tubiflorum have been measured by isolation of malic acid following dark fixation and enzymic determination of the isotopic composition of carbon-4 of this material. Corrections are made for residual malic acid, fumarase activity, and respiration. Comparison of these data with calculations from the model indicates that the rate of carbon fixation is limited principally by diffusion, rather than by carboxylation. Processes subsequent to the initial carboxylation also contribute to the over-all isotopic composition of the plant. PMID:16661555

  3. Carbon dioxide fixation and lipid storage by Scenedesmus obtusiusculus.


    Toledo-Cervantes, Alma; Morales, Marcia; Novelo, Eberto; Revah, Sergio


    An indigenous microalga was isolated from the springs in Cuatro Ciénegas, México. It was morphologically identified as Scenedesmus obtusiusculus and cultivated in bubble-column photobioreactors in batch operation mode. This microalga grows at 10% of carbon dioxide (CO(2)) showing a maximum CO(2) fixation rate of 970gm(-3)d(-1). The microalga, without any nutrient limitation, contained 20% of nonpolar lipids with a biomass productivity of 500gm(-3)d(-1) and a maximum biomass concentration of around 6,000gm(-3) at 5% CO(2) and irradiance of 134μmolm(-2)s(-1). Furthermore, it was observed that the microalga stored 55.7% of nonpolar lipids when 5% CO(2) was fed at 0.8vvm and 54.7μmolm(-2)s(-1) under nitrogen starvation. The lipid profile included C16:0, C18:0, C18:1n9t, C18:1n9c, C18:3n6 with a productivity of 200g lipid m(-3)d(-1). Therefore, the microalga may have biotechnological potential producing lipids for biodiesel. PMID:23334023

  4. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge.


    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide


    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2-0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology. PMID:26439402

  5. A Simple Demonstration of Carbon Dioxide Fixation and Acid Production in CAM Plants

    ERIC Educational Resources Information Center

    Walker, John R. L.; McWha, James A.


    Described is an experiment investigating carbon dioxide fixation in the dark and the diurnal rhythm of acid production in plants exhibiting Crassulacean Acid Metabolism. Included are suggestions for four further investigations. (SL)

  6. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge

    PubMed Central

    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide


    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2−0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology. PMID:26439402

  7. Facile Carbon Fixation to Performic Acids by Water-Sealed Dielectric Barrier Discharge

    NASA Astrophysics Data System (ADS)

    Kawasaki, Mitsuo; Morita, Tatsuo; Tachibana, Kunihide


    Carbon fixation refers to the conversion of carbon dioxide (CO2) to organic materials, as commonly performed in nature through photosynthesis by plants and other autotrophic organisms. The creation of artificial carbon fixation processes is one of the greatest challenges for chemistry to solve the critical environmental issue concerning the reduction of CO2 emissions. We have developed an electricity-driven facile CO2 fixation process that yields performic acid, HCO2OH, from CO2 and water at neutral pH by dielectric barrier discharge with an input electric power conversion efficiency of currently 0.2-0.4%. This method offers a promising future technology for artificial carbon fixation on its own, and may also be scaled up in combination with e.g., the post-combustion CO2 capture and storage technology.

  8. Carbon Dioxide Fixation by Metallosphaera yellowstonensis and Acidothermophilic Iron-Oxidizing Microbial Communities from Yellowstone National Park

    PubMed Central

    Jennings, Ryan M.; Whitmore, Laura M.; Moran, James J.


    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope (13CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ∼2.5‰. Analysis of the 13C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  9. Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park.


    Jennings, Ryan M; Whitmore, Laura M; Moran, James J; Kreuzer, Helen W; Inskeep, William P


    The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope ((13)CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ∼2.5‰. Analysis of the (13)C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

  10. Model of carbon fixation in microbial mats from 3,500 Myr ago to the present.


    Rothschild, L J; Mancinelli, R L


    Biological carbon fixation is an important part of global carbon cycling and ecology. Fixation that took place 3,500 million years ago is recorded in the laminated sedimentary rock structures known as stromatolites, which are fossilized remains of microbial mat communities. Stromatolites are the most abundant type of fossil found in the Proterozoic (2,500 to 590 Myr ago), but they then declined, possibly because of predation and competition. Using modern microbial mats as analogues for ancient stromatolites, we show that the rate of carbon fixation is higher at the greater levels of atmospheric CO2 that were probably present in the past. We suggest that carbon fixation in microbial mats was not carbon-limited during the early Precambrian, but became carbon-limited as the supply of inorganic carbon decreased. Carbon limitation led to a lower rate of carbon fixation, especially towards the end of the Precambrian. Thus, another reason for the decline of the stromatolites could have been a decrease in available CO2. PMID:11536465

  11. Computational protein design enables a novel one-carbon assimilation pathway

    PubMed Central

    Siegel, Justin B.; Smith, Amanda Lee; Poust, Sean; Wargacki, Adam J.; Bar-Even, Arren; Louw, Catherine; Shen, Betty W.; Eiben, Christopher B.; Tran, Huu M.; Noor, Elad; Gallaher, Jasmine L.; Bale, Jacob; Yoshikuni, Yasuo; Gelb, Michael H.; Keasling, Jay D.; Stoddard, Barry L.; Lidstrom, Mary E.; Baker, David


    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway. PMID:25775555

  12. Computational protein design enables a novel one-carbon assimilation pathway

    SciTech Connect

    Siegel, JB; Smith, AL; Poust, S; Wargacki, AJ; Bar-Even, A; Louw, C; Shen, BW; Eiben, CB; Tran, HM; Noor, E; Gallaher, JL; Bale, J; Yoshikuni, Y; Gelb, MH; Keasling, JD; Stoddard, BL; Lidstrom, ME; Baker, D


    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway.

  13. Computational protein design enables a novel one-carbon assimilation pathway.


    Siegel, Justin B; Smith, Amanda Lee; Poust, Sean; Wargacki, Adam J; Bar-Even, Arren; Louw, Catherine; Shen, Betty W; Eiben, Christopher B; Tran, Huu M; Noor, Elad; Gallaher, Jasmine L; Bale, Jacob; Yoshikuni, Yasuo; Gelb, Michael H; Keasling, Jay D; Stoddard, Barry L; Lidstrom, Mary E; Baker, David


    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway. PMID:25775555

  14. Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

    SciTech Connect

    Feist, AM; Nagarajan, H; Rotaru, AE; Tremblay, PL; Zhang, T; Nevin, KP; Lovley, DR; Zengler, K


    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. Author Summary The ability of microorganisms to exchange electrons directly with their environment has large implications for our knowledge of industrial and environmental processes. For decades, it has been known that microbes can use electrodes as electron acceptors in microbial fuel cell settings. Geobacter metallireducens has been one of the model organisms for characterizing microbe-electrode interactions as well as environmental processes such as bioremediation. Here, we significantly expand the knowledge of metabolism and energetics of this model organism by employing constraint-based metabolic modeling. Through this analysis, we build the metabolic pathways necessary for carbon fixation, a desirable property for industrial chemical production. We further discover a novel growth condition which enables the characterization of autotrophic (i.e., carbon-fixing) metabolism in Geobacter. Importantly, our systems-level modeling approach helped elucidate the key metabolic pathways and the energetic cost associated with extracellular electron transfer. This model can be applied to characterize and engineer the metabolism and electron transfer capabilities of Geobacter for biotechnological applications.

  15. Dark inorganic carbon fixation sustains the functioning of benthic deep-sea ecosystems

    NASA Astrophysics Data System (ADS)

    Molari, Massimiliano; Manini, Elena; Dell'Anno, Antonio


    studies have provided evidence that dark inorganic carbon fixation is an important process for the functioning of the ocean interior. However, its quantitative relevance and ecological significance in benthic deep-sea ecosystems remain unknown. We investigated the rates of inorganic carbon fixation together with prokaryotic abundance, biomass, assemblage composition, and heterotrophic carbon production in surface sediments of different benthic deep-sea systems along the Iberian margin (northeastern Atlantic Ocean) and in the Mediterranean Sea. Inorganic carbon fixation rates in these surface deep-sea sediments did not show clear depth-related patterns, and, on average, they accounted for 19% of the total heterotrophic biomass production. The incorporation rates of inorganic carbon were significantly related to the abundance of total Archaea (as determined by catalyzed reporter deposition fluorescence in situ hybridization) and completely inhibited using an inhibitor of archaeal metabolism, N1-guanyl-1,7-diaminoheptane. This suggests a major role of the archaeal assemblages in inorganic carbon fixation. We also show that benthic archaeal assemblages contribute approximately 25% of the total 3H-leucine incorporation. Inorganic carbon fixation in surface deep-sea sediments appears to be dependent not only upon chemosynthetic processes but also on heterotrophic/mixotrophic metabolism, as suggested by estimates of the chemolithotrophic energy requirements and the enhanced inorganic carbon fixation due to the increase in the availability of organic trophic resources. Overall, our data suggest that archaeal assemblages of surface deep-sea sediments are responsible for the high rates of inorganic carbon incorporation and thereby sustain the functioning of the food webs as well as influence the carbon cycling of benthic deep-sea ecosystems.

  16. Community structure and soil pH determine chemoautotrophic carbon dioxide fixation in drained paddy soils.


    Long, Xi-En; Yao, Huaiying; Wang, Juan; Huang, Ying; Singh, Brajesh K; Zhu, Yong-Guan


    Previous studies suggested that microbial photosynthesis plays a potential role in paddy fields, but little is known about chemoautotrophic carbon fixers in drained paddy soils. We conducted a microcosm study using soil samples from five paddy fields to determine the environmental factors and quantify key functional microbial taxa involved in chemoautotrophic carbon fixation. We used stable isotope probing in combination with phospholipid fatty acid (PLFA) and molecular approaches. The amount of microbial (13)CO2 fixation was determined by quantification of (13)C-enriched fatty acid methyl esters and ranged from 21.28 to 72.48 ng of (13)C (g of dry soil)(-1), and the corresponding ratio (labeled PLFA-C:total PLFA-C) ranged from 0.06 to 0.49%. The amount of incorporationof (13)CO2 into PLFAs significantly increased with soil pH except at pH 7.8. PLFA and high-throughput sequencing results indicated a dominant role of Gram-negative bacteria or proteobacteria in (13)CO2 fixation. Correlation analysis indicated a significant association between microbial community structure and carbon fixation. We provide direct evidence of chemoautotrophic C fixation in soils with statistical evidence of microbial community structure regulation of inorganic carbon fixation in the paddy soil ecosystem. PMID:25989872

  17. Carbon and energy fixation of great duckweed Spirodela polyrhiza growing in swine wastewater.


    Wang, Wenguo; Yang, Chuang; Tang, Xiaoyu; Zhu, Qili; Pan, Ke; Cai, Denggao; Hu, Qichun; Ma, Danwei


    The ability to fix carbon and energy in swine wastewater of duckweeds was investigated using Spirodela polyrhiza as the model species. Cultures of S. polyrhiza were grown in dilutions of both original swine wastewater (OSW) and anaerobic digestion effluent (ADE) based on total ammonia nitrogen (TAN). Results showed that elevated concentrations of TAN caused decreased growth, carbon fixation, and energy production rates, particularly just after the first rise in two types of swine wastewater. Also, OSW was more suitable for S. polyrhiza cultivation than ADE. Maximum carbon and energy fixation were achieved at OSW-TAN concentrations of 12.08 and 13.07 mg L(-1), respectively. Photosynthetic activity of S. polyrhiza could be inhibited by both nutrient stress (in high-concentration wastewater) and nutrient limitation (in low-concentration wastewater), affecting its growth and ability for carbon-energy fixation. PMID:26036587

  18. A “footprint” of plant carbon fixation cycle functions during the development of a heterotrophic fungus

    PubMed Central

    Lyu, Xueliang; Shen, Cuicui; Xie, Jiatao; Fu, Yanping; Jiang, Daohong; Hu, Zijin; Tang, Lihua; Tang, Liguang; Ding, Feng; Li, Kunfei; Wu, Song; Hu, Yanping; Luo, Lilian; Li, Yuanhao; Wang, Qihua; Li, Guoqing; Cheng, Jiasen


    Carbon fixation pathway of plants (CFPP) in photosynthesis converts solar energy to biomass, bio-products and biofuel. Intriguingly, a large number of heterotrophic fungi also possess enzymes functionally associated with CFPP, raising the questions about their roles in fungal development and in evolution. Here, we report on the presence of 17 CFPP associated enzymes (ten in Calvin-Benson-Basham reductive pentose phosphate pathway and seven in C4-dicarboxylic acid cycle) in the genome of Sclerotinia sclerotiorum, a heterotrophic phytopathogenic fungus, and only two unique enzymes: ribulose-1, 5-bisphosphate carboxylase-oxygenase (Rubisco) and phosphoribulokinase (PRK) were absent. This data suggested an incomplete CFPP-like pathway (CLP) in fungi. Functional profile analysis demonstrated that the activity of the incomplete CLP was dramatically regulated during different developmental stages of S. sclerotiorum. Subsequent experiments confirmed that many of them were essential to the virulence and/or sclerotial formation. Most of the CLP associated genes are conserved in fungi. Phylogenetic analysis showed that many of them have undergone gene duplication, gene acquisition or loss and functional diversification in evolutionary history. These findings showed an evolutionary links in the carbon fixation processes of autotrophs and heterotrophs and implicated the functions of related genes were in course of continuous change in different organisms in evolution. PMID:26263551

  19. [Regulation of alternative CO[sub 2] fixation pathways in procaryotic and eucaryotic photosynthetic organisms

    SciTech Connect

    Not Available


    The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.

  20. Effects of model structural uncertainty on carbon cycle projections: biological nitrogen fixation as a case study

    NASA Astrophysics Data System (ADS)

    Wieder, William R.; Cleveland, Cory C.; Lawrence, David M.; Bonan, Gordon B.


    Uncertainties in terrestrial carbon (C) cycle projections increase uncertainty of potential climate feedbacks. Efforts to improve model performance often include increased representation of biogeochemical processes, such as coupled carbon-nitrogen (N) cycles. In doing so, models are becoming more complex, generating structural uncertainties in model form that reflect incomplete knowledge of how to represent underlying processes. Here, we explore structural uncertainties associated with biological nitrogen fixation (BNF) and quantify their effects on C cycle projections. We find that alternative plausible structures to represent BNF result in nearly equivalent terrestrial C fluxes and pools through the twentieth century, but the strength of the terrestrial C sink varies by nearly a third (50 Pg C) by the end of the twenty-first century under a business-as-usual climate change scenario representative concentration pathway 8.5. These results indicate that actual uncertainty in future C cycle projections may be larger than previously estimated, and this uncertainty will limit C cycle projections until model structures can be evaluated and refined.

  1. Microbial carbon and nitrogen fixation on the surface of glaciers and ice sheets

    NASA Astrophysics Data System (ADS)

    Telling, J.; Anesio, A. M.; Stibal, M.; Hawkings, J.; Bellas, C. M.; Tranter, M.; Wadham, J. L.; Cook, J.; Hodson, A. J.; Yallop, M.; Barker, G.; Butler, C. E.; Fountain, A. G.; Nylen, T.; Irvine-Fynn, T. D.; Sole, A. J.; Nienow, P. W.


    Studying the microbial sequestration of atmospheric carbon dioxide (via net autochthonous production) and nitrogen (via nitrogen fixation) into organic matter on the surface of glaciers and ice sheets is important for three main reasons. First, they can provide essential nutrients for supporting microbial ecosystems in these cold, typically nutrient-poor environments. Second, nutrients formed in the supraglacial environment may be important for sustaining hydrologically connected subglacial and downstream (e.g. fjords, near-shore marine) ecosystems. Third, organic matter produced or transformed by microbial activity can alter the albedo of ice, either directly by the production of dark pigments, or indirectly through the trapping and agglutination of dark mineral via the production of exopolysaccharides. Here, we present recent results of microbial carbon and nitrogen fixation in surface sediment (cryoconite) on Arctic and Antarctic glaciers and the Greenland Ice Sheet ablation zone. Results suggest that the fixation and recycling of autochthonous carbon in cryoconite on glaciers and ice sheets can support a significant fraction of the total microbial activity in the supraglacial environment during the ablation season. Nitrogen fixation can be important as a nitrogen source for microbial communities on both Arctic and Antarctic glaciers during the main ablation season. Nitrogen fixation could feasibly exceed precipitation as a source of nitrogen to microbial communities in debris rich zones on the margins of the Greenland Ice Sheet, aiding the colonization and subsequent 'greening' of subglacial and moraine derived debris.

  2. A model for diurnal patterns of carbon fixation in a Precambrian microbial mat based on a modern analog

    NASA Technical Reports Server (NTRS)

    Rothschild, L. J.


    Microbial mat communities are one of the first and most prevalent biological communities known from the Precambrian fossil record. These fossil mat communities are found as laminated sedimentary rock structures called stromatolites. Using a modern microbial mat as an analog for Precambrian stromatolites, a study of carbon fixation during a diurnal cycle under ambient conditions was undertaken. The rate of carbon fixation depends primarily on the availability of light (consistent with photosynthetic carbon fixation) and inorganic carbon, and not nitrogen or phosphorus. Atmospheric PCO2 is thought to have decreased from 10 bars at 4 Ga (10(9) years before present) to approximately 10(-4) bars today, implying a change in the availability of inorganic carbon for carbon fixation. Experimental manipulation of levels of inorganic carbon to levels that may have been available to Precambrian mat communities resulted in increased levels of carbon fixation during daylight hours. Combining these data with models of daylength during the Precambrian, models are derived for diurnal patterns of photosynthetic carbon fixation in a Precambrian microbial mat community. The models suggest that, even in the face of shorter daylengths during the Precambrian, total daily carbon fixation has been declining over geological time, with most of the decrease having occurred during the Precambrian.

  3. Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

    PubMed Central

    Feist, Adam M.; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P.; Lovley, Derek R.; Zengler, Karsten


    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. PMID:24762737

  4. Carbon dioxide fixation and respiration relationships observed during closure experiments in Biosphere 2

    NASA Astrophysics Data System (ADS)

    Nelson, Mark; Dempster, William; Allen, John P.

    Biosphere 2 enclosed several ecosystems - ones analogous to rainforest, tropical savannah, thornscrub, desert, marsh and coral reef - and a diverse agro-ecology, with dozens of food crops, in virtual material isolation from Earth's environment. This permits a detailed examination of fixation and respiration from the continuous record of carbon dioxide concentration from sensors inside the facility. Unlike the Earth, all the ecosystems were active during sunlight hours, while phyto and soil respiration dominated nighttime hours. This resulted in fluctuations of as much as 600-700 ppm CO2 daily during days of high sunlight input. We examine the relationships between daytime fixation as driven by photosynthesis to nighttime respiration and also fixation and respiration as related to carbon dioxide concentration. Since carbon dioxide concentrations varied from near Earth ambient levels to over 3000 ppm (during low-light winter months), the response of the plant communities and impact on phytorespiration and soil respiration may be of relevance to the global climate change research community. An investigation of these dynamics will also allow the testing of models predicting the response of community metabolism to variations in sunlight and degree of previous net carbon fixation.

  5. Photosynthesis in Grass Species Differing in Carbon Dioxide Fixation Pathways

    PubMed Central

    Morgan, Jack A.; Brown, R. Harold


    Thirty-three grass species were examined in two experiments in an attempt to locate plants with photosynthetic responses to O2, CO2 compensation concentrations, and leaf anatomy intermediate to those of C3 and C4 species. Species examined included seven from the Laxa group in the Panicum genus, one of which, P. milioides Nees ex Trin., has been reported earlier to have intermediate characteristics. The species with O2-sensitive photosynthesis typical of C3 plants showed more than 37% increase in apparent photosynthesis at 2% O2 compared to 21% O2 at 25 C and 335 microliters per liter CO2, whereas in Panicum milioides, P. schenckii Hack., and P. decipiens Nees ex Trin., members of the Laxa group of Panicum, increases ranged from 25 to 30%. The remainder of the species did not respond to O2. Species with O2 responses characteristic of C3 plants exhibited CO2 compensation concentrations of 44 microliters per liter or higher at 21% O2 and 25 to 27.5 C and species characterized as O2-insensitive had values of microliters per liter or less. The CO2 compensation concentration (Г) values of P. milioides, P. schenckii, and P. decipiens ranged from 10.3 to 23.3 microliters per liter. Other species of the Laxa group of Panicum exhibited O2 response and Г values of either C3 (P. laxum Sw., P. hylaeicum Mez., and P. rivulare Trin.) or C4 (P. prionitis Griseb.) plants. Leaves of species with O2 response and CO2 compensation values typical of C3 plants had poorly developed or nearly empty bundle sheath cells, and much larger distances and mesophyll cell numbers between veins than did the O2-insensitive ones. Vein spacings in P. milioides, P. schenckii, and P. decipiens ranged from 0.18 to 0.28 millimeter and mesophyll cell number between veins from 5.2 to 7.8. While these vein spacings are closer than those of most C3 grasses, two O2-sensitive species of Dactylis had vein spacings similar to these Panicums and veins in Glyceria striata, another O2-sensitive plant, were separated by only four mesophyll cells and 0.12 millimeter. Bundle sheath cells of the three intermediate Panicums contained greater quantities of organelles than are typical for C3 grasses. Images PMID:16660944

  6. Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean

    PubMed Central

    Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M


    Bacteria and archaea in the dark ocean (>200 m) comprise 0.3–1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

  7. Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean.


    Mattes, Timothy E; Nunn, Brook L; Marshall, Katharine T; Proskurowski, Giora; Kelley, Deborah S; Kawka, Orest E; Goodlett, David R; Hansell, Dennis A; Morris, Robert M


    Bacteria and archaea in the dark ocean (>200 m) comprise 0.3-1.3 billion tons of actively cycled marine carbon. Many of these microorganisms have the genetic potential to fix inorganic carbon (autotrophs) or assimilate single-carbon compounds (methylotrophs). We identified the functions of autotrophic and methylotrophic microorganisms in a vent plume at Axial Seamount, where hydrothermal activity provides a biogeochemical hot spot for carbon fixation in the dark ocean. Free-living members of the SUP05/Arctic96BD-19 clade of marine gamma-proteobacterial sulfur oxidizers (GSOs) are distributed throughout the northeastern Pacific Ocean and dominated hydrothermal plume waters at Axial Seamount. Marine GSOs expressed proteins for sulfur oxidation (adenosine phosphosulfate reductase, sox (sulfur oxidizing system), dissimilatory sulfite reductase and ATP sulfurylase), carbon fixation (ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)), aerobic respiration (cytochrome c oxidase) and nitrogen regulation (PII). Methylotrophs and iron oxidizers were also active in plume waters and expressed key proteins for methane oxidation and inorganic carbon fixation (particulate methane monooxygenase/methanol dehydrogenase and RuBisCO, respectively). Proteomic data suggest that free-living sulfur oxidizers and methylotrophs are among the dominant primary producers in vent plume waters in the northeastern Pacific Ocean. PMID:23842654

  8. Coupling of Phosphorylation and Carbon Dioxide Fixation in Extracts of Thiobacillus thioparus1

    PubMed Central

    Johnson, Emmett J.; Peck, Harry D.


    Johnson, Emmett J. (University of Mississippi Medical Center, Jackson), and Harry D. Peck, Jr. Coupling of phosphorylation and carbon dioxide fixation in extracts of Thiobacillus thioparus. J. Bacteriol. 89:10411050. 1965.A cell-free system from Thiobacillus thioparus which fixes large quantities of C14O2 in the presence of ribose-5-phosphate, adenosine triphosphate (ATP), and Mg++ has been described. The specific activity (0.041 ?mole of ribulose-1,5-diphosphate min?1 mg?1 protein) of the CO2-fixing system approaches that of green plants, and is further evidence for the importance of the role of carboxydismutase in the thiobacilli. In addition to ATP, adenosine diphosphate (ADP) and other nucleoside triphosphates served with varying degrees of effectiveness for the fixation of C14O2. The ATP requirement for CO2 fixation was partially replaced under aerobic conditions by a combination of SO3=, PO4?, and adenosine monophosphate (AMP). Phosphorylation and CO2 fixation were separated in time by first incubating SO3= and AMP aerobically, and then anaerobically introducing C14O3= and ribose-5-phosphate into the reaction mixture. During the first incubation, P32O4? was esterified into nucleotides, mainly ADP, and in the second incubation C14O2 was fixed, with the concomitant utilization of almost equal amounts of the esterified phosphate. These data provide the first in vitro evidence for the mechanism of the coupling of CO2 fixation and phosphorylation in T. thioparus. The fixation of C14O2 was shown to be almost completely inhibited by AMP. This inhibition was not due to the conversion of ATP to ADP by adenylic kinase, or to the binding of magnesium by the nucleotide. The inhibition was specific for AMP, since other mononucleotides, adenosine, and adenine did not inhibit. The AMP regulation of CO2 fixation may represent a basic control mechanism in autotrophic metabolism. PMID:14276093

  9. Carbon sequestration in soybean crop soils: the role of hydrogen-coupled CO2 fixation

    NASA Astrophysics Data System (ADS)

    Graham, A.; Layzell, D. B.; Scott, N. A.; Cen, Y.; Kyser, T. K.


    Conversion of native vegetation to agricultural land in order to support the world's growing population is a key factor contributing to global climate change. However, the extent to which agricultural activities contribute to greenhouse gas emissions compared to carbon storage is difficult to ascertain, especially for legume crops, such as soybeans. Soybean establishment often leads to an increase in N2O emissions because N-fixation leads to increased soil available N during decomposition of the low C:N legume biomass. However, soybean establishment may also reduce net greenhouse gas emissions by increasing soil fertility, plant growth, and soil carbon storage. The mechanism behind increased carbon storage, however, remains unclear. One explanation points to hydrogen coupled CO2 fixation; the process by which nitrogen fixation releases H2 into the soil system, thereby promoting chemoautotrophic carbon fixation by soil microbes. We used 13CO2 as a tracer to track the amount and fate of carbon fixed by hydrogen coupled CO2 fixation during one-year field and laboratory incubations. The objectives of the research are to 1) quantify rates of 13CO2 fixation in soil collected from a field used for long-term soybean production 2) examine the impact of H2 gas concentration on rates of 13CO2 fixation, and 3) measure changes in ?13C signature over time in 3 soil fractions: microbial biomass, light fraction, and acid stable fraction. If this newly-fixed carbon is incorporated into the acid-stable soil C fraction, it has a good chance of contributing to long-term soil C sequestration under soybean production. Soil was collected in the field both adjacent to root nodules (nodule soil) and >3cm away (root soil) and labelled with 13CO2 (1% v/v) in the presence and absence of H2 gas. After a two week labelling period, ?13C signatures already revealed differences in the four treatments of bulk soil: -17.1 for root, -17.6 for nodule, -14.2 for root + H2, and -6.1 for nodule + H2. Labelled soil was then placed in nylon mesh bags and buried in the field at a depth of 15cm in a soybean field at the Central Experiment Farm in Ottawa, Ontario. Samples will be removed at intervals of 1,2,3,6,9,12, and 15 months, and the ?13C of three soil fractions will be examined to reveal changes in carbon storage over time. Our results will provide insights into the fate of carbon fixed during hydrogen coupled CO2 fixation, and demonstrate whether this CO2 fixation can contribute to the long-term greenhouse gas balance of soybean production systems.

  10. Metal-complex/semiconductor hybrids for carbon dioxide fixation

    NASA Astrophysics Data System (ADS)

    Maeda, Kazuhiko; Kuriki, Ryo; Sekizawa, Keita; Ishitani, Osamu


    A hybrid photocatalyst consisting of a catalytic Ru complex and polymeric carbon nitride (band gap, 2.7 eV) was capable of reducing CO2 into HCOOH with ~80% selectivity under visible light (? > 420 nm) in the presence of a suitable electron donor. Introduction of mesoporosity into the graphitic carbon nitride structure to increase the specific surface area was essential to enhancing the activity. However, higher surface area (in other words, lower crystallinity) that originated from excessively introduced mesopores had a negative impact on activity. Promoting electron injection from carbon nitride to the catalytic Ru unit as well as strengthening the electronic interactions between the two units improved the activity. Under the optimal condition, a turnover number (TON, with respect to the Ru complex used) greater than 1000 and an apparent quantum yield of 5.7% (at 400 nm) were obtained, which are the greatest among heterogeneous photocatalysts for visible-light CO2 reduction ever reported.

  11. The effect of nutrients on carbon and nitrogen fixation by the UCYN-A-haptophyte symbiosis.


    Krupke, Andreas; Mohr, Wiebke; LaRoche, Julie; Fuchs, Bernhard M; Amann, Rudolf I; Kuypers, Marcel M M


    Symbiotic relationships between phytoplankton and N2-fixing microorganisms play a crucial role in marine ecosystems. The abundant and widespread unicellular cyanobacteria group A (UCYN-A) has recently been found to live symbiotically with a haptophyte. Here, we investigated the effect of nitrogen (N), phosphorus (P), iron (Fe) and Saharan dust additions on nitrogen (N2) fixation and primary production by the UCYN-A-haptophyte association in the subtropical eastern North Atlantic Ocean using nifH expression analysis and stable isotope incubations combined with single-cell measurements. N2 fixation by UCYN-A was stimulated by the addition of Fe and Saharan dust, although this was not reflected in the nifH expression. CO2 fixation by the haptophyte was stimulated by the addition of ammonium nitrate as well as Fe and Saharan dust. Intriguingly, the single-cell analysis using nanometer scale secondary ion mass spectrometry indicates that the increased CO2 fixation by the haptophyte in treatments without added fixed N is likely an indirect result of the positive effect of Fe and/or P on UCYN-A N2 fixation and the transfer of N2-derived N to the haptophyte. Our results reveal a direct linkage between the marine carbon and nitrogen cycles that is fuelled by the atmospheric deposition of dust. The comparison of single-cell rates suggests a tight coupling of nitrogen and carbon transfer that stays balanced even under changing nutrient regimes. However, it appears that the transfer of carbon from the haptophyte to UCYN-A requires a transfer of nitrogen from UCYN-A. This tight coupling indicates an obligate symbiosis of this globally important diazotrophic association. PMID:25535939

  12. Slow carboxylation of Rubisco constrains the rate of carbon fixation during Antarctic phytoplankton blooms.


    Young, Jodi N; Goldman, Johanna A L; Kranz, Sven A; Tortell, Philippe D; Morel, Francois M M


    High-latitude oceans are areas of high primary production despite temperatures that are often well below the thermal optima of enzymes, including the key Calvin Cycle enzyme, Ribulose 1,5 bisphosphate carboxylase oxygenase (Rubisco). We measured carbon fixation rates, protein content and Rubisco abundance and catalytic rates during an intense diatom bloom in the Western Antarctic Peninsula (WAP) and in laboratory cultures of a psychrophilic diatom (Fragilariopsis cylindrus). At -1C, the Rubisco turnover rate, kcat (c) , was 0.4 C s(-1) per site and the half saturation constant for CO2 was 15 ?M (vs c. 3 C s(-1) per site and 50 ?M at 20C). To achieve high carboxylation rates, psychrophilic diatoms increased Rubisco abundance to c. 8% of biomass (vs c. 0.6% at 20C), along with their total protein content, resulting in a low carbon : nitrogen ratio of c. 5. In psychrophilic diatoms, Rubisco must be almost fully active and near CO2 saturation to achieve carbon fixation rates observed in the WAP. Correspondingly, total protein concentrations were close to the highest ever measured in phytoplankton and likely near the maximum possible. We hypothesize that this high protein concentration, like that of Rubisco, is necessitated by slow enzyme rates, and that carbon fixation rates in the WAP are near a theoretical maximum. PMID:25283055

  13. Unravelling Carbon Fixation under Nutrient limited Conditions - a Water Column Perspective

    NASA Astrophysics Data System (ADS)

    Thomas, Helmuth; Craig, Susanne; Shadwick, Elizabeth H.; Li, William K.; Greenan, Blair J. W.


    Phytoplankton plays a critical role in the uptake of atmospheric carbon dioxide (CO2) by the ocean, and is comprised of a spectrum of cell sizes that are strongly regulated by oceanographic conditions. Elevated CO2 fixation relative to nutrient availability, also called carbon overconsumption, has been observed in various mid to high latitude systems, such as the Baltic and North Seas, the North Atlantic Ocean, the Canadian Arctic Archipelago or the Scotian Shelf. We shed light on this phenomenon relying on an extensive data set of water column observations of the CO2 system and phytoplankton cell counts from the Scotian Shelf, a temperate shelf sea. We show that in the summertime, the population of numerically abundant small cells, which favour warmer, nutrient poor conditions, accounts for approximately 20% of annual carbon uptake. At the broader scale, the neglection of this "non-Redfieldian" contribution typically leads to an underestimation of net community production by approximately 20% to 50%. These small cells are not well represented by chlorophyll a - the ubiquitously used proxy of phytoplankton biomass - but rather, are strongly correlated with surface water temperature. Given the persistent near-zero nutrient concentrations during the summer, it appears that small cells drive carbon overconsumption, and suggest that their role in carbon fixation will become increasingly important in a warming, increasingly stratified ocean.

  14. Chemoautotrophic carbon fixation rates and active bacterial communities in intertidal marine sediments.


    Boschker, Henricus T S; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W C; Moodley, Leon


    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, The Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m(-2) d(-1). Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)(-1), which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  15. Chemoautotrophic Carbon Fixation Rates and Active Bacterial Communities in Intertidal Marine Sediments

    PubMed Central

    Boschker, Henricus T. S.; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W. C.; Moodley, Leon


    Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, the Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m−2 d−1. Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)−1, which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology. PMID:25003508

  16. Irreversibly increased nitrogen fixation in Trichodesmium experimentally adapted to elevated carbon dioxide

    NASA Astrophysics Data System (ADS)

    Hutchins, David A.; Walworth, Nathan G.; Webb, Eric A.; Saito, Mak A.; Moran, Dawn; McIlvin, Matthew R.; Gale, Jasmine; Fu, Fei-Xue


    Nitrogen fixation rates of the globally distributed, biogeochemically important marine cyanobacterium Trichodesmium increase under high carbon dioxide (CO2) levels in short-term studies due to physiological plasticity. However, its long-term adaptive responses to ongoing anthropogenic CO2 increases are unknown. Here we show that experimental evolution under extended selection at projected future elevated CO2 levels results in irreversible, large increases in nitrogen fixation and growth rates, even after being moved back to lower present day CO2 levels for hundreds of generations. This represents an unprecedented microbial evolutionary response, as reproductive fitness increases acquired in the selection environment are maintained after returning to the ancestral environment. Constitutive rate increases are accompanied by irreversible shifts in diel nitrogen fixation patterns, and increased activity of a potentially regulatory DNA methyltransferase enzyme. High CO2-selected cell lines also exhibit increased phosphorus-limited growth rates, suggesting a potential advantage for this keystone organism in a more nutrient-limited, acidified future ocean.

  17. Irreversibly increased nitrogen fixation in Trichodesmium experimentally adapted to elevated carbon dioxide

    PubMed Central

    Hutchins, David A.; Walworth, Nathan G.; Webb, Eric A.; Saito, Mak A.; Moran, Dawn; McIlvin, Matthew R.; Gale, Jasmine; Fu, Fei-Xue


    Nitrogen fixation rates of the globally distributed, biogeochemically important marine cyanobacterium Trichodesmium increase under high carbon dioxide (CO2) levels in short-term studies due to physiological plasticity. However, its long-term adaptive responses to ongoing anthropogenic CO2 increases are unknown. Here we show that experimental evolution under extended selection at projected future elevated CO2 levels results in irreversible, large increases in nitrogen fixation and growth rates, even after being moved back to lower present day CO2 levels for hundreds of generations. This represents an unprecedented microbial evolutionary response, as reproductive fitness increases acquired in the selection environment are maintained after returning to the ancestral environment. Constitutive rate increases are accompanied by irreversible shifts in diel nitrogen fixation patterns, and increased activity of a potentially regulatory DNA methyltransferase enzyme. High CO2-selected cell lines also exhibit increased phosphorus-limited growth rates, suggesting a potential advantage for this keystone organism in a more nutrient-limited, acidified future ocean. PMID:26327191

  18. The use of short carbon fibre reinforced thermoplastic plates for fracture fixation.


    Gillett, N; Brown, S A; Dumbleton, J H; Pool, R P


    Thermoplastic plates of Nylon 6-10 and Polybutylene terephthalate reinforced with 30% short randomly oriented carbon fibres were tested for internal fixation of canine femoral transverse midshaft fractures. The elastic modulus of the plates was one-half that of bone: however, ultimate strength and strain in bending were comparable to bone. The fractures healed with moderate callus formation which was completely remodelled by 8 to 12 wk post surgery. Although a moderate inflammatory reaction to occasional particulate debris was noted, the materials appeared to possess the proper elastic moduli to allow sufficient support for the healing fracture without protecting the remodelling process. PMID:3159436

  19. Comparative Shotgun Proteomic Analysis of Wastewater-Cultured Microalgae: Nitrogen Sensing and Carbon Fixation for Growth and Nutrient Removal in Chlamydomonas reinhardtii.


    Patel, Anil K; Huang, Eric L; Low-Décarie, Etienne; Lefsrud, Mark G


    Chlamydomonas reinhardtii was batch-cultured for 12 days under continuous illumination to investigate nitrogen uptake and metabolic responses to wastewater processing. Our approach compared two conditions: (1) artificial wastewater containing nitrate and ammonia and (2) nutrient-sufficient control containing nitrate as sole form of nitrogen. Treatments did not differ in final biomass; however, comparison of group proteomes revealed significant differences. Label-free shotgun proteomic analysis identified 2358 proteins, of which 92 were significantly differentially abundant. Wastewater cells showed higher relative abundances of photosynthetic antenna proteins, enzymes related to carbon fixation, and biosynthesis of amino acids and secondary metabolites. Control cells showed higher abundances of enzymes and proteins related to nitrogen metabolism and assimilation, synthesis and utilization of starch, amino acid recycling, evidence of oxidative stress, and little lipid biosynthesis. This study of the eukaryotic microalgal proteome response to nitrogen source, availability, and switching highlights tightly controlled pathways essential to the maintenance of culture health and productivity in concert with light absorption and carbon assimilation. Enriched pathways in artificial wastewater, notably, photosynthetic carbon fixation and biosynthesis of plant hormones, and those in nitrate only control, most notably, nitrogen, amino acid, and starch metabolism, represent potential targets for genetic improvement requiring targeted elucidation. PMID:25997359

  20. Ecological Aspects of the Distribution of Different Autotrophic CO2 Fixation Pathways?

    PubMed Central

    Berg, Ivan A.


    Autotrophic CO2 fixation represents the most important biosynthetic process in biology. Besides the well-known Calvin-Benson cycle, five other totally different autotrophic mechanisms are known today. This minireview discusses the factors determining their distribution. As will be made clear, the observed diversity reflects the variety of the organisms and the ecological niches existing in nature. PMID:21216907

  1. [Regulation of alternative CO{sub 2} fixation pathways in procaryotic and eucaryotic photosynthetic organisms]. Progress report

    SciTech Connect

    Not Available


    The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.

  2. Carboxysomal carbonic anhydrases: Structure and role in microbial CO2 fixation

    SciTech Connect

    Cannon, Gordon C.; Heinhorst, Sabine; Kerfeld, Cheryl A.


    Cyanobacteria and some chemoautotrophic bacteria are able to grow in environments with limiting CO2 concentrations by employing a CO2-concentrating mechanism (CCM) that allows them to accumulate inorganic carbon in their cytoplasm to concentrations several orders of magnitude higher than that on the outside. The final step of this process takes place in polyhedral protein microcompartments known as carboxysomes, which contain the majority of the CO2-fixing enzyme, RubisCO. The efficiency of CO2 fixation by the sequestered RubisCO is enhanced by co-localization with a specialized carbonic anhydrase that catalyzes dehydration of the cytoplasmic bicarbonate and ensures saturation of RubisCO with its substrate, CO2. There are two genetically distinct carboxysome types that differ in their protein composition and in the carbonic anhydrase(s) they employ. Here we review the existing information concerning the genomics, structure and enzymology of these uniquely adapted carbonic anhydrases, which are of fundamental importance in the global carbon cycle.


    SciTech Connect

    Kerry M. Dooley; F. Carl Knopf; Robert P. Gambrell


    The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SC-CO {sub 2})-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resistance) cement-based products. SC-CO{sub 2} can rapidly convert the calcium hydroxide in cured cement to calcium carbonate, which increases the density and unconfined compressive strength in the treated region. In cured concrete, this treated region is typically a several-mm thick layer (generally <{approx}5mm, unless treatment time is excessive). However, we have found that by treating the entire cement matrix with SC-CO{sub 2} as part of the curing process, we can carbonate it rapidly, regardless of the thickness. By ''rapidly'' we mean simultaneous carbonation/curing in < 5 ks even for large cement forms, compared to typical carbonation times of several days or even years at low pressures. Carbonation changes the pH in the treated region from {approx}13 to {approx}8, almost exactly compatible with seawater. Therefore the leaching rates from these cements is reduced. These cement improvements are directed to the development of strong but thin artificial reefs, to which can be attached microalgae used for the enhanced fixation of CO{sub 2}. It is shown below that attached microalgae, as algal beds or reefs, are more efficient for CO{sub 2} fixation by a factor of 20, compared to the open ocean on an area basis. We have performed preliminary tests of the pH-neutral cements of our invention for attachment of microalgae populations. We have found pH-neutral materials which attach microalgae readily. These include silica-enriched (pozzolanic) cements, blast-furnace slags and fly ash, which are also silica-rich. We have already developed technology to simultaneously foam, carbonate and cure the cements; this foaming process further increases cement surface areas for microalgae attachment, in some cases to >10 m{sup 2}/g internal surface area. This project involves a team of researchers with backgrounds in cement technology, supercritical fluid technology, materials science, oceanography, and wetland biogeochemistry.

  4. Longitudinal Profiles of Carbon Dioxide Fixation Capacities in Marine Macroalgae 1

    PubMed Central

    Kppers, Ursula; Kremer, Bruno P.


    Fucus serratus L., Fucus spiralis L., and Fucus vesiculosus L. (Fucales, Phaeophyceae) as well as Laminaria digitata (Huds.) Lamour., Laminaria hyperborea (Gunn.) Fosl., and Laminaria saccharina (L.) Lamour. (Laminariales, Phaeophyceae) have been investigated for the distribution of enzymic CO2 fixation capacities via phosphoenolpyruvate carboxykinase (EC (PEP-CK) and via ribulose-1,5-bisphosphate carboxylase (EC (RubP-C) in different regions of the thalli. The maximum of PEP-CK activity is found to be confined to the growing regions of the algae, while the activity of RubP-C achieves its highest values in the entirely differentiated parts of the fronds. These findings are confirmed by the results of photosynthetic and light-independent (dark) carbon assimilation as determined by in vivo 14CO2 fixation. The physiological significance of these differential patterns of carboxylation patterns is discussed with respect to the ontogenetic stage and the chemical constitution of the different thallus parts. PMID:16660467

  5. Predicting the Electron Requirement for Carbon Fixation in Seas and Oceans

    PubMed Central

    Lawrenz, Evelyn; Silsbe, Greg; Capuzzo, Elisa; Ylöstalo, Pasi; Forster, Rodney M.; Simis, Stefan G. H.; Prášil, Ondřej; Kromkamp, Jacco C.; Hickman, Anna E.; Moore, C. Mark; Forget, Marie-Hélèn; Geider, Richard J.; Suggett, David J.


    Marine phytoplankton account for about 50% of all global net primary productivity (NPP). Active fluorometry, mainly Fast Repetition Rate fluorometry (FRRf), has been advocated as means of providing high resolution estimates of NPP. However, not measuring CO2-fixation directly, FRRf instead provides photosynthetic quantum efficiency estimates from which electron transfer rates (ETR) and ultimately CO2-fixation rates can be derived. Consequently, conversions of ETRs to CO2-fixation requires knowledge of the electron requirement for carbon fixation (Φe,C, ETR/CO2 uptake rate) and its dependence on environmental gradients. Such knowledge is critical for large scale implementation of active fluorescence to better characterise CO2-uptake. Here we examine the variability of experimentally determined Φe,C values in relation to key environmental variables with the aim of developing new working algorithms for the calculation of Φe,C from environmental variables. Coincident FRRf and 14C-uptake and environmental data from 14 studies covering 12 marine regions were analysed via a meta-analytical, non-parametric, multivariate approach. Combining all studies, Φe,C varied between 1.15 and 54.2 mol e− (mol C)−1 with a mean of 10.9±6.91 mol e− mol C)−1. Although variability of Φe,C was related to environmental gradients at global scales, region-specific analyses provided far improved predictive capability. However, use of regional Φe,C algorithms requires objective means of defining regions of interest, which remains challenging. Considering individual studies and specific small-scale regions, temperature, nutrient and light availability were correlated with Φe,C albeit to varying degrees and depending on the study/region and the composition of the extant phytoplankton community. At the level of large biogeographic regions and distinct water masses, Φe,C was related to nutrient availability, chlorophyll, as well as temperature and/or salinity in most regions, while light availability was also important in Baltic Sea and shelf waters. The novel Φe,C algorithms provide a major step forward for widespread fluorometry-based NPP estimates and highlight the need for further studying the natural variability of Φe,C to verify and develop algorithms with improved accuracy. PMID:23516441

  6. P700 Activity and Chlorophyll Content of Plants with Different Photosynthetic Carbon Dioxide Fixation Cycles 1

    PubMed Central

    Black, C. C.; Mayne, B. C.


    Representative plants containing either the reductive pentose phosphate cycle or the C4 dicarboxylic acid cycle of photosynthetic carbon dioxide fixation have distinctly different contents of P700 and chlorophylls a and b. With leaf extracts and isolated chloroplasts from C4 cycle plants, the mean value of the relative ratio of P700 to total chlorophyll was 1.83 and the mean value of the ratio of chlorophyll a to b was 3.89. The respective values in similar extracts and chloroplasts from pentose cycle plants are 1.2 and 2.78. It seems likely that these results are indicative of a more active Photosystem I or a different size photosynthetic unit in C4 cycle plants than in the reductve pentose phosphate cycle plants. PMID:16657384

  7. Inhibitory effect of hypergravity on photosynthetic carbon dioxide fixation in Euglena gracilis.


    Ortiz, W; Wignarajah, K; Smith, J D


    Photosynthesis, the conversion of light energy into chemical energy, is a critical biological process, whereby plants synthesize carbohydrates from light, carbon dioxide (CO2) and water. The influence of gravity on this biological process, however, is not well understood. Thus, centrifugation was used to alter the gravity environment of Euglena gracilis grown on nutritive agar plates illuminated with red and blue light emitting diodes. The results showed that hypergravity (up to 10xg) had an inhibitory effect on photosynthetic CO2 fixation. Chlorophyll accumulation per cell was essentially unaffected by treatment; however, Chl a/Chl b ratios decreased in hypergravity when compared to 1xg controls. Photosynthesis in Euglena appears to have limited tolerance for even moderate changes in gravitational acceleration. PMID:11543574

  8. [Regulation of alternative CO{sub 2} fixation pathways in prokaryotic and eukaryotic photosynthetic organisms]. Progress report, June 15, 1991--June 14, 1993

    SciTech Connect

    Tabita, R.


    The goal of this project to determine how photosynthetic microorganisms regulate the assimilation of CO{sub 2} via pathways alternative to the usual Calvin-Benson-Bassham reductive pentose phosphate scheme, particularly in the molecular basis for switches in CO{sub 2} metabolic paths. We have identified proteins on one-dimensional and two-dimensional SDS gels that appear differentially expressed in R. sphaeroides strain 16PHC which may be due to a mutation or change in some locus that controls the expression of several genes and their products. Similar observations were made relative to R. rubrum I-19 and the wild-type, namely that additional protein bands were observed in extracts of I-19 compared to the wild-type when both were grown photoheterotrophically with malate as electron donor and CO{sub 2} as the obligatory electron acceptor. The results of Tn5 mutagenesis of R. sphaeroides 16PHC resulted in the isolation of several strains that effectively changed back to the 16 phenotype; i.e., no malate-dependent phototrophic growth with CO{sub 2} as electron acceptor. We have found that both wild-type R. sphaeroides and R. rubrum, and the respective RubisCO negative mutant strains, are all capable of photolithoautotrophic growth using reduced sulfur compounds as electron donors and CO{sub 2} as the sole carbon source and electron acceptor. The fact that the RubisCO negative are capable of photoautotrophic growth is an exciting development for us because it proves that alternative or nonCalvin CO{sub 2} fixation pathways are extremely important to the overall carbon metabolism of these organisms. Moreover, wild-type strains turn off the synthesis of RubisCO under these cultural conditions. Thus, there appears to be separate autotrophic CO{sub 2} fixation pathways in these organisms, and a major emphasis has been placed to identify how these bacteria can grow autotrophically and fix CO{sub 2} in the absence of RubisCO.

  9. Creation of active sites by impregnation of carbon fibers: application to the fixation of hydrogen sulfide.


    Meljac, Laure; Perier-Camby, Laurent; Thomas, Grard


    Activated carbon fibers, which exhibit high specific area and numerous active surface sites, constitute very powerful adsorbents and are widely used in filtration to eliminate pollutants from liquid or gaseous effluents. The fibers studied in this work are devoted to the filtration of gaseous effluent containing very small amounts (few vpm) of hydrogen sulfide. Preliminary experiments evidenced that these fibers weakly adsorb hydrogen sulfide. To improve their fixation capacity toward H(2)S the activated fibers are impregnated in an aqueous solution of potassium hydroxide. The impregnation treatment usually takes place before activation but in this work it occurs at room temperature after activation of the fibers. A further thermal treatment is performed to increase the efficiency of the system. The overall treatment leads to the creation of basic sites showing a great activity for H(2)S gas in the presence of water vapor. The mechanism has been established by a series of characterizations before, during, and after the different operation units. The KOH deposited after impregnation is carbonated into KHCO(3) at room temperature and then decomposed into K(2)CO(3) during the thermal treatment. K(2)CO(3) and H(2)S dissolve in a liquid aqueous solution formed on the fiber surface. Then carbonate ions and H(2)S molecules react together almost completely to yield HS(-) species. As a consequence the sorption capacities of hydrogen sulfide on the impregnated fibers are much higher, even for small hydrogen sulfide volume fractions. PMID:15120288

  10. Volatile organic compound emissions in relation to plant carbon fixation and the terrestrial carbon budget

    NASA Astrophysics Data System (ADS)

    Kesselmeier, Jrgen; Ciccioli, Paolo; Kuhn, Uwe; Stefani, Paolo; Biesenthal, Thomas; Rottenberger, Stefanie; Wolf, Annette; Vitullo, Marina; Valentini, Ricardo; Nobre, Antonio; Kabat, Pavel; Andreae, Meinrat O.


    A substantial amount of carbon is emitted by terrestrial vegetation as biogenic volatile organic compounds (VOC), which contributes to the oxidative capacity of the atmosphere, to particle production and to the carbon cycle. With regard to the carbon budget of the terrestrial biosphere, a release of these carbon compounds is regarded as a loss of photosynthetically fixed carbon. The significance of this loss for the regional and global carbon cycles is controversial. We estimate the amount of VOC carbon emitted in relation to the CO2 taken up, based on our own enclosure and micrometeorological flux measurements of VOC emissions and CO2 exchange within the Mediterranean area and the tropical rainforest in Amazonia and on literature data. While VOC flux estimates are small in relation to net primary productivity and gross primary productivity, the amount of carbon lost as VOC emissions can be highly significant relative to net ecosystem productivity. In fact, VOC losses are of the same order of magnitude as net biome productivity. Although we must assume that large amounts of these reemissions are recycled within the biosphere, a substantial part can be assumed to be lost into longer-lived oxidation products that are lost from the terrestrial biosphere by transport. However, our current knowledge does not allow a reliable estimation of this carbon loss.

  11. Assessing methanotrophy and carbon fixation for biofuel production by Methanosarcina acetivorans


    Nazem-Bokaee, Hadi; Gopalakrishnan, Saratram; Ferry, James G.; Wood, Thomas K.; Maranas, Costas D.


    Methanosarcina acetivorans is a model archaeon with renewed interest due to its unique reversible methane production pathways. However, the mechanism and relevant pathways implicated in (co)utilizing novel carbon substrates in this organism are still not fully understood. This paper provides a comprehensive inventory of thermodynamically feasible routes for anaerobic methane oxidation, co-reactant utilization, and maximum carbon yields of major biofuel candidates by M. acetivorans. Here, an updated genome-scale metabolic model of M. acetivorans is introduced (iMAC868 containing 868 genes, 845 reactions, and 718 metabolites) by integrating information from two previously reconstructed metabolic models (i.e., iVS941 and iMB745), modifying 17 reactions,more » adding 24 new reactions, and revising 64 gene-proteinreaction associations based on newly available information. The new model establishes improved predictions of growth yields on native substrates and is capable of correctly predicting the knockout outcomes for 27 out of 28 gene deletion mutants. By tracing a bifurcated electron flow mechanism, the iMAC868 model predicts thermodynamically feasible (co)utilization pathway of methane and bicarbonate using various terminal electron acceptors through the reversal of the aceticlastic pathway. In conclusion, this effort paves the way in informing the search for thermodynamically feasible ways of (co)utilizing novel carbon substrates in the domain Archaea.« less

  12. Genomic signatures of fifth autotrophic carbon assimilation pathway in bathypelagic Crenarchaeota.


    La Cono, Violetta; Smedile, Francesco; Ferrer, Manuel; Golyshin, Peter N; Giuliano, Laura; Yakimov, Michail M


    Marine Crenarchaeota, ubiquitous and abundant organisms in the oceans worldwide, remain metabolically uncharacterized, largely due to their low cultivability. Identification of candidate genes for bicarbonate fixation pathway in the Cenarchaeum symbiosum A was an initial step in understanding the physiology and ecology of marine Crenarchaeota. Recent cultivation and genome sequencing of obligate chemoautotrophic Nitrosopumilus maritimus SCM1 were a major breakthrough towards understanding of their functioning and provide a valuable model for experimental validation of genomic data. Here we present the identification of multiple key components of 3-hydroxipropionate/4-hydroxybutyrate cycle, the fifth pathway in carbon fixation, found in data sets of environmental sequences representing uncultivated superficial and bathypelagic Crenarchaeota from Sargasso sea (GOS data set) and KM3 (Mediterranean Sea) and ALOHA (Atlantic ocean) stations. These organisms are likely to use acetyl-CoA/propionyl-CoA carboxylase(s) as CO?-fixing enzyme(s) to form succinyl-CoA, from which one molecule of acetyl-CoA is regenerated via 4-hydroxybutyrate cleavage and another acetyl-CoA to be the pathway product. The genetic distinctiveness and matching sympatric abundance imply that marine crenarchaeal genotypes from the three different geographic sites share similar ecophysiological properties, and therefore may represent fundamental units of marine ecosystem functioning. To couple results of sequence comparison with the dark ocean primary production, dissolved inorganic carbon fixation rates were measured at KM3 Station (3000 m depth, Eastern Mediterranean Sea), i.e. at the same site and depth used for metagenomic library construction. PMID:21255356

  13. High cell-specific rates of nitrogen and carbon fixation by the cyanobacterium Aphanizomenon sp. at low temperatures in the Baltic Sea.


    Svedn, Jennie B; Adam, Birgit; Walve, Jakob; Nahar, Nurun; Musat, Niculina; Lavik, Gaute; Whitehouse, Martin J; Kuypers, Marcel M M; Ploug, Helle


    Aphanizomenon is a widespread genus of nitrogen (N2)-fixing cyanobacteria in lakes and estuaries, accounting for a large fraction of the summer N2-fixation in the Baltic Sea. However, information about its cell-specific carbon (C)- and N2-fixation rates in the early growth season has not previously been reported. We combined various methods to study N2-fixation, photosynthesis and respiration in field-sampled Baltic Sea Aphanizomenon sp. during early summer at 10C. Stable isotope incubations at in situ light intensities during 24 h combined with cell-specific secondary ion mass spectrometry showed an average net N2-fixation rate of 55 fmol N cell(-1) day(-1). Dark net N2-fixation rates over a course of 12 h were 20% of those measured in light. C-fixation, but not N2-fixation, was inhibited by high ambient light intensities during daytime. Consequently, the C:N fixation ratio varied substantially over the diel cycle. C- and N2-fixation rates were comparable to those reported for Aphanizomenon sp. in August at 19C, using the same methods. High respiration rates (23% of gross photosynthesis) were measured with (14)C-incubations and O2-microsensors, and presumably reflect the energy needed for high N2-fixation rates. Hence, Aphanizomenon sp. is an important contributor to N2-fixation at low in situ temperatures in the early growth season. PMID:26511856

  14. Phytoplankton Productivity in an Arctic Fjord (West Greenland): Estimating Electron Requirements for Carbon Fixation and Oxygen Production.


    Hancke, Kasper; Dalsgaard, Tage; Sejr, Mikael Kristian; Markager, Stiig; Glud, Ronnie Nhr


    Accurate quantification of pelagic primary production is essential for quantifying the marine carbon turnover and the energy supply to the food web. Knowing the electron requirement (?) for carbon (C) fixation (?C) and oxygen (O2) production (?O2), variable fluorescence has the potential to quantify primary production in microalgae, and hereby increasing spatial and temporal resolution of measurements compared to traditional methods. Here we quantify ?C and ?O2 through measures of Pulse Amplitude Modulated (PAM) fluorometry, C fixation and O2 production in an Arctic fjord (Godthbsfjorden, W Greenland). Through short- (2h) and long-term (24h) experiments, rates of electron transfer (ETRPSII), C fixation and/or O2 production were quantified and compared. Absolute rates of ETR were derived by accounting for Photosystem II light absorption and spectral light composition. Two-hour incubations revealed a linear relationship between ETRPSII and gross 14C fixation (R2 = 0.81) during light-limited photosynthesis, giving a ?C of 7.6 0.6 (mean S.E.) mol (mol C)-1. Diel net rates also demonstrated a linear relationship between ETRPSII and C fixation giving a ?C of 11.2 1.3 mol (mol C)-1 (R2 = 0.86). For net O2 production the electron requirement was lower than for net C fixation giving 6.5 0.9 mol (mol O2)-1 (R2 = 0.94). This, however, still is an electron requirement 1.6 times higher than the theoretical minimum for O2 production [i.e. 4 mol (mol O2)-1]. The discrepancy is explained by respiratory activity and non-photochemical electron requirements and the variability is discussed. In conclusion, the bio-optical method and derived electron requirement support conversion of ETR to units of C or O2, paving the road for improved spatial and temporal resolution of primary production estimates. PMID:26218096

  15. Hydrogen-based carbon fixation in the earliest known photosynthetic organisms

    NASA Astrophysics Data System (ADS)

    Tice, Michael M.; Lowe, Donald R.


    Thin carbonaceous laminations preserved in shallow-water facies of the 3416 Ma Buck Reef Chert, South Africa, have been interpreted to represent some of the oldest-known mats constructed by photosynthetic microbes. Preservation of these mats within a unit containing facies deposited at water depths ranging from 0 m to >200 m provides an opportunity to explore the electron donors employed in early microbial photosynthesis. The presence of siderite (FeCO3) as a primary sediment, lack of hematite (Fe2O3), and lack of cerium anomalies throughout the Buck Reef Chert imply that the entire water column was anoxic despite the presence of photosynthetic organisms. Authigenic uranium (Ua = U Th/3) correlates inversely with siderite abundance, suggesting that variations in carbonate rather than oxygen activity controlled uranium mobility. The inferred lack of oxygen and ferric minerals and the presence of dissolved Fe2+ in the water column imply that H2O, Fe2+, and H2S could not have served as primary electron donors for carbon fixation. It is most likely that Buck Reef Chert bacteria utilized H2 as the primary reductant for photosynthesis.

  16. Insights into hydrogen bond donor promoted fixation of carbon dioxide with epoxides catalyzed by ionic liquids.


    Liu, Mengshuai; Gao, Kunqi; Liang, Lin; Wang, Fangxiao; Shi, Lei; Sheng, Li; Sun, Jianmin


    Catalytic coupling of carbon dioxide with epoxides to obtain cyclic carbonates is an important reaction that has been receiving renewed interest. In this contribution, the cycloaddition reaction in the presence of various hydrogen bond donors (HBDs) catalyzed by hydroxyl/carboxyl task-specific ionic liquids (ILs) is studied in detail. It was found that the activity of ILs could be significantly enhanced in the presence of ethylene glycol (EG), and EG/HEBimBr were the most efficient catalysts for the CO2 cycloaddition to propylene oxide. Moreover, the binary catalysts were also efficiently versatile for the CO2 cycloaddition to less active epoxides such as styrene oxide and cyclohexene oxide. Besides, the minimum energy paths for this hydrogen bond-promoted catalytic reaction were calculated using the density functional theory (DFT) method. The DFT results suggested that the ring-closing reaction was the rate-determining step in the HEBimBr-catalyzed cycloaddition reaction but the EG addition could remarkably reduce its energy barrier as the formation of a hydrogen bond between EG and the oxygen atom of epoxides led this process along the standard SN2 mechanism. As a result, the ring-opening reaction became the rate-determining step in the EG/HEBimBr-catalyzed cycloaddition reaction. The work reported herein helped the understanding and design of catalysts for efficient fixation of CO2 to epoxides via hydrogen bond activation. PMID:25639733

  17. Carbon and nitrogen fixation differ between successional stages of biological soil crusts in the Colorado Plateau and Chihuahuan Desert

    USGS Publications Warehouse

    Housman, D.C.; Powers, H.H.; Collins, A.D.; Belnap, J.


    Biological soil crusts (cyanobacteria, mosses and lichens collectively) perform essential ecosystem services, including carbon (C) and nitrogen (N) fixation. Climate and land-use change are converting later successional soil crusts to early successional soil crusts with lower C and N fixation rates. To quantify the effect of such conversions on C and N dynamics in desert ecosystems we seasonally measured diurnal fixation rates in different biological soil crusts. We classified plots on the Colorado Plateau (Canyonlands) and Chihuahuan Desert (Jornada) as early (Microcoleus) or later successional (Nostoc/Scytonema or Placidium/Collema) and measured photosynthesis (Pn), nitrogenase activity (NA), and chlorophyll fluorescence (Fv/Fm) on metabolically active (moist) soil crusts. Later successional crusts typically had greater Pn, averaging 1.2-1.3-fold higher daily C fixation in Canyonlands and 2.4-2.8-fold higher in the Jornada. Later successional crusts also had greater NA, averaging 1.3-7.5-fold higher daily N fixation in Canyonlands and 1.3-25.0-fold higher in the Jornada. Mean daily Fv/Fm was also greater in later successional Canyonlands crusts during winter, and Jornada crusts during all seasons except summer. Together these findings indicate conversion of soil crusts back to early successional stages results in large reductions of C and N inputs into these ecosystems.

  18. Induction of Photosynthetic Carbon Fixation in Anoxia Relies on Hydrogenase Activity and Proton-Gradient Regulation-Like1-Mediated Cyclic Electron Flow in Chlamydomonas reinhardtii.


    Godaux, Damien; Bailleul, Benjamin; Berne, Nicolas; Cardol, Pierre


    The model green microalga Chlamydomonas reinhardtii is frequently subject to periods of dark and anoxia in its natural environment. Here, by resorting to mutants defective in the maturation of the chloroplastic oxygen-sensitive hydrogenases or in Proton-Gradient Regulation-Like1 (PGRL1)-dependent cyclic electron flow around photosystem I (PSI-CEF), we demonstrate the sequential contribution of these alternative electron flows (AEFs) in the reactivation of photosynthetic carbon fixation during a shift from dark anoxia to light. At light onset, hydrogenase activity sustains a linear electron flow from photosystem II, which is followed by a transient PSI-CEF in the wild type. By promoting ATP synthesis without net generation of photosynthetic reductants, the two AEF are critical for restoration of the capacity for carbon dioxide fixation in the light. Our data also suggest that the decrease in hydrogen evolution with time of illumination might be due to competition for reduced ferredoxins between ferredoxin-NADP(+) oxidoreductase and hydrogenases, rather than due to the sensitivity of hydrogenase activity to oxygen. Finally, the absence of the two alternative pathways in a double mutant pgrl1 hydrogenase maturation factor G-2 is detrimental for photosynthesis and growth and cannot be compensated by any other AEF or anoxic metabolic responses. This highlights the role of hydrogenase activity and PSI-CEF in the ecological success of microalgae in low-oxygen environments. PMID:25931521

  19. Carbon-Fixation Rates and Associated Microbial Communities Residing in Arid and Ephemerally Wet Antarctic Dry Valley Soils

    PubMed Central

    Niederberger, Thomas D.; Sohm, Jill A.; Gunderson, Troy; Tirindelli, Joëlle; Capone, Douglas G.; Carpenter, Edward J.; Cary, S. Craig


    Carbon-fixation is a critical process in severely oligotrophic Antarctic Dry Valley (DV) soils and may represent the major source of carbon in these arid environments. However, rates of C-fixation in DVs are currently unknown and the microorganisms responsible for these activities unidentified. In this study, C-fixation rates measured in the bulk arid soils (<5% moisture) ranged from below detection limits to ∼12 nmol C/cc/h. Rates in ephemerally wet soils ranged from ∼20 to 750 nmol C/cc/h, equating to turnover rates of ∼7–140 days, with lower rates in stream-associated soils as compared to lake-associated soils. Sequencing of the large subunit of RuBisCO (cbbL) in these soils identified green-type sequences dominated by the 1B cyanobacterial phylotype in both arid and wet soils including the RNA fraction of the wet soil. Red-type cbbL genes were dominated by 1C actinobacterial phylotypes in arid soils, with wetted soils containing nearly equal proportions of 1C (actinobacterial and proteobacterial signatures) and 1D (algal) phylotypes. Complementary 16S rRNA and 18S rRNA gene sequencing also revealed distinct differences in community structure between biotopes. This study is the first of its kind to examine C-fixation rates in DV soils and the microorganisms potentially responsible for these activities. PMID:26696969

  20. Carbon-Fixation Rates and Associated Microbial Communities Residing in Arid and Ephemerally Wet Antarctic Dry Valley Soils.


    Niederberger, Thomas D; Sohm, Jill A; Gunderson, Troy; Tirindelli, Jolle; Capone, Douglas G; Carpenter, Edward J; Cary, S Craig


    Carbon-fixation is a critical process in severely oligotrophic Antarctic Dry Valley (DV) soils and may represent the major source of carbon in these arid environments. However, rates of C-fixation in DVs are currently unknown and the microorganisms responsible for these activities unidentified. In this study, C-fixation rates measured in the bulk arid soils (<5% moisture) ranged from below detection limits to ?12 nmol C/cc/h. Rates in ephemerally wet soils ranged from ?20 to 750 nmol C/cc/h, equating to turnover rates of ?7-140 days, with lower rates in stream-associated soils as compared to lake-associated soils. Sequencing of the large subunit of RuBisCO (cbbL) in these soils identified green-type sequences dominated by the 1B cyanobacterial phylotype in both arid and wet soils including the RNA fraction of the wet soil. Red-type cbbL genes were dominated by 1C actinobacterial phylotypes in arid soils, with wetted soils containing nearly equal proportions of 1C (actinobacterial and proteobacterial signatures) and 1D (algal) phylotypes. Complementary 16S rRNA and 18S rRNA gene sequencing also revealed distinct differences in community structure between biotopes. This study is the first of its kind to examine C-fixation rates in DV soils and the microorganisms potentially responsible for these activities. PMID:26696969

  1. Establishment of Microbial Eukaryotic Enrichment Cultures from a Chemically Stratified Antarctic Lake and Assessment of Carbon Fixation Potential

    PubMed Central

    Dolhi, Jenna M.; Ketchum, Nicholas; Morgan-Kiss, Rachael M.


    Lake Bonney is one of numerous permanently ice-covered lakes located in the McMurdo Dry Valleys, Antarctica. The perennial ice cover maintains a chemically stratified water column and unlike other inland bodies of water, largely prevents external input of carbon and nutrients from streams. Biota are exposed to numerous environmental stresses, including year-round severe nutrient deficiency, low temperatures, extreme shade, hypersalinity, and 24-hour darkness during the winter 1. These extreme environmental conditions limit the biota in Lake Bonney almost exclusively to microorganisms 2. Single-celled microbial eukaryotes (called "protists") are important players in global biogeochemical cycling 3 and play important ecological roles in the cycling of carbon in the dry valley lakes, occupying both primary and tertiary roles in the aquatic food web. In the dry valley aquatic food web, protists that fix inorganic carbon (autotrophy) are the major producers of organic carbon for organotrophic organisms 4, 2. Phagotrophic or heterotrophic protists capable of ingesting bacteria and smaller protists act as the top predators in the food web 5. Last, an unknown proportion of the protist population is capable of combined mixotrophic metabolism 6, 7. Mixotrophy in protists involves the ability to combine photosynthetic capability with phagotrophic ingestion of prey microorganisms. This form of mixotrophy differs from mixotrophic metabolism in bacterial species, which generally involves uptake dissolved carbon molecules. There are currently very few protist isolates from permanently ice-capped polar lakes, and studies of protist diversity and ecology in this extreme environment have been limited 8, 4, 9, 10, 5. A better understanding of protist metabolic versatility in the simple dry valley lake food web will aid in the development of models for the role of protists in the global carbon cycle. We employed an enrichment culture approach to isolate potentially phototrophic and mixotrophic protists from Lake Bonney. Sampling depths in the water column were chosen based on the location of primary production maxima and protist phylogenetic diversity 4, 11, as well as variability in major abiotic factors affecting protist trophic modes: shallow sampling depths are limited for major nutrients, while deeper sampling depths are limited by light availability. In addition, lake water samples were supplemented with multiple types of growth media to promote the growth of a variety of phototrophic organisms. RubisCO catalyzes the rate limiting step in the Calvin Benson Bassham (CBB) cycle, the major pathway by which autotrophic organisms fix inorganic carbon and provide organic carbon for higher trophic levels in aquatic and terrestrial food webs 12. In this study, we applied a radioisotope assay modified for filtered samples 13 to monitor maximum carboxylase activity as a proxy for carbon fixation potential and metabolic versatility in the Lake Bonney enrichment cultures. PMID:22546995

  2. Fixation stability dictates the differentiation pathway of periosteal progenitor cells in fracture repair.


    Hagiwara, Yusuke; Dyment, Nathaniel A; Jiang, Xi; Jiang Ping, Huang; Ackert-Bicknell, Cheryl; Adams, Douglas J; Rowe, David W


    This study compared fracture repair stabilized by intramedullary pin (IMP) or external fixation (EF) in GFP reporter mice. A modified IMP was used as control while EF utilized six needles inserted transversely through the tibia and into a segment of a syringe barrel. X-rays taken at days 0, 14, and 35 showed that IMP resulted in significant three-dimensional deformity with a large callus while EF showed minimal deformity and callus formation. Cryohistological analysis of IMP at day 14 confirmed a large ColX-RFPchry+ callus surrounded by woven bone (Col3.6-GFPcyan) and TRAP+ osteoclasts with mature bone (hOC-GFPtpz) at the base. By day 35, cartilaginous components had been resorbed and an outer cortical shell (OCS) showed evidence of inward modeling. In contrast, the EF at day 14 showed no evidence of cartilage formation. Instead, periosteal-derived osteoblasts (Col3.6-GFPcyan) entered the fracture cleft and formed woven bone that spanned the marrow space. By day 35, mature bone had formed that was contiguous with the opposing cortical bone. Fracture site stability greatly affects the cellular response during repair and must be considered in the preclinical models that test therapies for improving fracture healing. PMID:25639792

  3. Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

    PubMed Central

    Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie


    Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae. PMID:23585853

  4. Characterization of microalgae-bacteria consortium cultured in landfill leachate for carbon fixation and lipid production.


    Zhao, Xin; Zhou, Yan; Huang, Sheng; Qiu, Duanyang; Schideman, Lance; Chai, Xiaoli; Zhao, Youcai


    The characteristics of cultivating high-density microalgae-bacteria consortium with landfill leachate was tested in this study. Landfill leachate was collected from Laogang landfill operated for over 10 years in Shanghai, China. The maximum biomass concentration of 1.58g L(-1) and chlorophyll a level of 22mg L(-1) were obtained in 10% leachate spike ratio. Meanwhile, up to 90% of the total nitrogen in landfill leachate was removed in culture with 10% leachate spike ratio with a total nitrogen concentration of 221.6mg L(-1). The fluorescence peak of humic-like organic matters red shifted to longer wavelengths by the end of culture, indicating that microalgae-bacteria consortium was effective for treating landfill leachate contaminants. Furthermore, with the leachate spike ratio of 10%, the maximum lipid productivity and carbon fixation were 24.1 and 65.8mg L(-1)d(-1), respectively. Results of this research provide valuable information for optimizing microalgae culture in landfill leachate. PMID:24525217

  5. Carbon Dioxide Fixation in the Light and in the Dark by Isolated Spinach Chloroplasts 1

    PubMed Central

    Avron, Mordhay; Gibbs, Martin


    Factors affecting CO2 fixation in the spinach (Spinacia oleracea) chloroplast were investigated. Free magnesium ions are shown to be highly inhibitory for photosynthetic CO2 fixation in isolated intact spinach chloroplasts. The pH optimum for CO2 fixation is about 8.5 but is dependent upon the reaction medium. Conditions are defined under which chloroplasts illuminated in the absence of CO2 accumulate ribulose 1,5-diphosphate, and fix CO2 in a subsequent dark period when high magnesium ion concentrations are provided. The regulation of photosynthetic CO2 assimilation by these factors is discussed. PMID:16658664

  6. Rates of fixation by lightning of carbon and nitrogen in possible primitive atmospheres.


    Chameides, W L; Walker, J C


    A thermochemical-hydrodynamic model of the production of trace species by electrical discharges has been used to estimate the rates of fixation of C and N by lightning in the primitive atmosphere. Calculations for various possible mixtures of CH4, CO2, CO, N2, H2, and H2O reveal that the prime species produced were probably HCN and NO and that the key parameter determining the rates of fixation was the ratio of C atoms to O atoms in the atmosphere. Atmospheres with C more abundant than O have large HCN fixation rates, in excess of 10(17) molecules J-1, but small NO yields. However, when O is more abundant than C, the NO fixation rate approaches 10(17) molecules J-1 while the HCN yield is small. The implications for the evolution of life are discussed. PMID:6276836

  7. Rates of fixation by lightning of carbon and nitrogen in possible primitive atmospheres

    NASA Technical Reports Server (NTRS)

    Chameides, W. L.; Walker, J. C. G.


    A thermochemical-hydrodynamic model of the production of trace species by electrical discharges has been used to estimate the rates of fixation of C and N by lightning in the primitive atmosphere. Calculations for various possible mixtures of CH4, CO2, CO, N2, H2, and H2O reveal that the prime species produced were probably HCN and NO and that the key parameter determining the rates of fixation was the ratio of C atoms to O atoms in the atmosphere. Atmospheres with C more abundant than O have large HCN fixation rates, in excess of 10 to the 17th molecules/J, but small NO yields. However, when O is more abundant than C, the NO fixation rate approaches 10 to the 17th molecules/J while the HCN yield is small. The implications for the evolution of life are discussed.

  8. Co-optimization of diesel fuel biodegradation and N{sub 2} fixation through the addition of particulate organic carbon

    SciTech Connect

    Piehler, M.; Swistak, J.; Paerl, H.


    Petroleum hydrocarbon pollution in the marine environment is widespread and current bioremedial techniques are often not cost effective for small spills. The formulation of simple and inexpensive bioremedial methods could help reduce the impacts of frequent low volume spills in areas like marinas and ports. Particulate organic carbon (POC) was added to diesel fuel amended samples from inshore marine waters in the form of corn-slash (post-harvest leaves and stems), with and without inorganic nutrients (nitrate and phosphate). Biodegradation of diesel fuel ({sup 14}C hexadecane mineralization) and N{sub 2} fixation were measured in response to the additions, The addition of POC was necessary for N{sub 2} fixation and diesel fuel biodegradation to co-occur. The effects of diesel fuel and inorganic nutrient additions on N{sub 2} fixation rates were not consistent, with both inhibitory and stimulatory responses to each addition observed. The highest observed diesel fuel biodegradation levels were in response to treatments that included inorganic nutrients. The addition of POC alone increased diesel fuel degradation levels above that observed in the control. In an attempt to determine the effect of the POC on the microbial community, the corn particles were observed microscopically using scanning electron microscopy and light microscopy with tetrazolium salt additions. The corn particles were found to have abundant attached bacterial communities and microscale oxygen concentration gradients occurring on individual particles. The formation of oxygen replete microzones may be essential for the co-occurrence of aerobic diesel fuel biodegradation and oxygen inhibited N2 fixation. Mesocosm experiments are currently underway to further examine the structure and function of this primarily heterotrophic system and to explore the potential contribution of N{sub 2} fixation to the N requirements of diesel fuel biodegradation.

  9. The role of dark carbon dioxide fixation in root nodules of soybean.


    King, B J; Layzell, D B; Canvin, D T


    The magnitude and role of dark CO(2) fixation were examined in nodules of intact soybean plants (Harosoy 63 x Rhizobium japonicum strain USDA 16). The estimated rate of nodule dark CO(2) fixation, based on a 2 minute pulse-feed with (14)CO(2) under saturating conditions, was 102 micromoles per gram dry weight per hour. This was equivalent to 14% of net nodule respiration. Only 18% of this CO(2) fixation was estimated to be required for organic and amino acid synthesis for growth and export processes. The major portion (75-92%) of fixed label was released as CO(2) within 60 minutes. The labeling pattern during pulse-chase experiments was consistent with CO(2) fixation by phosphoenolpyruvate carboxylase. During the chase, the greatest loss of label occurred in organic acids. Exposure of nodulated roots to Ar:O(2) (80:20) did not affect dark CO(2) fixation, while exposure to O(2):CO(2) (95:5) resulted in 54% inhibition. From these results, it was concluded that at least 66% of dark CO(2) fixation in soybean may be involved with the production of organic acids, which when oxidized would be capable of providing at least 48% of the requirement for ATP equivalents to support nitrogenase activity. PMID:16664774

  10. Role of dark carbon dioxide fixation in root nodules of soybean. [Rhizobium japonicum

    SciTech Connect

    King, B.J.; Layzell, D.B.; Canvin, D.T.


    The magnitude and role of dark Co/sub 2/ fixation were examined in nodules of intact soybean plants (Harosoy 63 x Rhizobium japonicum strain USDA 16). The estimated rate of nodule dark CO/sub 2/ fixation, based on a 2 minute pulse-feed with /sup 14/CO/sub 2/ under saturating conditions, was 102 micromoles per gram dry weight per hour. This was equivalent to 14% of net nodule respiration. Only 18% of this CO/sub 2/ fixation was estimated to be required for organic and amino acid synthesis for growth and export processes. The major portion (75-92%) of fixed label was released as CO/sub 2/ within 60 minutes. The labeling pattern during pulse-chase experiments was consistent with CO/sub 2/ fixation by phosphoenolpyruvate carboxylase. During the chase, the greatest loss of label occurred in organic acids. Exposure of nodulated roots to Ar:O/sub 2/(80:20) did not affect dark CO/sub 2/ fixation, while exposure to O/sub 2/:CO/sub 2/(95:5) resulted in 54% inhibition. From these results, it was concluded that at least 66% of dark CO/sub 2/ fixation in soybean may be involved with the production of organic acids, which when oxidized would be capable of providing at least 48% of the requirement for ATP equivalents to support nitrogenase activity.

  11. Phytoplankton Productivity in an Arctic Fjord (West Greenland): Estimating Electron Requirements for Carbon Fixation and Oxygen Production

    PubMed Central

    Hancke, Kasper; Dalsgaard, Tage; Sejr, Mikael Kristian; Markager, Stiig; Glud, Ronnie Nøhr


    Accurate quantification of pelagic primary production is essential for quantifying the marine carbon turnover and the energy supply to the food web. Knowing the electron requirement (Κ) for carbon (C) fixation (ΚC) and oxygen (O2) production (ΚO2), variable fluorescence has the potential to quantify primary production in microalgae, and hereby increasing spatial and temporal resolution of measurements compared to traditional methods. Here we quantify ΚC and ΚO2 through measures of Pulse Amplitude Modulated (PAM) fluorometry, C fixation and O2 production in an Arctic fjord (Godthåbsfjorden, W Greenland). Through short- (2h) and long-term (24h) experiments, rates of electron transfer (ETRPSII), C fixation and/or O2 production were quantified and compared. Absolute rates of ETR were derived by accounting for Photosystem II light absorption and spectral light composition. Two-hour incubations revealed a linear relationship between ETRPSII and gross 14C fixation (R2 = 0.81) during light-limited photosynthesis, giving a ΚC of 7.6 ± 0.6 (mean ± S.E.) mol é (mol C)−1. Diel net rates also demonstrated a linear relationship between ETRPSII and C fixation giving a ΚC of 11.2 ± 1.3 mol é (mol C)−1 (R2 = 0.86). For net O2 production the electron requirement was lower than for net C fixation giving 6.5 ± 0.9 mol é (mol O2)−1 (R2 = 0.94). This, however, still is an electron requirement 1.6 times higher than the theoretical minimum for O2 production [i.e. 4 mol é (mol O2)−1]. The discrepancy is explained by respiratory activity and non-photochemical electron requirements and the variability is discussed. In conclusion, the bio-optical method and derived electron requirement support conversion of ETR to units of C or O2, paving the road for improved spatial and temporal resolution of primary production estimates. PMID:26218096

  12. Microcystin content of Microcystis aeruginosa is modulated by nitrogen uptake rate relative to specific growth rate or carbon fixation rate.

    TOXLINE Toxicology Bibliographic Information

    Downing TG; Meyer C; Gehringer MM; van de Venter M


    Modulation of microcystin production has been extensively studied in both batch and continuous cultures. Positive correlations with medium nitrogen, medium phosphorous, light intensity, inorganic carbon availability, and growth rate have been reported. Negative correlations have been reported between microcystin content and medium phosphorous. The only reported quantitative relationship between any variable and microcystin production was that of growth rate. Microcystis aeruginosa PCC7806 was therefore cultured under continuous culture conditions in a bubble-lift reactor at a growth rate of 0.01 h(-1) in modified BG11 (constant phosphate concentration of 0.195 mM and varying nitrate from 0.125 to 18 mM) and sampled at steady states for analysis of cell number, microcystin content, cellular N and P, residual medium nutrient concentration, and carbon fixation rate. Cellular microcystin quotas showed significant positive correlation with both nitrate uptake and cellular nitrogen content and were negatively correlated with carbon fixation rate, phosphate uptake, and cellular phosphorous. Thus, the ratio of nitrate uptake to phosphate uptake, cellular N to cellular P, and nitrate uptake to carbon fixation were positively correlated to cellular microcystin. Microcystin quotas increased 10-fold from the lowest to the highest steady-state values. Cellular microcystin content therefore is controlled to a significant extent by variables other than growth rate, as was previously reported, with nitrogen the most significant modulator. Batch culture in BG11 under identical conditions yielded increased microcystin when nitrogen uptake exceeded relative growth rate, confirming the importance of nitrogen uptake in the modulation of microcystin content for a specific growth rate.

  13. Enhancing Carbon Fixation by Metabolic Engineering: A Model System of Complex Network Modulation

    SciTech Connect

    Dr. Gregory Stephanopoulos


    In the first two years of this research we focused on the development of a DNA microarray for transcriptional studies in the photosynthetic organism Synechocystis and the elucidation of the metabolic pathway for biopolymer synthesis in this organism. In addition we also advanced the molecular biological tools for metabolic engineering of biopolymer synthesis in Synechocystis and initiated a series of physiological studies for the elucidation of the carbon fixing pathways and basic central carbon metabolism of these organisms. During the last two-year period we focused our attention on the continuation and completion of the last task, namely, the development of tools for basic investigations of the physiology of these cells through, primarily, the determination of their metabolic fluxes. The reason for this decision lies in the importance of fluxes as key indicators of physiology and the high level of information content they carry in terms of identifying rate limiting steps in a metabolic pathway. While flux determination is a well-advanced subject for heterotrophic organisms, for the case of autotrophic bacteria, like Synechocystis, some special challenges had to be overcome. These challenges stem mostly from the fact that if one uses {sup 13}C labeled CO{sub 2} for flux determination, the {sup 13}C label will mark, at steady state, all carbon atoms of all cellular metabolites, thus eliminating the necessary differentiation required for flux determination. This peculiarity of autotrophic organisms makes it imperative to carry out flux determination under transient conditions, something that had not been accomplished before. We are pleased to report that we have solved this problem and we are now able to determine fluxes in photosynthetic organisms from stable isotope labeling experiments followed by measurements of label enrichment in cellular metabolites using Gas Chromatography-Mass Spectrometry. We have conducted extensive simulations to test the method and also are presently validating it experimentally using data generated in collaboration with a research group at Purdue University. As result of these studies we can now determine, for the first time, fluxes in photosynthetic organisms and, eventually, in plants.

  14. Diurnal variation in the coupling of photosynthetic electron transport and carbon fixation in iron-limited phytoplankton in the NE subarctic Pacific

    NASA Astrophysics Data System (ADS)

    Schuback, N.; Flecken, M.; Maldonado, M. T.; Tortell, P. D.


    Active chlorophyll a fluorescence approaches, including fast repetition rate fluorometry (FRRF), have the potential to provide estimates of phytoplankton primary productivity at unprecedented spatial and temporal resolution. FRRF-derived productivity rates are based on estimates of charge separation at PSII (ETRRCII), which must be converted into ecologically relevant units of carbon fixation. Understanding sources of variability in the coupling of ETRRCII and carbon fixation provides physiological insight into phytoplankton photosynthesis, and is critical for the application of FRRF as a primary productivity measurement tool. In the present study, we simultaneously measured phytoplankton carbon fixation and ETRRCII in the iron-limited NE subarctic Pacific, over the course of a diurnal cycle. We show that rates of ETRRCII are closely tied to the diurnal cycle in light availability, whereas rates of carbon fixation appear to be influenced by endogenous changes in metabolic energy allocation under iron-limited conditions. Unsynchronized diurnal oscillations of the two rates led to 3.5 fold changes in the conversion factor coupling ETRRCII and carbon fixation (Φe:C / nPSII). Consequently, diurnal variability in phytoplankton carbon fixation cannot be adequately captured with FRRF approaches if a constant conversion factor is applied. Utilizing several auxiliary photophysiological measurements, we observed that a high conversion factor is associated with conditions of excess light, and correlates with the expression of non-photochemical quenching (NPQ) in the pigment antenna, as derived from FRRF measurements. The observed correlation between NPQ and the conversion factor Φe:C / nPSII has the potential to improve estimates of phytoplankton carbon fixation rates from FRRF measurements alone.

  15. Diurnal variation in the coupling of photosynthetic electron transport and carbon fixation in iron-limited phytoplankton in the NE subarctic Pacific

    NASA Astrophysics Data System (ADS)

    Schuback, Nina; Flecken, Mirkko; Maldonado, Maria T.; Tortell, Philippe D.


    Active chlorophyll a fluorescence approaches, including fast repetition rate fluorometry (FRRF), have the potential to provide estimates of phytoplankton primary productivity at an unprecedented spatial and temporal resolution. FRRF-derived productivity rates are based on estimates of charge separation in reaction center II (ETRRCII), which must be converted into ecologically relevant units of carbon fixation. Understanding sources of variability in the coupling of ETRRCII and carbon fixation provides physiological insight into phytoplankton photosynthesis and is critical for the application of FRRF as a primary productivity measurement tool. In the present study, we simultaneously measured phytoplankton carbon fixation and ETRRCII in the iron-limited NE subarctic Pacific over the course of a diurnal cycle. We show that rates of ETRRCII are closely tied to the diurnal cycle in light availability, whereas rates of carbon fixation appear to be influenced by endogenous changes in metabolic energy allocation under iron-limited conditions. Unsynchronized diurnal oscillations of the two rates led to 3.5-fold changes in the conversion factor between ETRRCII and carbon fixation (Kc / nPSII). Consequently, diurnal variability in phytoplankton carbon fixation cannot be adequately captured with FRRF approaches if a constant conversion factor is applied. Utilizing several auxiliary photophysiological measurements, we observed that a high conversion factor is associated with conditions of excess light and correlates with the increased expression of non-photochemical quenching (NPQ) in the pigment antenna, as derived from FRRF measurements. The observed correlation between NPQ and Kc / nPSII requires further validation but has the potential to improve estimates of phytoplankton carbon fixation rates from FRRF measurements alone.

  16. Simultaneous quantification of active carbon- and nitrogen-fixing communities and estimation of fixation rates using fluorescence in situ hybridization and flow cytometry.


    McInnes, Allison S; Shepard, Alicia K; Raes, Eric J; Waite, Anya M; Quigg, Antonietta


    Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and (14)C/(15)N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

  17. Simultaneous Quantification of Active Carbon- and Nitrogen-Fixing Communities and Estimation of Fixation Rates Using Fluorescence In Situ Hybridization and Flow Cytometry

    PubMed Central

    Shepard, Alicia K.; Raes, Eric J.; Waite, Anya M.; Quigg, Antonietta


    Understanding the interconnectivity of oceanic carbon and nitrogen cycles, specifically carbon and nitrogen fixation, is essential in elucidating the fate and distribution of carbon in the ocean. Traditional techniques measure either organism abundance or biochemical rates. As such, measurements are performed on separate samples and on different time scales. Here, we developed a method to simultaneously quantify organisms while estimating rates of fixation across time and space for both carbon and nitrogen. Tyramide signal amplification fluorescence in situ hybridization (TSA-FISH) of mRNA for functionally specific oligonucleotide probes for rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase; carbon fixation) and nifH (nitrogenase; nitrogen fixation) was combined with flow cytometry to measure abundance and estimate activity. Cultured samples representing a diversity of phytoplankton (cyanobacteria, coccolithophores, chlorophytes, diatoms, and dinoflagellates), as well as environmental samples from the open ocean (Gulf of Mexico, USA, and southeastern Indian Ocean, Australia) and an estuary (Galveston Bay, Texas, USA), were successfully hybridized. Strong correlations between positively tagged community abundance and 14C/15N measurements are presented. We propose that these methods can be used to estimate carbon and nitrogen fixation in environmental communities. The utilization of mRNA TSA-FISH to detect multiple active microbial functions within the same sample will offer increased understanding of important biogeochemical cycles in the ocean. PMID:25172848

  18. Preferential remineralization of dissolved organic phosphorus and non-Redfield DOM dynamics in the global ocean: Impacts on marine productivity, nitrogen fixation, and carbon export

    NASA Astrophysics Data System (ADS)

    Letscher, Robert T.; Moore, J. Keith


    Selective removal of nitrogen (N) and phosphorus (P) from the marine dissolved organic matter (DOM) pool has been reported in several regional studies. Because DOM is an important advective/mixing pathway of carbon (C) export from the ocean surface layer and its non-Redfieldian stoichiometry would affect estimates of marine export production per unit N and P, we investigated the stoichiometry of marine DOM and its remineralization globally using a compiled DOM data set. Marine DOM is enriched in C and N compared to Redfield stoichiometry, averaging 317:39:1 and 810:48:1 for C:N:P within the degradable and total bulk pools, respectively. Dissolved organic phosphorus (DOP) is found to be preferentially remineralized about twice as rapidly with respect to the enriched C:N stoichiometry of marine DOM. Biogeochemical simulations with the Biogeochemical Elemental Cycling model using Redfield and variable DOM stoichiometry corroborate the need for non-Redfield dynamics to match the observed DOM stoichiometry. From our model simulations, preferential DOP remineralization is found to increase the strength of the biological pump by ~9% versus the case of Redfield DOM cycling. Global net primary productivity increases ~10% including an increase in marine nitrogen fixation of ~26% when preferential DOP remineralization and direct utilization of DOP by phytoplankton are included. The largest increases in marine nitrogen fixation, net primary productivity, and carbon export are observed within the western subtropical gyres, suggesting the lateral transfer of P in the form of DOP from the productive eastern and poleward gyre margins may be important for sustaining these processes downstream in the subtropical gyres.

  19. Engineering the Cyanobacterial Carbon Concentrating Mechanism for Enhanced CO2 Capture and Fixation

    SciTech Connect

    Sandh, Gustaf; Cai, Fei; Shih, Patrick; Kinney, James; Axen, Seth; Salmeen, Annette; Zarzycki, Jan; Sutter, Markus; Kerfeld, Cheryl


    In cyanobacteria CO2 fixation is localized in a special proteinaceous organelle, the carboxysome. The CO2 fixation enzymes are encapsulated by a selectively permeable protein shell. By structurally and functionally characterizing subunits of the carboxysome shell and the encapsulated proteins, we hope to understand what regulates the shape, assembly and permeability of the shell, as well as the targeting mechanism and organization of the encapsulated proteins. This knowledge will be used to enhance CO2 fixation in both cyanobacteria and plants through synthetic biology. The same strategy can also serve as a template for the production of modular synthetic bacterial organelles. Our research is conducted using a variety of techniques such as genomic sequencing and analysis, transcriptional regulation, DNA synthesis, synthetic biology, protein crystallization, Small Angle X-ray Scattering (SAXS), protein-protein interaction assays and phenotypic characterization using various types of cellular imaging, e.g. fluorescence microscopy, Transmission Electron Microscopy (TEM), and Soft X-ray Tomography (SXT).

  20. Carbon Cycling in Anabaena sp. PCC 7120. Sucrose Synthesis in the Heterocysts and Possible Role in Nitrogen Fixation1[OA

    PubMed Central

    Cumino, Andrea C.; Marcozzi, Clarisa; Barreiro, Roberto; Salerno, Graciela L.


    Nitrogen (N) available to plants mostly originates from N2 fixation carried out by prokaryotes. Certain cyanobacterial species contribute to this energetically expensive process related to carbon (C) metabolism. Several filamentous strains differentiate heterocysts, specialized N2-fixing cells. To understand how C and N metabolism are regulated in photodiazotrophically grown organisms, we investigated the role of sucrose (Suc) biosynthesis in N2 fixation in Anabaena sp. PCC 7120 (also known as Nostoc sp. PCC 7120). The presence of two Suc-phosphate synthases (SPS), SPS-A and SPS-B, directly involved in Suc synthesis with different glucosyl donor specificity, seems to be important in the N2-fixing filament. Measurement of enzyme activity and polypeptide levels plus reverse transcription-polymerase chain reaction experiments showed that total SPS expression is greater in cells grown in N2 versus combined N conditions. Only SPS-B, however, was seen to be active in the heterocyst, as confirmed by analysis of green fluorescent protein reporters. SPS-B gene expression is likely controlled at the transcriptional initiation level, probably in relation to a global N regulator. Metabolic control analysis indicated that the metabolism of glycogen and Suc is likely interconnected in N2-fixing filaments. These findings suggest that N2 fixation may be spatially compatible with Suc synthesis and support the role of the disaccharide as an intermediate in the reduced C flux in heterocyst-forming cyanobacteria. PMID:17237189

  1. Growth and nitrogen fixation in Lotus japonicus and Medicago truncatula under NaCl stress: nodule carbon metabolism.


    Lpez, Miguel; Herrera-Cervera, Jose A; Iribarne, Carmen; Tejera, Noel A; Lluch, Carmen


    Lotus japonicus and Medicago truncatula model legumes, which form determined and indeterminate nodules, respectively, provide a convenient system to study plant-Rhizobium interaction and to establish differences between the two types of nodules under salt stress conditions. We examined the effects of 25 and 50mM NaCl doses on growth and nitrogen fixation parameters, as well as carbohydrate content and carbon metabolism of M. truncatula and L. japonicus nodules. The leghemoglobin (Lb) content and nitrogen fixation rate (NFR) were approximately 10.0 and 2.0 times higher, respectively, in nodules of L. japonicus when compared with M. truncatula. Plant growth parameters and nitrogenase activity decreased with NaCl treatments in both legumes. Sucrose was the predominant sugar quantified in nodules of both legumes, showing a decrease in concentration in response to salt stress. The content of trehalose was low (less than 2.5% of total soluble sugars (TSS)) to act as an osmolyte in nodules, despite its concentration being increased under saline conditions. Nodule enzyme activities of trehalose-6-phosphate synthase (TPS) and trehalase (TRE) decreased with salinity. L. japonicus nodule carbon metabolism proved to be less sensitive to salinity than in M. truncatula, as enzymatic activities responsible for the carbon supply to the bacteroids to fuel nitrogen fixation, such as sucrose synthase (SS), alkaline invertase (AI), malate dehydrogenase (MDH) and phosphoenolpyruvate carboxylase (PEPC), were less affected by salt than the corresponding activities in barrel medics. However, nitrogenase activity was only inhibited by salinity in L. japonicus nodules. PMID:17728011

  2. Ammonia fixation by humic substances: A nitrogen-15 and carbon-13 NMR study

    USGS Publications Warehouse

    Thorn, K.A.; Mikita, M.A.


    The process of ammonia fixation has been studied in three well characterized and structurally diverse fulvic and humic acid samples. The Suwannee River fulvic acid, and the IHSS peat and leonardite humic acids, were reacted with 15N-labelled ammonium hydroxide, and analyzed by liquid phase 15N NMR spectrometry. Elemental analyses and liquid phase 13C NMR spectra also were recorded on the samples before and after reaction with ammonium hydroxide. The largest increase in percent nitrogen occurred with the Suwannee River fulvic acid, which had a nitrogen content of 0.88% before fixation and 3.17% after fixation. The 15N NMR spectra revealed that ammonia reacted similarly with all three samples, indicating that the functional groups which react with ammonia exist in structural configurations common to all three samples. The majority of nitrogcn incorporated into the samples appears to be in the form of indole and pyrrole nitrogen, followed by pyridine, pyrazine, amide and aminohydroquinone nitrogen. Chemical changes in the individual samples upon fixation could not be discerned from the 13C NMR spectra.

  3. Will Elevated Carbon Dioxide Concentration Amplify the Benefits of Nitrogen Fixation in Legumes?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Current evidence suggests there are three key features of the response of legumes to elevated [CO2]: (1) unlike other non-leguminous C3 plants, only legumes have the potential to maximize the benefit of elevated [CO2] by matching stimulated photosynthesis with increased N2 fixation; (2) this potenti...

  4. Light microenvironment and single-cell gradients of carbon fixation in tissues of symbiont-bearing corals.


    Wangpraseurt, Daniel; Pernice, Mathieu; Guagliardo, Paul; Kilburn, Matt R; Clode, Peta L; Polerecky, Lubos; Kühl, Michael


    Recent coral optics studies have revealed the presence of steep light gradients and optical microniches in tissues of symbiont-bearing corals. Yet, it is unknown whether such resource stratification allows for physiological differences of Symbiodinium within coral tissues. Using a combination of stable isotope labelling and nanoscale secondary ion mass spectrometry, we investigated in hospite carbon fixation of individual Symbiodinium as a function of the local O2 and light microenvironment within the coral host determined with microsensors. We found that net carbon fixation rates of individual Symbiodinium cells differed on average about sixfold between upper and lower tissue layers of single coral polyps, whereas the light and O2 microenvironments differed ~15- and 2.5-fold, respectively, indicating differences in light utilisation efficiency along the light microgradient within the coral tissue. Our study suggests that the structure of coral tissues might be conceptually similar to photosynthetic biofilms, where steep physico-chemical gradients define form and function of the local microbial community. PMID:26241503

  5. CO2 Fixation, Lipid Production, and Power Generation by a Novel Air-Lift-Type Microbial Carbon Capture Cell System.


    Hu, Xia; Liu, Baojun; Zhou, Jiti; Jin, Ruofei; Qiao, Sen; Liu, Guangfei


    An air-lift-type microbial carbon capture cell (ALMCC) was constructed for the first time by using an air-lift-type photobioreactor as the cathode chamber. The performance of ALMCC in fixing high concentration of CO2, producing energy (power and biodiesel), and removing COD together with nutrients was investigated and compared with the traditional microbial carbon capture cell (MCC) and air-lift-type photobioreactor (ALP). The ALMCC system produced a maximum power density of 972.5 mWm(-3) and removed 86.69% of COD, 70.52% of ammonium nitrogen, and 69.24% of phosphorus, which indicate that ALMCC performed better than MCC in terms of power generation and wastewater treatment efficiency. Besides, ALMCC demonstrated 9.98- and 1.88-fold increases over ALP and MCC in the CO2 fixation rate, respectively. Similarly, the ALMCC significantly presented a higher lipid productivity compared to those control reactors. More importantly, the preliminary analysis of energy balance suggested that the net energy of the ALMCC system was significantly superior to other systems and could theoretically produce enough energy to cover its consumption. In this work, the established ALMCC system simultaneously achieved the high level of CO2 fixation, energy recycle, and municipal wastewater treatment effectively and efficiently. PMID:26270956

  6. Single cell protein production of Euglena gracilis and carbon dioxide fixation in an innovative photo-bioreactor.


    Chae, S R; Hwang, E J; Shin, H S


    The biological fixation using microalgae has been known as an effective and economical carbon dioxide reduction technology. Carbon dioxide (CO2) fixation by microalgae has been shown to be effective and economical. Among various algae, a species Euglena gracilis was selected as it has advantages such as high protein content and high digestibility for animal feed. A kinetic model was studied in order to determine the relationship between specific growth rate and light intensity. The half-saturation constant for light intensity in the Monod model was 178.7 micromol photons/m2/s. The most favorable initial pH, temperature, and CO2 concentration were found to be 3.5, 27 degrees C, and 5-10% (vol/vol), respectively. Light intensity and hydraulic retention time were tested for effects on cell yield in a laboratory-scale photo-bioreactor of 100l working volume followed by semi-continuous and continuous culture. Subsequently, an innovative pilot-scale photo-bioreactor that used sunlight and flue gas was developed to increase production of this bioresource. The proposed pilot-scale reactor showed improved cell yield compared with the laboratory-scale reactor. PMID:16171688

  7. Carbon Dioxide Fixation in Roots and Nodules of Alnus glutinosa1

    PubMed Central

    McClure, Peter R.; Coker, George T.; Schubert, Karel R.


    Detached roots and nodules of the N2-fixing species, Albus glutinosa (European black alder), actively assimilate CO2. The maximum rates of dark CO2 fixation observed for detached nodules and roots were 15 and 3 micromoles CO2 fixed per gram dry weight per hour, respectively. The net incorporation of CO2 in these tissues was catalyzed by phosphoenolpyruvate carboxylase which produces organic acids, some of which are used in the synthesis of the amino acids, aspartate, glutamate, and citrulline and by carbamyl phosphate synthetase. The latter accounts for approximately 30 to 40% of the CO2 fixed and provides carbamyl phosphate for the synthesis of citrulline. Results of labeling studies suggest that there are multiple pools of malate present in nodules. The major pool is apparently metabolically inactive and of unknown function while the smaller pool is rapidly utilized in the synthesis of amino acids. Dark CO2 fixation and N2 fixation in nodules decreased after treatment of nodulated plants with nitrate while the percentage of the total 14C incorporated into organic acids increased. Phosphoenolpyruvate carboxylase and carbamyl phosphate synthetase play key roles in the synthesis of amino acids including citrulline and in the metabolism of N2-fixing nodules and roots of alder. PMID:16662882

  8. Phosphoketolase pathway engineering for carbon-efficient biocatalysis.


    Henard, Calvin Andrew; Freed, Emily Frances; Guarnieri, Michael Thomas


    Recent advances in metabolic engineering have facilitated the development of microbial biocatalysts capable of producing an array of bio-products, ranging from fuels to drug molecules. These bio-products are commonly generated through an acetyl-CoA intermediate, which serves as a key precursor in the biological conversion of carbon substrates. Conventional biocatalytic upgrading strategies proceeding through this route are limited by low carbon efficiencies, in large part due to carbon losses associated with pyruvate decarboxylation to acetyl-CoA. Bypass of pyruvate decarboxylation offers a means to dramatically enhance carbon yields and, in turn, bioprocess economics. Herein, we discuss recent advances and prospects for employing the phosphoketolase pathway for direct biosynthesis of acetyl-CoA from carbon substrates, and phosphoketolase-based metabolic engineering strategies for carbon efficient biocatalysis. PMID:26360872

  9. Geochemical roots of autotrophic carbon fixation: hydrothermal experiments in the system citric acid, H 2O-(FeS)-(NiS)

    NASA Astrophysics Data System (ADS)

    Cody, G. D.; Boctor, N. Z.; Hazen, R. M.; Brandes, J. A.; Morowitz, Harold J.; Yoder, H. S.


    Recent theories have proposed that life arose from primitive hydrothermal environments employing chemical reactions analogous to the reductive citrate cycle (RCC) as the primary pathway for carbon fixation. This chemistry is presumed to have developed as a natural consequence of the intrinsic geochemistry of the young, prebiotic, Earth. There has been no experimental evidence, however, demonstrating that there exists a natural pathway into such a cycle. Toward this end, the results of hydrothermal experiments involving citric acid are used as a method of deducing such a pathway. Homocatalytic reactions observed in the citric acid-H 2O experiments encompass many of the reactions found in modern metabolic systems, i.e., hydration-dehydration, retro-Aldol, decarboxylation, hydrogenation, and isomerization reactions. Three principal decomposition pathways operate to degrade citric acid under thermal and aquathermal conditions. It is concluded that the acid catalyzed ?? decarboxylation pathway, leading ultimately to propene and CO 2, may provide the most promise for reaction network reversal under natural hydrothermal conditions. Increased pressure is shown to accelerate the principal decarboxylation reactions under strictly hydrothermal conditions. The effect of forcing the pH via the addition of NaOH reveals that the ?? decarboxylation pathway operates even up to intermediate pH levels. The potential for network reversal (the conversion of propene and CO 2 up to a tricarboxylic acid) is demonstrated via the Koch (hydrocarboxylation) reaction promoted heterocatalytically with NiS in the presence of a source of CO. Specifically, an olefin (1-nonene) is converted to a monocarboxylic acid; methacrylic acid is converted to the dicarboxylic acid, methylsuccinic acid; and the dicarboxylic acid, itaconic acid, is converted into the tricarboxylic acid, hydroaconitic acid. A number of interesting sulfur-containing products are also formed that may provide for additional reaction. The intrinsic catalytic qualities of FeS and NiS are also explored in the absence of CO. It was shown that the addition of NiS has a minimal effect in the product distribution, whereas the addition of FeS leads to the formation of hydrogenated and sulfur-containing products (thioethers). These results point to a simple hydrothermal redox pathway for citric acid synthesis that may have provided a geochemical ignition point for the reductive citrate cycle.

  10. The role of pH in the regulation of carbon fixation in the chloroplast stroma. Studies on CO2 fixation in the light and dark.


    Werdan, K; Heldt, H W; Milovancev, M


    1. The pH in the stroma and in the thylakoid space has been measured in a number of chloroplast preparations in the dark and in the light at 20 degrees C. Illumination causes a decrease of the pH in the thylakoid space by 1.5 and an increase of the pH in the stroma by almost 1 pH unit. 2. CO2 fixation is shown to be strongly dependent on the pH in the stroma. The pH optimum was 8.1, with almost zero activity below pH 7.3.Phosphoglycerate reduction, which is a partial reaction of CO2 fixation, shows very little pH dependency. 3. Low concentrations of the uncoupler m-chlorocarbonylcyanide phenylhydrazone (CCCP) inhibit CO2 fixation without affecting phosphoglycerate reduction. This inhibition of CO2 fixation appears to be caused by reversal of light induced alkalisation in the stroma by CCCP. 4. Methylamine has a very different effect compared to CCCP. Increasing concentrations of methylamine inhibit CO2 fixation and phosphoglycerate reduction to the same extent. The light induced alkalisation of the stroma appears not to be significantly inhibited by methylamine, but the protons in the thylakoid space are neutralized. The inhibition of CO2 fixation by higher concentrations of methylamine is explained by an inhibition of photophosphorylation. It appears that methylamine does not abolish proton transport. 5. It is shown that intact chloroplasts are able to fix CO2 in the dark, yielding 3-phosphoglycerate. This requires the addition of dihydroxyacetone phosphate as precursor of ribulosemonophosphate and also to supply ATP, and the addition of oxaloacetate for reoxidation of the NADPH in the stroma. 6. Dark CO2 fixation in the presence of dihydroxyacetone phosphate and oxaloacetate has the same pH dependency as CO2 fixation in the light. This demonstrates that CO2 fixation in the dark is not possible, unless the pH in the medium is artificially raised to pH 8.8. PMID:239746

  11. 13C Metabolic Flux Analysis Identifies an Unusual Route for Pyruvate Dissimilation in Mycobacteria which Requires Isocitrate Lyase and Carbon Dioxide Fixation

    PubMed Central

    Beste, Dany J. V.; Bonde, Bhushan; Hawkins, Nathaniel; Ward, Jane L.; Beale, Michael H.; Noack, Stephan; Nöh, Katharina; Kruger, Nicholas J.; Ratcliffe, R. George; McFadden, Johnjoe


    Mycobacterium tuberculosis requires the enzyme isocitrate lyase (ICL) for growth and virulence in vivo. The demonstration that M. tuberculosis also requires ICL for survival during nutrient starvation and has a role during steady state growth in a glycerol limited chemostat indicates a function for this enzyme which extends beyond fat metabolism. As isocitrate lyase is a potential drug target elucidating the role of this enzyme is of importance; however, the role of isocitrate lyase has never been investigated at the level of in vivo fluxes. Here we show that deletion of one of the two icl genes impairs the replication of Mycobacterium bovis BCG at slow growth rate in a carbon limited chemostat. In order to further understand the role of isocitrate lyase in the central metabolism of mycobacteria the effect of growth rate on the in vivo fluxes was studied for the first time using 13C-metabolic flux analysis (MFA). Tracer experiments were performed with steady state chemostat cultures of BCG or M. tuberculosis supplied with 13C labeled glycerol or sodium bicarbonate. Through measurements of the 13C isotopomer labeling patterns in protein-derived amino acids and enzymatic activity assays we have identified the activity of a novel pathway for pyruvate dissimilation. We named this the GAS pathway because it utilizes the Glyoxylate shunt and Anapleurotic reactions for oxidation of pyruvate, and Succinyl CoA synthetase for the generation of succinyl CoA combined with a very low flux through the succinate – oxaloacetate segment of the tricarboxylic acid cycle. We confirm that M. tuberculosis can fix carbon from CO2 into biomass. As the human host is abundant in CO2 this finding requires further investigation in vivo as CO2 fixation may provide a point of vulnerability that could be targeted with novel drugs. This study also provides a platform for further studies into the metabolism of M. tuberculosis using 13C-MFA. PMID:21814509

  12. Crop yield and CO2 fixation monitoring over Asia by a photosynthetic-sterility model comparing with MODIS and carbon amounts in grain yields

    NASA Astrophysics Data System (ADS)

    Kaneko, Daijiro; Yang, Peng; Kumakura, Toshiro


    The authors have developed a photosynthesis crop model for grain production under the background of climate change and Asian economic growth in developing countries. This paper presents an application of the model to grain fields of paddy rice, winter wheat, and maize in China and Southeast Asia. The carbon hydrate in grains has the same chemical formula as that of cellulose in grain vegetation. The partitioning of carbon in grain plants can validate fixation amounts of computed carbon using a satellite-based photosynthesis model. The model estimates the photosynthesis fixation of rice reasonably in Japan and China. Results were validated through examination of carbon in grains, but the model tends to underestimate results for winter wheat and maize. This study also provides daily distributions of the PSN, which is the CO2 fixation in Asian areas combined with a land-cover distribution classified from MODIS data, NDVI from SPOT VEGETATION, and meteorological re-analysis data by European Centre for Medium-Range Forecasts (ECMWF). The mean CO2 and carbon fixation rates in paddy areas were 25.92 (t CO2/ha) and 5.28 (t/ha) in Japan, respectively. The method is based on routine observation data, enabling automated monitoring of crop yields.

  13. Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L

    SciTech Connect

    Singal, H.R.; Sheoran, I.S.; Singh, R.


    Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwall and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.

  14. Impact of ultraviolet-B radiation on photosystem II activity and its relationship to the inhibition of carbon fixation rates for antarctic ice algae communities

    SciTech Connect

    Schofield, O.; Prezelin, B.B.; Kroon, B.M.A.


    One goal of the Icecolors 1993 study was to determine whether or not photosystem II (PSII) was a major target site for photoinhibition by ultraviolet-B radiation (Q{sub UVB}, 280-320 nm) in natural communities. Second, the degree to which Q{sub UVB} inhibition of PSII could account for Q{sub UVB} effects on whole cell rates of carbon fixation in phytoplankton was assessed. On 1 October, 1993, at Palmer Station (Antarctica), dense samples of a frazil ice algal community were collected and maintained outdoors in the presence or absence of Q{sub UVB} and/or ultraviolet-A (Q{sub UVA}, 320-400 nm) radiation. The time of day course of UV inhibition of primary production was tracted. Over the day, {phi}{sub IIe}{degrees} declined due to increasing time-integrated dose exposure of Q{sub UVB}. The Q{sub UVB}-driven inhibition of {phi}{sub IIe}{degrees} increased from 4% in the early morning hours to a maximum of 23% at the end of the day. The Q{sub UVB} photoinhibition of PSII quantum yield did not recover by 6 h after sunset. In contrast, photoinhibition by Q{sub UVA} and photosynthetically available radiation (Q{sub PAR}, 400-700 nm) recovered during the late afternoon. Fluorescence-based estimates of carbon fixation rates were linearly correlated with measured carbon fixation. Fluorescence overestimated the observed Q{sub UVB} inhibition in measured carbon fixation rates. Researchers should be cautious in using fluorescence measurements to infer ultraviolet inhibition for rates of carbon fixation until there is a greater understanding of the coupling of carbon metabolism to PSII activity for natural populations. Despite these current limitations, fluorescence-based technologies represent powerful tools for studying the impact of the ozone hole on natural populations on spatial/temporal scales not possible using conventional productivity techniques. 55 refs., 11 figs., 2 tabs.

  15. RuBP limitation of photosynthetic carbon fixation during NH sub 3 assimilation: Interactions between photosynthesis, respiration, and ammonium assimilation in N-limited green algae

    SciTech Connect

    Elrifi, I.R.; Holmes, J.J.; Weger, H.G.; Mayo, W.P.; Turpin, D.H. )


    The effects of ammonium assimilation on photosynthetic carbon fixation and O{sub 2} exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP) concentration and the RuBP binding site density of ribulose bisphosphate carboxylase/oxygenase (Rubisco). In both species, ammonium assimilation resulted in a decrease in RuBP concentration. In S. minutum the concentration fell below the RuBP binding site density of Rubisco, indicating RuBP limitation of carboxylation. In contrast, RuBP concentration remained above the binding site density in C. pyrenoidosa. Compromising RuBP regeneration in C. pyrenoidosa with low light resulted in an ammonium-induced decrease in RuBP concentration below the RuBP binding site density of Rubisco. This resulted in a decrease in photosynthetic carbon fixation. In both species, ammonium assimilation resulted in a larger decrease in net O{sub 2} evolution than in carbon fixation. Mass spectrometric analysis shows this to be a result of an increase in the rate of mitochondrial respiration in the light.

  16. Hybrid Amine-Functionalized Graphene Oxide as a Robust Bifunctional Catalyst for Atmospheric Pressure Fixation of Carbon Dioxide using Cyclic Carbonates.


    Saptal, Vitthal B; Sasaki, Takehiko; Harada, Kei; Nishio-Hamane, Daisuke; Bhanage, Bhalchandra M


    An environmentally-benign carbocatalyst based on amine-functionalized graphene oxide (AP-GO) was synthesized and characterized. This catalyst shows superior activity for the chemical fixation of CO2 into cyclic carbonates at the atmospheric pressure. The developed carbocatalyst exhibits superior activity owing to its large surface area with abundant hydrogen bonding donor (HBD) capability and the presence of well-defined amine functional groups. The presence of various HBD and amine functional groups on the graphene oxide (GO) surface yields a synergistic effect for the activation of starting materials. Additionally, this catalyst shows high catalytic activity to synthesize carbonates at 70 °C and at 1 MPa CO2 pressure. The developed AP-GO could be easily recovered and used repetitively in up to seven recycle runs with unchanged catalyst activity. PMID:26840889

  17. Carbon dioxide fixation by microalgae photosynthesis using actual flue gas discharged from a boiler

    SciTech Connect

    Matsumoto, Hiroyo; Shioji, Norio; Hamasaki, Akihiro


    To mitigate CO{sub 2} discharged from thermal power plants, studies on CO{sub 2} fixation by the photosynthesis of microalgae using actual exhaust gas have been carried out. The results are as follows: (1) A method is proposed for evaluating the maximum photosynthesis rate in the raceway cultivator using only the algal physical properties; (2) Outdoor cultivation tests taking actual flue gas were performed with no trouble or break throughout 1 yr using the strain collected in the test; (3) The produced microalgae is effective as solid fuel; and (4) The feasibility studies of this system were performed. The system required large land area, but the area is smaller than that required for other biomass systems, such as tree farms.

  18. Carbon mineralization pathways and bioturbation in coastal Brazilian sediments

    PubMed Central

    Quintana, Cintia O.; Shimabukuro, Maurício; Pereira, Camila O.; Alves, Betina G. R.; Moraes, Paula C.; Valdemarsen, Thomas; Kristensen, Erik; Sumida, Paulo Y. G.


    Carbon mineralization processes and their dependence on environmental conditions (e.g. through macrobenthic bioturbation) have been widely studied in temperate coastal sediments, but almost nothing is known about these processes in subtropical coastal sediments. This study investigated pathways of organic carbon mineralization and associated effects of macrobenthic bioturbation in winter and summer (September 2012 and February 2014) at the SE Brazilian coast. Iron reduction (FeR) was responsible for 73–81% of total microbial carbon mineralization in September 2012 and 32–61% in February 2014. Similar high rates of FeR have only been documented a few times in coastal sediments and can be sustained by the presence of large bioturbators. Denitrification accounted for 5–27% of total microbial carbon mineralization while no SO42− reduction was detected in any season. Redox profiles suggested that conditions were less reduced in February 2014 than in September 2012, probably associated with low reactivity of the organic matter, higher rates of aerobic respiration and bioirrigation by the higher density of small-macrofauna. Bioturbation by small macrofauna may maintain the sediment oxidized in summer, while large-sized species stimulate the reoxidation of reduced compounds throughout the year. Therefore, bioturbation seems to have an important role modulating the pathways of carbon mineralization in the area. PMID:26525137

  19. Carbon mineralization pathways and bioturbation in coastal Brazilian sediments.


    Quintana, Cintia O; Shimabukuro, Maurcio; Pereira, Camila O; Alves, Betina G R; Moraes, Paula C; Valdemarsen, Thomas; Kristensen, Erik; Sumida, Paulo Y G


    Carbon mineralization processes and their dependence on environmental conditions (e.g. through macrobenthic bioturbation) have been widely studied in temperate coastal sediments, but almost nothing is known about these processes in subtropical coastal sediments. This study investigated pathways of organic carbon mineralization and associated effects of macrobenthic bioturbation in winter and summer (September 2012 and February 2014) at the SE Brazilian coast. Iron reduction (FeR) was responsible for 73-81% of total microbial carbon mineralization in September 2012 and 32-61% in February 2014. Similar high rates of FeR have only been documented a few times in coastal sediments and can be sustained by the presence of large bioturbators. Denitrification accounted for 5-27% of total microbial carbon mineralization while no SO4(2-) reduction was detected in any season. Redox profiles suggested that conditions were less reduced in February 2014 than in September 2012, probably associated with low reactivity of the organic matter, higher rates of aerobic respiration and bioirrigation by the higher density of small-macrofauna. Bioturbation by small macrofauna may maintain the sediment oxidized in summer, while large-sized species stimulate the reoxidation of reduced compounds throughout the year. Therefore, bioturbation seems to have an important role modulating the pathways of carbon mineralization in the area. PMID:26525137

  20. Photosynthetic Carbon Metabolism in Seagrasses 14C-Labeling Evidence for the C3 Pathway

    PubMed Central

    Andrews, T. John; Abel, Kay M.


    The ?13C values of several seagrasses were considerably less negative than those of terrestrial C3 plants and tended toward those of terrestrial C4 plants. However, for Thalassia hemprichii (Ehrenb.) Aschers and Halophila spinulosa (R. Br.) Aschers, phosphoglycerate and other C3 cycle intermediates predominated among the early labeled products of photosynthesis in 14C-labeled seawater (more than 90% at the earliest times) and the labeling pattern at longer times was brought about by the operation of the C3 pathway. Malate and aspartate together accounted for only a minor fraction of the total fixed label at all times and the kinetic data of this labeling were not at all consistent with these compounds being early intermediates in seagrass photosynthesis. Pulse-chase 14C-labeling studies further substantiated these conclusions. Significant labeling of photorespiratory intermediates was observed in all experiments. The kinetics of total fixation of label during some steady-state and pulse-chase experiments suggested that there may be an intermediate pool of inorganic carbon of variable size closely associated with the leaves, either externally or internally. Such a pool may be one cause for the C4-like carbon isotope ratios of seagrasses. Images PMID:16660784

  1. Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use

    SciTech Connect

    Kleiner, Manuel; Wentrop, C.; Lott, C.; Teeling, Hanno; Wetzel, Silke; Young, Jacque C; Chang, Y.; Shah, Manesh B; Verberkmoes, Nathan C; Zarzycki, Jan; Fuchs, Georg; Markert, Stephanie; Hempel, Kristina


    Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such as sulfide and CO2. Remarkably little is known about the physiological strategies that enable chemosynthetic symbioses to colonize oligotrophic environments. In this study, we used metaproteomics and metabolomics to investigate the intricate network of metabolic interactions in the chemosynthetic association between Olavius algarvensis, a gutless marine worm, and its bacterial symbionts. We propose novel pathways for coping with energy and nutrient limitation, some of which may be widespread in both free-living and symbiotic bacteria. These include (i) a pathway for symbiont assimilation of the host waste products acetate, propionate, succinate and malate, (ii) the potential use of carbon monoxide as an energy source, a substrate previously not known to play a role in marine invertebrate symbioses, (iii) the potential use of hydrogen as an energy source, (iv) the strong expression of high affinity uptake transporters, and (v) novel energy efficient steps in CO2 fixation and sulfate reduction. The high expression of proteins involved in pathways for energy and carbon uptake and conservation in the O. algarvensis symbiosis indicates that the oligotrophic nature of its environment exerted a strong selective pressure in shaping these associations.

  2. Role of Intracellular Carbon Metabolism Pathways in Shigella flexneri Virulence

    PubMed Central

    Waligora, E. A.; Fisher, C. R.; Hanovice, N. J.; Rodou, A.; Wyckoff, E. E.


    Shigella flexneri, which replicates in the cytoplasm of intestinal epithelial cells, can use the Embden-Meyerhof-Parnas, Entner-Doudoroff, or pentose phosphate pathway for glycolytic carbon metabolism. To determine which of these pathways is used by intracellular S. flexneri, mutants were constructed and tested in a plaque assay for the ability to invade, replicate intracellularly, and spread to adjacent epithelial cells. Mutants blocked in the Embden-Meyerhof-Parnas pathway (pfkAB and pykAF mutants) invaded the cells but formed very small plaques. Loss of the Entner-Doudoroff pathway gene eda resulted in small plaques, but the double eda edd mutant formed normal-size plaques. This suggested that the plaque defect of the eda mutant was due to buildup of the toxic intermediate 2-keto-3-deoxy-6-phosphogluconic acid rather than a specific requirement for this pathway. Loss of the pentose phosphate pathway had no effect on plaque formation, indicating that it is not critical for intracellular S. flexneri. Supplementation of the epithelial cell culture medium with pyruvate allowed the glycolysis mutants to form larger plaques than those observed with unsupplemented medium, consistent with data from phenotypic microarrays (Biolog) indicating that pyruvate metabolism was not disrupted in these mutants. Interestingly, the wild-type S. flexneri also formed larger plaques in the presence of supplemental pyruvate or glucose, with pyruvate yielding the largest plaques. Analysis of the metabolites in the cultured cells showed increased intracellular levels of the added compound. Pyruvate increased the growth rate of S. flexneri in vitro, suggesting that it may be a preferred carbon source inside host cells. PMID:24733092

  3. Dissolved inorganic carbon uptake in Thiomicrospira crunogena XCL-2 is Δp- and ATP-sensitive and enhances RubisCO-mediated carbon fixation.


    Menning, Kristy J; Menon, Balaraj B; Fox, Gordon; Scott, Kathleen M


    The gammaproteobacterium Thiomicrospira crunogena XCL-2 is an aerobic sulfur-oxidizing hydrothermal vent chemolithoautotroph that has a CO2 concentrating mechanism (CCM), which generates intracellular dissolved inorganic carbon (DIC) concentrations much higher than extracellular, thereby providing substrate for carbon fixation at sufficient rate. This CCM presumably requires at least one active DIC transporter to generate the elevated intracellular concentrations of DIC measured in this organism. In this study, the half-saturation constant (K CO2) for purified carboxysomal RubisCO was measured (276 ± 18 µM) which was much greater than the K CO2 of whole cells (1.03 µM), highlighting the degree to which the CCM facilitates CO2 fixation under low CO2 conditions. To clarify the bioenergetics powering active DIC uptake, cells were incubated in the presence of inhibitors targeting ATP synthesis (DCCD) or proton potential (CCCP). Incubations with each of these inhibitors resulted in diminished intracellular ATP, DIC, and fixed carbon, despite an absence of an inhibitory effect on proton potential in the DCCD-incubated cells. Electron transport complexes NADH dehydrogenase and the bc 1 complex were found to be insensitive to DCCD, suggesting that ATP synthase was the primary target of DCCD. Given the correlation of DIC uptake to the intracellular ATP concentration, the ABC transporter genes were targeted by qRT-PCR, but were not upregulated under low-DIC conditions. As the T. crunogena genome does not include orthologs of any genes encoding known DIC uptake systems, these data suggest that a novel, yet to be identified, ATP- and proton potential-dependent DIC transporter is active in this bacterium. This transporter serves to facilitate growth by T. crunogena and other Thiomicrospiras in the many habitats where they are found. PMID:26581415

  4. Carbon preservation in humic lakes; a hierarchical regulatory pathway.


    Fenner, Nathalie; Freeman, Chris


    Peatland catchments store vast amounts of carbon. Humic lakes and pools are the primary receptacles for terrigenous carbon in these meta-ecosystems, representing sequestration hotspots; boreal lakes alone store ca. 120Pg C. But little is known about the mechanisms that preserve aquatic carbon stocks. Here, we determined the regulatory pathway of decomposition in relation to 'traditional' limitations, namely anoxia, decay inhibiting compounds, low nutrients and acidity, using in vitro manipulation, mesocosms and natural gradients. We show that anoxia represents a powerful hierarchical preservation mechanism affecting all major limitations on decomposition and recapturing carbon that would otherwise escape from peatlands. Oxygen constraints on microbial synthesis of oxidases and nutrient-cycling enzymes, prevents the decay of organic matter to CO2 , CH4 and N2 O by allowing inhibitor accumulation and lowering nutrients. However, this pathway is sensitive to direct nutrient inputs and therefore eutrophication could initiate catastrophic feedback to global warming via dramatically increased greenhouse gas emissions. Identifying these process-specific limitations should inform better management and conservation of these vital systems. PMID:23504835

  5. Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities

    PubMed Central

    Kellermann, Matthias Y.; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe


    The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope–probing experiments with and without methane. The relative incorporation of 13C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both 13C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs. PMID:23129626

  6. Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities.


    Kellermann, Matthias Y; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe


    The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope-probing experiments with and without methane. The relative incorporation of (13)C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both (13)C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs. PMID:23129626

  7. Significance of non-sinking particulate organic carbon and dark CO2 fixation to heterotrophic carbon demand in the mesopelagic northeast Atlantic

    NASA Astrophysics Data System (ADS)

    Baltar, Federico; Arstegui, Javier; Sintes, Eva; Gasol, Josep M.; Reinthaler, Thomas; Herndl, Gerhard J.


    It is generally assumed that sinking particulate organic carbon (POC) constitutes the main source of organic carbon supply to the deep ocean's food webs. However, a major discrepancy between the rates of sinking POC supply (collected with sediment traps) and the prokaryotic organic carbon demand (the total amount of carbon required to sustain the heterotrophic metabolism of the prokaryotes; i.e., production plus respiration, PCD) of deep-water communities has been consistently reported for the dark realm of the global ocean. While the amount of sinking POC flux declines exponentially with depth, the concentration of suspended, buoyant non-sinking POC (nsPOC; obtained with oceanographic bottles) exhibits only small variations with depth in the (sub)tropical Northeast Atlantic. Based on available data for the North Atlantic we show here that the sinking POC flux would contribute only 4-12% of the PCD in the mesopelagic realm (depending on the primary production rate in surface waters). The amount of nsPOC potentially available to heterotrophic prokaryotes in the mesopelagic realm can be partly replenished by dark dissolved inorganic carbon fixation contributing between 12% to 72% to the PCD daily. Taken together, there is evidence that the mesopelagic microheterotrophic biota is more dependent on the nsPOC pool than on the sinking POC supply. Hence, the enigmatic major mismatch between the organic carbon demand of the deep-water heterotrophic microbiota and the POC supply rates might be substantially smaller by including the potentially available nsPOC and its autochthonous production in oceanic carbon cycling models.

  8. Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation

    PubMed Central

    Karl, David M.; Church, Matthew J.; Dore, John E.; Letelier, Ricardo M.; Mahaffey, Claire


    The atmospheric and deep sea reservoirs of carbon dioxide are linked via physical, chemical, and biological processes. The last of these include photosynthesis, particle settling, and organic matter remineralization, and are collectively termed the biological carbon pump. Herein, we present results from a 13-y (19922004) sediment trap experiment conducted in the permanently oligotrophic North Pacific Subtropical Gyre that document a large, rapid, and predictable summertime (July 15August 15) pulse in particulate matter export to the deep sea (4,000 m). Peak daily fluxes of particulate matter during the summer export pulse (SEP) average 408, 283, 24.1, 1.1, and 67.5 ?molm?2d?1 for total carbon, organic carbon, nitrogen, phosphorus (PP), and biogenic silica, respectively. The SEP is approximately threefold greater than mean wintertime particle fluxes and fuels more efficient carbon sequestration because of low remineralization during downward transit that leads to elevated total carbon/PP and organic carbon/PP particle stoichiometry (371:1 and 250:1, respectively). Our long-term observations suggest that seasonal changes in the microbial assemblage, namely, summertime increases in the biomass and productivity of symbiotic nitrogen-fixing cyanobacteria in association with diatoms, are the main cause of the prominent SEP. The recurrent SEP is enigmatic because it is focused in time despite the absence of any obvious predictable stimulus or habitat condition. We hypothesize that changes in day length (photoperiodism) may be an important environmental cue to initiate aggregation and subsequent export of organic matter to the deep sea. PMID:22308450

  9. Nitrogen fixation on early Mars and other terrestrial planets: experimental demonstration of abiotic fixation reactions to nitrite and nitrate.


    Summers, David P; Khare, Bishun


    Understanding the abiotic fixation of nitrogen is critical to understanding planetary evolution and the potential origin of life on terrestrial planets. Nitrogen, an essential biochemical element, is certainly necessary for life as we know it to arise. The loss of atmospheric nitrogen can result in an incapacity to sustain liquid water and impact planetary habitability and hydrological processes that shape the surface. However, our current understanding of how such fixation may occur is almost entirely theoretical. This work experimentally examines the chemistry, in both gas and aqueous phases, that would occur from the formation of NO and CO by the shock heating of a model carbon dioxide/nitrogen atmosphere such as is currently thought to exist on early terrestrial planets. The results show that two pathways exist for the abiotic fixation of nitrogen from the atmosphere into the crust: one via HNO and another via NO(2). Fixation via HNO, which requires liquid water, could represent fixation on a planet with liquid water (and hence would also be a source of nitrogen for the origin of life). The pathway via NO(2) does not require liquid water and shows that fixation could occur even when liquid water has been lost from a planet's surface (for example, continuing to remove nitrogen through NO(2) reaction with ice, adsorbed water, etc.). PMID:17480164

  10. Nitrogen-Dependent Carbon Fixation by Picoplankton In Culture and in the Mississippi River

    SciTech Connect

    Aubrey Smith; Marguerite W. Coomes; Thomas E. Smith


    The pepc gene, which encodes phosphoenolpyruvate carboxylase (PEPC), of the marine cyanobacterium Synechococcus PCC 7002, was isolated and sequenced. PEPC is an anaplerotic enzyme, but it may also contribute to overall CO2 fixation through β-carboxylation reactions. A consensus sequence generated by aligning the pepc genes of Anabaena variabilis, Anacystis nidulans and Synechocystis PCC 6803 was used to design two sets of primers that were used to amplify segments of Synechococcus PCC 7002 pepc. In order to isolate the gene, the sequence of the PCR product was used to search for the pepc nucleotide sequence from the publicly available genome of Synechococcus PCC 7002. At the time, the genome for this organism had not been completed although sequences of a significant number of its fragments are available in public databases. Thus, the major challenge was to find the pepc gene among those fragments and to complete gaps as necessary. Even though the search did not yield the complete gene, PCR primers were designed to amplify a DNA fragment using a high fidelity thermostable DNA polymerase. An open reading frame (ORF) consisting of 2988 base pairs coding for 995 amino acids was found in the 3066 bp PCR product. The pepc gene had a GC content of 52% and the deduced protein had a calculated molecular mass of 114,049 Da. The amino acid sequence was closely related to that of PEPC from other cyanobacteria, exhibiting 59-61% identity. The sequence differed significantly from plant and E. coli PEPC with only 30% homology. However, comparing the Synechococcus PCC 7002 sequence to the recently resolved E. coli PEPC revealed that most of the essential domains and amino acids involved in PEPC activity were shared by both proteins. The recombinant Synechococcus PCC 7002 PEPC was expressed in E. coli.

  11. Regulation of photosynthetic carbon fixation on the ocean margins. Final report

    SciTech Connect

    Paul, J.H.


    The US Department of Energy is concerned with the fate of energy-related materials, including carbon dioxide, in the marine environment. Using laboratory studies, as well as field studies, an attempt was made to understand the molecular regulation of photosynthetic carbon reduction. The objectives were: to determine the mechanism of regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBPCase) in phytoplankton in response to changes in light fields; and to determine regulation of (RuBPCase) in response to light under nutrient deprivation.

  12. Carbonate hydroxyapatite functionalization: a comparative study towards (bio)molecules fixation

    PubMed Central

    Russo, Laura; Taraballi, Francesca; Lupo, Cristina; Poveda, Ana; Jiménez-Barbero, Jesús; Sandri, Monica; Tampieri, Anna; Nicotra, Francesco; Cipolla, Laura


    Different methods for the functionalization of carbonate hydroxyapatite granules with free amine groups by reaction with (3-aminopropyl)triethoxysilane (APTES) have been compared in order to improve the potential for tethering of bioactive molecules to bioceramics. The combined use of tetraethoxyorthosilicate and APTES with acid catalysis resulted in an evident increase in amine surface grafting. PMID:24501671

  13. Soybean Photosynthetic Rate and Carbon Fixation at Early and Late Planting Dates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Early planting (late April to early May) is recommended for increasing soybean yield but a full understanding of the physiological response is lacking. This study was conducted to determine whether carbon dioxide exchange rate (CER) could explain this yield difference. A study with five (2007) and s...

  14. Pathways of organic carbon oxidation in three continental margin sediments

    NASA Technical Reports Server (NTRS)

    Canfield, D. E.; Jorgensen, B. B.; Fossing, H.; Glud, R.; Gundersen, J.; Ramsing, N. B.; Thamdrup, B.; Hansen, J. W.; Nielsen, L. P.; Hall, P. O.


    We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and Mn reduction) has probably been well underestimated.

  15. Nitrogen fixation and CO/sub 2/ metabolism: proceedings

    SciTech Connect

    Ludden, P.W.; Burris, J.E.


    Photosynthesis and nitrogen fixation are key metabolic processes which lead to the production of reduced carbon and nitrogen compounds. These compounds are essential for the maintenance and continuation of life on earth. In this volume many recent advances in the study of nitrogen fixation and photosynthetic carbon dioxide fixation are presented. The papers were presented in seven sessions. These sessions were the biochemistry of the legume nodule, genetics and molecular biology of nitrogen fixation, enzymes and cofactors involved in inorganic nitrogen reductions, aspects of nitrogen fixation by associations and symbioses, physiology of free-living nitrogen fixers, interactions between carbon metabolism and nitrogen fixation, photorespiration in plants, and photosynthetic carbon fixation. (DT)

  16. Carbon dioxide fixation and sulfate sequestration by a supramolecular trigonal bipyramid.


    Browne, Colm; Ramsay, William J; Ronson, Tanya K; Medley-Hallam, John; Nitschke, Jonathan R


    The subcomponent self-assembly of a bent dialdehyde ligand and different cationic and anionic templates led to the formation of two new metallosupramolecular architectures: a Fe(II) 4 L6 molecular rectangle was isolated following reaction of the ligand with iron(II) tetrafluoroborate, and a M5 L6 trigonal bipyramidal structure was constructed from either zinc(II) tetrafluoroborate or cadmium(II) trifluoromethanesulfonate. The spatially constrained arrangement of the three equatorial metal ions in the M5 L6 structures was found to induce small-molecule transformations. Atmospheric carbon dioxide was fixed as carbonate and bound to the equatorial metal centers in both the Zn5 L6 and Cd5 L6 assemblies, and sulfur dioxide was hydrated and bound as the sulfite dianion in the Zn5 L6 structure. Subsequent in situ oxidation of the sulfite dianion resulted in a sulfate dianion bound within the supramolecular pocket. PMID:26235039

  17. Improving high carbon dioxide tolerance and carbon dioxide fixation capability of Chlorella sp. by adaptive laboratory evolution.


    Li, Dengjin; Wang, Liang; Zhao, Quanyu; Wei, Wei; Sun, Yuhan


    CO2 capture by microalgae is a promising method to reduce greenhouse gas emissions. It is critical to construct a highly efficient way to obtain a microalgal strain tolerant to high CO2 concentrations with high CO2 fixation capability. In this study, two evolved Chlorella sp. strains, AE10 and AE20 were obtained after 31 cycles of adaptive laboratory evolution (ALE) under 10% and 20% CO2, respectively. Both of them grew rapidly in 30% CO2 and the maximal biomass concentration of AE10 was 3.680.08g/L, which was 1.22 and 2.94 times to those of AE20 and original strain, respectively. The chlorophyll contents of AE10 and AE20 were significantly higher than those of the original one under 1-30% CO2. The influences of ALE process on biochemical compositions of Chlorella cells were also investigated. This study proved that ALE was an effective approach to improve high CO2 tolerance of Chlorella sp. PMID:25776894

  18. Carbon nanopipettes characterize calcium release pathways in breast cancer cells

    NASA Astrophysics Data System (ADS)

    Schrlau, Michael G.; Brailoiu, Eugen; Patel, Sandip; Gogotsi, Yury; Dun, Nae J.; Bau, Haim H.


    Carbon-based nanoprobes are attractive for minimally invasive cell interrogation but their application in cell physiology has thus far been limited. We have developed carbon nanopipettes (CNPs) with nanoscopic tips and used them to inject calcium-mobilizing messengers into cells without compromising cell viability. We identify pathways sensitive to cyclic adenosine diphosphate ribose (cADPr) and nicotinic acid adenine dinucleotide phosphate (NAADP) in breast carcinoma cells. Our findings demonstrate the superior utility of CNPs for intracellular delivery of impermeant molecules and, more generally, for cell physiology studies. The CNPs do not appear to cause any lasting damage to cells. Their advantages over commonly used glass pipettes include smaller size, breakage and clogging resistance, and potential for multifunctionality such as in concurrent injection and electrical measurements.

  19. Urea Uptake and Carbon Fixation by Marine Pelagic Bacteria and Archaea during the Arctic Summer and Winter Seasons

    PubMed Central

    Connelly, Tara L.; Baer, Steven E.; Cooper, Joshua T.; Bronk, Deborah A.


    How Arctic climate change might translate into alterations of biogeochemical cycles of carbon (C) and nitrogen (N) with respect to inorganic and organic N utilization is not well understood. This study combined 15N uptake rate measurements for ammonium, nitrate, and urea with 15N- and 13C-based DNA stable-isotope probing (SIP). The objective was to identify active bacterial and archeal plankton and their role in N and C uptake during the Arctic summer and winter seasons. We hypothesized that bacteria and archaea would successfully compete for nitrate and urea during the Arctic winter but not during the summer, when phytoplankton dominate the uptake of these nitrogen sources. Samples were collected at a coastal station near Barrow, AK, during August and January. During both seasons, ammonium uptake rates were greater than those for nitrate or urea, and nitrate uptake rates remained lower than those for ammonium or urea. SIP experiments indicated a strong seasonal shift of bacterial and archaeal N utilization from ammonium during the summer to urea during the winter but did not support a similar seasonal pattern of nitrate utilization. Analysis of 16S rRNA gene sequences obtained from each SIP fraction implicated marine group I Crenarchaeota (MGIC) as well as Betaproteobacteria, Firmicutes, SAR11, and SAR324 in N uptake from urea during the winter. Similarly, 13C SIP data suggested dark carbon fixation for MGIC, as well as for several proteobacterial lineages and the Firmicutes. These data are consistent with urea-fueled nitrification by polar archaea and bacteria, which may be advantageous under dark conditions. PMID:25063662

  20. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco

    PubMed Central

    Simkin, Andrew J.; McAusland, Lorna; Headland, Lauren R.; Lawson, Tracy; Raines, Christine A.


    Over the next 40 years it has been estimated that a 50% increase in the yield of grain crops such as wheat and rice will be required to meet the food and fuel demands of the increasing world population. Transgenic tobacco plants have been generated with altered combinations of sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and the cyanobacterial putative-inorganic carbon transporter B, ictB, of which have all been identified as targets to improve photosynthesis based on empirical studies. It is shown here that increasing the levels of the three proteins individually significantly increases the rate of photosynthetic carbon assimilation, leaf area, and biomass yield. Furthermore, the daily integrated measurements of photosynthesis showed that mature plants fixed between 1219% more CO2 than the equivalent wild-type plants. Further enhancement of photosynthesis and yield was observed when sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and ictB were over-expressed together in the same plant. These results demonstrate the potential for the manipulation of photosynthesis, using multigene-stacking approaches, to increase crop yields. PMID:25956882

  1. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco.


    Simkin, Andrew J; McAusland, Lorna; Headland, Lauren R; Lawson, Tracy; Raines, Christine A


    Over the next 40 years it has been estimated that a 50% increase in the yield of grain crops such as wheat and rice will be required to meet the food and fuel demands of the increasing world population. Transgenic tobacco plants have been generated with altered combinations of sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and the cyanobacterial putative-inorganic carbon transporter B, ictB, of which have all been identified as targets to improve photosynthesis based on empirical studies. It is shown here that increasing the levels of the three proteins individually significantly increases the rate of photosynthetic carbon assimilation, leaf area, and biomass yield. Furthermore, the daily integrated measurements of photosynthesis showed that mature plants fixed between 12-19% more CO2 than the equivalent wild-type plants. Further enhancement of photosynthesis and yield was observed when sedoheptulose-1,7-bisphosphatase, fructose-1,6-bisphosphate aldolase, and ictB were over-expressed together in the same plant. These results demonstrate the potential for the manipulation of photosynthesis, using multigene-stacking approaches, to increase crop yields. PMID:25956882

  2. Biochemistry and control of the reductive tricarboxylic acid pathway of CO2 fixation and physiological role of the RubisCO-like protein

    SciTech Connect

    Tabita, F Robert


    During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris. 1. Reductive TCA pathway of CO2 assimilation Many diverse microorganisms use the reductive TCA (RTCA) pathway for CO2 assimilation. Included are photoautotrophic and chemoautotrophic organisms that occupy important niches in various ecosystems. Inasmuch as the biochemistry and regulation of the RTCA pathway has been virtually neglected, especially in comparison to the Calvin-Benson-Bassham (CBB) reductive pentose pathway of CO2 fixation, we sought to develop a system that would allow for detailed biochemical analysis of the RTCA enzymes and associated proteins, along with the genes that encode these proteins. We have focused on the green sulfur photosynthetic bacterium Chlorobium tepidum, a fast growing moderate thermophile originally isolated by Professor Mike Madigan and colleagues. Because of its rapid growth and relative ease to produce massive cell amounts via high-density fermentator vessels, C. tepidum has become the organism of choice for investigators interested in studying all aspects of the physiology and biochemistry of green sulfur bacteria. Moreover, this organism possesses a very convenient natural transformation system that allows routine genetic transfer and the generation of knockout mutations via homologous recombination at specific genetic loci. The first such mutations were generated in our laboratory [Hanson & Tabita, PNAS USA, 98 (2001), 4397-4402], such that these protocols have now become relatively routine. Moreover, the genome of C. tepidum was recently sequenced. Thus, all the tools are in place for productive analysis of key processes catalyzed by this organism, in particular for analysis of the RTCA pathway and the rather unique RubisCO-like protein (RLP) that we first discovered during the last grant period of this project [Hanson & Tabita, 2001]. We have concentrated on the enzymology of the key proteins of this pathway, in particular pyruvate synthase (PS), -ketoglutarate synthase (KGS), and ATP-citrate lyase (ACL). In addition, we have also focused on key electron transfer proteins that must provide needed reducing equivalents to PS and KGS, including two separate ferredoxins that were shown to be abundantly produced by this organism. 2. Physiological/biochemical/genetic studies on the RubisCO-like Protein (RLP) During the prior grant period we identified what we believe is an evolutional precursor to bona fide RubisCO in C. tepidum, the RubisCO-like protein (RLP) [Hanson & Tabita, 2001]. Typical bioinformatics software incorrectly indicates that RLP is RubisCO, however our previous experience with RubisCO enabled us to establish that C. tepidum RLP has substitutions in 9 out of the 19 residues known to be important for RubisCO-catalyzed CO2 fixation. After purifying recombinant RLP, we showed that the RLP is not a bona fide RubisCO that catalyzes RuBP-dependent CO2 fixation, but appears to function in some aspect of the oxidation of reduced sulfur compounds by this organism. More recent studies [Hanson & Tabita, Photosynth. Res. 78 (2003) 231-248] during the past grant period have established that this effect is related to some aspect of thiosulfate oxidation in the reduced sulfur compound oxidation pathway, as sulfide oxidation was not affected. When we first discovered the RLP, we noted that RLP homologs were also found in other organisms, including heterotrophic bacteria and at least one archaeon [Hanson & Tabita, 2001, 2003]. Finally, as long-time Rubiscologists we have always been intrigued with how the active site of RubisCO might have evolved for its key functional role in metabolizing CO2 and O2 [Tabita, Photosynth. Res. 60 (1999) 1-28; Tabita et al. Microbiol. Mol. Biol. Rev. 71 (2007) 576-599]. This was borne out by the recent elucidation of the structure of RLP via a collaborative with our group and the laboratory of Prof. David Eisenberg at UCLA [Li, Sawaya, Tabita & Eisenberg, Structure 13 (2005) 779-789]. Finally, in another collaborative effort with Prof. John Gerlt’s group at the Univeristy of Illinois, we have shown that the RLP from Rhodospirillum rubrum catalyzes an unusual double isomerase reaction [Imker, Singh, Warlick, Tabita, and Gerlt, Biochemistry (2008) 11171-11173.] and is most likely involved in a completely novel pathway of sulfur salvage [Singh and Tabita, manuscript in preparation; Singh, J., Ph. D. Dissertation, The Ohio State University, 2008].

  3. Effects of dissolved inorganic carbon and nutrient levels on carbon fixation and properties of Thermosynechococcus sp. in a continuous system.


    Su, Chih Ming; Hsueh, Hsin Ta; Chen, Hsing Hui; Chu, Hsin


    The concept of CO(2) chemo-absorption by sodium hydroxide in a wet scrubber followed by microalgae cultivation was used as a means to reduce the major greenhouse gas. A thermophilic and alkaline tolerable cyanobacterium named Thermosynechococcus CL-1 (TCL-1) was cultivated in continuous system, with a carbonate-bicarbonate buffer as carbon source. The effects of dissolved inorganic carbon (DIC(in)) and nutrient levels in influent on cell mass productivity, DIC removal efficiency, and alkaline solution regeneration by TCL-1 were investigated. The results show the highest cell mass productivity reaches 1.7 g L(-1)d(-1) under the highest DIC and nutrients level. Conversely, the best regeneration of alkaline solution proceeds from pH 9.5 to 11.3 under the lowest level. In addition, the highest ΔDIC (DIC consumption) and DIC removal efficiency are 42 mM and 43% at 113.2 and 57 mM DIC(in), respectively. PMID:22560699

  4. Will elevated carbon dioxide concentration amplify the benefits of nitrogen fixation in legumes?

    SciTech Connect

    Rogers, A.; Ainsworth, E. A.; Leakey, A. D. B.


    Growth at elevated [CO{sub 2}] stimulates photosynthesis and increases carbon (C) supply in all C3 species. A sustained and maximal stimulation in productivity at elevated [CO{sub 2}] requires an enhanced nutrient supply to match the increase in C acquisition. The ability of legumes to exchange C for nitrogen (N) with their N{sub 2}-fixing symbionts has led to the hypothesis that legumes will have a competitive advantage over nonleguminous species when grown at elevated [CO{sub 2}]. On balance, evidence suggests that in managed systems, legumes are more responsive to elevated [CO{sub 2}] than other plants (e.g. Ainsworth and Long, 2005); however, in natural ecosystems, nutrient availability can limit the response of legumes to elevated [CO{sub 2}] (Hungate et al., 2004; van Groenigen et al., 2006). Here, we consider these observations, outline the mechanisms that underlie them, and examine recent work that advances our understanding of how legumes respond to growth at elevated [CO{sub 2}]. First we highlight the global importance of legumes and provide a brief overview of the symbiotic relationship.

  5. How sensitive are estimates of carbon fixation in agricultural models to input data?

    PubMed Central


    Background Process based vegetation models are central to understand the hydrological and carbon cycle. To achieve useful results at regional to global scales, such models require various input data from a wide range of earth observations. Since the geographical extent of these datasets varies from local to global scale, data quality and validity is of major interest when they are chosen for use. It is important to assess the effect of different input datasets in terms of quality to model outputs. In this article, we reflect on both: the uncertainty in input data and the reliability of model results. For our case study analysis we selected the Marchfeld region in Austria. We used independent meteorological datasets from the Central Institute for Meteorology and Geodynamics and the European Centre for Medium-Range Weather Forecasts (ECMWF). Land cover / land use information was taken from the GLC2000 and the CORINE 2000 products. Results For our case study analysis we selected two different process based models: the Environmental Policy Integrated Climate (EPIC) and the Biosphere Energy Transfer Hydrology (BETHY/DLR) model. Both process models show a congruent pattern to changes in input data. The annual variability of NPP reaches 36% for BETHY/DLR and 39% for EPIC when changing major input datasets. However, EPIC is less sensitive to meteorological input data than BETHY/DLR. The ECMWF maximum temperatures show a systematic pattern. Temperatures above 20C are overestimated, whereas temperatures below 20C are underestimated, resulting in an overall underestimation of NPP in both models. Besides, BETHY/DLR is sensitive to the choice and accuracy of the land cover product. Discussion This study shows that the impact of input data uncertainty on modelling results need to be assessed: whenever the models are applied under new conditions, local data should be used for both input and result comparison. PMID:22296931

  6. Lanthanide Complexes with Multidentate Oxime Ligands as Single-Molecule Magnets and Atmospheric Carbon Dioxide Fixation Systems.


    Ho?y?ska, Ma?gorzata; Clrac, Rodolphe; Rouzires, Mathieu


    The synthesis, structure, and magnetic properties of five lanthanide complexes with multidentate oxime ligands are described. Complexes 1 and 2 (1: [La2 (pop)2 (acac)4 (CH3 OH)], 2: [Dy2 (pop)(acac)5 ]) are synthesized from the 2-hydroxyimino-N-[1-(2-pyridyl)ethylidene]propanohydrazone (Hpop) ligand, while 3, 4, and 5 (3: [Dy2 (naphthsaoH)2 (acac)4 H(OH)]?0.85?CH3 CN?1.58?H2 O; 4: [Tb2 (naphthsaoH)2 (acac)4 H(OH)]?0.52?CH3 CN?1.71?H2 O; 5: [La6 (CO3 )2 (naphthsao)5 (naphthsaoH)0.5 (acac)8 (CO3 )0.5 (CH3 OH)2.76 H5.5 (H2 O)1.24 ]?2.39?CH3 CN?0.12?H2 O) contain 1-(1-hydroxynaphthalen-2-yl)-ethanone oxime (naphthsaoH2 ). In 1-4, dinuclear [Ln2 ] complexes crystallize, whereas hexanuclear La(III) complex 5 is formed after fixation of atmospheric carbon dioxide. Dy(III) -based complexes 2 and 3 display single-molecule-magnet properties with energy barriers of 27 and 98?K, respectively. The presence of a broad and unsymmetrical relaxation mode observed in the ac susceptibility data for 3 suggest two different dynamics of the magnetization which might be a consequence of independent relaxation processes of the two different Dy(3+) ions. PMID:26230414

  7. Design of Zeolitic Imidazolate Framework Derived Nitrogen-Doped Nanoporous Carbons Containing Metal Species for Carbon Dioxide Fixation Reactions.


    Toyao, Takashi; Fujiwaki, Mika; Miyahara, Kenta; Kim, Tae-Ho; Horiuchi, Yu; Matsuoka, Masaya


    Various N-doped nanoporous carbons containing metal species were prepared by direct thermal conversion of zeolitic imidazolate frameworks (ZIFs; ZIF-7, -8, -9, and -67) at different temperatures (600, 800, and 1000?C). These materials were utilized as bifunctional acid-base catalysts to promote the reaction of CO2 with epoxides to form cyclic carbonates under 0.6?MPa of CO2 at 80?C. The catalyst generated by thermal conversion of ZIF-9 at 600?C (C600-ZIF-9) was found to exhibit a higher catalytic activity than the other ZIFs, other conventional catalysts, and other metal-organic framework catalysts. The results of various characterization techniques including elemental analysis, X-ray diffraction, X-ray photoelectron spectroscopy, X-ray absorption spectroscopy, and transmission electron microscopy show that C600-ZIF-9 contains partly oxidized Co nanoparticles and N species. Temperature-programmed desorption measurements by using CO2 and NH3 as probe molecules revealed that C600-ZIF-9 has both Lewis acid and Lewis base catalytic sites. Finally, the substrate scope was extended to seven other kinds of epoxides. PMID:26395673

  8. Trophic pathways and carbon flux patterns in the Laptev Sea

    NASA Astrophysics Data System (ADS)

    Schmid, Michael K.; Piepenburg, Dieter; Golikov, Alexander A.; Juterzenka, Karen von; Petryashov, Victor V.; Spindler, Michael


    The Laptev Sea is a high-Arctic epicontinental sea north of Siberia (Russia) that is one of the least understood regions of the worlds ocean. It is characterized by a shallow and broad shelf plateau, high influx of river water, sediments and nutrients during summer, long-lasting sea-ice cover from October to May, and the formation of a narrow flaw-lead polynya off the fast-ice edge during winter. Here, we describe results of a German-Russian research project (1993-present), presenting the distribution patterns and dynamics of its marine flora and fauna, as well as pathways and processes of coupling between sea-ice, water-column and sea-floor biota. Three ecological zones are distinguished along a combined east-west and Lena-impact gradient, differing in the composition of pelagic and benthic communities. In general, high Chl a concentrations in the sediments indicate a tight coupling between sympagic and pelagic primary production and nutrient supply to the benthos throughout the entire Laptev Sea. However, there were pronounced regional differences between the ecological zones in magnitude of primary production and trophic dynamics. Primary production during the ice-free summer was highest in the estuarine zone most strongly influenced by the Lena River (210 mg C m -2 day -1). The western and northeastern Laptev Sea yielded 55 and 95 mg C m -2 day -1, respectively. Moreover, the zones differed in the partitioning of carbon flux between zooplankton and benthic food webs. In the Lena zone zooplankton carbon demand was about 31 mg C m -2 day -1 whereas in the western zone it was 21 mg C m -2 day -1 and in the eastern zone 4 mg C m -2 day -1. Total benthic carbon demand was 32 mg C m -2 day -1 for the Lena zone, 56 mg C m -2 day -1 in the western zone and 100 mg C m -2 day -1 in the northeastern zone. A carbon budget constructed for the Laptev Sea indicates that (1) a high proportion of primary production is channelled through the benthic trophic web, bypassing the pelagic trophic web, and (2) autochthonous primary production in the northeastern and western Laptev Sea might not be sufficient to fuel both pelagic and benthic secondary production and, hence, input of allochthonous organic carbon is required to balance the overall carbon demand.

  9. Biomechanical properties of a structurally optimized carbon-fibre/epoxy intramedullary nail for femoral shaft fracture fixation.


    Samiezadeh, Saeid; Fawaz, Zouheir; Bougherara, Habiba


    Intramedullary nails are the golden treatment option for diaphyseal fractures. However, their high stiffness can shield the surrounding bone from the natural physiologic load resulting in subsequent bone loss. Their stiff structure can also delay union by reducing compressive loads at the fracture site, thereby inhibiting secondary bone healing. Composite intramedullary nails have recently been introduced to address these drawbacks. The purpose of this study is to evaluate the mechanical properties of a previously developed composite IM nail made of carbon-fibre/epoxy whose structure was optimized based on fracture healing requirements using the selective stress shielding approach. Following manufacturing, the cross-section of the composite nail was examined under an optical microscope to find the porosity of the structure. Mechanical properties of the proposed composite intramedullary nail were determined using standard tension, compression, bending, and torsion tests. The failed specimens were then examined to obtain the modes of failure. The material showed high strength in tension (403.9±7.8MPa), compression (316.9±10.9MPa), bending (405.3±8.1MPa), and torsion (328.5±7.3MPa). Comparing the flexural modulus (41.1±0.9GPa) with the compressive modulus (10.0±0.2GPa) yielded that the material was significantly more flexible in compression than in bending. This customized flexibility along with the high torsional stiffness of the nail (70.7±2.0Nm(2)) has made it ideal as a fracture fixation device since this unique structure can stabilize the fracture while allowing for compression of fracture ends. Negligible moisture absorption (~0.5%) and low porosity of the laminate structure (< 3%) are other advantages of the proposed structure. The findings suggested that the carbon-fibre/epoxy intramedullary nail is flexible axially while being relatively rigid in bending and torsion and is strong enough in all types of physiologic loading, making it a potential candidate for use as an alternative to the conventional titanium-alloy intramedullary nails. PMID:26703226

  10. Pathways of Carbon and Energy Metabolism of the Epibiotic Community Associated with the Deep-Sea Hydrothermal Vent Shrimp Rimicaris exoculata

    PubMed Central

    Hgler, Michael; Petersen, Jillian M.; Dubilier, Nicole; Imhoff, Johannes F.; Sievert, Stefan M.


    Background The shrimp Rimicaris exoculata dominates the faunal biomass at many deep-sea hydrothermal vent sites at the Mid-Atlantic Ridge. In its enlarged gill chamber it harbors a specialized epibiotic bacterial community for which a nutritional role has been proposed. Methodology/Principal Findings We analyzed specimens from the Snake Pit hydrothermal vent field on the Mid-Atlantic Ridge by complementing a 16S rRNA gene survey with the analysis of genes involved in carbon, sulfur and hydrogen metabolism. In addition to Epsilon- and Gammaproteobacteria, the epibiotic community unexpectedly also consists of Deltaproteobacteria of a single phylotype, closely related to the genus Desulfocapsa. The association of these phylogenetic groups with the shrimp was confirmed by fluorescence in situ hybridization. Based on functional gene analyses, we hypothesize that the Gamma- and Epsilonproteobacteria are capable of autotrophic growth by oxidizing reduced sulfur compounds, and that the Deltaproteobacteria are also involved in sulfur metabolism. In addition, the detection of proteobacterial hydrogenases indicates the potential for hydrogen oxidation in these communities. Interestingly, the frequency of these phylotypes in 16S rRNA gene clone libraries from the mouthparts differ from that of the inner lining of the gill chamber, indicating potential functional compartmentalization. Conclusions Our data show the specific association of autotrophic bacteria with Rimicaris exoculata from the Snake Pit hydrothermal vent field, and suggest that autotrophic carbon fixation is contributing to the productivity of the epibiotic community with the reductive tricarboxylic acid cycle as one important carbon fixation pathway. This has not been considered in previous studies of carbon fixation and stable carbon isotope composition of the shrimp and its epibionts. Furthermore, the co-occurrence of sulfur-oxidizing and sulfur-reducing epibionts raises the possibility that both may be involved in the syntrophic exchange of sulfur compounds, which could increase the overall efficiency of this epibiotic community. PMID:21249205

  11. Pyrolysis pathways of sulfonated polyethylene, an alternative carbon fiber precursor.


    Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A; Naskar, Amit K; Beste, Ariana


    Polyethylene is an emerging precursor material for the production of carbon fibers. Its sulfonated derivative yields ordered carbon when pyrolyzed under inert atmosphere. Here, we investigate its pyrolysis pathways by selecting n-heptane-4-sulfonic acid (H4S) as a model compound. Density functional theory and transition state theory were used to determine the rate constants of pyrolysis for H4S from 300 to 1000 K. Multiple reaction channels from two different mechanisms were explored: (1) internal five-centered elimination (Ei5) and (2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain thermogravimetric (TGA) plots that compared favorably to experiment. We observed that at temperatures <550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial ?H radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440 to 460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene (~31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOS?2 became competitive to ?-H abstraction by HOS?2, making ?H the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures >600 K. Low-scale carbonization utilizes temperatures <620 K; thus, internal elimination will not be competitive. E(i)5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. PMID:23560686

  12. 14C Fixation by Leaves and Leaf Cell Protoplasts of the Submerged Aquatic Angiosperm Potamogeton lucens: Carbon Dioxide or Bicarbonate? 1

    PubMed Central

    Staal, Marten; Elzenga, J. Theo M.; Prins, Hidde B. A.


    Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is, acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant. PMID:16666848

  13. sup 14 C fixation by leaves and leaf cell protoplasts of the submerged aquatic angiosperm Potamogeton lucens: Carbon dioxide or bicarbonate

    SciTech Connect

    Staal, M.; Elzenga, J.T.M.; Prins, H.B.A. )


    Protoplasts were isolated from leaves of the aquatic angiosperm Potamogeton lucens L. The leaves utilize bicarbonate as a carbon source for photosynthesis, and show polarity; that is acidification of the periplasmic space of the lower, and alkalinization of the space near the upper leaf side. At present there are two models under consideration for this photosynthetic bicarbonate utilization process: conversion of bicarbonate into free carbon dioxide as a result of acidification and, second, a bicarbonate-proton symport across the plasma membrane. Carbon fixation of protoplasts was studied at different pH values and compared with that in leaf strips. Using the isotopic disequilibrium technique, it was established that carbon dioxide and not bicarbonate was the form in which DIC actually crossed the plasma membrane. It is concluded that there is probably no true bicarbonate transport system at the plasma membrane of these cells and that bicarbonate utilization in this species apparently rests on the conversion of bicarbonate into carbon dioxide. Experiments with acetazolamide, an inhibitor of periplasmic carbonic anhydrase, and direct measurements of carbonic anhydrase activity in intact leaves indicate that in this species the role of this enzyme for periplasmic conversion of bicarbonate into carbon dioxide is insignificant.

  14. Relationship of photosynthetic carbon fixation with environmental changes in the Jiulong River estuary of the South China Sea, with special reference to the effects of solar UV radiation.


    Li, Gang; Gao, Kunshan; Yuan, Dongxing; Zheng, Ying; Yang, Guiyuan


    Phytoplankton cells in estuary waters usually experience drastic changes in chemical and physical environments due to mixing of fresh and seawaters. In order to see their photosynthetic performance in such dynamic waters, we measured the photosynthetic carbon fixation by natural phytoplankton assemblages in the Jiulong River estuary of the South China Sea during April 24-26 and July 24-26 of 2008, and investigated its relationship with environmental changes in the presence or the absence of UV radiation. Phytoplankton biomass (Chl a) decreased sharply from the river-mouth to seawards (17.3-2.1 ?g L(-1)), with the dominant species changed from chlorophytes to diatoms. The photosynthetic rate based on Chl a at noon time under PAR-alone increased from 1.9 ?g C (?g Chl a)(-1) L(-1) in low salinity zone (SSS<10) to 12.4 ?g C (?g Chl a)(-1) L(-1) in turbidity front (SSS within 10-20), and then decreased to 2.1 ?g C (?g Chl a)(-1) L(-1) in mixohaline zone (SSS>20); accordingly, the carbon fixation per volume of seawater increased from 12.8 to 149 ?g C L(-1) h(-1), and decreased to 14.3 ?g C L(-1) h(-1). Solar UVR caused the inhibition of carbon fixation in surface water of all the investigated zones, by 39% in turbidity area and 7-10% in freshwater or mixohaline zones. In the turbidity zone, higher availability of CO2 could have enhanced the photosynthetic performance; while osmotic stress might be responsible for the higher sensitivity of phytoplankton assemblages to solar UV radiation. PMID:21714975

  15. Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata

    PubMed Central

    Ponsard, Julie; Cambon-Bonavita, Marie-Anne; Zbinden, Magali; Lepoint, Gilles; Joassin, Andr; Corbari, Laure; Shillito, Bruce; Durand, Lucile; Cueff-Gauchard, Valrie; Compre, Philippe


    The shrimp Rimicaris exoculata dominates several hydrothermal vent ecosystems of the Mid-Atlantic Ridge and is thought to be a primary consumer harbouring a chemoautotrophic bacterial community in its gill chamber. The aim of the present study was to test current hypotheses concerning the epibiont's chemoautotrophy, and the mutualistic character of this association. In-vivo experiments were carried out in a pressurised aquarium with isotope-labelled inorganic carbon (NaH13CO3 and NaH14CO3) in the presence of two different electron donors (Na2S2O3 and Fe2+) and with radiolabelled organic compounds (14C-acetate and 3H-lysine) chosen as potential bacterial substrates and/or metabolic by-products in experiments mimicking transfer of small biomolecules from epibionts to host. The bacterial epibionts were found to assimilate inorganic carbon by chemoautotrophy, but many of them (thick filaments of epsilonproteobacteria) appeared versatile and able to switch between electron donors, including organic compounds (heterotrophic acetate and lysine uptake). At least some of them (thin filamentous gammaproteobacteria) also seem capable of internal energy storage that could supply chemosynthetic metabolism for hours under conditions of electron donor deprivation. As direct nutritional transfer from bacteria to host was detected, the association appears as true mutualism. Import of soluble bacterial products occurs by permeation across the gill chamber integument, rather than via the digestive tract. This first demonstration of such capabilities in a decapod crustacean supports the previously discarded hypothesis of transtegumental absorption of dissolved organic matter or carbon as a common nutritional pathway. PMID:22914596

  16. Advances in mechanisms and signaling pathways of carbon nanotube toxicity

    PubMed Central

    Dong, Jie; Ma, Qiang


    Carbon nanotubes (CNT) have been developed into new materials with a variety of industrial and commercial applications. In contrast, the physicochemical properties of CNT at the nanoscale render them the potency to generate toxic effects. Indeed, the potential health impacts of CNT have drawn a great deal of attention in recent years, owing to their identified toxicological and pathological consequences including cytotoxicity, inflammation, fibrosis, genotoxicity, tumorigenesis, and immunotoxicity. Understanding the mechanisms by which CNT induce toxicity and pathology is thus urgently needed for accurate risk assessment of CNT exposure in humans, and for safe and responsible development and commercialization of nanotechnology. Here, we summarize and discuss recent advances in this area with a focus on the molecular interactions between CNT and mammalian systems, and the signaling pathways important for the development of CNT toxicity such as the NF-κB, NLRP3 inflammasome, TGF-β1, MAPK, and p53 signaling cascades. With the current mechanistic evidence summarized in this review, we expect to provide new insights into CNT toxicology at the molecular level and offer new clues to the prevention of health effects resulting from CNT exposure. Moreover, we disclose questions and issues that remain in this rapidly advancing field of nanotoxicology, which would facilitate ascertaining future research directions. PMID:25676622

  17. [Potential Carbon Fixation Capability of Non-photosynthetic Microbial Community at Different Depth of the South China Sea and Its Response to Different Electron Donors].


    Fang, Feng; Wang, Lei; Xi, Xue-fei; Hu, Jia-jun; Fu, Xiao-hua; Lu, Bing; Xu, Dian-sheng


    The seawater samples collected from many different areas with different depth in the South China Sea were cultivated using different electron donors respectively. And the variation in the potential carbon fixation capability ( PCFC ) of non-photosynthetic microbial community (NPMC) in seawater with different depth was determined after a cycle of cultivation through the statistic analysis. In addition, the cause for the variation was clarified through analyzing key gene abundance regarding CO2 fixation and characteristics of seawater with different depth. The result showed that the PCFCs of NPMC in seawater with different depth were generally low and had no significant difference when using NaNO2 as the electron donor. The PCFC of NPMC in surface seawater was higher than that in deep seawater when using H2 as the electron donor, on the contrary, the PCFC of NPMC in deep seawater was higher than that in surface seawater when using Na2S2O3 as the electron donor. The abundance of the main CO2 fixation gene cbbL in surface seawater was higher than that in deep seawater while the cbbM gene abundance in deep seawater was higher than that in surface seawater. Most hydrogen-oxidizing bacteria had the cbbL gene, and most sulfur bacteria had the cbbM gene. The tendency of seawater cbbL/cbbM gene abundance with the change of depth revealed that there were different kinds of bacteria accounting for the majority in NPMC fixing CO2 at different depth of ocean, which led to different response of PCFC of NPMC at different depth of the sea to different electron donors. The distributions of dissolved oxygen and inorganic carbon concentration with the change of the depth of the sea might be an important reason leading to the difference of NPMC structure and even the difference of PCFC at different depth of the sea. PMID:26314099

  18. Carbon isotopes as tracers of dissolved organic carbon sources and water pathways in headwater catchments

    NASA Astrophysics Data System (ADS)

    Lambert, Thibault; Pierson-Wickmann, Anne-Catherine; Gruau, Grard; Thibault, Jean-Nol; Jaffrezic, Anne


    SummaryStable carbon isotopes (? 13C) are assessed in further detail for their potential to (i) trace the relationship between spatial variations in the source of dissolved organic carbon (DOC) in soils and temporal variability of both DOC concentration and composition in streams, and (ii) elucidate water pathway changes during storm events in headwater catchments. For this purpose, we investigated ? 13C DOC values in a wetland soil (0-50 cm), in deep groundwater (until 6 m) and during a storm flow event with high-resolution monitoring (?hourly basis) in a small, lowland catchment in western France (Kervidy-Naizin catchment). The results show a combined increase of stream DOC concentration (from 4 to 14 mg L -1) and decrease of stream ? 13C DOC (from -27 to -29) with increasing discharge, suggesting a change in DOC sources between base flow and storm flow periods. Such an interpretation is consistent with the ? 13C DOC values in soils that show a 6 vertical variation, with ? 13C DOC values of the uppermost soil horizons (0-10 cm) of the wetland domains being close to those measured in the stream channel during the ascending limb of the hydrograph. Overall, the results presented in this study are consistent with a model in which the water-table rise and wetland runoff caused by rainfall lead to a flushing of the DOC stored in the uppermost soil horizons of the wetland domains near the channel network. Subsequently, these wetland soils become the dominant DOC source during storm events (ca. 70% of the total DOC flux). In this way, the stream DOC isotopic composition reflects the combined effects of the vertical variation of soil organic matter composition as well as the changes in water routing through time. This study demonstrates the ability of the stable isotopes of carbon to serve not only as a tool for the location of stream DOC sources in landscapes but also the reconstruction of water pathways in headwater catchments.

  19. Cytochrome c terminal oxidase pathways of Azotobacter vinelandii: analysis of cytochrome c4 and c5 mutants and up-regulation of cytochrome c-dependent pathways with N2 fixation.

    PubMed Central

    Rey, L; Maier, R J


    The Azotobacter vinelandii cytochrome c5 gene (termed cycB) was cloned and sequenced. Mutants in this c-type cytochrome as well as cytochrome c4 mutants (mutations in cycA) and double mutants in both of the c-type respiratory pathways were characterized. Spectral and heme staining experiments on membranes from the mutants were consistent with the anticipated characteristics of all the gene-directed mutants. Membranes of the individual cytochrome c4 or c5 mutants had normal respiratory rates with physiological substrates but respiration significantly lower than the wild-type rate with ascorbate-N,N,N',N',-tetramethyl-p-phenylenediamine (TMPD) as a reductant. The growth rates of the individual cytochrome c4 or c5 mutants were not markedly different from that of the wild-type strain, but the cycA cycB double-mutant strain was noticeably growth retarded at and below 7.5% O2 on both N-containing and N-free media. The double-mutant strain was unable to grow on agar plates at O2 tensions of 2.5% or less on N-free medium. As the wild-type growth was unaffected by varying the O2 tension, the results indicate that the role of the cytochrome c-dependent pathways is to provide respiration at intermediate (5 to 10%) and low (below 5%) O2 tensions. The two c-type cytochrome genes are transcriptionally up-regulated with N2 fixation; N starvation caused 2.8-fold and 7- to 10-fold increases in the promoter activities of cycA and cycB, respectively, but these activities were affected little by the O2 level supplied to the cultures. PMID:9371471

  20. Two-dimensional isobutyl acetate production pathways to improve carbon yield

    PubMed Central

    Tashiro, Yohei; Desai, Shuchi H.; Atsumi, Shota


    For an economically competitive biological process, achieving high carbon yield of a target chemical is crucial. In biochemical production, pyruvate and acetyl-CoA are primary building blocks. When sugar is used as the sole biosynthetic substrate, acetyl-CoA is commonly generated by pyruvate decarboxylation. However, pyruvate decarboxylation during acetyl-CoA formation limits the theoretical maximum carbon yield (TMCY) by releasing carbon, and in some cases also leads to redox imbalance. To avoid these problems, we describe here the construction of a metabolic pathway that simultaneously utilizes glucose and acetate. Acetate is utilized to produce acetyl-CoA without carbon loss or redox imbalance. We demonstrate the utility of this approach for isobutyl acetate (IBA) production, wherein IBA production with glucose and acetate achieves a higher carbon yield than with either sole carbon source. These results highlight the potential for this multiple carbon source approach to improve the TMCY and balance redox in biosynthetic pathways. PMID:26108471

  1. Carbon Assimilation Pathways, Water Relationships and Plant Ecology.

    ERIC Educational Resources Information Center

    Etherington, John R.


    Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

  2. C3 and C4 Pathways of Photosynthetic Carbon Assimilation in Marine Diatoms Are under Genetic, Not Environmental, Control1[W][OA

    PubMed Central

    Roberts, Karen; Granum, Espen; Leegood, Richard C.; Raven, John A.


    Marine diatoms are responsible for up to 20% of global CO2 fixation. Their photosynthetic efficiency is enhanced by concentrating CO2 around Rubisco, diminishing photorespiration, but the mechanism is yet to be resolved. Diatoms have been regarded as C3 photosynthesizers, but recent metabolic labeling and genome sequencing data suggest that they perform C4 photosynthesis. We studied the pathways of photosynthetic carbon assimilation in two diatoms by short-term metabolic 14C labeling. In Thalassiosira weissflogii, both C3 (glycerate-P and triose-P) and C4 (mainly malate) compounds were major initial (25 s) products, whereas Thalassiosira pseudonana produced mainly C3 and C6 (hexose-P) compounds. The data provide evidence of C3-C4 intermediate photosynthesis in T. weissflogii, but exclusively C3 photosynthesis in T. pseudonana. The labeling patterns were the same for cells grown at near-ambient (380 ?L L?1) and low (100 ?L L?1) CO2 concentrations. The lack of environmental modulation of carbon assimilatory pathways was supported in T. pseudonana by measurements of gene transcript and protein abundances of C4-metabolic enzymes (phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase) and Rubisco. This study suggests that the photosynthetic pathways of diatoms are diverse, and may involve combined CO2-concentrating mechanisms. Furthermore, it emphasizes the requirement for metabolic and functional genetic and enzymic analyses before accepting the presence of C4-metabolic enzymes as evidence for C4 photosynthesis. PMID:17644625

  3. Methanotrophy induces nitrogen fixation during peatland development.


    Larmola, Tuula; Leppänen, Sanna M; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja


    Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

  4. Methanotrophy induces nitrogen fixation during peatland development

    PubMed Central

    Larmola, Tuula; Leppänen, Sanna M.; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja


    Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

  5. Carbon partitioning to the terpenoid biosynthetic pathway enables heterologous ?-phellandrene production in Escherichia coli cultures.


    Formighieri, Cinzia; Melis, Anastasios


    Escherichia coli was used as a microbial system for the heterologous synthesis of ?-phellandrene, a monoterpene of plant origin with several potential commercial applications. Expression of Lavandula angustifolia ?-phellandrene synthase (PHLS), alone or in combination with Picea abies geranyl-diphosphate synthase in E. coli, resulted in no ?-phellandrene accumulation, in sharp contrast to observations with PHLS-transformed cyanobacteria. Lack of ?-phellandrene biosynthesis in E. coli was attributed to the limited endogenous carbon partitioning through the native 2-C-methylerythritol-4-phosphate (MEP) pathway. Heterologous co-expression of the mevalonic acid pathway, enhancing cellular carbon partitioning and flux toward the universal isoprenoid precursors, isopentenyl-diphosphate and dimethylallyl-diphosphate, was required to confer ?-phellandrene production. Differences in endogenous carbon flux toward the synthesis of isoprenoids between photosynthetic (Synechocystis) and non-photosynthetic bacteria (E. coli) are discussed in terms of differences in the regulation of carbon partitioning through the MEP biosynthetic pathway in the two systems. PMID:25116411

  6. Carbon Balance of a Mannitol Fermentation and the Biosynthetic Pathway

    PubMed Central

    Lee, Wei Hwa


    The carbon balance was determined for a fermentation in which mannitol is produced from glucose by an Aspergillus species. The products found were: cells (17% of carbon input), CO2 (26%), mannitol (35%), glycerol (10%), erythritol (2.5%), glycogen (1%), and unidentified compounds (8%). Thus, 92% of the carbon input was accounted for. Cell-free enzyme studies showed that mannitol was synthesized via the reduction of fructose-6-phosphate and not by the direct reduction of fructose. If the cell yield from glucose was assumed to be 50% and the theoretical conversion efficiency from glucose to polyols was 90%, as calculated from the energy balance, then 34% of the glucose carbon was used for growth and 53% was used for polyol formation. PMID:4294822

  7. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    NASA Astrophysics Data System (ADS)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.


    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the theoretical acidic conditions of these soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. Regarding the carbonate flux, another direct consequence of wood feeding is a concomitant flux of carbonate formed in wood tissues, which is not consumed by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter. Therefore, an oxalate pool is formed on the forest ground. Then, wood rotting gents (mainly termites, fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition some of these gents are themselves producers of oxalate (fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with δ13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as define by the ecological theory.

  8. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    NASA Astrophysics Data System (ADS)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.


    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. In addition, a concomitant flux of carbonate formed in wood tissues contributes to the carbonate flux and is identified as a direct consequence of wood feeding by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter, and an oxalate pool is formed on the forest ground. Then, wood rotting agents (mainly termites, saprophytic fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition, some of these agents are themselves producers of oxalate (e.g. fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can then start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with δ13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as defined by ecological theory.

  9. Carbon dioxide concentration dictates alternative methanogenic pathways in oil reservoirs.


    Mayumi, Daisuke; Dolfing, Jan; Sakata, Susumu; Maeda, Haruo; Miyagawa, Yoshihiro; Ikarashi, Masayuki; Tamaki, Hideyuki; Takeuchi, Mio; Nakatsu, Cindy H; Kamagata, Yoichi


    Deep subsurface formations (for example, high-temperature oil reservoirs) are candidate sites for carbon capture and storage technology. However, very little is known about how the subsurface microbial community would respond to an increase in CO2 pressure resulting from carbon capture and storage. Here we construct microcosms mimicking reservoir conditions (55 C, 5 MPa) using high-temperature oil reservoir samples. Methanogenesis occurs under both high and low CO2 conditions in the microcosms. However, the increase in CO2 pressure accelerates the rate of methanogenesis to more than twice than that under low CO2 conditions. Isotope tracer and molecular analyses show that high CO2 conditions invoke acetoclastic methanogenesis in place of syntrophic acetate oxidation coupled with hydrogenotrophic methanogenesis that typically occurs in this environment (low CO2 conditions). Our results present a possibility of carbon capture and storage for enhanced microbial energy production in deep subsurface environments that can mitigate global warming and energy depletion. PMID:23759740

  10. The intramolecular C-distribution in ethanol reveals the influence of the CO? -fixation pathway and environmental conditions on the site-specific C variation in glucose.


    Gilbert, Alexis; Silvestre, Virginie; Segebarth, Nicolas; Tcherkez, Guillaume; Guillou, Claude; Robins, Richard J; Akoka, Serge; Remaud, Grald S


    Efforts to understand the cause of C versus C isotope fractionation in plants during photosynthesis and post-photosynthetic metabolism are frustrated by the lack of data on the intramolecular C-distribution in metabolites and its variation with environmental conditions. We have exploited isotopic carbon-13 nuclear magnetic resonance (C NMR) spectrometry to measure the positional isotope composition (?C(i) , ) in ethanol samples from different origins: European wines, liquors and sugars from C?, C? and crassulacean acid metabolism (CAM) plants. In C?-ethanol samples, the methylene group was always C-enriched (?2) relative to the methyl group. In wines, this pattern was correlated with both air temperature and ?(18)O of wine water, indicating that water vapour deficit may be a critical defining factor. Furthermore, in C?-ethanol, the reverse relationship was observed (methylene-C relatively C-depleted), supporting the concept that photorespiration is the key metabolic process leading to the C distribution in C?-ethanol. By contrast, in CAM-ethanol, the isotopic pattern was similar to but stronger than C?-ethanol, with a relative C-enrichment in the methylene-C of up to 13. Plausible causes of this C-pattern are briefly discussed. As the intramolecular ?C(i) -values in ethanol reflect that in source glucose, our data point out the crucial impact on the ratio of metabolic pathways sustaining glucose synthesis. PMID:21410708

  11. Molybdenum Trafficking for Nitrogen Fixation

    PubMed Central

    Hernandez, Jose A.; George, Simon J.; Rubio, Luis M.


    The molybdenum nitrogenase is responsible for most biological nitrogen fixation, a prokaryotic metabolic process that determines the global biogeochemical cycles of nitrogen and carbon. Here we describe the trafficking of molybdenum for nitrogen fixation in the model diazotrophic bacterium Azotobacter vinelandii. The genes and proteins involved in molybdenum uptake, homeostasis, storage, regulation, and nitrogenase cofactor biosynthesis are reviewed. Molybdenum biochemistry in A. vinelandii reveals unexpected mechanisms and a new role for iron-sulfur clusters in the sequestration and delivery of molybdenum. PMID:19772354

  12. High-Gravity Carbonation Process for Enhancing CO2 Fixation and Utilization Exemplified by the Steelmaking Industry.


    Pan, Shu-Yuan; Chen, Yi-Hung; Chen, Chun-Da; Shen, Ai-Lin; Lin, Michael; Chiang, Pen-Chi


    The high-gravity carbonation process for CO2 mineralization and product utilization as a green cement was evaluated using field operation data from the steelmaking industry. The effect of key operating factors, including rotation speed, liquid-to-solid ratio, gas flow rate, and slurry flow rate, on CO2 removal efficiency was studied. The results indicated that a maximal CO2 removal of 97.3% was achieved using basic oxygen furnace slag at a gas-to-slurry ratio of 40, with a capture capacity of 165 kg of CO2 per day. In addition, the product with different carbonation conversions (i.e., 0%, 17%, and 48%) was used as supplementary cementitious materials in blended cement at various substitution ratios (i.e., 0%, 10%, and 20%). The performance of the blended cement mortar, including physicochemical properties, morphology, mineralogy, compressive strength, and autoclave soundness, was evaluated. The results indicated that the mortar with a high carbonation conversion of slag exhibited a higher mechanical strength in the early stage than pure portland cement mortar, suggesting its suitability for use as a high early strength cement. It also possessed superior soundness compared to the mortar using fresh slag. Furthermore, the optimal operating conditions of the high-gravity carbonation were determined by response surface models for maximizing CO2 removal efficiency and minimizing energy consumption. PMID:26397167

  13. Pathways and Bioenergetics of Anaerobic Carbon Monoxide Fermentation

    PubMed Central

    Diender, Martijn; Stams, Alfons J. M.; Sousa, Diana Z.


    Carbon monoxide can act as a substrate for different modes of fermentative anaerobic metabolism. The trait of utilizing CO is spread among a diverse group of microorganisms, including members of bacteria as well as archaea. Over the last decade this metabolism has gained interest due to the potential of converting CO-rich gas, such as synthesis gas, into bio-based products. Three main types of fermentative CO metabolism can be distinguished: hydrogenogenesis, methanogenesis, and acetogenesis, generating hydrogen, methane and acetate, respectively. Here, we review the current knowledge on these three variants of microbial CO metabolism with an emphasis on the potential enzymatic routes and bio-energetics involved. PMID:26635746

  14. Non-riverine pathways of terrigenous carbon to the ocean

    NASA Astrophysics Data System (ADS)

    Dittmar, T.


    The extent and nature of non-riverine fluxes of carbon from land to ocean are poorly understood. Tidal pumping from highly productive coastal environments, atmospheric deposition and submarine groundwater discharge can be significant transport mechanisms for carbon to the ocean. Evidence is mounting that tidally-induced porewater fluxes ("outwelling") of dissolved organic matter (DOM) from mangroves and salt marshes alone may be similar in magnitude as the global riverine flux of DOM. Tidal pumping of dissolved inorganic carbon (DIC) might exceed organic carbon fluxes by far, but the existing knowledge on DIC outwelling is too scarce for a first global estimate. Results from two case studies on the biogeochemistry of DOM outwelling are presented, from the mangroves in Northern Brazil and the salt marshes in the Northern Gulf of Mexico. Ongoing research in the Northern Gulf of Mexico indicates that outwelling and groundwater inputs probably exceed riverine DOM fluxes in this region. Similar observations were made in Northern Brazil. There, the fate of mangrove-derived DOM could be traced from its source in the mangrove sediments to the outer North Brazil shelf by using a combination of isotopic and molecular approaches. Reversed-phase liquid chromatography / mass spectrometry (LC/MS) provided a multifaceted array of information that mirrors the molecular complexity of DOM. Statistical analyses on these data revealed significant differences between mangrove and open-ocean DOM which successively disappeared by irradiating the samples with natural sunlight. Nuclear magnetic resonance analyses yielded concurrent results. Ultrahigh-resolution Fourier transform-ion cyclotron resonance mass spectrometry (FT-ICR MS) is the only technique capable of resolving and identifying individual elemental compositions in these complex mixtures. We applied this technique for characterizing mangrove-derived DOM and to assess the molecular changes that occur in the initial stages of outwelling. The different approaches concordantly show the presence of photodegraded mangrove DOM on the North Brazil shelf. During transport offshore, sunlight efficiently destroyed aromatic molecules, removing about one third of mangrove-derived DOM. The remainder was refractory and may thus be distributed over the oceans.

  15. Biological carbon fixation: A study of Isochrysis sp. growth under actual coal-fired power plant's flue gas

    NASA Astrophysics Data System (ADS)

    >Liyana Yahya, Muhammad Nazry Chik, Mohd Asyraf Mohd Azmir Pang,


    Preliminary study on the growth of marine microalgae Isochrysis sp. was carried out using actual flue gas from a coal-fired power station. The species was cultured using a 2×10-L customized bubble column photobioreactor skid under specified culture conditions. With an initial culture density of 0.459 Abs (optical density at 560 nm wavelength), the species was found able to survive - observed by increases in optical densities, number of cells and weights - in the presence of actual coal-fired flue gas containing on average 4.08 % O2, 200.21 mg/m3 SO2, 212.29 mg/m3 NOx, 4.73 % CO2 and 50.72 mg/m3 CO. Results thus add value to the potential and capability of microalgae, especially for Isochrysis sp., to be the biological carbon fixer in neutralizing carbon emissions from power plants.

  16. Diversity of freshwater Epsilonproteobacteria and dark inorganic carbon fixation in the sulphidic redoxcline of a meromictic karstic lake.


    Noguerola, Imma; Picazo, Antonio; Llirs, Marc; Camacho, Antonio; Borrego, Carles M


    Sulfidic redoxclines are a suitable niche for the growth and activity of different chemo- and photolithotrophic sulphide-oxidizing microbial groups such as the Epsilonproteobacteria and the green sulfur bacteria (GSB). We have investigated the diversity, abundance and contribution to inorganic carbon uptake of Epsilonproteobacteria in a meromictic basin of Lake Banyoles. CARD-FISH counts revealed that Epsilonproteobacteria were prevalent at the redoxcline in winter (maximum abundance of 2 10(6) cellsmL(-1), ?60% of total cells) but they were nearly absent in summer, when GSB bloomed. This seasonal trend was supported by 16S rRNA gene pyrotag datasets, which revealed that the epsilonproteobacterial community was mainly composed of a member of the genus Arcobacter. In situ incubations using NaH(14)CO3 and MAR-CARD-FISH observations showed that this population assimilated CO2 in the dark, likely being mainly responsible for the autotrophic activity at the redoxcline in winter. Clone libraries targeting the aclB gene provided additional evidence of the potential capacity of these epsilonproteobacteria to fix carbon via rTCA cycle. Our data reinforce the key role of Epsilonproteobacteria in linking carbon and sulphur cycles, extend their influence to freshwater karstic lakes and raise questions about the actual contribution of chemolithotrophy at their redoxcline and euxinic water compartments. PMID:26195601

  17. Toxicity of polychlorinated biphenyls (PCBs) to Euglena gracilis: cell population growth, carbon fixation, chlorophyll level, oxygen consumption, and protein and nucleic acid synthesis.


    Ewald, W G; French, J E; Champ, M A


    Populations of Euglena gracilis in exponential growth under light were exposed to 2.5, 5.0, 7.5, and 10 ppm of Aroclor 1221. The ID50/48 of Aroclor 1221 was estimated to be 4.4 ppm, while Aroclor 1232 tested at 20, 35, 50, and 100 ppm resulted in an id50/48 of 55 ppm. With Aroclor 1242, no inhibition of growth was observed with up to 100 ppm exposure. Cell cultures exposed to 4.4 ppm of Aroclor 1221 for 48 hrs had a significantly reduced rate of carbon fixation and reduced levels of chlorophyll after correction for cell density. Oxygen consumption was not affected at the ID50 level of the Aroclor. Uptake of [3H]-leucine in treated cultures was twice that of controls, and [3H]-uridine uptake was significantly lower. Uptake of [3H]-thymidine, and incorporation of [3H]-leucine, [3H]-thymidine, and [3H]-uridine were not significantly different in treated and control cultures. Thes results suggest that at the ID50 level, polychlorinated biphenyls (PCBs) reduce cell population growth in Euglena gracilis by inhibition of photosynthesis and/or chlorophyll production. PMID:822906

  18. NifA- and CooA-Coordinated cowN Expression Sustains Nitrogen Fixation by Rhodobacter capsulatus in the Presence of Carbon Monoxide

    PubMed Central

    Hoffmann, Marie-Christine; Pfänder, Yvonne; Fehringer, Maria; Narberhaus, Franz


    Rhodobacter capsulatus fixes atmospheric dinitrogen via two nitrogenases, Mo- and Fe-nitrogenase, which operate under different conditions. Here, we describe the functions in nitrogen fixation and regulation of the rcc00574 (cooA) and rcc00575 (cowN) genes, which are located upstream of the structural genes of Mo-nitrogenase, nifHDK. Disruption of cooA or cowN specifically impaired Mo-nitrogenase-dependent growth at carbon monoxide (CO) concentrations still tolerated by the wild type. The cooA gene was shown to belong to the Mo-nitrogenase regulon, which is exclusively expressed when ammonium is limiting. Its expression was activated by NifA1 and NifA2, the transcriptional activators of nifHDK. AnfA, the transcriptional activator of Fe-nitrogenase genes, repressed cooA, thereby counteracting NifA activation. CooA activated cowN expression in response to increasing CO concentrations. Base substitutions in the presumed CooA binding site located upstream of the cowN transcription start site abolished cowN expression, indicating that cowN regulation by CooA is direct. In conclusion, a transcription factor-based network controls cowN expression to protect Mo-nitrogenase (but not Fe-nitrogenase) under appropriate conditions. PMID:25070737

  19. Chemical mechanism of the high solubility pathway for the carbon dioxide free production of iron.


    Licht, Stuart; Wu, Hongjun; Zhang, Zhonghai; Ayub, Hina


    We determine the fundamental iron oxide high solubility mechanism that drives a new electrolytic pathway to iron production, and eliminates a major CO(2) emission source, for example it is produced using wind and solar energy, in a molten carbonate electrolyte, at a high rate and a low electrolysis energy. PMID:21301745

  20. Metabolome analysis and pathway abundance profiling of Yarrowia lipolytica cultivated on different carbon sources.


    Zhao, Chen; Gu, Deqing; Nambou, Komi; Wei, Liujing; Chen, Jun; Imanaka, Tadayuki; Hua, Qiang


    Yarrowia lipolytica, a model microorganism of oleaginous yeasts with developed sophisticated genetic tools, is able to metabolize a wide range of substrates and accumulate large amounts of lipids. However, there is a lack of literature reporting the metabolic characteristics of Y. lipolytica metabolizing these substrates in a systematic view. In this study, Y. lipolytica was cultivated on a variety of carbon sources, among which cell growth and production characteristics on two representative substrates (glucose and oleic acid) were investigated in detail at metabolomic level. Metabolic pathway abundance was computed to interpret the metabolome data in a straightforward way. The results showed that most pathway abundances decreased in the shift from growth to production phase. Specifically, when cultivated on glucose, abundances of twelve pathways decreased markedly between the growth and lipid production phases, while thirteen pathways reduced and only three pathways increased significantly in abundances on oleic acid. In comparison, for the same cultivation phase only a few pathways exhibited significant changes between glucose-grown and oleic acid-grown cells. This study revealed that the pathway abundance could be used to effectively show the activity changes of pathways, providing a new perspective to employ metabolomics data for understanding cell metabolism and enhancing the production of target metabolites. PMID:25912211

  1. Phytoplankton carbon fixation gene (RuBisCO) transcripts and air-sea CO(2) flux in the Mississippi River plume.


    John, David E; Wang, Zhaohui A; Liu, Xuewu; Byrne, Robert H; Corredor, Jorge E; López, José M; Cabrera, Alvaro; Bronk, Deborah A; Tabita, F Robert; Paul, John H


    River plumes deliver large quantities of nutrients to oligotrophic oceans, often resulting in significant CO(2) drawdown. To determine the relationship between expression of the major gene in carbon fixation (large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, RuBisCO) and CO(2) dynamics, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO(2) in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30-32) stations were dominated by rbcL mRNA concentrations from heterokonts, such as diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, alpha-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34-36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO(2). While Prochlorococcus cells did not exhibit a large difference between low and high pCO(2) water, Prochlorococcus rbcL RNA concentrations had a strong positive correlation to pCO(2), suggesting a very low level of RuBisCO RNA transcription among Prochlorococcus in the plume waters, possibly due to their relatively poor carbon concentrating mechanisms (CCMs). These results provide molecular evidence that diatom/pelagophyte productivity is largely responsible for the large CO(2) drawdown occurring in the MRP, based on the co-occurrence of elevated RuBisCO gene transcript concentrations from this group and reduced seawater pCO(2) levels. This may partly be due to efficient CCMs that enable heterokont eukaryotes such as diatoms to continue fixing CO(2) in the face of strong CO(2) drawdown. Our work represents the first attempt to relate in situ microbial gene expression to contemporaneous CO(2) flux measurements in the ocean. PMID:18043653

  2. Soil temperature and water content drive microbial carbon fixation in grassland of permafrost area on the Tibetan plateau

    NASA Astrophysics Data System (ADS)

    Kong, W.; Guo, G.; Liu, J.


    Soil microbial communities underpin terrestrial biogeochemical cycles and are greatly influenced by global warming and global-warming-induced dryness. However, the response of soil microbial community function to global change remains largely uncertain, particularly in the ecologically vulnerable Tibetan plateau permafrost area with large carbon storage. With the concept of space for time substitution, we investigated the responses of soil CO2-fixing microbial community and its enzyme activity to climate change along an elevation gradient (4400-5100 m) of alpine grassland on the central Tibetan plateau. The elevation gradient in a south-facing hill slope leads to variation in climate and soil physicochemical parameters. The autotrophic microbial communities were characterized by quantitative PCR (qPCR), terminal restriction fragment length polymorphism analysis (T-RFLP) and cloning/sequencing targeting the CO2-fixing gene (RubisCO). The results demonstrated that the autotrophic microbial community abundance, structure and its enzyme activity were mainly driven by soil temperature and water content. Soil temperature increase and water decrease dramatically reduced the abundance of the outnumbered form IC RubisCO-containing microbes, and significantly changed the structure of form IC, IAB and ID RubisCO-containing microbial community. Structural equation model revealed that the RubisCO enzyme was directly derived from RubisCO-containing microbes and its activity was significantly reduced by soil temperature increase and water content decrease. Thus our results provide a novel positive feedback loop of climate warming and warming-induced dryness by that soil microbial carbon fixing potential will reduce by 3.77%-8.86% with the soil temperature increase of 1.94oC and water content decrease of 60%-70%. This positive feedback could be capable of amplifying the climate change given the significant contribution of soil microbial CO2-fixing up to 4.9% of total soil organic carbon.

  3. Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor

    SciTech Connect

    Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A; Beste, Ariana; Naskar, Amit K


    Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. We observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.

  4. Carboxylases in Natural and Synthetic Microbial Pathways?

    PubMed Central

    Erb, Tobias J.


    Carboxylases are among the most important enzymes in the biosphere, because they catalyze a key reaction in the global carbon cycle: the fixation of inorganic carbon (CO2). This minireview discusses the physiological roles of carboxylases in different microbial pathways that range from autotrophy, carbon assimilation, and anaplerosis to biosynthetic and redox-balancing functions. In addition, the current and possible future uses of carboxylation reactions in synthetic biology are discussed. Such uses include the possible transformation of the greenhouse gas carbon dioxide into value-added compounds and the production of novel antibiotics. PMID:22003013

  5. Synthesis of [11C]Bexarotene by Cu-Mediated [11C]Carbon Dioxide Fixation and Preliminary PET Imaging

    PubMed Central


    Bexarotene (Targretin) is a retinoid X receptor (RXR) agonist that has applications for treatment of T cell lymphoma and proposed mechanisms of action in Alzheimers disease that have been the subject of recent controversy. Carbon-11 labeled bexarotene ([11C-carbonyl]4-[1-(3,5,5,8,8-pentamethyltetralin-2-yl)ethenyl]benzoic acid) was synthesized using a Cu-mediated cross-coupling reaction employing an arylboronate precursor 1 and [11C]carbon dioxide under atmospheric pressure in 15 2% uncorrected radiochemical yield (n = 3), based on [11C]CO2. Judicious choice of solvents, catalysts, and additives, as well as precursor concentration and purity of [11C]CO2, enabled the preparation of this 11C-labeled carboxylic acid. Formulated [11C]bexarotene was isolated (>37 mCi) with >99% radiochemical purity in 32 min. Preliminary positron emission tomographymagnetic resonance imaging revealed rapid brain uptake in nonhuman primate in the first 75 s following intravenous administration of the radiotracer (specific activity >0.3 Ci/?mol at time of injection), followed by slow clearance (? = ?43%) over 60 min. Modest uptake (SUVmax = 0.8) was observed in whole brain and regions with high RXR expression. PMID:24944741

  6. Pathways of Carbon Assimilation and Ammonia Oxidation Suggested by Environmental Genomic Analyses of Marine Crenarchaeota

    PubMed Central

    Hallam, Steven J; Mincer, Tracy J; Schleper, Christa; Preston, Christina M; Roberts, Katie; Richardson, Paul M


    Marine Crenarchaeota represent an abundant component of oceanic microbiota with potential to significantly influence biogeochemical cycling in marine ecosystems. Prior studies using specific archaeal lipid biomarkers and isotopic analyses indicated that planktonic Crenarchaeota have the capacity for autotrophic growth, and more recent cultivation studies support an ammonia-based chemolithoautotrophic energy metabolism. We report here analysis of fosmid sequences derived from the uncultivated marine crenarchaeote, Cenarchaeum symbiosum, focused on the reconstruction of carbon and energy metabolism. Genes predicted to encode multiple components of a modified 3-hydroxypropionate cycle of autotrophic carbon assimilation were identified, consistent with utilization of carbon dioxide as a carbon source. Additionally, genes predicted to encode a near complete oxidative tricarboxylic acid cycle were also identified, consistent with the consumption of organic carbon and in the production of intermediates for amino acid and cofactor biosynthesis. Therefore, C. symbiosum has the potential to function either as a strict autotroph, or as a mixotroph utilizing both carbon dioxide and organic material as carbon sources. From the standpoint of energy metabolism, genes predicted to encode ammonia monooxygenase subunits, ammonia permease, urease, and urea transporters were identified, consistent with the use of reduced nitrogen compounds as energy sources fueling autotrophic metabolism. Homologues of these genes, recovered from ocean waters worldwide, demonstrate the conservation and ubiquity of crenarchaeal pathways for carbon assimilation and ammonia oxidation. These findings further substantiate the likely global metabolic importance of Crenarchaeota with respect to key steps in the biogeochemical transformation of carbon and nitrogen in marine ecosystems. PMID:16533068

  7. In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways.


    Dey, Swati; North, Justin A; Sriram, Jaya; Evans, Bradley S; Tabita, F Robert


    All organisms possess fundamental metabolic pathways to ensure that needed carbon and sulfur compounds are provided to the cell in the proper chemical form and oxidation state. For most organisms capable of using CO2 as sole source of carbon, ribulose-1,5-bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) catalyzes primary carbon dioxide assimilation. In addition, sulfur salvage pathways are necessary to ensure that key sulfur-containing compounds are both available and, where necessary, detoxified in the cell. Using knock-out mutations and metabolomics in the bacterium Rhodospirillum rubrum, we show here that Rubisco concurrently catalyzes key and essential reactions for seemingly unrelated but physiologically essential central carbon and sulfur salvage metabolic pathways of the cell. In this study, complementation and mutagenesis studies indicated that representatives of all known extant functional Rubisco forms found in nature are capable of simultaneously catalyzing reactions required for both CO2-dependent growth as well as growth using 5-methylthioadenosine as sole sulfur source under anaerobic photosynthetic conditions. Moreover, specific inactivation of the CO2 fixation reaction did not affect the ability of Rubisco to support anaerobic 5-methylthioadenosine metabolism, suggesting that the active site of Rubisco has evolved to ensure that this enzyme maintains both key functions. Thus, despite the coevolution of both functions, the active site of this protein may be differentially modified to affect only one of its key functions. PMID:26511314

  8. Incomplete Wood–Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi

    PubMed Central

    Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L.; Feng, Xueyang; Men, Yujie; Conrad, Mark E.; Tang, Yinjie J.; Alvarez-Cohen, Lisa


    The acetyl-CoA “Wood–Ljungdahl” pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood–Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood–Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

  9. A critical knowledge pathway to low-carbon, sustainable futures: Integrated understanding of urbanization, urban areas, and carbon

    NASA Astrophysics Data System (ADS)

    Romero-Lankao, Patricia; Gurney, Kevin R.; Seto, Karen C.; Chester, Mikhail; Duren, Riley M.; Hughes, Sara; Hutyra, Lucy R.; Marcotullio, Peter; Baker, Lawrence; Grimm, Nancy B.; Kennedy, Christopher; Larson, Elisabeth; Pincetl, Stephanie; Runfola, Dan; Sanchez, Landy; Shrestha, Gyami; Feddema, Johannes; Sarzynski, Andrea; Sperling, Joshua; Stokes, Eleanor


    Independent lines of research on urbanization, urban areas, and carbon have advanced our understanding of some of the processes through which energy and land uses affect carbon. This synthesis integrates some of these diverse viewpoints as a first step toward a coproduced, integrated framework for understanding urbanization, urban areas, and their relationships to carbon. It suggests the need for approaches that complement and combine the plethora of existing insights into interdisciplinary explorations of how different urbanization processes, and socio-ecological and technological components of urban areas, affect the spatial and temporal patterns of carbon emissions, differentially over time and within and across cities. It also calls for a more holistic approach to examining the carbon implications of urbanization and urban areas, based not only on demographics or income but also on other interconnected features of urban development pathways such as urban form, economic function, economic-growth policies, and other governance arrangements. It points to a wide array of uncertainties around the urbanization processes, their interactions with urban socio-institutional and built environment systems, and how these impact the exchange of carbon flows within and outside urban areas. We must also understand in turn how carbon feedbacks, including carbon impacts and potential impacts of climate change, can affect urbanization processes. Finally, the paper explores options, barriers, and limits to transitioning cities to low-carbon trajectories, and suggests the development of an end-to-end, coproduced and integrated scientific understanding that can more effectively inform the navigation of transitional journeys and the avoidance of obstacles along the way.

  10. Integrated carbon dioxide/sludge gasification using waste heat from hot slags: syngas production and sulfur dioxide fixation.


    Sun, Yongqi; Zhang, Zuotai; Liu, Lili; Wang, Xidong


    The integrated CO2/sludge gasification using the waste heat in hot slags, was explored with the aim of syngas production, waste heat recovery and sewage sludge disposal. The results demonstrated that hot slags presented multiple roles on sludge gasification, i.e., not only a good heat carrier (500-950 C) but also an effective desulfurizer (800-900 C). The total gas yields increased from 0.022 kg/kgsludge at 500 C to 0.422 kg/kgsludge at 900 C; meanwhile, the SO2 concentration at 900 C remarkably reduced from 164 ppm to 114 ppm by blast furnace slags (BFS) and 93 ppm by steel slags (SS), respectively. A three-stage reaction was clarified including volatile release, char transformation and fixed carbon using Gaussian fittings and the kinetic model was analyzed. Accordingly, a decline process using the integrated method was designed and the optimum slag/sludge ratio was deduced. These deciphered results appealed potential ways of reasonable disposal of sewage sludge and efficient recovery of waste heat from hot slags. PMID:25647028

  11. Fixation strength of taper connection at head-neck junction in retrieved carbon fiber-reinforced PEEK hip stems.


    Nakahara, Ichiro; Takao, Masaki; Bandoh, Shunichi; Sugano, Nobuhiko


    Carbon fiber-reinforced polyetheretherketone (CFR-PEEK) hip prostheses possess numerous advantages over metal prostheses; however, the security of the taper connection between the CFR-PEEK stem and the modular femoral head in vivo has not been verified. Therefore, we mechanically examined the taper connection of retrieved in vivo loaded CFR-PEEK stems in comparison with in vivo loaded titanium alloy stems. CFR-PEEK and titanium alloy femoral stems with a 12/14 taper trunnion were implanted in ovine hips. A 22-mm ceramic head was intraoperatively impacted to the stem. Retrieved specimens were obtained following weight-bearing conditions for up to 39 postoperative weeks and taper junction pull-off tests were conducted. Postoperative retrieved CFR-PEEK stem pull-off strength was significantly greater than that at time zero. Postoperative retrieved CFR-PEEK stem pull-off strength was also significantly higher than that of postoperative retrieved titanium alloy stem. Microscopic findings of the taper surface revealed no obvious damage in the retrieved CFR-PEEK stems, whereas fretting and corrosion were observed in the retrieved titanium alloy stems. The present findings suggest that the taper connection between the ceramic head and the 12/14 CFR-PEEK stem trunnion is more secure than that between the ceramic head and the titanium alloy trunnion. PMID:25190272

  12. Nitrogen- and irradiance-dependent variations of the maximum quantum yield of carbon fixation in eutrophic, mesotrophic and oligotrophic marine systems

    NASA Astrophysics Data System (ADS)

    Babin, Marcel; Morel, Andr; Claustre, Herv; Bricaud, Annick; Kolber, Zbigniew; Falkowski, Paul G.


    Natural variability of the maximum quantum yield of carbon fixation ( ?C max), as determined from the initial slope of the photosynthesis-irradiance curve and from light absorption measurements, was studied at three sites in the northeast tropical Atlantic representing typical eutrophic, mesotrophic and oligotrophic regimes. At the eutrophic and mesotrophic sites, where the mixed layer extended deeper than the euphotic layer, all photosynthetic parameters were nearly constant with depth, and ?C max averaged between 0.05 and 0.03 molC (mol quanta absorbed) -1, respectively. At the oligotrophic site, a deep chlorophyll maximum (DCM) existed and ?C max varied from ca 0.005 in the upper nutrient-depleted mixed layer to 0.063 below the DCM in stratified waters. firstly, ?C max was found roughly to covary with nitrate concentration between sites and with depth at the oligotrophic site, and secondly, it was found to decrease with increasing relative concentrations of non-photosynthetic pigments. The extent of ?C max variations directly related to nitrate concentration was inferred from variations in the fraction of functional PS2 reaction centers ( f), measured using fast repetition rate fluorometry. Covariations between f and nitrate concentration indicate that the latter factor may be responsible for a 2-fold variation in ?C max. Moreover, partitioning light absorption between photosynthetic and non-photosynthetic pigments suggests that the variable contribution of the non-photosynthetic absorption may explain a 3-fold variation in ?C max, as indicated by variations in the effective absorption cross-section of photosystem 2 ( ?PS2). Results confirm the role of nitrate in ?C max variation, and emphasize those of light and vertical mixing.

  13. Dinitrogen fixation in aphotic oxygenated marine environments

    PubMed Central

    Rahav, Eyal; Bar-Zeev, Edo; Ohayon, Sarah; Elifantz, Hila; Belkin, Natalia; Herut, Barak; Mulholland, Margaret R.; Berman-Frank, Ilana


    We measured N2 fixation rates from oceanic zones that have traditionally been ignored as sources of biological N2 fixation; the aphotic, fully oxygenated, nitrate (NO−3)-rich, waters of the oligotrophic Levantine Basin (LB) and the Gulf of Aqaba (GA). N2 fixation rates measured from pelagic aphotic waters to depths up to 720 m, during the mixed and stratified periods, ranged from 0.01 nmol N L−1 d−1 to 0.38 nmol N L−1 d−1. N2 fixation rates correlated significantly with bacterial productivity and heterotrophic diazotrophs were identified from aphotic as well as photic depths. Dissolved free amino acid amendments to whole water from the GA enhanced bacterial productivity by 2–3.5 fold and N2 fixation rates by ~2-fold in samples collected from aphotic depths while in amendments to water from photic depths bacterial productivity increased 2–6 fold while N2 fixation rates increased by a factor of 2 to 4 illustrating that both BP and heterotrophic N2 fixation were carbon limited. Experimental manipulations of aphotic waters from the LB demonstrated a significant positive correlation between transparent exopolymeric particle (TEP) concentrations and N2 fixation rates. This suggests that sinking organic material and high carbon (C): nitrogen (N) micro-environments (such as TEP-based aggregates or marine snow) could support high heterotrophic N2 fixation rates in oxygenated surface waters and in the aphotic zones. Indeed, our calculations show that aphotic N2 fixation accounted for 37 to 75% of the total daily integrated N2 fixation rates at both locations in the Mediterranean and Red Seas with rates equal or greater to those measured from the photic layers. Moreover, our results indicate that that while N2 fixation may be limited in the surface waters, aphotic, pelagic N2 fixation may contribute significantly to new N inputs in other oligotrophic basins, yet it is currently not included in regional or global N budgets. PMID:23986748

  14. Carbon isotope fractionation by sulfate-reducing bacteria using different pathways for the oxidation of acetate.


    Goevert, Dennis; Conrad, Ralf


    Acetate is a key intermediate in the anaerobic degradation of organic matter. In anoxic environments, available acetate is a competitive substrate for sulfate-reducing bacteria (SRB) and methane-producing archaea. Little is known about the fractionation of carbon isotopes by sulfate reducers. Therefore, we determined carbon isotope compositions in cultures of three acetate-utilizing SRB, Desulfobacter postgatei, Desulfobacter hydrogenophilus, and Desulfobacca acetoxidans. We found that these species showed strong differences in their isotope enrichment factors (epsilon) of acetate. During the consumption of acetate and sulfate, acetate was enriched in 13C by 19.3% per hundred in Desulfobacca acetoxidans. By contrast, both D. postgatei and D. hydrogenophilus showed a slight depletion of 13C resulting in epsilon(ac)-values of 1.8 and 1.5% per hundred, respectively. We suggest that the different isotope fractionation is due to the different metabolic pathways for acetate oxidation. The strongly fractionating Desulfobacca acetoxidans uses the acetyl-CoA/carbon monoxide dehydrogenase pathway, which is also used by acetoclastic methanogens that show a similar fractionation of acetate (epsilon(ac) = -21 to -27% per hundred). In contrast, Desulfobacter spp. oxidize acetate to CO2 via the tricarboxylic acid (TCA) cycle and apparently did not discriminate against 13C. Our results suggestthat carbon isotope fractionation in environments with sulfate reduction will strongly depend on the composition of the sulfate-reducing bacterial community oxidizing acetate. PMID:19031865

  15. Aquatic carbon and GHG losses via the aquatic pathway in an arctic catchment

    NASA Astrophysics Data System (ADS)

    Dinsmore, Kerry; Billett, Mike; Lessels, Jason; Street, Lorna; Wookey, Philip; Baxter, Robert; Subke, Jens-Arne; Tetzlaff, Doerthe


    Based in Northwest Canada, the HYDRA project ('Permafrost catchments in transition: hydrological controls on carbon cycling and greenhouse gas budgets') aims to understand the fundamental role that hydrological processes play in regulating landscape-scale carbon fluxes. The project aims to determine a) the role of vegetation functional type in carbon uptake, turnover and allocation, b) how the same functional types influence the delivery of soil-derived carbon to surface waters, and c) how important the aquatic carbon and greenhouse gas (GHG) losses are relative to catchment scale terrestrial fluxes. Here we focus on the magnitude of the aquatic concentrations and fluxes, presenting results from the first year of field sampling. Concentrations of the greenhouse gases CO2, CH4 and N2O, as well as dissolved organic and inorganic carbon (DOC and DIC), will be presented from a range of freshwater types within the tundra landscape; sites include lakes, polygons and the 'Siksik' stream which drains the primary study catchment. Eight sampling locations were selected along the approximately 2km long Siksik stream to allow carbon and GHG concentrations to be considered within a set of nested subcatchments. This synoptic sampling regime, in combination with stable isotopes and major ion concentrations also measured at each sampling point, will allow inputs of carbon and GHGs to be traced to source areas within the catchment. Evasion and downstream export will also be calculated and preliminary results presented in the context of quantifying the relative importance of the aquatic pathway to the full catchment carbon and greenhouse gas budgets. This analysis will also allow an initial comparison between the relative importance of different water bodies within the catchment, highlighting spatial hotspots to be prioritized in future campaigns.

  16. Carbon Metabolic Pathways in Phototrophic Bacteria and Their Broader Evolutionary Implications

    PubMed Central

    Tang, Kuo-Hsiang; Tang, Yinjie J.; Blankenship, Robert Eugene


    Photosynthesis is the biological process that converts solar energy to biomass, bio-products, and biofuel. It is the only major natural solar energy storage mechanism on Earth. To satisfy the increased demand for sustainable energy sources and identify the mechanism of photosynthetic carbon assimilation, which is one of the bottlenecks in photosynthesis, it is essential to understand the process of solar energy storage and associated carbon metabolism in photosynthetic organisms. Researchers have employed physiological studies, microbiological chemistry, enzyme assays, genome sequencing, transcriptomics, and 13C-based metabolomics/fluxomics to investigate central carbon metabolism and enzymes that operate in phototrophs. In this report, we review diverse CO2 assimilation pathways, acetate assimilation, carbohydrate catabolism, the tricarboxylic acid cycle and some key, and/or unconventional enzymes in central carbon metabolism of phototrophic microorganisms. We also discuss the reducing equivalent flow during photoautotrophic and photoheterotrophic growth, evolutionary links in the central carbon metabolic network, and correlations between photosynthetic and non-photosynthetic organisms. Considering the metabolic versatility in these fascinating and diverse photosynthetic bacteria, many essential questions in their central carbon metabolism still remain to be addressed. PMID:21866228

  17. Carbon metabolism in methanococci

    SciTech Connect

    Shieh, J.


    The purpose of this dissertation research was to investigate the pathway of carbon assimilation in Methanococci spp. A model for autotrophic CO{sub 2} fixation in Methanobacterium thermoautotrophicum served as a guide. Enzyme studies and {sup 14}C labeling experiments were performed in cellular extracts obtained from both autotrophically and heterotrophically growing methanococci. Those enzymes believed to be involved in the CO{sub 2} fixation pathway were studied. The first chapter reported a novel spectrophotometric assay for autotrophic acetyl-CoA synthesis in Methanococcus maripaludis. The second chapter examined the pathway of acetate assimilation in autotrophically and heterotrophically grown methanococci. The third chapter investigated the acetate and amino acids biosynthesis in Methanococcus voltae.

  18. Pathways for utilization of carbon reserves in Desulfovibrio gigas under fermentative and respiratory conditions.


    Fareleira, P; Legall, J; Xavier, A V; Santos, H


    The sulfate-reducing bacterium Desulfovibrio gigas accumulates large amounts of polyglucose as an endogenous carbon and energy reserve. In the absence of exogenous substrates, the intracellular polysaccharide was utilized, and energy was conserved in the process (H. Santos, P. Fareleira, A. V. Xavier, L. Chen, M.-Y. Liu, and J. LeGall, Biochem. Biophys. Res. Commun. 195:551-557, 1993). When an external electron acceptor was not provided, degradation of polyglucose by cell suspensions of D. gigas yielded acetate, glycerol, hydrogen, and ethanol. A detailed investigation of the metabolic pathways involved in the formation of these end products was carried out, based on measurements of the activities of glycolytic enzymes in cell extracts, by either spectrophotometric or nuclear magnetic resonance (NMR) assays. All of the enzyme activities associated with the glycogen cleavage and the Embden-Meyerhof pathway were determined as well as those involved in the formation of glycerol from dihydroxyacetone phosphate (glycerol-3-phosphate dehydrogenase and glycerol phosphatase) and the enzymes that catalyze the reactions leading to the production of ethanol (pyruvate decarboxylase and ethanol dehydrogenase). The key enzymes of the Entner-Doudoroff pathway were not detected. The methylglyoxal bypass was identified as a second glycolytic branch operating simultaneously with the Embden-Meyerhof pathway. The relative contribution of these two pathways for polyglucose degradation was 2:3. 13C-labeling experiments with cell extracts using isotopically enriched glucose and 13C-NMR analysis supported the proposed pathways. The information on the metabolic pathways involved in polyglucose catabolism combined with analyses of the end products formed from polyglucose under fermentative conditions provided some insight into the role of NADH in D. gigas. In the presence of electron acceptors, NADH resulting from polyglucose degradation was utilized for the reduction of sulfate, thiosulfate, or nitrite, leading to the formation of acetate as the only carbon end product besides CO2. Evidence supporting the role of NADH as a source of reducing equivalents for the production of hydrogen is also presented. PMID:9190814

  19. Methanotrophy Induces Nitrogen Fixation in Boreal Mosses

    NASA Astrophysics Data System (ADS)

    Tiirola, M. A.


    Many methanotrophic bacterial groups fix nitrogen in laboratory conditions. Furthermore, nitrogen (N) is a limiting nutrient in many environments where methane concentrations are highest. Despite these facts, methane-induced N fixation has previously been overlooked, possibly due to methodological problems. To study the possible link between methanotrophy and diazotrophy in terrestrial and aquatic habitats, we measured the co-occurrence of these two processes in boreal forest, peatland and stream mosses using a stable isotope labeling approach (15 N2 and 13 CH4 double labeling) and sequencing of the nifH gene marker. N fixation associated with forest mosses was dependent on the annual N deposition, whereas methane stimulate N fixation neither in high (>3 kg N ha -1 yr -1) nor low deposition areas, which was in accordance with the nifH gene sequencing showing that forest mosses (Pleurozium schreberi and Hylocomium splendens ) carried mainly cyanobacterial N fixers. On the other extreme, in stream mosses (Fontinalis sp.) methane was actively oxidized throughout the year, whereas N fixation showed seasonal fluctuation. The co-occurrence of the two processes in single cell level was proven by co-localizing both N and methane-carbon fixation with the secondary ion mass spectrometry (SIMS) approach. Methanotrophy and diazotrophy was also studied in peatlands of different primary successional stages in the land-uplift coast of Bothnian Bay, in the Siikajoki chronosequence, where N accumulation rates in peat profiles indicate significant N fixation. Based on experimental evidence it was counted that methane-induced N fixation explained over one-third of the new N input in the younger peatland successional stages, where the highest N fixation rates and highest methane oxidation activities co-occurred in the water-submerged Sphagnum moss vegetation. The linkage between methanotrophic carbon cycling and N fixation may therefore constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. It is still an open issue whether methanotrophy induces N fixation directly or by enhancing phototrophic or heterotrophic N fixation.

  20. Controlling Central Carbon Metabolism for Improved Pathway Yields in Saccharomyces cerevisiae.


    Tan, Sue Zanne; Manchester, Shawn; Prather, Kristala L J


    Engineering control of metabolic pathways is important to improving product titers and yields. Traditional methods such as overexpressing pathway enzymes and deleting competing ones are restricted by the interdependence of metabolic reactions and the finite nature of cellular resources. Here, we developed a metabolite valve that controls glycolytic flux through central carbon metabolism in Saccharomyces cerevisiae. In a Hexokinase 2 and Glucokinase 1 deleted strain (hxk2?glk1?), glucose flux was diverted away from glycolysis and into a model pathway, gluconate, by controlling the transcription of Hexokinase 1 with the tetracycline transactivator protein (tTA). A maximum 10-fold decrease in hexokinase activity resulted in a 50-fold increase in gluconate yields, from 0.7% to 36% mol/mol of glucose. The reduction in glucose flux resulted in a significant decrease in ethanol byproduction that extended to semianaerobic conditions, as shown in the production of isobutanol. This proof-of-concept is one of the first demonstrations in S. cerevisiae of dynamic redirection of glucose from glycolysis and into a heterologous pathway. PMID:26544022

  1. Fixation: A Bibliography.

    ERIC Educational Resources Information Center

    Pedrini, D. T.; Pedrini, Bonnie C.

    Fixation and regression were considered complementary by Freud. You tend to regress to a point of fixation. They are both opposed to progression. In the general area, Anna Freud has written (The Ego and the Mechanisms of Defence. London: Hogarth and the Psycho-Analytic Institute, 1937), Sears has evaluated (Survey of Objective Studies of…

  2. Comparative biochemistry of CO2 fixation and the evolution of autotrophy.


    Peret, J G; Velasco, A M; Becerra, A; Lazcano, A


    Carbon dioxide fixation is a polyphyletic trait that has evolved in widely separated prokaryotic branches. The three principal CO2-assimilation pathways are (i) the reductive pentose-phosphate cycle, i.e. the Calvin-Benson cycle; (ii) the reductive citric acid (or Arnon) cycle; and (iii) the net synthesis of acetyl-CoA from CO/CO2, or Wood pathway. Sequence analysis and the comparative biochemistry of these routes suggest that all of them were shaped to a considerable extent by the evolutionary recruitment of enzymes. Molecular phylogenetic trees show that the Calvin-Benson cycle was a relatively late development in the (eu)bacterial branch, suggesting that some form(s) of carbon assimilation may have been operative before chlorophyll-based photosynthesis. On the other hand, the ample phylogenetic distribution of both the Arnon and the Wood pathways does not allow us to infer which one of them is older. However, different lines of evidence, including experimental reports on the NiS/FeS-mediated C-C bond formation from CO and CH3SH are used here to argue that the first CO2-fixation route may have been a semi-enzymatic Wood-like pathway. PMID:10943384

  3. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.


    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic compounds is critical for understanding deep subsurface ecosystems and the origin of organic compounds on Mars and other planets.

  4. Stable carbon isotope fractionations of the hyperthermophilic crenarchaeon Metallosphaera sedula.


    van der Meer, M T; Schouten, S; Rijpstra, W I; Fuchs, G; Sinninghe Damsté, J S


    The stable carbon isotopic compositions of the inorganic carbon source, bulk cell material, and isoprenoid lipids of the hyperthermophilic crenarchaeon Metallosphaera sedula, which uses a 3-hydroxypropionate-like pathway for autotrophic carbon fixation, have been measured. Bulk cell material was approximately 3 per thousand enriched in 13C relative to the dissolved inorganic carbon, and 2 per thousand depleted in 13C relative to isoprenoid membrane lipids. The isotope data suggested that M. sedula uses mainly bicarbonate rather than CO(2) as inorganic carbon source, which is in accordance with a 3-hydroxypropionate-like carbon fixation pathway. To the best of our knowledge this is the first report of 13C fractionation effects of such a hyperthermophilic crenarchaeon. PMID:11257550

  5. Cyanobacterial production of 1,3-propanediol directly from carbon dioxide using a synthetic metabolic pathway.


    Hirokawa, Yasutaka; Maki, Yuki; Tatsuke, Tsuneyuki; Hanai, Taizo


    Production of chemicals directly from carbon dioxide using light energy is an attractive option for a sustainable future. The 1,3-propanediol (1,3-PDO) production directly from carbon dioxide was achieved by engineered Synechococcus elongatus PCC 7942 with a synthetic metabolic pathway. Glycerol dehydratase catalyzing the conversion of glycerol to 3-hydroxypropionaldehyde in a coenzyme B12-dependent manner worked in S. elongatus PCC 7942 without addition of vitamin B12, suggesting that the intrinsic pseudovitamin B12 served as a substitute of coenzyme B12. The highest titers of 1,3-PDO (3.79±0.23mM; 288±17.7mg/L) and glycerol (12.62±1.55mM; 1.16±0.14g/L), precursor of 1,3-PDO, were reached after 14 days of culture under optimized conditions in this study. PMID:26769097

  6. The Influence of pCO2 and Temperature on Gene Expression of Carbon and Nitrogen Pathways in Trichodesmium IMS101

    PubMed Central

    Levitan, Orly; Sudhaus, Stefanie; LaRoche, Julie; Berman-Frank, Ilana


    Growth, protein amount, and activity levels of metabolic pathways in Trichodesmium are influenced by environmental changes such as elevated pCO2 and temperature. This study examines changes in the expression of essential metabolic genes in Trichodesmium grown under a matrix of pCO2 (400 and 900 atm) and temperature (25 and 31C). Using RT-qPCR, we studied 21 genes related to four metabolic functional groups: CO2 concentrating mechanism (bicA1, bicA2, ccmM, ccmK2, ccmK3, ndhF4, ndhD4, ndhL, chpX), energy metabolism (atpB, sod, prx, glcD), nitrogen metabolism (glnA, hetR, nifH), and inorganic carbon fixation and photosynthesis (rbcL, rca, psaB, psaC, psbA). nifH and most photosynthetic genes exhibited relatively high abundance and their expression was influenced by both environmental parameters. A two to three orders of magnitude increase was observed for glnA and hetR only when both pCO2 and temperature were elevated. CO2 concentrating mechanism genes were not affected by pCO2 and temperature and their expression levels were markedly lower than that of the nitrogen metabolism and photosynthetic genes. Many of the CO2 concentrating mechanism genes were co-expressed throughout the day. Our results demonstrate that in Trichodesmium, CO2 concentrating mechanism genes are constitutively expressed. Co-expression of genes from different functional groups were frequently observed during the first half of the photoperiod when oxygenic photosynthesis and N2 fixation take place, pointing at the tight and complex regulation of gene expression in Trichodesmium. Here we provide new data linking environmental changes of pCO2 and temperature to gene expression in Trichodesmium. Although gene expression indicates an active metabolic pathway, there is often an uncoupling between transcription and enzyme activity, such that transcript level cannot usually be directly extrapolated to metabolic activity. PMID:21151907

  7. External fixator pin design.


    Halsey, D; Fleming, B; Pope, M H; Krag, M; Kristiansen, T


    The integrity of the bone-pin interface is the critical link in the stability of external fixation systems. External fixation pins placed in cancellous metaphyseal bone frequently loosen over time, resulting in fixation failure and an increased risk of infection. To design an external fixation pin with optimal bone-metal interface strength in cancellous bone, a systematic study of various thread design features was performed. Combinations of pitch, tooth profile, and minor diameter in 5 mm self-tapping half pins were evaluated in coaxial pullout testing using a fresh bovine cancellous bone. A significant increase in pullout strength was found with a decrease in minor diameter. No statistical differences were found in pullout strength attributable to thread profile and pitch. There were no significant interactions between minor diameter and tooth profile or minor diameter and pitch. The data obtained suggest significantly greater holding power in cancellous bone can be achieved by using an external fixation pin with a smaller minor diameter or a larger interference. Additional pullout testing of five commercially available external fixator pins was performed. Of these, the two pins with the largest interference demonstrated greater pullout strength. Therefore, within a range of acceptable major diameters and adequate minor diameters for the torsional strength requirements, an optimal interference for cancellous pin application may exist and it may well be larger than that present in currently available external fixation pins. PMID:1563166

  8. A Central Role for Carbon-Overflow Pathways in the Modulation of Bacterial Cell Death

    PubMed Central

    Thomas, Vinai Chittezham; Sadykov, Marat R.; Chaudhari, Sujata S.; Jones, Joselyn; Endres, Jennifer L.; Widhelm, Todd J.; Ahn, Jong-Sam; Jawa, Randeep S.; Zimmerman, Matthew C.; Bayles, Kenneth W.


    Similar to developmental programs in eukaryotes, the death of a subpopulation of cells is thought to benefit bacterial biofilm development. However mechanisms that mediate a tight control over cell death are not clearly understood at the population level. Here we reveal that CidR dependent pyruvate oxidase (CidC) and ?-acetolactate synthase/decarboxylase (AlsSD) overflow metabolic pathways, which are active during staphylococcal biofilm development, modulate cell death to achieve optimal biofilm biomass. Whereas acetate derived from CidC activity potentiates cell death in cells by a mechanism dependent on intracellular acidification and respiratory inhibition, AlsSD activity effectively counters CidC action by diverting carbon flux towards neutral rather than acidic byproducts and consuming intracellular protons in the process. Furthermore, the physiological features that accompany metabolic activation of cell death bears remarkable similarities to hallmarks of eukaryotic programmed cell death, including the generation of reactive oxygen species and DNA damage. Finally, we demonstrate that the metabolic modulation of cell death not only affects biofilm development but also biofilm-dependent disease outcomes. Given the ubiquity of such carbon overflow pathways in diverse bacterial species, we propose that the metabolic control of cell death may be a fundamental feature of prokaryotic development. PMID:24945831

  9. Tight coupling of root-associated nitrogen fixation and plant photosynthesis in the salt marsh grass Spartina alterniflora and carbon dioxide enhancement of nitrogenase activity.

    PubMed Central

    Whiting, G J; Gandy, E L; Yoch, D C


    The coupling of root-associated nitrogen fixation and plant photosynthesis was examined in the salt marsh grass Spartina alterniflora. In both field experiments and hydroponic assay chambers, nitrogen fixation associated with the roots was rapidly enhanced by stimulating plant photosynthesis. A kinetic analysis of acetylene reduction activity (ARA) showed that a five-to sixfold stimulation occurred within 10 to 60 min after the plant leaves were exposed to light or increased CO2 concentrations (with the light held constant). In field experiments, CO2 enrichment increased plant-associated ARA by 27%. Further evidence of the dependence of ARA on plant photosynthate was obtained when activity in excised roots was shown to decrease after young greenhouse plants were placed in the dark. Seasonal variation in the ARA of excised plant roots from field cores appears to be related to the annual cycle of net photosynthesis in S. alterniflora. Images PMID:3089156

  10. Tight coupling of root-associated nitrogen fixation and plant photosynthesis in the salt marsh Spartina alterniflora and carbon dioxide enhancement of Nitrogenase activity

    SciTech Connect

    Whiting, G.J.; Gandy, E.L.; Yoch, D.C.


    The coupling of root-associated nitrogen fixation and plant photosynthesis was examined in the salt marsh grass Spartina alterniflora. In both field experiments and hydroponic assay chambers, nitrogen fixation associated with the roots was rapidly enhanced by stimulating plant photosynthesis. A kinetic analysis of acetylene reduction activity (ARA) showed that a five-to-sixfold stimulation occurred within 10 to 60 min after the plant leaves were exposed to light or increase CO/sub 2/ concentrations (with the light held constant). In field experiments, CO/sub 2/ enrichment increased plant-associated ARA by 27%. Further evidence of the dependence of ARA on plant photosynthate was obtained when activity in excised roots was shown to decrease after young greenhouse plants were placed in the dark. Seasonal variation in the ARA of excised plant roots from field cores appears to be related to the annual cycle of net photosynthesis in S. alterniflora.

  11. Carbon black and titanium dioxide nanoparticles elicit distinct apoptotic pathways in bronchial epithelial cells

    PubMed Central


    Background Increasing environmental and occupational exposures to nanoparticles (NPs) warrant deeper insight into the toxicological mechanisms induced by these materials. The present study was designed to characterize the cell death induced by carbon black (CB) and titanium dioxide (TiO2) NPs in bronchial epithelial cells (16HBE14o- cell line and primary cells) and to investigate the implicated molecular pathways. Results Detailed time course studies revealed that both CB (13 nm) and TiO2(15 nm) NP exposed cells exhibit typical morphological (decreased cell size, membrane blebbing, peripheral chromatin condensation, apoptotic body formation) and biochemical (caspase activation and DNA fragmentation) features of apoptotic cell death. A decrease in mitochondrial membrane potential, activation of Bax and release of cytochrome c from mitochondria were only observed in case of CB NPs whereas lipid peroxidation, lysosomal membrane destabilization and cathepsin B release were observed during the apoptotic process induced by TiO2 NPs. Furthermore, ROS production was observed after exposure to CB and TiO2 but hydrogen peroxide (H2O2) production was only involved in apoptosis induction by CB NPs. Conclusions Both CB and TiO2 NPs induce apoptotic cell death in bronchial epithelial cells. CB NPs induce apoptosis by a ROS dependent mitochondrial pathway whereas TiO2 NPs induce cell death through lysosomal membrane destabilization and lipid peroxidation. Although the final outcome is similar (apoptosis), the molecular pathways activated by NPs differ depending upon the chemical nature of the NPs. PMID:20398356

  12. Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria

    SciTech Connect

    Ferry, J.G.


    Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

  13. Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria

    SciTech Connect

    Ferry, J.G.


    Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

  14. Photographic fixative poisoning


    Photographic developer poisoning; Hydroquinone poisoning; Quinone poisoning; Sulfite poisoning ... Hydroquinones Quinones Sodium thiosulfate Sodium sulfite/bisulfite Boric acid Photographic fixative can also break down (decompose) to form sulfur ...

  15. Carbon and chlorine isotope analysis to identify abiotic degradation pathways of 1,1,1-trichloroethane.


    Palau, Jordi; Shouakar-Stash, Orfan; Hunkeler, Daniel


    This study investigates dual C-Cl isotope fractionation during 1,1,1-TCA transformation by heat-activated persulfate (PS), hydrolysis/dehydrohalogenation (HY/DH) and Fe(0). Compound-specific chlorine isotope analysis of 1,1,1-TCA was performed for the first time, and transformation-associated isotope fractionation ? bulk C and ? bulk Cl values were -4.0 0.2 and no chlorine isotope fractionation with PS, -1.6 0.2 and -4.7 0.1 for HY/DH, -7.8 0.4 and -5.2 0.2 with Fe(0). Distinctly different dual isotope slopes (??13C/??37Cl): ? with PS, 0.33 0.04 for HY/DH and 1.5 0.1 with Fe(0) highlight the potential of this approach to identify abiotic degradation pathways of 1,1,1-TCA in the field. The trend observed with PS agreed with a C-H bond oxidation mechanism in the first reaction step. For HY/DH and Fe(0) pathways, different slopes were obtained although both pathways involve cleavage of a C-Cl bond in their initial reaction step. In contrast to the expected larger primary carbon isotope effects relative to chlorine for C-Cl bond cleavage, ? bulk C < ? bulk Cl was observed for HY/DH and in a similar range for reduction by Fe(0), suggesting the contribution of secondary chlorine isotope effects. Therefore, different magnitude of secondary chlorine isotope effects could at least be partly responsible for the distinct slopes between HY/DH and Fe(0) pathways. Following this dual isotope approach, abiotic transformation processes can unambiguously be identified and quantified. PMID:25379605

  16. New Pathways and Metrics for Enhanced, Reversible Hydrogen Storage in Boron-Doped Carbon Nanospaces

    SciTech Connect

    Pfeifer, Peter; Wexler, Carlos; Hawthorne, M. Frederick; Lee, Mark W.; Jalistegi, Satish S.


    This project, since its start in 2007—entitled “Networks of boron-doped carbon nanopores for low-pressure reversible hydrogen storage” (2007-10) and “New pathways and metrics for enhanced, reversible hydrogen storage in boron-doped carbon nanospaces” (2010-13)—is in support of the DOE's National Hydrogen Storage Project, as part of the DOE Hydrogen and Fuel Cells Program’s comprehensive efforts to enable the widespread commercialization of hydrogen and fuel cell technologies in diverse sectors of the economy. Hydrogen storage is widely recognized as a critical enabling technology for the successful commercialization and market acceptance of hydrogen powered vehicles. Storing sufficient hydrogen on board a wide range of vehicle platforms, at energy densities comparable to gasoline, without compromising passenger or cargo space, remains an outstanding technical challenge. Of the main three thrust areas in 2007—metal hydrides, chemical hydrogen storage, and sorption-based hydrogen storage—sorption-based storage, i.e., storage of molecular hydrogen by adsorption on high-surface-area materials (carbons, metal-organic frameworks, and other porous organic networks), has emerged as the most promising path toward achieving the 2017 DOE storage targets of 0.055 kg H2/kg system (“5.5 wt%”) and 0.040 kg H2/liter system. The objective of the project is to develop high-surface-area carbon materials that are boron-doped by incorporation of boron into the carbon lattice at the outset, i.e., during the synthesis of the material. The rationale for boron-doping is the prediction that boron atoms in carbon will raise the binding energy of hydro- gen from 4-5 kJ/mol on the undoped surface to 10-14 kJ/mol on a doped surface, and accordingly the hydro- gen storage capacity of the material. The mechanism for the increase in binding energy is electron donation from H2 to electron-deficient B atoms, in the form of sp2 boron-carbon bonds. Our team is proud to have demonstrated the predicted increase in binding energy experimentally, currently at ~10 kJ/mol. The synthetic route for incorporation of boron at the outset is to create appropriately designed copoly- mers, with a boron-free and a boron-carrying monomer, followed by pyrolysis of the polymer, yielding a bo- ron-substituted carbon scaffold in which boron atoms are bonded to carbon atoms by synthesis. This is in contrast to a second route (funded by DE-FG36-08GO18142) in which first high-surface area carbon is cre- ated and doped by surface vapor deposition of boron, with incorporation of the boron into the lattice the final step of the fabrication. The challenge in the first route is to create high surface areas without compromising sp2 boron-carbon bonds. The challenge in the second route is to create sp2 boron-carbon bonds without com- promising high surface areas.

  17. 13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose

    PubMed Central

    Jouhten, Paula; Pitkänen, Esa; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Maaheimo, Hannu


    Background The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions and the utilization of the respirative pathway has not been investigated on the level of in vivo fluxes. Results The biosynthetic pathways of amino acids in T. reesei supported by genome-level evidence were reconstructed with computational carbon path analysis. The pathway reconstructions were a prerequisite for analysis of in vivo fluxes. The distribution of in vivo fluxes in both wild type strain and cre1, a key regulator of carbon catabolite repression, deletion strain were quantitatively studied by performing 13C-labeling on both repressive carbon source glucose and non-repressive carbon source sorbitol. In addition, the 13C-labeling on sorbitol was performed both in the presence and absence of sophorose that induces the expression of cellulase genes. Carbon path analyses and the 13C-labeling patterns of proteinogenic amino acids indicated high similarity between biosynthetic pathways of amino acids in T. reesei and yeast Saccharomyces cerevisiae. In contrast to S. cerevisiae, however, mitochondrial rather than cytosolic biosynthesis of Asp was observed under all studied conditions. The relative anaplerotic flux to the TCA cycle was low and thus characteristic to respiratory metabolism in both strains and independent of the carbon source. Only minor differences were observed in the flux distributions of the wild type and cre1 deletion strain. Furthermore, the induction of the hydrolytic gene expression did not show altered flux distributions and did not affect the relative amino acid requirements or relative anabolic and respirative activities of the TCA cycle. Conclusion High similarity between the biosynthetic pathways of amino acids in T. reesei and yeast S. cerevisiae was concluded. In vivo flux distributions confirmed that T. reesei uses primarily the respirative pathway also when growing on the repressive carbon source glucose in contrast to Saccharomyces cerevisiae, which substantially diminishes the respirative pathway flux under glucose repression. PMID:19874611

  18. The Path of Carbon in Photosynthesis XIII. pH Effects in C{sup 14}O{sub 2} Fixation by Scenedesmus

    DOE R&D Accomplishments Database

    Ouellet, C.; Benson, A. A.


    The rates of photosynthesis and dark fixation of C{sup 14}O{sub 2} in Scenedesmus have been compared in dilute phosphate buffers of 1.6 to 11.4 pH; determination of C{sup 14} incorporation into the various products shows enhancement of uptake in an acid medium into sucrose, polysaccharides, alanine and serine, in an alkaline medium into malic asparctic acids. kinetic experiments at extreme pH values suggest that several paths are available for CO{sub 2} assimilation. A tentative correlation of the results with the pH optima of some enzymes and resultant effects upon concentrations of intermediates is presented.

  19. Exciton-exciton annihilation and relaxation pathways in semiconducting carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Chmeliov, Jevgenij; Narkeliunas, Jonas; Graham, Matt W.; Fleming, Graham R.; Valkunas, Leonas


    We present a thorough analysis of one- and two-color transient absorption measurements performed on single- and double-walled semiconducting carbon nanotubes. By combining the currently existing models describing exciton-exciton annihilation--the coherent and the diffusion-limited ones--we are able to simultaneously reproduce excitation kinetics following both E11 and E22 pump conditions. Our simulations revealed the fundamental photophysical behavior of one-dimensional coherent excitons and non-trivial excitation relaxation pathways. In particular, we found that after non-linear annihilation a doubly-excited exciton relaxes directly to its E11 state bypassing the intermediate E22 manifold, so that after excitation resonant with the E11 transition, the E22 state remains unpopulated. A quantitative explanation for the observed much faster excitation kinetics probed at E22 manifold, comparing to those probed at the E11 band, is also provided.

  20. Gene-environment interactions and epigenetic pathways in autism: the importance of one-carbon metabolism.


    Schaevitz, Laura R; Berger-Sweeney, Joanne E


    Both genetic and epigenetic factors play important roles in the rate and severity of classic autism and autism spectrum disorders (ASDs). This review focuses on DNA methylation as a key epigenetic mechanism in autism. The critical role that one-carbon (C1) metabolism plays in establishing and maintaining DNA methylation patterns makes it a likely candidate pathway to regulate epigenetic processes in ASDs. This review is the first, to our knowledge, to examine how altering C1 metabolic function through genetic and environmental factors (focusing on diet) may lead to aberrant DNA methylation and increase susceptibility to ASDs. Additionally, the critical time windows for sensitivity to genetic and dietary factors both during the development of cortical networks implicated in ASDs and in regard to potential treatments are discussed. One thing is clear, if C1 metabolism plays a critical role in ASDs, it provides a potential avenue for treatment and perhaps, ultimately, prevention. PMID:23744970

  1. Detection of potential leakage pathways from geological carbon storage by fluid pressure data assimilation

    NASA Astrophysics Data System (ADS)

    González-Nicolás, Ana; Baù, Domenico; Alzraiee, Ayman


    One of the main concerns of geological carbon storage (GCS) systems is the risk of leakage through "weak" permeable areas of the sealing formation or caprock. Since the fluid pressure pulse travels faster than the carbon dioxide (CO2) plume across the storage reservoir, the fluid overpressure transmitted into overlying permeable formations through caprock discontinuities is potentially detectable sooner than actual CO2 leakage occurs. In this work, an inverse modeling method based on fluid pressure measurements collected in strata above the target CO2 storage formation is proposed, which aims at identifying the presence, the location, and the extent of possible leakage pathways through the caprock. We combine a three-dimensional subsurface multiphase flow model with ensemble-based data assimilation algorithms to recognize potential caprock discontinuities that could undermine the long-term safety of GCS. The goal of this work is to examine and compare the capabilities of data assimilation algorithms such as the ensemble smoother (ES) and the restart ensemble Kalman filter (REnKF) to detect the presence of brine and/or CO2 leakage pathways, potentially in real-time during GCS operations. For the purpose of this study, changes in fluid pressure in the brine aquifer overlying to CO2 storage formation aquifer are hypothetically observed in monitoring boreholes, or provided by time-lapse seismic surveys. Caprock discontinuities are typically characterized locally by higher values of permeability, so that the permeability distribution tends to fit to a non-Gaussian bimodal process, which hardly complies with the requirements of the ES and REnKF algorithms. Here, issues related to the non-Gaussianity of the caprock permeability field are investigated by developing and applying a normal score transform procedure. Results suggest that the REnKF is more effective than the ES in characterizing caprock discontinuities.

  2. C1 Metabolism in Corynebacterium glutamicum: an Endogenous Pathway for Oxidation of Methanol to Carbon Dioxide

    PubMed Central

    Witthoff, Sabrina; Mhlroth, Alice


    Methanol is considered an interesting carbon source in bio-based microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert 13C-labeled methanol to 13CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway. PMID:24014532

  3. The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast

    SciTech Connect

    Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.


    The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates.

  4. Role of Endoplasmic reticulum apoptotic pathway in testicular Sertoli cells injury induced by Carbon disulfide.


    Guo, Yinsheng; Ji, Jiajia; Wang, Wei; Dong, Yu; Zhang, Zhen; Zhou, Yijun; Chen, Guoyuan; Cheng, Jinquan


    The exposure of Carbon disulfide (CS2) is associated with germ cell injury and male infertility in animals and humans. However, the molecular mechanism is currently unknown. This study show here that CS2-induced Sertoli cells injury via Endoplasmic reticulum (ER) apoptotic pathway. SD male rats were exposed to doses of CS2 (0, 50, 250, 1250mgm(-3)) for 4weeks. After treatment, loose structures of seminiferous tubules and disordered cell arrangements were observed by light microscopy. Ultrastructural lesions, deformed chromatins and vacuoles formed from swollen ER were observed by electron microscopy. After primary culture of Sertoli cells, a dose-dependent increased apoptosis were found. The increased activity of Caspase 3, accumulation of intracellular Ca(2+), up-regulation of mRNA and protein expressions of ER apoptotic relative molecules (Calpain 2, Cleaved-Caspase 12, GRP78 and CHOP) were also found in this study. Altogether, our findings indicated that ER apoptotic pathway played an important role in CS2-induced Sertoli cell impairment. PMID:25816788

  5. Amino Acid Biosynthesis Pathways in Diatoms

    PubMed Central

    Bromke, Mariusz A.


    Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

  6. Constraining pathways of microbial mediation for carbonate concretions of the Miocene Monterey Formation using carbonate-associated sulfate

    NASA Astrophysics Data System (ADS)

    Loyd, Sean J.; Berelson, William M.; Lyons, Timothy W.; Hammond, Douglas E.; Corsetti, Frank A.


    Carbonate concretions can form as a result of organic matter degradation within sediments. However, the ability to determine specific processes and timing relationships to particular concretions has remained elusive. Previously employed proxies (e.g., carbon and oxygen isotopes) cannot uniquely distinguish among diagenetic alkalinity sources generated by microbial oxidation of organic matter using oxygen, nitrate, metal oxides, and sulfate as electron acceptors, in addition to degradation by thermal decarboxylation. Here, we employ concentrations of carbonate-associated sulfate (CAS) and δ 34S CAS (along with more traditional approaches) to determine the specific nature of concretion authigenesis within the Miocene Monterey Formation. Integrated geochemical analyses reveal that at least three specific organo-diagenetic reaction pathways can be tied to concretion formation and that these reactions are largely sample-site specific. One calcitic concretion from the Phosphatic Shale Member at Naples Beach yields δ 34S CAS values near Miocene seawater sulfate (˜+22‰ VCDT), abundant CAS (ca. 1000 ppm), depleted δ 13C carb (˜-11‰ VPDB), and very low concentrations of Fe (ca. 700 ppm) and Mn (ca. 15 ppm)—characteristics most consistent with shallow formation in association with organic matter degradation by nitrate, iron-oxides and/or minor sulfate reduction. Cemented concretionary layers of the Phosphatic Shale Member at Shell Beach display elevated δ 34S CAS (up to ˜+37‰), CAS concentrations of ˜600 ppm, mildly depleted δ 13C carb (˜-6‰), moderate amounts of Mn (ca. 250 ppm), and relatively low Fe (ca. 1700 ppm), indicative of formation in sediments dominated by sulfate reduction. Finally, concretions within a siliceous host at Montaña de Oro and Naples Beach show minimal CAS concentrations, positive δ 13C values, and the highest concentrations of Fe (ca. 11,300 ppm) and Mn (ca. 440 ppm), consistent with formation in sediments experiencing methanogenesis in a highly reducing environment. This study highlights the promise in combining CAS analysis with more traditional techniques to differentiate among diagenetic reactions as preserved in the geologic record and shows potential for unraveling subsurface biospheric processes in ancient samples with a high degree of specificity.

  7. Carbon Nanotube Degradation in Macrophages: Live Nanoscale Monitoring and Understanding of Biological Pathway.


    Elgrabli, Dan; Dachraoui, Walid; Mnard-Moyon, Ccilia; Liu, Xiao Jie; Bgin, Dominique; Bgin-Colin, Sylvie; Bianco, Alberto; Gazeau, Florence; Alloyeau, Damien


    Despite numerous applications, the cellular-clearance mechanism of multiwalled carbon nanotubes (MWCNTs) has not been clearly established yet. Previous in vitro studies showed the ability of oxidative enzymes to induce nanotube degradation. Interestingly, these enzymes have the common capacity to produce reactive oxygen species (ROS). Here, we combined material and life science approaches for revealing an intracellular way taken by macrophages to degrade carbon nanotubes. We report the in situ monitoring of ROS-mediated MWCNT degradation by liquid-cell transmission electron microscopy. Two degradation mechanisms induced by hydroxyl radicals were extracted from these unseen dynamic nanoscale investigations: a non-site-specific thinning process of the walls and a site-specific transversal drilling process on pre-existing defects of nanotubes. Remarkably, similar ROS-induced structural injuries were observed on MWCNTs after aging into macrophages from 1 to 7 days. Beside unraveling oxidative transformations of MWCNT structure, we elucidated an important, albeit not exclusive, biological pathway for MWCNT degradation in macrophages, involving NOX2 complex activation, superoxide production, and hydroxyl radical attack, which highlights the critical role of oxidative stress in cellular processing of MWCNTs. PMID:26331631

  8. Temporal and Spatial Deployment of Carbon Dioxide Capture and Storage Technologies across the Representative Concentration Pathways

    SciTech Connect

    Dooley, James J.; Calvin, Katherine V.


    The Intergovernmental Panel on Climate Change’s (IPCC) Fifth Assessment (to be published in 2013-2014) will to a significant degree be built around four Representative Concentration Pathways (RCPs) that are intended to represent four scenarios of future development of greenhouse gas emissions, land use, and concentrations that span the widest range of potential future atmospheric radiative forcing. Under the very stringent climate policy implied by the 2.6 W/m2 overshoot scenario, all electricity is eventually generated from low carbon sources. However, carbon dioxide capture and storage (CCS) technologies never comprise more than 50% of total electricity generation in that very stringent scenario or in any of the other cases examined here. There are significant differences among the cases studied here in terms of how CCS technologies are used, with the most prominent being is the significant expansion of biomass+CCS as the stringency of the implied climate policy increases. Cumulative CO2 storage across the three cases that imply binding greenhouse gas constraints ranges by nearly an order of magnitude from 170GtCO2 (radiative forcing of 6.0W/m2 in 2100) to 1600GtCO2 (2.6W/m2 in 2100) over the course of this century. This potential demand for deep geologic CO2 storage is well within published estimates of total global CO2 storage capacity.

  9. Comparative genomic analysis of carbon and nitrogen assimilation mechanisms in three indigenous bioleaching bacteria: predictions and validations

    PubMed Central

    Levicán, Gloria; Ugalde, Juan A; Ehrenfeld, Nicole; Maass, Alejandro; Parada, Pilar


    Background Carbon and nitrogen fixation are essential pathways for autotrophic bacteria living in extreme environments. These bacteria can use carbon dioxide directly from the air as their sole carbon source and can use different sources of nitrogen such as ammonia, nitrate, nitrite, or even nitrogen from the air. To have a better understanding of how these processes occur and to determine how we can make them more efficient, a comparative genomic analysis of three bioleaching bacteria isolated from mine sites in Chile was performed. This study demonstrated that there are important differences in the carbon dioxide and nitrogen fixation mechanisms among bioleaching bacteria that coexist in mining environments. Results In this study, we probed that both Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans incorporate CO2 via the Calvin-Benson-Bassham cycle; however, the former bacterium has two copies of the Rubisco type I gene whereas the latter has only one copy. In contrast, we demonstrated that Leptospirillum ferriphilum utilizes the reductive tricarboxylic acid cycle for carbon fixation. Although all the species analyzed in our study can incorporate ammonia by an ammonia transporter, we demonstrated that Acidithiobacillus thiooxidans could also assimilate nitrate and nitrite but only Acidithiobacillus ferrooxidans could fix nitrogen directly from the air. Conclusion The current study utilized genomic and molecular evidence to verify carbon and nitrogen fixation mechanisms for three bioleaching bacteria and provided an analysis of the potential regulatory pathways and functional networks that control carbon and nitrogen fixation in these microorganisms. PMID:19055775

  10. Effects of carbon dioxide and oxygen on the regulation of photosynthetic carbon metabolism by ammonia in spinach mesophyll cells

    SciTech Connect

    Lawyer, A.L.; Cornwell, K.L.; Larsen, P.O.; Bassham, J.A.


    Photosynthetic carbon metabolism of isolated spinach mesophyll cells was characterized under conditions favoring photorespiratory (PR; 0.04% CO/sub 2/ and 20% O/sub 2/) and nonphotorespiratory (NPR; 0.2% CO/sub 2/ and 2% O/sub 2/) metabolism, as well as intermediate conditions. Comparisons were made between the metabolic effects of extracellularly supplied NH/sub 4//sup +/ and intracellular NH/sub 4//sup +/, produced primarily via PR metabolism. The metabolic effects of /sup 14/CO/sub 2/ fixation under PR conditions were similar to perturbations of photosynthetic metabolism brought about by externally supplied NH/sub 4//sup +/; both increased labeling and intracellular concentrations of glutamine at the expense of glutamate and increased anaplerotic synthesis through ..cap alpha..-ketoglutarate. The metabolic effects of added NH/sub 4//sup +/ during NPR fixation were greater than those during PR fixation, presumably due to lower initial NH/sub 4//sup +/ levels during NPR fixation. During PR fixation, addition of ammonia caused decreased pools and labeling of glutamate and serine and increased glycolate, glyoxylate, and glycine labeling. The glycolate pathway was thus affected by increased rates of carbon flow and decreased glutamate availability for glyoxylate transamination, resulting in increased usage of serine for transamination. Sucrose labeling decreased with NH/sub 4//sup +/ addition only during PR fixation, suggesting that higher photosynthetic rates under NPR conditions can accommodate the increased drain of carbon toward amino acid synthesis while maintaining sucrose synthesis.

  11. The Fixation of Nitrogen.

    ERIC Educational Resources Information Center

    Andrew, S. P. S.


    Discusses the fixation of atmospheric nitrogen in the form of ammonia as one of the foundations of modern chemical industry. The article describes ammonia production and synthesis, purifying the hydrogen-nitrogen mix, nitric acid production, and its commericial plant. (HM)

  12. Update: Biological Nitrogen Fixation.

    ERIC Educational Resources Information Center

    Wiseman, Alan; And Others


    Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,…

  13. Update: Biological Nitrogen Fixation.

    ERIC Educational Resources Information Center

    Wiseman, Alan; And Others


    Updates knowledge on nitrogen fixation, indicating that investigation of free-living nitrogen-fixing organisms is proving useful in understanding bacterial partners and is expected to lead to development of more effective symbioses. Specific areas considered include biochemistry/genetics, synthesis control, proteins and enzymes, symbiotic systems,

  14. Fixation produced by conflict.


    Karsh, E B


    All rats given a choice between a rewarded alternative and a conflict alternative (rewarded and punished) developed position fixations when the position of the alternatives was reversed. In contrast, all animals given one rewarded alternative and another nonrewarded (or punished and nonrewarded) alternative learned to choose the rewarded side during 25 successive reversals. PMID:5444066

  15. Complications of Distal Radius Fixation.


    Lee, Dennis S; Weikert, Douglas R


    Complications following any form of distal radius fixation remain prevalent. With an armamentarium of fixation options available to practicing surgeons, familiarity with the risks of newer plate technology as it compares with other conventional methods is crucial to optimizing surgical outcome and managing patient expectations. This article presents an updated review on complications following various forms of distal radius fixation. PMID:26772950

  16. Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway.


    Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian


    Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 0.026 ng/mL for 1 mg/L, 0.21 0.024 ng/mL for 5 mg/L, and 0.27 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 0.01 ng/mL for 1 mg/L, 0.12 0.017 ng/mL for 5 mg/L, and 0.17 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus. PMID:24039418

  17. Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway

    PubMed Central

    Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian


    Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 0.026 ng/mL for 1 mg/L, 0.21 0.024 ng/mL for 5 mg/L, and 0.27 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 0.01 ng/mL for 1 mg/L, 0.12 0.017 ng/mL for 5 mg/L, and 0.17 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus. PMID:24039418

  18. Oxidation state, bioavailability & biochemical pathway define the fate of carbon in soil

    NASA Astrophysics Data System (ADS)

    Kuzyakov, Yakov; Apostel, Carolin; Gunina, Anna; Herrmann, Anke M.; Dippold, Michaela


    Numerous experiments under laboratory and field conditions analyzed microbial utilization and mean residence time (MRT) of carbon (C) from plant and microbial residues as well as root exudates in soil. Most of these studies tested the effects of various environmental factors, such as temperature, soil moisture, texture etc. on these parameters. However, only a few studies compared the properties of the substances themselves and there is no conceptual framework based on biochemical pathways. We hypothesize that the fate of C from organic substances in soil strongly depends on the first step of their microbial utilization, specifically, on biochemical pathway and initial C oxidation state, as well as its bioavailability in soils, defined by its hydrophobicity and molecular weight. Here we introduce and evaluate a new conceptual framework based on the following parameters: 1) C oxidation state, 2) molecular weight and hydrophobicity, 3) initial biochemical pathway of a substance class in microbial cells. To assess these parameters, two databases were prepared based on the literature and own studies. The first database included only the studies with 14C or 13C position specific labeled sugars, amino acids, carboxylic acids, phenols and lipids in soil. This database allowed us to analyze microbial utilization and mineralization of organics to CO2 depending on their C oxidation state (OS) and on functional groups. Additionally, we calculated data on the bond electronegativity of all compounds investigated in these studies. The second data base included the results of 14C and 13C studies with uniformly labeled substances of various classes. This database considered the free enthalpie (Delta H) per C unit from a variety of substrates differing in their aromaticity, hydrophobicity/electronegativity and location of the substance on the van Krevelen diagram. In addition, we calculated the hydrophobicity from the electronegativity of the individual bonds and recorded their molecular weight in our databases. For both data bases the decomposition rates and the MRT of C remaining in soil were calculated by the double first-order kinetics and related to the four parameter groups. The first database showed high correlation of mineralization rates to CO2 with the C oxidation state and biochemical pathway. Carboxyl group (OS = +3) was split at first from the skeleton of nearly all substances. In contrast, the methyl group (OS = -3) was mineralized as the slowest and after incorporation into microbial cells remained the longest period in soil. This general pattern reflects a clear preferential oxidation of already highly oxidized, polar functional groups. The initial use of substances within glucolysis (e.g. sugars) lead to a higher portion of remaining C in soil compared to C introduced via citric acid cycle (e.g. carboxylic acids). Concerning substance groups, the mineralization rates were the fastest for amino acids and sugars and the slowest for of the lipids - corresponding to their molecular weight and hydropobicity. This corresponded well with localization of the substance classes on the van Krevelen diagram. Generally, high oxidation state of the initial substance and consequently its low free enthalpy content lead to faster decomposition. In contrast, low oxidation state (e.g. lipids, aromatics) corresponds to high hydrophobicity and so, slow uptake from soil solution and utilization within microbial cells. Consequently, the optimum for microbial biomass utilization in soil and use for anabolic processes is common for sugars that have the oxidation state close to 0, have medium energy content and are hydrophilic. We conclude that from the tested substance properties, the oxidation state and biochemical pathway explained well the initial fate of C in soil, i.e. its mineralization to CO2 and incorporation into microbial biomass. Because the first step and microbial cycling are crucial for its further transformations, the same criteria are pivotal for C stabilization in soil.

  19. Mechanisms of lung fibrosis induced by carbon nanotubes: towards an Adverse Outcome Pathway (AOP).


    Vietti, Giulia; Lison, Dominique; van den Brule, Sybille


    Several experimental studies have shown that carbon nanotubes (CNT) can induce respiratory effects, including lung fibrosis. The cellular and molecular events through which these effects develop are, however, not clearly elucidated. The purpose of the present review was to analyze the key events involved in the lung fibrotic reaction induced by CNT and to assess their relationships. We thus address current knowledge and gaps with a view to draft an Adverse Outcome Pathway (AOP) concerning the fibrotic potential of CNT.As for many inhaled particles, CNT can indirectly activate fibroblasts through the release of pro-inflammatory (IL-1β) and pro-fibrotic (PDGF and TGF-β) mediators by inflammatory cells (macrophages and epithelial cells) via the induction of oxidative stress, inflammasome or NF-kB. We also highlight here direct effects of CNT on fibroblasts, which appear as a new mode of toxicity relatively specific for CNT. Direct effects of CNT on fibroblasts include the induction of fibroblast proliferation, differentiation and collagen production via ERK 1/2 or Smad signaling. We also point out the physico-chemical properties of CNT important for their toxicity and the relationship between in vitro and in vivo effects. This knowledge provides evidence to draft an AOP for the fibrogenic activity of CNT, which allows developing simple in vitro models contributing to predict the CNT effects in lung fibrosis, and risk assessment tools for regulatory decision. PMID:26926090

  20. Gate-Free Electrical Breakdown of Metallic Pathways in Single-Walled Carbon Nanotube Crossbar Networks.


    Li, Jinghua; Franklin, Aaron D; Liu, Jie


    Aligned single-walled carbon nanotubes (SWNTs) synthesized by the chemical vapor deposition (CVD) method have exceptional potential for next-generation nanoelectronics. However, the coexistence of semiconducting (s-) and metallic (m-) SWNTs remains a considerable challenge since the latter causes significant degradation in device performance. Here we demonstrate a facile and effective approach to selectively break all m-SWNTs by stacking two layers of horizontally aligned SWNTs to form crossbars and applying a voltage to the crossed SWNT arrays. The introduction of SWNT junctions amplifies the disparity in resistance between s- and m-pathways, leading to a complete deactivation of m-SWNTs while minimizing the degradation of the semiconducting counterparts. Unlike previous approaches that required an electrostatic gate to achieve selectivity in electrical breakdown, this junction process is gate-free and opens the way for straightforward integration of thin-film s-SWNT devices. Comparison to electrical breakdown in junction-less SWNT devices without gating shows that this junction-based breakdown method yields more than twice the average on-state current retention in the resultant s-SWNT arrays. Systematic studies show that the on/off ratio can reach as high as 1.4 × 10(6) with a correspondingly high retention of on-state current compared to the initial current value before breakdown. Overall, this method provides important insight into transport at SWNT junctions and a simple route for obtaining pure s-SWNT thin film devices for broad applications. PMID:26263184

  1. Potential release pathways, environmental fate, and ecological risks of carbon nanotubes.


    Petersen, Elijah J; Zhang, Liwen; Mattison, Nikolai T; O'Carroll, Denis M; Whelton, Andrew J; Uddin, Nasir; Nguyen, Tinh; Huang, Qingguo; Henry, Theodore B; Holbrook, R David; Chen, Kai Loon


    Carbon nanotubes (CNTs) are currently incorporated into various consumer products, and numerous new applications and products containing CNTs are expected in the future. The potential for negative effects caused by CNT release into the environment is a prominent concern and numerous research projects have investigated possible environmental release pathways, fate, and toxicity. However, this expanding body of literature has not yet been systematically reviewed. Our objective is to critically review this literature to identify emerging trends as well as persistent knowledge gaps on these topics. Specifically, we examine the release of CNTs from polymeric products, removal in wastewater treatment systems, transport through surface and subsurface media, aggregation behaviors, interactions with soil and sediment particles, potential transformations and degradation, and their potential ecotoxicity in soil, sediment, and aquatic ecosystems. One major limitation in the current literature is quantifying CNT masses in relevant media (polymers, tissues, soils, and sediments). Important new directions include developing mechanistic models for CNT release from composites and understanding CNT transport in more complex and environmentally realistic systems such as heteroaggregation with natural colloids and transport of nanoparticles in a range of soils. PMID:21988187

  2. Integrated carboxylic carbon nanotube pathways with membranes for voltage-activated humidity detection and microclimate regulation.


    Pingitore, V; Miriello, D; Drioli, E; Gugliuzza, A


    This work describes some single walled carboxylic carbon nanotubes with outstanding transport properties when assembled in a 3D microarray working like a humidity membrane-sensor and an adjustable moisture regulator. Combined nano-assembly approaches are used to build up a better quality pathway through which assisted-charge and mass transport synchronically takes place. The structure-electrical response relationship is found, while controllable and tunable donor-acceptor interactions established at material interfaces are regarded as key factors for the accomplishment of charge transportation, enhanced electrical responses and adjustable moisture exchange. Raman and infrared spectroscopy provides indications about the fine structural and chemical features of the hybrid-composite membranes, resulting in perfect agreement with related morphology and electrical properties. Enhanced and modular electrical response to changes in the surrounding atmosphere is concerned with doping events, while assisted moisture regulation is discussed in relation to swelling and hopping actions. The electro-activated hybrid-composite membrane proposed in this work can be regarded as an attractive 'sense-to-act' precursor for smart long-distance monitoring systems with capability to adapt itself and provide local comfortable microenvironments. PMID:25939404

  3. Carbonic Anhydrase-8 Regulates Inflammatory Pain by Inhibiting the ITPR1-Cytosolic Free Calcium Pathway

    PubMed Central

    Zhuang, Gerald Z.; Keeler, Benjamin; Grant, Jeff; Bianchi, Laura; Fu, Eugene S.; Zhang, Yan Ping; Erasso, Diana M.; Cui, Jian-Guo; Wiltshire, Tim; Li, Qiongzhen; Hao, Shuanglin; Sarantopoulos, Konstantinos D.; Candiotti, Keith; Wishnek, Sarah M.; Smith, Shad B.; Maixner, William; Diatchenko, Luda; Martin, Eden R.; Levitt, Roy C.


    Calcium dysregulation is causally linked with various forms of neuropathology including seizure disorders, multiple sclerosis, Huntington’s disease, Alzheimer’s, spinal cerebellar ataxia (SCA) and chronic pain. Carbonic anhydrase-8 (Car8) is an allosteric inhibitor of inositol trisphosphate receptor-1 (ITPR1), which regulates intracellular calcium release fundamental to critical cellular functions including neuronal excitability, neurite outgrowth, neurotransmitter release, mitochondrial energy production and cell fate. In this report we test the hypothesis that Car8 regulation of ITPR1 and cytoplasmic free calcium release is critical to nociception and pain behaviors. We show Car8 null mutant mice (MT) exhibit mechanical allodynia and thermal hyperalgesia. Dorsal root ganglia (DRG) from MT also demonstrate increased steady-state ITPR1 phosphorylation (pITPR1) and cytoplasmic free calcium release. Overexpression of Car8 wildtype protein in MT nociceptors complements Car8 deficiency, down regulates pITPR1 and abolishes thermal and mechanical hypersensitivity. We also show that Car8 nociceptor overexpression alleviates chronic inflammatory pain. Finally, inflammation results in downregulation of DRG Car8 that is associated with increased pITPR1 expression relative to ITPR1, suggesting a possible mechanism of acute hypersensitivity. Our findings indicate Car8 regulates the ITPR1-cytosolic free calcium pathway that is critical to nociception, inflammatory pain and possibly other neuropathological states. Car8 and ITPR1 represent new therapeutic targets for chronic pain. PMID:25734498

  4. Nitrogen fixation in peanut nodules during dark periods and detopped conditions with special reference to lipid bodies

    SciTech Connect

    Siddique, A.M.; Bal, A.K. )


    The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of {beta}-oxidation pathway and glyoxylate cycle is shown by the release of {sup 14}CO{sub 2} from {sup 14}C lineoleoyl coenzyme A by the nodule homogenate.

  5. An Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and Hypocotyl Elongation1[C][W][OA

    PubMed Central

    Lilley, Jodi L. Stewart; Gee, Christopher W.; Sairanen, Ilkka; Ljung, Karin; Nemhauser, Jennifer L.


    The local environment has a substantial impact on early seedling development. Applying excess carbon in the form of sucrose is known to alter both the timing and duration of seedling growth. Here, we show that sucrose changes growth patterns by increasing auxin levels and rootward auxin transport in Arabidopsis (Arabidopsis thaliana). Sucrose likely interacts with an endogenous carbon-sensing pathway via the PHYTOCHROME-INTERACTING FACTOR (PIF) family of transcription factors, as plants grown in elevated carbon dioxide showed the same PIF-dependent growth promotion. Overexpression of PIF5 was sufficient to suppress photosynthetic rate, enhance response to elevated carbon dioxide, and prolong seedling survival in nitrogen-limiting conditions. Thus, PIF transcription factors integrate growth with metabolic demands and thereby facilitate functional equilibrium during photomorphogenesis. PMID:23073695

  6. External Fixation: Principles and Applications.


    Bible, Jesse E; Mir, Hassan R


    The modularity and ease of application of modern external fixation has expanded its potential use in the management of fractures and other musculoskeletal conditions. In fracture care, it can be used for provisional and definitive fixation. Short-term provisional applications include "damage control" and periarticular fracture fixation. The risk:benefit ratio of added stability needs to be assessed with each fixator. Soft-tissue management is critical during pin insertion to lessen the risk of loosening and infection. Although provisional fixation is safe for early conversion to definitive fixation, several factors affect the timing of definitive surgery, including the initial injury, external fixator stability, infection, and the physiologic state of the patient. PMID:26306568

  7. Complement fixation by rheumatoid factor.

    PubMed Central

    Tanimoto, K; Cooper, N R; Johnson, J S; Vaughan, J H


    The capacity for fixation and activation of hemolytic complement by polyclonal IgM rheumatoid factors (RF) isolated from sera of patients with rheumatoid arthritis and monoclonal IgM-RF isolated from the cryoprecipitates of patients with IgM-IgG mixed cryoglobulinemia was examined. RF mixed with aggregated, reduced, and alkylated human IgG (Agg-R/A-IgG) in the fluid phase failed to significantly reduce the level of total hemolytic complement, CH50, or of individual complement components, C1, C2, C3, and C5. However, sheep erythrocytes (SRC) coated with Agg-R/A-IgG or with reduced and alkylated rabbit IgG anti-SRC antibody were hemolyzed by complement in the presence of polyclonal IgM-RF. Human and guinea pig complement worked equally well. The degree of hemolysis was in direct proportion to the hemagglutination titer of the RF against the same coated cells. Monoclonal IgM-RF, normal human IgM, and purified Waldenstrm macroglobulins without antiglobulin activity were all inert. Hemolysis of coated SRC by RF and complement was inhibited by prior treatment of the complement source with chelating agents, hydrazine, cobra venom factor, specific antisera to C1q, CR, C5, C6, or C8, or by heating at 56 degrees C for 30 min. Purified radiolabeled C4, C3, and C8 included in the complement source were bound to hemolysed SRC in direct proportion to the degree of hemolysis. These data indicate that polyclonal IgM-RF fix and activate complement via the classic pathway. The system described for assessing complement fixation by isolated RF is readily adaptable to use with whole human serum. PMID:1078825

  8. Soil Carbon Dynamics Along the Pathway From Diverse Microbial Carbon to Humus in a Temperate and Tropical Forest

    NASA Astrophysics Data System (ADS)

    Throckmorton, H. M.; Bird, J. A.; Firestone, M. K.; Horwath, W. R.


    This research investigates the importance of microbial biochemistry to humification pathways in two climatically different forest ecosystems; Blodgett forest (BF), a temperate forest in the Sierra Nevada and Luquillo forest (LF), a tropical forest in Puerto Rico. Non-living 13C enriched temperate and tropical microorganisms from four biochemically contrasting microbial groups (fungi, actinomycetes, bacteria gram (+), and bacteria gram (-)) were separately added to soil at both sites in a reciprocal transplant experiment. Decomposition rates were substantially greater at LF than BF for all microbial inputs. Although there were initial differences in microbial C turnover and recovery within the soil microbial biomass and dissolved organic carbon pools for unique microbial C inputs at both sites, over time treatment differences converge within each site and the quality of input microbial C becomes less important to C remaining and maintained within these soil C pools. Physical soil fractionation revealed important trends which illustrate the role of the soil mineral matrix to protect and stabilize C in soil. Results indicate different C turnover rates associated with the light, aggregate- occluded, and mineral-associated soil fractions at both sites. At BF input C recovered within the light and mineral-associated fractions decreased substantially over time (1 to 13 months), while C occluded within aggregates only slightly decreased. Similarly, LF soils exhibit only a slight decrease in aggregate-occluded C over time (0.5 to 3.5 months), while C recovered within the light fraction decreased substantially; however, unlike BF, LF soils exhibited only a slight decrease in C recovered within the mineral fraction. The distribution of total C among these physical soil pools differs substantially for either site, suggesting differences in the relative importance of the mineral matrix to protect and stabilize C. Preliminary compound-specific isotope analyses employing pyrolysis gas chromatography mass spectrometry and isotope ratio spectrometry (Py-GC-MS/IRMS) for temperate BF soils treated with 13C enriched temperate fungal residues indicates a substantial enrichment of low molecular weight (MW) compounds from microbial additions after 1 month in the field; however, after 5 months in the field the 13C enrichment shifts to higher MW compounds. These trends suggest higher MW compounds are formed through humification as synthesis or condensation products, which highlights the importance of monitoring biogeochemical transformations of unique sources of C over time. Future and ongoing work examines specific compounds associated with these high 13C enrichment values in an effort to understand the link between microbial C quality and humification products.

  9. Novel posterior fixation keratoprosthesis

    NASA Astrophysics Data System (ADS)

    Lacombe, Emmanuel


    The keratoprosthesis is the last solution for corneally blind patients that cannot benefit from corneal transplants. Keratoprostheses that have been designed to be affixed anteriorly usually necessitate multi-step surgical procedures and are continuously subjected to the extrusion forces generated by the positive intraocular pressure; therefore, clinical results in patients prove inconsistent. We proposed a novel keratoprosthesis concept that utilizes posterior corneal fixation which `a priori' minimizes the risk of aqueous leakage and expulsion. This prosthesis is implanted in a single procedure thereby reducing the number of surgical complications normally associated with anterior fixation devices. In addition, its novel design makes this keratoprosthesis implantable in phakic eyes. With an average follow-up of 13 months (range 3 to 25 months), our results on 21 cases are encouraging. Half of the keratoprostheses were implanted in severe burn cases, with the remainder in cases of pseudo- pemphigus. Good visual results and cosmetic appearance were obtained in 14 of 21 eyes.

  10. A batch study on the bio-fixation of carbon dioxide in the absorbed solution from a chemical wet scrubber by hot spring and marine algae.


    Hsueh, H T; Chu, H; Yu, S T


    Carbon dioxide mass transfer is a key factor in cultivating micro-algae except for the light limitation of photosynthesis. It is a novel idea to enhance mass transfer with the cyclic procedure of absorbing CO(2) with a high performance alkaline abosorber such as a packed tower and regenerating the alkaline solution with algal photosynthesis. Hence, the algae with high affinity for alkaline condition must be purified. In this study, a hot spring alga (HSA) was purified from an alkaline hot spring (pH 9.3, 62 degrees C) in Taiwan and grows well over pH 11.5 and 50 degrees C. For performance of HSA, CO(2) removal efficiencies in the packed tower increase about 5-fold in a suitable growth condition compared to that without adding any potassium hydroxide. But ammonia solution was not a good choice for this system with regard to carbon dioxide removal efficiency because of its toxicity on HSA. In addition, HSA also exhibits a high growth rate under the controlled pHs from 7 to 11. Besides, a well mass balance of carbon and nitrogen made sure that less other byproducts formed in the procedure of carboxylation. For analysis of some metals in HSA, such as Mg, Mn, Fe, Zn, related to the photosynthesis increased by a rising cultivated pH and revealed that those metals might be accumulated under alkaline conditions but the growth rate was still limited by the ratio of bicarbonate (useful carbon source) and carbonate. Meanwhile, Nannochlopsis oculta (NAO) was also tested under different additional carbon sources. The results revealed that solutions of sodium/potassium carbonate are better carbon sources than ammonia carbonate/bicarbonate for the growth of NAO. However, pH 9.6 of growth limitation based on sodium was lower than one of HSA. The integrated system is, therefore, more feasible to treat CO(2) in the flue gases using the algae with higher alkaline affinity such as HSA in small volume bioreactors. PMID:16860839

  11. Serine Biosynthesis with One Carbon Catabolism and the Glycine Cleavage System Represents a Novel Pathway for ATP Generation

    PubMed Central

    Vazquez, Alexei; Markert, Elke K.; Oltvai, Zoltn N.


    Previous experimental evidence indicates that some cancer cells have an alternative glycolysis pathway with net zero ATP production, implying that upregulation of glycolysis in these cells may not be related to the generation of ATP. Here we use a genome-scale model of human cell metabolism to investigate the potential metabolic alterations in cells using net zero ATP glycolysis. We uncover a novel pathway for ATP generation that involves reactions from serine biosynthesis, one-carbon metabolism and the glycine cleavage system, and show that the pathway is transcriptionally upregulated in an inducible murine model of Myc-driven liver tumorigenesis. This pathway has a predicted two-fold higher flux rate in cells using net zero ATP glycolysis than those using standard glycolysis and generates twice as much ATP with significantly lower rate of lactate - but higher rate of alanine secretion. Thus, in cells using the standard - or the net zero ATP glycolysis pathways a significant portion of the glycolysis flux is always associated with ATP generation, and the ratio between the flux rates of the two pathways determines the rate of ATP generation and lactate and alanine secretion during glycolysis. PMID:22073143

  12. A physiological perspective on fixational eye movements.


    Snodderly, D Max


    For a behavioral neuroscientist, fixational eye movements are a double-edged sword. On one edge, they make control of visual stimuli difficult, but on the other edge they provide insight into the ways the visual system acquires information from the environment. We have studied macaque monkeys as models for human visual systems. Fixational eye movements of monkeys are similar to those of humans but they are more often vertically biased and spatially more dispersed. Eye movements scatter stimuli from their intended retinal locations, increase variability of neuronal responses, inflate estimates of receptive field size, and decrease measures of response amplitude. They also bias against successful stimulation of extremely selective cells. Compensating for eye movements reduced these errors and revealed a fine-grained motion pathway from V1 feeding the cortical ventral stream. Compensation is a useful tool for the experimenter, but rather than compensating for eye movements, the brain utilizes them as part of its input. The saccades and drifts that occur during fixation selectively activate different types of V1 neurons. Cells that prefer slower speeds respond during the drift periods with maintained discharges and tend to have smaller receptive fields that are selective for sign of contrast. They are well suited to code small details of the image and to enable our fine detailed vision. Cells that prefer higher speeds fire transient bursts of spikes when the receptive field leaves, crosses, or lands on a stimulus, but only the most transient ones (about one-third of our sample) failed to respond during drifts. Voluntary and fixational saccades had very similar effects, including the presence of a biphasic extraretinal modulation that interacted with stimulus-driven responses. Saccades evoke synchronous bursts that can enhance visibility but these bursts may also participate in the visual masking that contributes to saccadic suppression. Study of the small eye movements of fixation may illuminate some of the big problems in vision. PMID:25536465

  13. Transport of dissolved organic carbon from soil to surface water: Identifying the transport pathways

    NASA Astrophysics Data System (ADS)

    Van Gaelen, Nele


    Over the last decades, increasing concentrations of dissolved organic carbon (DOC) have been found in surface waters. It has also become clear that land use is an important driver for DOC export. However, causal factors controlling this temporal and spatial variation are not clear. Efforts to model DOC export on a catchment scale are rare. In this research, we aim to determine the factors controlling variations in DOC concentration and quality in surface waters. Secondly, the importance of the different pathways (surface runoff, subsurface flow and groundwater flow) for the transport of dissolved organic matter from the soil to the surface water is investigated. Six headwater catchments (100 - 400 ha) were selected in Belgium, representing three different types of land use, namely forest, grassland and arable land. At the outlet of each catchment, a flow-proportional sampler has been collecting samples of base flow and peak discharge since January 2010. In addition, samples of groundwater, subsurface water and precipitation water were collected on a regular base in three of the catchments. Samples were analyzed for DOC, specific UV absorbance (SUVA) and dissolved silica (DSi). Elemental analysis was carried out using ICP-OES. Since 2012, precipitation water and a selection of river water samples was also analyzed for O and H isotopes. Overall, DOC concentrations were highest in forest catchments and lowest in grassland catchments. For all land use types, measured DOC concentrations were highest during peak discharge. The rise in DOC concentrations was associated with a change in DOC quality. During periods of greater discharge, higher SUVA values were measured, indicating DOC with higher aromaticity (humic and fulvic fractions) reaches the outlet. ICP and DSi results also showed a significant difference in geochemical composition of the river water if peak events are compared to base flow samples. During an event, Ca, Mg, Na, S and DSi concentrations were lowered, while K concentrations rose. Isotope analysis showed more heavy O an H isotopes during peak events than during baseflow. Results of the river water were combined with analysis of possible end-members in the catchments, using the groundwater, soil water and precipitation samples. An end-member-mixing-analysis (EMMA) gained more insight into the contributing pathways for the transport of organic matter from the soil to the surface water during base and peak flow. Furthermore, results from the different catchments were compared, and allowed to relate DOC transport to land use type. This is an important step towards a model describing DOC transport at the catchment scale.

  14. Understanding Nitrogen Fixation

    SciTech Connect

    Paul J. Chirik


    The purpose of our program is to explore fundamental chemistry relevant to the discovery of energy efficient methods for the conversion of atmospheric nitrogen (N{sub 2}) into more value-added nitrogen-containing organic molecules. Such transformations are key for domestic energy security and the reduction of fossil fuel dependencies. With DOE support, we have synthesized families of zirconium and hafnium dinitrogen complexes with elongated and activated N-N bonds that exhibit rich N{sub 2} functionalization chemistry. Having elucidated new methods for N-H bond formation from dihydrogen, C-H bonds and Broensted acids, we have since turned our attention to N-C bond construction. These reactions are particularly important for the synthesis of amines, heterocycles and hydrazines with a range of applications in the fine and commodity chemicals industries and as fuels. One recent highlight was the discovery of a new N{sub 2} cleavage reaction upon addition of carbon monoxide which resulted in the synthesis of an important fertilizer, oxamide, from the diatomics with the two strongest bonds in chemistry. Nitrogen-carbon bonds form the backbone of many important organic molecules, especially those used in the fertilizer and pharamaceutical industries. During the past year, we have continued our work in the synthesis of hydrazines of various substitution patterns, many of which are important precursors for heterocycles. In most instances, the direct functionalization of N{sub 2} offers a more efficient synthetic route than traditional organic methods. In addition, we have also discovered a unique CO-induced N{sub 2} bond cleavage reaction that simultaneously cleaves the N-N bond of the metal dinitrogen compound and assembles new C-C bond and two new N-C bonds. Treatment of the CO-functionalized core with weak Broensted acids liberated oxamide, H{sub 2}NC(O)C(O)NH{sub 2}, an important slow release fertilizer that is of interest to replace urea in many applications. The synthesis of ammonia, NH{sub 3}, from its elements, H{sub 2} and N{sub 2}, via the venerable Haber-Bosch process is one of the most significant technological achievements of the past century. Our research program seeks to discover new transition metal reagents and catalysts to disrupt the strong N {triple_bond} N bond in N{sub 2} and create new, fundamental chemical linkages for the construction of molecules with application as fuels, fertilizers and fine chemicals. With DOE support, our group has discovered a mild method for ammonia synthesis in solution as well as new methods for the construction of nitrogen-carbon bonds directly from N{sub 2}. Ideally these achievements will evolve into more efficient nitrogen fixation schemes that circumvent the high energy demands of industrial ammonia synthesis. Industrially, atmospheric nitrogen enters the synthetic cycle by the well-established Haber-Bosch process whereby N{sub 2} is hydrogenated to ammonia at high temperature and pressure. The commercialization of this reaction represents one of the greatest technological achievements of the 20th century as Haber-Bosch ammonia is responsible for supporting approximately 50% of the world's population and serves as the source of half of the nitrogen in the human body. The extreme reaction conditions required for an economical process have significant energy consequences, consuming 1% of the world's energy supply mostly in the form of pollution-intensive coal. Moreover, industrial H{sub 2} synthesis via the water gas shift reaction and the steam reforming of methane is fossil fuel intensive and produces CO{sub 2} as a byproduct. New synthetic methods that promote this thermodynamically favored transformation ({Delta}G{sup o} = -4.1 kcal/mol) under milder conditions or completely obviate it are therefore desirable. Most nitrogen-containing organic molecules are derived from ammonia (and hence rely on the Haber-Bosch and H{sub 2} synthesis processes) and direct synthesis from atmospheric nitrogen could, in principle, be more energy-efficient. This is particularly attractive given the interest in direct hydrazine fuel cells.

  15. Carbon isotopes and the oldest record of life: potential and limits

    NASA Astrophysics Data System (ADS)

    Schidlowski, Manfred


    The currently available sedimentary carbon isotope record goes back to 3.85 Ga and conveys a remarkably consistent isotopic signal of biological carbon fixation based on the bias for light carbon ((superscript 12)C) exercised by common photosynthetic pathways. This holds particularly for the time segment < 3.5 Ga, whereas the older (Isua) record is blurred by a metamorphic overprint. In spite of the marked impairment of the oldest evidence by isotopic reequilibration between organic and carbonate carbon in the wake of the amphibolite-grade metamorphism suffered by the host rock, a coagent case can be built for the emergence of (photo)autotrophic carbon fixation and the start of a biogeochemical carbon cycle as from at least 3.85 Ga ago. This would imply that microbial (prokaryotic) ecosystems had been prolific on the Archaean Earth not long after the formation of the planet.

  16. Synthetic Pathway for Production of Five-Carbon Alcohols from Isopentenyl Diphosphate

    PubMed Central

    Chou, Howard H.


    Synthetic biological pathways could enhance the development of novel processes to produce chemicals from renewable resources. On the basis of models that describe the evolution of metabolic pathways and enzymes in nature, we developed a framework to rationally identify enzymes able to catalyze reactions on new substrates that overcomes one of the major bottlenecks in the assembly of a synthetic biological pathway. We verified the framework by implementing a pathway with two novel enzymatic reactions to convert isopentenyl diphosphate into 3-methyl-3-butenol, 3-methyl-2-butenol, and 3-methylbutanol. To overcome competition with native pathways that share the same substrate, we engineered two bifunctional enzymes that redirect metabolic flux toward the synthetic pathway. Taken together, our work demonstrates a new approach to the engineering of novel synthetic pathways in the cell. PMID:22941086

  17. Measurement of black carbon at Syowa station, Antarctica: seasonal variation, transport processes and pathways

    NASA Astrophysics Data System (ADS)

    Hara, K.; Osada, K.; Yabuki, M.; Hayashi, M.; Yamanouchi, T.; Shiobara, M.; Wada, M.


    Measurement of black carbon (BC) was carried out at Syowa station Antarctica (69 S, 39 E) from February 2004 until January 2007. The BC concentration at Syowa ranged from below detection to 176 ng m-3 during the measurements. Higher BC concentrations were observed mostly under strong wind (blizzard) conditions due to the approach of a cyclone and blocking event. The BC-rich air masses traveled from the lower troposphere of the Atlantic and Indian Oceans to Syowa (Antarctic coast). During the summer (November-February), the BC concentration showed a diurnal variation together with surface wind speed and increased in the katabatic wind from the Antarctic continent. Considering the low BC source strength in the Antarctic continent, the higher BC concentration in the continental air (katabatic wind) might be caused by long range transport of BC via the free troposphere from mid- and low- latitudes. The seasonal variation of BC at Syowa had a maximum in August, while at the other coastal stations (Halley, Neumayer, and Ferraz) and the continental station (Amundsen-Scott), the maximum occurred in October. This difference may result from different transport pathways and scavenging of BC by precipitation during the transport from the source regions. During the austral summer, long-range transport of BC via the free troposphere is likely to make an important contribution to the ambient BC concentration. The BC transport flux indicated that BC injection into the Antarctic region strongly depended on the frequency of storm (blizzard) conditions. The seasonal variation of BC transport flux increased by 290 mg m-2 month-1 in winter-spring when blizzards frequently occurred, whereas the flux decreased to lower than 50 mg m-2 month-1 in the summer with infrequent blizzards.

  18. [Advances on CO2 fixation by microalgae].


    Cheng, Li-Hua; Zhang, Lin; Chen, Huan-Lin; Gao, Cong-Jie


    The greenhouse effect, which is believed to occur primarily as a result of the accumulation of carbon dioxide in the atmosphere, has become one of the major environmental concerns and received worldwide attention. In this paper, algae species screening and cultivation for efficient CO2 fixation are reviewed. The related dissolved inorganic carbon (DIC) utilization form and CO2 concentration mechanism (CCM) in the process of CO2 fixation by microalgae are analyzed. Four objectives of the highly effective photobioreactor design and operation are discussed, and the advances on CO2 mitigation technology with integration of microalgae (enzyme) and membrane bioreactor are also briefly introduced. In response to elevated CO2 concentration, much attention needs to be paid to the construction of transgenic microalgae with higher performance in CO2 fixation based on the further ascertainment of the related mechanism, and the development of effective CO2 biofixation system integrated with other kinds of advanced technology, such as membrane immobilization and separation. PMID:16013471

  19. Elementary Flux Mode Analysis Revealed Cyclization Pathway as a Powerful Way for NADPH Regeneration of Central Carbon Metabolism.


    Rui, Bin; Yi, Yin; Shen, Tie; Zheng, Meijuan; Zhou, Wenwei; Du, Honglin; Fan, Yadong; Wang, Yongkang; Zhang, Zhengdong; Xu, Shengsheng; Liu, Zhijie; Wen, Han; Xie, Xiaoyao


    NADPH regeneration capacity is attracting growing research attention due to its important role in resisting oxidative stress. Besides, NADPH availability has been regarded as a limiting factor in production of industrially valuable compounds. The central carbon metabolism carries the carbon skeleton flux supporting the operation of NADPH-regenerating enzyme and offers flexibility in coping with NADPH demand for varied intracellular environment. To acquire an insightful understanding of its NADPH regeneration capacity, the elementary mode method was employed to compute all elementary flux modes (EFMs) of a network representative of central carbon metabolism. Based on the metabolic flux distributions of these modes, a cluster analysis of EFMs with high NADPH regeneration rate was conducted using the self-organizing map clustering algorithm. The clustering results were used to study the relationship between the flux of total NADPH regeneration and the flux in each NADPH producing enzyme. The results identified several reaction combinations supporting high NADPH regeneration, which are proven to be feasible in cells via thermodynamic analysis and coincident with a great deal of previous experimental report. Meanwhile, the reaction combinations showed some common characteristics: there were one or two decarboxylation oxidation reactions in the combinations that produced NADPH and the combination constitution included certain gluconeogenesis pathways. These findings suggested cyclization pathways as a powerful way for NADPH regeneration capacity of bacterial central carbon metabolism. PMID:26086807

  20. Elementary Flux Mode Analysis Revealed Cyclization Pathway as a Powerful Way for NADPH Regeneration of Central Carbon Metabolism

    PubMed Central

    Shen, Tie; Zheng, Meijuan; Zhou, Wenwei; Du, Honglin; Fan, Yadong; Wang, Yongkang; Zhang, Zhengdong; Xu, Shengsheng; Liu, Zhijie; Wen, Han; Xie, Xiaoyao


    NADPH regeneration capacity is attracting growing research attention due to its important role in resisting oxidative stress. Besides, NADPH availability has been regarded as a limiting factor in production of industrially valuable compounds. The central carbon metabolism carries the carbon skeleton flux supporting the operation of NADPH-regenerating enzyme and offers flexibility in coping with NADPH demand for varied intracellular environment. To acquire an insightful understanding of its NADPH regeneration capacity, the elementary mode method was employed to compute all elementary flux modes (EFMs) of a network representative of central carbon metabolism. Based on the metabolic flux distributions of these modes, a cluster analysis of EFMs with high NADPH regeneration rate was conducted using the self-organizing map clustering algorithm. The clustering results were used to study the relationship between the flux of total NADPH regeneration and the flux in each NADPH producing enzyme. The results identified several reaction combinations supporting high NADPH regeneration, which are proven to be feasible in cells via thermodynamic analysis and coincident with a great deal of previous experimental report. Meanwhile, the reaction combinations showed some common characteristics: there were one or two decarboxylation oxidation reactions in the combinations that produced NADPH and the combination constitution included certain gluconeogenesis pathways. These findings suggested cyclization pathways as a powerful way for NADPH regeneration capacity of bacterial central carbon metabolism. PMID:26086807

  1. Absorbable biologically based internal fixation.


    Ibrahim, Ahmed M S; Koolen, Pieter G L; Kim, Kuylhee; Perrone, Gabe S; Kaplan, David L; Lin, Samuel J


    Absorbable devices for use in internal fixation have advanced over the years to become reliable and cost-effective alternatives to metallic hardware. In the past, biodegradable fixation involved a laborious implantation process, and induced osteolysis and inflammatory reactions. Modern iterations exhibit increased strength, smoother resorption, and lower rates of reactivity. A newer generation manufactured from silk has emerged that may address existing limitations and provide a greater range of fixation applications. PMID:25440418

  2. A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime

    NASA Technical Reports Server (NTRS)

    Carr, Mary-Elena


    A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

  3. Nitrogen fixation apparatus


    Chen, Hao-Lin (Walnut Creek, CA)


    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

  4. Regulation of Development and Nitrogen Fixation in Anabaena

    SciTech Connect

    James W Golden


    The nitrogen-fixing filamentous cyanobacterium Anabaena sp. strain PCC 7120 is being used as a simple model of microbial development and pattern formation in a multicellular prokaryotic organism. Anabaena reduces atmospheric nitrogen to ammonia in highly specialized, terminally differentiated cells called heterocysts. Anabaena is an important model system because of the multicellular growth pattern, the suspected antiquity of heterocyst development, and the contribution of fixed nitrogen to the environment. We are especially interested in understanding the molecular signaling pathways and genetic regulation that control heterocyst development. In the presence of an external source of reduced nitrogen, the differentiation of heterocysts is inhibited. When Anabaena is grown on dinitrogen, a one-dimensional developmental pattern of single heterocysts separated by approximately ten vegetative cells is established to form a multicellular organism composed of two interdependent cell types. The goal of this project is to understand the signaling and regulatory pathways that commit a vegetative cell to terminally differentiate into a nitrogen-fixing heterocyst. Several genes identified by us and by others were chosen as entry points into the regulatory network. Our research, which was initially focused on transcriptional regulation by group 2 sigma factors, was expanded to include group 3 sigma factors and their regulators after the complete Anabaena genome sequence became available. Surprisingly, no individual sigma factor is essential for heterocyst development. We have used the isolation of extragenic suppressors to study genetic interactions between key regulatory genes such as patS, hetR, and hetC in signaling and developmental pathways. We identified a hetR R223W mutation as a bypass suppressor of patS overexpression. Strains containing the hetR R223W allele fail to respond to pattern formation signals and overexpression of this allele results in a lethal phenotype because all cells differentiate a few days after nitrogen step-down. Our continued analysis of these genes will provide a better understanding of how a simple prokaryotic organism can perform both photosynthetic carbon fixation and nitrogen fixation simultaneously by separating these processes in different cell types.

  5. Allocate carbon for a reason: priorities are reflected in the C/C ratios of plant lipids synthesized via three independent biosynthetic pathways.


    Zhou, Youping; Stuart-Williams, Hilary; Grice, Kliti; Kayler, Zachary E; Zavadlav, Saa; Vogts, Angela; Rommerskirchen, Florian; Farquhar, Graham D; Gessler, Arthur


    It has long been theorized that carbon allocation, in addition to the carbon source and to kinetic isotopic effects associated with a particular lipid biosynthetic pathway, plays an important role in shaping the carbon isotopic composition ((13)C/(12)C) of lipids (Park and Epstein, 1961). If the latter two factors are properly constrained, valuable information about carbon allocation during lipid biosynthesis can be obtained from carbon isotope measurements. Published work of Chikaraishi et al. (2004) showed that leaf lipids isotopic shifts from bulk leaf tissue ??(13)C(bk-lp) (defined as ?(13)C(bulkleaftissue)-?(13)C(lipid)) are pathway dependent: the acetogenic (ACT) pathway synthesizing fatty lipids has the largest isotopic shift, the mevalonic acid (MVA) pathway synthesizing sterols the lowest and the phytol synthesizing 1-deoxy-D-xylulose 5-phosphate (DXP) pathway gives intermediate values. The differences in ??(13)C(bk-lp) between C3 and C4 plants ??(13)C(bk-lp,C4-C3) are also pathway-dependent: ??(13)C(ACT)(bk-lp,C4-C3) > ??(13)C(DXP(bk-lp,C4-C3) > ??(13)C(MVA)(bk-lp,C4-C3). These pathway-dependent differences have been interpreted as resulting from kinetic isotopic effect differences of key but unspecified biochemical reactions involved in lipids biosynthesis between C3 and C4 plants. After quantitatively considering isotopic shifts caused by (dark) respiration, export-of-carbon (to sink tissues) and photorespiration, we propose that the pathway-specific differences ??(13)C(bk-lp,C4-C3) can be successfully explained by C4-C3 carbon allocation (flux) differences with greatest flux into the ACT pathway and lowest into the MVA pathways (when flux is higher, isotopic shift relative to source is smaller). Highest carbon allocation to the ACT pathway appears to be tied to the most stringent role of water-loss-minimization by leaf waxes (composed mainly of fatty lipids) while the lowest carbon allocation to the MVA pathway can be largely explained by the fact that sterols act as regulatory hormones and membrane fluidity modulators in rather low concentrations. PMID:25576502

  6. Flexible fixation and fracture healing: do locked plating 'internal fixators' resemble external fixators?


    Schmal, Hagen; Strohm, Peter C; Jaeger, Martin; Südkamp, Norbert P


    External and internal fixators use bone screws that are locked to a plate or bar to prevent periosteal compression and associated impairment of blood supply. Both osteosynthesis techniques rely on secondary bone healing with callus formation with the exception of compression plating of simple, noncomminuted fractures. External fixation uses external bars for stabilization, whereas internal fixation is realized by subcutaneous placement of locking plates. Both of these "biologic" osteosynthesis methods allow a minimally invasive approach and do not compromise fracture hematoma and periosteal blood supply. Despite these similarities, differences between the two fixation methods prevail. Locked plating "internal fixators" allow a combination of biomechanical principles such as buttressing and dynamic compression. Periarticular locking plates are anatomically contoured to facilitate fixation of articular fractures. They allow for subchondral stabilization using small-diameter angular stable screws as well as buttressing of the joint and the metaphyseal component of a fracture. Biomechanically, they can be far stiffer than external fixators, because subcutaneous plates are located much closer to the bone surface than external fixator bars. External fixators have the advantage of being less expensive, highly flexible, and technically less demanding. They remain an integral part of orthopaedic surgery for emergent stabilization, for pediatric fractures, for definitive osteosynthesis in certain indications such as distal radius fractures, and for callus distraction. PMID:21248555

  7. Ammonia oxidation coupled to CO2 fixation by archaea and bacteria in an agricultural soil.


    Pratscher, Jennifer; Dumont, Marc G; Conrad, Ralf


    Ammonia oxidation is an essential part of the global nitrogen cycling and was long thought to be driven only by bacteria. Recent findings expanded this pathway also to the archaea. However, most questions concerning the metabolism of ammonia-oxidizing archaea, such as ammonia oxidation and potential CO(2) fixation, remain open, especially for terrestrial environments. Here, we investigated the activity of ammonia-oxidizing archaea and bacteria in an agricultural soil by comparison of RNA- and DNA-stable isotope probing (SIP). RNA-SIP demonstrated a highly dynamic and diverse community involved in CO(2) fixation and carbon assimilation coupled to ammonia oxidation. DNA-SIP showed growth of the ammonia-oxidizing bacteria but not of archaea. Furthermore, the analysis of labeled RNA found transcripts of the archaeal acetyl-CoA/propionyl-CoA carboxylase (accA/pccB) to be expressed and labeled. These findings strongly suggest that ammonia-oxidizing archaeal groups in soil autotrophically fix CO(2) using the 3-hydroxypropionate-4-hydroxybutyrate cycle, one of the two pathways recently identified for CO(2) fixation in Crenarchaeota. Catalyzed reporter deposition (CARD)-FISH targeting the gene encoding subunit A of ammonia monooxygenase (amoA) mRNA and 16S rRNA of archaea also revealed ammonia-oxidizing archaea to be numerically relevant among the archaea in this soil. Our results demonstrate a diverse and dynamic contribution of ammonia-oxidizing archaea in soil to nitrification and CO(2) assimilation and that their importance to the overall archaeal community might be larger than previously thought. PMID:21368116


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Illinois bundleflower [Desmanthus illinoensis (Michx.) MacMillan] is a warm-season perennial forage legume that may serve as a pulse crop. Its productivity is influenced by its N2 fixation capability. Our objective was to estimate symbiotic N2 fixation of three Illinois bundleflower accessions from ...

  9. Activation of the phospholipase C signaling pathway in nerve growth factor-treated neurons by carbon nanotubes.


    Matsumoto, Kotaro; Shimizu, Norio


    Low concentrations of carbon nanotubes (CNTs) promoted the number of nerve growth factor (NGF)-treated neurons with neurite outgrowth by activating extracellular signal-regulated kinase (ERK), even when MEK inhibitor was added to the neuron culture medium. We speculated that CNTs may activate ERK through the phospholipase C (PLC) signaling pathway independent of the Ras/Raf/MEK cascade involved in the ERK signaling pathway. CNTs enhanced phosphorylation of PLC-?1 in NGF-treated neurons but failed to increase the number and length of neurites of NGF-treated neurons with neurite outgrowth when a PLC inhibitor, an inositol triphosphate receptor (IP3R) inhibitor, or an inhibitor of protein kinase C (PKC) in the PLC signaling pathway were added to the neuron culture medium. Furthermore, intracellular Ca(++) levels of cells treated with CNTs+NGF were higher than those of cells treated with NGF alone. Although the combination of CNTs and NGF increased the concentration of phosphorylated ERK (p-ERK) in MEK inhibitor-treated neurons, CNTs did not induce phosphorylation of ERK in PLC inhibitor-treated neurons. These data suggest that PKC in the PLC signaling pathway may activate ERK independent of the Ras/Raf/MEK cascade. In summary, we identified a role of PLC signaling in mediating neurite outgrowth of NGF-treated neurons in the presence of CNTs. PMID:23669261

  10. A Dynamic Pathway for Stone-Wales Bond Rotation on Carbon Nanotubes through Diamond-Like Bonds

    NASA Technical Reports Server (NTRS)

    Wei, Chen-Yu; Srivastava, Deepak; Cho, Kyeong-Jae; Menon, Madhu


    A new lower energy barrier with a two-step pathway of Stone-Wales (SW) ,ond rotation on carbon nanotubes (CNTs) is found through molecular dynamics (MD) simulations of CNTs under tension. The first step involves going over to a stable sp3-like metastable configuration with half rotated and partially tilted C-C bond. The second step involves going over to the fully rotated C-C bond with the formation of a SW defect in the nanotube. The energy barrier for this two-step dynamic pathway is significantly lower than the previously known static barrier for in-plane rotation of the C-C bond on a tensile strained (> 4%) CNT.

  11. Surgical rib fixation - technical aspects.


    Marasco, Silvana; Saxena, Pankaj


    Surgical rib fixation (SRF) for severe rib fracture injuries is increasingly becoming an accepted treatment modality. There is now adequate evidence in randomised controlled trials that rib fixation in flail chest patients reduces ventilator times, intensive care stay and costs of treatment in ventilator dependent patients [1-3]. Despite this, rib fixation has not become standard of care for these patients and remains a treatment modality practised by few centres, usually those with large trauma loads who see high volumes of severe rib fracture injury patients. The purpose of this article is to outline the available prostheses, indications, operative planning and techniques of rib fixation. Surgical approaches to rib fractures in anterior, lateral and posterior positions are described as are the use of currently available cortical and medullary fixation prostheses. PMID:25624272

  12. Eighth international congress on nitrogen fixation

    SciTech Connect

    Not Available


    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  13. Microbial fixation of CO2 in water bodies and in drylands to combat climate change, soil loss and desertification.


    Rossi, Federico; Olguín, Eugenia J; Diels, Ludo; De Philippis, Roberto


    The growing concern for the increase of the global warming effects due to anthropogenic activities raises the challenge of finding novel technological approaches to stabilize CO2 emissions in the atmosphere and counteract impinging interconnected issues such as desertification and loss of biodiversity. Biological-CO2 mitigation, triggered through biological fixation, is considered a promising and eco-sustainable method, mostly owing to its downstream benefits that can be exploited. Microorganisms such as cyanobacteria, green algae and some autotrophic bacteria could potentially fix CO2 more efficiently than higher plants, due to their faster growth. Some examples of the potential of biological-CO2 mitigation are reported and discussed in this paper. In arid and semiarid environments, soil carbon sequestration (CO2 fixation) by cyanobacteria and biological soil crusts is considered an eco-friendly and natural process to increase soil C content and a viable pathway to soil restoration after one disturbance event. Another way for biological-CO2 mitigation intensively studied in the last few years is related to the possibility to perform carbon dioxide sequestration using microalgae, obtaining at the same time bioproducts of industrial interest. Another possibility under study is the exploitation of specific chemotrophic bacteria, such as Ralstonia eutropha (or picketii) and related organisms, for CO2 fixation coupled with the production chemicals such as polyhydroxyalkanoates (PHAs). In spite of the potential of these processes, multiple factors still have to be optimized for maximum rate of CO2 fixation by these microorganisms. The optimization of culture conditions, including the optimal concentration of CO2 in the provided gas, the use of metabolic engineering and of dual purpose systems for the treatment of wastewater and production of biofuels and high value products within a biorefinery concept, the design of photobioreactors in the case of phototrophs are some of the issues that, among others, have to be addressed and tested for cost-effective CO2 sequestration. PMID:24355428

  14. Mutations in alternative carbon utilization pathways in Candida albicans attenuate virulence and confer pleiotropic phenotypes.


    Ramírez, Melissa A; Lorenz, Michael C


    The interaction between Candida albicans and cells of the innate immune system is a key determinant of disease progression. Transcriptional profiling has revealed that C. albicans has a complex response to phagocytosis, much of which is similar to carbon starvation. This suggests that nutrient limitation is a significant stress in vivo, and we have shown that glyoxylate cycle mutants are less virulent in mice. To examine whether other aspects of carbon metabolism are important in vivo during an infection, we have constructed strains lacking FOX2 and FBP1, which encode key components of fatty acid beta-oxidation and gluconeogenesis, respectively. As expected, fox2Delta mutants failed to utilize several fatty acids as carbon sources. Surprisingly, however, these mutants also failed to grow in the presence of several other carbon sources, whose assimilation is independent of beta-oxidation, including ethanol and citric acid. Mutants lacking the glyoxylate enzyme ICL1 also had more severe carbon utilization phenotypes than were expected. These results suggest that the regulation of alternative carbon metabolism in C. albicans is significantly different from that in other fungi. In vivo, fox2Delta mutants show a moderate but significant reduction in virulence in a mouse model of disseminated candidiasis, while disruption of the glyoxylate cycle or gluconeogenesis confers a severe attenuation in this model. These data indicate that C. albicans often encounters carbon-poor conditions during growth in the host and that the ability to efficiently utilize multiple nonfermentable carbon sources is a virulence determinant. Consistent with this in vivo requirement, C. albicans uniquely regulates carbon metabolism in a more integrated manner than in Saccharomyces cerevisiae, such that defects in one part of the machinery have wider impacts than expected. These aspects of alternative carbon metabolism may then be useful as targets for therapeutic intervention. PMID:17158734

  15. Multifactor dimensionality reduction analysis to elucidate the cross-talk between one-carbon and xenobiotic metabolic pathways in multi-disease models.


    Naushad, Shaik Mohammad; Vijayalakshmi, Sana Venkata; Rupasree, Yedluri; Kumudini, Nadella; Sowganthika, Sampathkumar; Naidu, Janardhanan Venketlakshmi; Ramaiah, M Janaki; Rao, Dunna Nageswara; Kutala, Vijay Kumar


    Putatively functional polymorphisms of one-carbon and xenobiotic metabolic pathways influence susceptibility for wide spectrum of diseases. The current study was aimed to explore gene-gene interactions among these two metabolic pathways in four diseases i.e. breast cancer, systemic lupus erythematosus (SLE), coronary artery disease (CAD) and Parkinson's disease (PD). Multifactor dimensionality reduction analysis was carried out on four case-control datasets. Cross-talk was observed between one-carbon and xenobiotic pathways in breast cancer (RFC 80 G>A, COMT H108L and TYMS 5'-UTR 28 bp tandem repeat) and SLE (CYP1A1 m1, MTRR 66 A>G and GSTT1). Gene-gene interactions within one-carbon metabolic pathway were observed in CAD (GCPII 1561 C>T, SHMT 1420 C>T and MTHFR 677 C>T) and PD (cSHMT 1420 C>T, MTRR 66 A>G and RFC1 80 G>A). These interaction models showed good predictability of risk for PD (The area under the receiver operating characteristic curve (C) = 0.83) and SLE (C = 0.73); and moderate predictability of risk for breast cancer (C = 0.64) and CAD (C = 0.63). Cross-talk between one-carbon and xenobiotic pathways was observed in diseases with female preponderance. Gene-gene interactions within one-carbon metabolic pathway were observed in diseases with male preponderance. PMID:25648260

  16. [External fixator: surgical technique, pinless fixator, change in procedure].


    Oberli, H; Frigg, R; Schenk, R


    External Fixation-Technique: The advantages of external over internal fixation are as follows: a) endosteal and periosteal blood supply is undisturbed, b) "low-tech" equipment may be used, c) secondary adjustments are possible and d) easy implant removal. These benefits however are outweighed by the main disadvantages of long term external fixation i.e. pin complications and delayed union of fractures. Better understanding of postoperative management and careful application of screws of improved design will lead to better results. Today's standard applications of external fixation for tibial fractures is a unilateral fixator, using Schanz screws. The pin-bone interface is the most critical site of all external fixation. By avoiding heat necrosis (low temperature drilling) and preventing micro motion at the pin-bone interface (by applying bending- or more recently radial-preload), pin complications such as infection and loosening can be reduced. Two Schanz screws are inserted into each main fragment and are connected with one short tube per fragment. The fracture is then reduced by using these tubes as handles. After reduction a third tube connects the first two by means of two tube-to-tube clamps. This type of fixation will easily allow for three dimensional secondary corrections of alignment. Approximately three weeks following the injury some motion at the fracture site will stimulate callus formation. This can be achieved by destabilisation, dynamisation or "active stimulation" of the fracture site [2]. Pinless fixator: The pinless external fixator holds the fragments firmly with pointed clamps that penetrate about one millimeter into cortical bone without entering and contaminating the medullary canal.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7875986

  17. Exploring the Altered Dynamics of Mammalian Central Carbon Metabolic Pathway in Cancer Cells: A Classical Control Theoretic Approach

    PubMed Central

    Paul, Debjyoti; Dasgupta, Abhijit; De, Rajat K.


    Background In contrast with normal cells, most of the cancer cells depend on aerobic glycolysis for energy production in the form of adenosine triphosphate (ATP) bypassing mitochondrial oxidative phosphorylation. Moreover, compared to normal cells, cancer cells exhibit higher consumption of glucose with higher production of lactate. Again, higher rate of glycolysis provides the necessary glycolytic intermediary precursors for DNA, protein and lipid synthesis to maintain high active proliferation of the tumor cells. In this scenario, classical control theory based approach may be useful to explore the altered dynamics of the cancer cells. Since the dynamics of the cancer cells is different from that of the normal cells, understanding their dynamics may lead to development of novel therapeutic strategies. Method We have developed a model based on the state space equations of classical control theory along with an order reduction technique to mimic the actual dynamic behavior of mammalian central carbon metabolic (CCM) pathway in normal cells. Here, we have modified Michaelis Menten kinetic equation to incorporate feedback mechanism along with perturbations and cross talks associated with a metabolic pathway. Furthermore, we have perturbed the proposed model to reduce the mitochondrial oxidative phosphorylation. Thereafter, we have connected proportional-integral (PI) controller(s) with the model for tuning it to behave like the CCM pathway of a cancer cell. This methodology allows one to track the altered dynamics mediated by different enzymes. Results and Discussions The proposed model successfully mimics all the probable dynamics of the CCM pathway in normal cells. Moreover, experimental results demonstrate that in cancer cells, a coordination among enzymes catalyzing pentose phosphate pathway and intermediate glycolytic enzymes along with switching of pyruvate kinase (M2 isoform) plays an important role to maintain their altered dynamics. PMID:26367460

  18. Biomechanical Concepts for Fracture Fixation.


    Bottlang, Michael; Schemitsch, Christine E; Nauth, Aaron; Routt, Milton; Egol, Kenneth A; Cook, Gillian E; Schemitsch, Emil H


    Application of the correct fixation construct is critical for fracture healing and long-term stability; however, it is a complex issue with numerous significant factors. This review describes a number of common fracture types and evaluates their currently available fracture fixation constructs. In the setting of complex elbow instability, stable fixation or radial head replacement with an appropriately sized implant in conjunction with ligamentous repair is required to restore stability. For unstable sacral fractures with vertical or multiplanar instabilities, "standard" iliosacral screw fixation is not sufficient. Periprosthetic femur fractures, in particular Vancouver B1 fractures, have increased stability when using 90/90 fixation versus a single locking plate. Far cortical locking combines the concept of dynamization with locked plating to achieve superior healing of a distal femur fracture. Finally, there is no ideal construct for syndesmotic fracture stabilization; however, these fractures should be fixed using a device that allows for sufficient motion in the syndesmosis. In general, orthopaedic surgeons should select a fracture fixation construct that restores stability and promotes healing at the fracture site, while reducing the potential for fixation failure. PMID:26584263

  19. Variation in moss-associated nitrogen fixation in boreal forest stands.


    Markham, John H


    Traditionally it has been thought that most boreal forest communities lack a significant input of biologically fixed nitrogen. Recent discoveries of nitrogen fixation by cyanobacteria associated with mosses have resulted in a re-evaluation of this view. While it is recognized that rates of nitrogen fixation in mosses can be highly variable, there is little understanding as to why this occurs. I monitored nitrogen fixation, using acetylene reduction, in wet lowland and dry upland boreal forest communities, in central Canada, over a growing season. At the peak of nitrogen fixation in mid summer, Sphagnum capillifolium had an 11 times higher rate of fixation than Pleurozium schreberi. Variation in canopy openness and precipitation had no effect on rates of fixation over the growing season. In P. schreberi fixation rates did not vary between sites. Temperature had a positive effect on fixation rates in both S. capillifolium and P. schreberi, but the effect was 4 times more pronounced in S. capillifolium. Seasonal rates of nitrogen fixation were estimated at 193 mg N m(-2) for S. capillifolium and 23 mg N m(-2) for P. schreberi. With moderate increases in climate warming, predicted increases in nitrogen fixation in S. capillifolium are sufficient to raise its decomposition rate. Increased temperatures may therefore act synergistically to change boreal systems from a sink to a source of carbon. PMID:19543750

  20. Rapid methods for the high yield synthesis of carbon-13 enriched intermediates of the pentose-phosphate pathway.


    Arora, K K; Collins, J G; MacLeod, J K; Williams, J F


    Methods for the synthesis of carbon-13 enriched substrates, intermediates and products of the pentose-phosphate pathway, viz. ribose, arabinose, xylulose and ribulose 5-phosphates, sedoheptulose mono- and bisphosphates, octulose (both the ido- and altro-epimers) mono- and bisphosphates, are described. The procedure of the classical Kiliani synthesis was adopted for the preparation of the two starting compounds, [1-13C]ribose and [1-13C]arabinose 5-phosphates. Using these initial reactants and enzymic methods involving the group-transferring enzymes, transketolase, aldolase and transaldolase, a variety of specifically 13C-labelled five-, six-, seven- and eight-carbon sugar phosphates were synthesized in high yield and purity. The isolation and authenticity of each of the 13C-labelled sugars were established by column, paper and thin layer chromatographic methods and specific enzymic assays. The purity and positional isotopic analysis of these sugar-P's were confirmed by 13C-NMR spectroscopy. These specifically 13C-enriched compounds are required for enzymatic, mechanistic and quantitative investigations of pentose-pathway reactions in animal, plant and tumour tissues in vitro and in vivo. PMID:3223986

  1. Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501

    PubMed Central

    Yan, Yongliang; Yang, Jian; Dou, Yuetan; Chen, Ming; Ping, Shuzhen; Peng, Junping; Lu, Wei; Zhang, Wei; Yao, Ziying; Li, Hongquan; Liu, Wei; He, Sheng; Geng, Lizhao; Zhang, Xiaobing; Yang, Fan; Yu, Haiying; Zhan, Yuhua; Li, Danhua; Lin, Zhanglin; Wang, Yiping; Elmerich, Claudine; Lin, Min; Jin, Qi


    The capacity to fix nitrogen is widely distributed in phyla of Bacteria and Archaea but has long been considered to be absent from the Pseudomonas genus. We report here the complete genome sequencing of nitrogen-fixing root-associated Pseudomonas stutzeri A1501. The genome consists of a single circular chromosome with 4,567,418 bp. Comparative genomics revealed that, among 4,146 protein-encoding genes, 1,977 have orthologs in each of the five other Pseudomonas representative species sequenced to date. The genome contains genes involved in broad utilization of carbon sources, nitrogen fixation, denitrification, degradation of aromatic compounds, biosynthesis of polyhydroxybutyrate, multiple pathways of protection against environmental stress, and other functions that presumably give A1501 an advantage in root colonization. Genetic information on synthesis, maturation, and functioning of nitrogenase is clustered in a 49-kb island, suggesting that this property was acquired by lateral gene transfer. New genes required for the nitrogen fixation process have been identified within the nif island. The genome sequence offers the genetic basis for further study of the evolution of the nitrogen fixation property and identification of rhizosphere competence traits required in the interaction with host plants; moreover, it opens up new perspectives for wider application of root-associated diazotrophs in sustainable agriculture. PMID:18495935

  2. Mimicking a natural pathway for de novo biosynthesis: natural vanillin production from accessible carbon sources

    PubMed Central

    Ni, Jun; Tao, Fei; Du, Huaiqing; Xu, Ping


    Plant secondary metabolites have been attracting people’s attention for centuries, due to their potentials; however, their production is still difficult and costly. The rich diversity of microbes and microbial genome sequence data provide unprecedented gene resources that enable to develop efficient artificial pathways in microorganisms. Here, by mimicking a natural pathway of plants using microbial genes, a new metabolic route was developed in E. coli for the synthesis of vanillin, the most widely used flavoring agent. A series of factors were systematically investigated for raising production, including efficiency and suitability of genes, gene dosage, and culture media. The metabolically engineered strain produced 97.2 mg/L vanillin from l-tyrosine, 19.3 mg/L from glucose, 13.3 mg/L from xylose and 24.7 mg/L from glycerol. These results show that the metabolic route enables production of natural vanillin from low-cost substrates, suggesting that it is a good strategy to mimick natural pathways for artificial pathway design. PMID:26329726

  3. Mimicking a natural pathway for de novo biosynthesis: natural vanillin production from accessible carbon sources.


    Ni, Jun; Tao, Fei; Du, Huaiqing; Xu, Ping


    Plant secondary metabolites have been attracting people's attention for centuries, due to their potentials; however, their production is still difficult and costly. The rich diversity of microbes and microbial genome sequence data provide unprecedented gene resources that enable to develop efficient artificial pathways in microorganisms. Here, by mimicking a natural pathway of plants using microbial genes, a new metabolic route was developed in E. coli for the synthesis of vanillin, the most widely used flavoring agent. A series of factors were systematically investigated for raising production, including efficiency and suitability of genes, gene dosage, and culture media. The metabolically engineered strain produced 97.2?mg/L vanillin from l-tyrosine, 19.3?mg/L from glucose, 13.3?mg/L from xylose and 24.7?mg/L from glycerol. These results show that the metabolic route enables production of natural vanillin from low-cost substrates, suggesting that it is a good strategy to mimick natural pathways for artificial pathway design. PMID:26329726

  4. Effects of Carbon Dioxide on Growth and Maltose Fermentation by Bacteroides amylophilus

    PubMed Central

    Caldwell, Daniel R.; Keeney, Mark; Van Soest, Peter J.


    The requirement of carbon dioxide for growth of Bacteroides amylophilus is quantitatively similar to that of certain other rumen bacteria. Carbon dioxide could be replaced by bicarbonate, but not by formate or certain amino acids. Label from 14CO2 was incorporated into the succinate produced during maltose fermentation by B. amylophilus, and during glucose fermentation by B. ruminicola, and during cellobiose fermentation by B. succinogenes. All of the incorporated label could be associated with the carboxyl function of the molecule. The depression in radioactivity per micromole of carbon in the succinate formed from the fermentation of uniformly labeled 14C-maltose by B. amylophilus was greater than would be expected if all of the succinate formed was produced via a direct CO2 fixation pathway(s) involving phosphoenolpyruvate or pyruvate; the radioactivity per micromole of carbon suggests that as much as 60% of the total succinate results from a pathway(s) involving direct CO2 fixation. Maltose fermentation by B. amylophilus was dependent upon CO2 concentration, but CO2 concentration could not be shown to influence either the fermentation end-product ratios or the proportion of total succinate formed attributable to CO2 fixation. PMID:5814705

  5. The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast

    NASA Astrophysics Data System (ADS)

    Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.


    The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates. Using 7Be and 234Th XS, the sediment-mixing coefficient ( Db) was 4.3 1.8 cm 2 y -1, a value that lies at the lower limit for marine environments, indicating that mixing was not important in these sediments at this time. Sediment accumulation rates ( Sa), estimated using 137Cs and 210Pb XS, were 0.16 0.02 g cm -2 y -1. The supply rate of organic carbon to the sediment-water interface was 30 3.9 mmol C m -2 d -1, of which 10% or 2.9 0.44 mmol C m -2 d -1was lost from the system through burial below the 1-cm thick surface mixed layer. Measured fluxes of O 2 were 26 3.8 mmol m -2 d -1 and equated to a carbon oxidation rate of 20 3.3 mmol C m -2 d -1, which is an upper limit due to the potential for oxidation of additional reduced species. Using organic carbon gradients in the surface mixed layer, carbon oxidation was estimated at 2.6 1.1 mmol C m -2 d -1. Independent estimates made using pore water concentration gradients of ammonium and C:N stoichiometry, equaled 2.8 0.46 mmol C m -2 d -1. The flux of DOC out of the sediments (DOC efflux) was 5.6 1.3 mmol C m -2 d -1. In general, while mass balance was achieved indicating the sediments were at steady state during this time, changes in environmental conditions within the bay and the surrounding area, mean this conclusion might not always hold. These results show that the majority of carbon oxidation occurred at the sediment-water interface, via O 2 reduction. This likely results from the high frequency of sediment resuspension events combined with the shallow sediment mixing zone, leaving anaerobic oxidants responsible for only 10-15% of the carbon oxidized in these sediments.

  6. Molecular Biology of Nitrogen Fixation

    ERIC Educational Resources Information Center

    Shanmugam, K. T.; Valentine, Raymond C.


    Reports that as a result of our increasing knowledge of the molecular biology of nitrogen fixation it might eventually be possible to increase the biological production of nitrogenous fertilizer from atmospheric nitrogen. (GS)

  7. Trophic structure and pathways of biogenic carbon flow in the eastern North Water Polynya

    NASA Astrophysics Data System (ADS)

    Tremblay, Jean-Éric; Hattori, Hiroshi; Michel, Christine; Ringuette, Marc; Mei, Zhi-Ping; Lovejoy, Connie; Fortier, Louis; Hobson, Keith A.; Amiel, David; Cochran, Kirk


    In the eastern North Water, most of the estimated annual new and net production of carbon (C) occurred during the main diatom bloom in 1998. During the bloom, at least 30% of total and new phytoplankton production occurred as dissolved organic carbon (DOC) and was unavailable for short-term assimilation into the herbivorous food web or sinking export. Based on particle interceptor traps and 234Th deficits, 27% of the particulate primary production (PP) sank out of the upper 50 m, with only 7% and 1% of PP reaching the benthos at shallow (≈200 m) and deep (≈500 m) sites, respectively. Mass balance calculations and grazing estimates agree that ≈79% of PP was ingested by pelagic consumers between April and July. During this period, the vertical flux of biogenic silica (BioSi) at 50 m was equivalent to the total BioSi produced, indicating that all of the diatom production was removed from the euphotic zone as intact cells (direct sinking) or empty frustules (grazing or lysis). The estimated flux of empty frustules was consistent with rates of herbivory by the large, dominant copepods and appendicularians during incubations. Since the carbon demand of the dominant planktivorous bird, Alle alle, amounted to ≈2% of the biomass synthesized by its main prey, the large copepod Calanus hyperboreus, most of the secondary carbon production was available to pelagic carnivores. Stable isotopes indicated that the biomass of predatory amphipods, polar cod and marine mammals was derived from these herbivores, but corresponding carbon fluxes were not quantified. Our analysis shows that a large fraction of PP in the eastern North Water was ingested by consumers in the upper 50 m, leading to substantial carbon respiration and DOC accumulation in surface waters. An increasingly early and prolonged opening of the Artic Ocean is likely to promote the productivity of the herbivorous food web, but not the short-term efficiency of the particulate, biological CO 2 pump.

  8. Carbon-13 NMR studies and purification of gluconate pathway enzymes from Schizosaccharomyces pombe.


    Tsai, C S; Ye, H G; Shi, J L


    Evidence is presented to show that D-glucose in Schizosaccharomyces pombe can be metabolized via a new alternative route (gluconate pathway) in addition to the regular D-glucose 6-phosphate route. This gluconate pathway consists of two steps: oxidation of D-glucose to D-gluconate by NADP(+)-dependent glucose dehydrogenase and phosphorylation of D-gluconate to 6-phosphogluconate by gluconate kinase. The formation of D-gluconate and 6-phosphogluconate from D-glucose was monitored by 13C nuclear magnetic resonance spectroscopy using D-[1-13C]glucose and D-[U-13C]glucose. The operation of the gluconate pathway was further substantiated by the purification of its two member enzymes, glucose dehydrogenase and gluconate kinase, from the cell-free extract of the fission yeast. Glucose dehydrogenase has been purified (580-fold) to homogeneity by the combined procedures of ammonium sulfate fractionation, Sephadex gel filtration, cation-exchange chromatography, matrex gel chromatography, and agarose-NADP+ affinity chromatography. The purified enzyme is monomeric with a relative molecular weight of 6.65 x 10(4) Da. Gluconate kinase has been purified (410-fold) to near homogeneity by a combination of chromatographic procedures using Bio-gels, matrex gel, and agarose gels. The purified enzyme is monomeric with a relative molecular weight of 2.4 x 10(4) Da. The gluconate pathway presented here provides an alternative route for the D-glucose metabolism in Sch. pombe. Meanwhile, this paper documents another metabolic difference between the fission and budding yeasts. PMID:7840611

  9. Nitrogen reduction pathways in estuarine sediments: Influences of organic carbon and sulfide

    NASA Astrophysics Data System (ADS)

    Plummer, Patrick; Tobias, Craig; Cady, David


    Potential rates of sediment denitrification, anaerobic ammonium oxidation (anammox), and dissimilatory nitrate reduction to ammonium (DNRA) were mapped across the entire Niantic River Estuary, CT, USA, at 100-200 m scale resolution consisting of 60 stations. On the estuary scale, denitrification accounted for ~ 90% of the nitrogen reduction, followed by DNRA and anammox. However, the relative importance of these reactions to each other was not evenly distributed through the estuary. A Nitrogen Retention Index (NIRI) was calculated from the rate data (DNRA/(denitrification + anammox)) as a metric to assess the relative amounts of reactive nitrogen being recycled versus retained in the sediments following reduction. The distribution of rates and accompanying sediment geochemical analytes suggested variable controls on specific reactions, and on the NIRI, depending on position in the estuary and that these controls were linked to organic carbon abundance, organic carbon source, and pore water sulfide concentration. The relationship between NIRI and organic carbon abundance was dependent on organic carbon source. Sulfide proved the single best predictor of NIRI, accounting for 44% of its observed variance throughout the whole estuary. We suggest that as a single metric, sulfide may have utility as a proxy for gauging the distribution of denitrification, anammox, and DNRA.

  10. Fixation of mandibular fractures: a comparative analysis of rigid internal fixation and standard fixation techniques.


    Dodson, T B; Perrott, D H; Kaban, L B; Gordon, N C


    This study used a prospective design to compare standard therapy (closed or open reduction with 4 weeks of maxillomandibular fixation) to rigid internal fixation (RIF) for the treatment of mandibular fractures. Ninety-two patients with 143 fractures were evaluated and treated. There was no statistically significant difference in the treatment results between the two groups, despite a bias in the distribution of study variables that favored the standard therapy. PMID:2313443

  11. Genetic regulation of nitrogen fixation in rhizobia.

    PubMed Central

    Fischer, H M


    This review presents a comparison between the complex genetic regulatory networks that control nitrogen fixation in three representative rhizobial species, Rhizobium meliloti, Bradyrhizobium japonicum, and Azorhizobium caulinodans. Transcription of nitrogen fixation genes (nif and fix genes) in these bacteria is induced primarily by low-oxygen conditions. Low-oxygen sensing and transmission of this signal to the level of nif and fix gene expression involve at least five regulatory proteins, FixL, FixJ, FixK, NifA, and RpoN (sigma 54). The characteristic features of these proteins and their functions within species-specific regulatory pathways are described. Oxygen interferes with the activities of two transcriptional activators, FixJ and NifA. FixJ activity is modulated via phosphorylation-dephosphorylation by the cognate sensor hemoprotein FixL. In addition to the oxygen responsiveness of the NifA protein, synthesis of NifA is oxygen regulated at the level of transcription. This type of control includes FixLJ in R. meliloti and FixLJ-FixK in A. caulinodans or is brought about by autoregulation in B. japonicum. NifA, in concert with sigma 54 RNA polymerase, activates transcription from -24/-12-type promoters associated with nif and fix genes and additional genes that are not directly involved in nitrogen fixation. The FixK proteins constitute a subgroup of the Crp-Fnr family of bacterial regulators. Although the involvement of FixLJ and FixK in nifA regulation is remarkably different in the three rhizobial species discussed here, they constitute a regulatory cascade that uniformly controls the expression of genes (fixNOQP) encoding a distinct cytochrome oxidase complex probably required for bacterial respiration under low-oxygen conditions. In B. japonicum, the FixLJ-FixK cascade also controls genes for nitrate respiration and for one of two sigma 54 proteins. Images PMID:7968919


    SciTech Connect

    John J. Kilbane III


    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage pathway. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum.

  13. ABI1 regulates carbon/nitrogen-nutrient signal transduction independent of ABA biosynthesis and canonical ABA signalling pathways in Arabidopsis.


    Lu, Yu; Sasaki, Yuki; Li, Xingwen; Mori, Izumi C; Matsuura, Takakazu; Hirayama, Takashi; Sato, Takeo; Yamaguchi, Junji


    Plants are able to sense and mediate the balance between carbon (C) and nitrogen (N) nutrient availability to optimize metabolism and growth, described as the C/N response. To clarify the C/N signalling mechanism, C/N-insensitive plants were obtained from an Arabidopsis FOX hunting population, which over-expresses full-length cDNAs for individuals. The resulting cni2-D (carbon/nitrogen insensitive 2-dominant) plant was found to overcome the post-germination growth checkpoint and to expand green cotyledons in disrupted high C/low N stress conditions. The CNI2 gene encodes ABI1, a phosphatase type 2C protein, which negatively regulates abscisic acid (ABA) signal transduction. Over-expressors of ABI1 were found to be insensitive to disrupted C/N stress, whereas the loss-of function mutant abi1-2 was hypersensitive, suggesting that ABI1 plays an essential role in the plant C/N response. By contrast, the C/N-dependent growth phenotype observed in wild-type plants was not associated with endogenous ABA content. Accordingly, the ABA-insensitive mutant abi1-1, which could not bind to the ABA-ABA receptor complex, was not insensitive and restored normal sensitivity to high C/low N stress. The canonical ABA signalling mutants abi4 and abi5 were also sensitive to disrupted C/N stress. Further gene expression analysis demonstrated that several genes in the SnRK2s and SnRK1s pathways are transcriptionally affected by high C/low N stress in wild-type plants regardless of the lack of increased endogenous ABA contents, whereas the expression of these genes were significantly suppressed in ABI1 over-expressors. Taken together, these results suggest direct cross-talk between C/N and non-canonical ABA signalling pathways, regulated by ABI1, in plants. PMID:25795738

  14. Pathways and transformations of dissolved methane and dissolved inorganic carbon in Arctic tundra soils: Evidence from analysis of stable isotopes

    NASA Astrophysics Data System (ADS)

    Throckmorton, H.; Perkins, G.; Muss, J. D.; Smith, L. J.; Conrad, M. E.; Torn, M. S.; Heikoop, J. M.; Newman, B. D.; Wilson, C. J.; Wullschleger, S. D.


    Arctic soils contain a large pool of terrestrial C and are of great interest because of their potential for releasing significant amounts of carbon dioxide (CO2) and methane (CH4) to the atmosphere. Few attempts have been made, however, to derive quantitative budgets of CO2 and CH4 budgets for high-latitude ecosystems. Therefore, this study used naturally occurring geochemical and isotopic tracers to estimate production pathways and transformations of dissolved inorganic carbon (DIC = Σ (total) dissolved CO2) and dissolved CH4 in soil pore waters from 17 locations (drainages) in Barrow, Alaska (USA) in July and September, 2013; and to approximate a complete balance of belowground C cycling at our sampling locations. Results suggest that CH4 was primarily derived from biogenic acetate fermentation, with a shift at 4 locations from July to September towards CO2 reduction as the dominant methanogenic pathway. A large majority of CH4 produced at the frost table methane was transferred directly to the atmosphere via plant roots and ebullition (94.0 ± 1.4% and 96.6 ± 5.0% in July and September). A considerable fraction of the remaining CH4 was oxidized to CO2 during upward diffusion in July and September, respectively. Methane oxidization produced <1% of CO2 relative to alternative production mechanisms in deep subsurface pore waters. The majority of subsurface CO2 was produced from anaerobic respiration, likely due to reduction of Fe oxides and humics (52 ± 6 to 100 ± 13%, on average) while CO2 produced from methanogenesis accounted for the remainder (0 ± 13% to 47 ± 6%, on average) for July and September, respectively. Dissolved CH4 and dissolved CO2 concentrations correlated with thaw depth, suggesting that Arctic ecosystems will likely produce and release a greater amount of greenhouse gasses under projected warming and deepening of active layer thaw depth under future climate change scenarios.

  15. Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds

    SciTech Connect

    John J. Kilbane II


    The objective of the project is to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. The selective cleavage of the second C-N bond has been challenging, and efforts to overcome that challenge have been the focus of recent research in this project. Enrichment culture experiments succeeded in isolating bacterial cultures that can metabolize 2-aminobiphenyl, but no enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl has been identified. Aniline is very similar to the structure of 2-aminobiphenyl and aniline dioxygenase catalyzes the conversion of aniline to catechol and ammonia. For the remainder of the project the emphasis of research will be to simultaneously express the genes for carbazole dioxygenase and for aniline dioxygenase in the same bacterial host and then to select for derivative cultures capable of using carbazole as the sole source of nitrogen.

  16. Carbon Fluxes between Primary Metabolism and Phenolic Pathway in Plant Tissues under Stress.


    Caretto, Sofia; Linsalata, Vito; Colella, Giovanni; Mita, Giovanni; Lattanzio, Vincenzo


    Higher plants synthesize an amazing diversity of phenolic secondary metabolites. Phenolics are defined secondary metabolites or natural products because, originally, they were considered not essential for plant growth and development. Plant phenolics, like other natural compounds, provide the plant with specific adaptations to changing environmental conditions and, therefore, they are essential for plant defense mechanisms. Plant defensive traits are costly for plants due to the energy drain from growth toward defensive metabolite production. Being limited with environmental resources, plants have to decide how allocate these resources to various competing functions. This decision brings about trade-offs, i.e., promoting some functions by neglecting others as an inverse relationship. Many studies have been carried out in order to link an evaluation of plant performance (in terms of growth rate) with levels of defense-related metabolites. Available results suggest that environmental stresses and stress-induced phenolics could be linked by a transduction pathway that involves: (i) the proline redox cycle; (ii) the stimulated oxidative pentose phosphate pathway; and, in turn, (iii) the reduced growth of plant tissues. PMID:26556338

  17. Carbon Fluxes between Primary Metabolism and Phenolic Pathway in Plant Tissues under Stress

    PubMed Central

    Caretto, Sofia; Linsalata, Vito; Colella, Giovanni; Mita, Giovanni; Lattanzio, Vincenzo


    Higher plants synthesize an amazing diversity of phenolic secondary metabolites. Phenolics are defined secondary metabolites or natural products because, originally, they were considered not essential for plant growth and development. Plant phenolics, like other natural compounds, provide the plant with specific adaptations to changing environmental conditions and, therefore, they are essential for plant defense mechanisms. Plant defensive traits are costly for plants due to the energy drain from growth toward defensive metabolite production. Being limited with environmental resources, plants have to decide how allocate these resources to various competing functions. This decision brings about trade-offs, i.e., promoting some functions by neglecting others as an inverse relationship. Many studies have been carried out in order to link an evaluation of plant performance (in terms of growth rate) with levels of defense-related metabolites. Available results suggest that environmental stresses and stress-induced phenolics could be linked by a transduction pathway that involves: (i) the proline redox cycle; (ii) the stimulated oxidative pentose phosphate pathway; and, in turn, (iii) the reduced growth of plant tissues. PMID:26556338


    SciTech Connect

    John J. Kilbane II


    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project was focused on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate deaminase. The objective of the final phase of the project will be to develop derivative C-N bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments resulted in the isolation of microbial cultures that utilize aromatic amides as sole nitrogen sources, several amidase genes were cloned and were included in directed evolution experiments to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. During the second year of the project (October, 2003-September, 2004) enrichment culture experiments succeeded in isolating a mixed bacterial culture that can utilize 2-aminobiphenyl as a sole nitrogen source, directed evolution experiments were focused on the aniline dioxygenase enzyme that is capable of deaminating aniline, and expression vectors were constructed to enable the expression of genes encoding C-N bond cleaving enzymes in Rhodococcus hosts. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum. Aromatic compounds such as carbazole are representative of the difficult-to-treat organonitrogen compounds most commonly encountered in petroleum. There are two C-N bonds in carbazole and the construction of a metabolic pathway for the removal of nitrogen from carbazole will require enzymes capable cleaving both C-N bonds. A multi-component enzyme, carbazole dioxygenase, which can selectively cleave the first C-N bond has been identified and the genes that encode this enzyme have been cloned, sequenced, and are being expressed in Rhodococcus erythropolis, a bacterial culture that tolerates exposure to petroleum. An enzyme capable of selectively cleaving the second C-N bond in carbazole has not yet been identified, but enrichment culture experiments have recently succeeded in isolating a bacterial culture that is a likely candidate and may possess a suitable enzyme. Research in the near future will verify if a suitable enzyme for the cleavage of the second C-N bond in carbazole has indeed been found, then the genes encoding a suitable enzyme will be identified, cloned, and sequenced. Ultimately genes encoding enzymes for selective cleavage of both C-N bonds in carbazole will be assembled into a new metabolic pathway and the ability of the resulting bacterial culture to remove nitrogen from petroleum will be determined.

  19. Functional ecology of free-living nitrogen fixation: A contemporary perspective

    USGS Publications Warehouse

    Reed, Sasha C.; Cleveland, Cory C.; Townsend, Alan R.


    Nitrogen (N) availability is thought to frequently limit terrestrial ecosystem processes, and explicit consideration of N biogeochemistry, including biological N2 fixation, is central to understanding ecosystem responses to environmental change. Yet, the importance of free-living N2 fixationa process that occurs on a wide variety of substrates, is nearly ubiquitous in terrestrial ecosystems, and may often represent the dominant pathway for acquiring newly available Nis often underappreciated. Here, we draw from studies that investigate free-living N2 fixation from functional, physiological, genetic, and ecological perspectives. We show that recent research and analytical advances have generated a wealth of new information that provides novel insight into the ecology of N2 fixation as well as raises new questions and priorities for future work. These priorities include a need to better integrate free-living N2 fixation into conceptual and analytical evaluations of the N cycle's role in a variety of global change scenarios.

  20. Multi-Walled Carbon Nanotubes Promote Cementoblast Differentiation and Mineralization through the TGF-?/Smad Signaling Pathway

    PubMed Central

    Li, Lu; Zhu, Zhimin; Xiao, Weixiong; Li, Lei


    Excretion of cementum by cementoblasts on the root surface is a process indispensable for the formation of a functional periodontal ligament. This study investigated whether carboxyl group-functionalized multi-walled carbon nanotubes (MWCNT-COOH) could enhance differentiation and mineralization of mammalian cementoblasts (OCCM-30) and the possible signaling pathway involved in this process. Cementoblasts were incubated with various doses of MWCNT-COOH suspension. Cell viability was detected, and a scanning electron microscopy (SEM) observed both the nanomaterials and the growth of cells cultured with the materials. Alizarin red staining was used to investigate the formation of calcium deposits. Real-time PCR and western blot were used to detect cementoblast differentiation and the underlying mechanisms through the expression of the osteogenic genes and the downstream effectors of the TGF-?/Smad signaling. The results showed that 5 g/mL MWCNT-COOH had the most obvious effects on promoting differentiation without significant toxicity. Alp, Ocn, Bsp, Opn, Col1 and Runx2 gene expression was up-regulated. Smad2 and Smad3 mRNA was up-regulated, while Smad7 was first down-regulated on Day 3 and later up-regulated on Day 7. The elevated levels of phospho-Smad2/3 were also confirmed by western blot. In sum, the MWCNT-COOH promoted cementoblast differentiation and mineralization, at least partially, through interactions with the TGF-?/Smad pathway. PMID:25648319

  1. Delayed Turnover of Unphosphorylated Ssk1 during Carbon Stress Activates the Yeast Hog1 Map Kinase Pathway

    PubMed Central

    Vallejo, Milene Carmes; Mayinger, Peter


    In Saccharomyces cerevisiae, the Hog1 mitogen-activated protein kinase (MAPK) pathway coordinates the adaptation to osmotic stress and was recently reported to respond to acute changes in glucose levels. Similarly as in osmotic stress, glucose starvation leads to a transient accumulation of Hog1 in the nucleus. However, the kinetics and the mechanism of Hog1 activation are different for these stress conditions. During osmotic shock the activation of Hog1 can be transduced by either the Sho1 or the Sln1/Ypd1/Ssk1 branch. During glucose starvation the phosphorylation of Hog1 is slower and is completely dependent on Ssk1, but independent of Sho1. To characterize the mechanism of activation of Hog1 during carbon stress, we examined the turnover of Ssk1 protein levels upon glucose starvation in the presence of cycloheximide and monitored protein levels by western blotting. Our data demonstrate that unphosphorylated Ssk1 was quickly degraded during exponential growth and after osmotic stress but remained remarkably stable during glucose limitation. We conclude that glucose starvation induces a delay in the turnover of unphosphorylated Ssk1, which is sufficient to activate the Hog1 MAPK pathway. Although unphosphorylated Ssk1 is known to be degraded by the proteasome, its stabilization is apparently not due to changes in cellular localization or decrease in ubiquitination levels during glucose limitation. PMID:26340004

  2. Carbon nanotubes enhance intercalated disc assembly in cardiac myocytes via the ?1-integrin-mediated signaling pathway.


    Sun, Hongyu; L, Shuanghong; Jiang, Xiao-Xia; Li, Xia; Li, Hong; Lin, Qiuxia; Mou, Yongchao; Zhao, Yuwei; Han, Yao; Zhou, Jin; Wang, Changyong


    Carbon nanotubes (CNTs) offer a new paradigm for constructing functional cardiac patches and repairing myocardial infarction (MI). However, little is known about how CNTs enhance the mechanical integrity and electrophysiological function of cardiac myocytes. To address this issue, we investigated the regularity and precise mechanism of the influence of CNTs on the assembly of intercalated disc (IDs). Here, single walled CNTs incorporated into collagen substrates were utilized as growth supports for neonatal cardiomyocytes, which enhanced cardiomyocyte adhesion and maturation. Furthermore, through the use of immunohistochemical staining, western blotting, transmission electron microscopy, and intracellular calcium transient measurement, we discovered that the addition of CNTs remarkably increased ID-related protein expression and enhanced ID assembly and functionality. On that basis, we further explored the underlying mechanism for how CNTs enhanced ID assembly through the use of immunohistochemical staining and western blotting. We found that the ?1-integrin-mediated signaling pathway mediated CNT-induced upregulation of electrical and mechanical junction proteins. Notably, CNTs remarkably accelerated gap junction formation via activation of the ?1-integrin-mediated FAK/ERK/GATA4 pathway. These findings provide valuable insight into the mechanistic effects that CNTs have on neonatal cardiomyocyte performance and will have a significant impact on the future of nanomedical research. PMID:25934454

  3. Carbon monoxide releasing molecule?2 attenuated ischemia/reperfusion?induced apoptosis in cardiomyocytes via a mitochondrial pathway.


    Zhao, Shen; Lin, Qingming; Li, Heng; He, Yumin; Fang, Xiangshao; Chen, Feng; Chen, Changwei; Huang, Zitong


    Carbon monoxide (CO) is an endogenous gaseous transmitter that exerts multi-protection in ischemia/reperfusion (I/R) injury, but few experimental studies regarding CO on myocardial I/R-induced apoptosis, as well as its underlying mechanism have been conducted. The present study was designed to investigate whether CO released from CO-releasing molecule-2 (CORM-2) is capable of ameliorating myocardial I/R-induced apoptosis via a mitochondrial apoptotic pathway. Primary cultures of neonatal rat cardiomyocytes were randomly distributed into four groups: Control, I/R (cultured cardiomyocytes were subjected to 2 h simulated ischemia followed by 4 h reperfusion), CORM-2 and inactive CORM-2 (iCORM-2) groups (20 M CORM-2 and 20 M iCORM-2 were administered at the beginning of reperfusion following ischemia, respectively). Flow cytometric analysis showed that CORM-2 treatment significantly decreased apoptosis of cardiomyocytes triggered by simulated I/R. CORM-2 partially recovered mitochondrial respiration and ultrastructure alteration, and lowered caspase-3 expression and the release of cytochrome c. Furthermore, CORM-2 partly reduced BAK/BAX expression in mitochondria, as well as the BAX level in the cytoplasm. Cardioprotection is lost when CORM-2 is replaced by iCORM-2. CORM-2 treatment, at the time of reperfusion, was concluded to attenuate myocardial I/R-induced apoptosis. The protection mechanisms may be targeted to the mitochondria and involved in the inhibition of the BAK/BAX?mediated intrinsic pathway. PMID:24337106

  4. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    SciTech Connect

    Snyder-Talkington, Brandi N.; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R.; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L.


    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 ?g MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: A novel computational model identified toxicity pathways matching in vivo pathology. Systematic identification of MWCNT-induced biological processes in mouse lungs MWCNT-induced functional networks of lung inflammation and fibrosis were revealed. Two functional, representative genes, ccl2 and vegfa, were validated in vitro.

  5. Nitrogen fixation in boreal peatlands: the effects of increased N deposition on N2-fixation

    NASA Astrophysics Data System (ADS)

    Popma, J. M.; Wieder, R.; Lamers, L.; Vile, M. A.


    Boreal peatlands are of great importance to global carbon and nitrogen cycling. While covering only 3-4 % of the terrestrial surface, they account for 25-30 % of the world's soil C and 9-15 % of the world's soil N. In Western Canada atmospheric dry deposition rates are extremely low: approximately 1 kg N ha-1 yr-1. Though these systems have been functioning as net sinks over the past 11,000 years, natural and anthropogenic disturbances might compromise the historical balance of C and N. Biological N2-fixation has recently been shown to represent a very significant input of N into these systems, contributing to 62% of total N in Western Canada. Interactions between N deposition and biological N2-fixation are as yet, unknown, but the impact of elevated deposition of N-compounds from increased industrial expansion of oil sands mining to peatlands, is concerning. Given that nitrogenase, the enzyme responsible for catalyzing N2-fixation, is energetically costly when active, enhanced inputs of atmospheric N deposition could be a major determinant for enzyme activity and rates of biological N input to these bogs. Understanding interactions between N deposition and N2 fixation in boreal peatlands can aid in predicting the consequences of increased N deposition and setting critical loads. We conducted a field-fertilization experiment in a poor fen in Alberta, Canada, to determine the effects of enhanced N deposition on a dominant fen species Sphagnum angustifolium. The experiment consisted of seven N treatments: Control, 0, 5, 10, 15, 20 and 25 kg N ha-1 y1, n=3. N2-fixation was measured during summer 2012 and 2013 using the acetylene reduction assay (ARA). ARA rates were converted to rates of N2-fixation by calibrating ARA with paired 15N2-incubations. In both 2012 and 2013, with increasing N deposition from 0 kg N ha-1 yr-1 to 25 kg N ha-1 yr-1, rates of N2 fixation decreased, with highest rates in the 0 kg N ha-1 yr-1 treatment mosses (54.2 × 1.40; 48.58 × 7.12 kg N ha-1 yr-1, mean × std err for 2012 and 2013, respectively) followed by progressively lower rates with a low of 5.02 × 0.87 in 2012 and 8.94 × 3.09 in 2013 (mean × std err). As biological N2-fixation is an energetically costly process, up-regulating enzyme activity when N availability is low and down-regulating activity when N deposition is enhanced makes thermodynamic and evolutionary sense. N2-fixation shows to be one of the most early-warning indicators to the early response of boreal peatlands to increased N deposition, and can aid in setting critical loads to protect these historically pristine ecosystems.

  6. Specific inhibitors for identifying pathways for methane production from carbon monoxide by a nonadapted anaerobic mixed culture.


    Navarro, Silvia Sancho; Cimpoia, Ruxandra; Bruant, Guillaume; Guiot, Serge R


    Specific inhibitors such as 2-bromoethanesulfonate (BES) and vancomycin were employed in activity batch tests to decipher metabolic pathways that are preferentially used by a mixed anaerobic consortium (sludge from an anaerobic digester) to transform carbon monoxide (CO) into methane (CH4). We first evaluated the inhibitory effect of both BES and vancomycin on the microbial community, as well as the efficiency and stability of vancomycin at 35 C, over time. The activity tests with CO2-H2, CO, glucose, acetate, formate, propionate, butyrate, methanol, and ethanol showed that vancomycin does not inhibit some Gram-negative bacteria, and 50 mmol/L BES effectively blocks CH4 production in the sludge. However, when sludge was incubated with propionate, butyrate, methanol, or ethanol as the sole energy and carbon source, methanogenesis was only partially inhibited by BES. Separate tests showed that 0.07 mmol/L vancomycin is enough to maintain its inhibitory efficiency and stability in the population for at least 32 days at 35 C. Using the inhibitors above, it was demonstrated that CO conversion to CH4 is an indirect, 2-step process, in which the CO is converted first to acetate and subsequently to CH4. PMID:24896194

  7. Percutaneous fixation of scaphoid fractures.


    Slade, J F; Jaskwhich, D


    The scaphoid proximal pole and waist fractures presented here were treated by a novel dorsal percutaneous technique with arthroscopic assistance. All fractures healed, with good final functional results and no complications. The advantages of the dorsal percutaneous approach to scaphoid fixation are: (1) the proximal-to-distal placement of the guide pin and screw allow for more precise placement along the central axis of the scaphoid, which decreases healing time and reduces risk of screw thread exposure. (2) The dorsal approach avoids injuring the vulnerable volar ligament anatomy. And (3) the insertion of the screw from the proximal to distal direction allows the more rigid fixation of proximal scaphoid fractures. Arthroscopy allows confirmation of fracture reduction and screw implantation as well as evaluation of concurrent ligament injuries not detected with standard imaging. Percutaneous K-wires act as joysticks to reduce and compress fracture fragments prior to fixation. The presented technique allows for early, rigid internal fixation with minimal associated morbidity. Patients successfully treated with this technique include those with stable and unstable acute fractures of the scaphoid at all locations, including the proximal pole. Nondisplaced fractures that present with delayed or fibrous union without evidence of avascular necrosis, cyst formation, or bony sclerosis may also be treated with this technique. This technique allows for faster rehabilitation and an earlier return to work or avocation without restriction once CT scan confirms a solid union. Some articles document extraordinary rapid healing by standard radiographs; however, we caution that scaphoid bone healing cannot accurately be determined without CT scan. Percutaneous, arthroscopically assisted internal fixation by a dorsal approach may be considered in all acute scaphoid fractures selected for surgical fixation. The dorsal guidewire permits dorsal and volar implantation of a cannulated screw along the central axis of the scaphoid. This technique permits the reduction of displaced fractures and the stable repair of fractures of the proximal pole. In addition, selected scaphoid fibrous union or delayed union may also be repaired, with realistic expectations of healing. The proven benefits of the percutaneous technique include decreased soft tissue trauma; arthroscopic visualization of the fracture, ensuring anatomic reduction; and stable fixation, allowing early physical rehabilitation. The theoretical benefits of the technique include decreased risk of interruption of the tenuous scaphoid blood supply. Percutaneous internal fixation of scaphoid fractures provides faster rehabilitation, earlier return to work, and quicker bony union in most patients. PMID:11775468

  8. Hydrogen coupled CO2 fixation in legume cropping systems

    NASA Astrophysics Data System (ADS)

    Philpott, T.; Cen, Y.; Layzell, D. B.; Kyser, K.; Scott, N. A.


    Electron flow from oxidation of excess H2 released by root nodules was shown to contribute to microbial CO2 fixation in soybean crops. This discovery has important implications for carbon storage in soils used to grow legumes; however, further research is needed to understand the fate and turnover time of this H2-coupled CO2 fixation. Isotopic labeling of soil through incubation with 13CO2 was used to elucidate movement of sequestered carbon into soil carbon pools. Measurement of isotopic shifts was determined using Isotope Ratio Mass Spectrometry. Preliminary experiments have confirmed CO2 uptake through an isotopic shift (?13C -20.4 to -14.5 ) in 24 hour incubated soils labeled with 13CO2 (1% v/v, 99.5 Atom%) under elevated H2 concentration (6000 ppm). Other incubation experiments have confirmed the biotic nature of observed CO2 uptake by comparing isotopic shifts in oven dried and autoclaved soils to moist soil. Under an elevated H2 atmosphere, no significant isotopic shift was observed in dry and autoclaved soils whereas moist soil showed an isotopic shift of ?13C -21.9 to 11.4 over 48 hours. Future experiments will involve longer incubations (7 days) and will be aimed at determining isotopic shifts within soil carbon pools. Samples will be incubated and fractionated into microbial biomass, light fraction carbon, and acid stable carbon and subsequent isotopic analysis will be carried out. This will help determine the distribution of H2- coupled fixed CO2 within soil carbon pools and the turnover time of sequestered carbon. This and further research may lead to modification of greenhouse gas coefficients for leguminous crops that includes a CO2 fixation component.

  9. N2 fixation in eddies of the eastern tropical South Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Löscher, C. R.; Bourbonnais, A.; Dekaezemacker, J.; Charoenpong, C. N.; Altabet, M. A.; Bange, H. W.; Czeschel, R.; Hoffmann, C.; Schmitz, R. A.


    Mesoscale eddies play a major role in controlling ocean biogeochemistry. By impacting nutrient availability and water column ventilation, they are of critical importance for oceanic primary production. In the eastern tropical South Pacific Ocean off Peru, where a large and persistent oxygen deficient zone is present, mesoscale processes have been reported to occur frequently. However, investigations on their biological activity are mostly based on model simulations, and direct measurements of carbon and dinitrogen (N2) fixation are scarce. We examined an open ocean cyclonic eddy and two anticyclonic mode water eddies: a coastal one and an open ocean one in the waters off Peru along a section at 16° S in austral summer 2012. Molecular data and bioassay incubations point towards a difference between the active diazotrophic communities present in the cyclonic eddy and the anticyclonic mode water eddies. In the cyclonic eddy, highest rates of N2 fixation were measured in surface waters but no N2 fixation signal was detected at intermediate water depths. In contrast, both anticyclonic mode water eddies showed pronounced maxima in N2 fixation below the euphotic zone as evidenced by rate measurements and geochemical data. N2 fixation and carbon (C) fixation were higher in the young coastal mode water eddy compared to the older offshore mode water eddy. A co-occurrence between N2 fixation and biogenic N2, an indicator for N loss, indicated a link between N loss and N2 fixation in the mode water eddies, which was not observed for the cyclonic eddy. The comparison of two consecutive surveys of the coastal mode water eddy in November and December 2012 revealed also a reduction of N2 and C fixation at intermediate depths along with a reduction in chlorophyll by half, mirroring an aging effect in this eddy. Our data indicate an important role for anticyclonic mode water eddies in stimulating N2 fixation and thus supplying N offshore.

  10. Carbon isotopic composition of individual Precambrian microfossils

    NASA Technical Reports Server (NTRS)

    House, C. H.; Schopf, J. W.; McKeegan, K. D.; Coath, C. D.; Harrison, T. M.; Stetter, K. O.


    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

  11. Carbon isotopic composition of individual Precambrian microfossils.


    House, C H; Schopf, J W; McKeegan, K D; Coath, C D; Harrison, T M; Stetter, K O


    Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment. PMID:11543502

  12. Missing nitrogen fixation in the Benguela region

    NASA Astrophysics Data System (ADS)

    Wasmund, Norbert; Struck, Ulrich; Hansen, Anja; Flohr, Anita; Nausch, Günther; Grüttmüller, Annett; Voss, Maren


    Opposing opinions on the importance of nitrogen fixation in the northern Benguela upwelling region provoked us to investigate the magnitude of nitrogen fixation in front of northern Namibia and southern Angola. Measurements of nitrogen fixation rates using the 15N method at 66 stations during seven cruises from 2008 to 2014 showed that, in general, the 15N content in the biomass did not increase after tracer incubation with 15N2, indicating that no nitrogen fixation occurred. Correspondingly, the filamentous nitrogen-fixing cyanobacterium Trichodesmium was almost not present. The abundant picocyanobacteria did obviously not perform nitrogen fixation to a significant degree. The artificial improvement of conditions for nitrogen fixation in mesocosm experiments, including phosphate and iron additions and a warmer temperature, failed to induce nitrogen fixation. A plausible explanation of these findings is a lack of conditioned cells for nitrogen fixation in the Benguela region.

  13. NCI-Frederick PHL - Fixatives and Solutions

    Services Price List Courier Services & Shipment Procedures Scheduling Contact Information Related Links Establishing an Account PHL Forms Staff Publications PHL Portal Fixatives and Solutions Routine fixatives: 10% Neutral Buffered Formalin (NBF) 37

  14. Tricarboxylic Acid Cycle and One-Carbon Metabolism Pathways Are Important in Edwardsiella ictaluri Virulence

    PubMed Central

    Dahal, Neeti; Abdelhamed, Hossam; Lu, Jingjun; Karsi, Attila; Lawrence, Mark L.


    Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of channel catfish (ESC). The disease causes considerable economic losses in the commercial catfish industry in the United States. Although antibiotics are used as feed additive, vaccination is a better alternative for prevention of the disease. Here we report the development and characterization of novel live attenuated E. ictaluri mutants. To accomplish this, several tricarboxylic acid cycle (sdhC, mdh, and frdA) and one-carbon metabolism genes (gcvP and glyA) were deleted in wild type E. ictaluri strain 93-146 by allelic exchange. Following bioluminescence tagging of the E. ictaluri ΔsdhC, Δmdh, ΔfrdA, ΔgcvP, and ΔglyA mutants, their dissemination, attenuation, and vaccine efficacy were determined in catfish fingerlings by in vivo imaging technology. Immunogenicity of each mutant was also determined in catfish fingerlings. Results indicated that all of the E. ictaluri mutants were attenuated significantly in catfish compared to the parent strain as evidenced by 2,265-fold average reduction in bioluminescence signal from all the mutants at 144 h post-infection. Catfish immunized with the E. ictaluri ΔsdhC, Δmdh, ΔfrdA, and ΔglyA mutants had 100% relative percent survival (RPS), while E. ictaluri ΔgcvP vaccinated catfish had 31.23% RPS after re-challenge with the wild type E. ictaluri. PMID:23762452

  15. Liquiritigenin Protects Rats from Carbon Tetrachloride Induced Hepatic Injury through PGC-1? Pathway

    PubMed Central

    Zhang, Yiping; He, Yuanqiao; Yu, Hongbo; Ma, Fuying; Wu, Jianguo; Zhang, Xiaoyu


    The lack of effective treatment for liver cirrhosis and hepatocellular carcinomas imposes serious challenges to the healthcare system. Here, we investigated the efficacy and mechanism of liquiritigenin involved in preventing or retarding the progression of liver diseases in a rat model with chronic carbon tetrachloride (CCl4) exposure. Sprague Dawley rats were given CCl4 and lliquiritigenin alone or simultaneously for 8 weeks before liver was harvested to check histological changes by Hematoxylin and Eosin (H&E) staining, apoptosis by TUNEL assay, ROS by dihydroethidium staining, antioxidant enzyme activities and malondialdehyde using specific kits, and gene expression by quantitative real-time PCR and western blot. Chronic CCl4 exposure caused profound changes in liver histology with extensive hepatocyte death (necrosis and apoptosis), fat accumulation, and infiltration of inflammatory cells, accompanied by depressed activities of antioxidant enzymes, increased oxidative stress, elevated expression of inflammation and fibrotic genes, and downregulation of PGC-1?, ND1, and Bcl-x in rat liver. All these changes were abolished or alleviated by lliquiritigenin. The results demonstrated that liquiritigenin is effective in protecting liver from injury or treating chronic liver diseases. The modulation of PGC-1? and its downstream genes might play a critical role in relieving CCl4-induced hepatic pathogenesis by liquiritigenin. PMID:26199636

  16. Transit Fixatives: An Innovative Study

    PubMed Central

    A, Ravi Prakash; G, Sreenath; JK, Sonia Bai; NDVN, Shyam


    Background: Universally accepted fixative is 10% formalin which has been used for preserving the tissues and their architecture. In certain conditions, formalin might not be readily available for immediate fixation. We here by explore more economical, eco-friendly and easily available solutions that can be used as transit media/ transporting media for tissue specimens. Materials and Methods: The study included commonly available solutions like Spirit, Saline, Betadine solution, Hydrogen peroxide (H2O2), Local anesthesia (L.A), Rose water, Coconut oil, Coconut water, Ice cold water, Honey and Milk while keeping formalin as control. The fresh tissue sample was cut into multiple bits and placed in different containers for a period of 8 hours before transferring to formalin solution. Conclusion: Transit fixatives are very important in certain situations where formalin is not readily available. These fixatives can be used to fix the tissues for a period of at least 8 hours without causing any damage or distortion before they are fixed in formalin solution. PMID:25954725

  17. Weakly Supervised Human Fixations Prediction.


    Zhang, Luming; Li, Xuelong; Nie, Liqiang; Yang, Yi; Xia, Yingjie


    Automatically predicting human eye fixations is a useful technique that can facilitate many multimedia applications, e.g., image retrieval, action recognition, and photo retargeting. Conventional approaches are frustrated by two drawbacks. First, psychophysical experiments show that an object-level interpretation of scenes influences eye movements significantly. Most of the existing saliency models rely on object detectors, and therefore, only a few prespecified categories can be discovered. Second, the relative displacement of objects influences their saliency remarkably, but current models cannot describe them explicitly. To solve these problems, this paper proposes weakly supervised fixations prediction, which leverages image labels to improve accuracy of human fixations prediction. The proposed model hierarchically discovers objects as well as their spatial configurations. Starting from the raw image pixels, we sample superpixels in an image, thereby seamless object descriptors termed object-level graphlets (oGLs) are generated by random walking on the superpixel mosaic. Then, a manifold embedding algorithm is proposed to encode image labels into oGLs, and the response map of each prespecified object is computed accordingly. On the basis of the object-level response map, we propose spatial-level graphlets (sGLs) to model the relative positions among objects. Afterward, eye tracking data is employed to integrate these sGLs for predicting human eye fixations. Thorough experiment results demonstrate the advantage of the proposed method over the state-of-the-art. PMID:26168451

  18. System-based Identification of Toxicity Pathways Associated With Multi-Walled Carbon Nanotube-Induced Pathological Responses

    PubMed Central

    Snyder-Talkington, Brandi N.; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R.; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L.


    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 g MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and were used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. PMID:23845593

  19. Carbon monoxide alleviates ethanol-induced oxidative damage and inflammatory stress through activating p38 MAPK pathway.


    Li, Yanyan; Gao, Chao; Shi, Yanru; Tang, Yuhan; Liu, Liang; Xiong, Ting; Du, Min; Xing, Mingyou; Liu, Liegang; Yao, Ping


    Stress-inducible protein heme oxygenase-1(HO-1) is well-appreciative to counteract oxidative damage and inflammatory stress involving the pathogenesis of alcoholic liver diseases (ALD). The potential role and signaling pathways of HO-1 metabolite carbon monoxide (CO), however, still remained unclear. To explore the precise mechanisms, ethanol-dosed adult male Balb/c mice (5.0g/ or ethanol-incubated primary rat hepatocytes (100mmol/L) were pretreated by tricarbonyldichlororuthenium (II) dimmer (CORM-2, 8mg/kg for mice or 20μmol/L for hepatocytes), as well as other pharmacological reagents. Our data showed that CO released from HO-1 induction by quercetin prevented ethanol-derived oxidative injury, which was abolished by CO scavenger hemoglobin. The protection was mimicked by CORM-2 with the attenuation of GSH depletion, SOD inactivation, MDA overproduction, and the leakage of AST, ALT or LDH in serum and culture medium induced by ethanol. Moreover, CORM-2 injection or incubation stimulated p38 phosphorylation and suppressed abnormal Tnfa and IL-6, accompanying the alleviation of redox imbalance induced by ethanol and aggravated by inflammatory factors. The protective role of CORM-2 was abolished by SB203580 (p38 inhibitor) but not by PD98059 (ERK inhibitor) or SP600125 (JNK inhibitor). Thus, HO-1 released CO prevented ethanol-elicited hepatic oxidative damage and inflammatory stress through activating p38 MAPK pathway, suggesting a potential therapeutic role of gaseous signal molecule on ALD induced by naturally occurring phytochemicals. PMID:23994557

  20. Carbon monoxide alleviates ethanol-induced oxidative damage and inflammatory stress through activating p38 MAPK pathway

    SciTech Connect

    Li, Yanyan; Gao, Chao; Shi, Yanru; Tang, Yuhan; Liu, Liang; Xiong, Ting; Du, Min; Xing, Mingyou; Liu, Liegang; Yao, Ping


    Stress-inducible protein heme oxygenase-1(HO-1) is well-appreciative to counteract oxidative damage and inflammatory stress involving the pathogenesis of alcoholic liver diseases (ALD). The potential role and signaling pathways of HO-1 metabolite carbon monoxide (CO), however, still remained unclear. To explore the precise mechanisms, ethanol-dosed adult male Balb/c mice (5.0 g/ or ethanol-incubated primary rat hepatocytes (100 mmol/L) were pretreated by tricarbonyldichlororuthenium (II) dimmer (CORM-2, 8 mg/kg for mice or 20 μmol/L for hepatocytes), as well as other pharmacological reagents. Our data showed that CO released from HO-1 induction by quercetin prevented ethanol-derived oxidative injury, which was abolished by CO scavenger hemoglobin. The protection was mimicked by CORM-2 with the attenuation of GSH depletion, SOD inactivation, MDA overproduction, and the leakage of AST, ALT or LDH in serum and culture medium induced by ethanol. Moreover, CORM-2 injection or incubation stimulated p38 phosphorylation and suppressed abnormal Tnfa and IL-6, accompanying the alleviation of redox imbalance induced by ethanol and aggravated by inflammatory factors. The protective role of CORM-2 was abolished by SB203580 (p38 inhibitor) but not by PD98059 (ERK inhibitor) or SP600125 (JNK inhibitor). Thus, HO-1 released CO prevented ethanol-elicited hepatic oxidative damage and inflammatory stress through activating p38 MAPK pathway, suggesting a potential therapeutic role of gaseous signal molecule on ALD induced by naturally occurring phytochemicals. - Highlights: • CO alleviated ethanol-derived liver oxidative and inflammatory stress in mice. • CO eased ethanol and inflammatory factor-induced oxidative damage in hepatocytes. • The p38 MAPK is a key signaling mechanism for the protective function of CO in ALD.

  1. Cognitive deficits induced by multi-walled carbon nanotubes via the autophagic pathway.


    Gao, Jing; Zhang, Xiaochen; Yu, Mei; Ren, Guogang; Yang, Zhuo


    Multi-walled carbon nanotubes (MWCNTs) have shown potential applications in many fields, especially in the field of biomedicine. Several studies have reported that MWCNTs induce apoptosis and oxidative damage in nerve cells during in vitro experiments. However, there are few studies focused on the neurotoxicity of MWCNTs used in vivo. Many studies have reported that autophagy, a cellular stress response to degrade damaged cell components, can be activated by diverse nanoparticles. In this study, we investigated the neurotoxic effects of MWCNTs on hippocampal synaptic plasticity and spatial cognition in rats. Then, we used an inhibitor of autophagy called chloroquine (CQ) to examine whether autophagy plays an important role in hippocampal synaptic plasticity, since this was damaged by MWCNTs. In this study, adult male Wister rats were randomly divided into three groups: a control group, a group treated with MWCNTs (2.5mg/kg/day) and a group treated with MWCNTs+CQ (20mg/kg/day). After two-weeks of intraperitoneal (i.p.) injections, rats were subjected to the Morris water maze (MWM) test, and the long-term potentiation (LTP) and other biochemical parameters were determined. Results showed that MWCNTs could induce cognitive deficits, histopathological alteration and changes of autophagy level (increased the ratio of LC3 II /LC3 I and the expression of Beclin-1). Furthermore, we found that CQ could suppress MWCNTs-induced autophagic flux and partly rescue the synapse deficits, which occurred with the down-regulation of NR2B (a subunit of NMDA receptor) and synaptophysin (SYP) in the hippocampus. Our results suggest that MWCNTs could induce cognitive deficits in vivo via the increased autophagic levels, and provide a potential strategy to avoid the adverse effects of MWCNTs. PMID:26327526

  2. Binocular Fixation Disparity in Single Word Displays

    ERIC Educational Resources Information Center

    Paterson, Kevin B.; Jordan, Timothy R.; Kurtev, Stoyan


    It has been claimed that the recognition of words displayed in isolation is affected by the precise location at which they are fixated. However, this putative role for fixation location has yet to be reconciled with the finding from reading research that binocular fixations are often misaligned and, therefore, more than 1 location in a word is

  3. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A fixation device is an AC-powered device intended for...

  4. Pathways and transformations of dissolved methane and dissolved inorganic carbon in Arctic tundra watersheds: Evidence from analysis of stable isotopes

    NASA Astrophysics Data System (ADS)

    Throckmorton, Heather M.; Heikoop, Jeffrey M.; Newman, Brent D.; Altmann, Garrett L.; Conrad, Mark S.; Muss, Jordan D.; Perkins, George B.; Smith, Lydia J.; Torn, Margaret S.; Wullschleger, Stan D.; Wilson, Cathy J.


    Arctic soils contain a large pool of terrestrial C and are of interest due to their potential for releasing significant carbon dioxide (CO2) and methane (CH4) to the atmosphere. Due to substantial landscape heterogeneity, predicting ecosystem-scale CH4 and CO2 production is challenging. This study assessed dissolved inorganic carbon (DIC = Σ (total) dissolved CO2) and CH4 in watershed drainages in Barrow, Alaska as critical convergent zones of regional geochemistry, substrates, and nutrients. In July and September of 2013, surface waters and saturated subsurface pore waters were collected from 17 drainages. Based on simultaneous DIC and CH4 cycling, we synthesized isotopic and geochemical methods to develop a subsurface CH4 and DIC balance by estimating mechanisms of CH4 and DIC production and transport pathways and oxidation of subsurface CH4. We observed a shift from acetoclastic (July) toward hydrogenotropic (September) methanogenesis at sites located toward the end of major freshwater drainages, adjacent to salty estuarine waters, suggesting an interesting landscape-scale effect on CH4 production mechanism. The majority of subsurface CH4 was transported upward by plant-mediated transport and ebullition, predominantly bypassing the potential for CH4 oxidation. Thus, surprisingly, CH4 oxidation only consumed approximately 2.51 ± 0.82% (July) and 0.79 ± 0.79% (September) of CH4 produced at the frost table, contributing to <0.1% of DIC production. DIC was primarily produced from respiration, with iron and organic matter serving as likely e- acceptors. This work highlights the importance of spatial and temporal variability of CH4 production at the watershed scale and suggests broad scale investigations are required to build better regional or pan-Arctic representations of CH4 and CO2 production.

  5. Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre

    PubMed Central

    Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel MM


    Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N2-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N2-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200?m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of 15N-labeled ammonium and leucine in our incubation experiments. N2-fixation was detectable throughout the upper 200?m at most stations, with rates ranging from 0.001 to 0.19?nM?N?h?1. N2-fixation in the SPG may account for the production of 820% of global oceanic new nitrogen. Interestingly, comparable 15N2-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

  6. Changes in North Atlantic nitrogen fixation controlled by ocean circulation.


    Straub, Marietta; Sigman, Daniel M; Ren, Haojia; Martnez-Garca, Alfredo; Meckler, A Nele; Hain, Mathis P; Haug, Gerald H


    In the ocean, the chemical forms of nitrogen that are readily available for biological use (known collectively as 'fixed' nitrogen) fuel the global phytoplankton productivity that exports carbon to the deep ocean. Accordingly, variation in the oceanic fixed nitrogen reservoir has been proposed as a cause of glacial-interglacial changes in atmospheric carbon dioxide concentration. Marine nitrogen fixation, which produces most of the ocean's fixed nitrogen, is thought to be affected by multiple factors, including ocean temperature and the availability of iron and phosphorus. Here we reconstruct changes in North Atlantic nitrogen fixation over the past 160,000?years from the shell-bound nitrogen isotope ratio ((15)N/(14)N) of planktonic foraminifera in Caribbean Sea sediments. The observed changes cannot be explained by reconstructed changes in temperature, the supply of (iron-bearing) dust or water column denitrification. We identify a strong, roughly 23,000-year cycle in nitrogen fixation and suggest that it is a response to orbitally driven changes in equatorial Atlantic upwelling, which imports 'excess' phosphorus (phosphorus in stoichiometric excess of fixed nitrogen) into the tropical North Atlantic surface. In addition, we find that nitrogen fixation was reduced during glacial stages 6 and 4, when North Atlantic Deep Water had shoaled to become glacial North Atlantic intermediate water, which isolated the Atlantic thermocline from excess phosphorus-rich mid-depth waters that today enter from the Southern Ocean. Although modern studies have yielded diverse views of the controls on nitrogen fixation, our palaeobiogeochemical data suggest that excess phosphorus is the master variable in the North Atlantic Ocean and indicate that the variations in its supply over the most recent glacial cycle were dominated by the response of regional ocean circulation to the orbital cycles. PMID:23965620

  7. Levels of Daily Light Doses Under Changed Day-Night Cycles Regulate Temporal Segregation of Photosynthesis and N2 Fixation in the Cyanobacterium Trichodesmium erythraeum IMS101

    PubMed Central

    Cai, Xiaoni; Gao, Kunshan


    While the diazotrophic cyanobacterium Trichodesmium is known to display inverse diurnal performances of photosynthesis and N2 fixation, such a phenomenon has not been well documented under different day-night (L-D) cycles and different levels of light dose exposed to the cells. Here, we show differences in growth, N2 fixation and photosynthetic carbon fixation as well as photochemical performances of Trichodesmium IMS101 grown under 12L:12D, 8L:16D and 16L:8D L-D cycles at 70 μmol photons m-2 s-1 PAR (LL) and 350 μmol photons m-2 s-1 PAR (HL). The specific growth rate was the highest under LL and the lowest under HL under 16L:8D, and it increased under LL and decreased under HL with increased levels of daytime light doses exposed under the different light regimes, respectively. N2 fixation and photosynthetic carbon fixation were affected differentially by changes in the day-night regimes, with the former increasing directly under LL with increased daytime light doses and decreased under HL over growth-saturating light levels. Temporal segregation of N2 fixation from photosynthetic carbon fixation was evidenced under all day-night regimes, showing a time lag between the peak in N2 fixation and dip in carbon fixation. Elongation of light period led to higher N2 fixation rate under LL than under HL, while shortening the light exposure to 8 h delayed the N2 fixation peaking time (at the end of light period) and extended it to night period. Photosynthetic carbon fixation rates and transfer of light photons were always higher under HL than LL, regardless of the day-night cycles. Conclusively, diel performance of N2 fixation possesses functional plasticity, which was regulated by levels of light energy supplies either via changing light levels or length of light exposure. PMID:26258473

  8. Inhibition of MAPK and NF-κB signaling pathways alleviate carbon tetrachloride (CCl4)-induced liver fibrosis in Toll-like receptor 5 (TLR5) deficiency mice.


    Shu, Ming; Huang, Dan-Dan; Hung, Zuo-An; Hu, Xiao-Rong; Zhang, Shun


    Current researches showed that TLR family plays an important role in liver fibrosis, yet the molecular mechanism by which this occurs is not fully explained. In this study, we investigated the role of TLR5 in carbon tetrachloride-induced liver fibrosis, and further examined wether TLR5 knockout attenuated tetrachloride-induced liver fibrosis by inhibiting hepatic stellate cells activation via modulating NF-κB and MAPK signaling pathways. Our results found that carbon tetrachloride induced liver function injury in WT mice with a inflammatory responses through the activation of NF-κB and MAPK signaling pathways, resulting in hepatic stellate cells activation. In contrast, TLR5 deficiency mice after carbon tetrachloride administration reduced NF-κB and MAPK signaling pathways activation, which down regulated hepatic stellate cells activation. In addition, alpha smooth muscle-actin as marker of hepatic stellate cells further indicated that TLR5 knockout mice have a lower collagen accumulation in liver tissue than WT mice after carbon tetrachloride administration, resulting in inhibition of NF-κB and MAPK signaling pathways activation. Moreover, in vitro experiment of hepatic stellate cells challenged with LPS or TGF-β, further indicated that NF-κB and MAPK were involved in liver fibrosis development, leading to α-SMA expression and inflammation infiltration. However, cells from TLR5(-)(/-) may weaken phosphorylation levels of signal pathways, finally suppress progress of collagen accumulation and inflammatory responses. These results suggest a new therapeutic approach or target to protect against fibrosis caused by chronic liver diseases. PMID:26845355

  9. N-acetylcysteine protects against liver injure induced by carbon tetrachloride via activation of the Nrf2/HO-1 pathway

    PubMed Central

    Cai, Zhaobin; Lou, Qi; Wang, Fugen; Li, Er; Sun, Jingjing; Fang, Hongying; Xi, Jianjun; Ju, Liping


    Chronic liver injury is an important clinical problem which eventually leads to cirrhosis, hepatocellular carcinoma and end-stage liver failure. It is well known that cell damage induced by reactive oxygen species (ROS) is an important mechanism of hepatocyte injure. N-acetylcysteine (NAC), a precursor of glutathione (GSH), is well-known role as the antidote to acetaminophen toxicity in clinic. NAC is now being utilized more widely in the clinical setting for non-acetaminophen (APAP) related causes of liver injure. However, the mechanisms underlying its beneficial effects are poorly defined. Thus, Aim of the present study was to investigate potential hepatic protective role of NAC and to delineate its mechanism of action against carbon tetrachloride (CCl4)-induced liver injury in models of rat. Our results showed that the alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities as well as malondialdehyde (MDA) contents decreased significantly in CCl4-induced rats with NAC treatment. GSH content and superoxide dismutase (SOD) activities remarkably increased in the NAC groups compared with those in CCl4-induced group. Treatment with NAC had been shown to an increase in nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) mRNA levels. In conclusion, these results suggested that NAC upregulated HO-1 through the activation of Nrf2 pathway and protected rat against CCl4-induced liver injure. The results of this study provided pharmacological evidence to support the clinical application of NAC. PMID:26339453


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Malate is crucial for symbiotic dinitrogen (N2) fixation, occurring in high concentrations in N2-fixing nodules as the major carbon source for bacteroid respiration. Malate also provides carbon skeletons for the assimilation of fixed nitrogen from ammonia into amino acids and is proposed to be invol...

  11. Fixation strategies for retinal immunohistochemistry.


    Stradleigh, Tyler W; Ishida, Andrew T


    Immunohistochemical and ex vivo anatomical studies have provided many glimpses of the variety, distribution, and signaling components of vertebrate retinal neurons. The beauty of numerous images published to date, and the qualitative and quantitative information they provide, indicate that these approaches are fundamentally useful. However, obtaining these images entailed tissue handling and exposure to chemical solutions that differ from normal extracellular fluid in composition, temperature, and osmolarity. Because the differences are large enough to alter intercellular and intracellular signaling in neurons, and because retinae are susceptible to crush, shear, and fray, it is natural to wonder if immunohistochemical and anatomical methods disturb or damage the cells they are designed to examine. Tissue fixation is typically incorporated to guard against this damage and is therefore critically important to the quality and significance of the harvested data. Here, we describe mechanisms of fixation; advantages and disadvantages of using formaldehyde and glutaraldehyde as fixatives during immunohistochemistry; and modifications of widely used protocols that have recently been found to improve cell shape preservation and immunostaining patterns, especially in proximal retinal neurons. PMID:25892361

  12. Analysis of Sensitive CO2 Pathways and Genes Related to Carbon Uptake and Accumulation in Chlamydomonas reinhardtii through Genomic Scale Modeling and Experimental Validation.


    Winck, Flavia V; Melo, David O Pez; Riao-Pachn, Diego M; Martins, Marina C M; Caldana, Camila; Barrios, Andrs F Gonzlez


    The development of microalgae sustainable applications needs better understanding of microalgae biology. Moreover, how cells coordinate their metabolism toward biomass accumulation is not fully understood. In this present study, flux balance analysis (FBA) was performed to identify sensitive metabolic pathways of Chlamydomonas reinhardtii under varied CO2 inputs. The metabolic network model of Chlamydomonas was updated based on the genome annotation data and sensitivity analysis revealed CO2 sensitive reactions. Biological experiments were performed with cells cultivated at 0.04% (air), 2.5, 5, 8, and 10% CO2 concentration under controlled conditions and cell growth profiles and biomass content were measured. Pigments, lipids, proteins, and starch were further quantified for the reference low (0.04%) and high (10%) CO2 conditions. The expression level of candidate genes of sensitive reactions was measured and validated by quantitative real time PCR. The sensitive analysis revealed mitochondrial compartment as the major affected by changes on the CO2 concentrations and glycolysis/gluconeogenesis, glyoxylate, and dicarboxylate metabolism among the affected metabolic pathways. Genes coding for glycerate kinase (GLYK), glycine cleavage system, H-protein (GCSH), NAD-dependent malate dehydrogenase (MDH3), low-CO2 inducible protein A (LCIA), carbonic anhydrase 5 (CAH5), E1 component, alpha subunit (PDC3), dual function alcohol dehydrogenase/acetaldehyde dehydrogenase (ADH1), and phosphoglucomutase (GPM2), were defined, among other genes, as sensitive nodes in the metabolic network simulations. These genes were experimentally responsive to the changes in the carbon fluxes in the system. We performed metabolomics analysis using mass spectrometry validating the modulation of carbon dioxide responsive pathways and metabolites. The changes on CO2 levels mostly affected the metabolism of amino acids found in the photorespiration pathway. Our updated metabolic network was compared to previous model and it showed more consistent results once considering the experimental data. Possible roles of the sensitive pathways in the biomass metabolism are discussed. PMID:26904035

  13. Analysis of Sensitive CO2 Pathways and Genes Related to Carbon Uptake and Accumulation in Chlamydomonas reinhardtii through Genomic Scale Modeling and Experimental Validation

    PubMed Central

    Winck, Flavia V.; Melo, David O. Páez; Riaño-Pachón, Diego M.; Martins, Marina C. M.; Caldana, Camila; Barrios, Andrés F. González


    The development of microalgae sustainable applications needs better understanding of microalgae biology. Moreover, how cells coordinate their metabolism toward biomass accumulation is not fully understood. In this present study, flux balance analysis (FBA) was performed to identify sensitive metabolic pathways of Chlamydomonas reinhardtii under varied CO2 inputs. The metabolic network model of Chlamydomonas was updated based on the genome annotation data and sensitivity analysis revealed CO2 sensitive reactions. Biological experiments were performed with cells cultivated at 0.04% (air), 2.5, 5, 8, and 10% CO2 concentration under controlled conditions and cell growth profiles and biomass content were measured. Pigments, lipids, proteins, and starch were further quantified for the reference low (0.04%) and high (10%) CO2 conditions. The expression level of candidate genes of sensitive reactions was measured and validated by quantitative real time PCR. The sensitive analysis revealed mitochondrial compartment as the major affected by changes on the CO2 concentrations and glycolysis/gluconeogenesis, glyoxylate, and dicarboxylate metabolism among the affected metabolic pathways. Genes coding for glycerate kinase (GLYK), glycine cleavage system, H-protein (GCSH), NAD-dependent malate dehydrogenase (MDH3), low-CO2 inducible protein A (LCIA), carbonic anhydrase 5 (CAH5), E1 component, alpha subunit (PDC3), dual function alcohol dehydrogenase/acetaldehyde dehydrogenase (ADH1), and phosphoglucomutase (GPM2), were defined, among other genes, as sensitive nodes in the metabolic network simulations. These genes were experimentally responsive to the changes in the carbon fluxes in the system. We performed metabolomics analysis using mass spectrometry validating the modulation of carbon dioxide responsive pathways and metabolites. The changes on CO2 levels mostly affected the metabolism of amino acids found in the photorespiration pathway. Our updated metabolic network was compared to previous model and it showed more consistent results once considering the experimental data. Possible roles of the sensitive pathways in the biomass metabolism are discussed. PMID:26904035

  14. Life in hot acid: Pathway analyses in extremely thermoacidophilic archaea

    PubMed Central

    Auernik, Kathryne S.; Cooper, Charlotte R.; Kelly, Robert M.


    SUMMARY The extremely thermoacidophilic archaea are a particularly intriguing group of microorganisms that must simultaneously cope with biologically extreme pHs (? 4) and temperatures (Topt ? 60C) in their natural environments. Their expandi ng biotechnological significance relates to their role in biomining of base and precious metals and their unique mechanisms of survival in hot acid, at both the cellular and biomolecular levels. Recent developments, such as advances in understanding of heavy metal tolerance mechanisms, implementation of a genetic system, and discovery of a new carbon fixation pathway, have been facilitated by availability of genome sequence data and molecular genetic systems. As a result, new insights into the metabolic pathways and physiological features that define extreme thermoacidophily have been obtained, in some cases suggesting prospects for biotechnological opportunities. PMID:18760359

  15. Tissue fixation and the effect of molecular fixatives on downstream staining procedures

    PubMed Central

    Howat, William J.; Wilson, Beverley A.


    It is impossible to underplay the importance of fixation in histopathology. Whether the scientist is interested in the extraction of information on lipids, proteins, RNA or DNA, fixation is critical to this extraction. This review aims to give a brief overview of the current “state of play” in fixation and focus on the effect fixation, and particularly the effect of the newer brand of “molecular fixatives” have on morphology, histochemistry, immunohistochemistry and RNA/DNA analysis. A methodology incorporating the creation of a fixation tissue microarray for the study of the effect of fixation on histochemistry is detailed. PMID:24561827

  16. Evolution of fracture and fault-controlled fluid pathways in carbonates of the Albanides fold-thrust belt

    USGS Publications Warehouse

    Graham, Wall B.R.; Girbacea, R.; Mesonjesi, A.; Aydin, A.


    The process of fracture and fault formation in carbonates of the Albanides fold-thrust belt has been systematically documented using hierarchical development of structural elements from hand sample, outcrop, and geologic-map scales. The function of fractures and faults in fluid migration was elucidated using calcite cement and bitumen in these structures as a paleoflow indicator. Two prefolding pressure-solution and vein assemblages were identified: an overburden assemblage and a remote tectonic stress assemblage. Sheared layer-parallel pressure-solution surfaces of the overburden assemblage define mechanical layers. Shearing of mechanical layers associated with folding resulted in the formation of a series of folding assemblage fractures at different orientations, depending on the slip direction of individual mechanical layers. Prefolding- and folding-related fracture assemblages together formed fragmentation zones in mechanical layers and are the sites of incipient fault localization. Further deformation along these sites was accommodated by rotation and translation of fragmented rock, which formed breccia and facilitated fault offset across multiple mechanical layers. Strike-slip faults formed by this process are organized in two sets in an apparent conjugate pattern. Calcite cement and bitumen that accumulated along fractures and faults are evidence of localized fluid flow along fault zones. By systematic identification of fractures and faults, their evolution, and their fluid and bitumen contents, along with subsurface core and well-log data, we identify northeast-southwest-trending strike-slip faults and the associated structures as dominant fluid pathways in the Albanides fold-thrust belt. Copyright ?? 2006. The American Association of Petroleum Geologists. All rights reserved.

  17. Polymorphism in one-carbon metabolism pathway affects survival of gastric cancer patients: Large and comprehensive study.


    Zhao, Tingting; Gu, Dongying; Xu, Zhi; Huo, Xinying; Shen, Lili; Wang, Chun; Tang, Yongfei; Wu, Peng; He, Jason; Gong, Weida; He, Ming-Liang; Chen, Jinfei


    Although it has been shown that polymorphisms in one-carbon metabolism (OCM) pathway are associated with gastric cancer (GC), their interactions and contributions for patients' survival are elusive. In this study, we investigated the effects of polymorphisms and their interactions on the survival of GC patients, including genes of Methylenetetrahydrofolate reductase (MTHFR 677C > T, 1298A > C), Methionine synthase reductase (MTRR 66A > G), Methionine synthase (MTR 2756A > G), and Thymidylate synthase (TS 3'-UTR ins6 > del6, 5'-UTR 2R > 3R). We recruited 919 GC patients from 1998 to 2006. The Kaplan-Meier plots, Cox regression analyses and the log-rank tests were carried out in this study. MTHFR 1298CC genotype showed protective effect (HR = 0.444, 95% CI = 0.210-0.940). MTRR 66 GA + GG genotypes decreased the risk of death (HR = 0.793, 95% CI = 0.651-0.967) in general, and in subgroups with more pronounced diffuse type, greater depth of invasion (T2/T3/T4), higher level lymph node metastasis (N1/N2/N3), advanced TNM stages (II/III level) and 5-Fu treatment. However, the improved survival disappeared when GC patients simultaneously had MTR 2756 GA + GG genotypes (HR = 1.063, 95% CI = 0.750-1.507). Although MTRR 66GA genotype was not associated with the survival of GC patients, patients with simultaneous MTRR 66GA and MTR 2756AA genotypes exhibited significant risk reduction of death (HR = 0.773, 95% CI = 0.609-0.981). MTHFR 1298 CA + CC combined with TS 5-UTR 2R3R + 3R3R genotypes (HR = 0.536, 95% CI = 0.315-0.913) also increased patient survival rates. Our results suggest that the MTRR 66A > G and MTHFR 1298A > C polymorphisms may be useful prognostic biomarkers for GC patients. PMID:25840420

  18. Polymorphism in one-carbon metabolism pathway affects survival of gastric cancer patients: Large and comprehensive study

    PubMed Central

    Huo, Xinying; Shen, Lili; Wang, Chun; Tang, Yongfei; Wu, Peng; He, Jason; Gong, Weida; He, Ming-Liang; Chen, Jinfei


    Although it has been shown that polymorphisms in one-carbon metabolism (OCM) pathway are associated with gastric cancer (GC), their interactions and contributions for patients survival are elusive. In this study, we investigated the effects of polymorphisms and their interactions on the survival of GC patients, including genes of Methylenetetrahydrofolate reductase (MTHFR 677C > T, 1298A > C), Methionine synthase reductase (MTRR 66A > G), Methionine synthase (MTR 2756A > G), and Thymidylate synthase (TS 3?-UTR ins6 > del6, 5?-UTR 2R > 3R). We recruited 919 GC patients from 1998 to 2006. The KaplanMeier plots, Cox regression analyses and the log-rank tests were carried out in this study. MTHFR 1298CC genotype showed protective effect (HR = 0.444, 95% CI = 0.2100.940). MTRR 66 GA + GG genotypes decreased the risk of death (HR = 0.793, 95% CI = 0.6510.967) in general, and in subgroups with more pronounced diffuse type, greater depth of invasion (T2/T3/T4), higher level lymph node metastasis (N1/N2/N3), advanced TNM stages (II/III level) and 5-Fu treatment. However, the improved survival disappeared when GC patients simultaneously had MTR 2756 GA + GG genotypes (HR = 1.063, 95% CI = 0.7501.507). Although MTRR 66GA genotype was not associated with the survival of GC patients, patients with simultaneous MTRR 66GA and MTR 2756AA genotypes exhibited significant risk reduction of death (HR = 0.773, 95% CI = 0.6090.981). MTHFR 1298 CA + CC combined with TS 5-UTR 2R3R + 3R3R genotypes (HR = 0.536, 95% CI = 0.3150.913) also increased patient survival rates. Our results suggest that the MTRR 66A > G and MTHFR 1298A > C polymorphisms may be useful prognostic biomarkers for GC patients. PMID:25840420

  19. Metabolite Profile Analysis Reveals Functional Effects of 28-Day Vitamin B-6 Restriction on One-Carbon Metabolism and Tryptophan Catabolic Pathways in Healthy Men and Women123

    PubMed Central

    da Silva, Vanessa R.; Rios-Avila, Luisa; Lamers, Yvonne; Ralat, Maria A.; Midttun, ivind; Quinlivan, Eoin P.; Garrett, Timothy J.; Coats, Bonnie; Shankar, Meena N.; Percival, Susan S.; Chi, Yueh-Yun; Muller, Keith E.; Ueland, Per Magne; Stacpoole, Peter W.; Gregory, Jesse F.


    Suboptimal vitamin B-6 status, as reflected by low plasma pyridoxal 5?-phosphate (PLP) concentration, is associated with increased risk of vascular disease. PLP plays many roles, including in one-carbon metabolism for the acquisition and transfer of carbon units and in the transsulfuration pathway. PLP also serves as a coenzyme in the catabolism of tryptophan. We hypothesize that the pattern of these metabolites can provide information reflecting the functional impact of marginal vitamin B-6 deficiency. We report here the concentration of major constituents of one-carbon metabolic processes and the tryptophan catabolic pathway in plasma from 23 healthy men and women before and after a 28-d controlled dietary vitamin B-6 restriction (<0.35 mg/d). liquid chromatography-tandem mass spectrometry analysis of the compounds relevant to one-carbon metabolism showed that vitamin B-6 restriction yielded increased cystathionine (53% pre- and 76% postprandial; P < 0.0001) and serine (12% preprandial; P < 0.05), and lower creatine (40% pre- and postprandial; P < 0.0001), creatinine (9% postprandial; P < 0.05), and dimethylglycine (16% postprandial; P < 0.05) relative to the vitamin B-6adequate state. In the tryptophan pathway, vitamin B-6 restriction yielded lower kynurenic acid (22% pre- and 20% postprandial; P < 0.01) and higher 3-hydroxykynurenine (39% pre- and 34% postprandial; P < 0.01). Multivariate ANOVA analysis showed a significant global effect of vitamin B-6 restriction and multilevel partial least squares-discriminant analysis supported this conclusion. Thus, plasma concentrations of creatine, cystathionine, kynurenic acid, and 3-hydroxykynurenine jointly reveal effects of vitamin B-6 restriction on the profiles of one-carbon and tryptophan metabolites and serve as biomarkers of functional effects of marginal vitamin B-6 deficiency. PMID:23966327

  20. Fixational eye movements and binocular vision

    PubMed Central

    Otero-Millan, Jorge; Macknik, Stephen L.; Martinez-Conde, Susana


    During attempted visual fixation, small involuntary eye movementscalled fixational eye movementscontinuously change of our gazes position. Disagreement between the left and right eye positions during such motions can produce diplopia (double vision). Thus, the ability to properly coordinate the two eyes during gaze fixation is critical for stable perception. For the last 50 years, researchers have studied the binocular characteristics of fixational eye movements. Here we review classical and recent studies on the binocular coordination (i.e., degree of conjugacy) of each fixational eye movement type: microsaccades, drift and tremor, and its perceptual contribution to increasing or reducing binocular disparity. We also discuss how amblyopia and other visual pathologies affect the binocular coordination of fixational eye movements. PMID:25071480

  1. Environmentally relevant parameters affecting PCB degradation: carbon source- and growth phase-mitigated effects of the expression of the biphenyl pathway and associated genes in Burkholderia xenovorans LB400.


    Parnell, J Jacob; Denef, Vincent J; Park, Joonhong; Tsoi, Tamara; Tiedje, James M


    The principal means for microbial degradation of polychlorinated biphenyls (PCBs) is through the biphenyl pathway. Although molecular aspects of the regulation of the biphenyl pathway have been studied, information on environmental facets such as the effect of alternative carbon sources on (polychlorinated) biphenyl degradation is limited. Here we explore the effect of environmental conditions (e.g., carbon source and growth phase) on the variation in PCB degradation profiles of Burkholderia xenovorans LB400. Genome-wide expression patterns reveal 25 genes commonly up-regulated during PCB degradation and growth on biphenyl to be upregulated in the transition to stationary phase (relative to growth on succinate) including two putative detoxification pathways. Quantitative reverse transcription PCR (Q-RT-PCR) analysis of the upper biphenyl pathway (bphA, bphD, and bphR1), and detoxification genes in response to environmental conditions suggest associated regulation of the biphenyl pathway and chloroacetaldehyde dehydrogenase. The response of genes in the upper biphenyl pathway to carbon source competition and growth phase reveals inhibition of the biphenyl pathway by PCBs. Although PCBs are not degraded during growth on succinate with PCBs, expression data indicate that the biphenyl pathway is induced, suggesting that post-transcriptional regulation or active transport of biphenyl maybe limiting PCB degradation. Identification of the involvement of peripheral pathways in degradation of PCBs is crucial to understanding PCB degradation in an environmental context as bacteria capable of biodegradation experience a range of carbon sources and growth phases. PMID:19672561

  2. Determination of pathways of glycogen synthesis and the dilution of the three-carbon pool with (U- sup 13 C)glucose

    SciTech Connect

    Katz, J.; Wals, P.A. ); Lee, W.N.P. )


    Rats were infused with glucose at 30 mg/min, containing 18% enriched (U-{sup 13}C)glucose and (1-{sup 14}C)- and (3-{sup 3}H)glucose and liver glycogen were determined by gas chromatography/mass spectroscopy. The contribution of the direct pathway to glycogen was calculated from the three tracers, and the values by all three were nearly identical, about 50%. The {sup 14}C specific activity in carbon 6 of glycogen glucose was about 6% that of carbon 1. The ({sup 3}H)glucose/(1-{sup 14}C)glucose ratio in glycogen was 80-90% that is blood glucose. The enrichment of {sup 13}C and the specific activity of {sup 14}C in glycogen formed by the indirect path were 20-25% of glycogen formed directly from glucose. The dilution is of two kinds: (1) an exchange of labeled carbon with unlabeled carbon in the tricarboxylic acid cycle and (2) dilution by unlabeled nonglucose carbon. Methods to calculate the two types of dilution are presented. In rate preinjected with glucagon, the dilution through the tricarboxylic acid cycle was unaffected but that by nonglucose carbon was decreased.

  3. Nitrogen fixation method and apparatus


    Chen, Hao-Lin (Walnut Creek, CA)


    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

  4. Nitrogen fixation method and apparatus


    Chen, H.L.


    A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O[sub 2]/cm promotes the formation of vibrationally excited N[sub 2]. Atomic oxygen interacts with vibrationally excited N[sub 2] at a much quicker rate than unexcited N[sub 2], greatly improving the rate at which NO is formed. 1 fig.

  5. Do Fixation Cues Ensure Fixation Accuracy in Split-Fovea Studies of Word Recognition?

    ERIC Educational Resources Information Center

    Jordan, Timothy R.; Paterson, Kevin B.; Kurtev, Stoyan; Xu, Mengyun


    Many studies have claimed that hemispheric processing is split precisely at the foveal midline and so place great emphasis on the precise location at which words are fixated. These claims are based on experiments in which a variety of fixation procedures were used to ensure fixation accuracy but the effectiveness of these procedures is unclear. We

  6. Models of Fixation and Tissue Processing

    PubMed Central

    Grizzle, William E.


    Fixation and processing of tissue to paraffin blocks are used to permit tissues to be cut thinly (4 to 5 m); cutting thin sections of tissue and staining them histochemically or immunohistochemically are necessary to permit tissues to be viewed adequately as to their structures (e.g., subcellular components and surrounding stroma) using a bright field microscope. Over the last century, anatomists and pathologists have used fixation in 10% neutral buffered formalin (10% NBF) as the fixative of choice. Also, both human and veterinary pathologists have trained using fixation in 10% NBF so these professionals have been and are reluctant to change the microscopic appearance of diagnostic tissues by using a different type of fixation; in addition, the effects of tissue processing on the microscopic appearance of tissue has essentially been ignored in most studies. Because of the use of 10% NBF by pathologists, archives of paraffin blocks contain essentially paraffin blocks only fixed in 10% NBF. Thus, if retrospective studies use archival paraffin blocks to correlate the molecular features of diseases with the outcomes of diseases, the studies must be based upon using tissue fixed in 10% NBF. Studies of how fixation in 10% NBF interacts with histochemical and immunohistochemical staining are very limited in number and most are based upon relatively long times of fixation in 10% NBF (? 36 hours). Current times of fixation in 10% NBF have been reduced to < 24 hours. Actually, little is known about fixation in 10% NBF and its interaction with tissue processing at any time of fixation, especially short times of fixation. Even less is known about how fixation of tissues in 10% NBF interact with more modern assays using immunohistochemistry, real time quantitative PCR, and techniques which depend upon the analysis of proteins extracted from paraffin blocks such as analysis by multiplex immunoassays or by mass spectrometry. In general, multiple antibody-antigen combinations are reported not to work in tissues fixed in 10% NBF, i.e., immunorecognition is almost lost completely for such antibody-antigen combinations as Ki67/MIB, ER? and PR, and partially lost for Bcl-2. Several models have been developed to study the interactions of tissue fixation and immunorecognition, but most have viewed the problem in immunorecognition as being completely caused by fixation. Also, some of the models discussed in this special issue do not predict observations of the effects of fixation on frozen tissues fixed in 10% NBF, but not processed to paraffin blocks. This article is a brief review of issues with using 10% NBF combined with tissue processing as a combined process to study biomarkers as identified by immunohistochemistry. PMID:19886755

  7. Determination of methanogenic pathways through carbon isotope (δ13C) analysis for the two-stage anaerobic digestion of high-solids substrates.


    Gehring, Tito; Klang, Johanna; Niedermayr, Andrea; Berzio, Stephan; Immenhauser, Adrian; Klocke, Michael; Wichern, Marc; Lübken, Manfred


    This study used carbon isotope (δ(13)C)-based calculations to quantify the specific methanogenic pathways in a two-stage experimental biogas plant composed of three thermophilic leach bed reactors (51-56 °C) followed by a mesophilic (36.5 °C) anaerobic filter. Despite the continuous dominance of the acetoclastic Methanosaeta in the anaerobic filter, the methane (CH4) fraction derived from carbon dioxide reduction (CO2), fmc, varied significantly over the investigation period of 200 days. At organic loading rates (OLRs) below 6.0 gCOD L(-1) d(-1), the average fmc value was 33%, whereas at higher OLRs, with a maximum level of 17.0 gCOD L(-1) d(-1), the fmc values reached 47%. The experiments allowed for a clear differentiation of the isotope fractionation related to the formation and consumption of acetate in both stages of the plant. Our data indicate constant carbon isotope fractionation for acetate formation at different OLRs within the thermophilic leach bed reactors as well as a negligible contribution of homoacetogenesis. These results present the first quantification of methanogenic pathway (fmc values) dynamics for a continually operated mesophilic bioreactor and highlight the enormous potential of δ(13)C analysis for a more comprehensive understanding of the anaerobic degradation processes in CH4-producing biogas plants. PMID:25741999

  8. Investigations of potential microbial methanogenic and carbon monoxide utilization pathways in ultra-basic reducing springs associated with present-day continental serpentinization: the Tablelands, NL, CAN

    PubMed Central

    Morrill, Penny L.; Brazelton, William J.; Kohl, Lukas; Rietze, Amanda; Miles, Sarah M.; Kavanagh, Heidi; Schrenk, Matthew O.; Ziegler, Susan E.; Lang, Susan Q.


    Ultra-basic reducing springs at continental sites of serpentinization act as portals into the biogeochemistry of a subsurface environment with H2 and CH4 present. Very little, however, is known about the carbon substrate utilization, energy sources, and metabolic pathways of the microorganisms that live in this ultra-basic environment. The potential for microbial methanogenesis with bicarbonate, formate, acetate, and propionate precursors and carbon monoxide (CO) utilization pathways were tested in laboratory experiments by adding substrates to water and sediment from the Tablelands, NL, CAD, a site of present-day continental serpentinization. Microbial methanogenesis was not observed after bicarbonate, formate, acetate, or propionate addition. CO was consumed in the live experiments but not in the killed controls and the residual CO in the live experiments became enriched in 13C. The average isotopic enrichment factor resulting from this microbial utilization of CO was estimated to be 11.2 ± 0.2‰. Phospholipid fatty acid concentrations and δ13C values suggest limited incorporation of carbon from CO into microbial lipids. This indicates that in our experiments, CO was used primarily as an energy source, but not for biomass growth. Environmental DNA sequencing of spring fluids collected at the same time as the addition experiments yielded a large proportion of Hydrogenophaga-related sequences, which is consistent with previous metagenomic data indicating the potential for these taxa to utilize CO. PMID:25431571

  9. Whole Animal Perfusion Fixation for Rodents

    PubMed Central

    Gage, Gregory J.; Kipke, Daryl R.; Shain, William


    The goal of fixation is to rapidly and uniformly preserve tissue in a life-like state. While placing tissue directly in fixative works well for small pieces of tissue, larger specimens like the intact brain pose a problem for immersion fixation because the fixative does not reach all regions of the tissue at the same rate 5,7. Often, changes in response to hypoxia begin before the tissue can be preserved 12. The advantage of directly perfusing fixative through the circulatory system is that the chemical can quickly reach every corner of the organism using the natural vascular network. In order to utilize the circulatory system most effectively, care must be taken to match physiological pressures 3. It is important to note that physiological pressures are dependent on the species used. Techniques for perfusion fixation vary depending on the tissue to be fixed and how the tissue will be processed following fixation. In this video, we describe a low-cost, rapid, controlled and uniform fixation procedure using 4% paraformaldehyde perfused via the vascular system: through the heart of the rat to obtain the best possible preservation of the brain for immunohistochemistry. The main advantage of this technique (vs. gravity-fed systems) is that the circulatory system is utilized most effectively. PMID:22871843

  10. Biochemical Approaches to Improved Nitrogen Fixation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Improving symbiotic nitrogen fixation by legumes has emerged again as an important topic on the world scene due to the energy crisis and lack of access to nitrogen fertilizer in developing countries. We have taken a biochemical genomics approach to improving symbiotic nitrogen fixation in legumes. L...


    PubMed Central

    Grau, F. H.; Wilson, P. W.


    Grau, F. H. (University of Wisconsin, Madison) and P. W. Wilson. Physiology of nitrogen fixation by Bacillus polymyxa. J. Bacteriol. 83:490496. 1962.Of 17 strains of Bacillus polymyxa tested for fixation of molecular nitrogen, 15 fixed considerable quantities (30 to 150 ?g N/ml). Two strains of the closely related B. macerans did not use N2, but possibly other members of this species may do so. Confirmation of fixation was obtained by showing incorporation of N15 into cell material. Both iron and molybdenum are specifically required for fixation; without the addition of these metals to the nitrogen-free medium, the growth rate and the total nitrogen fixed were reduced about 30 to 50%. No requirement for added molybdenum could be shown when ammonia was the nitrogen source, and the absence of iron caused only a slight decrease in growth. Washed-cell suspensions of B. polymyxa containing an active hydrogenase readily incorporated N15 into cell materials when provided with mannitol, glucose, or pyruvate but not when formate was the substrate. Hydrogen is a specific inhibitor of fixation, reducing both the rate and final amount of nitrogen fixed; it did not reduce growth on ammonia. Fixation was strictly anaerobic, 1% oxygen in the gas phase being sufficient to stop fixation. Arsenate is a powerful inhibitor of fixation of N2 by washed-cell suspensions of B. polymyxa, indicating that high-energy phosphate may be significant for this process. PMID:13901244

  12. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  13. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  14. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  15. 21 CFR 886.1290 - Fixation device.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Fixation device. 886.1290 Section 886.1290 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1290 Fixation device. (a) Identification. A...

  16. A MicroRNA-Mediated Insulin Signaling Pathway Regulates the Toxicity of Multi-Walled Carbon Nanotubes in Nematode Caenorhabditis elegans.


    Zhao, Yunli; Yang, Junnian; Wang, Dayong


    The underlying mechanisms for functions of microRNAs (miRNAs) in regulating toxicity of nanomaterials are largely unclear. Using Illumina HiSeq(TM) 2000 sequencing technique, we obtained the dysregulated mRNA profiling in multi-walled carbon nanotubes (MWCNTs) exposed nematodes. Some dysregulated genes encode insulin signaling pathway. Genetic experiments confirmed the functions of these dysregulated genes in regulating MWCNTs toxicity. In the insulin signaling pathway, DAF-2/insulin receptor regulated MWCNTs toxicity by suppressing function of DAF-16/FOXO transcription factor. Moreover, we raised a miRNAs-mRNAs network involved in the control of MWCNTs toxicity. In this network, mir-355 might regulate MWCNTs toxicity by inhibiting functions of its targeted gene of daf-2, suggesting that mir-355 may regulate functions of the entire insulin signaling pathway by acting as an upregulator of DAF-2, the initiator of insulin signaling pathway, in MWCNTs exposed nematodes. Our results provides highlight on understanding the crucial role of miRNAs in regulating toxicity of nanomaterials in organisms. PMID:26984256

  17. A MicroRNA-Mediated Insulin Signaling Pathway Regulates the Toxicity of Multi-Walled Carbon Nanotubes in Nematode Caenorhabditis elegans

    PubMed Central

    Zhao, Yunli; Yang, Junnian; Wang, Dayong


    The underlying mechanisms for functions of microRNAs (miRNAs) in regulating toxicity of nanomaterials are largely unclear. Using Illumina HiSeqTM 2000 sequencing technique, we obtained the dysregulated mRNA profiling in multi-walled carbon nanotubes (MWCNTs) exposed nematodes. Some dysregulated genes encode insulin signaling pathway. Genetic experiments confirmed the functions of these dysregulated genes in regulating MWCNTs toxicity. In the insulin signaling pathway, DAF-2/insulin receptor regulated MWCNTs toxicity by suppressing function of DAF-16/FOXO transcription factor. Moreover, we raised a miRNAs-mRNAs network involved in the control of MWCNTs toxicity. In this network, mir-355 might regulate MWCNTs toxicity by inhibiting functions of its targeted gene of daf-2, suggesting that mir-355 may regulate functions of the entire insulin signaling pathway by acting as an upregulator of DAF-2, the initiator of insulin signaling pathway, in MWCNTs exposed nematodes. Our results provides highlight on understanding the crucial role of miRNAs in regulating toxicity of nanomaterials in organisms. PMID:26984256

  18. Stability of unicortical locked fixation versus bicortical non-locked fixation for forearm fractures.


    Pater, Timothy J; Grindel, Steve I; Schmeling, Gregory J; Wang, Mei


    Locking plate fixation is being widely applied for fixation of forearm fractures and has many potential advantages, such as fixed angle fixation and improved construct stability, especially in osteoporotic bone. Biomechanical data comparing locking devices to commonly used Low Contact Dynamic Compression (LCDCP) plates for the fixation of forearm fractures has been lacking. The purpose of this study was to compare the fixation stability of a 3.5-mm unicortical locked plate with bicortical non-locked LCDCP plates. Six matched pairs of fresh frozen cadaveric forearms were randomly assigned to unicortical locked and bicortical unlocked groups. Non-destructive four-point bending and torsional test was performed on the ulna and radius separately, using a servohydraulic testing system to obtain construct stiffness of the intact specimens and specimens after osteotomy and plating. The specimens were then loaded to failure to test the fixation strength. The locked unicortical fixation showed significantly higher bending stiffness than the unlocked bicortical fixation, but with significantly lower stiffness and strength in torsion. Fixation strength was comparable between the two groups under bending, but significantly greater in the bicortical non-locked group under torsion. Findings from this study suggest that postoperative rehabilitation protocols may need modification to limit torsional loading in the early stage when using locked unicortical fixation. The study also points out the potential advantage of a hybrid fixation that combines locked unicortical and unlocked bicortical screws. PMID:26273524

  19. Optimizing Stability in Femoral Neck Fracture Fixation.


    Ye, Ye; Hao, Jiandong; Mauffrey, Cyril; Hammerberg, E Mark; Stahel, Philip F; Hak, David J


    Optimizing stability of femoral neck fracture fixation is important in obtaining a successful outcome. The mechanical problems and strategies for achieving optimal stability differ depending on patients' age and degree of osteoporosis. Femoral neck fractures in younger adults usually result from high-energy trauma and have a vertical fracture pattern. Strategies for optimizing fixation stability in this group include placing additional screws at right angles to the fracture plane and medial buttress plate augmentation. In elderly patients, screw position relative to the intact cortical femoral neck bone is of critical importance. Additional strategies for optimizing fixation stability in this group include the concept of length stable fixation, use of adjunctive calcium phosphate cement, and use of novel fixed angle fixation implants. PMID:26488776

  20. Eighth international congress on nitrogen fixation. Final program

    SciTech Connect

    Not Available


    This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

  1. Biological dinitrogen fixation (acetylene reduction) associated with Florida mangroves.


    Zuberer, D A; Silver, W S


    Biological dinitrogen fixation in mangrove communities of the Tampa Bay region of South Florida was investigated using the acetylene reduction technique. Low rates of acetylene reduction (0.01 to 1.84 nmol of C(2)H(4)/g [wet weight] per h) were associated with plant-free sediments, while plant-associated sediments gave rise to slightly higher rates. Activity in sediments increased greatly upon the addition of various carbon sources, indicating an energy limitation for nitrogenase (C(2)H(2)) activity. In situ determinations of dinitrogen fixation in sediments also indicated low rates and exhibited a similar response to glucose amendment. Litter from the green macroalga, Ulva spp., mangrove leaves, and sea grass also gave rise to significant rates of acetylene reduction. Higher rates of nitrogenase activity (15 to 53 nmol of C(2)H(4)/g [wet weight] per h were associated with washed excised roots of three Florida mangrove species [Rhizophora mangle L., Avicennia germinans (L) Stern, and Laguncularia racemosa Gaertn.] as well as with isolated root systems of intact plants (11 to 58 mug of N/g [dry weight] per h). Following a short lag period, root-associated activity was linear and did not exhibit a marked response to glucose amendment. It appears that dinitrogen-fixing bacteria in the mangrove rhizoplane are able to use root exudates and/or sloughed cell debris as energy sources for dinitrogen fixation. PMID:637550

  2. Biological Dinitrogen Fixation (Acetylene Reduction) Associated with Florida Mangroves

    PubMed Central

    Zuberer, D. A.; Silver, W. S.


    Biological dinitrogen fixation in mangrove communities of the Tampa Bay region of South Florida was investigated using the acetylene reduction technique. Low rates of acetylene reduction (0.01 to 1.84 nmol of C2H4/g [wet weight] per h) were associated with plant-free sediments, while plant-associated sediments gave rise to slightly higher rates. Activity in sediments increased greatly upon the addition of various carbon sources, indicating an energy limitation for nitrogenase (C2H2) activity. In situ determinations of dinitrogen fixation in sediments also indicated low rates and exhibited a similar response to glucose amendment. Litter from the green macroalga, Ulva spp., mangrove leaves, and sea grass also gave rise to significant rates of acetylene reduction. Higher rates of nitrogenase activity (15 to 53 nmol of C2H4/g [wet weight] per h were associated with washed excised roots of three Florida mangrove species [Rhizophora mangle L., Avicennia germinans (L) Stern, and Laguncularia racemosa Gaertn.] as well as with isolated root systems of intact plants (11 to 58 ?g of N/g [dry weight] per h). Following a short lag period, root-associated activity was linear and did not exhibit a marked response to glucose amendment. It appears that dinitrogen-fixing bacteria in the mangrove rhizoplane are able to use root exudates and/or sloughed cell debris as energy sources for dinitrogen fixation. PMID:637550

  3. Abnormal Fixational Eye Movements in Amblyopia

    PubMed Central

    Shaikh, Aasef G.; Otero-Millan, Jorge; Kumar, Priyanka; Ghasia, Fatema F.


    Purpose Fixational saccades shift the foveal image to counteract visual fading related to neural adaptation. Drifts are slow eye movements between two adjacent fixational saccades. We quantified fixational saccades and asked whether their changes could be attributed to pathologic drifts seen in amblyopia, one of the most common causes of blindness in childhood. Methods Thirty-six pediatric subjects with varying severity of amblyopia and eleven healthy age-matched controls held their gaze on a visual target. Eye movements were measured with high-resolution video-oculography during fellow eye-viewing and amblyopic eye-viewing conditions. Fixational saccades and drifts were analyzed in the amblyopic and fellow eye and compared with controls. Results We found an increase in the amplitude with decreased frequency of fixational saccades in children with amblyopia. These alterations in fixational eye movements correlated with the severity of their amblyopia. There was also an increase in eye position variance during drifts in amblyopes. There was no correlation between the eye position variance or the eye velocity during ocular drifts and the amplitude of subsequent fixational saccade. Our findings suggest that abnormalities in fixational saccades in amblyopia are independent of the ocular drift. Discussion This investigation of amblyopia in pediatric age group quantitatively characterizes the fixation instability. Impaired properties of fixational saccades could be the consequence of abnormal processing and reorganization of the visual system in amblyopia. Paucity in the visual feedback during amblyopic eye-viewing condition can attribute to the increased eye position variance and drift velocity. PMID:26930079

  4. Nonstatistical 13C Distribution during Carbon Transfer from Glucose to Ethanol during Fermentation Is Determined by the Catabolic Pathway Exploited*

    PubMed Central

    Bayle, Kevin; Akoka, Serge; Remaud, Grald S.; Robins, Richard J.


    During the anaerobic fermentation of glucose to ethanol, the three micro-organisms Saccharomyces cerevisiae, Zymomonas mobilis, and Leuconostoc mesenteroides exploit, respectively, the Embden-Meyerhof-Parnas, the Entner-Doudoroff, and the reductive pentose phosphate pathways. Thus, the atoms incorporated into ethanol do not have the same affiliation to the atomic positions in glucose. The isotopic fractionation occurring in each pathway at both the methylene and methyl positions of ethanol has been investigated by isotopic quantitative 13C NMR spectrometry with the aim of observing whether an isotope redistribution characteristic of the enzymes active in each pathway can be measured. First, it is found that each pathway has a unique isotope redistribution signature. Second, for the methylene group, a significant apparent kinetic isotope effect is only found in the reductive pentose phosphate pathway. Third, the apparent kinetic isotope effects related to the methyl group are more pronounced than for the methylene group. These findings can (i) be related to known kinetic isotope effects of some of the enzymes concerned and (ii) give indicators as to which steps in the pathways are likely to be influencing the final isotopic composition in the ethanol. PMID:25538251

  5. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.


    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  6. Acetate Regulation of Spore Formation Is under the Control of the Ras/Cyclic AMP/Protein Kinase A Pathway and Carbon Dioxide in Saccharomyces cerevisiae

    PubMed Central

    Jungbluth, Marc; Msch, Hans-Ulrich


    In Saccharomyces cerevisiae, the Ras/cyclic AMP (cAMP)/protein kinase A (PKA) pathway is a nutrient-sensitive signaling cascade that regulates vegetative growth, carbohydrate metabolism, and entry into meiosis. How this pathway controls later steps of meiotic development is largely unknown. Here, we have analyzed the role of the Ras/cAMP/PKA pathway in spore formation by the meiosis-specific manipulation of Ras and PKA or by the disturbance of cAMP production. We found that the regulation of spore formation by acetate takes place after commitment to meiosis and depends on PKA and appropriate A kinase activation by Ras/Cyr1 adenylyl cyclase but not by activation through the Gpa2/Gpr1 branch. We further discovered that spore formation is regulated by carbon dioxide/bicarbonate, and an analysis of mutants defective in acetate transport (ady2?) or carbonic anhydrase (nce103?) provided evidence that these metabolites are involved in connecting the nutritional state of the meiotic cell to spore number control. Finally, we observed that the potential PKA target Ady1 is required for the proper localization of the meiotic plaque proteins Mpc70 and Spo74 at spindle pole bodies and for the ability of these proteins to initiate spore formation. Overall, our investigation suggests that the Ras/cAMP/PKA pathway plays a crucial role in the regulation of spore formation by acetate and indicates that the control of meiotic development by this signaling cascade takes places at several steps and is more complex than previously anticipated. PMID:22660623

  7. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.


    Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  8. Open reduction and internal fixation compared to closed reduction and external fixation in distal radial fractures

    PubMed Central

    Kopylov, Philippe; Geijer, Mats; Tgil, Magnus


    Background and purpose In unstable distal radial fractures that are impossible to reduce or to maintain in reduced position, the treatment of choice is operation. The type of operation and the choice of implant, however, is a matter of discussion. Our aim was to investigate whether open reduction and internal fixation would produce a better result than traditional external fixation. Methods 50 patients with an unstable or comminute distal radius fracture were randomized to either closed reduction and bridging external fixation, or open reduction and internal fixation using the TriMed system. The primary outcome parameter was grip strength, but the patients were followed for 1 year with objective clinical assessment, subjective outcome using DASH, and radiographic examination. Results At 1 year postoperatively, grip strength was 90% (SD 16) of the uninjured side in the internal fixation group and 78% (17) in the external fixation group. Pronation/supination was 150 (15) in the internal fixation group and 136 (20) in the external fixation group at 1 year. There were no differences in DASH scores or in radiographic parameters. 5 patients in the external fixation group were reoperated due to malunion, as compared to 1 in the internal fixation group. 7 other cases were classified as radiographic malunion: 5 in the external fixation group and 2 in the internal fixation group. Interpretation Internal fixation gave better grip strength and a better range of motion at 1 year, and tended to have less malunions than external fixation. No difference could be found regarding subjective outcome. PMID:19857180

  9. The ecology and genomics of C02 fixation in oceanic river plumes

    SciTech Connect

    F. Robert Tabita


    The ocean/atmosphere interface is the major conduit for the entry of atmospheric CO2 into oceanic carbon pools that can lead to sequestration or recycled release. The surface layers of the temperate and tropical oceans are often too oligotrophic to result in significant primary production that might lead to carbon sequestration. However, nutrient-rich river plumes can alter the primary production schemes of oligotrophic ocean basins, resulting in increased phytoplankton biomass and carbon fixation. The ultimate goal of this proposal is to understand these carbon cycling processes in major river plumes from the molecular processes involved in biological DIC uptake to contribution to basin-wide production and potential sequestration. Our research efforts include a field component to answer the questions raised concerning DIC in plumes entering ocean basins and an intensive genomics approach to understanding these processes on the cellular level using genomic fragments obtained from plume biota. This project is actually composed of 3 separate PI-initiated projects, including projects at the University of South Florida (USF) College of Marine Science, the University of Puerto Rico, and The Ohio State University. This report concerns research conducted at The Ohio State University and studies performed in collaboration with USF. In order to understand what might occur in the field, two model sysytems were studied in the laboratory. Carbon fixation in the unicellular cyanobacterium Synechococcus sp Strain PCC 7002 took place mainly through the CBB pathway. Nitrogen nutrition in cyanobacteria is regulated by NtcA, a transcriptional regulatory protein. We show that the rubisco activity and gene (rbcL) expression were not affected when cells were exposed to prolonged periods of nitrogen stress, however cells appear to use intracellular nitrogen reserves during nitrogen starvation. Transcripts of the global transcriptional regulator NtcA are expressed under nitrogen starved and nitrogen replete (nitrate or ammonia) growth conditions, with slight decrease in transcription in the presence of ammonia. These results suggest that intracellular levels of NtcA do not directly affect carbon metabolism. Gene expression of the other nitrogen regulatory signal transducer, encoded by glnB was also studied. The glnB gene was highly transcribed in nitrogen-limited cells compared to nitrogen depleted growth conditions. Therefore in the cyanobacterium Synechococcus sp PCC 7002, nitrogen does not affect the metabolic potential and carbon fixation. The NtcA regulator behaved differently and studies indicate that the product of the ntcA gene (NtcA) has an indirect effect on ca rbon assimilation and the genes involved in the carbon concentrating mechanism of strain 7002. The product of the ccmM gene plays an important role in carboxysome assembly and inorganic carbon transport within the cell. We hypothesized that under nitrogen limiting conditions the transcriptional regulator NtcA binds at the region upstream of ccmM, near the transcription start site, and blocks the transcription of ccmM. This hypothesis was experimentally proven. In another study, with USF researchers, we performed experiments in situ on RubisCO espression. To determine the relationship between expression of the major gene in carbon fixation, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO2 in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30–32) stations were dominated by rbcL mRNA concentrations from heterokonts; i.e., diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, a-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34–36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO2. While Prochlorococcus cells did not exhibit a large difference between low and high pCO2 water, Prochlorococcus rbcL RNA concentrations had a strong positive correlation to pCO2, suggesting a very low level of RuBisCO RNA transcription among Prochlorococcus in the plume waters, possibly due to their relatively poor carbon concentrating mechanisms (CCMs). These results provide molecular evidence that diatom/pelagophyte productivity is largely responsible for the large CO2 drawdown occurring in the MRP, based on the cooccurrence of elevated RuBisCO gene transcript concentrations from this group and reduced seawater pCO2 levels. This may partly be due to efficient CCMs that enable heterokont eukaryotes such as diatoms to continue fixing CO2 in the face of strong CO2 drawdown. This work represents the first attempt to relate in situ microbial gene expression to contemporaneous CO2 flux measurements in the ocean.

  10. Carboxylation of multiwalled carbon nanotube attenuated the cytotoxicity by limiting the oxidative stress initiated cell membrane integrity damage, cell cycle arrestment, and death receptor mediated apoptotic pathway.


    Liu, Zhenbao; Liu, Yanfei; Peng, Dongming


    In this study, the effects of carboxylated multiwalled carbon nanotubes (MWCNTs-COOH) on human normal liver cell line L02 was compared with that of pristine multiwalled carbon nanotubes (p-MWCNTs). It was shown that compared with MWCNTs-COOH, p-MWCNTs induced apoptosis, reduced the level of intracellular antioxidant glutathione more significantly, and caused severer cell membrane damage as demonstrated by lactate dehydrogenase leakage. Cell cycles were arrested by both MWCNTs, while p-MWCNTs induced higher ratio of G0/G1 phase arrestment as compared with MWCNTs-COOH. Caspase-8 was also activated after both MWCNTs exposure, indicating extrinsic apoptotic pathway was involved in the apoptosis induced by MWCNTs exposure, more importantly, MWCNTs-COOH significantly reduced the activation of caspase-8 as compared with p-MWCNTs. All these results suggested that MWCNTs-COOH might be safer for in vivo application as compared with p-MWCNTs. PMID:25684371

  11. The effects of folate intake on DNA and single-carbon pathway metabolism in the fruit fly Drosophila melanogaster compared to mammals.


    Blatch, Sydella A; Stabler, Sally P; Harrison, Jon F


    Mechanisms of vitamin function in non-mammals are poorly understood, despite being essential for development. Folate and cobalamin are B-vitamin cofactors with overlapping roles in transferring various single-carbon units. In mammals, one or both is needed for nucleotide synthesis, DNA methylation, amino acid conversions and other reactions. However, there has been little investigation of the response to folate or cobalamin in insects. Here, we manipulated folate intake and potentially cobalamin levels in the fruit fly Drosophila melanogaster with chemically-defined diets, an antibiotic to reduce bacterially-derived vitamins, and the folate-interfering pharmaceutical methotrexate, to see if single-carbon metabolites and DNA synthesis rates would be affected. We found that similar to mammals with low folate intake, fruit fly larvae had significantly slower growth and DNA synthesis rates. But changes to single carbon-metabolites did not mirror that of mammals with abnormal folate or given MTX. Five of the nine metabolites measured were not significantly affected (methionine, serine, glycine, methylglycine, and dimethylglycine) and three (cystathionine, methylgycine, and methylmalonic acid) were only decreased in larvae consuming methotrexate. Metabolites expected to be elevated if flies used cobalamin from microbial symbionts were not affected by dietary sulfaquinoxaline. Our data support the role of folate in nucleotide synthesis in D. melanogaster and that microbial symbionts provide functioning folates. We could not confirm how folate intake affects single carbon pathway metabolites, nor whether Drososphila use microbially-derived cobalamin. Further work should explore which cofactors are used in fruit flies in these important and potentially novel pathways. PMID:26219578

  12. From chemolithoautotrophs to electrolithoautotrophs: CO2 fixation by Fe(II)-oxidizing bacteria coupled with direct uptake of electrons from solid electron sources.


    Ishii, Takumi; Kawaichi, Satoshi; Nakagawa, Hirotaka; Hashimoto, Kazuhito; Nakamura, Ryuhei


    At deep-sea vent systems, hydrothermal emissions rich in reductive chemicals replace solar energy as fuels to support microbial carbon assimilation. Until recently, all the microbial components at vent systems have been assumed to be fostered by the primary production of chemolithoautotrophs; however, both the laboratory and on-site studies demonstrated electrical current generation at vent systems and have suggested that a portion of microbial carbon assimilation is stimulated by the direct uptake of electrons from electrically conductive minerals. Here we show that chemolithoautotrophic Fe(II)-oxidizing bacterium, Acidithiobacillus ferrooxidans, switches the electron source for carbon assimilation from diffusible Fe(2+) ions to an electrode under the condition that electrical current is the only source of energy and electrons. Site-specific marking of a cytochrome aa3 complex (aa3 complex) and a cytochrome bc1 complex (bc1 complex) in viable cells demonstrated that the electrons taken directly from an electrode are used for O2 reduction via a down-hill pathway, which generates proton motive force that is used for pushing the electrons to NAD(+) through a bc1 complex. Activation of carbon dioxide fixation by a direct electron uptake was also confirmed by the clear potential dependency of cell growth. These results reveal a previously unknown bioenergetic versatility of Fe(II)-oxidizing bacteria to use solid electron sources and will help with understanding carbon assimilation of microbial components living in electronically conductive chimney habitats. PMID:26500609

  13. From chemolithoautotrophs to electrolithoautotrophs: CO2 fixation by Fe(II)-oxidizing bacteria coupled with direct uptake of electrons from solid electron sources

    PubMed Central

    Ishii, Takumi; Kawaichi, Satoshi; Nakagawa, Hirotaka; Hashimoto, Kazuhito; Nakamura, Ryuhei


    At deep-sea vent systems, hydrothermal emissions rich in reductive chemicals replace solar energy as fuels to support microbial carbon assimilation. Until recently, all the microbial components at vent systems have been assumed to be fostered by the primary production of chemolithoautotrophs; however, both the laboratory and on-site studies demonstrated electrical current generation at vent systems and have suggested that a portion of microbial carbon assimilation is stimulated by the direct uptake of electrons from electrically conductive minerals. Here we show that chemolithoautotrophic Fe(II)-oxidizing bacterium, Acidithiobacillus ferrooxidans, switches the electron source for carbon assimilation from diffusible Fe2+ ions to an electrode under the condition that electrical current is the only source of energy and electrons. Site-specific marking of a cytochrome aa3 complex (aa3 complex) and a cytochrome bc1 complex (bc1 complex) in viable cells demonstrated that the electrons taken directly from an electrode are used for O2 reduction via a down-hill pathway, which generates proton motive force that is used for pushing the electrons to NAD+ through a bc1 complex. Activation of carbon dioxide fixation by a direct electron uptake was also confirmed by the clear potential dependency of cell growth. These results reveal a previously unknown bioenergetic versatility of Fe(II)-oxidizing bacteria to use solid electron sources and will help with understanding carbon assimilation of microbial components living in electronically conductive chimney habitats. PMID:26500609

  14. Immaturity of Visual Fixations in Dyslexic Children

    PubMed Central

    Tiadi, Aimé; Gérard, Christophe-Loïc; Peyre, Hugo; Bui-Quoc, Emmanuel; Bucci, Maria Pia


    To our knowledge, behavioral studies recording visual fixations abilities in dyslexic children are scarce. The object of this article is to explore further the visual fixation ability in dyslexics compared to chronological age-matched and reading age-matched non-dyslexic children. Fifty-five dyslexic children from 7 to 14 years old, 55 chronological age-matched non-dyslexic children and 55 reading age-matched non-dyslexic children participated to this study. Eye movements from both eyes were recorded horizontally and vertically by a video-oculography system (EyeBrain® T2). The fixation task consisted in fixating a white-filled circle appearing in the center of the screen for 30 s. Results showed that dyslexic children produced a significantly higher number of unwanted saccades than both groups of non-dyslexic children. Moreover, the number of unwanted saccades significantly decreased with age in both groups of non-dyslexic children, but not in dyslexics. Furthermore, dyslexics made more saccades during the last 15 s of fixation period with respect to both groups of non-dyslexic children. Such poor visual fixation capability in dyslexic children could be due to impaired attention abilities, as well as to an immaturity of the cortical areas controlling the fixation system. PMID:26924975

  15. Immaturity of Visual Fixations in Dyslexic Children.


    Tiadi, Aim; Grard, Christophe-Loc; Peyre, Hugo; Bui-Quoc, Emmanuel; Bucci, Maria Pia


    To our knowledge, behavioral studies recording visual fixations abilities in dyslexic children are scarce. The object of this article is to explore further the visual fixation ability in dyslexics compared to chronological age-matched and reading age-matched non-dyslexic children. Fifty-five dyslexic children from 7 to 14 years old, 55 chronological age-matched non-dyslexic children and 55 reading age-matched non-dyslexic children participated to this study. Eye movements from both eyes were recorded horizontally and vertically by a video-oculography system (EyeBrain() T2). The fixation task consisted in fixating a white-filled circle appearing in the center of the screen for 30 s. Results showed that dyslexic children produced a significantly higher number of unwanted saccades than both groups of non-dyslexic children. Moreover, the number of unwanted saccades significantly decreased with age in both groups of non-dyslexic children, but not in dyslexics. Furthermore, dyslexics made more saccades during the last 15 s of fixation period with respect to both groups of non-dyslexic children. Such poor visual fixation capability in dyslexic children could be due to impaired attention abilities, as well as to an immaturity of the cortical areas controlling the fixation system. PMID:26924975

  16. High speed fracture fixation: assessing resulting fixation stability and fastener withdrawal strength.


    Prygoski, Matthew Philip; Sanchez Caballero, Samuel; Schmid, Steven R; Lozier, Antony J; Selles, Miguel Angel


    A new method of bone fracture fixation has been developed in which fixation darts (small diameter nails/pins) are driven across a fracture site at high velocity with a pneumatically powered gun. When fixation darts are inserted oblique to one another, kinematic constraints prevent fragment motion and allow bone healing to progress. The primary aim of this study is to determine if fixation darts can provide reasonable fixation stability compared to bone screws, which were used as a benchmark since they represent a simple, yet well-established, surgical technique. The first objective was to evaluate macro-level stability using different numbers of darts inserted parallel and oblique to each other; experimental comparisons were undertaken in a bone analog model. Experimental results showed fixation darts could not be substituted for screws on a one-to-one basis, but that a plurality of fixation darts provided comparable fixation to two bone screws while allowing for faster insertion and damaging less bone. A second objective was to evaluate micro-level stability; a finite element model was created in order to provide a detailed look at the stress state surrounding the fixation darts and the evolution of the fracture gap. Even with relatively weak fixation dart configurations, the fracture gap was maintained below physiological thresholds for bone healing. Most failures of the fixed fractures were attributed to fixation dart pullout from the cancellous structure. The final objective of the study was to characterize this mode of failure with separate fixation dart and screw pullout tests conducted in Sawbones cancellous foam and fresh porcine cancellous bone. The results showed that the cancellous foam was an acceptable substitute for real bone and provided a conservative estimate of the fixation darts' performance relative to bone screws. A final comparison between experimental and numerically predicted pullout strengths provided confirmation that the model and experiments were consistent. PMID:23722627

  17. Distal Humerus Fractures: Open Reduction Internal Fixation.


    Mighell, Mark A; Stephens, Brent; Stone, Geoffrey P; Cottrell, Benjamin J


    Distal humerus fractures are challenging injuries for the upper extremity surgeon. However, recent techniques in open reduction internal fixation have been powerful tools in getting positive outcomes. To get such results, the surgeon must be aware of how to properly use these techniques in their respective practices. The method of fixation depends on the fracture, taking the degree of comminution and the restoration of the columns and articular surface into account. This article helps surgeons understand the concepts behind open reduction internal fixation of the distal humerus and makes them aware of pitfalls that may lead to negative results. PMID:26498548

  18. Diallyl disulfide attenuated carbon ion irradiation-induced apoptosis in mouse testis through changing the ratio of Tap73/?Np73 via mitochondrial pathway.


    Di, Cui-xia; Han, Lu; Zhang, Hong; Xu, Shuai; Mao, Ai-hong; Sun, Chao; Liu, Yang; Si, Jing; Li, Hong-yan; Zhou, Xin; Liu, Bing; Miao, Guo-ying


    Diallyl disulfide (DADS), a major organosulfur compound derived from garlic, has various biological properties, including anti-cancer effects. However, the protective mechanism of DADS against radiation-induced mouse testis cell apoptosis has not been elucidated. In this study, the magnitude of radiation effects evoked by carbon ion irradiation was marked by morphology changes, significant rise in apoptotic cells, activation expression of p53, up regulation the ratio of pro-apoptotic Tap73/anti-apoptotic ?Np73, as well as alterations of crucial mediator of the mitochondrial pathway. Interestingly, pretreatment with DADS attenuated carbon ion irradiation-induced morphology damages and apoptotic cells. Additionally, DADS elevated radiation-induced p53 and p21 expression, suggesting that p53 might be involved in the inhibition of cell cycle progression through up regulation of p21. Furthermore, administration with DADS prevented radiation-induced Tap73/?Np73 expression and consequently down regulated Bax/Bcl-2 ratio, cytochrome c release and caspase-3 expression, indicating that the balance between Tap73 and ?Np73 had potential to activate p53 responsive genes. Thus, our results showed that radio protection effect of DADS on mouse testis is mediated by blocking apoptosis through changing the ratio of Tap73/?Np73 via mitochondrial pathway, suggesting that DADS could be used as a potential radio protection agent for the testis against heavy-ion radiation. PMID:26526304

  19. Pd-catalyzed electrohydrogenation of carbon dioxide to formate: high mass activity at low overpotential and identification of the deactivation pathway.


    Min, Xiaoquan; Kanan, Matthew W


    Electrochemical reduction of CO2 to formate (HCO2(-)) powered by renewable electricity is a possible carbon-negative alternative to synthesizing formate from fossil fuels. This process is energetically inefficient because >1 V of overpotential is required for CO2 reduction to HCO2(-) on the metals currently used as cathodic catalysts. Pd reduces CO2 to HCO2(-) with no overpotential, but this activity has previously been limited to low synthesis rates and plagued by an unidentified deactivation pathway. Here we show that Pd nanoparticles dispersed on a carbon support reach high mass activities (50-80 mA HCO2(-) synthesis per mg Pd) when driven by less than 200 mV of overpotential in aqueous bicarbonate solutions. Electrokinetic measurements are consistent with a mechanism in which the rate-determining step is the addition of electrochemically generated surface adsorbed hydrogen to CO2 (i.e., electrohydrogenation). The electrodes deactivate over the course of several hours because of a minor pathway that forms CO. Activity is recovered, however, by removing CO with brief air exposure. PMID:25812119

  20. Diallyl disulfide attenuated carbon ion irradiation-induced apoptosis in mouse testis through changing the ratio of Tap73/ΔNp73 via mitochondrial pathway

    PubMed Central

    Di, Cui-xia; Han, Lu; Zhang, Hong; Xu, Shuai; Mao, Ai-hong; Sun, Chao; Liu, Yang; Si, Jing; Li, Hong-yan; Zhou, Xin; Liu, Bing; Miao, Guo-ying


    Diallyl disulfide (DADS), a major organosulfur compound derived from garlic, has various biological properties, including anti-cancer effects. However, the protective mechanism of DADS against radiation-induced mouse testis cell apoptosis has not been elucidated. In this study, the magnitude of radiation effects evoked by carbon ion irradiation was marked by morphology changes, significant rise in apoptotic cells, activation expression of p53, up regulation the ratio of pro-apoptotic Tap73/anti-apoptotic ΔNp73, as well as alterations of crucial mediator of the mitochondrial pathway. Interestingly, pretreatment with DADS attenuated carbon ion irradiation-induced morphology damages and apoptotic cells. Additionally, DADS elevated radiation-induced p53 and p21 expression, suggesting that p53 might be involved in the inhibition of cell cycle progression through up regulation of p21. Furthermore, administration with DADS prevented radiation-induced Tap73/ΔNp73 expression and consequently down regulated Bax/Bcl-2 ratio, cytochrome c release and caspase-3 expression, indicating that the balance between Tap73 and ΔNp73 had potential to activate p53 responsive genes. Thus, our results showed that radio protection effect of DADS on mouse testis is mediated by blocking apoptosis through changing the ratio of Tap73/ΔNp73 via mitochondrial pathway, suggesting that DADS could be used as a potential radio protection agent for the testis against heavy-ion radiation. PMID:26526304

  1. Neural correlates of fixation duration in natural reading: Evidence from fixation-related fMRI.


    Henderson, John M; Choi, Wonil; Luke, Steven G; Desai, Rutvik H


    A key assumption of current theories of natural reading is that fixation duration reflects underlying attentional, language, and cognitive processes associated with text comprehension. The neurocognitive correlates of this relationship are currently unknown. To investigate this relationship, we compared neural activation associated with fixation duration in passage reading and a pseudo-reading control condition. The results showed that fixation duration was associated with activation in oculomotor and language areas during text reading. Fixation duration during pseudo-reading, on the other hand, showed greater involvement of frontal control regions, suggesting flexibility and task dependency of the eye movement network. Consistent with current models, these results provide support for the hypothesis that fixation duration in reading reflects attentional engagement and language processing. The results also demonstrate that fixation-related fMRI provides a method for investigating the neurocognitive bases of natural reading. PMID:26151101

  2. Direct and Indirect Costs of Dinitrogen Fixation in Crocosphaera watsonii WH8501 and Possible Implications for the Nitrogen Cycle

    PubMed Central

    Großkopf, Tobias; LaRoche, Julie


    The recent detection of heterotrophic nitrogen (N2) fixation in deep waters of the southern Californian and Peruvian OMZ questions our current understanding of marine N2 fixation as a process confined to oligotrophic surface waters of the oceans. In experiments with Crocosphaera watsonii WH8501, a marine unicellular diazotrophic (N2 fixing) cyanobacterium, we demonstrated that the presence of high nitrate concentrations (up to 800 μM) had no inhibitory effect on growth and N2 fixation over a period of 2 weeks. In contrast, the environmental oxygen concentration significantly influenced rates of N2 fixation and respiration, as well as carbon and nitrogen cellular content of C. watsonii over a 24-h period. Cells grown under lowered oxygen atmosphere (5%) had a higher nitrogenase activity and respired less carbon during the dark cycle than under normal oxygen atmosphere (20%). Respiratory oxygen drawdown during the dark period could be fully explained (104%) by energetic needs due to basal metabolism and N2 fixation at low oxygen, while at normal oxygen these two processes could only account for 40% of the measured respiration rate. Our results revealed that under normal oxygen concentration most of the energetic costs during N2 fixation (∼60%) are not derived from the process of N2 fixation per se but rather from the indirect costs incurred for the removal of intracellular oxygen or by the reversal of oxidative damage (e.g., nitrogenase de novo synthesis). Theoretical calculations suggest a slight energetic advantage of N2 fixation relative to assimilatory nitrate uptake, when oxygen supply is in balance with the oxygen requirement for cellular respiration (i.e., energy generation for basal metabolism and N2 fixation). Taken together our results imply the existence of a niche for diazotrophic organisms inside oxygen minimum zones, which are predicted to further expand in the future ocean. PMID:22833737

  3. Direct and Indirect Costs of Dinitrogen Fixation in Crocosphaera watsonii WH8501 and Possible Implications for the Nitrogen Cycle.


    Grokopf, Tobias; Laroche, Julie


    The recent detection of heterotrophic nitrogen (N(2)) fixation in deep waters of the southern Californian and Peruvian OMZ questions our current understanding of marine N(2) fixation as a process confined to oligotrophic surface waters of the oceans. In experiments with Crocosphaera watsonii WH8501, a marine unicellular diazotrophic (N(2) fixing) cyanobacterium, we demonstrated that the presence of high nitrate concentrations (up to 800??M) had no inhibitory effect on growth and N(2) fixation over a period of 2?weeks. In contrast, the environmental oxygen concentration significantly influenced rates of N(2) fixation and respiration, as well as carbon and nitrogen cellular content of C. watsonii over a 24-h period. Cells grown under lowered oxygen atmosphere (5%) had a higher nitrogenase activity and respired less carbon during the dark cycle than under normal oxygen atmosphere (20%). Respiratory oxygen drawdown during the dark period could be fully explained (104%) by energetic needs due to basal metabolism and N(2) fixation at low oxygen, while at normal oxygen these two processes could only account for 40% of the measured respiration rate. Our results revealed that under normal oxygen concentration most of the energetic costs during N(2) fixation (?60%) are not derived from the process of N(2) fixation per se but rather from the indirect costs incurred for the removal of intracellular oxygen or by the reversal of oxidative damage (e.g., nitrogenase de novo synthesis). Theoretical calculations suggest a slight energetic advantage of N(2) fixation relative to assimilatory nitrate uptake, when oxygen supply is in balance with the oxygen requirement for cellular respiration (i.e., energy generation for basal metabolism and N(2) fixation). Taken together our results imply the existence of a niche for diazotrophic organisms inside oxygen minimum zones, which are predicted to further expand in the future ocean. PMID:22833737

  4. A simple and inexpensive external fixator.


    Noor, M A


    A simple and inexpensive external fixator has been designed. It is constructed of galvanized iron pipe and mild steel bolts and nuts. It can easily be manufactured in a hospital workshop with a minimum of tools. PMID:3267638

  5. Nitrogen fixation on Arctic glaciers, Svalbard

    NASA Astrophysics Data System (ADS)

    Telling, Jon; Anesio, Alexandre M.; Tranter, Martyn; Irvine-Fynn, Tristram; Hodson, Andy; Butler, Catriona; Wadham, Jemma


    Glacier surfaces contain a wide diversity of microorganisms and can host a range of microbial activities. However, microbial nutrient cycling on glaciers is poorly understood. This study is the first to document nitrogen fixation (nitrogenase activity) on glaciers and demonstrate its importance in supporting microbial growth. Rates of nitrogen fixation (nitrogenase activity) in cryoconite holes on three valley glaciers in Svalbard ranged from <2.0 to 99.9 ?mol ethylene m-2 d-1 with rates inversely correlated to concentrations of available inorganic nitrogen. Annual inputs of nitrogen by nitrogen fixation on a glacier catchment scale are more than 2 orders of magnitude lower than the combined nitrogen inputs from snowmelt and rain. However, nitrogen fixation can be important for supporting microbial growth on the glaciers during the middle to late melt season after the snowline has retreated upslope.

  6. Use of bioabsorbable plates for cranial fixation.


    Noda, Kosumo; Tanikawa, Rokuya; Sugimura, Toshihide; Kawasaki, Kazutsune; Kimura, Teruo; Izumi, Naoto; Hashimoto, Masaaki


    LactoSorb fixation plates are made of a bioabsorbable polymer (82% poly-L-lactic acid and 18% polyglycolic acid), and the strength is not inferior to titanium plates. LactoSorb has been used in the fields of pediatric neurosurgery and facial plastic surgery. Cranial fixation in craniotomy is mostly performed using titanium plates and clamps, but there are issues with esthetics and artifacts on postoperative radiographic images. Absorbable plates solve these problems, but are slightly thicker and more expensive. Here, we describe a technique to solve these disadvantages by inserting absorbable plates into the diploe. The present method was employed in 46 patients, and esthetically favorable results were obtained without intraoperative and postoperative complications. Absorbable plates may replace titanium plates as the main device for cranial fixation. The present method is particularly useful for cranial fixation in adults with a thin scalp. PMID:19940411

  7. Complement fixation test to C. burnetii


    ... a laboratory where it is examined for Coxiella antibodies using a laboratory method called complement fixation. This ... checks if the body has produced substances called antibodies to a specific foreign substance (antigen), in this ...

  8. Bicondylar tibial fractures: Internal or external fixation?

    PubMed Central

    Kumar, Gunasekaran; Peterson, Nicholas; Narayan, Badri


    Bicondylar fractures of the tibia, representing the Schatzker V and VI fractures represent a challenging problem. Any treatment protocol should aim at restoring articular congruity and the metaphyseo-diaphsyeal dissociation (MDD)both of these are equally important to long-term outcome. Both internal and external fixations have their proponents, and each method of treatment is associated with its unique features and complications. We review the initial and definitive management of these injuries, and the advantages and disadvantages of each method of definitive fixation. We suggest the use of a protocol for definitive management, using either internal or external fixation as deemed appropriate. This protocol is based on the fracture configuration, local soft tissue status and patient condition. In a nutshell, if the fracture pattern and soft tissue status are amenable plate fixation (single or double) is performed, otherwise limited open reduction and articular surface reconstruction with screws and circular frame is performed. PMID:21430865

  9. Carbon-Isotope Fractionations of Autotrophic Bacteria: Relevance to Primary Production and Microbial Evolution in Hot Springs and Hydrothermal Vents

    NASA Astrophysics Data System (ADS)

    Zhang, C. L.; Romanek, C. S.; Mills, G.


    Terrestrial hot springs and marine hydrothermal vents are often dominated by autotrophic microorganisms. Species of the Bacteria Domain in these environments are known to use different pathways for CO2 fixation. These may include the Calvin cycle, the Acetyl CoA pathway, the reverse TCA cycle, and the 3-HP pathway. Each cycle or pathway may be characterized by distinct patterns of carbon isotope fractionation. This presentation will summarize isotope fractionation patterns associated with known autotrophic bacteria and to use these patterns for interpreting natural isotopic variations. Examples will include hot springs from the Yellowstone National Park and Nevada desert, USA and Kamchatka, Russia, and hydrothermal vents from the East Pacific Rise. An attempt will be made to discuss isotopic variations within a particular pathway in the context of species evolution through horizontal gene transfer.

  10. The Path of Carbon in Photosynthesis

    DOE R&D Accomplishments Database

    Calvin, M.; Benson, A. A.


    The dark fixation of carbon dioxide by green algae has been investigated and found to be closely related to photosynthesis fixation. By illumination in the absence of carbon dioxide followed by treatment with radioactive carbon dioxide in the dark, the amount fixed has been increased ten to twenty fold. This rate of maximum fixation approaches photosynthesis maximum rates. The majority of the radioactive products formed under these conditions have been identified and isolated and the distribution of labeled carbon determined. From these results a tentative scheme for the mechanism of photosynthesis is set forth.

  11. Carbon and nitrogen cycling in thermally heated sediments

    NASA Astrophysics Data System (ADS)

    Meyer-Dombard, D. R.; Burton, M.; Vennelakanti, S.; Havig, J. R.; Shock, E.


    Hydrothermally heated sediment environments, such as are found in abundance throughout Yellowstone National Park, host fully functional microbial ecosystems. As with any ecosystem, both sources and sinks of carbon, nitrogen, and a myriad of other nutrients and energy-driving factors must be supplied. While we know microbial communities in hydrothermal environments can be surprisingly diverse, we know little about basic ecological functions such as carbon and nitrogen cycling. Previous work has shown that carbon cycling in one hot spring in Yellowstone National Park [“Bison Pool”] and its associated runoff channel functions as a complex system. Analysis of carbon and nitrogen isotopes in sediments and biofilms across a temperature and chemical gradient at this location revealed that the four best studied carbon fixation pathways [Calvin, reverse tricarboxylic acid, acetyl-CoA, 3-hydroxypropionate cycles] may all be functioning in this system, and nitrogen fixation varies across the chemosynthetic/photosynthetic ecotone [1]. Microcosm experiments using biofilms from this hot spring as inoculae with 13C labeled carbon substrates indicate heterotrophic growth [2]. In addition, metagenomic analysis of environmental DNA has indicated the presence of genes involved in carbon fixation [both phototrophic and autotrophic], and heterotrophy, as well as nitrogen fixation [3]. Studies from other Yellowstone locations have also found genetic evidence for carbon and nitrogen fixation [4, 5]. Of particular interest is the role of individuals in carbon and nitrogen cycling as environmental conditions suitable for chemosynthetic and photosynthetic growth vary. This study explores the diversity of cbbM/cbbL [Calvin cycle], aclB/oor/porA [rTCA cycle], nifH [nitrogen fixation], nirK [nitrite reduction] and amoA [ammonia oxidation] genes across a variety of Yellowstone environments. The transition of genetic diversity within sediments and biofilms is focused on the chemosynthetic/photosynthetic ecotone from a variety of hot springs spanning a range of pH and geochemical conditions. By sampling across this ecotone, changes in carbon and nitrogen fixation as a function of changing community structure become apparent. Environmental DNA was extracted from these samples, and the presence/absence of Bacteria and Archaea determined by PCR. In addition, PCR-directed screens reveal the presence or absence of the aforementioned functional genes. Further, comparison across a broad spectrum of environmental conditions supplies context for phylogenetic analysis of diversity. [1] Havig, J.R., 2009. Geochemistry of Hydrothermal Biofilms: Composition of Biofilms in Siliceous Sinter-Deposting Hot Springs. Doctoral Dissertation, Arizona State University. [2] Meyer-Dombard et al., 2007. Microbial Diversity and SIP Investigations of Streamer Biofilm Communities in Yellowstone. Goldschmidt Geochemical Conference. [3] Raymond et al., 2008. EOS Trans AGU. Abstract B14A-03. [4] Hall et al., 2008. AEM 74:4910-4922. [5] Steunou et al., 2006. PNAS 103:2398-2403.

  12. Hepatic Progenitor Cells Contribute to the Progression of 2-Acetylaminofluorene/Carbon Tetrachloride-Induced Cirrhosis via the Non-Canonical Wnt Pathway

    PubMed Central

    Chen, Jiamei; Zhang, Xiao; Xu, Ying; Li, Xuewei; Ren, Shuang; Zhou, Yaning; Duan, Yuyou; Zern, Mark; Zhang, Hua; Chen, Gaofeng; Liu, Chenghai


    Hepatic progenitor cells (HPCs) appear to play an important role in chronic liver injury. In this study, cirrhosis was induced in F-344 rats (n = 32) via subcutaneous injection of 50% carbon tetrachloride (CCl4) twice a week for 8 weeks. Then, 30% CCl4 was administered in conjunction with intragastric 2-acetylaminofluorine (2-AAF) for 4 weeks to induce activation of HPCs. WB-F344 cells were used to provide direct evidence for differentiation of HPCs to myofibroblasts. The results showed that after administration of 2-AAF, the hydroxyproline content and the expressions of ?-SMA, Col I, Col IV, TGF-?1, CD68, TNF-?, CK19 and OV6 were significantly increased. OV6 and ?-SMA were largely co-expressed in fibrous septum and the expressions of Wnt5b, frizzled2, frizzled3 and frizzled6 were markedly increased, while ?-catenin expression was not statistically different among the different groups. Consistent with the above results, WB-F344 cells, treated with TGF-?1 in vitro, differentiated into myofibroblasts and ?-SMA, Col I, Col IV, Wnt5b and frizzled2 expressions were significantly increased, while ?-catenin expression was decreased. After blocking the non-canonical Wnt pathway via WIF-1, the Wnt5b level was down regulated, and ?-SMA and F-actin expressions were significantly decreased in the WIF-1-treated cells. In conclusion, these results indicate that HPCs appear to differentiate into myofibroblasts and exhibit a profibrotic effect in progressive cirrhosis via activation of the non-canonical Wnt pathway. Blocking the non-canonical Wnt pathway can inhibit the differentiation of HPCs into myofibroblasts, suggesting that blocking this pathway and changing the fate of differentiated HPCs may be a potential treatment for cirrhosis. PMID:26087010

  13. Highly stable rice-straw-derived charcoal in 3700-year-old ancient paddy soil: evidence for an effective pathway toward carbon sequestration.


    Wu, Mengxiong; Yang, Min; Han, Xingguo; Zhong, Ting; Zheng, Yunfei; Ding, Pin; Wu, Weixiang


    Recalcitrant charcoal application is predicted to decelerate global warming through creating a long-term carbon sink in soil. Although many studies have showed high stability of charcoal derived from woody materials, few have focused on the dynamics of straw-derived charcoal in natural environment on a long timescale to evaluate its potential for agricultural carbon sequestration. Here, we examined straw-derived charcoal in an ancient paddy soil dated from ~3700 calendar year before present (cal. year BP). Analytical results showed that soil organic matter consisted of more than 25 % of charcoal in charcoal-rich layer. Similarities in morphology and molecular structure between the ancient and the fresh rice-straw-derived charcoal indicated that ancient charcoal was derived from rice straw. The lower carbon content, higher oxygen content, and obvious carbonyl of the ancient charcoal compared with fresh rice straw charcoal implied that oxidation occurred in the scale of thousands years. However, the dominant aromatic C of ancient charcoal indicated that rice-straw-derived charcoal was highly stable in the buried paddy soil due to its intrinsic chemical structures and the physical protection of ancient paddy wetland. Therefore, it may suggest that straw charcoal application is a potential pathway for C sequestration considering its longevity. PMID:25850742

  14. Laboratory studies of carbon kinetic isotope effects on the production mechanism of particulate phenolic compounds formed by toluene photooxidation: a tool to constrain reaction pathways.


    Irei, Satoshi; Rudolph, Jochen; Huang, Lin; Auld, Janeen; Collin, Fabrice; Hastie, Donald


    In this study, we examined compound-specific stable carbon isotope ratios for phenolic compounds in secondary organic aerosol (SOA) formed by photooxidation of isotope-label-free toluene. SOA generated by photooxidation of toluene using a continuous-flow reactor and an 8 m(3) indoor smog chamber was collected on filters, which were extracted with acetonitrile for compound-specific analysis. Eight phenolic compounds were identified in the extracts using a gas chromatograph coupled with a mass spectrometer, and their compound-specific stable carbon isotope ratios were determined using a gas chromatograph coupled with a combustion furnace followed by an isotope ratio mass spectrometer. The majority of products, including methylnitrophenols and methylnitrocatechols, were isotopically depleted by 5-6‰ compared to the initial isotope ratio of toluene, whereas the isotope ratio for 4-nitrophenol remained identical to that of toluene. On the basis of the reaction mechanisms proposed in previous reports, stable carbon isotope ratios of these products were calculated. By comparing the observed isotope ratios with the predicted isotope ratios, we explored possible production pathways for the particulate phenolic compounds. PMID:25490235

  15. Fixational eye movements predict visual sensitivity.


    Scholes, Chris; McGraw, Paul V; Nystrm, Marcus; Roach, Neil W


    During steady fixation, observers make small fixational saccades at a rate of around 1-2 per second. Presentation of a visual stimulus triggers a biphasic modulation in fixational saccade rate-an initial inhibition followed by a period of elevated rate and a subsequent return to baseline. Here we show that, during passive viewing, this rate signature is highly sensitive to small changes in stimulus contrast. By training a linear support vector machine to classify trials in which a stimulus is either present or absent, we directly compared the contrast sensitivity of fixational eye movements with individuals' psychophysical judgements. Classification accuracy closely matched psychophysical performance, and predicted individuals' threshold estimates with less bias and overall error than those obtained using specific features of the signature. Performance of the classifier was robust to changes in the training set (novel subjects and/or contrasts) and good prediction accuracy was obtained with a practicable number of trials. Our results indicate a tight coupling between the sensitivity of visual perceptual judgements and fixational eye control mechanisms. This raises the possibility that fixational saccades could provide a novel and objective means of estimating visual contrast sensitivity without the need for observers to make any explicit judgement. PMID:26468244

  16. Elementary Flux Mode Analysis of Acetyl-CoA Pathway in Carboxydothermus hydrogenoformans Z-2901

    PubMed Central

    Chinnasamy Perumal, Rajadurai; Selvaraj, Ashok; Ramesh Kumar, Gopal


    Carboxydothermus hydrogenoformans is a carboxydotrophic hydrogenogenic bacterium species that produces hydrogen molecule by utilizing carbon monoxide (CO) or pyruvate as a carbon source. To investigate the underlying biochemical mechanism of hydrogen production, an elementary mode analysis of acetyl-CoA pathway was performed to determine the intermediate fluxes by combining linear programming (LP) method available in CellNetAnalyzer software. We hypothesized that addition of enzymes necessary for carbon monoxide fixation and pyruvate dissimilation would enhance the theoretical yield of hydrogen. An in silico gene knockout of pyk, pykC, and mdh genes of modeled acetyl-CoA pathway allows the maximum theoretical hydrogen yield of 47.62 mmol/gCDW/h for 1 mole of carbon monoxide (CO) uptake. The obtained hydrogen yield is comparatively two times greater than the previous experimental data. Therefore, it could be concluded that this elementary flux mode analysis is a crucial way to achieve efficient hydrogen production through acetyl-CoA pathway and act as a model for strain improvement. PMID:24822064

  17. Collaborative regulation of CO2 transport and fixation during succinate production in Escherichia coli.


    Zhu, Li-Wen; Zhang, Lei; Wei, Li-Na; Li, Hong-Mei; Yuan, Zhan-Peng; Chen, Tao; Tang, Ya-Ling; Liang, Xin-Hua; Tang, Ya-Jie


    In Escherichia coli, succinic acid is synthesized by CO2 fixation-based carboxylation of C3 metabolites. A two-step process is involved in CO2 integration: CO2 uptake into the cell and CO2 fixation by carboxylation enzymes. The phosphoenolpyruvate (PEP) carboxylase (PPC) and carboxykinase (PCK) are two important carboxylation enzymes within the succinate synthetic pathway, while SbtA and BicA are two important bicarbonate transporters. In this study, we employed a dual expression system, in which genes regulating both CO2 uptake and fixation were co-overexpressed, or overexpressed individually to improve succinate biosynthesis. Active CO2 uptake was observed by the expression of SbtA or/and BicA, but the succinate biosynthesis was decreased. The succinate production was significantly increased only when a CO2 fixation gene (ppc or pck) and a CO2 transport gene (sbtA or bicA) were co-expressed. Co-expression of pck and sbtA provided the best succinate production among all the strains. The highest succinate production of 73.4?g L(-1) was 13.3%, 66.4% or 15.0% higher than that obtained with the expression of PCK, SbtA alone, or with empty plasmids, respectively. We believe that combined regulation of CO2 transport and fixation is critical for succinate production. Imbalanced gene expression may disturb the cellular metabolism and succinate production. PMID:26626308

  18. Collaborative regulation of CO2 transport and fixation during succinate production in Escherichia coli

    PubMed Central

    Zhu, Li-Wen; Zhang, Lei; Wei, Li-Na; Li, Hong-Mei; Yuan, Zhan-Peng; Chen, Tao; Tang, Ya-Ling; Liang, Xin-Hua; Tang, Ya-Jie


    In Escherichia coli, succinic acid is synthesized by CO2 fixation-based carboxylation of C3 metabolites. A two-step process is involved in CO2 integration: CO2 uptake into the cell and CO2 fixation by carboxylation enzymes. The phosphoenolpyruvate (PEP) carboxylase (PPC) and carboxykinase (PCK) are two important carboxylation enzymes within the succinate synthetic pathway, while SbtA and BicA are two important bicarbonate transporters. In this study, we employed a dual expression system, in which genes regulating both CO2 uptake and fixation were co-overexpressed, or overexpressed individually to improve succinate biosynthesis. Active CO2 uptake was observed by the expression of SbtA or/and BicA, but the succinate biosynthesis was decreased. The succinate production was significantly increased only when a CO2 fixation gene (ppc or pck) and a CO2 transport gene (sbtA or bicA) were co-expressed. Co-expression of pck and sbtA provided the best succinate production among all the strains. The highest succinate production of 73.4?g L?1 was 13.3%, 66.4% or 15.0% higher than that obtained with the expression of PCK, SbtA alone, or with empty plasmids, respectively. We believe that combined regulation of CO2 transport and fixation is critical for succinate production. Imbalanced gene expression may disturb the cellular metabolism and succinate production. PMID:26626308

  19. Key role of symbiotic dinitrogen fixation in tropical forest secondary succession.


    Batterman, Sarah A; Hedin, Lars O; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J; Hall, Jefferson S


    Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000 kg carbon per hectare) in the first 12 years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2. PMID:24037375

  20. Key role of symbiotic dinitrogen fixation in tropical forest secondary succession

    NASA Astrophysics Data System (ADS)

    Batterman, Sarah A.; Hedin, Lars O.; van Breugel, Michiel; Ransijn, Johannes; Craven, Dylan J.; Hall, Jefferson S.


    Forests contribute a significant portion of the land carbon sink, but their ability to sequester CO2 may be constrained by nitrogen, a major plant-limiting nutrient. Many tropical forests possess tree species capable of fixing atmospheric dinitrogen (N2), but it is unclear whether this functional group can supply the nitrogen needed as forests recover from disturbance or previous land use, or expand in response to rising CO2 (refs 6, 8). Here we identify a powerful feedback mechanism in which N2 fixation can overcome ecosystem-scale deficiencies in nitrogen that emerge during periods of rapid biomass accumulation in tropical forests. Over a 300-year chronosequence in Panama, N2-fixing tree species accumulated carbon up to nine times faster per individual than their non-fixing neighbours (greatest difference in youngest forests), and showed species-specific differences in the amount and timing of fixation. As a result of fast growth and high fixation, fixers provided a large fraction of the nitrogen needed to support net forest growth (50,000kg carbon per hectare) in the first 12years. A key element of ecosystem functional diversity was ensured by the presence of different N2-fixing tree species across the entire forest age sequence. These findings show that symbiotic N2 fixation can have a central role in nitrogen cycling during tropical forest stand development, with potentially important implications for the ability of tropical forests to sequester CO2.

  1. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.


    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and Arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multiyear mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) buildup and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  2. Spring bloom community change modifies carbon pathways and C : N : P : Chl a stoichiometry of coastal material fluxes

    NASA Astrophysics Data System (ADS)

    Spilling, K.; Kremp, A.; Klais, R.; Olli, K.; Tamminen, T.


    Diatoms and dinoflagellates are major bloom-forming phytoplankton groups competing for resources in the oceans and coastal seas. Recent evidence suggests that their competition is significantly affected by climatic factors under ongoing change, modifying especially the conditions for cold-water, spring bloom communities in temperate and arctic regions. We investigated the effects of phytoplankton community composition on spring bloom carbon flows and nutrient stoichiometry in multi-year mesocosm experiments. Comparison of differing communities showed that community structure significantly affected C accumulation parameters, with highest particulate organic carbon (POC) build-up and dissolved organic carbon (DOC) release in diatom-dominated communities. In terms of inorganic nutrient drawdown and bloom accumulation phase, the dominating groups behaved as functional surrogates. Dominance patterns, however, significantly affected C : N : P : Chl a ratios over the whole bloom event: when diatoms were dominant, these ratios increased compared to dinoflagellate dominance or mixed communities. Diatom-dominated communities sequestered carbon up to 3.6-fold higher than the expectation based on the Redfield ratio, and 2-fold higher compared to dinoflagellate dominance. To our knowledge, this is the first experimental report of consequences of climatically driven shifts in phytoplankton dominance patterns for carbon sequestration and related biogeochemical cycles in coastal seas. Our results also highlight the need for remote sensing technologies with taxonomical resolution, as the C : Chl a ratio was strongly dependent on community composition and bloom stage. Climate-driven changes in phytoplankton dominance patterns will have far-reaching consequences for major biogeochemical cycles and need to be considered in climate change scenarios for marine systems.

  3. Malate-Mediated Carbon Catabolite Repression in Bacillus subtilis Involves the HPrK/CcpA Pathway ▿ §

    PubMed Central

    Meyer, Frederik M.; Jules, Matthieu; Mehne, Felix M. P.; Le Coq, Dominique; Landmann, Jens J.; Görke, Boris; Aymerich, Stéphane; Stülke, Jörg


    Most organisms can choose their preferred carbon source from a mixture of nutrients. This process is called carbon catabolite repression. The Gram-positive bacterium Bacillus subtilis uses glucose as the preferred source of carbon and energy. Glucose-mediated catabolite repression is caused by binding of the CcpA transcription factor to the promoter regions of catabolic operons. CcpA binds DNA upon interaction with its cofactors HPr(Ser-P) and Crh(Ser-P). The formation of the cofactors is catalyzed by the metabolite-activated HPr kinase/phosphorylase. Recently, it has been shown that malate is a second preferred carbon source for B. subtilis that also causes catabolite repression. In this work, we addressed the mechanism by which malate causes catabolite repression. Genetic analyses revealed that malate-dependent catabolite repression requires CcpA and its cofactors. Moreover, we demonstrate that HPr(Ser-P) is present in malate-grown cells and that CcpA and HPr interact in vivo in the presence of glucose or malate but not in the absence of a repressing carbon source. The formation of the cofactor HPr(Ser-P) could be attributed to the concentrations of ATP and fructose 1,6-bisphosphate in cells growing with malate. Both metabolites are available at concentrations that are sufficient to stimulate HPr kinase activity. The adaptation of cells to environmental changes requires dynamic metabolic and regulatory adjustments. The repression strength of target promoters was similar to that observed in steady-state growth conditions, although it took somewhat longer to reach the second steady-state of expression when cells were shifted to malate. PMID:22001508

  4. Cost of external fixation vs external fixation then nailing in bone infection

    PubMed Central

    Emara, Khaled Mohamed; Diab, Ramy Ahmed; Ghafar, Khaled Abd EL


    AIM: To study the cost benefit of external fixation vs external fixation then nailing in treatment of bone infection by segment transfer. METHODS: Out of 71 patients with infected nonunion tibia treated between 2003 and 2006, 50 patients fitted the inclusion criteria (26 patients were treated by external fixation only, and 24 patients were treated by external fixation early removal after segment transfer and replacement by internal fixation). Cost of inpatient treatment, total cost of inpatient and outpatient treatment till full healing, and the weeks of absence from school or work were calculated and compared between both groups. RESULTS: The cost of hospital stay and surgery in the group of external fixation only was 22.6 ± 3.3 while the cost of hospital stay and surgery in the group of early external fixation removal and replacement by intramedullary nail was 26.0 ± 3.2. The difference was statistically significant regarding the cost of hospital stay and surgery in favor of the group of external fixation only. The total cost of medical care (surgery, hospital stay, treatment outside the hospital including medications, dressing, physical therapy, outpatient laboratory work, etc.) in group of external fixation only was 63.3 ± 15.1, and total absence from work was 38.6 ± 6.6 wk. While the group of early removal of external fixation and replacement by IM nail, total cost of medical care was 38.3 ± 6.4 and total absence from work or school was 22.7 ± 4.1. The difference was statistically significant regarding the total cost and absence from work in favor of the group of early removal and replacement by IM nail. CONCLUSION: Early removal of external fixation and replacement by intramedullary nail in treatment of infected nonunion showed more cost effectiveness. Orthopaedic society needs to show the cost effectiveness of different procedures to the community, insurance, and health authorities. PMID:25621219

  5. Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}

    NASA Astrophysics Data System (ADS)

    Thomas, P. J.; Boller, A. J.; Zhao, Z.; Tabita, F. R.; Cavanaugh, C. M.; Scott, K. M.


    Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (δ13C = {[13C/12Csample/13C/12Cstandard] - 1} × 1000). Five different forms of RubisCO (IA, IB, IC, ID, and II) are utilized by algae and autotrophic bacteria reliant on the Calvin-Benson cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs, and their ɛ values (={[12k/13k] - 1} × 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, explaining the variation in biomass δ13C values of autotrophs utilizing these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides and Ralstonia eutropha. The purpose of this work was to determine the ɛ values for form IC RubisCO enzymes from R. sphaeroides and R. eutropha. Recombinant form IC RubisCOs were purified by conventional column chromatography procedures. Assay conditions (pH, dissolved inorganic carbon concentration) were tested to determine which parameters were conducive to the high rates of carbon fixation necessary for ɛ determination. Under standard conditions (pH 8.5 and 5 mM DIC), form IC RubisCO activities were sufficient for ɛ determination. Experiments are currently being conducted to measure the ɛ values of these enzymes. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of δ13C values of organisms fixing carbon via the Calvin-Benson cycle. These results are critical for determining the degree to which Calvin cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.

  6. Gaze shifts and fixations dominate gaze behavior of walking cats

    PubMed Central

    Rivers, Trevor J.; Sirota, Mikhail G.; Guttentag, Andrew I.; Ogorodnikov, Dmitri A.; Shah, Neet A.; Beloozerova, Irina N.


    Vision is important for locomotion in complex environments. How it is used to guide stepping is not well understood. We used an eye search coil technique combined with an active marker-based head recording system to characterize the gaze patterns of cats walking over terrains of different complexity: (1) on a flat surface in the dark when no visual information was available, (2) on the flat surface in light when visual information was available but not required, (3) along the highly structured but regular and familiar surface of a horizontal ladder, a task for which visual guidance of stepping was required, and (4) along a pathway cluttered with many small stones, an irregularly structured surface that was new each day. Three cats walked in a 2.5 m corridor, and 958 passages were analyzed. Gaze activity during the time when the gaze was directed at the walking surface was subdivided into four behaviors based on speed of gaze movement along the surface: gaze shift (fast movement), gaze fixation (no movement), constant gaze (movement at the bodys speed), and slow gaze (the remainder). We found that gaze shifts and fixations dominated the cats gaze behavior during all locomotor tasks, jointly occupying 6284% of the time when the gaze was directed at the surface. As visual complexity of the surface and demand on visual guidance of stepping increased, cats spent more time looking at the surface, looked closer to them, and switched between gaze behaviors more often. During both visually guided locomotor tasks, gaze behaviors predominantly followed a repeated cycle of forward gaze shift followed by fixation. We call this behavior gaze stepping. Each gaze shift took gaze to a site approximately 7580 cm in front of the cat, which the cat reached in 0.71.2 s and 1.11.6 strides. Constant gaze occupied only 521% of the time cats spent looking at the walking surface. PMID:24973656

  7. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion

    PubMed Central

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom


    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C−C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

  8. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion

    NASA Astrophysics Data System (ADS)

    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom


    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C-C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion.

  9. Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion.


    Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom


    Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N?) does not easily react with other chemicals. By dry ball-milling graphite with N?, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N? at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C--C bonds generated active carbon species that react directly with N? to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion. PMID:23877200

  10. Evidence for carbon flux shortage and strong carbon/nitrogen interactions in pea nodules at early stages of water stress.


    Glvez, Loli; Gonzlez, Esther M; Arrese-Igor, Cesar


    Symbiotic N2 fixation in legume nodules declines under a wide range of environmental stresses. A high correlation between N2 fixation decline and sucrose synthase (SS; EC activity down-regulation has been reported, although it has still to be elucidated whether a causal relationship between SS activity down-regulation and N2 fixation decline can be established. In order to study the likely C/N interactions within nodules and the effects on N2 fixation, pea plants (Pisum sativum L. cv. Sugar snap) were subjected to progressive water stress by withholding irrigation. Under these conditions, nodule SS activity declined concomitantly with apparent nitrogenase activity. The levels of UDP-glucose, glucose-1-phosphate, glucose-6-phosphate, and fructose-6-phosphate decreased in water-stressed nodules compared with unstressed nodules. Drought also had a marked effect on nodule concentrations of malate, succinate, and alpha-ketoglutarate. Moreover, a general decline in nodule adenylate content was detected. NADP+-dependent isocitrate dehydrogenase (ICDH; EC was the only enzyme whose activity increased as a result of water deficit, compensating for a possible C/N imbalance and/or supplying NADPH in circumstances that the pentose phosphate pathway was impaired, as suggested by the decline in glucose-6-phosphate dehydrogenase (G6PDH; EC activity. The overall results show the occurrence of strong C/N interactions in nodules subjected to water stress and support a likely limitation of carbon flux that might be involved in the decline of N2 fixation under drought. PMID:16061503

  11. The CCAAT box-binding factor stimulates ammonium assimilation in Saccharomyces cerevisiae, defining a new cross-pathway regulation between nitrogen and carbon metabolisms.

    PubMed Central

    Dang, V D; Bohn, C; Bolotin-Fukuhara, M; Daignan-Fornier, B


    In Saccharomyces cerevisiae, carbon and nitrogen metabolisms are connected via the incorporation of ammonia into glutamate; this reaction is catalyzed by the NADP-dependent glutamate dehydrogenase (NADP-GDH) encoded by the GDH1 gene. In this report, we show that the GDH1 gene requires the CCAAT box-binding activator (HAP complex) for optimal expression. This conclusion is based on several lines of evidence: (1) overexpression of GDH1 can correct the growth defect of hap2 and hap3 mutants on ammonium sulfate as a nitrogen source, (ii) Northern (RNA) blot analysis shows that the steady-state level of GDH1 mRNA is strongly lowered in a hap2 mutant, (iii) expression of a GDH1-lacZ fusion is drastically reduced in hap mutants, (iv) NADP-GDH activity is several times lower in the hap mutants compared with that in the isogenic wild-type strain, and finally, (v) site-directed mutagenesis of two consensual HAP binding sites in the GDH1 promoter strongly reduces expression of GDH1 and makes it HAP independent. Expression of GDH1 is also regulated by the carbon source, i.e., expression is higher on lactate than on ethanol, glycerol, or galactose, with the lowest expression being found on glucose. Finally, we show that a hap2 mutation does not affect expression of other genes involved in nitrogen metabolism (GDH2, GLN1, and GLN3 encoding, respectively, the NAD-GDH, glutamine synthetase, and a general activator of several nitrogen catabolic genes). The HAP complex is known to regulate expression of several genes involved in carbon metabolism; its role in the control of GDH1 gene expression, therefore, provides evidence for a cross-pathway regulation between carbon and nitrogen metabolisms. PMID:8606156

  12. John D.E., Z.A. Wang, X. Liu, R.H. Byrne, J.E. Corredor, J.M. López, A. Cabrera, D.A. Bronk, R. F. Tabita, and J.H. Paul. 2007. Carbon fixation gene (RuBisCO) transcripts and CO2 flux in the Mississippi River plume. ISME Journal. 1 -15.

    SciTech Connect

    John, D. E.; Wang, Z. A.; Liu, X.; Byrne, R. H.; Corredor, J. E.; López, J. M.; Cabrera, A.; Bronk, D. A.; Tabita, R. F.; Paul, J. H.


    River plumes deliver large quantities of nutrients to oligotrophic oceans, often resulting in significant CO2 drawdown. To determine the relationship between expression of the major gene in carbon fixation (large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, RuBisCO) and CO2 dynamics, we evaluated rbcL mRNA abundance using novel quantitative PCR assays, phytoplankton cell analyses, photophysiological parameters, and pCO2 in and around the Mississippi River plume (MRP) in the Gulf of Mexico. Lower salinity (30–32) stations were dominated by rbcL mRNA concentrations from heterokonts, such as diatoms and pelagophytes, which were at least an order of magnitude greater than haptophytes, a-Synechococcus or high-light Prochlorococcus. However, rbcL transcript abundances were similar among these groups at oligotrophic stations (salinity 34–36). Diatom cell counts and heterokont rbcL RNA showed a strong negative correlation to seawater pCO2. While Prochlorococcus cells did not exhibit a large difference between low and high pCO2 water, Prochlorococcus rbcL RNA concentrations had a strong positive correlation to pCO2, suggesting a very low level of RuBisCO RNA transcription among Prochlorococcus in the plume waters, possibly due to their relatively poor carbon concentrating mechanisms (CCMs). These results provide molecular evidence that diatom/pelagophyte productivity is largely responsible for the large CO2 drawdown occurring in the MRP, based on the cooccurrence of elevated RuBisCO gene transcript concentrations from this group and reduced seawater pCO2 levels. This may partly be due to efficient CCMs that enable heterokont eukaryotes such as diatoms to continue fixing CO2 in the face of strong CO2 drawdown. Our work represents the first attempt to relate in situ microbial gene expression to contemporaneous CO2 flux measurements in the ocean.

  13. Biomechanical evaluation of the Pinless external fixator.


    Stene, G M; Frigg, R; Schlegel, U; Swiontkowski, M


    In open fractures especially in those with severe soft tissue damage, fracture stabilisation is best achieved by using external fixators. There are some intrinsic complications which occur during classical external pin fixation. To overcome the problem of pin track infection and vascular damage from drilling, the Pinless external fixator was developed. It is based on the idea of a forceps with trocar points, which only penetrate the bone cortex superficially. The function of the device was tested in two mechanical trials and two in vitro tests in which one pinless clamp was put under a controlled load of 50 N, 150 cycles/day and studied over a 5 week period in sheep. The loads and time range of the experiment were chosen to simulate a temporary fracture stabilisation in a patient not bearing weight. The main question to be answered was whether the Pinless external fixator would be able to maintain stable fixation. Furthermore, it was to determine the changes at the trocar-to-bone interface. The clamp was found to maintain 72% of the initially applied clamping force after 5 weeks of in vivo application and it was found to be tight at removal. Some decrease of clamping force was found during the first 20 days and then the force tended to level off. There was no slippage nor did the clamp penetrate the cortex. There were no obvious signs of infection around the trocar-holes and in the bacterial tests no pathological cultures were grown. Histology revealed very localised bone reactions, the indentation caused by the trocar tips being only 1.2 mm deep. The study concludes, as far as could be ascertained from these tests, that it is safe to use pinless external fixation for temporary fracture fixation. PMID:1286923

  14. Autotrophic Microbe Metagenomes and Metabolic Pathways Differentiate Adjacent Red Sea Brine Pools

    PubMed Central

    Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan


    In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens. PMID:23624511

  15. Temporary external fixation facilitates open reduction and internal fixation of intra-articular calcaneal fractures.


    Elgamal, Tarek A; Tanagho, Andy E; Ferdinand, Rupert D


    Management of intra-articular calcaneal fractures during the past years has ranged from the nihilistic approach of no active treatment to open reduction and internal fixation or even to early subtalar arthrodesis. Operative treatment presents the surgeon with many challenges. Good results require atraumatic exposure, anatomic reduction, rigid fixation and early mobilization. We describe the use of a temporary external fixator as an intraoperative aid in the open reduction and internal fixation of intra-articular calcaneal fractures. We propose this operative strategy as an option for the treatment of calcaneal fractures. The controlled distractive force provides numerous benefits. These include improved exposure of the subtalar joint, correction of angulation and maintenance of temporary stability prior to definitive fixation. We have found this technique applicable and easily reproducible. PMID:24563983

  16. The importance of regulation of nitrogen fixation

    NASA Astrophysics Data System (ADS)

    Menge, D. N.


    I am not a proponent of including more detail in models simply because it makes them more realistic. More complexity increases the difficulty of model interpretation, so it only makes sense to include complexity if its benefit exceeds its costs. Biological nitrogen (N) fixation (BNF) is one process for which I feel the benefits of including greater complexity far outweigh the costs. I don't think that just because I work on BNF; I work on BNF because I think that. BNF, a microbial process carried out by free-living and symbiotic microbes, is the dominant N input to many ecosystems, the primary mechanism by which N deficiency can feed back to N inputs, and a main mechanism by which N surplus can develop. The dynamics of BNF, therefore, have huge implications for the rate of carbon uptake and the extent of CO2 fertilization, as well as N export to waterways and N2O emissions to the atmosphere. Unfortunately, there are serious deficiencies in our understanding of BNF. One main deficiency in our understanding is the extent to which various symbiotic N fixing organisms respond to imbalanced nutrition. Theory suggests that these responses, which I will call "strategies," have fundamental consequences for N fixer niches and ecosystem-level N and C cycling. Organisms that fix N regardless of whether they need it, a strategy that I will call "obligate," occupy post-disturbance niches and rapidly lead to N surplus. On the contrary, organisms that only fix as much N as they need, a "facultative" strategy, can occupy a wider range of successional niches, do not produce surplus N, and respond more rapidly to increased atmospheric CO2. In this talk I will show new results showing that consideration of these strategies could on its own explain the latitudinal distribution of symbiotic N fixing trees in North America. Specifically, the transition in N-fixing tree abundance from ~10% of basal area south of 35° latitude to ~1% of basal area north of 35° latitude that we observe from systematic forest inventory data can be explained by a concomitant switch from predominantly facultative N-fixing trees to predominantly obligate N-fixing trees. This transition in the dominant N-fixing strategy would have important consequences for the rate at which CO2 fertilization can occur and the extent of N surplus in different biomes. These theoretical and forest inventory results suggest that greater knowledge of BNF strategies would greatly increase our understanding of the distribution of N fixers and ecosystem responses to global change. I will finish the talk with a brief literature synthesis that attempts to draw generalizations about BNF strategies. With the limited data available, actinorhizal symbioses in temperate environments appear to be obligate but rhizobial symbioses appear to employ different strategies in different environments. From these results it is unclear whether the strategy is more strongly influenced by the microbes, the plants, or the environments in which the symbiosis has evolved; answering this question would point toward the best ways to incorporate N fixation into global ecosystem models.

  17. Effects of soil structure destruction on methane production and carbon partitioning between methanogenic pathways in tropical rain forest soils

    NASA Astrophysics Data System (ADS)

    Teh, Yit Arn; Silver, Whendee L.


    Controls on methanogenesis are often determined from laboratory incubations of soils converted to slurries. Destruction of soil structure during slurry conversion may disrupt syntrophic associations, kill methanogens, and/or alter the microsite distribution of methanogenic activity, suppressing CH4 production. The effects of slurry conversion on methanogenesis were investigated to determine if disruption of aggregate structure impacted methanogenesis, substrate utilization, and C partitioning between methanogenic pathways. Soils were collected from the tropical rain forest life zone of the Luquillo Experimental Forest, Puerto Rico, and exposed to different physical disturbances, including flooding and physical homogenization. Slurry conversion negatively impacted methanogenesis. Rates of CH4 production declined by a factor of 17 after well-aggregated soils were converted to slurries. Significantly more 13C-acetate was recovered in CO2 compared to CH4 after slurry conversion, suggesting that methanogens consumed less acetate after slurry conversion and may have competed less effectively with other anaerobes for acetate. Isotopic data indicate that the relative partitioning of C between aceticlastic and hydrogenotrophic pathways was unchanged after slurry conversion. These data suggest that experiments which destroy soil structure may significantly underestimate methanogenesis and overestimate the potential for other microorganisms to compete with methanogens for organic substrates. Current knowledge of the factors that regulate methanogenesis in soil may be biased by the findings of slurry-based experiments, that do not accurately represent the complex, spatially heterogeneous conditions found in well-aggregated soils.

  18. Requirement of carbon dioxide for initial growth of facultative methylotroph, Acidomonas methanolica MB58.


    Mitsui, Ryoji; Katayama, Hiroko; Tanaka, Mitsuo


    The facultative methylotrophic bacterium Acidomonas methanolica MB58 can utilize C1 compounds via the ribulose monophosphate pathway. A large gene cluster comprising three components related to C1 metabolism was found in the genome. From upstream, the first was an mxa cluster encoding proteins for oxidation of methanol to formaldehyde; the second was the rmp cluster encoding enzymes for formaldehyde fixation; and the third was the cbb gene cluster encoding proteins for carbon dioxide (CO2) fixation. Examination of CO2 requirements for growth of A.methanolica MB58 cells demonstrated that it did not grow on any carbon source under CO2-free conditions. Measurement of ribulose-1,5-bisphosphate carboxylase activity and RT-PCR analysis demonstrated enzymatic activity was detected in A.methanolica MB58 at growth phase, regardless of carbon sources. However, methanol dehydrogenase and 3-hexlose-6-phosphate synthase expression was regulated by methanol or formaldehyde; it were detected during growth and apparently differed from ribulose-1,5-bisphosphate carboxylase expression. These results suggested that A.methanolica MB58 may be initially dependent on autotrophic growth and that carbon assimilation was subsequently coupled with the ribulose monophosphate pathway at early- to mid-log phases during methylotrophic growth. PMID:25511787

  19. [Visual fixation features after treatment of exudative age macular degeneration].


    Surguch, V K; Surnina, Z V; Sizova, M V


    Changes of visual fixation in patients with choroidal neovascularitation (CNV) associated with age macular degeneration (AMD) after bevacizumab are studied. 45 patients (45 eyes) with active CNV treated with intravitreal bevacizumab were enrolled into the study. Visual fixation was studied before and 3-6 months after treatment using original method that included fundus foto and fluorescein angiography. Fixation relative to fovea and lesion was evaluated. Foveal fixation beyond lesion was found in 9%, foveal fixation within lesion--in 47%, extrafoveal fixation beyond lesion--in 18%, extrafoveal fixation within lesion--in 26% of patients. Changes of fixation localization after treatment was found in 24% patients. Examination of visual fixation may be useful for prognosis of anti-VEGF treatment efficacy in patients with CNV. PMID:21721271

  20. Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria.


    Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrs-Ali, Carlos; Gonzlez, Jos M; Pinhassi, Jarone


    Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 8% and 24 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light--but only in Ala--contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy. PMID:25136122

  1. Nano-scale, planar and multi-tiered current pathways from a carbon nanotube-copper composite with high conductivity, ampacity and stability.


    Subramaniam, Chandramouli; Sekiguchi, Atsuko; Yamada, Takeo; Futaba, Don N; Hata, Kenji


    New lithographically processable materials with high ampacity are in demand to meet the increasing requirement for high operational current density at high temperatures existing in current pathways within electronic devices. To meet this demand, we report an approach to fabricate a high ampacity (?100 times higher than Cu) carbon nanotube-copper (CNT-Cu) composite into a variety of complex nano-scale, planar and multi-tiered current pathways. The approach involved the use of a two-stage electrodeposition of copper into a pre-patterned template of porous, thin CNT sheets acting as the electrode. The versatility of this approach enabled the realization of completely suspended multi-tier, dielectric-less 'air-gap' CNT-Cu circuits that could be electrically isolated from each other and are challenging to fabricate with pure Cu or any metal. Importantly, all such complex structures, ranging from 500 nm to 20 ?m in width, exhibited ?100-times higher ampacity than any known metal, with comparable electrical conductivity as Cu. In addition, CNT-Cu structures also exhibited a superior temperature stability compared to the ?10-times wider Cu counterparts. We believe that the combination of our approach and the properties demonstrated here are vital achievements for the future development of efficient and powerful electrical devices. PMID:26486752

  2. Nano-scale, planar and multi-tiered current pathways from a carbon nanotube-copper composite with high conductivity, ampacity and stability

    NASA Astrophysics Data System (ADS)

    Subramaniam, Chandramouli; Sekiguchi, Atsuko; Yamada, Takeo; Futaba, Don N.; Hata, Kenji


    New lithographically processable materials with high ampacity are in demand to meet the increasing requirement for high operational current density at high temperatures existing in current pathways within electronic devices. To meet this demand, we report an approach to fabricate a high ampacity (~100 times higher than Cu) carbon nanotube-copper (CNT-Cu) composite into a variety of complex nano-scale, planar and multi-tiered current pathways. The approach involved the use of a two-stage electrodeposition of copper into a pre-patterned template of porous, thin CNT sheets acting as the electrode. The versatility of this approach enabled the realization of completely suspended multi-tier, dielectric-less `air-gap' CNT-Cu circuits that could be electrically isolated from each other and are challenging to fabricate with pure Cu or any metal. Importantly, all such complex structures, ranging from 500 nm to 20 μm in width, exhibited ~100-times higher ampacity than any known metal, with comparable electrical conductivity as Cu. In addition, CNT-Cu structures also exhibited a superior temperature stability compared to the ~10-times wider Cu counterparts. We believe that the combination of our approach and the properties demonstrated here are vital achievements for the future development of efficient and powerful electrical devices.

  3. Single-walled carbon nanotube exposure induces membrane rearrangement and suppression of receptor-mediated signalling pathways in model mast cells

    PubMed Central

    Umemoto, Eric Y.; Speck, Mark; Shimoda, Lori M.N.; Kahue, Kara; Sung, Carl; Stokes, Alexander J.; Turner, Helen


    Carbon nanotubes (CNT) are environmental challenges to the respiratory and gastrointestinal mucosa, and to the dermal immune system. Mast cells (MC) are pro-inflammatory immunocytes that reside at these interfaces with the environment. Mast cells are sources of pro-inflammatory mediators (histamine, serotonin, matrix-active proteases, eicosanoids, prostanoids, cytokines and chemokines), which are released in a calcium-dependent manner following immunological challenge or physico-chemical stimulation. Since C-60 fullerenes, which share geometry with CNT, are suppressive of mast cell-driven inflammatory responses, we explored the effects of unmodified SWCNT aggregates on mast cell signaling pathways, phenotype and pro-inflammatory function. We noted SWCNT suppression of antigen-induced signalling pathways and pro-inflammatory degranulation responses. Mast cells recognize unmodified SWCNT by remodeling the plasma membrane, disaggregating the cortical actin cytoskeleton and relocalizing clathrin. Clathrin was also identified as a component of an affinity-purified interactome isolated from MC using an SWCNT affinity matrix for mast cell lysates. Together these data are consistent with the ability of SWCNT to suppress mast cell pro-inflammatory function via a novel recognition mechanism. PMID:24910985

  4. Effects of multi-walled carbon nanotube (MWCNT) on antioxidant depletion, the ERK signaling pathway, and copper bioavailability in the copepod (Tigriopus japonicus).


    Lee, Jin Wuk; Won, Eun-Ji; Kang, Hye-Min; Hwang, Dae-Sik; Kim, Duck-Hyun; Kim, Rae-Kwon; Lee, Su-Jae; Lee, Jae-Seong


    Multi-walled carbon nanotubes (MWCNTs) are nanoparticles widely applicable in various industrial fields. However, despite the usefulness of MWCNTs in industry, their oxidative stress-induced toxicity, combined toxicity with metal, and mitogen-activated protein kinase (MAPK) activation have not been widely investigated in marine organisms. We used the intertidal copepod Tigriopus japonicus as a test organism to demonstrate the adverse effects induced by MWCNTs in aquatic test organisms. The dispersion of the MWCNTs in seawater was maintained over 48h without aggregation. MWCNTs caused a decrease in acute copper toxicity compared to the copper-only group in response to 20 and 100mg/L MWCNTs, but not in response to 4mg/L MWCNT, indicating that MWCNT may suppress acute copper toxicity. Reactive oxygen species (ROS) and enzymatic activities of glutathione S-transferase (GST) and catalase were significantly down-regulated in response to 100mg/L MWCNT exposure. Glutathione (GSH) and glutathione reductase (GR) activity did not change significantly, indicating that MWCNTs may cause failure of the antioxidant system in T. japonicus. However, MWCNT induced extracellular signal-regulated kinase (ERK) activation without p38 and c-jun NH2-terminal kinase (JNK) activation, suggesting that ERK activation plays a key role in cell signaling pathways downstream of CNT exposure. This suggests that this pathway can be used as a biomarker for CNT exposure in T. japonicus. This study provides a better understanding of the cellular-damage response to MWCNTs. PMID:26716406

  5. Carbon ion beam triggers both caspase-dependent and caspase-independent pathway of apoptosis in HeLa and status of PARP-1 controls intensity of apoptosis.


    Ghorai, Atanu; Sarma, Asitikantha; Bhattacharyya, Nitai P; Ghosh, Utpal


    High linear energy transfer (LET) carbon ion beam (CIB) is becoming very promising tool for various cancer treatments and is more efficient than conventional low LET gamma or X-rays to kill malignant or radio-resistant cells, although detailed mechanism of cell death is still unknown. Poly (ADP-ribose) polymerase-1 (PARP-1) is a key player in DNA repair and its inhibitors are well-known as radio-sensitizer for low LET radiation. The objective of our study was to find mechanism(s) of induction of apoptosis by CIB and role of PARP-1 in CIB-induced apoptosis. We observed overall higher apoptosis in PARP-1 knocked down HeLa cells (HsiI) compared with negative control H-vector cells after irradiation with CIB (0-4Gy). CIB activated both intrinsic and extrinsic pathways of apoptosis via caspase-9 and caspase-8 activation respectively, followed by caspase-3 activation, apoptotic body, nucleosomal ladder formation and sub-G1 accumulation. Apoptosis inducing factor translocation into nucleus in H-vector but not in HsiI cells after CIB irradiation contributed caspase-independent apoptosis. Higher p53 expression was observed in HsiI cells compared with H-vector after exposure with CIB. Notably, we observed about 37% fall of mitochondrial membrane potential, activation of caspase-9 and caspase-3 and mild activation of caspase-8 without any detectable apoptotic body formation in un-irradiated HsiI cells. We conclude that reduction of PARP-1 expression activates apoptotic signals via intrinsic and extrinsic pathways in un-irradiated cells. CIB irradiation further intensified both intrinsic and extrinsic pathways of apoptosis synergistically along with up-regulation of p53 in HsiI cells resulting overall higher apoptosis in HsiI than H-vector. PMID:25670618

  6. One-Carbon Metabolism Pathway Gene Variants and Risk of Clear Cell Renal Cell Carcinoma in a Chinese Population

    PubMed Central

    Cai, Hongzhou; Li, Pu; Cao, Qiang; Shao, Pengfei; Qin, Chao; Yin, Changjun


    Background One-carbon metabolism is the basement of nucleotide synthesis and the methylation of DNA linked to cancer risk. Variations in one-carbon metabolism genes are reported to affect the risk of many cancers, including renal cancer, but little knowledge about this mechanism is known in Chinese population. Methods Each subject donated 5 mL venous blood after signing the agreement. The study was approved by the Institutional Review Board of the Nanjing Medical University, Nanjing, China. 18 SNPs in six one-carbon metabolism-related genes (CBS, MTHFR, MTR, MTRR, SHMT1, and TYMS) were genotyped in 859 clear cell renal cell carcinoma (ccRCC) patients and 1005 cancer-free controls by the Snapshot. Results Strong associations with ccRCC risk were observed for rs706209 (P = 0.006) in CBS and rs9332 (P = 0.027) in MTRR. Compared with those carrying none variant allele, individuals carrying one or more variant alleles in these two genes had a statistically significantly decreased risk of ccRCC [P = 0.001, adjusted odds ratio (OR) = 0.73, 95% confidence interval (CI) = 0.06–0.90]. In addition, patients carrying one or more variant alleles were more likely to develop localized stage disease (P = 0.002, adjusted OR = 1.37, 95%CI = 1.11–1.69) and well-differentiated ccRCC (P<0.001, adjusted OR = 1.42, 95%CI = 0.87–1.68). In the subgroup analysis, individuals carrying none variant allele in older group (P = 0.007, adjusted OR = 0.67, 95%CI = 0.49–0.91), male group (P = 0.007, adjusted OR = 0.71, 95%CI = 0.55–0.92), never smoking group (P = 0.002, adjusted OR = 0.68, 95%CI = 0.53–0.88) and never drinking group (P<0.001, adjusted OR = 0.68, 95%CI = 0.53–0.88) had an increased ccRCC risk. Conclusions Our results suggest that the polymorphisms of the one-carbon metabolism-related genes are associated with ccRCC risk in Chinese population. Future population-based prospective studies are required to confirm the results. PMID:24278388

  7. Quantum Chemistry Study of Cycloaddition Pathways for the Reaction of o-Benzyne with Fullerenes and Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Jaffe, Richard; Han, Jie; Langhoff, Stephen R. (Technical Monitor)


    Functionalization of fullerenes via the [2+2] cycloaddition reaction with o-benzyne has been demonstrated in the laboratory. In contrast, [2+4) cycloaddition products are formed when benzyne reacts with planar polycyclic aromatic hydrocarbons. Using density functional theory (DFT) calculations with Becke's hybrid functional and small contracted gaussian basis sets, we are able to reproduce these product preferences. The objective of this work is to explore the functionalization of carbon nanotubes. We have studied o-benzyne cycloaddition products with a [14,0] single-walled nanotube. We find both the [2+2] and [2+4] adducts to be stable, with the latter product being somewhat favored.

  8. Carbon isotopic composition, methanogenic pathway, and fraction of CH4 oxidized in a rice field flooded year-round

    NASA Astrophysics Data System (ADS)

    Zhang, Guangbin; Zhang, Xiaoyan; Ji, Yang; Ma, Jing; Xu, Hua; Cai, Zucong


    Values of ?13C were investigated of CH4 trapped in the soil pore water and floodwater of and emitted from a rice field under continuous flooding throughout the fallow and following rice seasons, and CH4 produced via different pathways and fraction of CH4 oxidized was calculated by using the isotopic data. Pore water CH4 was relatively 13C depleted, with ?13C values about -65 over the season except between July and August (around -55). Also, hydrogenotrophic methanogenesis was very important (around 50%) for most of the season, while acetoclastic methanogenesis dominated (about 70%) only between July and August. Floodwater CH4 was heavier in ?13C value (from -50 to -34) than pore water CH4 (from -68 to -54) over the season, demonstrating that it is highly influenced by methanotrophy. The ?13C value of emitted CH4was negatively correlated with flux in temporal variation (P <0.05), and it was more positive in the fallow season (between -56 and -44) than in the rice season (between -68 and -48). This indicates that plant-mediated CH4 transport is probably a more important pathway and causes less CH4 oxidation during the rice season than during the fallow season, which is further confirmed by the fraction of CH4 oxidized being generally greater in the fallow season (60%-90%) than in the rice season (10%-80%). These findings suggest a low contribution of acetoclastic methanogenesis and a high fraction of CH4 being oxidized in the field, especially in the fallow season.

  9. Chemical and physical basics of routine formaldehyde fixation.


    Thavarajah, Rooban; Mudimbaimannar, Vidya Kazhiyur; Elizabeth, Joshua; Rao, Umadevi Krishnamohan; Ranganathan, Kannan


    Formaldehyde is the widely employed fixative that has been studied for decades. The chemistry of fixation has been studied widely since the early 20(th) century. However, very few studies have been focused on the actual physics/chemistry aspect of process of this fixation. This article attempts to explain the chemistry of formaldehyde fixation and also to study the physical aspects involved in the fixation. The factors involved in the fixation process are discussed using well documented mathematical and physical formulae. The deeper understanding of these factors will enable pathologist to optimize the factors and use them in their favor. PMID:23248474

  10. Chemical and physical basics of routine formaldehyde fixation

    PubMed Central

    Thavarajah, Rooban; Mudimbaimannar, Vidya Kazhiyur; Elizabeth, Joshua; Rao, Umadevi Krishnamohan; Ranganathan, Kannan


    Formaldehyde is the widely employed fixative that has been studied for decades. The chemistry of fixation has been studied widely since the early 20th century. However, very few studies have been focused on the actual physics/chemistry aspect of process of this fixation. This article attempts to explain the chemistry of formaldehyde fixation and also to study the physical aspects involved in the fixation. The factors involved in the fixation process are discussed using well documented mathematical and physical formulae. The deeper understanding of these factors will enable pathologist to optimize the factors and use them in their favor. PMID:23248474

  11. Rapid Two-Temperature Formalin Fixation

    PubMed Central

    Roberts, Esteban; Borlee, Grace; Otter, Michael; Baird, Geoffrey S.


    Formalin fixation is a mainstay of modern histopathologic analysis, yet the practice is poorly standardized and a significant potential source of preanalytical errors. Concerns of workflow and turnaround time drive interest in developing shorter fixation protocols, but rapid protocols can lead to poor histomorphology or inadequate downstream assay results. Additionally, assays such as immunohistochemistry for phosphorylated epitopes have historically been challenging in the context of formalin-fixed tissue, indicating that there may be room for improvement in this process that is fundamental to the practice of anatomic pathology. With these issues in mind, we studied basic formalin biochemistry to develop a novel formalin fixation protocol that inv