Note: This page contains sample records for the topic carbon fixation pathways from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: August 15, 2014.
1

Improving carbon fixation pathways.  

PubMed

A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that novel pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials. PMID:22647231

Ducat, Daniel C; Silver, Pamela A

2012-08-01

2

Improving Carbon Fixation Pathways  

PubMed Central

A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that alternative pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials.

Ducat, Daniel C.

2012-01-01

3

An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis  

PubMed Central

Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes.

Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thurmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Muller, Volker

2012-01-01

4

Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans  

PubMed Central

Background Acidithiobacillus ferrooxidans is chemolithoautotrophic ?-proteobacterium that thrives at extremely low pH (pH 1-2). Although a substantial amount of information is available regarding CO2 uptake and fixation in a variety of facultative autotrophs, less is known about the processes in obligate autotrophs, especially those living in extremely acidic conditions, prompting the present study. Results Four gene clusters (termed cbb1-4) in the A. ferrooxidans genome are predicted to encode enzymes and structural proteins involved in carbon assimilation via the Calvin-Benson-Bassham (CBB) cycle including form I of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO, EC 4.1.1.39) and the CO2-concentrating carboxysomes. RT-PCR experiments demonstrated that each gene cluster is a single transcriptional unit and thus is an operon. Operon cbb1 is divergently transcribed from a gene, cbbR, encoding the LysR-type transcriptional regulator CbbR that has been shown in many organisms to regulate the expression of RubisCO genes. Sigma70-like -10 and -35 promoter boxes and potential CbbR-binding sites (T-N11-A/TNA-N7TNA) were predicted in the upstream regions of the four operons. Electrophoretic mobility shift assays (EMSAs) confirmed that purified CbbR is able to bind to the upstream regions of the cbb1, cbb2 and cbb3 operons, demonstrating that the predicted CbbR-binding sites are functional in vitro. However, CbbR failed to bind the upstream region of the cbb4 operon that contains cbbP, encoding phosphoribulokinase (EC 2.7.1.19). Thus, other factors not present in the assay may be required for binding or the region lacks a functional CbbR-binding site. The cbb3 operon contains genes predicted to encode anthranilate synthase components I and II, catalyzing the formation of anthranilate and pyruvate from chorismate. This suggests a novel regulatory connection between CO2 fixation and tryptophan biosynthesis. The presence of a form II RubisCO could promote the ability of A. ferrooxidans to fix CO2 at different concentrations of CO2. Conclusions A. ferrooxidans has features of cbb gene organization for CO2-assimilating functions that are characteristic of obligate chemolithoautotrophs and distinguish this group from facultative autotrophs. The most conspicuous difference is a separate operon for the cbbP gene. It is hypothesized that this organization may provide greater flexibility in the regulation of expression of genes involved in inorganic carbon assimilation.

2010-01-01

5

Carbon dioxide fixation.  

National Technical Information Service (NTIS)

Solar carbon dioxide fixation offers the possibility of a renewable source of chemicals and fuels in the future. Its realization rests on future advances in the efficiency of solar energy collection and development of suitable catalysts for CO(sub 2) conv...

E. Fujita

2000-01-01

6

Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans  

Microsoft Academic Search

BACKGROUND: Acidithiobacillus ferrooxidans is chemolithoautotrophic ?-proteobacterium that thrives at extremely low pH (pH 1-2). Although a substantial amount of information is available regarding CO2 uptake and fixation in a variety of facultative autotrophs, less is known about the processes in obligate autotrophs, especially those living in extremely acidic conditions, prompting the present study. RESULTS: Four gene clusters (termed cbb1-4) in

Mario Esparza; Juan Pablo Cárdenas; Botho Bowien; Eugenia Jedlicki; David S. Holmes

2010-01-01

7

Widespread Occurrence of Two Carbon Fixation Pathways in Tubeworm Endosymbionts: Lessons from Hydrothermal Vent Associated Tubeworms from the Mediterranean Sea  

PubMed Central

Vestimentiferan tubeworms (siboglinid polychetes) of the genus Lamellibrachia are common members of cold seep faunal communities and have also been found at sedimented hydrothermal vent sites in the Pacific. As they lack a digestive system, they are nourished by chemoautotrophic bacterial endosymbionts growing in a specialized tissue called the trophosome. Here we present the results of investigations of tubeworms and endosymbionts from a shallow hydrothermal vent field in the Western Mediterranean Sea. The tubeworms, which are the first reported vent-associated tubeworms outside the Pacific, are identified as Lamellibrachia anaximandri using mitochondrial ribosomal and cytochrome oxidase I (COI) gene sequences. They harbor a single gammaproteobacterial endosymbiont. Carbon isotopic data, as well as the analysis of genes involved in carbon and sulfur metabolism indicate a sulfide-oxidizing chemoautotrophic endosymbiont. The detection of a hydrogenase gene fragment suggests the potential for hydrogen oxidation as alternative energy source. Surprisingly, the endosymbiont harbors genes for two different carbon fixation pathways, the Calvin-Benson-Bassham (CBB) cycle as well as the reductive tricarboxylic acid (rTCA) cycle, as has been reported for the endosymbiont of the vent tubeworm Riftia pachyptila. In addition to RubisCO genes we detected ATP citrate lyase (ACL – the key enzyme of the rTCA cycle) type II gene sequences using newly designed primer sets. Comparative investigations with additional tubeworm species (Lamellibrachia luymesi, Lamellibrachia sp. 1, Lamellibrachia sp. 2, Escarpia laminata, Seepiophila jonesi) from multiple cold seep sites in the Gulf of Mexico revealed the presence of acl genes in these species as well. Thus, our study suggests that the presence of two different carbon fixation pathways, the CBB cycle and the rTCA cycle, is not restricted to the Riftia endosymbiont, but rather might be common in vestimentiferan tubeworm endosymbionts, regardless of the habitat.

Thiel, Vera; Hugler, Michael; Blumel, Martina; Baumann, Heike I.; Gartner, Andrea; Schmaljohann, Rolf; Strauss, Harald; Garbe-Schonberg, Dieter; Petersen, Sven; Cowart, Dominique A.; Fisher, Charles R.; Imhoff, Johannes F.

2012-01-01

8

Potential role of multiple carbon fixation pathways during lipid accumulation in Phaeodactylum tricornutum  

PubMed Central

Background Phaeodactylum tricornutum is a unicellular diatom in the class Bacillariophyceae. The full genome has been sequenced (<30?Mb), and approximately 20 to 30% triacylglyceride (TAG) accumulation on a dry cell basis has been reported under different growth conditions. To elucidate P. tricornutum gene expression profiles during nutrient-deprivation and lipid-accumulation, cell cultures were grown with a nitrate to phosphate ratio of 20:1 (N:P) and whole-genome transcripts were monitored over time via RNA-sequence determination. Results The specific Nile Red (NR) fluorescence (NR fluorescence per cell) increased over time; however, the increase in NR fluorescence was initiated before external nitrate was completely exhausted. Exogenous phosphate was depleted before nitrate, and these results indicated that the depletion of exogenous phosphate might be an early trigger for lipid accumulation that is magnified upon nitrate depletion. As expected, many of the genes associated with nitrate and phosphate utilization were up-expressed. The diatom-specific cyclins cyc7 and cyc10 were down-expressed during the nutrient-deplete state, and cyclin B1 was up-expressed during lipid-accumulation after growth cessation. While many of the genes associated with the C3 pathway for photosynthetic carbon reduction were not significantly altered, genes involved in a putative C4 pathway for photosynthetic carbon assimilation were up-expressed as the cells depleted nitrate, phosphate, and exogenous dissolved inorganic carbon (DIC) levels. P. tricornutum has multiple, putative carbonic anhydrases, but only two were significantly up-expressed (2-fold and 4-fold) at the last time point when exogenous DIC levels had increased after the cessation of growth. Alternative pathways that could utilize HCO3- were also suggested by the gene expression profiles (e.g., putative propionyl-CoA and methylmalonyl-CoA decarboxylases). Conclusions The results indicate that P. tricornutum continued carbon dioxide reduction when population growth was arrested and different carbon-concentrating mechanisms were used dependent upon exogenous DIC levels. Based upon overall low gene expression levels for fatty acid synthesis, the results also suggest that the build-up of precursors to the acetyl-CoA carboxylases may play a more significant role in TAG synthesis rather than the actual enzyme levels of acetyl-CoA carboxylases per se. The presented insights into the types and timing of cellular responses to inorganic carbon will help maximize photoautotrophic carbon flow to lipid accumulation.

2012-01-01

9

Photosynthesis of Grass Species Differing in Carbon Dioxide Fixation Pathways 1  

PubMed Central

Panicum species of the Laxa group were investigated in a series of published reports and were found to possess C4, C3, and intermediate photosynthetic characteristics. Taxonomic and other relationships among these plants, however, are not clear. It was the objective of this investigation to document chromosome number, metaphase I chromosome behavior, and mode of reproduction, including abnormalities in the embryo sac, for these species. Chromosome counts showed a basic number (x) of 10 and ploidy levels of diploid (2n = 2x = 20), tetraploid (2n = 4x = 40), and hexaploid (2n = 6x = 60) in this group of Panicum. One diploid and one tetraploid accession of the C4 species, Panicum prionitis Griseb., were obtained. Of the intermediate species, Panicum milioides Nees ex Trin. was diploid, Panicum schenckii Hack. was hexaploid, and Panicum decipiens Nees, ex Trin. was found to possess two ploidy levels, one accession being diploid and the other accession being hexaploid. All the C3 species, which included two accessions of Panicum laxum Sw., three accessions of Panicum hylaeicum Mez., and one accession of Panicum rivulare Trin., were tetraploid. Meiosis was regular with primarily bivalent pairing at metaphase I in all species except the tetraploid accession of P. prionitis which possessed from 4 to 10 tetravalents. Stainable pollen was high in all species, ranging from 70 to 99%. Embryo sac analyses showed a single sac in all plants except the tetraploid accession of P. prionitis, which was found to possess an additional sac at anthesis. An additional sac was also observed in some ovaries of the P. schenckii accession. Self-pollinated seed set was high in all accessions except the diploid accession of P. prionitis and one accession of P. laxum where no seed was set under bagged conditions. This information establishes, within the limits of this collection, a base for future studies on genetic, taxonomic, photosynthetic, and evolutionary relationships among these plants. Possession of the same basic chromosome number, regular meiotic pairing, a high degree of stainable pollen, and good seed set in most of the plants studied indicate possible success in making hybrids for a genetic study of photosynthetic pathways in Panicum. Images

Bouton, Joseph H.; Brown, R. Harold; Bolton, Jacqueline K.; Campagnoli, Raymond P.

1981-01-01

10

Beyond the Calvin Cycle: Autotrophic Carbon Fixation in the Ocean  

NASA Astrophysics Data System (ADS)

Organisms capable of autotrophic metabolism assimilate inorganic carbon into organic carbon. They form an integral part of ecosystems by making an otherwise unavailable form of carbon available to other organisms, a central component of the global carbon cycle. For many years, the doctrine prevailed that the Calvin-Benson-Bassham (CBB) cycle is the only biochemical autotrophic CO2 fixation pathway of significance in the ocean. However, ecological, biochemical, and genomic studies carried out over the last decade have not only elucidated new pathways but also shown that autotrophic carbon fixation via pathways other than the CBB cycle can be significant. This has ramifications for our understanding of the carbon cycle and energy flow in the ocean. Here, we review the recent discoveries in the field of autotrophic carbon fixation, including the biochemistry and evolution of the different pathways, as well as their ecological relevance in various oceanic ecosystems.

Hügler, Michael; Sievert, Stefan M.

2011-01-01

11

The emergence and early evolution of biological carbon-fixation.  

PubMed

The fixation of CO? into living matter sustains all life on Earth, and embeds the biosphere within geochemistry. The six known chemical pathways used by extant organisms for this function are recognized to have overlaps, but their evolution is incompletely understood. Here we reconstruct the complete early evolutionary history of biological carbon-fixation, relating all modern pathways to a single ancestral form. We find that innovations in carbon-fixation were the foundation for most major early divergences in the tree of life. These findings are based on a novel method that fully integrates metabolic and phylogenetic constraints. Comparing gene-profiles across the metabolic cores of deep-branching organisms and requiring that they are capable of synthesizing all their biomass components leads to the surprising conclusion that the most common form for deep-branching autotrophic carbon-fixation combines two disconnected sub-networks, each supplying carbon to distinct biomass components. One of these is a linear folate-based pathway of CO? reduction previously only recognized as a fixation route in the complete Wood-Ljungdahl pathway, but which more generally may exclude the final step of synthesizing acetyl-CoA. Using metabolic constraints we then reconstruct a "phylometabolic" tree with a high degree of parsimony that traces the evolution of complete carbon-fixation pathways, and has a clear structure down to the root. This tree requires few instances of lateral gene transfer or convergence, and instead suggests a simple evolutionary dynamic in which all divergences have primary environmental causes. Energy optimization and oxygen toxicity are the two strongest forces of selection. The root of this tree combines the reductive citric acid cycle and the Wood-Ljungdahl pathway into a single connected network. This linked network lacks the selective optimization of modern fixation pathways but its redundancy leads to a more robust topology, making it more plausible than any modern pathway as a primitive universal ancestral form. PMID:22536150

Braakman, Rogier; Smith, Eric

2012-01-01

12

Computation of metabolic fluxes and efficiencies for biological carbon dioxide fixation.  

PubMed

With rising energy prices and concern over the environmental impact of fossil fuel consumption, the push to develop biomass derived fuels has increased significantly. Although most global carbon fixation occurs via the Calvin Benson Bassham cycle, there are currently five other known pathways for carbon fixation; the goal of this study was to determine the thermodynamic efficiencies of all six carbon fixation pathways for the production of biomass using flux balance analysis. The three chemotrophic pathways, the reductive acetyl-CoA pathway, the 3-hydroxypropionate/4-hydroxybutyrate cycle and the dicarboxylate/4-hydroxybutyrate cycle, were found to be more efficient than photoautotrophic carbon fixation pathways. However, as hydrogen is not freely available, the energetic cost of hydrogen production from sunlight was calculated and included in the overall energy demand, which results in a 5 fold increase in the energy demand of chemoautotrophic carbon fixation. Therefore, when the cost of hydrogen production is included, photoautotrophic pathways are more efficient. However, the energetic cost for the production of 12 metabolic precursors was found to vary widely across the different carbon fixation pathways; therefore, different pathways may be more efficient at producing products from a single precursor than others. The results of this study have significant impact on the selection or design of autotrophic organisms for biofuel or biochemical production. Overall biomass production from solar energy is most efficient in organisms using the reductive TCA cycle, however, products derived from one metabolic precursor may be more efficiently produced using other carbon fixation pathways. PMID:21276868

Boyle, Nanette R; Morgan, John A

2011-03-01

13

Current views on the regulation of autotrophic carbon dioxide fixation via the Calvin cycle in bacteria  

Microsoft Academic Search

The Calvin cycle of carbon dioxide fixation constitutes a biosynthetic pathway for the generation of (multi-carbon) intermediates\\u000a of central metabolism from the one-carbon compound carbon dioxide. The product of this cycle can be used as a precursor for\\u000a the synthesis of all components of cell material. Autotrophic carbon dioxide fixation is energetically expensive and it is\\u000a therefore not surprising that

L. Dijkhuizen; W. Harder

1984-01-01

14

Stable Carbon Isotopic Fractionations Associated with Inorganic Carbon Fixation by Anaerobic Ammonium-Oxidizing Bacteria  

PubMed Central

Isotopic analyses of Candidatus “Brocadia anammoxidans,” a chemolithoautotrophic bacterium that anaerobically oxidizes ammonium (anammox), show that it strongly fractionates against 13C; i.e., lipids are depleted by up to 47‰ versus CO2. Similar results were obtained for the anammox bacterium Candidatus “Scalindua sorokinii,” which thrives in the anoxic water column of the Black Sea, suggesting that different anammox bacteria use identical carbon fixation pathways, which may be either the Calvin cycle or the acetyl coenzyme A pathway.

Schouten, Stefan; Strous, Marc; Kuypers, Marcel M. M.; Rijpstra, W. Irene C.; Baas, Marianne; Schubert, Carsten J.; Jetten, Mike S. M.; Sinninghe Damste, Jaap S.

2004-01-01

15

Spatially ordered dynamics of the bacterial carbon fixation machinery.  

PubMed

Cyanobacterial carbon fixation is a major component of the global carbon cycle. This process requires the carboxysome, an organelle-like proteinaceous microcompartment that sequesters the enzymes of carbon fixation from the cytoplasm. Here, fluorescently tagged carboxysomes were found to be spatially ordered in a linear fashion. As a consequence, cells undergoing division evenly segregated carboxysomes in a nonrandom process. Mutation of the cytoskeletal protein ParA specifically disrupted carboxysome order, promoted random carboxysome segregation during cell division, and impaired carbon fixation after disparate partitioning. Thus, cyanobacteria use the cytoskeleton to control the spatial arrangement of carboxysomes and to optimize the metabolic process of carbon fixation. PMID:20203050

Savage, David F; Afonso, Bruno; Chen, Anna H; Silver, Pamela A

2010-03-01

16

Acetogenesis and the Wood-Ljungdahl Pathway of CO2 Fixation  

PubMed Central

I. Summary Conceptually, the simplest way to synthesize an organic molecule is to construct it one carbon at a time. The Wood-Ljungdahl pathway of CO2 fixation involves this type of stepwise process. The biochemical events that underlie the condensation of two one-carbon units to form the two-carbon compound, acetate, have intrigued chemists, biochemists, and microbiologists for many decades. We begin this review with a description of the biology of acetogenesis. Then, we provide a short history of the important discoveries that have led to the identification of the key components and steps of this usual mechanism of CO and CO2 fixation. In this historical perspective, we have included reflections that hopefully will sketch the landscape of the controversies, hypotheses, and opinions that led to the key experiments and discoveries. We then describe the properties of the genes and enzymes involved in the pathway and conclude with a section describing some major questions that remain unanswered.

Ragsdale, Stephen W.; Pierce, Elizabeth

2008-01-01

17

Stable carbon isotopic fractionations associated with inorganic carbon fixation by anaerobic ammonium-oxidizing bacteria.  

PubMed

Isotopic analyses of Candidatus "Brocadia anammoxidans," a chemolithoautotrophic bacterium that anaerobically oxidizes ammonium (anammox), show that it strongly fractionates against (13)C; i.e., lipids are depleted by up to 47 per thousand versus CO(2). Similar results were obtained for the anammox bacterium Candidatus "Scalindua sorokinii," which thrives in the anoxic water column of the Black Sea, suggesting that different anammox bacteria use identical carbon fixation pathways, which may be either the Calvin cycle or the acetyl coenzyme A pathway. PMID:15184193

Schouten, Stefan; Strous, Marc; Kuypers, Marcel M M; Rijpstra, W Irene C; Baas, Marianne; Schubert, Carsten J; Jetten, Mike S M; Sinninghe Damsté, Jaap S

2004-06-01

18

Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation.  

PubMed

Archaea of the phylum Thaumarchaeota are among the most abundant prokaryotes on Earth and are widely distributed in marine, terrestrial, and geothermal environments. All studied Thaumarchaeota couple the oxidation of ammonia at extremely low concentrations with carbon fixation. As the predominant nitrifiers in the ocean and in various soils, ammonia-oxidizing archaea contribute significantly to the global nitrogen and carbon cycles. Here we provide biochemical evidence that thaumarchaeal ammonia oxidizers assimilate inorganic carbon via a modified version of the autotrophic hydroxypropionate/hydroxybutyrate cycle of Crenarchaeota that is far more energy efficient than any other aerobic autotrophic pathway. The identified genes of this cycle were found in the genomes of all sequenced representatives of the phylum Thaumarchaeota, indicating the environmental significance of this efficient CO2-fixation pathway. Comparative phylogenetic analysis of proteins of this pathway suggests that the hydroxypropionate/hydroxybutyrate cycle emerged independently in Crenarchaeota and Thaumarchaeota, thus supporting the hypothesis of an early evolutionary separation of both archaeal phyla. We conclude that high efficiency of anabolism exemplified by this autotrophic cycle perfectly suits the lifestyle of ammonia-oxidizing archaea, which thrive at a constantly low energy supply, thus offering a biochemical explanation for their ecological success in nutrient-limited environments. PMID:24843170

Könneke, Martin; Schubert, Daniel M; Brown, Philip C; Hügler, Michael; Standfest, Sonja; Schwander, Thomas; Schada von Borzyskowski, Lennart; Erb, Tobias J; Stahl, David A; Berg, Ivan A

2014-06-01

19

Carbon fixation efficiency of plants influenced by sulfur dioxide.  

PubMed

In the land ecosystem, the forest can absorb the carbon dioxide (CO2) in the atmosphere and turn the CO2 into organic carbon to store it in the plant body. About 2×10(11) tons of CO2 changes through photosynthesis into organic matter by plant annually. In this research, ten kinds of woody plants were selected for assessing the carbon fixation ability influenced by sulfur dioxide (SO2). The tested trees were put into a fumigation chamber for 210 days in a 40-ppb SO2 environment. The results of this study showed that there was no clear symptom of tested trees under a 40-ppb SO2 environment. The tested trees could tolerate this polluted environment, but it will impact their CO2 absorption ability. The carbon fixation ability will reduce as the polluted period lengthens. The carbon fixation potential of tested trees ranged from 2.1 to 15.5 g·CO2/m2·d with an average of 7.7 g·CO2/m2·d. The changes in CO2 absorption volume for Messerschmidia argentea were more stable during the fumigation period with a variation of 102%. Among the tested trees, Diospyros morrisiana had the best carbon fixation potential of 9.19 g·CO2/m2·d and M. argentea had the least with 2.54 g·CO2/m2·d. PMID:20364315

Chung, Chung-Yi; Chung, Pei-Ling; Liao, Shao-Wei

2011-02-01

20

Model of carbon fixation in microbial mats from 3,500 Myr ago to the present  

NASA Technical Reports Server (NTRS)

Using modern microbial mats as analogs for ancient stromatolites, it is shown that the rate of carbon fixation is higher at the greater levels of atmospheric CO2 that were probably present in the past. It is suggested that carbon fixation in microbial mats was not carbon-limited during the early Precambrian, but became carbon-limited as the supply of inorganic carbon decreased. Carbon limitation led to a lower rate of carbon fixation, especially towards the end of the Precambrian.

Rothschild, Lynn J.; Mancinelli, Rocco L.

1990-01-01

21

Abundance and Distribution of Diagnostic Carbon Fixation Genes in a Deep-Sea Hydrothermal Gradient Ecosystem  

NASA Astrophysics Data System (ADS)

The walls of deep-sea hydrothermal vent chimneys sustain steep thermal and chemical gradients resulting from the mixing of hot (350°C+) hydrothermal fluids with cold, oxygenated seawater. The chemical disequilibrium generated from this process has the potential to drive numerous chemolithoautotrophic metabolisms, many of which have been demonstrated to be operative in microbial pure cultures. In addition to the well-known Calvin Cycle, at least five additional pathways have been discovered including the Reverse Tricarboxylic Acid Cycle (rTCA), the Reductive Acetyl-CoA pathway, and the 3-hydroxyproprionate pathway. Most of the newly discovered pathways have been found in thermophilic and hyperthermophilic Bacteria and Archaea, which are the well represented in microbial diversity studies of hydrothermal chimney walls. However, to date, little is known about the environmental controls that impact various carbon fixation pathways. The overlap of limited microbial diversity with distinct habitat conditions in hydrothermal chimney walls provides an ideal setting to explore these relationships. Hydrothermal chimney walls from multiple structures recovered from the Juan de Fuca Ridge in the northeastern Pacific were sub-sampled and analyzed using PCR-based assays. Earlier work showed elevated microbial abundances in the outer portions of mature chimney walls, with varying ratios of Archaea to Bacteria from the outer to inner portions of the chimneys. Common phylotypes identified in these regions included Epsilonproteobacteria, Gammaproteobacteria, and Desulfurococcales. Total genomic DNA was extracted from mineralogically distinct niches within these structures and queried for genes coding key regulatory enzymes for each of the well studied carbon fixation pathways. Preliminary results show the occurrence of genes representing rTCA cycle (aclB) and methyl coenzyme A reductase (mcrA) - a proxy for the Reductive Acetyl-CoA Pathway within interior portion of mature hydrothermal chimneys. Ongoing analyses are aimed at quantifying the abundances of these diagnostic carbon fixation genes within the hydrothermal chimney gradients. These data are being compared to a broad array of contextual data to provide insight into the environmental and biological controls that may impact the distribution of the various carbon fixation pathways. Application of genomic approaches to the hydrothermal chimney ecosystem will provide insight into the microbial ecology of such structures and refine our ability to measure autotrophy in hydrothermal habitats sustained by chemical energy.

Blumenfeld, H. N.; Kelley, D. S.; Girguis, P. R.; Schrenk, M. O.

2010-12-01

22

Something from almost nothing: carbon dioxide fixation in chemoautotrophs.  

PubMed

The last decade has seen significant advances in our understanding of the physiology, ecology, and molecular biology of chemoautotrophic bacteria. Many ecosystems are dependent on CO2 fixation by either free-living or symbiotic chemoautotrophs. CO2 fixation in the chemoautotroph occurs via the Calvin-Benson-Bassham cycle. The cycle is characterized by three unique enzymatic activities: ribulose bisphosphate carboxylase/oxygenase, phosphoribulokinase, and sedoheptulose bisphosphatase. Ribulose bisphosphate carboxylase/oxygenase is commonly found in the cytoplasm, but a number of bacteria package much of the enzyme into polyhedral organelles, the carboxysomes. The carboxysome genes are located adjacent to cbb genes, which are often, but not always, clustered in large operons. The availability of carbon and reduced substrates control the expression of cbb genes in concert with the LysR-type transcriptional regulator, CbbR. Additional regulatory proteins may also be involved. All of these, as well as related topics, are discussed in detail in this review. PMID:9891798

Shively, J M; van Keulen, G; Meijer, W G

1998-01-01

23

Carboxylase Levels and Carbon Dioxide Fixation in Baker's Yeast  

PubMed Central

Levels of pyruvate carboxylase (PC), phosphopyruvate carboxylase (PEPC), and malate dehydrogenase (decarboxylating) were compared in wild-type bakers' yeast (I), a cytoplasmic-respiratory mutant (II), a biotin-deficient wild-type yeast (III), and a biotin-deficient respiratory mutant (IV). PC activities were greatly reduced in III and IV, whereas PEPC was reduced in II and IV. Malate dehydrogenase (decarboxylating) could not be detected in any of the yeasts. With yeast I growing on glucose as the sole carbon source, PEPC decreased to negligible levels during the logarithmic phase of growth (glucose repression effect), whereas PC increased. Both enzymes reverted to their original levels during the stationary phase, when glucose in the medium was exhausted. In agreement with the leading role of PC for CO2 assimilation, the rates of 14CO2 fixation in yeasts I and II were approximately equal and were much higher than that in yeast IV. With I and II, most of the 14C was distributed similarly in oxalacetate derivatives; with yeast IV, most of 14C appeared in a compound apparently unrelated to CO2 fixation via C4-dicarboxylic acids.

Cazzulo, J. J.; Claisse, L. M.; Stoppani, A. O. M.

1968-01-01

24

Pyruvate Is Synthesized by Two Pathways in Pea Bacteroids with Different Efficiencies for Nitrogen Fixation?  

PubMed Central

Nitrogen fixation in legume bacteroids is energized by the metabolism of dicarboxylic acids, which requires their oxidation to both oxaloacetate and pyruvate. In alfalfa bacteroids, production of pyruvate requires NAD+ malic enzyme (Dme) but not NADP+ malic enzyme (Tme). However, we show that Rhizobium leguminosarum has two pathways for pyruvate formation from dicarboxylates catalyzed by Dme and by the combined activities of phosphoenolpyruvate (PEP) carboxykinase (PckA) and pyruvate kinase (PykA). Both pathways enable N2 fixation, but the PckA/PykA pathway supports N2 fixation at only 60% of that for Dme. Double mutants of dme and pckA/pykA did not fix N2. Furthermore, dme pykA double mutants did not grow on dicarboxylates, showing that they are the only pathways for the production of pyruvate from dicarboxylates normally expressed. PckA is not expressed in alfalfa bacteroids, resulting in an obligate requirement for Dme for pyruvate formation and N2 fixation. When PckA was expressed from a constitutive nptII promoter in alfalfa dme bacteroids, acetylene was reduced at 30% of the wild-type rate, although this level was insufficient to prevent nitrogen starvation. Dme has N-terminal, malic enzyme (Me), and C-terminal phosphotransacetylase (Pta) domains. Deleting the Pta domain increased the peak acetylene reduction rate in 4-week-old pea plants to 140 to 150% of the wild-type rate, and this was accompanied by increased nodule mass. Plants infected with Pta deletion mutants did not have increased dry weight, demonstrating that there is not a sustained change in nitrogen fixation throughout growth. This indicates a complex relationship between pyruvate synthesis in bacteroids, nitrogen fixation, and plant growth.

Mulley, Geraldine; Lopez-Gomez, Miguel; Zhang, Ye; Terpolilli, Jason; Prell, Jurgen; Finan, Turlough; Poole, Philip

2010-01-01

25

Nocardia sp. 239, a facultative methanol utilizer with the ribulose monophosphate pathway of formaldehyde fixation  

Microsoft Academic Search

A study was made of the enzymology of methanol metabolism by a Nocardia sp. The organism, previously known as Streptomyces sp. 239 is a facultative methylotroph, which assimilates methanol via the ribulose monophosphate (RuMP) pathway of formaldehyde fixation. This was evident from the high levels of hexulose phosphate synthase in methanol-grown cells and from the high apparent growth yields of

W. Hazen; Johanna C. de Bruyn; J. P. van Dijken

1983-01-01

26

Measurement of carbon fixation and allocation using /sup 11/C-labeled carbon dioxide  

SciTech Connect

This paper describes the use of continuously produced and applied /sup 11/C in measurements of carbon dioxide assimilation and C movement in plant research. This technique differs from the pulsing type /sup 11/C research underway in other laboratories by being continuous and on-line with computer analysis making steady-state measurements of carbon fixation and movement possible. The studies to be described here make clear the advantages of using continuously produced and applied short half-lived isotopes.

Strain, B.R.; Goeschl, J.D.; Jaeger, C.H.; Fares, Y.; Magnuson, C.E.; Nelson, C.E.

1983-01-01

27

Diffusional Contribution to Carbon Isotope Fractionation during Dark CO(2) Fixation in CAM Plants.  

PubMed

A mathematical model is developed which can be used to predict in vivo carbon isotope fractionations associated with carbon fixation in plants in terms of diffusion, CO(2) hydration, and carboxylation components. This model also permits calculation of internal CO(2) concentration for comparison with results of gas-exchange experiments. The isotope fractionations associated with carbon fixation in Kalanchoë daigremontiana and Bryophyllum tubiflorum have been measured by isolation of malic acid following dark fixation and enzymic determination of the isotopic composition of carbon-4 of this material. Corrections are made for residual malic acid, fumarase activity, and respiration. Comparison of these data with calculations from the model indicates that the rate of carbon fixation is limited principally by diffusion, rather than by carboxylation. Processes subsequent to the initial carboxylation also contribute to the over-all isotopic composition of the plant. PMID:16661555

O'leary, M H; Osmond, C B

1980-11-01

28

Geochemical roots of autotrophic carbon fixation: hydrothermal experiments in the system citric acid, H 2O-(±FeS)?(±NiS)  

Microsoft Academic Search

Recent theories have proposed that life arose from primitive hydrothermal environments employing chemical reactions analogous to the reductive citrate cycle (RCC) as the primary pathway for carbon fixation. This chemistry is presumed to have developed as a natural consequence of the intrinsic geochemistry of the young, prebiotic, Earth. There has been no experimental evidence, however, demonstrating that there exists a

G. D. Cody; N. Z. Boctor; R. M. Hazen; J. A. Brandes; Harold J. Morowitz; H. S. Yoder

2001-01-01

29

Carbon dioxide fixation by Metallosphaera yellowstonensis and acidothermophilic iron-oxidizing microbial communities from Yellowstone National Park.  

PubMed

The fixation of inorganic carbon has been documented in all three domains of life and results in the biosynthesis of diverse organic compounds that support heterotrophic organisms. The primary aim of this study was to assess carbon dioxide fixation in high-temperature Fe(III)-oxide mat communities and in pure cultures of a dominant Fe(II)-oxidizing organism (Metallosphaera yellowstonensis strain MK1) originally isolated from these environments. Protein-encoding genes of the complete 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) carbon dioxide fixation pathway were identified in M. yellowstonensis strain MK1. Highly similar M. yellowstonensis genes for this pathway were identified in metagenomes of replicate Fe(III)-oxide mats, as were genes for the reductive tricarboxylic acid cycle from Hydrogenobaculum spp. (Aquificales). Stable-isotope ((13)CO2) labeling demonstrated CO2 fixation by M. yellowstonensis strain MK1 and in ex situ assays containing live Fe(III)-oxide microbial mats. The results showed that strain MK1 fixes CO2 with a fractionation factor of ?2.5‰. Analysis of the (13)C composition of dissolved inorganic C (DIC), dissolved organic C (DOC), landscape C, and microbial mat C showed that mat C is from both DIC and non-DIC sources. An isotopic mixing model showed that biomass C contains a minimum of 42% C of DIC origin, depending on the fraction of landscape C that is present. The significance of DIC as a major carbon source for Fe(III)-oxide mat communities provides a foundation for examining microbial interactions that are dependent on the activity of autotrophic organisms (i.e., Hydrogenobaculum and Metallosphaera spp.) in simplified natural communities. PMID:24532073

Jennings, Ryan M; Whitmore, Laura M; Moran, James J; Kreuzer, Helen W; Inskeep, William P

2014-05-01

30

The ribulose monophosphate pathway operon encoding formaldehyde fixation in a thermotolerant methylotroph, Bacillus brevis S1  

Microsoft Academic Search

The hps and phi genes encoding 3-hexulose-6-phosphate synthase and 6-phospho-3-hexuloisomerase, the key enzymes of the ribulose monophosphate (RuMP) pathway for formaldehyde fixation, were cloned from the chromosomal DNA of a thermotolerant methylotroph, Bacillus brevis S1. Enzyme induction and Northern blot analyses revealed that both the hps and phi genes are induced by methanol or ethanol, and that their expression is

Hiroya Yurimoto; Reiko Hirai; Hisashi Yasueda; Ryoji Mitsui; Yasuyoshi Sakai; Nobuo Kato

2002-01-01

31

Stapes fixation accompanied with abnormal facial nerve pathway.  

PubMed

The patient was a 52-year-old woman. She had been aware of her bilateral hearing loss since she was 20 years old. The hearing in her left ear started to deteriorate at the age of 49. Pure-tone audiometry showed a bilateral mixed hearing loss. The hearing levels for the right ear and the left ear were 52dB and 68dB, respectively. There were no remarkable findings in a computed tomography (CT) scan of the temporal bone. We suspected that she had otosclerosis, and an operation was performed on her left ear. When the incudostapedial joint (I-S joint) was exposed to investigate the movement of the stapes, a soft white band that ran under the superstructure of the stapes was noted. By using a nerve monitoring system, we confirmed that the white band was the bare facial nerve. The ossicular chain was normal, except for a malformed stape due to the facial nerve, and the footplate of the stapes was fixed. Therefore, she was diagnosed as having otosclerosis with an abnormal facial nerve pathway. The malformed superstructure of the stapes was removed carefully. When the ectopic facial nerve was shifted to anteroinferior side, the oval window could be seen. Stapedotomy using a Teflon piston prosthesis was performed with no complications. PMID:24581447

Inagaki, Taro; Kawano, Atsushi; Ogawa, Yasuo; Shimizu, Masaaki; Negishi, Miho; Kawada, Yuri; Suzuki, Mamoru

2014-06-01

32

Dark inorganic carbon fixation sustains the functioning of benthic deep-sea ecosystems  

NASA Astrophysics Data System (ADS)

studies have provided evidence that dark inorganic carbon fixation is an important process for the functioning of the ocean interior. However, its quantitative relevance and ecological significance in benthic deep-sea ecosystems remain unknown. We investigated the rates of inorganic carbon fixation together with prokaryotic abundance, biomass, assemblage composition, and heterotrophic carbon production in surface sediments of different benthic deep-sea systems along the Iberian margin (northeastern Atlantic Ocean) and in the Mediterranean Sea. Inorganic carbon fixation rates in these surface deep-sea sediments did not show clear depth-related patterns, and, on average, they accounted for 19% of the total heterotrophic biomass production. The incorporation rates of inorganic carbon were significantly related to the abundance of total Archaea (as determined by catalyzed reporter deposition fluorescence in situ hybridization) and completely inhibited using an inhibitor of archaeal metabolism, N1-guanyl-1,7-diaminoheptane. This suggests a major role of the archaeal assemblages in inorganic carbon fixation. We also show that benthic archaeal assemblages contribute approximately 25% of the total 3H-leucine incorporation. Inorganic carbon fixation in surface deep-sea sediments appears to be dependent not only upon chemosynthetic processes but also on heterotrophic/mixotrophic metabolism, as suggested by estimates of the chemolithotrophic energy requirements and the enhanced inorganic carbon fixation due to the increase in the availability of organic trophic resources. Overall, our data suggest that archaeal assemblages of surface deep-sea sediments are responsible for the high rates of inorganic carbon incorporation and thereby sustain the functioning of the food webs as well as influence the carbon cycling of benthic deep-sea ecosystems.

Molari, Massimiliano; Manini, Elena; Dell'Anno, Antonio

2013-01-01

33

[Carbon storage and carbon fixation during the succession of natural vegetation in wetland ecosystem on east beach of Chongming Island].  

PubMed

Vegetation is an important biological factor in the ecological succession of wetland, and the main factor affecting the carbon storage and carbon fixation in wetland ecosystem. By the methods of field survey and lab analysis, this paper studied the carbon storage and carbon fixation during the succession of wetland vegetation on east beach of Chongming Island, and the results showed that there existed greater differences in the existing carbon storage and its allocation in wetland vegetation at its different succession stages. The existing carbon storage of the pioneer plant Scirpus mariqueter was much less than that of Phragmites australis, only accounted for about 13% of the latter. The underground rhizome of P. australis and the aboveground part of S. mariqueter were the main sites of existing carbon storage. P. australis at the later succession stage of wetland vegetation had a stronger capability of carbon fixation than S. mariqueter at the earlier succession stage of the vegetation, with the values being (1.63 +/- 0.39) kg x m(-2) x a(-1) and (0.63 +/- 0.28) kg x m(-2) x a(-1), respectively, suggesting that during the succession of S. mariqueter community to P. australis community, the carbon fixation capability of the wetland ecosystem became stronger. PMID:17615896

Mei, Xue-Ying; Zhang, Xiu-Feng

2007-04-01

34

[Regulation of alternative CO[sub 2] fixation pathways in procaryotic and eucaryotic photosynthetic organisms  

SciTech Connect

The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.

Not Available

1992-01-01

35

Microbial carbon and nitrogen fixation on the surface of glaciers and ice sheets  

NASA Astrophysics Data System (ADS)

Studying the microbial sequestration of atmospheric carbon dioxide (via net autochthonous production) and nitrogen (via nitrogen fixation) into organic matter on the surface of glaciers and ice sheets is important for three main reasons. First, they can provide essential nutrients for supporting microbial ecosystems in these cold, typically nutrient-poor environments. Second, nutrients formed in the supraglacial environment may be important for sustaining hydrologically connected subglacial and downstream (e.g. fjords, near-shore marine) ecosystems. Third, organic matter produced or transformed by microbial activity can alter the albedo of ice, either directly by the production of dark pigments, or indirectly through the trapping and agglutination of dark mineral via the production of exopolysaccharides. Here, we present recent results of microbial carbon and nitrogen fixation in surface sediment (cryoconite) on Arctic and Antarctic glaciers and the Greenland Ice Sheet ablation zone. Results suggest that the fixation and recycling of autochthonous carbon in cryoconite on glaciers and ice sheets can support a significant fraction of the total microbial activity in the supraglacial environment during the ablation season. Nitrogen fixation can be important as a nitrogen source for microbial communities on both Arctic and Antarctic glaciers during the main ablation season. Nitrogen fixation could feasibly exceed precipitation as a source of nitrogen to microbial communities in debris rich zones on the margins of the Greenland Ice Sheet, aiding the colonization and subsequent 'greening' of subglacial and moraine derived debris.

Telling, J.; Anesio, A. M.; Stibal, M.; Hawkings, J.; Bellas, C. M.; Tranter, M.; Wadham, J. L.; Cook, J.; Hodson, A. J.; Yallop, M.; Barker, G.; Butler, C. E.; Fountain, A. G.; Nylen, T.; Irvine-Fynn, T. D.; Sole, A. J.; Nienow, P. W.

2012-12-01

36

A model for diurnal patterns of carbon fixation in a Precambrian microbial mat based on a modern analog  

NASA Technical Reports Server (NTRS)

Microbial mat communities are one of the first and most prevalent biological communities known from the Precambrian fossil record. These fossil mat communities are found as laminated sedimentary rock structures called stromatolites. Using a modern microbial mat as an analog for Precambrian stromatolites, a study of carbon fixation during a diurnal cycle under ambient conditions was undertaken. The rate of carbon fixation depends primarily on the availability of light (consistent with photosynthetic carbon fixation) and inorganic carbon, and not nitrogen or phosphorus. Atmospheric PCO2 is thought to have decreased from 10 bars at 4 Ga (10(9) years before present) to approximately 10(-4) bars today, implying a change in the availability of inorganic carbon for carbon fixation. Experimental manipulation of levels of inorganic carbon to levels that may have been available to Precambrian mat communities resulted in increased levels of carbon fixation during daylight hours. Combining these data with models of daylength during the Precambrian, models are derived for diurnal patterns of photosynthetic carbon fixation in a Precambrian microbial mat community. The models suggest that, even in the face of shorter daylengths during the Precambrian, total daily carbon fixation has been declining over geological time, with most of the decrease having occurred during the Precambrian.

Rothschild, L. J.

1991-01-01

37

Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens  

PubMed Central

Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species.

Feist, Adam M.; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P.; Lovley, Derek R.; Zengler, Karsten

2014-01-01

38

Earth Exploration Toolbook Chapter: Visualizing Carbon Pathways  

NSDL National Science Digital Library

DATA: NASA Satellite Images TOOLS: ImageJ and Image Composite Explorer (ICE) of NASA Earth Observations (NEO). SUMMARY: Build animations of satellite data to illustrate and explore carbon pathways through the Earth system.

Dahlman, Luann; Whitmer, Ali; Caron, Bruce; Herring, David; Tschillard, Ray

39

Photosynthesis in Grass Species Differing in Carbon Dioxide Fixation Pathways  

PubMed Central

Thirty-three grass species were examined in two experiments in an attempt to locate plants with photosynthetic responses to O2, CO2 compensation concentrations, and leaf anatomy intermediate to those of C3 and C4 species. Species examined included seven from the Laxa group in the Panicum genus, one of which, P. milioides Nees ex Trin., has been reported earlier to have intermediate characteristics. The species with O2-sensitive photosynthesis typical of C3 plants showed more than 37% increase in apparent photosynthesis at 2% O2 compared to 21% O2 at 25 C and 335 microliters per liter CO2, whereas in Panicum milioides, P. schenckii Hack., and P. decipiens Nees ex Trin., members of the Laxa group of Panicum, increases ranged from 25 to 30%. The remainder of the species did not respond to O2. Species with O2 responses characteristic of C3 plants exhibited CO2 compensation concentrations of 44 microliters per liter or higher at 21% O2 and 25 to 27.5 C and species characterized as O2-insensitive had values of microliters per liter or less. The CO2 compensation concentration (?) values of P. milioides, P. schenckii, and P. decipiens ranged from 10.3 to 23.3 microliters per liter. Other species of the Laxa group of Panicum exhibited O2 response and ? values of either C3 (P. laxum Sw., P. hylaeicum Mez., and P. rivulare Trin.) or C4 (P. prionitis Griseb.) plants. Leaves of species with O2 response and CO2 compensation values typical of C3 plants had poorly developed or nearly empty bundle sheath cells, and much larger distances and mesophyll cell numbers between veins than did the O2-insensitive ones. Vein spacings in P. milioides, P. schenckii, and P. decipiens ranged from 0.18 to 0.28 millimeter and mesophyll cell number between veins from 5.2 to 7.8. While these vein spacings are closer than those of most C3 grasses, two O2-sensitive species of Dactylis had vein spacings similar to these Panicums and veins in Glyceria striata, another O2-sensitive plant, were separated by only four mesophyll cells and 0.12 millimeter. Bundle sheath cells of the three intermediate Panicums contained greater quantities of organelles than are typical for C3 grasses. Images

Morgan, Jack A.; Brown, R. Harold

1979-01-01

40

Photosynthesis of Grass Species Differing in Carbon Dioxide Fixation Pathways  

PubMed Central

The response of apparent photosynthesis to N nutrition was studied in the C3 grass, tall fescue (Festuca arundinacea Schreb.), in the C4 species Panicum maximum Jacq., and in Panicum milioides Nees ex Trin., a species with characteristics intermediate between C3 and C4 photosynthetic types. Plants were grown in culture solution containing 1, 5, 50, and 200 milligrams N per liter. Apparent photosynthesis was measured on the youngest fully expanded leaves at 320 microliters of CO2 per liter of air and 21% O2. Leaf conductance was calculated from transpiration measurements, and CO2 compensation concentrations were also estimated. Several leaf anatomical characteristics were studied on plastic-embedded material. Leaf N content was determined on leaves which were used in photosynthesis measurements. Apparent photosynthesis increased in a linear fashion with increases in leaf N content in all three species. The increase in apparent photosynthesis per unit increase in leaf N was over twice as great in P. maximum (9.7 milligrams CO2 per square decimeter per hour for each increase of 1% leaf N) as in P. milioides and tall fescue. Apparent photosynthesis and its response to N level were similar in P. milioides and tall fescue, but at leaf N concentrations above 2%, apparent photosynthesis in these two species was only about one-half of that in P. maximum. Increases in apparent photosynthesis due to higher N levels were accompanied by increases in both leaf and mesophyll conductances in P. maximum, whereas in P. milioides and tall fescue only mesophyll conductance was significantly correlated with leaf N. Water use efficiency (apparent photosynthesis/transpiration) increased in a linear manner with increased leaf N in all three species but was more closely related to leaf N in P. milioides and tall fescue than in P. maximum. High N levels tended to increase leaf thickness and interveinal distance in all three species. The percentage of air space in leaf tissue and the mesophyll cell diameter were either not affected or changed only slightly by N nutrition with the exception that percentage of air space in tall fescue leaves rose from 17.3 to 24.8 with an increase in solution N level from 1 to 200 milligrams per liter. Although P. milioides has been shown to have photosynthetic and leaf anatomical characteristics intermediate to C3 and C4 species, its response to N was similar to that of the C3 grass, tall fescue.

Bolton, Jacqueline K.; Brown, R. Harold

1980-01-01

41

Carbon sequestration in soybean crop soils: the role of hydrogen-coupled CO2 fixation  

NASA Astrophysics Data System (ADS)

Conversion of native vegetation to agricultural land in order to support the world's growing population is a key factor contributing to global climate change. However, the extent to which agricultural activities contribute to greenhouse gas emissions compared to carbon storage is difficult to ascertain, especially for legume crops, such as soybeans. Soybean establishment often leads to an increase in N2O emissions because N-fixation leads to increased soil available N during decomposition of the low C:N legume biomass. However, soybean establishment may also reduce net greenhouse gas emissions by increasing soil fertility, plant growth, and soil carbon storage. The mechanism behind increased carbon storage, however, remains unclear. One explanation points to hydrogen coupled CO2 fixation; the process by which nitrogen fixation releases H2 into the soil system, thereby promoting chemoautotrophic carbon fixation by soil microbes. We used 13CO2 as a tracer to track the amount and fate of carbon fixed by hydrogen coupled CO2 fixation during one-year field and laboratory incubations. The objectives of the research are to 1) quantify rates of 13CO2 fixation in soil collected from a field used for long-term soybean production 2) examine the impact of H2 gas concentration on rates of 13CO2 fixation, and 3) measure changes in ?13C signature over time in 3 soil fractions: microbial biomass, light fraction, and acid stable fraction. If this newly-fixed carbon is incorporated into the acid-stable soil C fraction, it has a good chance of contributing to long-term soil C sequestration under soybean production. Soil was collected in the field both adjacent to root nodules (nodule soil) and >3cm away (root soil) and labelled with 13CO2 (1% v/v) in the presence and absence of H2 gas. After a two week labelling period, ?13C signatures already revealed differences in the four treatments of bulk soil: -17.1 for root, -17.6 for nodule, -14.2 for root + H2, and -6.1 for nodule + H2. Labelled soil was then placed in nylon mesh bags and buried in the field at a depth of 15cm in a soybean field at the Central Experiment Farm in Ottawa, Ontario. Samples will be removed at intervals of 1,2,3,6,9,12, and 15 months, and the ?13C of three soil fractions will be examined to reveal changes in carbon storage over time. Our results will provide insights into the fate of carbon fixed during hydrogen coupled CO2 fixation, and demonstrate whether this CO2 fixation can contribute to the long-term greenhouse gas balance of soybean production systems.

Graham, A.; Layzell, D. B.; Scott, N. A.; Cen, Y.; Kyser, T. K.

2011-12-01

42

Autotrophic carbon dioxide fixation via the Calvin-Benson-Bassham cycle by the denitrifying methanotroph "Candidatus Methylomirabilis oxyfera".  

PubMed

Methane is an important greenhouse gas and the most abundant hydrocarbon in the Earth's atmosphere. Methanotrophic microorganisms can use methane as their sole energy source and play a crucial role in the mitigation of methane emissions in the environment. "Candidatus Methylomirabilis oxyfera" is a recently described intra-aerobic methanotroph that is assumed to use nitric oxide to generate internal oxygen to oxidize methane via the conventional aerobic pathway, including the monooxygenase reaction. Previous genome analysis has suggested that, like the verrucomicrobial methanotrophs, "Ca. Methylomirabilis oxyfera" encodes and transcribes genes for the Calvin-Benson-Bassham (CBB) cycle for carbon assimilation. Here we provide multiple independent lines of evidence for autotrophic carbon dioxide fixation by "Ca. Methylomirabilis oxyfera" via the CBB cycle. The activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO), a key enzyme of the CBB cycle, in cell extracts from an "Ca. Methylomirabilis oxyfera" enrichment culture was shown to account for up to 10% of the total methane oxidation activity. Labeling studies with whole cells in batch incubations supplied with either (13)CH4 or [(13)C]bicarbonate revealed that "Ca. Methylomirabilis oxyfera" biomass and lipids became significantly more enriched in (13)C after incubation with (13)C-labeled bicarbonate (and unlabeled methane) than after incubation with (13)C-labeled methane (and unlabeled bicarbonate), providing evidence for autotrophic carbon dioxide fixation. Besides this experimental approach, detailed genomic and transcriptomic analysis demonstrated an operational CBB cycle in "Ca. Methylomirabilis oxyfera." Altogether, these results show that the CBB cycle is active and plays a major role in carbon assimilation by "Ca. Methylomirabilis oxyfera" bacteria. Our results suggest that autotrophy might be more widespread among methanotrophs than was previously assumed and implies that a methanotrophic community in the environment is not necessarily revealed by (13)C-depleted lipids. PMID:24509918

Rasigraf, Olivia; Kool, Dorien M; Jetten, Mike S M; Sinninghe Damsté, Jaap S; Ettwig, Katharina F

2014-04-01

43

Carbon dioxide fixation as a central redox cofactor recycling mechanism in bacteria.  

PubMed

The Calvin-Benson-Bassham cycle (Calvin cycle) catalyzes virtually all primary productivity on Earth and is the major sink for atmospheric CO(2). A less appreciated function of CO(2) fixation is as an electron-accepting process. It is known that anoxygenic phototrophic bacteria require the Calvin cycle to accept electrons when growing with light as their sole energy source and organic substrates as their sole carbon source. However, it was unclear why and to what extent CO(2) fixation is required when the organic substrates are more oxidized than biomass. To address these questions we measured metabolic fluxes in the photosynthetic bacterium Rhodopseudomonas palustris grown with (13)C-labeled acetate. R. palustris metabolized 22% of acetate provided to CO(2) and then fixed 68% of this CO(2) into cell material using the Calvin cycle. This Calvin cycle flux enabled R. palustris to reoxidize nearly half of the reduced cofactors generated during conversion of acetate to biomass, revealing that CO(2) fixation plays a major role in cofactor recycling. When H(2) production via nitrogenase was used as an alternative cofactor recycling mechanism, a similar amount of CO(2) was released from acetate, but only 12% of it was reassimilated by the Calvin cycle. These results underscore that N(2) fixation and CO(2) fixation have electron-accepting roles separate from their better-known roles in ammonia production and biomass generation. Some nonphotosynthetic heterotrophic bacteria have Calvin cycle genes, and their potential to use CO(2) fixation to recycle reduced cofactors deserves closer scrutiny. PMID:20558750

McKinlay, James B; Harwood, Caroline S

2010-06-29

44

Regulation of Autotrophic and Heterotrophic Carbon Dioxide Fixation in Hydrogenomonas facilis1  

PubMed Central

After growth on various carbon sources, sonic extracts of Hydrogenomonas facilis contained ribulosediphosphate (RuDP) carboxylase and phosphoribulokinase (Ru5-P kinase). After very short sonic treatment, a reductive adenosine triphosphate (ATP)-dependent incorporation of 14CO2 was also detectable. Reduced nicotinamide adenine dinucleotide (NADH2) served as reductant 30-fold more effectively than reduced nicotinamide adenine dinucleotide phosphate (NADPH2). Adenosine 5?-phosphate (AMP) and adenosine 5?-pyrophosphate (ADP) inhibited Ru5-P kinase and NADH2-, ATP-dependent CO2 fixation. The levels and duration of CO2 fixation suggested that it is a cyclic process. The requirement of reduced pyridine nucleotide and ATP and the sensitivity of fixation to AMP and ADP support the conjecture that it occurs via the Calvin cycle. After thorough study of variables affecting catalysis, specific activities (millimicromoles of substrate disappearing per milligram of protein) at 30 C were determined for RuDP carboxylase (C), Ru5-P kinase (K) and ATP-, NADH2- dependent CO2 fixation (CO2 F) after growth autotrophically on fructose, glucose, ribose, glutamate, lactate, succinate, and acetate. Values for these growth modes were, respectively—for C: 67.3, 51.1, 51.4, 24.6, 2.05, 10.2, 2.25, 1.4; for K: 24.7, 24.0, 23.2, 14.2, 12.8, 12.9, 13.4, 2.8; and for CO2 F: 4.54, 4.83, 3.10, 2.87, 0.85, 1.51, 0.24, 0.41. The qualitative parallel between values for RuDP carboxylase and CO2 fixation suggests that one major control point in fixation is the step catalyzed by RuDP carboxylase. Images

McFadden, Bruce A.; Tu, Chang-Chu L.

1967-01-01

45

Carbon dioxide fixation as a central redox cofactor recycling mechanism in bacteria  

PubMed Central

The Calvin-Benson-Bassham cycle (Calvin cycle) catalyzes virtually all primary productivity on Earth and is the major sink for atmospheric CO2. A less appreciated function of CO2 fixation is as an electron-accepting process. It is known that anoxygenic phototrophic bacteria require the Calvin cycle to accept electrons when growing with light as their sole energy source and organic substrates as their sole carbon source. However, it was unclear why and to what extent CO2 fixation is required when the organic substrates are more oxidized than biomass. To address these questions we measured metabolic fluxes in the photosynthetic bacterium Rhodopseudomonas palustris grown with 13C-labeled acetate. R. palustris metabolized 22% of acetate provided to CO2 and then fixed 68% of this CO2 into cell material using the Calvin cycle. This Calvin cycle flux enabled R. palustris to reoxidize nearly half of the reduced cofactors generated during conversion of acetate to biomass, revealing that CO2 fixation plays a major role in cofactor recycling. When H2 production via nitrogenase was used as an alternative cofactor recycling mechanism, a similar amount of CO2 was released from acetate, but only 12% of it was reassimilated by the Calvin cycle. These results underscore that N2 fixation and CO2 fixation have electron-accepting roles separate from their better-known roles in ammonia production and biomass generation. Some nonphotosynthetic heterotrophic bacteria have Calvin cycle genes, and their potential to use CO2 fixation to recycle reduced cofactors deserves closer scrutiny.

McKinlay, James B.; Harwood, Caroline S.

2010-01-01

46

Carbon dioxide fixation and mixotrophic metabolism by strain DCB-1, a dehalogenating anaerobic bacterium.  

PubMed Central

Fixation by strain DCB-1 of CO2 carbon into cell material and organic acids occurred during growth on pyruvate both with and without thiosulfate. By using sodium [14C]bicarbonate and sodium [2-14C]pyruvate, the isotopic composition of products and cells was investigated. Up to 70% of cell carbon was derived from CO2. CO2 carbon was also incorporated into succinate, formate, and acetate. Both carbons of acetate underwent exchange reactions with CO2, although the carboxyl-group exchange was twice as fast. Because strain DCB-1 uses CO2 as its major but not sole carbon source while deriving energy from pyruvate metabolism, we describe its metabolism as mixotrophic. Other mixotrophic conditions also supported growth. Lactate or butyrate, which could not support growth in mineral medium, could replace pyruvate as the oxidizable substrate only when acetate was added to the medium.

Stevens, T O; Tiedje, J M

1988-01-01

47

Unravelling Carbon Fixation under Nutrient limited Conditions - a Water Column Perspective  

NASA Astrophysics Data System (ADS)

Phytoplankton plays a critical role in the uptake of atmospheric carbon dioxide (CO2) by the ocean, and is comprised of a spectrum of cell sizes that are strongly regulated by oceanographic conditions. Elevated CO2 fixation relative to nutrient availability, also called carbon overconsumption, has been observed in various mid to high latitude systems, such as the Baltic and North Seas, the North Atlantic Ocean, the Canadian Arctic Archipelago or the Scotian Shelf. We shed light on this phenomenon relying on an extensive data set of water column observations of the CO2 system and phytoplankton cell counts from the Scotian Shelf, a temperate shelf sea. We show that in the summertime, the population of numerically abundant small cells, which favour warmer, nutrient poor conditions, accounts for approximately 20% of annual carbon uptake. At the broader scale, the neglection of this "non-Redfieldian" contribution typically leads to an underestimation of net community production by approximately 20% to 50%. These small cells are not well represented by chlorophyll a - the ubiquitously used proxy of phytoplankton biomass - but rather, are strongly correlated with surface water temperature. Given the persistent near-zero nutrient concentrations during the summer, it appears that small cells drive carbon overconsumption, and suggest that their role in carbon fixation will become increasingly important in a warming, increasingly stratified ocean.

Thomas, Helmuth; Craig, Susanne; Shadwick, Elizabeth H.; Li, William K.; Greenan, Blair J. W.

2014-05-01

48

Chemoautotrophic Carbon Fixation Rates and Active Bacterial Communities in Intertidal Marine Sediments  

PubMed Central

Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, the Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m?2 d?1. Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)?1, which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology.

Boschker, Henricus T. S.; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W. C.; Moodley, Leon

2014-01-01

49

Carbon dioxide fixation in the metabolism of propylene and propylene oxide by Xanthobacter strain Py2.  

PubMed Central

Evidence for a requirement for CO2 in the productive metabolism of aliphatic alkenes and epoxides by the propylene-oxidizing bacterium Xanthobacter strain Py2 is presented. In the absence of CO2, whole-cell suspensions of propylene-grown cells catalyzed the isomerization of propylene oxide (epoxypropane) to acetone. In the presence of CO2, no acetone was produced. Acetone was not metabolized by suspensions of propylene-grown cells, in either the absence or presence of CO2. The degradation of propylene and propylene oxide by propylene-grown cells supported the fixation of 14CO2 into cell material, and the time course of 14C fixation correlated with the time course of propylene and propylene oxide degradation. The degradation of glucose and propionaldehyde by propylene-grown or glucose-grown cells did not support significant 14CO2 fixation. With propylene oxide as the substrate, the concentration dependence of 14CO2 fixation exhibited saturation kinetics, and at saturation, 0.9 mol of CO2 was fixed per mol of propylene oxide consumed. Cultures grown with propylene in a nitrogen-deficient medium supplemented with NaH13CO3 specifically incorporated 13C label into the C-1 (major labeled position) and C-3 (minor labeled position) carbon atoms of the endogenous storage compound poly-beta-hydroxybutyrate. No specific label incorporation was observed when cells were cultured with glucose or n-propanol as a carbon source. The depletion of CO2 from cultures grown with propylene, but not glucose or n-propanol, inhibited bacterial growth. We propose that propylene oxide metabolism in Xanthobacter strain Py2 proceeds by terminal carboxylation of an isomerization intermediate, which, in the absence of CO2, is released as acetone.

Small, F J; Ensign, S A

1995-01-01

50

Induction of a crassulacean acid-like metabolism in the C(4) succulent plant, Portulaca oleracea L: study of enzymes involved in carbon fixation and carbohydrate metabolism.  

PubMed

The C(4) succulent plant Portulaca oleracea shifts its photosynthetic metabolism to crassulacean acid metabolism (CAM) after 23 d of withholding water. This is accounted by diurnal acid fluctuation, net nocturnal but not day CO(2) uptake and drastic changes in phosphoenolpyruvate carboxylase (PEPC) kinetic and regulatory properties [Lara et al. (2003) Photosynth: Res. 77: 241]. The goal of the present work was to characterize the CAM activity in leaves of P. oleracea during water stress through the study of enzymes involved in carbon fixation and carbohydrate metabolism. After drought stress, a general decrease in the photosynthetic metabolism, as accounted by the decrease in the net CO(2) fixation and in the activity of enzymes such as ribulose-1,5-bisphosphate carboxylase/oxygenase, PEPC, pyruvate orthophosphate dikinase, phosphoenolpyruvate carboxykinase and NAD-malic enzyme was observed. We also found changes in the day/night activities and level of immunoreactive protein of some of these enzymes which were correlated to night CO(2) fixation, as occurs under CAM metabolism. Based on the results obtained, including those from in situ immunolocalization studies, we propose a scheme for the possible CO(2) fixation pathways used by P. oleracea under conditions of sufficient and limiting water supply. PMID:15169944

Lara, María V; Drincovich, María F; Andreo, Carlos S

2004-05-01

51

Electron-deficient tin(IV)tetraphenylporphyrin perchlorate: A highly efficient catalyst for chemical fixation of carbon dioxide  

Microsoft Academic Search

Electron-deficient tin(IV)tetraphenylporphyrin perchlorate, [SnIV(TPP)(ClO4)2] was used as a highly efficient catalyst for chemical fixation of carbon dioxide. The bifunctional catalytic system [Sn(TPP)(ClO4)2]\\/tetrabutylphosphonium bromide (TBPB) was applied for preparation of cyclic carbonates from epoxides and carbon dioxide. The effect of reaction parameters was also investigated.

Fatemeh Ahmadi; Shahram Tangestaninejad; Majid Moghadam; Valiollah Mirkhani; Iraj Mohammadpoor-Baltork; Ahmed Reza Khosropour

52

Carboxysomal carbonic anhydrases: Structure and role in microbial CO2 fixation.  

PubMed

Cyanobacteria and some chemoautotrophic bacteria are able to grow in environments with limiting CO(2) concentrations by employing a CO(2)-concentrating mechanism (CCM) that allows them to accumulate inorganic carbon in their cytoplasm to concentrations several orders of magnitude higher than that on the outside. The final step of this process takes place in polyhedral protein microcompartments known as carboxysomes, which contain the majority of the CO(2)-fixing enzyme, RubisCO. The efficiency of CO(2) fixation by the sequestered RubisCO is enhanced by co-localization with a specialized carbonic anhydrase that catalyzes dehydration of the cytoplasmic bicarbonate and ensures saturation of RubisCO with its substrate, CO(2). There are two genetically distinct carboxysome types that differ in their protein composition and in the carbonic anhydrase(s) they employ. Here we review the existing information concerning the genomics, structure and enzymology of these uniquely adapted carbonic anhydrases, which are of fundamental importance in the global carbon cycle. PMID:19818881

Cannon, Gordon C; Heinhorst, Sabine; Kerfeld, Cheryl A

2010-02-01

53

[Regulation of alternative CO{sub 2} fixation pathways in procaryotic and eucaryotic photosynthetic organisms]. Progress report  

SciTech Connect

The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.

Not Available

1992-12-31

54

PH-NEUTRAL CONCRETE FOR ATTACHED MICROALGAE AND ENHANCED CARBON DIOXIDE FIXATION - PHASE I  

SciTech Connect

The novelty/innovation of the proposed work is as follows. Supercritical carbon dioxide (SC-CO {sub 2})-based extrusion and molding technology can be used to produce significantly improved (in terms of strength/unit weight, durability, hardness and chemical resistance) cement-based products. SC-CO{sub 2} can rapidly convert the calcium hydroxide in cured cement to calcium carbonate, which increases the density and unconfined compressive strength in the treated region. In cured concrete, this treated region is typically a several-mm thick layer (generally <{approx}5mm, unless treatment time is excessive). However, we have found that by treating the entire cement matrix with SC-CO{sub 2} as part of the curing process, we can carbonate it rapidly, regardless of the thickness. By ''rapidly'' we mean simultaneous carbonation/curing in < 5 ks even for large cement forms, compared to typical carbonation times of several days or even years at low pressures. Carbonation changes the pH in the treated region from {approx}13 to {approx}8, almost exactly compatible with seawater. Therefore the leaching rates from these cements is reduced. These cement improvements are directed to the development of strong but thin artificial reefs, to which can be attached microalgae used for the enhanced fixation of CO{sub 2}. It is shown below that attached microalgae, as algal beds or reefs, are more efficient for CO{sub 2} fixation by a factor of 20, compared to the open ocean on an area basis. We have performed preliminary tests of the pH-neutral cements of our invention for attachment of microalgae populations. We have found pH-neutral materials which attach microalgae readily. These include silica-enriched (pozzolanic) cements, blast-furnace slags and fly ash, which are also silica-rich. We have already developed technology to simultaneously foam, carbonate and cure the cements; this foaming process further increases cement surface areas for microalgae attachment, in some cases to >10 m{sup 2}/g internal surface area. This project involves a team of researchers with backgrounds in cement technology, supercritical fluid technology, materials science, oceanography, and wetland biogeochemistry.

Kerry M. Dooley; F. Carl Knopf; Robert P. Gambrell

1999-05-31

55

Longitudinal Profiles of Carbon Dioxide Fixation Capacities in Marine Macroalgae 1  

PubMed Central

Fucus serratus L., Fucus spiralis L., and Fucus vesiculosus L. (Fucales, Phaeophyceae) as well as Laminaria digitata (Huds.) Lamour., Laminaria hyperborea (Gunn.) Fosl., and Laminaria saccharina (L.) Lamour. (Laminariales, Phaeophyceae) have been investigated for the distribution of enzymic CO2 fixation capacities via phosphoenolpyruvate carboxykinase (EC 4.1.1.32) (PEP-CK) and via ribulose-1,5-bisphosphate carboxylase (EC 4.1.1.39) (RubP-C) in different regions of the thalli. The maximum of PEP-CK activity is found to be confined to the growing regions of the algae, while the activity of RubP-C achieves its highest values in the entirely differentiated parts of the fronds. These findings are confirmed by the results of photosynthetic and light-independent (dark) carbon assimilation as determined by in vivo 14CO2 fixation. The physiological significance of these differential patterns of carboxylation patterns is discussed with respect to the ontogenetic stage and the chemical constitution of the different thallus parts.

Kuppers, Ursula; Kremer, Bruno P.

1978-01-01

56

Predicting the electron requirement for carbon fixation in seas and oceans.  

PubMed

Marine phytoplankton account for about 50% of all global net primary productivity (NPP). Active fluorometry, mainly Fast Repetition Rate fluorometry (FRRf), has been advocated as means of providing high resolution estimates of NPP. However, not measuring CO2-fixation directly, FRRf instead provides photosynthetic quantum efficiency estimates from which electron transfer rates (ETR) and ultimately CO2-fixation rates can be derived. Consequently, conversions of ETRs to CO2-fixation requires knowledge of the electron requirement for carbon fixation (?e,C, ETR/CO2 uptake rate) and its dependence on environmental gradients. Such knowledge is critical for large scale implementation of active fluorescence to better characterise CO2-uptake. Here we examine the variability of experimentally determined ?e,C values in relation to key environmental variables with the aim of developing new working algorithms for the calculation of ?e,C from environmental variables. Coincident FRRf and (14)C-uptake and environmental data from 14 studies covering 12 marine regions were analysed via a meta-analytical, non-parametric, multivariate approach. Combining all studies, ?e,C varied between 1.15 and 54.2 mol e(-) (mol C)(-1) with a mean of 10.9 ± 6.91 mol e(-) mol C)(-1). Although variability of ?e,C was related to environmental gradients at global scales, region-specific analyses provided far improved predictive capability. However, use of regional ? e,C algorithms requires objective means of defining regions of interest, which remains challenging. Considering individual studies and specific small-scale regions, temperature, nutrient and light availability were correlated with ? e,C albeit to varying degrees and depending on the study/region and the composition of the extant phytoplankton community. At the level of large biogeographic regions and distinct water masses, ? e,C was related to nutrient availability, chlorophyll, as well as temperature and/or salinity in most regions, while light availability was also important in Baltic Sea and shelf waters. The novel ? e,C algorithms provide a major step forward for widespread fluorometry-based NPP estimates and highlight the need for further studying the natural variability of ?e,C to verify and develop algorithms with improved accuracy. PMID:23516441

Lawrenz, Evelyn; Silsbe, Greg; Capuzzo, Elisa; Ylöstalo, Pasi; Forster, Rodney M; Simis, Stefan G H; Prášil, Ond?ej; Kromkamp, Jacco C; Hickman, Anna E; Moore, C Mark; Forget, Marie-Hélèn; Geider, Richard J; Suggett, David J

2013-01-01

57

Carbon dioxide fixation: bifunctional complexes containing acidic and basic sites working as reversible carriers  

SciTech Connect

Carbon dioxide fixation in its intact form is achieved from ''bifunctional'' complexes containing in their structure a nucleophilic cobalt(I) and an alkali cation: Co(R-salen)M (R-salen = substituted salen ligand; salen = N,N'-ethylenebis(salicylideneaminato); M = Li, Na, K, Cs). The fixation of CO/sub 2/ by such systems displays different degrees of reversibility depending on the reaction solvent and the nature of the alkali cation. The X-ray analysis carried out on (Co(n-Pr-salen)K-(CO)/sub 2/(THF)) shows carbon dioxide anchored to the cobalt through a Co-C sigma bond, while the oxygens interact with the alkali cation, in a polymeric structure. IR spectra are diagnostic for the presence of CO/sub 2/ bonded as a bent molecule in a reduced form displaying three strong bands in the following ranges: 1700-1650, 1300-1250, and 1250-1200 cm/sup -1/. The binding of CO/sub 2/ is partially prevented in the presence of a crown ether, which can complex the alkali cation. The reaction of (Co(salen)Na(CO/sub 2/)) and (Co(salen)Na(THF)) with dicyclohexano-18 crown-6(DCHC) gave a complex, (Co(salen)Na)/sub 2/(DCHC), whose structure shows the presence of the intact bifunctional unit where, however, all the coordination sites around the alkali cation are filled by the oxygens from salen and DCHC and are not further available for binding the oxygen atoms of the CO/sub 2/ molecule. Crystallographic details and the final R factor for specific observed reflections are given for (Co(n-Pr-salen)K(CO/sub 2/)(THF))/sub n/, (CO(n-Pr-salen)K(CO/sub 2/)(THF))/sub n/, (Co(salen)Na)/sub 2/(DCHC).

Gambarotta, S. (Universita' di Pisa, Italy); Arena, F., Zanazzi, P.

1982-09-22

58

The Majority of Free-Living Autotrophic Bacteria use the Reductive TCA Cycle for Carbon Fixation at Deep-Sea Hydrothermal Vents  

NASA Astrophysics Data System (ADS)

Deep-sea hydrothermal vents support large micro and macroscopic communities, without the input of photosynthesis. Autotrophic production at these vents is based on hydrothermal vent fluid chemistry. Primary production has been thought to occur mainly via hydrogen sulfide oxidation through the Calvin-Benson pathway, as measured by the presence of Rubisco in endosymbionts of several invertebrate hosts. Recently, we characterized two fosmids from a large insert library of the epsilon Proteobacterial episymbionts of Alvinella pompejana. Both contained sequences encoding ATP citrate lyase, a key enzyme in the reverse TCA cycle, an alternate carbon dioxide fixation pathway. Previous investigators have demonstrated the dominance of the epsilon subdivision in the free-living bacterial communities at hydrothermal vents. Based on these results, our working hypothesis is: The rTCA cycle is the dominant pathway for carbon fixation in the free-living bacterial communities at hydrothermal vents. A selection of free-living bacterial communities from various geographic locations (9N, East Pacific Rise and Guaymas Basin) were screened for the presence, diversity and expression (via RT-PCR) of Rubisco (forms I and II) and ATP citrate lyase. Our results indicate that the ATP citrate lyase gene is diverse and is consistently expressed in several types of vent communities. The two forms of Rubisco are not consistently present or expressed in the same environments. These results indicate that chemoautotrophic production in the free-living bacterial communities at deep-sea hydrothermal vents is dominated by bacteria that utilize the rTCA cycle, and parallels the phylogenetic dominance of members of the epsilon subdivision of Proteobacteria.

Campbell, B. J.; Cary, C.

2003-12-01

59

Carbon and nitrogen fixation differ between successional stages of biological soil crusts in the Colorado Plateau and Chihuahuan Desert  

USGS Publications Warehouse

Biological soil crusts (cyanobacteria, mosses and lichens collectively) perform essential ecosystem services, including carbon (C) and nitrogen (N) fixation. Climate and land-use change are converting later successional soil crusts to early successional soil crusts with lower C and N fixation rates. To quantify the effect of such conversions on C and N dynamics in desert ecosystems we seasonally measured diurnal fixation rates in different biological soil crusts. We classified plots on the Colorado Plateau (Canyonlands) and Chihuahuan Desert (Jornada) as early (Microcoleus) or later successional (Nostoc/Scytonema or Placidium/Collema) and measured photosynthesis (Pn), nitrogenase activity (NA), and chlorophyll fluorescence (Fv/Fm) on metabolically active (moist) soil crusts. Later successional crusts typically had greater Pn, averaging 1.2-1.3-fold higher daily C fixation in Canyonlands and 2.4-2.8-fold higher in the Jornada. Later successional crusts also had greater NA, averaging 1.3-7.5-fold higher daily N fixation in Canyonlands and 1.3-25.0-fold higher in the Jornada. Mean daily Fv/Fm was also greater in later successional Canyonlands crusts during winter, and Jornada crusts during all seasons except summer. Together these findings indicate conversion of soil crusts back to early successional stages results in large reductions of C and N inputs into these ecosystems.

Housman, D. C.; Powers, H. H.; Collins, A. D.; Belnap, J.

2006-01-01

60

Microbial microstratification, inorganic carbon photoassimilation and dark carbon fixation at the chemocline of the meromictic Lake Cadagno (Switzerland) and its relevance to the food web  

Microsoft Academic Search

The microstratification of the microbial community at the chemocline of Lake Cadagno and the associated inorganic carbon fixation activity was studied by fine layer sampling. A deep chlorophyll maximum caused by diatoms overlying Cryptomonas was found at the upper edge of the chemocline. A high population density of phototrophic sulphur bacteria, mainly Amoebobacter cf. purpureus, occurred closely below the oxic-anoxic

Antonio Camacho; Jonathan Erez; Alvaro Chicote; Máximo Florín; Margaret M. Squires; Christine Lehmann; Reinhard Backofen

2001-01-01

61

Study of the carbon dioxide chemical fixation—activation by guanidines  

Microsoft Academic Search

Fixation of CO2 is one of the most important priorities of the scientific community dedicated to reduce global warming. In this work, we propose new methods for the fixation of CO2 using the guanidine bases tetramethylguanidine (TMG) and 1,3,4,6,7,8-hexahydro-2H-pyrimido[1,2-a]-pyrimidine (TBD). In order to understand the reactions occurring during the CO2 fixation and release processes, we employed several experimental methods, including

Fernanda Stuani Pereira; Eduardo Ribeiro deAzevedo; Eirik F. da Silva; Tito José Bonagamba; Deuber L. da Silva Agostíni; Alviclér Magalhães; Aldo Eloizo Job; Eduardo R. Pérez González

2008-01-01

62

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5?-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.  

PubMed Central

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5?- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Kuo, Rita C.; Zhang, Huan; Zhuang, Yunyun; Hannick, Linda; Lin, Senjie

2013-01-01

63

Nutrient uptake, chlorophyll a and carbon fixation by Rhodomonas sp. (Cryptophyceae) cultured at different irradiance and nutrient concentrations  

Microsoft Academic Search

The goal of this research was to study biomass production, nitrate and phosphate uptake and carbon fixation in batch culture of the marine microalgae Rhodomonas sp., which is used in aquaculture as food for commercially reared invertebrates. Cultures were grown for 7 days under four irradiance levels (52, 68, 103 and 142?molphotonm?2s?1) and at three nitrate and phosphate concentrations (661–29,

Fabiola Lafarga-De la Cruz; Enrique Valenzuela-Espinoza; Roberto Millán-Núñez; Charles C. Trees; Eduardo Santamaría-del-Ángel; Filiberto Núñez-Cebrero

2006-01-01

64

Physiological regulation of carbon fixation in the photosynthesis and calcification of coccolithophorids.  

PubMed

Emiliania huxleyi and Gephyrocapsa oceanica are the predominant coccolithophorid species that produce blooms in the ocean and affect the global environment. These species are capable of carbon fixation by both photosynthesis for organic matter production and by intracellular calcification for coccolith production. Both processes were strongly affected by the nutrient status in a laboratory culture. The coccolith production was stimulated by the addition of a high concentration of sodium bicarbonate and by the depletion of phosphate. Interestingly, when the calcification was stimulated, the increase in cell number during algal growth was greatly suppressed and then the cell volume increased. When the growth rate was increased under nutrient-sufficient conditions, the cells became very small in size and most of them bore few or no coccoliths. The data from laboratory experiments show that the cell growth and calcification proceeded apparently independently at different phases. We, therefore, assume that the coccolithophorid blooms in the ocean might be separated into two phases; firstly, the increase in cell population might be triggered by an adequate supply of nutrients to enhance algal growth and then the calcification might subsequently be stimulated when the nutrients become depleted by substantial algal growth. PMID:14662302

Shiraiwa, Yoshihiro

2003-12-01

65

Coupling of Carbon Dioxide Fixation to the Oxyhydrogen Reaction in the Isolated Chloroplast of Chlamydomonas reinhardtii.  

PubMed

The oxyhydrogen reaction (the reduction of O(2) to water by H(2)) in the presence of CO(2) was studied in the isolated Chlamydomonas reinhardtii chloroplast by monitoring the rate of (14)CO(2) incorporation into acid-stable products in the dark. The endogenous rate of CO(2) uptake (50-125 nmol/mg chlorophyll per h) was increased about 3- to 4-fold by ATP and additionally when combined with glucose, ribose-5-phosphate, and glycerate-3-phosphate. The rate was diminished 50 to 75%, respectively, when H(2) was replaced by N(2) or by air. Decrease in CO(2) uptake by dl-glyceraldehyde was taken to indicate that the regenerative phase and complete Calvin cycle turnover were involved. Diminution of CO(2) incorporation by rotenone, antimycin A, and 2,5-dibromo-3-methyl-6-isopropanol-p-benzoquinone was attributed to an inhibition of the oxyhydrogen reaction, resulting in an elevated NADPH/NADP ratio. If so, then the diminished CO(2) uptake could have been by "product inhibition" of the carbon metabolic network. Our data are consistent with the proposal (H. Gaffron [1942] J Gen Physiol 26: 241-267) that CO(2) fixation coupled to the oxyhydrogen reaction is dependent to some extent on exchloroplastic metabolism. This support is primarily ATP provided by mitochondrial respiration. PMID:16653129

Chen, C; Gibbs, M

1992-11-01

66

Carbon Dioxide Fixation in the Light and in the Dark by Isolated Spinach Chloroplasts 1  

PubMed Central

Factors affecting CO2 fixation in the spinach (Spinacia oleracea) chloroplast were investigated. Free magnesium ions are shown to be highly inhibitory for photosynthetic CO2 fixation in isolated intact spinach chloroplasts. The pH optimum for CO2 fixation is about 8.5 but is dependent upon the reaction medium. Conditions are defined under which chloroplasts illuminated in the absence of CO2 accumulate ribulose 1,5-diphosphate, and fix CO2 in a subsequent dark period when high magnesium ion concentrations are provided. The regulation of photosynthetic CO2 assimilation by these factors is discussed.

Avron, Mordhay; Gibbs, Martin

1974-01-01

67

Oxygen-18 incorporation into malic acid during nocturnal carbon dioxide fixation in crassulacean acid metabolism plants: a new approach to estimating in vivo carbonic anhydrase activity  

SciTech Connect

Crassulacean acid metabolism (CAM) plants fix carbon dioxide at night by the carboxylation of phosphoenolpyruvate. If CO2 fixation is conducted with TC YO2, then in the absence of carbonic anhydrase, the malate formed by dark CO2 fixation should also contain high levels of carbon-13 and oxygen-18. Conversely, if carbonic anhydrase is present and highly active, oxygen exchange between CO2 and cellular H2O will occur more rapidly than carboxylation, and the ( TC) malate formed will contain little or no oxygen-18 above the natural abundance level. The presence of oxygen-18 in these molecules can be detected either by nuclear magnetic resonance or by mass spectrometry. Studies of phosphoenolpyruvate carboxylase in the presence and absence of carbonic anhydrase in vitro confirm the validity of the method. When CAM plants are studied by this method, we find that most species show incorporation of a significant amount of oxygen-18. Comparison of these results with results of isotope fractionation and gas exchange studies permits calculation of the in vivo activity of carbonic anhydrase toward HCO3 compared with that of phosphoenolpyruvate carboxylase. The ratio (carbonic anhydrase activity/phosphoenolpyruvate carboxylase activity) is species dependent and varies from a low of about 7 for Ananas comosus to values near 20 for Hoya carnosa and Bryophyllum pinnatum, 40 for Kalanchoee daigremontiana, and 100 or greater for Bryophyllum tubiflorum, Kalanchoee serrata, and Kalanchoae tomentosa. Carbonic anhydrase activity increases relative to phosphoenolpyruvate carboxylase activity at higher temperature. 37 references, 2 figures, 8 tables.

Holtum, J.A.M.; Summons, R.; Roeske, C.A.; Comins, H.N.; O'Leary, M.H.

1984-01-01

68

Greater efficiency of photosynthetic carbon fixation due to single amino-acid substitution  

PubMed Central

The C4-photosynthetic carbon cycle is an elaborated addition to the classical C3-photosynthetic pathway, which improves solar conversion efficiency. The key enzyme in this pathway, phosphoenolpyruvate carboxylase, has evolved from an ancestral non-photosynthetic C3 phosphoenolpyruvate carboxylase. During evolution, C4 phosphoenolpyruvate carboxylase has increased its kinetic efficiency and reduced its sensitivity towards the feedback inhibitors malate and aspartate. An open question is the molecular basis of the shift in inhibitor tolerance. Here we show that a single-point mutation is sufficient to account for the drastic differences between the inhibitor tolerances of C3 and C4 phosphoenolpyruvate carboxylases. We solved high-resolution X-ray crystal structures of a C3 phosphoenolpyruvate carboxylase and a closely related C4 phosphoenolpyruvate carboxylase. The comparison of both structures revealed that Arg884 supports tight inhibitor binding in the C3-type enzyme. In the C4 phosphoenolpyruvate carboxylase isoform, this arginine is replaced by glycine. The substitution reduces inhibitor affinity and enables the enzyme to participate in the C4 photosynthesis pathway.

Paulus, Judith Katharina; Schlieper, Daniel; Groth, Georg

2013-01-01

69

Role of dark carbon dioxide fixation in root nodules of soybean. [Rhizobium japonicum  

SciTech Connect

The magnitude and role of dark Co/sub 2/ fixation were examined in nodules of intact soybean plants (Harosoy 63 x Rhizobium japonicum strain USDA 16). The estimated rate of nodule dark CO/sub 2/ fixation, based on a 2 minute pulse-feed with /sup 14/CO/sub 2/ under saturating conditions, was 102 micromoles per gram dry weight per hour. This was equivalent to 14% of net nodule respiration. Only 18% of this CO/sub 2/ fixation was estimated to be required for organic and amino acid synthesis for growth and export processes. The major portion (75-92%) of fixed label was released as CO/sub 2/ within 60 minutes. The labeling pattern during pulse-chase experiments was consistent with CO/sub 2/ fixation by phosphoenolpyruvate carboxylase. During the chase, the greatest loss of label occurred in organic acids. Exposure of nodulated roots to Ar:O/sub 2/(80:20) did not affect dark CO/sub 2/ fixation, while exposure to O/sub 2/:CO/sub 2/(95:5) resulted in 54% inhibition. From these results, it was concluded that at least 66% of dark CO/sub 2/ fixation in soybean may be involved with the production of organic acids, which when oxidized would be capable of providing at least 48% of the requirement for ATP equivalents to support nitrogenase activity.

King, B.J.; Layzell, D.B.; Canvin, D.T.

1986-05-01

70

Enhancing Carbon Fixation by Metabolic Engineering: A Model System of Complex Network Modulation  

SciTech Connect

In the first two years of this research we focused on the development of a DNA microarray for transcriptional studies in the photosynthetic organism Synechocystis and the elucidation of the metabolic pathway for biopolymer synthesis in this organism. In addition we also advanced the molecular biological tools for metabolic engineering of biopolymer synthesis in Synechocystis and initiated a series of physiological studies for the elucidation of the carbon fixing pathways and basic central carbon metabolism of these organisms. During the last two-year period we focused our attention on the continuation and completion of the last task, namely, the development of tools for basic investigations of the physiology of these cells through, primarily, the determination of their metabolic fluxes. The reason for this decision lies in the importance of fluxes as key indicators of physiology and the high level of information content they carry in terms of identifying rate limiting steps in a metabolic pathway. While flux determination is a well-advanced subject for heterotrophic organisms, for the case of autotrophic bacteria, like Synechocystis, some special challenges had to be overcome. These challenges stem mostly from the fact that if one uses {sup 13}C labeled CO{sub 2} for flux determination, the {sup 13}C label will mark, at steady state, all carbon atoms of all cellular metabolites, thus eliminating the necessary differentiation required for flux determination. This peculiarity of autotrophic organisms makes it imperative to carry out flux determination under transient conditions, something that had not been accomplished before. We are pleased to report that we have solved this problem and we are now able to determine fluxes in photosynthetic organisms from stable isotope labeling experiments followed by measurements of label enrichment in cellular metabolites using Gas Chromatography-Mass Spectrometry. We have conducted extensive simulations to test the method and also are presently validating it experimentally using data generated in collaboration with a research group at Purdue University. As result of these studies we can now determine, for the first time, fluxes in photosynthetic organisms and, eventually, in plants.

Dr. Gregory Stephanopoulos

2008-04-10

71

Engineering the Cyanobacterial Carbon Concentrating Mechanism for Enhanced CO2 Capture and Fixation  

SciTech Connect

In cyanobacteria CO2 fixation is localized in a special proteinaceous organelle, the carboxysome. The CO2 fixation enzymes are encapsulated by a selectively permeable protein shell. By structurally and functionally characterizing subunits of the carboxysome shell and the encapsulated proteins, we hope to understand what regulates the shape, assembly and permeability of the shell, as well as the targeting mechanism and organization of the encapsulated proteins. This knowledge will be used to enhance CO2 fixation in both cyanobacteria and plants through synthetic biology. The same strategy can also serve as a template for the production of modular synthetic bacterial organelles. Our research is conducted using a variety of techniques such as genomic sequencing and analysis, transcriptional regulation, DNA synthesis, synthetic biology, protein crystallization, Small Angle X-ray Scattering (SAXS), protein-protein interaction assays and phenotypic characterization using various types of cellular imaging, e.g. fluorescence microscopy, Transmission Electron Microscopy (TEM), and Soft X-ray Tomography (SXT).

Sandh, Gustaf; Cai, Fei; Shih, Patrick; Kinney, James; Axen, Seth; Salmeen, Annette; Zarzycki, Jan; Sutter, Markus; Kerfeld, Cheryl

2011-06-02

72

Oxygen-18 incorporation into malic acid during nocturnal carbon dioxide fixation in crassulacean acid metabolism plants. A new approach to estimating in vivo carbonic anhydrase activity.  

PubMed

Crassulacean acid metabolism (CAM) plants fix carbon dioxide at night by the carboxylation of phosphoenolpyruvate. If CO2 fixation is conducted with 13C18O2 , then in the absence of carbonic anhydrase, the malate formed by dark CO2 fixation should also contain high levels of carbon-13 and oxygen-18. Conversely, if carbonic anhydrase is present and highly active, oxygen exchange between CO2 and cellular H2O will occur more rapidly than carboxylation, and the [13C] malate formed will contain little or no oxygen-18 above the natural abundance level. The presence of oxygen-18 in these molecules can be detected either by nuclear magnetic resonance (using the oxygen-18 effect on the carbon-13 chemical shift of the carboxyl carbon) or by mass spectrometry (comparing the ions at three and five units above the molecular weight with that one unit above). Studies of phosphoenolpyruvate carboxylase in the presence and absence of carbonic anhydrase in vitro confirm the validity of the method. When CAM plants are studied by this method, we find that most species show incorporation of a significant amount of oxygen-18. Comparison of these results with results of isotope fractionation and gas exchange studies permits calculation of the in vivo activity of carbonic anhydrase toward HCO-3 compared with that of phosphoenolpyruvate carboxylase. The ratio (carbonic anhydrase activity/phosphoenolpyruvate carboxylase activity) is species dependent and varies from a low of about 7 for Ananas comosus to values near 20 for Hoya carnosa and Bryophyllum pinnatum , 40 for Kalancho ë daigremontiana , and 100 or greater for Bryophyllum tubiflorum , Kalancho ë serrata, and Kalancho ë tomentosa. Carbonic anhydrase activity increases relative to phosphoenolpyruvate carboxylase activity at higher temperature. PMID:6427227

Holtum, J A; Summons, R; Roeske, C A; Comins, H N; O'Leary, M H

1984-06-10

73

Ammonia fixation by humic substances: A nitrogen-15 and carbon-13 NMR study  

USGS Publications Warehouse

The process of ammonia fixation has been studied in three well characterized and structurally diverse fulvic and humic acid samples. The Suwannee River fulvic acid, and the IHSS peat and leonardite humic acids, were reacted with 15N-labelled ammonium hydroxide, and analyzed by liquid phase 15N NMR spectrometry. Elemental analyses and liquid phase 13C NMR spectra also were recorded on the samples before and after reaction with ammonium hydroxide. The largest increase in percent nitrogen occurred with the Suwannee River fulvic acid, which had a nitrogen content of 0.88% before fixation and 3.17% after fixation. The 15N NMR spectra revealed that ammonia reacted similarly with all three samples, indicating that the functional groups which react with ammonia exist in structural configurations common to all three samples. The majority of nitrogcn incorporated into the samples appears to be in the form of indole and pyrrole nitrogen, followed by pyridine, pyrazine, amide and aminohydroquinone nitrogen. Chemical changes in the individual samples upon fixation could not be discerned from the 13C NMR spectra.

Thorn, K. A.; Mikita, M. A.

1992-01-01

74

Pyrophosphate Inhibition of Carbon Dioxide Fixation in Isolated Pea Chloroplasts by Uptake in Exchange for Endogenous Adenine Nucleotides 1  

PubMed Central

Carbon dioxide-dependent O2 evolution by isolated pea (Pisum sativum) chloroplasts was inhibited by inorganic pyrophosphate (PPi). Oxygen evolution was also inhibited by high concentrations of orthophosphate (Pi) and the inhibition was relieved by 3-phosphoglycerate. In contrast, the inhibition by PPi was not relieved by 3-phosphoglycerate, indicating that hydrolysis of PPi and accumulation of inhibitory concentrations of Pi were not occurring. In agreement with this suggestion, the percentage of 14C-labeled products diffusing out of the chloroplasts was increased by Pi but not by PPi. The inhibition of O2 evolution by PPi was reversed by ATP. The concentration of PPi required for 50% inhibition was 1.2 to 1.4 mm and the subsequent stimulation by ATP was half-maximal at 16 to 25 ?m. Carbon dioxide-dependent O2 evolution by spinach chloroplasts, or chloroplasts isolated from older pea plants, was not significantly inhibited by PPi. Chloroplasts were preloaded with 14C-ATP and release of the labeled nucleotides was measured to assess the activity of adenine nucleotide transport across the inner chloroplast envelope membrane. A rapid exchange was promoted by the addition of exogenous ATP. Addition of PPi also resulted in a release of endogenous nucleotides. We suggest that PPi inhibits CO2 fixation by entering the chloroplast in exchange for endogenous adenine nucleotides via the transporter on the inner envelope membrane. The subsequent depletion of the internal adenine nucleotide pool would result in decreased CO2 fixation due to insufficient ATP. Addition of ATP to PPi-inhibited chloroplasts apparently results in uptake of catalytic amounts of ATP and restoration of the internal adenine nucleotide pool thus relieving the inhibition of CO2 fixation.

Robinson, Simon P.; Wiskich, Joseph T.

1977-01-01

75

Transitions in pathways of human development and carbon emissions  

NASA Astrophysics Data System (ADS)

Countries are known to follow diverse pathways of life expectancy and carbon emissions, but little is known about factors driving these dynamics. In this letter we estimate the cross-sectional economic, demographic and geographic drivers of consumption-based carbon emissions. Using clustering techniques, countries are grouped according to their drivers, and analysed with respect to a criteria of one tonne of carbon emissions per capita and a life expectancy over 70 years (Goldemberg’s Corner). Five clusters of countries are identified with distinct drivers and highly differentiated outcomes of life expectancy and carbon emissions. Representatives from four clusters intersect within Goldemberg’s Corner, suggesting diverse combinations of drivers may still lead to sustainable outcomes, presenting many countries with an opportunity to follow a pathway towards low-carbon human development. By contrast, within Goldemberg’s Corner, there are no countries from the core, wealthy consuming nations. These results reaffirm the need to address economic inequalities within international agreements for climate mitigation, but acknowledge plausible and accessible examples of low-carbon human development for countries that share similar underlying drivers of carbon emissions. In addition, we note differences in drivers between models of territorial and consumption-based carbon emissions, and discuss interesting exceptions to the drivers-based cluster analysis.

Lamb, W. F.; Steinberger, J. K.; Bows-Larkin, A.; Peters, G. P.; Roberts, J. T.; Wood, F. R.

2014-01-01

76

Geochemical roots of autotrophic carbon fixation: hydrothermal experiments in the system citric acid, H 2O-(±FeS)-(±NiS)  

NASA Astrophysics Data System (ADS)

Recent theories have proposed that life arose from primitive hydrothermal environments employing chemical reactions analogous to the reductive citrate cycle (RCC) as the primary pathway for carbon fixation. This chemistry is presumed to have developed as a natural consequence of the intrinsic geochemistry of the young, prebiotic, Earth. There has been no experimental evidence, however, demonstrating that there exists a natural pathway into such a cycle. Toward this end, the results of hydrothermal experiments involving citric acid are used as a method of deducing such a pathway. Homocatalytic reactions observed in the citric acid-H 2O experiments encompass many of the reactions found in modern metabolic systems, i.e., hydration-dehydration, retro-Aldol, decarboxylation, hydrogenation, and isomerization reactions. Three principal decomposition pathways operate to degrade citric acid under thermal and aquathermal conditions. It is concluded that the acid catalyzed ?? decarboxylation pathway, leading ultimately to propene and CO 2, may provide the most promise for reaction network reversal under natural hydrothermal conditions. Increased pressure is shown to accelerate the principal decarboxylation reactions under strictly hydrothermal conditions. The effect of forcing the pH via the addition of NaOH reveals that the ?? decarboxylation pathway operates even up to intermediate pH levels. The potential for network reversal (the conversion of propene and CO 2 up to a tricarboxylic acid) is demonstrated via the Koch (hydrocarboxylation) reaction promoted heterocatalytically with NiS in the presence of a source of CO. Specifically, an olefin (1-nonene) is converted to a monocarboxylic acid; methacrylic acid is converted to the dicarboxylic acid, methylsuccinic acid; and the dicarboxylic acid, itaconic acid, is converted into the tricarboxylic acid, hydroaconitic acid. A number of interesting sulfur-containing products are also formed that may provide for additional reaction. The intrinsic catalytic qualities of FeS and NiS are also explored in the absence of CO. It was shown that the addition of NiS has a minimal effect in the product distribution, whereas the addition of FeS leads to the formation of hydrogenated and sulfur-containing products (thioethers). These results point to a simple hydrothermal redox pathway for citric acid synthesis that may have provided a geochemical ignition point for the reductive citrate cycle.

Cody, G. D.; Boctor, N. Z.; Hazen, R. M.; Brandes, J. A.; Morowitz, Harold J.; Yoder, H. S.

2001-10-01

77

Photophosphorylation and Carbon Dioxide Fixation by Chloroplasts Isolated from Populus deltoides1  

PubMed Central

A system has been developed for the isolation of photosynthetically active chloroplasts from leaves of Populus deltoides. A high proportion of the chloroplasts appeared intact. The maximum rates of different photosynthetic processes were as follows: CO2 fixation 3.5 micromoles per milligram chlorophyll per hour, noncyclic ATP synthesis 10 micromoles per milligram chlorophyll per hour, and cyclic ATP synthesis 300 micromoles per milligram chlorophyll per hour.

Hernandez-Gil, Ruben; Schaedle, Michail

1972-01-01

78

13C Metabolic Flux Analysis Identifies an Unusual Route for Pyruvate Dissimilation in Mycobacteria which Requires Isocitrate Lyase and Carbon Dioxide Fixation  

PubMed Central

Mycobacterium tuberculosis requires the enzyme isocitrate lyase (ICL) for growth and virulence in vivo. The demonstration that M. tuberculosis also requires ICL for survival during nutrient starvation and has a role during steady state growth in a glycerol limited chemostat indicates a function for this enzyme which extends beyond fat metabolism. As isocitrate lyase is a potential drug target elucidating the role of this enzyme is of importance; however, the role of isocitrate lyase has never been investigated at the level of in vivo fluxes. Here we show that deletion of one of the two icl genes impairs the replication of Mycobacterium bovis BCG at slow growth rate in a carbon limited chemostat. In order to further understand the role of isocitrate lyase in the central metabolism of mycobacteria the effect of growth rate on the in vivo fluxes was studied for the first time using 13C-metabolic flux analysis (MFA). Tracer experiments were performed with steady state chemostat cultures of BCG or M. tuberculosis supplied with 13C labeled glycerol or sodium bicarbonate. Through measurements of the 13C isotopomer labeling patterns in protein-derived amino acids and enzymatic activity assays we have identified the activity of a novel pathway for pyruvate dissimilation. We named this the GAS pathway because it utilizes the Glyoxylate shunt and Anapleurotic reactions for oxidation of pyruvate, and Succinyl CoA synthetase for the generation of succinyl CoA combined with a very low flux through the succinate – oxaloacetate segment of the tricarboxylic acid cycle. We confirm that M. tuberculosis can fix carbon from CO2 into biomass. As the human host is abundant in CO2 this finding requires further investigation in vivo as CO2 fixation may provide a point of vulnerability that could be targeted with novel drugs. This study also provides a platform for further studies into the metabolism of M. tuberculosis using 13C-MFA.

Beste, Dany J. V.; Bonde, Bhushan; Hawkins, Nathaniel; Ward, Jane L.; Beale, Michael H.; Noack, Stephan; Noh, Katharina; Kruger, Nicholas J.; Ratcliffe, R. George; McFadden, Johnjoe

2011-01-01

79

Fixation of CO 2 by carbonating calcium derived from blast furnace slag  

Microsoft Academic Search

Industrial waste materials, such as steelmaking slags, appear to be potential raw materials for reducing CO2 emissions by carbonation. The suitability of applying a carbonation route based on acetic acid leaching to produce carbonates from blast furnace slag is presented in this study. The effect of solution pH, temperature, and CO2 pressure on the precipitation of carbonates was experimentally studied.

Sanni Eloneva; Sebastian Teir; Justin Salminen; Carl-Johan Fogelholm; Ron Zevenhoven

2008-01-01

80

The carbon assimilation pathways of Methylococcus capsulatus, Pseudomonas methanica and Methylosinus trichosporium (OB3B) during growth on methane  

PubMed Central

d-arabino-3-Hexulose 6-phosphate was prepared by condensation of formaldehyde with ribulose 5-phosphate in the presence of 3-hexulose phosphate synthase from methane-grown Methylococcus capsulatus. The 3-hexulose phosphate was unstable in solutions of pH greater than 3, giving a mixture of products in which, after dephosphorylation, allulose and fructose were detected. A complete conversion of d-ribulose 5-phosphate and formaldehyde into d-fructose 6-phosphate was demonstrated in the presence of 3-hexulose phosphate synthase and phospho-3-hexuloisomerase (prepared from methane-grown M. capsulatus). d-Allulose 6-phosphate was prepared from d-allose by way of d-allose 6-phosphate. No evidence was found for its metabolism by extracts of M. capsulatus, thus eliminating it as an intermediate in the carbon assimilation process of this organism. A survey was made of the enzymes involved in the regeneration of pentose phosphate during C1 assimilation via a modified pentose phosphate cycle. On the basis of the presence of the necessary enzymes, two alternative routes for cleavage of fructose 6-phosphate are suggested, one route involves fructose diphosphate aldolase and the other 6-phospho-2-keto-3-deoxygluconate aldolase. A detailed formulation of the complete ribulose monophosphate cycle of formaldehyde fixation is presented. The energy requirements for carbon assimilation by this cycle are compared with those for the serine pathway and the ribulose diphosphate cycle of carbon dioxide fixation. A cyclic scheme for oxidation of formaldehyde via 6-phosphogluconate is suggested.

Str?m, Terje; Ferenci, Thomas; Quayle, J. Rodney

1974-01-01

81

Activity of carbon dioxide fixation by anthers and leaves of cereal grains  

SciTech Connect

This paper gives a comparative evaluation of the photosynthetic activity of anthers and flag leaves in winter wheat, rye, and triticale. The content of chlorophylls in anthers and leaves was determined. The activity of /sup 14/CO/sub 2/ fixation by anthers and leaf disks was determined by the radiometric method in a chamber floating on mercury under standard exposure conditions (0.1% concentration of /sup 14/CO/sub 2/, illumination of 15,000 1x, temperature of 23 C). Analyses were conducted in three replications and the results of typical biological experiments are cited. Data show that chlorophyll is actively synthesized in the anthers of cereal grains.

Kirichenko, E.B.; Chernyad'ev, I.I.; Doman, N.G.; Talibullina, K.K.; Voronkova, T.V.

1986-05-01

82

RuBP limitation of photosynthetic carbon fixation during NH sub 3 assimilation: Interactions between photosynthesis, respiration, and ammonium assimilation in N-limited green algae  

SciTech Connect

The effects of ammonium assimilation on photosynthetic carbon fixation and O{sub 2} exchange were examined in two species of N-limited green algae, Chlorella pyrenoidosa and Selenastrum minutum. Under light-saturating conditions, ammonium assimilation resulted in a suppression of photosynthetic carbon fixation by S. minutum but not by C. pyrenoidosa. These different responses are due to different relationships between cellular ribulose bisphosphate (RuBP) concentration and the RuBP binding site density of ribulose bisphosphate carboxylase/oxygenase (Rubisco). In both species, ammonium assimilation resulted in a decrease in RuBP concentration. In S. minutum the concentration fell below the RuBP binding site density of Rubisco, indicating RuBP limitation of carboxylation. In contrast, RuBP concentration remained above the binding site density in C. pyrenoidosa. Compromising RuBP regeneration in C. pyrenoidosa with low light resulted in an ammonium-induced decrease in RuBP concentration below the RuBP binding site density of Rubisco. This resulted in a decrease in photosynthetic carbon fixation. In both species, ammonium assimilation resulted in a larger decrease in net O{sub 2} evolution than in carbon fixation. Mass spectrometric analysis shows this to be a result of an increase in the rate of mitochondrial respiration in the light.

Elrifi, I.R.; Holmes, J.J.; Weger, H.G.; Mayo, W.P.; Turpin, D.H. (Queen's Univ., Kingston, Ontario (Canada))

1988-06-01

83

Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L  

SciTech Connect

Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwall and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.

Singal, H.R.; Sheoran, I.S.; Singh, R.

1987-04-01

84

Photosynthetic Carbon Metabolism in Seagrasses 14C-Labeling Evidence for the C3 Pathway  

PubMed Central

The ?13C values of several seagrasses were considerably less negative than those of terrestrial C3 plants and tended toward those of terrestrial C4 plants. However, for Thalassia hemprichii (Ehrenb.) Aschers and Halophila spinulosa (R. Br.) Aschers, phosphoglycerate and other C3 cycle intermediates predominated among the early labeled products of photosynthesis in 14C-labeled seawater (more than 90% at the earliest times) and the labeling pattern at longer times was brought about by the operation of the C3 pathway. Malate and aspartate together accounted for only a minor fraction of the total fixed label at all times and the kinetic data of this labeling were not at all consistent with these compounds being early intermediates in seagrass photosynthesis. Pulse-chase 14C-labeling studies further substantiated these conclusions. Significant labeling of photorespiratory intermediates was observed in all experiments. The kinetics of total fixation of label during some steady-state and pulse-chase experiments suggested that there may be an intermediate pool of inorganic carbon of variable size closely associated with the leaves, either externally or internally. Such a pool may be one cause for the C4-like carbon isotope ratios of seagrasses. Images

Andrews, T. John; Abel, Kay M.

1979-01-01

85

The R3-carbon allotrope: a pathway towards glassy carbon under high pressure  

PubMed Central

Pressure-induced bond type switching and phase transformation in glassy carbon (GC) has been simulated by means of Density Functional Theory (DFT) calculations and the Stochastic Quenching method (SQ) in a wide range of pressures (0–79?GPa). Under pressure, the GC experiences a hardening transition from sp- and sp2-type to sp3-type bonding, in agreement with previous experimental results. Moreover, a new crystalline carbon allotrope possessing R3 symmetry (R3-carbon) is predicted using the stochastic SQ method. The results indicate that R3-carbon can be regarded as an allotrope similar to that of amorphous GC. A very small difference in the heat of formation and the coherence of the radial and angular distribution functions of GC and the R3-carbon structure imply that small perturbations to this crystalline carbon allotrope may provide another possible amorphization pathway of carbon besides that of quenching the liquid melt or gas by ultra-fast cooling.

Jiang, Xue; Arhammar, Cecilia; Liu, Peng; Zhao, Jijun; Ahuja, Rajeev

2013-01-01

86

Carbon preservation in humic lakes; a hierarchical regulatory pathway.  

PubMed

Peatland catchments store vast amounts of carbon. Humic lakes and pools are the primary receptacles for terrigenous carbon in these meta-ecosystems, representing sequestration hotspots; boreal lakes alone store ca. 120 Pg C. But little is known about the mechanisms that preserve aquatic carbon stocks. Here, we determined the regulatory pathway of decomposition in relation to 'traditional' limitations, namely anoxia, decay inhibiting compounds, low nutrients and acidity, using in vitro manipulation, mesocosms and natural gradients. We show that anoxia represents a powerful hierarchical preservation mechanism affecting all major limitations on decomposition and recapturing carbon that would otherwise escape from peatlands. Oxygen constraints on microbial synthesis of oxidases and nutrient-cycling enzymes, prevents the decay of organic matter to CO2 , CH4 and N2 O by allowing inhibitor accumulation and lowering nutrients. However, this pathway is sensitive to direct nutrient inputs and therefore eutrophication could initiate catastrophic feedback to global warming via dramatically increased greenhouse gas emissions. Identifying these process-specific limitations should inform better management and conservation of these vital systems. PMID:23504835

Fenner, Nathalie; Freeman, Chris

2013-03-01

87

Autotrophy as a predominant mode of carbon fixation in anaerobic methane-oxidizing microbial communities  

PubMed Central

The methane-rich, hydrothermally heated sediments of the Guaymas Basin are inhabited by thermophilic microorganisms, including anaerobic methane-oxidizing archaea (mainly ANME-1) and sulfate-reducing bacteria (e.g., HotSeep-1 cluster). We studied the microbial carbon flow in ANME-1/ HotSeep-1 enrichments in stable-isotope–probing experiments with and without methane. The relative incorporation of 13C from either dissolved inorganic carbon or methane into lipids revealed that methane-oxidizing archaea assimilated primarily inorganic carbon. This assimilation is strongly accelerated in the presence of methane. Experiments with simultaneous amendments of both 13C-labeled dissolved inorganic carbon and deuterated water provided further insights into production rates of individual lipids derived from members of the methane-oxidizing community as well as their carbon sources used for lipid biosynthesis. In the presence of methane, all prominent lipids carried a dual isotopic signal indicative of their origin from primarily autotrophic microbes. In the absence of methane, archaeal lipid production ceased and bacterial lipid production dropped by 90%; the lipids produced by the residual fraction of the metabolically active bacterial community predominantly carried a heterotrophic signal. Collectively our results strongly suggest that the studied ANME-1 archaea oxidize methane but assimilate inorganic carbon and should thus be classified as methane-oxidizing chemoorganoautotrophs.

Kellermann, Matthias Y.; Wegener, Gunter; Elvert, Marcus; Yoshinaga, Marcos Yukio; Lin, Yu-Shih; Holler, Thomas; Mollar, Xavier Prieto; Knittel, Katrin; Hinrichs, Kai-Uwe

2012-01-01

88

Pathways of organic carbon oxidation in three continental margin sediments  

NASA Technical Reports Server (NTRS)

We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and Mn reduction) has probably been well underestimated.

Canfield, D. E.; Jorgensen, B. B.; Fossing, H.; Glud, R.; Gundersen, J.; Ramsing, N. B.; Thamdrup, B.; Hansen, J. W.; Nielsen, L. P.; Hall, P. O.

1993-01-01

89

Photosynthesis of Grass Species Differing in Carbon Dioxide Fixation Pathways 1  

PubMed Central

Ultrastructural studies of leaves of seven Panicum species in or closely related to the Laxa group and classified as C3, C4 or C3-C4 intermediate were undertaken to examine features associated with C3 and C4 photosynthesis. The C3 species Panicum rivulare Trin. had few organelles in bundle sheath cell profiles (2 chloroplasts, 1.1 mitochondria, and 0.3 peroxisomes per cell section) compared to an average of 10.6 chloroplasts, 17.7 mitochondria, and 3.2 peroxisomes per bundle sheath cell profile for three C3-C4 species, Panicum milioides Nees ex Trin., Panicum decipiens Nees ex Trin. and Panicum schenckii Hack. However, two other C3 species, Panicum laxum Sw. and Panicum hylaeicum Mez, contained about 0.7, 0.5, and 0.3 as many chloroplasts, mitochondria, and peroxisomes, respectively, as in bundle sheath cell profiles of the C3-C4 species. Chloroplasts and mitochondria in bundle sheath cells were larger than those in mesophyll cells for the C4 species Panicum prionitis Griseb. and the C3-C4 species, but in C3 species the organelles were similar in size or were smaller in the bundle sheath cells. The C3-C4 species and P. laxum and P. hylaeicum exhibited an unusually close association of organelles in bundle sheath cells with mitochondria frequently surrounded in profile by chloroplasts. The high concentrations in bundle sheath cells of somewhat larger organelles than in mesophyll cells correlates with the reduced photorespiration of the C3-C4 species. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6

Brown, R. Harold; Bouton, Joseph H.; Rigsby, Luanne; Rigler, Mark

1983-01-01

90

Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation  

PubMed Central

The atmospheric and deep sea reservoirs of carbon dioxide are linked via physical, chemical, and biological processes. The last of these include photosynthesis, particle settling, and organic matter remineralization, and are collectively termed the “biological carbon pump.” Herein, we present results from a 13-y (1992–2004) sediment trap experiment conducted in the permanently oligotrophic North Pacific Subtropical Gyre that document a large, rapid, and predictable summertime (July 15–August 15) pulse in particulate matter export to the deep sea (4,000 m). Peak daily fluxes of particulate matter during the summer export pulse (SEP) average 408, 283, 24.1, 1.1, and 67.5 ?mol·m?2·d?1 for total carbon, organic carbon, nitrogen, phosphorus (PP), and biogenic silica, respectively. The SEP is approximately threefold greater than mean wintertime particle fluxes and fuels more efficient carbon sequestration because of low remineralization during downward transit that leads to elevated total carbon/PP and organic carbon/PP particle stoichiometry (371:1 and 250:1, respectively). Our long-term observations suggest that seasonal changes in the microbial assemblage, namely, summertime increases in the biomass and productivity of symbiotic nitrogen-fixing cyanobacteria in association with diatoms, are the main cause of the prominent SEP. The recurrent SEP is enigmatic because it is focused in time despite the absence of any obvious predictable stimulus or habitat condition. We hypothesize that changes in day length (photoperiodism) may be an important environmental cue to initiate aggregation and subsequent export of organic matter to the deep sea.

Karl, David M.; Church, Matthew J.; Dore, John E.; Letelier, Ricardo M.; Mahaffey, Claire

2012-01-01

91

Carbon isotope fractionation and the acetyl-CoA pathway  

NASA Astrophysics Data System (ADS)

Homoacetogenic bacteria can catalyze the reductive synthesis of acetate from CO2 via the acetyl-CoA pathway. Besides this unifying property homoacetogenic bacteria constitute a metabolically and phylogenetically diverse bacteriological group. Therefore their environmental role is difficult to address. It has been recognized that in methanogenic environments homoacetogenic bacteria contribute to the degradation of organic matter. The natural abundance of 13C may be used to understand the functional impact of homoacetogenic bacteria in the soil environment. To distinguish the acetyl-CoA pathway from other dominant processes, the isotopic composition of acetate and CO2 can be determined and the fractionation factors of the individual processes may be used to discriminate between the dominant pathways. To characterize the fractionation factor associated with the acetyl-CoA pathway the phylogenetic and metabolic diversity needs to be considered. Therefore the fractionation factor of substrate utilization and product formation of different homoacetogens (Acetobacterium woodii, Sporomusa ovata, Thermoanaerobacter kivui, Morella thermoautotrophica) has been studied under pure culture conditions in two defined minimal medium with H2/CO2 as sole source of carbon and energy. It became obvious that the cultivation conditions have a major impact on the obtained fractionation factors.

Blaser, Martin; Conrad, Ralf

2010-05-01

92

Nitrogen-Dependent Carbon Fixation by Picoplankton In Culture and in the Mississippi River  

SciTech Connect

The pepc gene, which encodes phosphoenolpyruvate carboxylase (PEPC), of the marine cyanobacterium Synechococcus PCC 7002, was isolated and sequenced. PEPC is an anaplerotic enzyme, but it may also contribute to overall CO2 fixation through β-carboxylation reactions. A consensus sequence generated by aligning the pepc genes of Anabaena variabilis, Anacystis nidulans and Synechocystis PCC 6803 was used to design two sets of primers that were used to amplify segments of Synechococcus PCC 7002 pepc. In order to isolate the gene, the sequence of the PCR product was used to search for the pepc nucleotide sequence from the publicly available genome of Synechococcus PCC 7002. At the time, the genome for this organism had not been completed although sequences of a significant number of its fragments are available in public databases. Thus, the major challenge was to find the pepc gene among those fragments and to complete gaps as necessary. Even though the search did not yield the complete gene, PCR primers were designed to amplify a DNA fragment using a high fidelity thermostable DNA polymerase. An open reading frame (ORF) consisting of 2988 base pairs coding for 995 amino acids was found in the 3066 bp PCR product. The pepc gene had a GC content of 52% and the deduced protein had a calculated molecular mass of 114,049 Da. The amino acid sequence was closely related to that of PEPC from other cyanobacteria, exhibiting 59-61% identity. The sequence differed significantly from plant and E. coli PEPC with only 30% homology. However, comparing the Synechococcus PCC 7002 sequence to the recently resolved E. coli PEPC revealed that most of the essential domains and amino acids involved in PEPC activity were shared by both proteins. The recombinant Synechococcus PCC 7002 PEPC was expressed in E. coli.

Aubrey Smith; Marguerite W. Coomes; Thomas E. Smith

2005-04-30

93

Regulation of photosynthetic carbon fixation on the ocean margins. Final report  

SciTech Connect

The US Department of Energy is concerned with the fate of energy-related materials, including carbon dioxide, in the marine environment. Using laboratory studies, as well as field studies, an attempt was made to understand the molecular regulation of photosynthetic carbon reduction. The objectives were: to determine the mechanism of regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBPCase) in phytoplankton in response to changes in light fields; and to determine regulation of (RuBPCase) in response to light under nutrient deprivation.

Paul, J.H.

1997-06-01

94

Highly efficient chemical fixation of carbon dioxide catalyzed by high-valent tetraphenylporphyrinatotin(IV) triflate  

Microsoft Academic Search

High-valent tetraphenylporphyrinatotin(IV) triflate, [SnIV(TPP)(OTf)2], was found as an efficient catalyst for the coupling of several epoxides (linear and cyclic) with carbon dioxide in the presence of tetrabutylphosphonium bromide as co-catalyst at atmospheric pressure. The reaction temperature, kind of solvent, co-catalyst and axial ligand effect were also investigated.

Fatemeh Ahmadi; Shahram Tangestaninejad; Majid Moghadam; Valiollah Mirkhani; Iraj Mohammadpoor-Baltork; Ahmad Reza Khosropour

2011-01-01

95

Preparation of three-dimensional braided carbon fiber-reinforced PEEK composites for potential load-bearing bone fixations. Part I. Mechanical properties and cytocompatibility.  

PubMed

In this study, we focused on fabrication and characterization of three-dimensional carbon fiber-reinforced polyetheretherketone (C3-D/PEEK) composites for orthopedic applications. We found that pre-heating of 3-D fabrics before hot-pressing could eliminate pores in the composites prepared by 3-D co-braiding and hot-pressing techniques. The manufacturing process and the processing variables were studied and optimum parameters were obtained. Moreover, the carbon fibers were surface treated by the anodic oxidization and its effect on mechanical properties of the composites was determined. Preliminary cell studies with mouse osteoblast cells were also performed to examine the cytocompatibility of the composites. Feasibility of the C3-D/PEEK composites as load-bearing bone fixation materials was evaluated. Results suggest that the C3-D/PEEK composites show good promising as load-bearing bone fixations. PMID:24076782

Luo, Honglin; Xiong, Guangyao; Yang, Zhiwei; Raman, Sudha R; Li, Qiuping; Ma, Chunying; Li, Deying; Wang, Zheren; Wan, Yizao

2014-01-01

96

Thermodynamics and high-pressure kinetics of a fast carbon dioxide fixation reaction by a (2,6-pyridinedicarboxamidato-hydroxo)nickel(II) complex.  

PubMed

The previously reported carbon dioxide fixation reaction by the planar terminal hydroxide complex [Ni(pyN2(Me2))(OH)](1-) in DMF has been further characterized by determination of the equilibrium constants K(eq)²?? = 2.4 ± 0.2 × 10(5) M(-1) and K(eq)²²³ = 1.3 ± 0.1 × 10(7) M(-1), as well as the volume of activation for the CO2 binding (?V(on)(?223) = -21 ± 3 cm(3) mol(-1)) and back decarboxylation (?V(off)(?223) = -13 ± 1 cm(3) mol(-1)) by high-pressure kinetics. The data are consistent with an earlier DFT computation, including the probable nature of the transition state, and support designating the reaction as one of the most completely investigated carbon dioxide fixation reactions of any type. PMID:24572679

Troeppner, O; Huang, D; Holm, R H; Ivanovi?-Burmazovi?, I

2014-04-14

97

Chemolithotrophic nitrite oxidation by Nitrobacter: coupling with carbon dioxide fixation for growth and influence of metal ions and inorganic compounds of sulfur  

SciTech Connect

The growth of Nitrobacter winogradskyi was completely inhibited by 0.1 mM persulfate, 0.5 mM tetrathionate, or by 5 mM each of dithionite, metabisulfite, or trithionate. The oxygen uptake activity of washed N. agilis cell suspensions was not influenced by persulfate or tetrathionate. Carbon dioxide fixation was insensitive to tetrathionate and in fact an enhancement by tetrathionate was observed. Persulfate inhibited the fixation of carbon dioxide only at a high concentration. The oxygen uptake activity of washed ell suspensions of N. agilis was tested in the presence of copper, nickel, aluminum, uranyl, and molybdate ions. Copper ion was slightly stimulatory at 0.17 M and strongly inhibitory at 17 mM. Molybdate ion showed either slight enhancement or no inhibition at all test concentrations. With the other test ions inhibition of oxygen uptake was observed.

Tsai, Y.L.

1986-01-01

98

Fixation and activation of carbon dioxide on aluminum porphyrin. Catalytic formation of carbamic ester from carbon dioxide, amine, and epoxide  

SciTech Connect

Carbon dioxide is trapped by (5,10,15,20-tetraphenylporphinato) aluminum acetate in the presence of a secondary amine in the form of an aluminum carbamate on the opposite side to the acetate group with respect to the porphyrin plane. Carbon dioxide thus trapped by aluminum porphyrin is activated enough to undergo a catalytic reaction involving secondary amine and epoxide to afford dialkylcarbamic ester under atmospheric pressure at room temperature. 15 references, 2 figures, 2 tables.

Kojima, F.; Aida, T.; Inoue, S.

1986-02-05

99

Influence of the CO2 absorbent monoethanolamine on growth and carbon fixation by the green alga Scenedesmus sp.  

PubMed

The influence of monoethanolamine (MEA) as a CO(2) absorbent on photoautotrophic culture of CO(2)-fixing microalgae was investigated. When 300 ppm MEA (4.92 mM) was added to blank culture medium, the dissolved inorganic carbon and the molar absorption ratio increased to 51.0mg/L and 0.34 mol CO2 = mol MEA, respectively, which was an almost 6-fold increase in CO(2) solubility. When free MEA up to 300 mg/L was added to a green alga Scenedesmus sp. culture that was supplied 5% (v/v) CO(2) at 0.1 vvm, both cell growth rate and final cell density were enhanced compared to when no MEA was added. The cell growth rate reached 288.6 mg/L/d, which was equivalent to 539.6 mg-CO(2)/L/d as a CO(2)-fixation rate and enhancement of about 63.0% compared to not adding MEA. Chlorophyll-a content and nitrate consumption rate increased correspondingly. MEA doses higher than 400mg/L inhibited cell growth, probably due to toxicity of the carbamate intermediate. PMID:22771020

Choi, Wookjin; Kim, Garam; Lee, Kisay

2012-09-01

100

Coupling of Carbon Dioxide Fixation to the Oxyhydrogen Reaction in the Isolated Chloroplast of Chlamydomonas reinhardtii1  

PubMed Central

The oxyhydrogen reaction (the reduction of O2 to water by H2) in the presence of CO2 was studied in the isolated Chlamydomonas reinhardtii chloroplast by monitoring the rate of 14CO2 incorporation into acid-stable products in the dark. The endogenous rate of CO2 uptake (50-125 nmol/mg chlorophyll per h) was increased about 3- to 4-fold by ATP and additionally when combined with glucose, ribose-5-phosphate, and glycerate-3-phosphate. The rate was diminished 50 to 75%, respectively, when H2 was replaced by N2 or by air. Decrease in CO2 uptake by dl-glyceraldehyde was taken to indicate that the regenerative phase and complete Calvin cycle turnover were involved. Diminution of CO2 incorporation by rotenone, antimycin A, and 2,5-dibromo-3-methyl-6-isopropanol-p-benzoquinone was attributed to an inhibition of the oxyhydrogen reaction, resulting in an elevated NADPH/NADP ratio. If so, then the diminished CO2 uptake could have been by “product inhibition” of the carbon metabolic network. Our data are consistent with the proposal (H. Gaffron [1942] J Gen Physiol 26: 241-267) that CO2 fixation coupled to the oxyhydrogen reaction is dependent to some extent on exchloroplastic metabolism. This support is primarily ATP provided by mitochondrial respiration.

Chen, Changguo; Gibbs, Martin

1992-01-01

101

Mesaconyl-coenzyme A hydratase, a new enzyme of two central carbon metabolic pathways in bacteria.  

PubMed

The coenzyme A (CoA)-activated C5-dicarboxylic acids mesaconyl-CoA and beta-methylmalyl-CoA play roles in two as yet not completely resolved central carbon metabolic pathways in bacteria. First, these compounds are intermediates in the 3-hydroxypropionate cycle for autotrophic CO2 fixation in Chloroflexus aurantiacus, a phototrophic green nonsulfur bacterium. Second, mesaconyl-CoA and beta-methylmalyl-CoA are intermediates in the ethylmalonyl-CoA pathway for acetate assimilation in various bacteria, e.g., in Rhodobacter sphaeroides, Methylobacterium extorquens, and Streptomyces species. In both cases, mesaconyl-CoA hydratase was postulated to catalyze the interconversion of mesaconyl-CoA and beta-methylmalyl-CoA. The putative genes coding for this enzyme in C. aurantiacus and R. sphaeroides were cloned and heterologously expressed in Escherichia coli, and the proteins were purified and studied. The recombinant homodimeric 80-kDa proteins catalyzed the reversible dehydration of erythro-beta-methylmalyl-CoA to mesaconyl-CoA with rates of 1,300 micromol min(-1) mg protein(-1). Genes coding for similar enzymes with two (R)-enoyl-CoA hydratase domains are present in the genomes of Roseiflexus, Methylobacterium, Hyphomonas, Rhodospirillum, Xanthobacter, Caulobacter, Magnetospirillum, Jannaschia, Sagittula, Parvibaculum, Stappia, Oceanicola, Loktanella, Silicibacter, Roseobacter, Roseovarius, Dinoroseobacter, Sulfitobacter, Paracoccus, and Ralstonia species. A similar yet distinct class of enzymes containing only one hydratase domain was found in various other bacteria, such as Streptomyces species. The role of this widely distributed new enzyme is discussed. PMID:18065535

Zarzycki, Jan; Schlichting, Ansgar; Strychalsky, Nina; Müller, Michael; Alber, Birgit E; Fuchs, Georg

2008-02-01

102

CO2 fixation kinetics of Halothiobacillus neapolitanus mutant carboxysomes lacking carbonic anhydrase suggest the shell acts as a diffusional barrier for CO2.  

PubMed

The widely accepted models for the role of carboxysomes in the carbon-concentrating mechanism of autotrophic bacteria predict the carboxysomal carbonic anhydrase to be a crucial component. The enzyme is thought to dehydrate abundant cytosolic bicarbonate and provide ribulose 1.5-bisphosphate carboxylase/oxygenase (RubisCO) sequestered within the carboxysome with sufficiently high concentrations of its substrate, CO(2), to permit its efficient fixation onto ribulose 1,5-bisphosphate. In this study, structure and function of carboxysomes purified from wild type Halothiobacillus neapolitanus and from a high CO(2)-requiring mutant that is devoid of carboxysomal carbonic anhydrase were compared. The kinetic constants for the carbon fixation reaction confirmed the importance of a functional carboxysomal carbonic anhydrase for efficient catalysis by RubisCO. Furthermore, comparisons of the reaction in intact and broken microcompartments and by purified carboxysomal RubisCO implicated the protein shell of the microcompartment as impeding diffusion of CO(2) into and out of the carboxysome interior. PMID:18258595

Dou, Zhicheng; Heinhorst, Sabine; Williams, Eric B; Murin, C Daniel; Shively, Jessup M; Cannon, Gordon C

2008-04-18

103

Pathways of Carbon and Energy Metabolism of the Epibiotic Community Associated with the Deep-Sea Hydrothermal Vent Shrimp Rimicaris exoculata  

PubMed Central

Background The shrimp Rimicaris exoculata dominates the faunal biomass at many deep-sea hydrothermal vent sites at the Mid-Atlantic Ridge. In its enlarged gill chamber it harbors a specialized epibiotic bacterial community for which a nutritional role has been proposed. Methodology/Principal Findings We analyzed specimens from the Snake Pit hydrothermal vent field on the Mid-Atlantic Ridge by complementing a 16S rRNA gene survey with the analysis of genes involved in carbon, sulfur and hydrogen metabolism. In addition to Epsilon- and Gammaproteobacteria, the epibiotic community unexpectedly also consists of Deltaproteobacteria of a single phylotype, closely related to the genus Desulfocapsa. The association of these phylogenetic groups with the shrimp was confirmed by fluorescence in situ hybridization. Based on functional gene analyses, we hypothesize that the Gamma- and Epsilonproteobacteria are capable of autotrophic growth by oxidizing reduced sulfur compounds, and that the Deltaproteobacteria are also involved in sulfur metabolism. In addition, the detection of proteobacterial hydrogenases indicates the potential for hydrogen oxidation in these communities. Interestingly, the frequency of these phylotypes in 16S rRNA gene clone libraries from the mouthparts differ from that of the inner lining of the gill chamber, indicating potential functional compartmentalization. Conclusions Our data show the specific association of autotrophic bacteria with Rimicaris exoculata from the Snake Pit hydrothermal vent field, and suggest that autotrophic carbon fixation is contributing to the productivity of the epibiotic community with the reductive tricarboxylic acid cycle as one important carbon fixation pathway. This has not been considered in previous studies of carbon fixation and stable carbon isotope composition of the shrimp and its epibionts. Furthermore, the co-occurrence of sulfur-oxidizing and sulfur-reducing epibionts raises the possibility that both may be involved in the syntrophic exchange of sulfur compounds, which could increase the overall efficiency of this epibiotic community.

Hugler, Michael; Petersen, Jillian M.; Dubilier, Nicole; Imhoff, Johannes F.; Sievert, Stefan M.

2011-01-01

104

Biochemistry and control of the reductive tricarboxylic acid pathway of CO2 fixation and physiological role of the RubisCO-like protein  

SciTech Connect

During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris. 1. Reductive TCA pathway of CO2 assimilation Many diverse microorganisms use the reductive TCA (RTCA) pathway for CO2 assimilation. Included are photoautotrophic and chemoautotrophic organisms that occupy important niches in various ecosystems. Inasmuch as the biochemistry and regulation of the RTCA pathway has been virtually neglected, especially in comparison to the Calvin-Benson-Bassham (CBB) reductive pentose pathway of CO2 fixation, we sought to develop a system that would allow for detailed biochemical analysis of the RTCA enzymes and associated proteins, along with the genes that encode these proteins. We have focused on the green sulfur photosynthetic bacterium Chlorobium tepidum, a fast growing moderate thermophile originally isolated by Professor Mike Madigan and colleagues. Because of its rapid growth and relative ease to produce massive cell amounts via high-density fermentator vessels, C. tepidum has become the organism of choice for investigators interested in studying all aspects of the physiology and biochemistry of green sulfur bacteria. Moreover, this organism possesses a very convenient natural transformation system that allows routine genetic transfer and the generation of knockout mutations via homologous recombination at specific genetic loci. The first such mutations were generated in our laboratory [Hanson & Tabita, PNAS USA, 98 (2001), 4397-4402], such that these protocols have now become relatively routine. Moreover, the genome of C. tepidum was recently sequenced. Thus, all the tools are in place for productive analysis of key processes catalyzed by this organism, in particular for analysis of the RTCA pathway and the rather unique RubisCO-like protein (RLP) that we first discovered during the last grant period of this project [Hanson & Tabita, 2001]. We have concentrated on the enzymology of the key proteins of this pathway, in particular pyruvate synthase (PS), ?-ketoglutarate synthase (KGS), and ATP-citrate lyase (ACL). In addition, we have also focused on key electron transfer proteins that must provide needed reducing equivalents to PS and KGS, including two separate ferredoxins that were shown to be abundantly produced by this organism. 2. Physiological/biochemical/genetic studies on the RubisCO-like Protein (RLP) During the prior grant period we identified what we believe is an evolutional precursor to bona fide RubisCO in C. tepidum, the RubisCO-like protein (RLP) [Hanson & Tabita, 2001]. Typical bioinformatics software incorrectly indicates that RLP is RubisCO, however our previous experience with RubisCO enabled us to establish that C. tepidum RLP has substitutions in 9 out of the 19 residues known to be important for RubisCO-catalyzed CO2 fixation. After purifying recombinant RLP, we showed that the RLP is not a bona fide RubisCO that catalyzes RuBP-dependent CO2 fixation, but appears to function in some aspect of the oxidation of reduced sulfur compounds by this organism. More recent studies [Hanson & Tabita, Photosynth. Res. 78 (2003) 231-248] during the past grant period have established that this effect is related to some aspect of thiosulfate oxidation in the reduced sulfur compound oxidation pathway, as sulfide oxidation was not affected. When we first discovered the RLP, we noted that RLP homologs were also found in other organisms, including heterotrophic bacteria and at least one archaeon [Hanson & Tabita, 2001, 2003]. Finally, as long-time Rubiscologists we have always been intrigued with how the active site of RubisCO might have evolved for its key functional role in metabolizing CO2 and O2 [Tabita, Photosynth. Res. 60 (1999) 1-

Tabita, F Robert

2008-12-04

105

Kinetics and Apparent Km of Oxygen Cycle under Conditions of Limiting Carbon Dioxide Fixation 1  

PubMed Central

A mass spectrometer with a membrane inlet was used to monitor light-driven O2 evolution, O2 uptake, and CO2 uptake in suspensions of algae (Scenedesmus obliquus). We observed the following. (a) The rate of O2 uptake, which, in the presence of iodoacetamide, replaces the uptake of CO2, showed a distinct plateau (Vmax) beyond ?30% O2 and was half-maximal at ?8% O2. We concluded that this light-driven O2 uptake process, which does not involve carbon compounds, is saturated at lower O2 concentrations than are photorespiration and glycolate formation. (b) In the absence of inhibitor, O2 evolution was relatively unaffected by the presence or absence of CO2. During the course of CO2 depletion, electron flow to CO2 was replaced by an equivalent flow to O2. (c) There was a distinct delay between the cessation of CO2 uptake and the increase in O2 uptake. We ascribe this delay to the transient utilization of another electron acceptor—possibly bicarbonate or another bound form of CO2.

Radmer, Richard; Kok, Bessel; Ollinger, Otto

1978-01-01

106

How sensitive are estimates of carbon fixation in agricultural models to input data?  

PubMed Central

Background Process based vegetation models are central to understand the hydrological and carbon cycle. To achieve useful results at regional to global scales, such models require various input data from a wide range of earth observations. Since the geographical extent of these datasets varies from local to global scale, data quality and validity is of major interest when they are chosen for use. It is important to assess the effect of different input datasets in terms of quality to model outputs. In this article, we reflect on both: the uncertainty in input data and the reliability of model results. For our case study analysis we selected the Marchfeld region in Austria. We used independent meteorological datasets from the Central Institute for Meteorology and Geodynamics and the European Centre for Medium-Range Weather Forecasts (ECMWF). Land cover / land use information was taken from the GLC2000 and the CORINE 2000 products. Results For our case study analysis we selected two different process based models: the Environmental Policy Integrated Climate (EPIC) and the Biosphere Energy Transfer Hydrology (BETHY/DLR) model. Both process models show a congruent pattern to changes in input data. The annual variability of NPP reaches 36% for BETHY/DLR and 39% for EPIC when changing major input datasets. However, EPIC is less sensitive to meteorological input data than BETHY/DLR. The ECMWF maximum temperatures show a systematic pattern. Temperatures above 20°C are overestimated, whereas temperatures below 20°C are underestimated, resulting in an overall underestimation of NPP in both models. Besides, BETHY/DLR is sensitive to the choice and accuracy of the land cover product. Discussion This study shows that the impact of input data uncertainty on modelling results need to be assessed: whenever the models are applied under new conditions, local data should be used for both input and result comparison.

2012-01-01

107

Pyrolysis pathways of sulfonated polyethylene, an alternative carbon fiber precursor.  

PubMed

Polyethylene is an emerging precursor material for the production of carbon fibers. Its sulfonated derivative yields ordered carbon when pyrolyzed under inert atmosphere. Here, we investigate its pyrolysis pathways by selecting n-heptane-4-sulfonic acid (H4S) as a model compound. Density functional theory and transition state theory were used to determine the rate constants of pyrolysis for H4S from 300 to 1000 K. Multiple reaction channels from two different mechanisms were explored: (1) internal five-centered elimination (Ei5) and (2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain thermogravimetric (TGA) plots that compared favorably to experiment. We observed that at temperatures <550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial ?H radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440 to 460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene (~31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOS?2 became competitive to ?-H abstraction by HOS?2, making ?H the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures >600 K. Low-scale carbonization utilizes temperatures <620 K; thus, internal elimination will not be competitive. E(i)5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. PMID:23560686

Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A; Naskar, Amit K; Beste, Ariana

2013-04-24

108

Malonyl-Coenzyme A Reductase in the Modified 3-Hydroxypropionate Cycle for Autotrophic Carbon Fixation in Archaeal Metallosphaera and Sulfolobus spp  

Microsoft Academic Search

Autotrophic members of the Sulfolobales (Crenarchaeota) contain acetyl-coenzyme A (CoA)\\/propionyl-CoA carboxylase as the CO2 fixation enzyme and use a modified 3-hydroxypropionate cycle to assimilate CO2 into cell material. In this central metabolic pathway malonyl-CoA, the product of acetyl-CoA carboxylation, is further reduced to 3-hydroxypropionate. Extracts of Metallosphaera sedula contained NADPH-specific malonyl- CoA reductase activity that was 10-fold up-regulated under autotrophic

Birgit Alber; Marc Olinger; Annika Rieder; Daniel Kockelkorn; Bjorn Jobst; Michael Hugler; Georg Fuchs

2006-01-01

109

Transition pathways to a low carbon economy: Linking governance patterns and assessment methodologies  

Microsoft Academic Search

This paper describes work being undertaken as part of an interdisciplinary project on transition pathways to a low carbon economy, bringing together insights from engineers, social scientists and policy analysts. The project is examining the plausibility of different transition pathways for a low carbon energy system in the UK, under different governance patterns, in relation to both centralised and decentralised

Timothy J. Foxon; Jacquelin Burgess; Geoffrey P. Hammond; Tom Hargreaves

2010-01-01

110

Relationship of photosynthetic carbon fixation with environmental changes in the Jiulong River estuary of the South China Sea, with special reference to the effects of solar UV radiation.  

PubMed

Phytoplankton cells in estuary waters usually experience drastic changes in chemical and physical environments due to mixing of fresh and seawaters. In order to see their photosynthetic performance in such dynamic waters, we measured the photosynthetic carbon fixation by natural phytoplankton assemblages in the Jiulong River estuary of the South China Sea during April 24-26 and July 24-26 of 2008, and investigated its relationship with environmental changes in the presence or the absence of UV radiation. Phytoplankton biomass (Chl a) decreased sharply from the river-mouth to seawards (17.3-2.1 ?g L(-1)), with the dominant species changed from chlorophytes to diatoms. The photosynthetic rate based on Chl a at noon time under PAR-alone increased from 1.9 ?g C (?g Chl a)(-1) L(-1) in low salinity zone (SSS<10) to 12.4 ?g C (?g Chl a)(-1) L(-1) in turbidity front (SSS within 10-20), and then decreased to 2.1 ?g C (?g Chl a)(-1) L(-1) in mixohaline zone (SSS>20); accordingly, the carbon fixation per volume of seawater increased from 12.8 to 149 ?g C L(-1) h(-1), and decreased to 14.3 ?g C L(-1) h(-1). Solar UVR caused the inhibition of carbon fixation in surface water of all the investigated zones, by 39% in turbidity area and 7-10% in freshwater or mixohaline zones. In the turbidity zone, higher availability of CO2 could have enhanced the photosynthetic performance; while osmotic stress might be responsible for the higher sensitivity of phytoplankton assemblages to solar UV radiation. PMID:21714975

Li, Gang; Gao, Kunshan; Yuan, Dongxing; Zheng, Ying; Yang, Guiyuan

2011-08-01

111

Effects of femoral component material properties on cementless fixation in total hip arthroplasty. A comparison study between carbon composite, titanium alloy, and stainless steel.  

PubMed

Carbon-fiber-reinforced-carbon composite material is an attractive implant material because its modulus of elasticity can be made similar to that of cortical bone. This study investigated the effect of femoral prosthesis elastic modulus on cementless implant fixation. Distal, as well as proximal, relative micromovements between implant and bone were measured in two testing protocols (axial-load and torsional-load), comparing identically shaped carbon composite (modulus of elasticity = 18.6 GPa), Ti6Al4V (100 GPa), and 630 stainless steel (200 GPa) prostheses. In the axial-load test, proximal mediolateral micromotions were significantly larger in the flexible composite stem than in the two metals. In the torsional-load test, rotational micromotions and "slop" displacements in the flexible stem were significantly larger proximally and significantly smaller distally than in the two metals. While these results suggest that proximal stress transfer may be improved by a flexible stem, they raise the possibility of increased proximal micromotion, and suggest that improved proximal fixation may be necessary to achieve clinical success with flexible composite femoral components. PMID:8436992

Otani, T; Whiteside, L A; White, S E; McCarthy, D S

1993-02-01

112

Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata.  

PubMed

The shrimp Rimicaris exoculata dominates several hydrothermal vent ecosystems of the Mid-Atlantic Ridge and is thought to be a primary consumer harbouring a chemoautotrophic bacterial community in its gill chamber. The aim of the present study was to test current hypotheses concerning the epibiont's chemoautotrophy, and the mutualistic character of this association. In-vivo experiments were carried out in a pressurised aquarium with isotope-labelled inorganic carbon (NaH(13)CO(3) and NaH(14)CO(3)) in the presence of two different electron donors (Na(2)S(2)O(3) and Fe(2+)) and with radiolabelled organic compounds ((14)C-acetate and (3)H-lysine) chosen as potential bacterial substrates and/or metabolic by-products in experiments mimicking transfer of small biomolecules from epibionts to host. The bacterial epibionts were found to assimilate inorganic carbon by chemoautotrophy, but many of them (thick filaments of epsilonproteobacteria) appeared versatile and able to switch between electron donors, including organic compounds (heterotrophic acetate and lysine uptake). At least some of them (thin filamentous gammaproteobacteria) also seem capable of internal energy storage that could supply chemosynthetic metabolism for hours under conditions of electron donor deprivation. As direct nutritional transfer from bacteria to host was detected, the association appears as true mutualism. Import of soluble bacterial products occurs by permeation across the gill chamber integument, rather than via the digestive tract. This first demonstration of such capabilities in a decapod crustacean supports the previously discarded hypothesis of transtegumental absorption of dissolved organic matter or carbon as a common nutritional pathway. PMID:22914596

Ponsard, Julie; Cambon-Bonavita, Marie-Anne; Zbinden, Magali; Lepoint, Gilles; Joassin, André; Corbari, Laure; Shillito, Bruce; Durand, Lucile; Cueff-Gauchard, Valérie; Compère, Philippe

2013-01-01

113

Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway.  

PubMed

Carbon disulfide (CS2), one of the most important volatile organic chemicals, was shown to have serious impairment to male reproductive system. But the underline mechanism is still unclear. In the present study, we aim to investigate the male germ cell apoptosis induced by CS2 exposure alone and by co-administration with cyclosporin A (CsA), which is the inhibitor of membrane permeability transition pore (MPTP). It was shown that CS2 exposure impaired ultrastructure of germ cells, increased the numbers of apoptotic germ cells, accumulated intracellular level of calcium, elevated ROS level, and increased activities of complexes of respiratory chain. Meanwhile, exposure to CS2 dramatically decreased the mitochondrial transmembrane potential (??m) and levels of ATP and MPTP opening. Exposure to CS2 can also cause a significantly dose-dependent increase in the expression levels of Bax, Cytc, Caspase-9, and Caspase-3, but decreased the expression level of Bcl-2. Moreover, co-administration of CsA with CS2 can reverse or alleviate the above apoptotic damage effects of CS2 on testicular germ cells. Taken together, our findings suggested that CS2 can cause damage to testicular germ cells via mitochondrial apoptotic pathway, and MPTP play a crucial role in this process. PMID:24582363

Guo, Yinsheng; Wang, Wei; Dong, Yu; Zhang, Zhen; Zhou, Yijun; Chen, Guoyuan

2014-08-01

114

Molybdenum Trafficking for Nitrogen Fixation  

PubMed Central

The molybdenum nitrogenase is responsible for most biological nitrogen fixation, a prokaryotic metabolic process that determines the global biogeochemical cycles of nitrogen and carbon. Here we describe the trafficking of molybdenum for nitrogen fixation in the model diazotrophic bacterium Azotobacter vinelandii. The genes and proteins involved in molybdenum uptake, homeostasis, storage, regulation, and nitrogenase cofactor biosynthesis are reviewed. Molybdenum biochemistry in A. vinelandii reveals unexpected mechanisms and a new role for iron-sulfur clusters in the sequestration and delivery of molybdenum.

Hernandez, Jose A.; George, Simon J.; Rubio, Luis M.

2009-01-01

115

Special Aspects of Nitrogen Fixation by Blue-Green Algae  

Microsoft Academic Search

When carbon dioxide fixation was over 90% inhibited by CMU, nitrogen fixation remained unaffected in nitrogen-starved cells of Anabaena cylindrica. In normal cells under the same conditions nitrogen fixation was about 50% inhibited by CMU. These data suggest, first, that nitrogen fixation in this organism is independent of reducing potential generated by non-cyclic photo-electron transport and, secondly, that nitrogen fixation

Rosalie M. Cox; P. Fay

1969-01-01

116

C3 and C4 pathways of photosynthetic carbon assimilation in marine diatoms are under genetic, not environmental, control1  

Microsoft Academic Search

Marine diatoms are responsible for up to 20% of global CO2 fixation. Their photosynthetic efficiency is enhanced by con- centrating CO2 around Rubisco, diminishing photorespiration, but the mechanism is yet to be resolved. Diatoms have been regarded as C3 photosynthesizers, but recent metabolic labeling and genome sequencing data suggest that they perform C4 photosynthesis. We studied the pathways of photosynthetic

Karen Roberts; Espen Granum; Richard C. Leegood; John A. Raven

117

Root Carbon Dioxide Fixation by Phosphorus-Deficient Lupinus albus (Contribution to Organic Acid Exudation by Proteoid Roots).  

PubMed Central

When white lupin (Lupinus albus L.) is subjected to P deficiency lateral root development is altered and densely clustered, tertiary lateral roots (proteoid roots) are initiated. These proteoid roots exude large amounts of citrate, which increases P solubilization. In the current study plants were grown with either 1 mM P (+P-treated) or without P (-P-treated). Shoots or roots of intact plants from both P treatments were labeled independently with 14CO2 to compare the relative contribution of C fixed in each with the C exuded from roots as citrate and other organic acids. About 25-fold more acid-stable 14C, primarily in citrate and malate, was recovered in exudates from the roots of -P-treated plants compared with +P-treated plants. The rate of in vivo C fixation in roots was about 4-fold higher in -P-treated plants than in +P-treated plants. Evidence from labeling intact shoots or roots indicates that synthesis of citrate exuded by -P-treated roots is directly related to nonphotosynthetic C fixation in roots. C fixed in roots of -P-treated plants contributed about 25 and 34% of the C exuded as citrate and malate, respectively. Nonphotosynthetic C fixation in white lupin roots is an integral component in the exudation of large amounts of citrate and malate, thus increasing the P available to the plant.

Johnson, J. F.; Allan, D. L.; Vance, C. P.; Weiblen, G.

1996-01-01

118

Nuclear Technology Pathways to a Carbon-Neutral Energy System  

Microsoft Academic Search

Climate change is one of the most critical scientific and economic challenges facing the world today. Stabilizing the atmospheric carbon concentration will require fundamental changes in the energy system worldwide over the next century. Novel energy technologies, such as carbon capture and sequestration, and biomass production enhanced by advanced biotechnology, may be required. However, currently deployed non-carbon energy technologies, such

J. F. Clarke; J. Edmonds; C. Geffen

119

Presence of Acetyl Coenzyme A (CoA) Carboxylase and Propionyl-CoA Carboxylase in Autotrophic Crenarchaeota and Indication for Operation of a 3-Hydroxypropionate Cycle in Autotrophic Carbon Fixation  

Microsoft Academic Search

The pathway of autotrophic CO2 fixation was studied in the phototrophic bacterium Chloroflexus aurantiacus and in the aerobic thermoacidophilic archaeon Metallosphaera sedula. In both organisms, none of the key enzymes of the reductive pentose phosphate cycle, the reductive citric acid cycle, and the reductive acetyl coenzyme A (acetyl-CoA) pathway were detectable. However, cells contained the biotin-dependent acetyl-CoA carboxylase and propionyl-CoA

CASTOR MENENDEZ; ZSUZSA BAUER; HARALD HUBER; NASSER GAD' ON; KARL-OTTO STETTER; GEORG FUCHS

1999-01-01

120

Reduced Carbon Availability to Bacteroids and Elevated Ureides in Nodules, But Not in Shoots, Are Involved in the Nitrogen Fixation Response to Early Drought in Soybean1[OA  

PubMed Central

Nitrogen fixation (NF) in soybean (Glycine max L. Merr.) is highly sensitive to soil drying. This sensitivity has been related to an accumulation of nitrogen compounds, either in shoots or in nodules, and a nodular carbon flux shortage under drought. To assess the relative importance of carbon and nitrogen status on NF regulation, the responses to the early stages of drought were monitored with two soybean cultivars with known contrasting tolerance to drought. In the sensitive cultivar (‘Biloxi’), NF inhibition occurred earlier and was more dramatic than in the tolerant cultivar (‘Jackson’). The carbon flux to bacteroids was also more affected in ‘Biloxi’ than in ‘Jackson’, due to an earlier inhibition of sucrose synthase activity and a larger decrease of malate concentration in the former. Drought provoked ureide accumulation in nodules of both cultivars, but this accumulation was higher and occurred earlier in ‘Biloxi’. However, at this early stage of drought, there was no accumulation of ureides in the leaves of either cultivar. These results indicate that a combination of both reduced carbon flux and nitrogen accumulation in nodules, but not in shoots, is involved in the inhibition of NF in soybean under early drought.

Ladrera, Ruben; Marino, Daniel; Larrainzar, Estibaliz; Gonzalez, Esther M.; Arrese-Igor, Cesar

2007-01-01

121

Carbon Assimilation Pathways, Water Relationships and Plant Ecology.  

ERIC Educational Resources Information Center

Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

Etherington, John R.

1988-01-01

122

Preparation of monodispersed aragonite microspheres via a carbonation crystallization pathway  

Microsoft Academic Search

Monodispersed calcium carbonate microspheres were prepared by carbonating a calcium acetate aqueous solution with CO2 gas at a high pressure of 40 bar and a high temperature of 80 °C after 60 minutes of reaction. The products were characterized by X-ray powder diffraction (XRD) and scanning electron microscopy (SEM), respectively. The XRD pattern showed that the crystal polymorph of the

Weijun Bao; Huiquan Li; Yi Zhang

2009-01-01

123

Dinitrogen fixation in aphotic oxygenated marine environments  

PubMed Central

We measured N2 fixation rates from oceanic zones that have traditionally been ignored as sources of biological N2 fixation; the aphotic, fully oxygenated, nitrate (NO?3)-rich, waters of the oligotrophic Levantine Basin (LB) and the Gulf of Aqaba (GA). N2 fixation rates measured from pelagic aphotic waters to depths up to 720 m, during the mixed and stratified periods, ranged from 0.01 nmol N L?1 d?1 to 0.38 nmol N L?1 d?1. N2 fixation rates correlated significantly with bacterial productivity and heterotrophic diazotrophs were identified from aphotic as well as photic depths. Dissolved free amino acid amendments to whole water from the GA enhanced bacterial productivity by 2–3.5 fold and N2 fixation rates by ~2-fold in samples collected from aphotic depths while in amendments to water from photic depths bacterial productivity increased 2–6 fold while N2 fixation rates increased by a factor of 2 to 4 illustrating that both BP and heterotrophic N2 fixation were carbon limited. Experimental manipulations of aphotic waters from the LB demonstrated a significant positive correlation between transparent exopolymeric particle (TEP) concentrations and N2 fixation rates. This suggests that sinking organic material and high carbon (C): nitrogen (N) micro-environments (such as TEP-based aggregates or marine snow) could support high heterotrophic N2 fixation rates in oxygenated surface waters and in the aphotic zones. Indeed, our calculations show that aphotic N2 fixation accounted for 37 to 75% of the total daily integrated N2 fixation rates at both locations in the Mediterranean and Red Seas with rates equal or greater to those measured from the photic layers. Moreover, our results indicate that that while N2 fixation may be limited in the surface waters, aphotic, pelagic N2 fixation may contribute significantly to new N inputs in other oligotrophic basins, yet it is currently not included in regional or global N budgets.

Rahav, Eyal; Bar-Zeev, Edo; Ohayon, Sarah; Elifantz, Hila; Belkin, Natalia; Herut, Barak; Mulholland, Margaret R.; Berman-Frank, Ilana

2013-01-01

124

Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem  

NASA Astrophysics Data System (ADS)

An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. In addition, a concomitant flux of carbonate formed in wood tissues contributes to the carbonate flux and is identified as a direct consequence of wood feeding by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter, and an oxalate pool is formed on the forest ground. Then, wood rotting agents (mainly termites, saprophytic fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition, some of these agents are themselves producers of oxalate (e.g. fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can then start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with ?13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as defined by ecological theory.

Cailleau, G.; Braissant, O.; Verrecchia, E. P.

2011-07-01

125

Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem  

NASA Astrophysics Data System (ADS)

An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the theoretical acidic conditions of these soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. Regarding the carbonate flux, another direct consequence of wood feeding is a concomitant flux of carbonate formed in wood tissues, which is not consumed by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter. Therefore, an oxalate pool is formed on the forest ground. Then, wood rotting gents (mainly termites, fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition some of these gents are themselves producers of oxalate (fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped through the roots, leading to carbonate precipitation. The main pools of carbon are clearly identified as the organic matter (the tree and its organic products), the oxalate crystals, and the various carbonate features. A functional model based on field observations and diagenetic investigations with ?13C signatures of the various compartments involved in the local carbon cycle is proposed. It suggests that the iroko ecosystem can act as a long-term carbon sink, as long as the calcium source is related to non-carbonate rocks. Consequently, this carbon sink, driven by the oxalate carbonate pathway around an iroko tree, constitutes a true carbon trapping ecosystem as define by the ecological theory.

Cailleau, G.; Braissant, O.; Verrecchia, E. P.

2011-02-01

126

Methanotrophy induces nitrogen fixation during peatland development.  

PubMed

Nitrogen (N) accumulation rates in peatland ecosystems indicate significant biological atmospheric N2 fixation associated with Sphagnum mosses. Here, we show that the linkage between methanotrophic carbon cycling and N2 fixation may constitute an important mechanism in the rapid accumulation of N during the primary succession of peatlands. In our experimental stable isotope enrichment study, previously overlooked methane-induced N2 fixation explained more than one-third of the new N input in the younger peatland stages, where the highest N2 fixation rates and highest methane oxidation activities co-occurred in the water-submerged moss vegetation. PMID:24379382

Larmola, Tuula; Leppänen, Sanna M; Tuittila, Eeva-Stiina; Aarva, Maija; Merilä, Päivi; Fritze, Hannu; Tiirola, Marja

2014-01-14

127

Evidence for Autotrophic CO2 Fixation via the Reductive Tricarboxylic Acid Cycle by Members of the ? Subdivision of Proteobacteria†  

PubMed Central

Based on 16S rRNA gene surveys, bacteria of the ? subdivision of proteobacteria have been identified to be important members of microbial communities in a variety of environments, and quite a few have been demonstrated to grow autotrophically. However, no information exists on what pathway of autotrophic carbon fixation these bacteria might use. In this study, Thiomicrospira denitrificans and Candidatus Arcobacter sulfidicus, two chemolithoautotrophic sulfur oxidizers of the ? subdivision of proteobacteria, were examined for activities of the key enzymes of the known autotrophic CO2 fixation pathways. Both organisms contained activities of the key enzymes of the reductive tricarboxylic acid cycle, ATP citrate lyase, 2-oxoglutarate:ferredoxin oxidoreductase, and pyruvate:ferredoxin oxidoreductase. Furthermore, no activities of key enzymes of other CO2 fixation pathways, such as the Calvin cycle, the reductive acetyl coenzyme A pathway, and the 3-hydroxypropionate cycle, could be detected. In addition to the key enzymes, the activities of the other enzymes involved in the reductive tricarboxylic acid cycle could be measured. Sections of the genes encoding the ?- and ?-subunits of ATP citrate lyase could be amplified from both organisms. These findings represent the first direct evidence for the operation of the reductive tricarboxylic acid cycle for autotrophic CO2 fixation in ?-proteobacteria. Since ?-proteobacteria closely related to these two organisms are important in many habitats, such as hydrothermal vents, oxic-sulfidic interfaces, or oilfields, these results suggest that autotrophic CO2 fixation via the reductive tricarboxylic acid cycle might be more important than previously considered.

Hugler, Michael; Wirsen, Carl O.; Fuchs, Georg; Taylor, Craig D.; Sievert, Stefan M.

2005-01-01

128

Carbon dioxide concentration dictates alternative methanogenic pathways in oil reservoirs.  

PubMed

Deep subsurface formations (for example, high-temperature oil reservoirs) are candidate sites for carbon capture and storage technology. However, very little is known about how the subsurface microbial community would respond to an increase in CO2 pressure resulting from carbon capture and storage. Here we construct microcosms mimicking reservoir conditions (55 °C, 5 MPa) using high-temperature oil reservoir samples. Methanogenesis occurs under both high and low CO2 conditions in the microcosms. However, the increase in CO2 pressure accelerates the rate of methanogenesis to more than twice than that under low CO2 conditions. Isotope tracer and molecular analyses show that high CO2 conditions invoke acetoclastic methanogenesis in place of syntrophic acetate oxidation coupled with hydrogenotrophic methanogenesis that typically occurs in this environment (low CO2 conditions). Our results present a possibility of carbon capture and storage for enhanced microbial energy production in deep subsurface environments that can mitigate global warming and energy depletion. PMID:23759740

Mayumi, Daisuke; Dolfing, Jan; Sakata, Susumu; Maeda, Haruo; Miyagawa, Yoshihiro; Ikarashi, Masayuki; Tamaki, Hideyuki; Takeuchi, Mio; Nakatsu, Cindy H; Kamagata, Yoichi

2013-01-01

129

Carbon dioxide concentration dictates alternative methanogenic pathways in oil reservoirs  

PubMed Central

Deep subsurface formations (for example, high-temperature oil reservoirs) are candidate sites for carbon capture and storage technology. However, very little is known about how the subsurface microbial community would respond to an increase in CO2 pressure resulting from carbon capture and storage. Here we construct microcosms mimicking reservoir conditions (55?°C, 5?MPa) using high-temperature oil reservoir samples. Methanogenesis occurs under both high and low CO2 conditions in the microcosms. However, the increase in CO2 pressure accelerates the rate of methanogenesis to more than twice than that under low CO2 conditions. Isotope tracer and molecular analyses show that high CO2 conditions invoke acetoclastic methanogenesis in place of syntrophic acetate oxidation coupled with hydrogenotrophic methanogenesis that typically occurs in this environment (low CO2 conditions). Our results present a possibility of carbon capture and storage for enhanced microbial energy production in deep subsurface environments that can mitigate global warming and energy depletion.

Mayumi, Daisuke; Dolfing, Jan; Sakata, Susumu; Maeda, Haruo; Miyagawa, Yoshihiro; Ikarashi, Masayuki; Tamaki, Hideyuki; Takeuchi, Mio; Nakatsu, Cindy H.; Kamagata, Yoichi

2013-01-01

130

Torsional moment to failure for carbon fibre polysulphone expandable rivets as compared with stainless steel screws for carbon fibre-reinforced epoxy fracture plate fixation.  

PubMed

A method of securing carbon fibre-reinforced epoxy bone plates with carbon fibre polysulphone expanding rivets was investigated. Six carbon fibre-reinforced epoxy bone plates were secured to rods with carbon fibre polysulphone rivets and six were secured with standard cortical stainless steel screws. These constructions were then subjected to pure torsional load to failure. The carbon fibre expandable rivets failed at a greater torsional moment. PMID:2720038

Sell, P J; Prakash, R; Hastings, G W

1989-04-01

131

ENZYMOLOGY: A Trio of Transition Metals in Anaerobic CO2 Fixation  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Certain anaerobic microorganisms can gain energy and biomass using carbon monoxide or dioxide and dihydrogen as sole sources of carbon and energy. In his Perspective, Peters explains how new results by Doukov et al. illuminate the carbon dioxide fixation pathway. Doukov et al. report that the enzyme responsible for the process contains a highly unusual metal cluster, with three different transition metals including copper, in one of its active sites.

John W. Peters (Montana State University;Department of Chemistry and Biochemistry)

2002-10-18

132

Carboxylases in Natural and Synthetic Microbial Pathways?†  

PubMed Central

Carboxylases are among the most important enzymes in the biosphere, because they catalyze a key reaction in the global carbon cycle: the fixation of inorganic carbon (CO2). This minireview discusses the physiological roles of carboxylases in different microbial pathways that range from autotrophy, carbon assimilation, and anaplerosis to biosynthetic and redox-balancing functions. In addition, the current and possible future uses of carboxylation reactions in synthetic biology are discussed. Such uses include the possible transformation of the greenhouse gas carbon dioxide into value-added compounds and the production of novel antibiotics.

Erb, Tobias J.

2011-01-01

133

Orthopedic prosthesis fixation.  

PubMed

The fixation of orthopedic implants has been one of the most difficult and challenging problems. The fixation can be achieved via: (a) direct mechanical fixation using screws, pins, wires, etc.; (b) passive or interference mechanical fixation where the implants are allowed to move or merely positioned onto the tissue surfaces; (c) bone cement fixation which is actually a grouting material; (d) biological fixation by allowing tissues to grow into the interstices of pores or textured surfaces of implants; (e) direct chemical bonding between implant and tissues; or (f) any combination of the above techniques. This article is concerned with various fixation techniques including the potential use of electrical, pulsed electromagnetic field, chemical stimulation using calcium phosphates for the enhancement of tissue ingrowth, direct bonding with bone by glass-ceramics and resorbable particle impregnated bone cement to take advantages of both the immediate fixation offered by the bone cement and long term fixation due to tissue ingrowth. PMID:1449228

Park, J B

1992-01-01

134

Quantifying carbon fixation in trace minerals from processed kimberlite: A comparative study of quantitative methods using X-ray powder diffraction data with applications to the Diavik Diamond Mine, Northwest Territories, Canada  

Microsoft Academic Search

The capacity of mine waste to trap CO2 is, in some cases, much larger than the greenhouse gas production of a mining operation. In mine tailings, the presence of secondary carbonate minerals that trap CO2 can therefore represent substantial fixation of this greenhouse gas. The abilities of three methods of quantitative phase analysis to measure trace nesquehonite (MgCO3·3H2O) in samples

Siobhan A. Wilson; Mati Raudsepp; Gregory M. Dipple

2009-01-01

135

Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor  

SciTech Connect

Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. We observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.

Younker, Jarod M [ORNL; Saito, Tomonori [ORNL; Hunt, Marcus A [ORNL; Beste, Ariana [ORNL; Naskar, Amit K [ORNL

2013-01-01

136

Membrane perturbation by carbon nanotube insertion: pathways to internalization.  

PubMed

Carbon nanotubes (CNTs) can penetrate the membranes of cells, offering prospects for nanomedicine but problems for nanotoxicity. Molecular simulations are used to provide a systematic analysis of the interactions of single-walled and multi-walled CNTs of different radii with a model lipid bilayer membrane. The simulations allow characterization of the mechanism of spontaneous exothermic insertion of CNTs into lipid bilayer membranes. The size and type of CNT determine the nature and extent of the local perturbation of the bilayer. Single-walled CNTs are shown to insert via a two-step mechanism with initial transient formation of a water filled pore followed by full insertion of the CNT into the bilayer. The latter stage is associated with formation of a persistent inverted micelle arrangement of lipid molecules trapped inside the CNT. This suggests a possible vehicle for nano-encapsulation of drugs, enabling their entry into and subsequent release within cells following endocytosis of CNT-containing membranes. PMID:23418066

Lelimousin, Mickaël; Sansom, Mark S P

2013-11-11

137

Incomplete Wood-Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi.  

PubMed

The acetyl-CoA "Wood-Ljungdahl" pathway couples the folate-mediated one-carbon (C1) metabolism to either CO2 reduction or acetate oxidation via acetyl-CoA. This pathway is distributed in diverse anaerobes and is used for both energy conservation and assimilation of C1 compounds. Genome annotations for all sequenced strains of Dehalococcoides mccartyi, an important bacterium involved in the bioremediation of chlorinated solvents, reveal homologous genes encoding an incomplete Wood-Ljungdahl pathway. Because this pathway lacks key enzymes for both C1 metabolism and CO2 reduction, its cellular functions remain elusive. Here we used D. mccartyi strain 195 as a model organism to investigate the metabolic function of this pathway and its impacts on the growth of strain 195. Surprisingly, this pathway cleaves acetyl-CoA to donate a methyl group for production of methyl-tetrahydrofolate (CH3-THF) for methionine biosynthesis, representing an unconventional strategy for generating CH3-THF in organisms without methylene-tetrahydrofolate reductase. Carbon monoxide (CO) was found to accumulate as an obligate by-product from the acetyl-CoA cleavage because of the lack of a CO dehydrogenase in strain 195. CO accumulation inhibits the sustainable growth and dechlorination of strain 195 maintained in pure cultures, but can be prevented by CO-metabolizing anaerobes that coexist with D. mccartyi, resulting in an unusual syntrophic association. We also found that this pathway incorporates exogenous formate to support serine biosynthesis. This study of the incomplete Wood-Ljungdahl pathway in D. mccartyi indicates a unique bacterial C1 metabolism that is critical for D. mccartyi growth and interactions in dechlorinating communities and may play a role in other anaerobic communities. PMID:24733917

Zhuang, Wei-Qin; Yi, Shan; Bill, Markus; Brisson, Vanessa L; Feng, Xueyang; Men, Yujie; Conrad, Mark E; Tang, Yinjie J; Alvarez-Cohen, Lisa

2014-04-29

138

Action spectrum and maximum quantum yield of carbon fixation in natural phytoplankton populations: implications for primary production estimates in the ocean  

NASA Astrophysics Data System (ADS)

Spectral and non-spectral measurements of the maximum quantum yield of carbon fixation for natural phytoplankton assemblages were compared in order to evaluate their effect on bio-optical models of primary production. Field samples were collected from two different coastal regions of NW Spain in spring, summer and autumn and in a polar environment (Gerlache Strait, Antarctica) during the austral summer. Concurrent determinations were made of spectral phytoplankton absorption coefficient [ aph( ?)], white-light-limited slope of the photosynthesis-irradiance relationships ( ?B), carbon uptake action spectra [ ?B( ?)], broad-band maximum quantum yields ( ?m), and spectral maximum quantum yields [ ?m( ?)]. Carbon uptake action spectra roughly followed the shape of the corresponding phytoplankton absorption spectra but with a slight displacement in the blue-green region that could be attributed to imbalance between the two photosystems PS I and PS II. Results also confirmed previous observations of wavelength dependency of maximum quantum yield. The broad-band maximum quantum yield ( ?m) calculated considering the measured spectral phytoplankton absorption coefficient and the spectrum of the light source of the incubators was not significantly different form the averaged spectral maximum quantum yield [ overline? max(?) ] ( t-test for paired samples, P=0.34). These results suggest that maximum quantum yield can be estimated with enough accuracy from white-light P- E curves and measured phytoplankton absorption spectra. Primary production at light limiting regimes was compared using four different models with a varying degree of spectral complexity. No significant differences ( t-test for paired samples, P=0.91) were found between a spectral model based on the carbon uptake action spectra [ ?B( ?) — model a] and a model which uses the broad-band ?m and measured aph( ?) (model b). In addition, primary production derived from constructed action spectra [ acB( ?) from aph( ?) and ?B (model c) was also not significantly different from that derived from total spectral model a ( t-test for paired samples, P=0.60). It was found, however, that primary production at low light regimes can be strongly overestimated (44%) when aph( ?) is derived from chlorophyll concentrations. A white-light model based on broad-band ?B (model d), which does not consider phytoplankton light absorption, yields values 17% lower than those of model a. It is concluded that primary production at light-limited conditions can be computed accurately from broad-band maximum quantum yield estimates or from constructed action spectra provided that aph( ?) is measured. However, given that phytoplankton absorption coefficients are necessary for both approaches and as computations based on ?m showed less variability, we suggest that the maximum quantum yield proxy should be used.

Arbones, B.; Figueiras, F. G.; Varela, R.

2000-09-01

139

Gene regulation of carbon fixation, storage, and utilization in the diatom Phaeodactylum tricornutum acclimated to light/dark cycles.  

PubMed

The regulation of carbon metabolism in the diatom Phaeodactylum tricornutum at the cell, metabolite, and gene expression levels in exponential fed-batch cultures is reported. Transcriptional profiles and cell chemistry sampled simultaneously at all time points provide a comprehensive data set on carbon incorporation, fate, and regulation. An increase in Nile Red fluorescence (a proxy for cellular neutral lipids) was observed throughout the light period, and water-soluble glucans increased rapidly in the light period. A near-linear decline in both glucans and lipids was observed during the dark period, and transcription profile data indicated that this decline was associated with the onset of mitosis. More than 4,500 transcripts that were differentially regulated during the light/dark cycle are identified, many of which were associated with carbohydrate and lipid metabolism. Genes not previously described in algae and their regulation in response to light were integrated in this analysis together with proposed roles in metabolic processes. Some very fast light-responding genes in, for example, fatty acid biosynthesis were identified and allocated to biosynthetic processes. Transcripts and cell chemistry data reflect the link between light energy availability and light energy-consuming metabolic processes. Our data confirm the spatial localization of processes in carbon metabolism to either plastids or mitochondria or to glycolysis/gluconeogenesis, which are localized to the cytosol, chloroplast, and mitochondria. Localization and diel expression pattern may be of help to determine the roles of different isoenzymes and the mining of genes involved in light responses and circadian rhythms. PMID:23209127

Chauton, Matilde Skogen; Winge, Per; Brembu, Tore; Vadstein, Olav; Bones, Atle M

2013-02-01

140

Synthesis of [(11)C]Bexarotene by Cu-Mediated [(11)C]Carbon Dioxide Fixation and Preliminary PET Imaging.  

PubMed

Bexarotene (Targretin) is a retinoid X receptor (RXR) agonist that has applications for treatment of T cell lymphoma and proposed mechanisms of action in Alzheimer's disease that have been the subject of recent controversy. Carbon-11 labeled bexarotene ([(11)C-carbonyl]4-[1-(3,5,5,8,8-pentamethyltetralin-2-yl)ethenyl]benzoic acid) was synthesized using a Cu-mediated cross-coupling reaction employing an arylboronate precursor 1 and [(11)C]carbon dioxide under atmospheric pressure in 15 ± 2% uncorrected radiochemical yield (n = 3), based on [(11)C]CO2. Judicious choice of solvents, catalysts, and additives, as well as precursor concentration and purity of [(11)C]CO2, enabled the preparation of this (11)C-labeled carboxylic acid. Formulated [(11)C]bexarotene was isolated (>37 mCi) with >99% radiochemical purity in 32 min. Preliminary positron emission tomography-magnetic resonance imaging revealed rapid brain uptake in nonhuman primate in the first 75 s following intravenous administration of the radiotracer (specific activity >0.3 Ci/?mol at time of injection), followed by slow clearance (? = -43%) over 60 min. Modest uptake (SUVmax = 0.8) was observed in whole brain and regions with high RXR expression. PMID:24944741

Rotstein, Benjamin H; Hooker, Jacob M; Woo, Jiyeon; Collier, Thomas Lee; Brady, Thomas J; Liang, Steven H; Vasdev, Neil

2014-06-12

141

Internal Fixation for Fractures  

MedlinePLUS

... implants, such as plates, screws, nails and wires. Internal fixation allows shorter hospital stays, enables patients to ... position) of broken bones. The implants used for internal fixation are made from stainless steel and titanium, ...

142

Heterologous expression of the mevalonic acid pathway in cyanobacteria enhances endogenous carbon partitioning to isoprene.  

PubMed

Heterologous expression of the isoprene synthase gene in the cyanobacterium Synechocystis PCC 6803 conferred upon these microorganisms the property of photosynthetic isoprene (C?H?) hydrocarbons production. Continuous production of isoprene from CO? and H?O was achieved in the light, occurring via the endogenous methylerythritol-phosphate (MEP) pathway, in tandem with the growth of Synechocystis. This work addressed the issue of photosynthetic carbon partitioning between isoprene and biomass in Synechocystis. Evidence is presented to show heterologous genomic integration and cellular expression of the mevalonic acid (MVA) pathway genes in Synechocystis endowing a non-native pathway for carbon flux amplification to isopentenyl-diphosphate (IPP) and dimethylallyl-diphosphate (DMAPP) precursors of isoprene. Heterologous expression of the isoprene synthase in combination with the MVA pathway enzymes resulted in photosynthetic isoprene yield improvement by approximately 2.5-fold, compared with that measured in cyanobacteria transformed with the isoprene synthase gene only. These results suggest that the MVA pathway introduces a bypass in the flux of endogenous cellular substrate in Synechocystis to IPP and DMAPP, overcoming flux limitations of the native MEP pathway. The work employed a novel chromosomal integration and expression of synthetic gene operons in Synechocystis, comprising up to four genes under the control of a single promoter, and expressing three operons simultaneously. This is the first time an entire biosynthetic pathway with seven recombinant enzymes has been heterologously expressed in a photosynthetic microorganism. It constitutes contribution to the genetic engineering toolkit of photosynthetic microorganisms and a paradigm in the pursuit of photosynthetic approaches for the renewable generation of high-impact products. PMID:24157609

Bentley, Fiona K; Zurbriggen, Andreas; Melis, Anastasios

2014-01-01

143

Lung macrophages "digest" carbon nanotubes using a superoxide/peroxynitrite oxidative pathway.  

PubMed

In contrast to short-lived neutrophils, macrophages display persistent presence in the lung of animals after pulmonary exposure to carbon nanotubes. While effective in the clearance of bacterial pathogens and injured host cells, the ability of macrophages to "digest" carbonaceous nanoparticles has not been documented. Here, we used chemical, biochemical, and cell and animal models and demonstrated oxidative biodegradation of oxidatively functionalized single-walled carbon nanotubes via superoxide/NO* ? peroxynitrite-driven oxidative pathways of activated macrophages facilitating clearance of nanoparticles from the lung. PMID:24871084

Kagan, Valerian E; Kapralov, Alexandr A; St Croix, Claudette M; Watkins, Simon C; Kisin, Elena R; Kotchey, Gregg P; Balasubramanian, Krishnakumar; Vlasova, Irina I; Yu, Jaesok; Kim, Kang; Seo, Wanji; Mallampalli, Rama K; Star, Alexander; Shvedova, Anna A

2014-06-24

144

Stable carbon isotope discrimination by form IC rubisCO from Rhodobacter sphaeroides  

Microsoft Academic Search

Variations in the relative amounts of ¹²C and ¹³C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against ¹³C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating the stable carbon isotopic composition (d¹³C = {[¹³C\\/¹²Csample\\/¹³C\\/¹²Cstandard] - 1} X 1000) of biomass. Six different forms

Phaedra Thomas

2008-01-01

145

Autotrophic methanotrophy in verrucomicrobia: Methylacidiphilum fumariolicum SolV uses the Calvin-Benson-Bassham cycle for carbon dioxide fixation.  

PubMed

Genome data of the extreme acidophilic verrucomicrobial methanotroph Methylacidiphilum fumariolicumstrain SolV indicated the ability of autotrophic growth. This was further validated by transcriptome analysis, which showed that all genes required for a functional Calvin-Benson-Bassham (CBB) cycle were transcribed. Experiments with (13)CH(4) or (13)CO(2) in batch and chemostat cultures demonstrated that CO(2) is the sole carbon source for growth of strain SolV. In the presence of CH(4), CO(2) concentrations in the headspace below 1% (vol/vol) were growth limiting, and no growth was observed when CO(2)concentrations were below 0.3% (vol/vol). The activity of the key enzyme of the CBB cycle, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), measured with a (13)C stable-isotope method was about 70 nmol CO(2) fixed · min(-1)· mg of protein(-1). An immune reaction with antibody against the large subunit of RuBisCO on Western blots was found only in the supernatant fractions of cell extracts. The apparent native mass of the RuBisCO complex in strain SolV was about 482 kDa, probably consisting of 8 large (53-kDa) and 8 small (16-kDa) subunits. Based on phylogenetic analysis of the corresponding RuBisCO gene, we postulate that RuBisCO of the verrucomicrobial methanotrophs represents a new type of form I RuBisCO. PMID:21725016

Khadem, Ahmad F; Pol, Arjan; Wieczorek, Adam; Mohammadi, Seyed S; Francoijs, Kees-Jan; Stunnenberg, Henk G; Jetten, Mike S M; Op den Camp, Huub J M

2011-09-01

146

Autotrophic Methanotrophy in Verrucomicrobia: Methylacidiphilum fumariolicumSolV Uses the Calvin-Benson-Bassham Cycle for Carbon Dioxide Fixation ? †  

PubMed Central

Genome data of the extreme acidophilic verrucomicrobial methanotroph Methylacidiphilum fumariolicumstrain SolV indicated the ability of autotrophic growth. This was further validated by transcriptome analysis, which showed that all genes required for a functional Calvin-Benson-Bassham (CBB) cycle were transcribed. Experiments with 13CH4or 13CO2in batch and chemostat cultures demonstrated that CO2is the sole carbon source for growth of strain SolV. In the presence of CH4, CO2concentrations in the headspace below 1% (vol/vol) were growth limiting, and no growth was observed when CO2concentrations were below 0.3% (vol/vol). The activity of the key enzyme of the CBB cycle, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), measured with a 13C stable-isotope method was about 70 nmol CO2fixed · min?1· mg of protein?1. An immune reaction with antibody against the large subunit of RuBisCO on Western blots was found only in the supernatant fractions of cell extracts. The apparent native mass of the RuBisCO complex in strain SolV was about 482 kDa, probably consisting of 8 large (53-kDa) and 8 small (16-kDa) subunits. Based on phylogenetic analysis of the corresponding RuBisCO gene, we postulate that RuBisCO of the verrucomicrobial methanotrophs represents a new type of form I RuBisCO.

Khadem, Ahmad F.; Pol, Arjan; Wieczorek, Adam; Mohammadi, Seyed S.; Francoijs, Kees-Jan; Stunnenberg, Henk G.; Jetten, Mike S. M.; Op den Camp, Huub J. M.

2011-01-01

147

Aquatic carbon and GHG losses via the aquatic pathway in an arctic catchment  

NASA Astrophysics Data System (ADS)

Based in Northwest Canada, the HYDRA project ('Permafrost catchments in transition: hydrological controls on carbon cycling and greenhouse gas budgets') aims to understand the fundamental role that hydrological processes play in regulating landscape-scale carbon fluxes. The project aims to determine a) the role of vegetation functional type in carbon uptake, turnover and allocation, b) how the same functional types influence the delivery of soil-derived carbon to surface waters, and c) how important the aquatic carbon and greenhouse gas (GHG) losses are relative to catchment scale terrestrial fluxes. Here we focus on the magnitude of the aquatic concentrations and fluxes, presenting results from the first year of field sampling. Concentrations of the greenhouse gases CO2, CH4 and N2O, as well as dissolved organic and inorganic carbon (DOC and DIC), will be presented from a range of freshwater types within the tundra landscape; sites include lakes, polygons and the 'Siksik' stream which drains the primary study catchment. Eight sampling locations were selected along the approximately 2km long Siksik stream to allow carbon and GHG concentrations to be considered within a set of nested subcatchments. This synoptic sampling regime, in combination with stable isotopes and major ion concentrations also measured at each sampling point, will allow inputs of carbon and GHGs to be traced to source areas within the catchment. Evasion and downstream export will also be calculated and preliminary results presented in the context of quantifying the relative importance of the aquatic pathway to the full catchment carbon and greenhouse gas budgets. This analysis will also allow an initial comparison between the relative importance of different water bodies within the catchment, highlighting spatial hotspots to be prioritized in future campaigns.

Dinsmore, Kerry; Billett, Mike; Lessels, Jason; Street, Lorna; Wookey, Philip; Baxter, Robert; Subke, Jens-Arne; Tetzlaff, Doerthe

2014-05-01

148

Carbon Metabolic Pathways in Phototrophic Bacteria and Their Broader Evolutionary Implications  

PubMed Central

Photosynthesis is the biological process that converts solar energy to biomass, bio-products, and biofuel. It is the only major natural solar energy storage mechanism on Earth. To satisfy the increased demand for sustainable energy sources and identify the mechanism of photosynthetic carbon assimilation, which is one of the bottlenecks in photosynthesis, it is essential to understand the process of solar energy storage and associated carbon metabolism in photosynthetic organisms. Researchers have employed physiological studies, microbiological chemistry, enzyme assays, genome sequencing, transcriptomics, and 13C-based metabolomics/fluxomics to investigate central carbon metabolism and enzymes that operate in phototrophs. In this report, we review diverse CO2 assimilation pathways, acetate assimilation, carbohydrate catabolism, the tricarboxylic acid cycle and some key, and/or unconventional enzymes in central carbon metabolism of phototrophic microorganisms. We also discuss the reducing equivalent flow during photoautotrophic and photoheterotrophic growth, evolutionary links in the central carbon metabolic network, and correlations between photosynthetic and non-photosynthetic organisms. Considering the metabolic versatility in these fascinating and diverse photosynthetic bacteria, many essential questions in their central carbon metabolism still remain to be addressed.

Tang, Kuo-Hsiang; Tang, Yinjie J.; Blankenship, Robert Eugene

2011-01-01

149

Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}  

Microsoft Academic Search

Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (delta13C = {[13C\\/12Csample\\/13C\\/12Cstandard] - 1} × 1000). Five different forms of RubisCO

P. J. Thomas; A. J. Boller; Z. Zhao; F. R. Tabita; C. M. Cavanaugh; K. M. Scott

2006-01-01

150

Catalytic ozonation of sulphamethoxazole in the presence of carbon materials: catalytic performance and reaction pathways.  

PubMed

Two carbon materials (multi-walled carbon nanotubes, MWCNTs, and activated carbon) were investigated as ozonation catalysts for the mineralization of the antibiotic sulphamethoxazole (SMX). MWCNTs presented a higher catalytic performance than activated carbons, which was justified by their differences in surface chemistry and by the higher internal mass transfer resistances expected for activated carbons. 3-Amino-5-methylisoxazole and p-benzoquinone were detected as primary products of single and catalytic ozonation of SMX, whereas oxamic, oxalic, pyruvic and maleic acids were identified as refractory final oxidation products. The original sulphur of the SMX was almost completely converted to sulphate and part of the nitrogen was converted to NH4+ and NO3-. The presence of the radical scavenger tert-butanol during catalytic and single ozonation evidenced the participation of HO radicals in the oxidation mechanisms of SMX, especially in the mineralization of several intermediates. Microtox tests revealed that simultaneous use of ozone and MWCNTs originated lower acute toxicity. The time course of all detected compounds was studied and the transformation pathway for the complete mineralization of SMX by single and catalytic ozonation in the presence of the selected materials was elucidated. PMID:23009796

Gonçalves, Alexandra G; Órfão, José J M; Pereira, Manuel Fernando R

2012-11-15

151

Sulfide oxidation, nitrate respiration, carbon acquisition, and electron transport pathways suggested by the draft genome of a single orange Guaymas Basin Beggiatoa (Cand. Maribeggiatoa) sp. filament.  

PubMed

A near-complete draft genome has been obtained for a single vacuolated orange Beggiatoa (Cand. Maribeggiatoa) filament from a Guaymas Basin seafloor microbial mat, the third relatively complete sequence for the Beggiatoaceae. Possible pathways for sulfide oxidation; nitrate respiration; inorganic carbon fixation by both Type II RuBisCO and the reductive tricarboxylic acid cycle; acetate and possibly formate uptake; and energy-generating electron transport via both oxidative phosphorylation and the Rnf complex are discussed here. A role in nitrite reduction is suggested for an abundant orange cytochrome produced by the Guaymas strain; this has a possible homolog in Beggiatoa (Cand. Isobeggiatoa) sp. PS, isolated from marine harbor sediment, but not Beggiatoa alba B18LD, isolated from a freshwater rice field ditch. Inferred phylogenies for the Calvin-Benson-Bassham (CBB) cycle and the reductive (rTCA) and oxidative (TCA) tricarboxylic acid cycles suggest that genes encoding succinate dehydrogenase and enzymes for carboxylation and/or decarboxylation steps (including RuBisCO) may have been introduced to (or exported from) one or more of the three genomes by horizontal transfer, sometimes by different routes. Sequences from the two marine strains are generally more similar to each other than to sequences from the freshwater strain, except in the case of RuBisCO: only the Guaymas strain encodes a Type II enzyme, which (where studied) discriminates less against oxygen than do Type I RuBisCOs. Genes subject to horizontal transfer may represent key steps for adaptation to factors such as oxygen and carbon dioxide concentration, organic carbon availability, and environmental variability. PMID:24012537

MacGregor, Barbara J; Biddle, Jennifer F; Harbort, Christopher; Matthysse, Ann G; Teske, Andreas

2013-09-01

152

The influence of pCO2 and temperature on gene expression of carbon and nitrogen pathways in Trichodesmium IMS101.  

PubMed

Growth, protein amount, and activity levels of metabolic pathways in Trichodesmium are influenced by environmental changes such as elevated pCO(2) and temperature. This study examines changes in the expression of essential metabolic genes in Trichodesmium grown under a matrix of pCO(2) (400 and 900 µatm) and temperature (25 and 31°C). Using RT-qPCR, we studied 21 genes related to four metabolic functional groups: CO(2) concentrating mechanism (bicA1, bicA2, ccmM, ccmK2, ccmK3, ndhF4, ndhD4, ndhL, chpX), energy metabolism (atpB, sod, prx, glcD), nitrogen metabolism (glnA, hetR, nifH), and inorganic carbon fixation and photosynthesis (rbcL, rca, psaB, psaC, psbA). nifH and most photosynthetic genes exhibited relatively high abundance and their expression was influenced by both environmental parameters. A two to three orders of magnitude increase was observed for glnA and hetR only when both pCO(2) and temperature were elevated. CO(2) concentrating mechanism genes were not affected by pCO(2) and temperature and their expression levels were markedly lower than that of the nitrogen metabolism and photosynthetic genes. Many of the CO(2) concentrating mechanism genes were co-expressed throughout the day. Our results demonstrate that in Trichodesmium, CO(2) concentrating mechanism genes are constitutively expressed. Co-expression of genes from different functional groups were frequently observed during the first half of the photoperiod when oxygenic photosynthesis and N(2) fixation take place, pointing at the tight and complex regulation of gene expression in Trichodesmium. Here we provide new data linking environmental changes of pCO(2) and temperature to gene expression in Trichodesmium. Although gene expression indicates an active metabolic pathway, there is often an uncoupling between transcription and enzyme activity, such that transcript level cannot usually be directly extrapolated to metabolic activity. PMID:21151907

Levitan, Orly; Sudhaus, Stefanie; LaRoche, Julie; Berman-Frank, Ilana

2010-01-01

153

Engineering a synthetic pathway in cyanobacteria for isopropanol production directly from carbon dioxide and light.  

PubMed

Production of alternate fuels or chemicals directly from solar energy and carbon dioxide using engineered cyanobacteria is an attractive method to reduce petroleum dependency and minimize carbon emissions. Here, we constructed a synthetic pathway composed of acetyl-CoA acetyl transferase (encoded by thl), acetoacetyl-CoA transferase (encoded by atoAD), acetoacetate decarboxylase (encoded by adc) and secondary alcohol dehydrogenase (encoded by adh) in Synechococcus elongatus strain PCC 7942 to produce isopropanol. The enzyme-coding genes, heterogeneously originating from Clostridium acetobutylicum ATCC 824 (thl and adc), Escherichia coli K-12 MG1655 (atoAD) and Clostridium beijerinckii (adh), were integrated into the S. elongatus genome. Under the optimized production conditions, the engineered cyanobacteria produced 26.5 mg/L of isopropanol after 9 days. PMID:24076145

Kusakabe, Tamami; Tatsuke, Tsuneyuki; Tsuruno, Keigo; Hirokawa, Yasutaka; Atsumi, Shota; Liao, James C; Hanai, Taizo

2013-11-01

154

Identification and characterization of the Rhizobium meliloti ntrC gene: R. meliloti has separate regulatory pathways for activation of nitrogen fixation genes in free-living and symbiotic cells.  

PubMed Central

We show here that Rhizobium meliloti, the nitrogen-fixing endosymbiont of alfalfa (Medicago sativa), has a regulatory gene that is structurally homologous to previously characterized ntrC genes in enteric bacteria. DNA sequence analysis showed that R. meliloti ntrC is homologous to previously sequenced ntrC genes from Klebsiella pneumoniae and Bradyrhizobium sp. (Parasponia) and that an ntrB-like gene is situated directly upstream from R. meliloti ntrC. Similar to its counterparts in K. pneumoniae and Escherichia coli, R. meliloti ntrC is expressed when the cells are grown in nitrogen-limiting media. In addition, R. meliloti ntrC is required for growth on media containing nitrate as the sole nitrogen source and for the ex planta transcription of several R. meliloti nif genes. On the other hand, root nodules elicited by R. meliloti ntrC mutants fix nitrogen as well as nodules elicited by wild-type R. meliloti. These latter results indicate that R. meliloti has separate regulatory pathways for activating nif gene expression ex planta and during symbiotic nitrogen fixation. Images

Szeto, W W; Nixon, B T; Ronson, C W; Ausubel, F M

1987-01-01

155

Appearance and accumulation of C/sub 4/ carbon pathway enzymes in developing wheat leaves  

SciTech Connect

Soluble protein has been extracted from sections of wheat leaves, from base to tip, and the content of several key enzymes of photosynthetic carbon assimilation in each section has been determined by the protein blot method. In the first leaf, ribulose 1,5-bisphosphate carboxylase (RuBPC) (EC 4.1.1.39) in the basal 0 to 1 centimeter section is about 12% the level in the tip section, whereas phosphoenolpyruvate carboxylase (EC 4.1.1.31) is present in small amounts in the basal section and does not change much in the tip. Pyruvate orthophosphate dikinase (PPDK) (EC 2.7.9.1) first appears in the 4 to 6 centimeter section and increases gradually with development to 10-fold in the tip. Malic enzyme, NADP-dependent (EC 1.3.1.37) also appears in the 4 to 6 centimeter section but remains low to the tip. Fixation of /sup 14/CO/sub 2/ by wheat leaf base sections resulted in 42% of total incorporation into malate and aspartate, indicating ..beta..-carboxylation, whereas in the tip section these labeled compounds were only 8% of the total. Although the amount of PPDK in wheat leaves is only 1 to 3% of that in maize leaves, this C/sub 3/ PPDK may have a limited role in photosynthesis leading to formation of C/sub 4/ compounds. The possibility of a further role, similar to that in C/sub 4/ plants, but for intracellular carbon transport in wheat leaves is discussed. The presence of malic dehydrogenase, NADP-specific (EC 1.1.1.82) in wheat leaf chloroplasts was shown, a necessary though not sufficient condition for such a proposed role. Assuming each of the four enzymes associated with C/sub 4/ carbon transport were fully active in vivo during photosynthesis, PPDK would still be rate limiting, even in the leaf tip where its activity is maximal. Possible evolutionary and breeding implications are discussed.

Aoyagi, K.; Bassham, J.A.

1986-02-01

156

Fixation: A Bibliography.  

ERIC Educational Resources Information Center

Fixation and regression were considered complementary by Freud. You tend to regress to a point of fixation. They are both opposed to progression. In the general area, Anna Freud has written (The Ego and the Mechanisms of Defence. London: Hogarth and the Psycho-Analytic Institute, 1937), Sears has evaluated (Survey of Objective Studies of…

Pedrini, D. T.; Pedrini, Bonnie C.

157

A central role for carbon-overflow pathways in the modulation of bacterial cell death.  

PubMed

Similar to developmental programs in eukaryotes, the death of a subpopulation of cells is thought to benefit bacterial biofilm development. However mechanisms that mediate a tight control over cell death are not clearly understood at the population level. Here we reveal that CidR dependent pyruvate oxidase (CidC) and ?-acetolactate synthase/decarboxylase (AlsSD) overflow metabolic pathways, which are active during staphylococcal biofilm development, modulate cell death to achieve optimal biofilm biomass. Whereas acetate derived from CidC activity potentiates cell death in cells by a mechanism dependent on intracellular acidification and respiratory inhibition, AlsSD activity effectively counters CidC action by diverting carbon flux towards neutral rather than acidic byproducts and consuming intracellular protons in the process. Furthermore, the physiological features that accompany metabolic activation of cell death bears remarkable similarities to hallmarks of eukaryotic programmed cell death, including the generation of reactive oxygen species and DNA damage. Finally, we demonstrate that the metabolic modulation of cell death not only affects biofilm development but also biofilm-dependent disease outcomes. Given the ubiquity of such carbon overflow pathways in diverse bacterial species, we propose that the metabolic control of cell death may be a fundamental feature of prokaryotic development. PMID:24945831

Thomas, Vinai Chittezham; Sadykov, Marat R; Chaudhari, Sujata S; Jones, Joselyn; Endres, Jennifer L; Widhelm, Todd J; Ahn, Jong-Sam; Jawa, Randeep S; Zimmerman, Matthew C; Bayles, Kenneth W

2014-06-01

158

A Central Role for Carbon-Overflow Pathways in the Modulation of Bacterial Cell Death  

PubMed Central

Similar to developmental programs in eukaryotes, the death of a subpopulation of cells is thought to benefit bacterial biofilm development. However mechanisms that mediate a tight control over cell death are not clearly understood at the population level. Here we reveal that CidR dependent pyruvate oxidase (CidC) and ?-acetolactate synthase/decarboxylase (AlsSD) overflow metabolic pathways, which are active during staphylococcal biofilm development, modulate cell death to achieve optimal biofilm biomass. Whereas acetate derived from CidC activity potentiates cell death in cells by a mechanism dependent on intracellular acidification and respiratory inhibition, AlsSD activity effectively counters CidC action by diverting carbon flux towards neutral rather than acidic byproducts and consuming intracellular protons in the process. Furthermore, the physiological features that accompany metabolic activation of cell death bears remarkable similarities to hallmarks of eukaryotic programmed cell death, including the generation of reactive oxygen species and DNA damage. Finally, we demonstrate that the metabolic modulation of cell death not only affects biofilm development but also biofilm-dependent disease outcomes. Given the ubiquity of such carbon overflow pathways in diverse bacterial species, we propose that the metabolic control of cell death may be a fundamental feature of prokaryotic development.

Thomas, Vinai Chittezham; Sadykov, Marat R.; Chaudhari, Sujata S.; Jones, Joselyn; Endres, Jennifer L.; Widhelm, Todd J.; Ahn, Jong-Sam; Jawa, Randeep S.; Zimmerman, Matthew C.; Bayles, Kenneth W.

2014-01-01

159

Carbon emission limits required to satisfy future representative concentration pathways of greenhouse gases  

NASA Astrophysics Data System (ADS)

The response of the second-generation Canadian earth system model (CanESM2) to historical (1850-2005) and future (2006-2100) natural and anthropogenic forcing is assessed using the newly-developed representative concentration pathways (RCPs) of greenhouse gases (GHGs) and aerosols. Allowable emissions required to achieve the future atmospheric CO2 concentration pathways, are reported for the RCP 2.6, 4.5 and 8.5 scenarios. For the historical 1850-2005 period, cumulative land plus ocean carbon uptake and, consequently, cumulative diagnosed emissions compare well with observation-based estimates. The simulated historical carbon uptake is somewhat weaker for the ocean and stronger for the land relative to their observation-based estimates. The simulated historical warming of 0.9°C compares well with the observation-based estimate of 0.76 ± 0.19°C. The RCP 2.6, 4.5 and 8.5 scenarios respectively yield warmings of 1.4, 2.3, and 4.9°C and cumulative diagnosed fossil fuel emissions of 182, 643 and 1617 Pg C over the 2006-2100 period. The simulated warming of 2.3°C over the 1850-2100 period in the RCP 2.6 scenario, with the lowest concentration of GHGs, is slightly larger than the 2°C warming target set to avoid dangerous climate change by the 2009 UN Copenhagen Accord. The results of this study suggest that limiting warming to roughly 2°C by the end of this century is unlikely since it requires an immediate ramp down of emissions followed by ongoing carbon sequestration in the second half of this century.

Arora, V. K.; Scinocca, J. F.; Boer, G. J.; Christian, J. R.; Denman, K. L.; Flato, G. M.; Kharin, V. V.; Lee, W. G.; Merryfield, W. J.

2011-03-01

160

Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria  

SciTech Connect

Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

Ferry, J.G.

1991-01-01

161

Enzymological studies of one-carbon reactions in the pathway of acetate utilization by methanogenic bacteria  

SciTech Connect

Several enzymes in the pathway of acetate conversion to methane and carbon dioxide have been purified from Methanosarcina thermophila. The mechanisms of these enzymes are under investigation utilizing biochemical, biophysical and molecular genetic approaches. Acetate kinase and phosphotransacetylase catalyzes the activation of acetate to acetyl-CoA. The primary structure of these enzymes will be determined through cloning and sequencing of the genes. Two protein components of the CO dehydrogenase complex are under investigations. The metal centers of each component have been characterized using EPR. Cloning and sequencing of the genes for the two subunits of each component is in progress. Results indicate that the Ni/Fe-S component cleaves the C-C and C-S bonds of acetyl-CoA followed by oxidation of the carbonyl group to carbon dioxide and transfer of the methyl group to the Co/Fe-S component. The enzymes and cofactors involved in transfer of the methyl group from the Co/Fe-S component to coenzyme M will be purified and characterized. Ferredoxin is an electron acceptor for the Ni/Fe-S component and also serves to reductively reactivate methylreductase which catalyzes the demethylation of methyl coenzyme M to methane. This ferredoxin is being characterized utilizing EPR and RR spectroscopic methods to determine the properties of the Fe-S centers. Genes encoding this and other ferredoxins have been cloned and sequenced to determine the primary structures. Carbonic anhydrase is being purified and characterized to determine the function of this enzyme in the pathway.

Ferry, J.G.

1991-12-31

162

Impairment of Photorespiratory Carbon Flow into Rubber by the Inhibition of the Glycolate Pathway in Guayule (Parthenium argentatum Gray).  

PubMed

Cut shoots of guayule (Parthenium argentatum Gray) were treated with four inhibitors of the glycolate pathway (alpha-hydroxypyridinemethanesulfonic acid; isonicotinic acid hydrazide, glycine hydroxamate, and amino-oxyacetate, AOA) in order to evaluate the role of photorespiratory intermediates in providing precursors for the biosynthesis of rubber. Photorespiratory CO(2) evolution in guayule leaves was severely inhibited by AOA. Application of each of the four inhibitors has resulted in a significantly decreased incorporation of (14)C into rubber fractions suggesting that the glycolate pathway is involved in the biosynthesis of rubber in guayule. However, the application of each of the glycolate pathway inhibitors showed no significant effect on photosynthetic CO(2) fixation in the leaves. The inhibitors individually also reduced the incorporation of labeled glycolate, glyoxylate, and glycine into rubber, while the incorporation of serine and pyruvate was not affected. The effective inhibition of incorporation of glycolate pathway intermediates in the presence of AOA was due to an inhibition of glycine decarboxylase and serine hydroxymethyltransferase. It is concluded that serine is a putative photorespiratory intermediate in the biosynthesis of rubber via pyruvate and acetyl coenzyme A. PMID:16665625

Reddy, A R; Suhasini, M; Das, V S

1987-08-01

163

Impairment of Photorespiratory Carbon Flow into Rubber by the Inhibition of the Glycolate Pathway in Guayule (Parthenium argentatum Gray) 1  

PubMed Central

Cut shoots of guayule (Parthenium argentatum Gray) were treated with four inhibitors of the glycolate pathway (?-hydroxypyridinemethanesulfonic acid; isonicotinic acid hydrazide, glycine hydroxamate, and amino-oxyacetate, AOA) in order to evaluate the role of photorespiratory intermediates in providing precursors for the biosynthesis of rubber. Photorespiratory CO2 evolution in guayule leaves was severely inhibited by AOA. Application of each of the four inhibitors has resulted in a significantly decreased incorporation of 14C into rubber fractions suggesting that the glycolate pathway is involved in the biosynthesis of rubber in guayule. However, the application of each of the glycolate pathway inhibitors showed no significant effect on photosynthetic CO2 fixation in the leaves. The inhibitors individually also reduced the incorporation of labeled glycolate, glyoxylate, and glycine into rubber, while the incorporation of serine and pyruvate was not affected. The effective inhibition of incorporation of glycolate pathway intermediates in the presence of AOA was due to an inhibition of glycine decarboxylase and serine hydroxymethyltransferase. It is concluded that serine is a putative photorespiratory intermediate in the biosynthesis of rubber via pyruvate and acetyl coenzyme A.

Reddy, A. Ramachandra; Suhasini, M.; Das, V. S. Rama

1987-01-01

164

13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose  

PubMed Central

Background The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions and the utilization of the respirative pathway has not been investigated on the level of in vivo fluxes. Results The biosynthetic pathways of amino acids in T. reesei supported by genome-level evidence were reconstructed with computational carbon path analysis. The pathway reconstructions were a prerequisite for analysis of in vivo fluxes. The distribution of in vivo fluxes in both wild type strain and cre1, a key regulator of carbon catabolite repression, deletion strain were quantitatively studied by performing 13C-labeling on both repressive carbon source glucose and non-repressive carbon source sorbitol. In addition, the 13C-labeling on sorbitol was performed both in the presence and absence of sophorose that induces the expression of cellulase genes. Carbon path analyses and the 13C-labeling patterns of proteinogenic amino acids indicated high similarity between biosynthetic pathways of amino acids in T. reesei and yeast Saccharomyces cerevisiae. In contrast to S. cerevisiae, however, mitochondrial rather than cytosolic biosynthesis of Asp was observed under all studied conditions. The relative anaplerotic flux to the TCA cycle was low and thus characteristic to respiratory metabolism in both strains and independent of the carbon source. Only minor differences were observed in the flux distributions of the wild type and cre1 deletion strain. Furthermore, the induction of the hydrolytic gene expression did not show altered flux distributions and did not affect the relative amino acid requirements or relative anabolic and respirative activities of the TCA cycle. Conclusion High similarity between the biosynthetic pathways of amino acids in T. reesei and yeast S. cerevisiae was concluded. In vivo flux distributions confirmed that T. reesei uses primarily the respirative pathway also when growing on the repressive carbon source glucose in contrast to Saccharomyces cerevisiae, which substantially diminishes the respirative pathway flux under glucose repression.

Jouhten, Paula; Pitkanen, Esa; Pakula, Tiina; Saloheimo, Markku; Penttila, Merja; Maaheimo, Hannu

2009-01-01

165

Comparative genomic analysis of carbon and nitrogen assimilation mechanisms in three indigenous bioleaching bacteria: predictions and validations  

PubMed Central

Background Carbon and nitrogen fixation are essential pathways for autotrophic bacteria living in extreme environments. These bacteria can use carbon dioxide directly from the air as their sole carbon source and can use different sources of nitrogen such as ammonia, nitrate, nitrite, or even nitrogen from the air. To have a better understanding of how these processes occur and to determine how we can make them more efficient, a comparative genomic analysis of three bioleaching bacteria isolated from mine sites in Chile was performed. This study demonstrated that there are important differences in the carbon dioxide and nitrogen fixation mechanisms among bioleaching bacteria that coexist in mining environments. Results In this study, we probed that both Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans incorporate CO2 via the Calvin-Benson-Bassham cycle; however, the former bacterium has two copies of the Rubisco type I gene whereas the latter has only one copy. In contrast, we demonstrated that Leptospirillum ferriphilum utilizes the reductive tricarboxylic acid cycle for carbon fixation. Although all the species analyzed in our study can incorporate ammonia by an ammonia transporter, we demonstrated that Acidithiobacillus thiooxidans could also assimilate nitrate and nitrite but only Acidithiobacillus ferrooxidans could fix nitrogen directly from the air. Conclusion The current study utilized genomic and molecular evidence to verify carbon and nitrogen fixation mechanisms for three bioleaching bacteria and provided an analysis of the potential regulatory pathways and functional networks that control carbon and nitrogen fixation in these microorganisms.

Levican, Gloria; Ugalde, Juan A; Ehrenfeld, Nicole; Maass, Alejandro; Parada, Pilar

2008-01-01

166

Comprehensive Evaluation of One-Carbon Metabolism Pathway Gene Variants and Renal Cell Cancer Risk  

PubMed Central

Introduction Folate and one-carbon metabolism are linked to cancer risk through their integral role in DNA synthesis and methylation. Variation in one-carbon metabolism genes, particularly MTHFR, has been associated with risk of a number of cancers in epidemiologic studies, but little is known regarding renal cancer. Methods Tag single nucleotide polymorphisms (SNPs) selected to produce high genomic coverage of 13 gene regions of one-carbon metabolism (ALDH1L1, BHMT, CBS, FOLR1, MTHFR, MTR, MTRR, SHMT1, SLC19A1, TYMS) and the closely associated glutathione synthesis pathway (CTH, GGH, GSS) were genotyped for 777 renal cell carcinoma (RCC) cases and 1,035 controls in the Central and Eastern European Renal Cancer case-control study. Associations of individual SNPs (n?=?163) with RCC risk were calculated using unconditional logistic regression adjusted for age, sex and study center. Minimum p-value permutation (Min-P) tests were used to identify gene regions associated with risk, and haplotypes were evaluated within these genes. Results The strongest associations with RCC risk were observed for SLC19A1 (Pmin-P?=?0.03) and MTHFR (Pmin-P?=?0.13). A haplotype consisting of four SNPs in SLC19A1 (rs12483553, rs2838950, rs2838951, and rs17004785) was associated with a 37% increased risk (p?=?0.02), and exploratory stratified analysis suggested the association was only significant among those in the lowest tertile of vegetable intake. Conclusions To our knowledge, this is the first study to comprehensively examine variation in one-carbon metabolism genes in relation to RCC risk. We identified a novel association with SLC19A1, which is important for transport of folate into cells. Replication in other populations is required to confirm these findings.

Gibson, Todd M.; Brennan, Paul; Han, Summer; Karami, Sara; Zaridze, David; Janout, Vladimir; Kollarova, Helen; Bencko, Vladimir; Navratilova, Marie; Szeszenia-Dabrowska, Neonila; Mates, Dana; Slamova, Alena; Pfeiffer, Ruth M.; Stolzenberg-Solomon, Rachael Z.; Mayne, Susan T.; Yeager, Meredith; Chanock, Stephen; Rothman, Nat; Chow, Wong-Ho; Rosenberg, Philip S.; Boffetta, Paolo; Moore, Lee E.

2011-01-01

167

Amino Acid Biosynthesis Pathways in Diatoms  

PubMed Central

Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity.

Bromke, Mariusz A.

2013-01-01

168

Photographic fixative poisoning  

MedlinePLUS

Photographic developer poisoning; Hydroquinone poisoning; Quinone poisoning; Sulfite poisoning ... Hydroquinones Quinones Sodium thiosulfate Sodium sulfite/bisulfite Boric acid Photographic fixative can also break down (decompose) to form sulfur dioxide gas.

169

Interaction between the carbon monoxide and nitric oxide pathways in the locus coeruleus during fever.  

PubMed

We have documented that the locus coeruleus (LC), the main noradrenergic nucleus in the brain, is part of a thermoeffector neuronal pathway in fever induced by lipopolysaccharide (LPS). Following this pioneering study, we have investigated the role of the LC carbon monoxide (CO) and nitric oxide (NO) pathways in fever. Interestingly, despite both CO and NO are capable of activating the same intracellular target, soluble guanylate cyclase (sGC), our data have shown that LC CO is an antipyretic molecule, whereas LC NO is propyretic. Thus, aiming at further exploring the mechanisms underlying their anti- and propyretic properties, we investigated the putative interplay between the LC CO and NO pathways. Male Wistar rats were implanted with a guide cannula in the fourth ventricle (4V) and a temperature datalogger capsule in the peritoneal cavity. The animals were microinjected into the 4V with an inhibitor of heme oxygenase (HO) (ZnDPBG [zinc(II)deuteroporphyrin IX 2,4 bis ethylene glycol]), or a CO donor (CORM-2 [tricarbonyldichlororuthenium-(II)-dimer]), or an inhibitor of nitric oxide synthase (NOS) (l-NMMA [N(G)-monomethyl-L-arginine acetate]), or an NO donor (NOC12 [3-ethyl-3-(ethylaminoethyl)-1-hydroxy-2-oxo-1-triazene]), and injected with LPS (100 ?g/kg i.p.). Two hours later, the rats were decapitated, and the brains were frozen and cut in a cryostat. LC punches were processed to assess LC bilirubin and nitrite/nitrate (NOx) levels. Microinjection of ZnDPBG reduced LC bilirubin and increased LC NOx, whereas l-NMMA diminished LC NOx and reduced LC bilirubin. Furthermore, NOC12 caused an increase in LC bilirubin, whereas CORM-2 caused a reduction in LC NOx. These findings are consistent with the notion that in the LC during LPS fever the CO pathway downmodulates NOS activity and the NO pathway upmodulates HO activity, and, together with previous data, allow us to conjecture that LC CO blunts fever by downmodulating NOS (antipyretic property), LC NO upmodulates HO and sGC activities favoring the development of LPS fever (propyretic effect). PMID:22300982

Soriano, R N; Kwiatkoski, M; Batalhao, M E; Branco, L G; Carnio, E C

2012-03-29

170

C1 Metabolism in Corynebacterium glutamicum: an Endogenous Pathway for Oxidation of Methanol to Carbon Dioxide  

PubMed Central

Methanol is considered an interesting carbon source in “bio-based” microbial production processes. Since Corynebacterium glutamicum is an important host in industrial biotechnology, in particular for amino acid production, we performed studies of the response of this organism to methanol. The C. glutamicum wild type was able to convert 13C-labeled methanol to 13CO2. Analysis of global gene expression in the presence of methanol revealed several genes of ethanol catabolism to be upregulated, indicating that some of the corresponding enzymes are involved in methanol oxidation. Indeed, a mutant lacking the alcohol dehydrogenase gene adhA showed a 62% reduced methanol consumption rate, indicating that AdhA is mainly responsible for methanol oxidation to formaldehyde. Further studies revealed that oxidation of formaldehyde to formate is catalyzed predominantly by two enzymes, the acetaldehyde dehydrogenase Ald and the mycothiol-dependent formaldehyde dehydrogenase AdhE. The ?ald ?adhE and ?ald ?mshC deletion mutants were severely impaired in their ability to oxidize formaldehyde, but residual methanol oxidation to CO2 was still possible. The oxidation of formate to CO2 is catalyzed by the formate dehydrogenase FdhF, recently identified by us. Similar to the case with ethanol, methanol catabolism is subject to carbon catabolite repression in the presence of glucose and is dependent on the transcriptional regulator RamA, which was previously shown to be essential for expression of adhA and ald. In conclusion, we were able to show that C. glutamicum possesses an endogenous pathway for methanol oxidation to CO2 and to identify the enzymes and a transcriptional regulator involved in this pathway.

Witthoff, Sabrina; Muhlroth, Alice

2013-01-01

171

Using Phospholipids and Stable Carbon Isotopes to Assess Microbial Community Structures and Carbon Cycle Pathways in Kamchatka Hot Springs  

NASA Astrophysics Data System (ADS)

Phospholipid fatty acid (PLFA) and stable carbon isotopes were used to assess the microbial community structures in Kamchatka hot springs. Eighteen mats or surface sediments were collected from hot springs having temperatures of 31 to 91°C and pHs of 4.9 to 8.5. These samples were clearly separated into three groups according to the bacterial PLFA: 1) those dominated by terminally branched odd-numbered fatty acids, 2) those dominated by C18:1 and 3) those dominated by C20:1. With support from other minor PLFA components, group 2 may be used as biomarkers for Chloroflexales or other phototrophic bacteria and group 3 for Aquificales, respectively. Among the sampled hot springs, the Arkashin pool represents the simplest microbial structure with members of Aquificales being the dominant primary producers. On the other hand, the Zavarzin pool may represent the most heterogeneous pool that may include members of Chloroflexales and Aquificales as primary producers. Bacterial 16S rDNA clone libraries confirmed the presence of these microbial groups in the two pools. Results of stable carbon isotope fractionation between CO2 source, bulk biomass and total PLFA showed that primary producers in the Arkashin pool primarily used the reductive tricarboxylic acid (rTCA) cycle (e.g., members of Aquificales); whereas the Zavarzin pool may be a mixture of the 3-hydroxypropionate (3-HP) pathway (e.g. members of Chloroflexales) and the rTCA cycle. Bacterial contribution using the Calvin cycle was not significant and may be less important in Kamchatka hot springs.

Zhao, W.; Romanek, C. S.; Burgess, E. A.; Wiegel, J.; Mills, G.; Zhang, C. L.

2006-12-01

172

Ab externo sulcus fixation.  

PubMed

A new suturing method for sulcus fixation of posterior chamber lenses is described. This technique involves using a 28-gauge hollow-bore needle on an insulin syringe and a straight suture needle carrying 10-0 polypropylene. Both of these needles penetrate the eye wall in ab externo fashion, with measurements guiding their insertion. This technique promotes reproducible suture placement and reliable sulcus fixation of the implant. PMID:1792035

Lewis, J S

1991-11-01

173

Modulation of Apoptotic Pathways of Macrophages by Surface-Functionalized Multi-Walled Carbon Nanotubes  

PubMed Central

Biomedical applications of carbon nanotubes (CNTs) often involve improving their hydrophilicity and dispersion in biological media by modifying them through noncovalent or covalent functionalization. However, the potential adverse effects of surface-functionalized CNTs have not been well characterized. In this study, we functionalized multi-walled CNTs (MWCNTs) via carboxylation, to produce MWCNTs-COOH, and via poly (ethylene glycol) linking, to produce MWCNTs-PEG. We used these functionalized MWCNTs to study the effect of surface functionalization on MWCNTs-induced toxicity to macrophages, and elucidate the underlying mechanisms of action. Our results revealed that MWCNTs-PEG were less cytotoxic and were associated with less apoptotic cell death of macrophages than MWCNTs-COOH. Additionally, MWCNTs-PEG induced less generation of reactive oxygen species (ROS) involving less activation of NADPH oxidase compared with MWCNTs-COOH, as evidenced by membrane translocation of p47phox and p67phox in macrophages. The less cytotoxic and apoptotic effect of MWCNTs-PEG compared with MWCNTs-COOH resulted from the lower cellular uptake of MWCNTs-PEG, which resulted in less activation of oxidative stress-responsive pathways, such as p38 mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-?B. These results demonstrate that surface functionalization of CNTs may alter ROS-mediated cytotoxic and apoptotic response by modulating apoptotic signaling pathways. Our study thus provides new insights into the molecular basis for the surface properties affecting CNTs toxicity.

Jiang, Yuanqin; Zhang, Honggang; Wang, Yange; Chen, Min; Ye, Shefang; Hou, Zhenqing; Ren, Lei

2013-01-01

174

Temporal and Spatial Deployment of Carbon Dioxide Capture and Storage Technologies across the Representative Concentration Pathways  

SciTech Connect

The Intergovernmental Panel on Climate Change’s (IPCC) Fifth Assessment (to be published in 2013-2014) will to a significant degree be built around four Representative Concentration Pathways (RCPs) that are intended to represent four scenarios of future development of greenhouse gas emissions, land use, and concentrations that span the widest range of potential future atmospheric radiative forcing. Under the very stringent climate policy implied by the 2.6 W/m2 overshoot scenario, all electricity is eventually generated from low carbon sources. However, carbon dioxide capture and storage (CCS) technologies never comprise more than 50% of total electricity generation in that very stringent scenario or in any of the other cases examined here. There are significant differences among the cases studied here in terms of how CCS technologies are used, with the most prominent being is the significant expansion of biomass+CCS as the stringency of the implied climate policy increases. Cumulative CO2 storage across the three cases that imply binding greenhouse gas constraints ranges by nearly an order of magnitude from 170GtCO2 (radiative forcing of 6.0W/m2 in 2100) to 1600GtCO2 (2.6W/m2 in 2100) over the course of this century. This potential demand for deep geologic CO2 storage is well within published estimates of total global CO2 storage capacity.

Dooley, James J.; Calvin, Katherine V.

2011-04-18

175

A candidate gene study of one-carbon metabolism pathway genes and colorectal cancer risk.  

PubMed

The risk of colorectal cancer (CRC) may be influenced by aberrant DNA methylation and altered nucleotide synthesis and repair, possibly caused by impaired dietary folate intake as well as by polymorphic variants in one-carbon metabolism genes. A case-control study using seventy-one CRC patients and eighty unrelated healthy controls was carried out to assess the genetic association of fifteen SNP and one insertion in nine genes belonging to the folate pathway. Polymorphism selection was based on literature data, and included those which have a known or suspected functional impact on cancer and missense polymorphisms that are most likely to alter protein function. Genotyping was performed by real-time PCR and PCR followed by restriction analysis. The likelihood ratio statistic indicated that most of the polymorphisms were not associated with the risk of CRC. However, an increased risk of CRC was observed for two variant alleles of SNP mapping on the transcobalamin 2 gene (TCN2): C776G (rs1801198) and c.1026-394T>G (rs7286680). Considering the crucial biological function played by one-carbon metabolism genes, further investigations with larger cohorts of CRC patients are needed in order to confirm our preliminary results. These preliminary results indicate that TCN2 polymorphisms can be a susceptibility factor for CRC. PMID:22794911

Martinelli, Marcella; Scapoli, Luca; Mattei, Gabriella; Ugolini, Giampaolo; Montroni, Isacco; Zattoni, Davide; Rosati, Giancarlo; Solmi, Rossella

2013-03-28

176

Preindustrial, historical, and fertilization simulations using a global ocean carbon model with new parameterizations of iron limitation, calcification, and N 2 fixation  

Microsoft Academic Search

The Canadian Model of Ocean Carbon (CMOC) has been developed as part of a global coupled climate carbon model. In a stand-alone integration to preindustrial equilibrium, the model ecosystem and global ocean carbon cycle are in general agreement with estimates based on observations. CMOC reproduces global mean estimates and spatial distributions of various indicators of the strength of the biological

Konstantin Zahariev; James R. Christian; Kenneth L. Denman

2008-01-01

177

Crosstalk between central pathways of nitric oxide and carbon monoxide in the hypertensive action of cyclosporine.  

PubMed

Although the intermediary role of central neurons in the hypertensive and sympathoexcitatory actions of cyclosporine (CSA) has been recognized in previous studies including our own, the underlying mechanism remains obscure. In this study, we tested the hypothesis that central pathways of nitric oxide (NO) and carbon monoxide (CO) modulate the blood pressure (BP) response elicited by CSA in conscious rats. Hemodynamic effects of CSA were evaluated in absence and presence of maneuvers that inhibit or facilitate biosynthesizing enzymes of NO (NOS) or CO (heme oxygenase, HO). CSA (20mg/kg i.v.) produced abrupt increases in BP that peaked in 5min and maintained for at least 45min. The hypertensive effect of CSA disappeared in rats pretreated intracisternally (i.c.) with N(?)-nitro-l-arginine methyl ester (L-NAME, nonselective NOS inhibitor), N(5)-(1-iminoethyl)-l-ornithine (L-NIO, selective eNOS inhibitor), N(?)-propyl-l-arginine (NPLA, selective nNOS inhibitor), or 1H-[1,2,4] oxadiazolo[4,3-a] quinoxalin-1-one (ODQ, guanylate cyclase inhibitor), suggesting the importance of central eNOS/nNOS/GC cascade in CSA-induced hypertension. L-NAME also abolished the hypotension caused by the sympatholytic drug moxonidine, indicating a tonic sympathoinhibitory action for NO. The inhibition of HO activity by zinc protoporphyrin IX (ZnPP) abrogated the hypertensive action of CSA. The abolition by L-NAME or ZnPP of CSA hypertension was compromised upon simultaneous i.c. exposure to hemin (HO substrate) and l-arginine (NOS substrate), respectively. Together, the interruption of the mutually facilitated NOS/NO and HO/CO pathways and coupled GC/cGMP in central neuronal pools accounts, at least partly, for the hypertensive and perhaps sympathoexcitatory actions of CSA. PMID:22226938

El-Mas, Mahmoud M; Omar, Amal G; Helmy, Mai M; Mohy El-Din, Mahmoud M

2012-03-01

178

Multiwall carbon nanotubes mediate macrophage activation and promote pulmonary fibrosis through TGF-?/Smad signaling pathway.  

PubMed

Multiwall carbon nanotubes (MWCNTs) have been widely used in many disciplines due to their unique physical and chemical properties, but have also raised great concerns about their possible negative health impacts, especially through occupational exposure. Although recent studies have demonstrated that MWCNTs induce granuloma formation and/or fibrotic responses in the lungs of rats or mice, their cellular and molecular mechanisms remain largely unaddressed. Here, it is reported that the TGF-?/Smad signaling pathway can be activated by MWCNTs and play a critical role in MWCNT-induced pulmonary fibrosis. Firstly, in vivo data show that spontaneously hypertensive (SH) rats administered long MWCNTs (20-50 ?m) but not short MWCNTs (0.5-2 ?m) exhibit increased fibroblast proliferation, collagen deposition and granuloma formation in lung tissue. Secondly, the in vivo experiments also indicate that only long MWCNTs can significantly activate macrophages and increase the production of transforming growth factor (TGF)-?1, which induces the phosphorylation of Smad2 and then the expression of collagen I/III and extracellular matrix (ECM) protease inhibitors in lung tissues. Finally, the present in vitro studies further demonstrate that the TGF-?/Smad signaling pathway is indeed necessary for the expression of collagen III in fibroblast cells. Together, these data demonstrate that MWCNTs stimulate pulmonary fibrotic responses such as fibroblast proliferation and collagen deposition in a TGF-?/Smad-dependent manner. These observations also suggest that tube length acts as an important factor in MWCNT-induced macrophage activation and subsequent TGF-?1 secretion. These in vivo and in vitro studies further highlight the potential adverse health effects that may occur following MWCNT exposure and provide a better understanding of the cellular and molecular mechanisms by which MWCNTs induce pulmonary fibrotic reactions. PMID:23650105

Wang, Peng; Nie, Xin; Wang, Yue; Li, Yang; Ge, Cuicui; Zhang, Lili; Wang, Liming; Bai, Ru; Chen, Zhiyun; Zhao, Yuliang; Chen, Chunying

2013-11-25

179

Dual Pathways of Carbon Monoxide-Mediated Vasoregulation: Modulation by Redox Mechanisms  

PubMed Central

Rationale Vascular tissues produce carbon monoxide (CO) via HO-dependent and HO-independent mechanisms; the former in tandem with biliverdin and iron and the latter as a lone product. CO has been shown to function as both a vasoconstrictor and vasodilator, however, factors that dictate the vasoregulatory phenotype of this gas are unknown. Objective Herein, we demonstrate that CO-mediated vasoconstriction is mechanistically linked to enhanced reactive oxygen species (ROS) production that masks vasodilatory pathways. Methods and Results Sprague Dawley rat interlobar and interlobular arteries were examined in terms of superoxide (O2-) generation and vascular reactivity in the absence and presence of antioxidants. Both authentic CO and the CO-releasing molecule (CORM)-3 constricted renal arteries and increased O2- production in a dose-dependent manner. Antioxidants tempol, ebselen and deferoxamine inhibited CO-induced O2- production and converted CO from constrictor to dilator. CO-induced O2- generation was found to involve the activity of multiple oxidases including nitric oxide synthase, NADPH-oxidase, xanthine oxidase and complex IV of the mitochondrial electron chain. Furthermore, inhibition of these enzymes converted CO from constrictor to dilator. Similarly, biliverdin and bilirubin inhibited CO-induced O2- production and vasoconstriction, allowing for a vasodilatory response to CO to be expressed. CO-induced vasoconstriction was dependent on a non-thromboxane agonist of the thromboxane receptor, while vasodilatory mechanisms of CO relied on the activation of soluble guanylate cyclase and calcium-gated potassium channels. Conclusions CO-induced vasoconstriction involves the generation of ROS which, when negated, allows for the expression of vasodilatory pathways which are masked by the primary oxidative stress response to this gas.

Lamon, Brian D.; Zhang, Frank F.; Puri, Nitin; Brodsky, Sergey V.; Goligorsky, Michael S.; Nasjletti, Alberto

2009-01-01

180

Molecular comparison of carbonic anhydrase from Flaveria species demonstrating different photosynthetic pathways.  

PubMed

During the evolution of C4 plants from C3 plants, both the function and intracellular location of carbonic anhydrase (CA) have changed. To determine whether these changes are due to changes at the molecular level, we have studied the cDNA sequences and the expression of CA from Flaveria species demonstrating different photosynthetic pathways. In leaf extracts from F. bidentis (C4), F. brownii (C4-like), F. linearis (C3-C4) and F. pringlei (C3), two polypeptides of M(r) 31 kDa and 35 kDa cross-reacted with anti-spinach CA antibodies. However, the relative labelling intensities of the two polypeptides differed depending on the species. Northern blot analysis indicated at least two CA transcripts are present in each Flaveria species with sizes ranging from 1.1 to 1.6 kb. Carbonic anhydrase cDNAs from all four Flaveria species studied encode an open reading frame for a polypeptide of 35-36 kDa. The amino acid sequences deduced from all four Flaveria cDNAs share at least 70% homology with the sequences of other dicot CAs. The F. bidentis (C4) CA sequence was found to be the least similar of the Flaveria proteins and, as most of the sequence dissimilarity was found in the first third of the CA molecule, these differences may be involved in the intracellular targeting of CA. A neighbour-joining tree inferred from CA amino acid sequences showed that the Flaveria CAs cluster with other dicot CAs forming a group distinct from those of monocot CAs and prokaryotic and Chlamydomonas periplasmic CAs. PMID:7579185

Ludwig, M; Burnell, J N

1995-10-01

181

Nicotinamide-functionalized multiwalled carbon nanotubes increase insulin production in pancreatic beta cells via MIF pathway  

PubMed Central

Recent data in the literature support the role of nicotinamide (NA) as a pharmacologic agent that stimulates pancreatic beta-cells to produce insulin in vitro. There are data showing that carbon nanotubes may be useful in initiating and maintaining cellular metabolic responses. This study shows that administration of multiwalled carbon nanotubes (MWCNTs) functionalized with nicotinamide (NA-MWCNTs) leads to significant insulin production compared with individual administration of NA, MWCNTs, and a control solution. Treatment of 1.4E7 cells for 30 minutes with NA-MWCNTs at concentrations ranging from 1 mg/L to 20 mg/L resulted in significantly increased insulin release (0.18 ± 0.026 ng/mL for 1 mg/L, 0.21 ± 0.024 ng/mL for 5 mg/L, and 0.27 ± 0.028 ng/mL for 20 mg/L). Thus, compared with cells treated with NA only (0.1 ± 0.01 ng/mL for 1 mg/L, 0.12 ± 0.017 ng/mL for 5 mg/L, and 0.17 ± 0.01 ng/mL for 20 mg/L) we observed a significant positive effect on insulin release in cells treated with NA-MWCNTs. The results were confirmed using flow cytometry, epifluorescence microscopy combined with immunochemistry staining, and enzyme-linked immunosorbent assay techniques. In addition, using immunofluorescence microscopy techniques, we were able to demonstrate that MWCNTs enhance insulin production via the macrophage migration inhibitory factor pathway. The application and potential of NA combined with MWCNTs as an antidiabetic agent may represent the beginning of a new chapter in the nanomediated treatment of diabetes mellitus.

Ilie, Ioana; Ilie, Razvan; Mocan, Teodora; Tabaran, Flaviu; Iancu, Cornel; Mocan, Lucian

2013-01-01

182

Variable fixation of staphylococcal slime by different histochemical fixatives  

Microsoft Academic Search

A variety of histochemical fixatives were used to compare the fixation of bacterial films produced by a standard slime-producing strain ofStaphylococcus epidermidis on plastic tissue culture plates. Some reagents were completely ineffective in fixing the slime layer, whereas others gave variable results. The best alternative to the fixative of the reference method, the potentially explosive Bouin's reagent, was air drying.

L. Baldassarri; W. A. Simpson; G. Donelli; G. D. Christensen

1993-01-01

183

Pyocyanin Alters Redox Homeostasis and Carbon Flux through Central Metabolic Pathways in Pseudomonas aeruginosa PA14? †  

PubMed Central

The opportunistic pathogen Pseudomonas aeruginosa produces colorful, redox-active antibiotics called phenazines. Excretion of pyocyanin, the best-studied natural phenazine, is responsible for the bluish tint of sputum and pus associated with P. aeruginosa infections in humans. Although the toxicity of pyocyanin for other bacteria, as well as its role in eukaryotic infection, has been studied extensively, the physiological relevance of pyocyanin metabolism for the producing organism is not well understood. Pyocyanin reduction by P. aeruginosa PA14 is readily observed in standing liquid cultures that have consumed all of the oxygen in the medium. We investigated the physiological consequences of pyocyanin reduction by assaying intracellular concentrations of NADH and NAD+ in the wild-type strain and a mutant defective in phenazine production. We found that the mutant accumulated more NADH in stationary phase than the wild type. This increased accumulation correlated with a decrease in oxygen availability and was relieved by the addition of nitrate. Pyocyanin addition to a phenazine-null mutant also decreased intracellular NADH levels, suggesting that pyocyanin reduction facilitates redox balancing in the absence of other electron acceptors. Analysis of extracellular organic acids revealed that pyocyanin stimulated stationary-phase pyruvate excretion in P. aeruginosa PA14, indicating that pyocyanin may also influence the intracellular redox state by decreasing carbon flux through central metabolic pathways.

Price-Whelan, Alexa; Dietrich, Lars E. P.; Newman, Dianne K.

2007-01-01

184

An Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and Hypocotyl Elongation1[C][W][OA  

PubMed Central

The local environment has a substantial impact on early seedling development. Applying excess carbon in the form of sucrose is known to alter both the timing and duration of seedling growth. Here, we show that sucrose changes growth patterns by increasing auxin levels and rootward auxin transport in Arabidopsis (Arabidopsis thaliana). Sucrose likely interacts with an endogenous carbon-sensing pathway via the PHYTOCHROME-INTERACTING FACTOR (PIF) family of transcription factors, as plants grown in elevated carbon dioxide showed the same PIF-dependent growth promotion. Overexpression of PIF5 was sufficient to suppress photosynthetic rate, enhance response to elevated carbon dioxide, and prolong seedling survival in nitrogen-limiting conditions. Thus, PIF transcription factors integrate growth with metabolic demands and thereby facilitate functional equilibrium during photomorphogenesis.

Lilley, Jodi L. Stewart; Gee, Christopher W.; Sairanen, Ilkka; Ljung, Karin; Nemhauser, Jennifer L.

2012-01-01

185

The Fixation of Nitrogen.  

ERIC Educational Resources Information Center

Discusses the fixation of atmospheric nitrogen in the form of ammonia as one of the foundations of modern chemical industry. The article describes ammonia production and synthesis, purifying the hydrogen-nitrogen mix, nitric acid production, and its commericial plant. (HM)

Andrew, S. P. S.

1978-01-01

186

Stable isotope probing and Raman spectroscopy for monitoring carbon flow in a food chain and revealing metabolic pathway.  

PubMed

Accurately measuring carbon flows is a challenge for understanding processes such as diverse intracellular metabolic pathways and predator-prey interactions. Combined with stable isotope probing (SIP), single-cell Raman spectroscopy was demonstrated for the first time to link the food chain from carbon substrate to bacterial prey up to predators at the single-cell level in a quantitative and nondestructive manner. Escherichia coli OP50 with different (13)C content, which were grown in a mixture of (12)C- and fully carbon-labeled (13)C-glucose (99%) as a sole carbon source, were fed to the nematode. The (13)C signal in Caenorhabditis elegans was proportional to the (13)C content in E. coli. Two Raman spectral biomarkers (Raman bands for phenylalanine at 1001 cm(-1) and thymine at 747 cm(-1) Raman bands), were used to quantify the (13)C content in E. coli and C. elegans over a range of 1.1-99%. The phenylalanine Raman band was a suitable biomarker for prokaryotic cells and thymine Raman band for eukaryotic cells. A biochemical mechanism accounting for the Raman red shifts of phenylalanine and thymine in response to (13)C-labeling is proposed in this study and is supported by quantum chemical calculation. This study offers new insights of carbon flow via the food chain and provides a research tool for microbial ecology and investigation of biochemical pathways. PMID:23259452

Li, Mengqiu; Huang, Wei E; Gibson, Christopher M; Fowler, Patrick W; Jousset, Alexandre

2013-02-01

187

Abiotic Nitrogen Fixation on Terrestrial Planets  

NASA Astrophysics Data System (ADS)

The abiotic fixation of nitrogen is critical to planetary evolution and the potential for life on terrestrial planets. A non-biological source of nitrogen, in a biochemically accessible form, is necessary for the origin and early evolution of life. Loss of nitrogen can result in atmospheric pressures too low for liquid water and will impact planetary habitability and hydrological processes. Shock heating of a non-reducing atmosphere produces NO and this has been well studied. Our understanding of the subsequent reactions was, in the past, theoretical. It was postulated that NO was photochemically converted to HNO which then, in surface waters, reacts to form nitrate and nitrite. This chemistry, including reactions in both the gas phase and the liquid phase, has now been studied experimentally. Our work has observed that there are multiple pathways for the fixation. One pathway observed is consistent with the theoretically predicted route via the formation of HNO. Interestingly, this pathway is coupled to photochemical formation of formaldehyde from CO through the formation of HCO. In the presence of liquid water, this pathway leads to the formation of nitrate and nitrite. In the presence of water vapor, but no liquid water, HNO appears to mostly dimerize to form N2O. A second pathway involves the formation of NO2 from CO2 and NO. This pathway becomes more dominant without water, but the reaction of NO2 with even adsorbed water can lead to the formation of nitric acid. Finally, with FeS suspended in liquid water, the direct reduction of NO to ammonia is observed. This last pathway represents the most efficient way to reduced nitrogen, with product yields well above 20% (nitrite/nitrate, from the first two pathways can also be reduced to ammonia thought the overall efficiency suffers). We wish to thank the NASA Astrobiology Institute for support.

Summers, David P.; Khare, B.; Basa, R. C. B.; Rodoni, D.

2009-09-01

188

Posterior transodontoid fixation: A new fixation (Kotil) technique  

PubMed Central

Anterior odontoid screw fixation or posterior C1-2 fusion techniques are routinely used in the treatment of Type II odontoid fractures, but these techniques may be inadequate in some types of odontoid fractures. In this new technique (Kotil technique), through a posterior bilateral approach, transarticular screw fixation was performed at the non-dominant vertebral artery (VA) side and posterior transodontoid fixation technique was performed at the dominant VA side. C1-2 complex fusion was aimed with unilateral transarticular fixation and odontoid fixation with posterior transodontoid screw fixation. Cervical spinal computed tomography (CT) of a 40-year-old male patient involved in a motor vehicle accident revealed an anteriorly dislocated Type II oblique dens fracture, not reducible by closed traction. Before the operation, the patient was found to have a dominant right VA with Doppler ultrasound. He was operated through a posterior approach. At first, transarticular screw fixation was performed at the non-dominant (left) side, and then fixation of the odontoid fracture was achieved by directing the contralateral screw (supplemental screw) medially and toward the apex. Cancellous autograft was scattered for fusion without the need for structural bone graft or wiring. Postoperative cervical spinal CT of the patient revealed that stabilization was maintained with transarticular screw fixation and reduction and fixation of the odontoid process was achieved completely by posterior transodontoid screw fixation. The patient is at the sixth month of follow-up and complete fusion has developed. With this new surgical technique, C1-2 fusion is maintained with transarticular screw fixation and odontoid process is fixed by concomitant contralateral posterior transodontoid screw (supplemental screw) fixation; thus, this technique both stabilizes the C1-2 complex and fixes the odontoid process and the corpus in atypical odontoid fractures, appearing as an alternative new technique among the previously defined C1-C2 fixation techniques in eligible cases.

Kotil, Kad?r; Koksal, Neslihan sutpideler; Kayac?, Selim

2011-01-01

189

Efficient [WO4](2-)-catalyzed chemical fixation of carbon dioxide with 2-aminobenzonitriles to quinazoline-2,4(1H,3H)-diones.  

PubMed

A simple monomeric tungstate, TBA(2)[WO(4)] (I, TBA = tetra-n-butylammonium), could act as an efficient homogeneous catalyst for chemical fixation of CO(2) with 2-aminobenzonitriles to quinazoline-2,4(1H,3H)-diones. Various kinds of structurally diverse 2-aminobenzonitriles could be converted into the corresponding quinazoline-2,4(1H,3H)-diones in high yields at atmospheric pressure of CO(2). Reactions of inactive 2-amino-4-chlorobenzonitrile and 2-amino-5-nitrobenzonitrile at 2 MPa of CO(2) also selectively proceeded. The present system was applicable to a g-scale reaction of 2-amino-5-fluorobenzonitrile (10 mmol scale) with CO(2) and 1.69 g of analytically pure quinazoline-2,4(1H,3H)-dione could be isolated. In this case, the turnover number reached up to 938 and the value was the highest among those reported for base-mediated systems so far. NMR spectroscopies showed formation of the corresponding carbamic acid through the simultaneous activation of both 2-aminobenzonitirile and CO(2) by I. Kinetic and computational studies revealed that I plays an important role in conversion of the carbamic acid into the product. PMID:23148733

Kimura, Toshihiro; Sunaba, Hanako; Kamata, Keigo; Mizuno, Noritaka

2012-12-01

190

One-carbon metabolism in methanogenic bacteria: analysis of short-term fixation products of 14CO2 and 14CH3OH incorporated into whole cells.  

PubMed Central

Methanobacterium thermoautotrophicum, M. ruminantium, and Methanosarcina barkeri were labeled with 14CO2 (14CO2 + H14CO3- + 14CO32-) for from 2 to 45 s. Radioactivity was recovered in coenzyme M derivatives, alanine, aspartate, glutamate, and several unidentified compounds. The properties of one important structurally unidentified intermediate (yellow fluorescent compound) displayed UV absorbance maxima at pH 1 of 290 and 335 nm, no absorbance in the visible region, and a fluorescence maximum at 460 nm. Label did not appear in organic phosphates until after 1 min. 14CH3OH was converted by M. barkeri primarily into coenzyme M derivatives at 25 s. [2-14C]acetate was assimilated by M. thermoautotrophicum mainly into alanine and succinate during 2 to 240 s, but not into coenzyme M derivatives or yellow fluorescent compound. Cell-free extracts of M. thermoautotrophicum lacked ribulose 1,5-bisphosphate carboxylase activity. The data indicated the absence of the Calvin, serine, and hexulose phosphate paths of C1 assimilation in the methanogens examined and indicated that pyruvate was an early intermediate product of net CO2 fixation. The in vivo importance of coenzyme M derivatives in methanogenesis was demonstrated. Images

Daniels, L; Zeikus, J G

1978-01-01

191

Synthetic Pathway for Production of Five-Carbon Alcohols from Isopentenyl Diphosphate  

PubMed Central

Synthetic biological pathways could enhance the development of novel processes to produce chemicals from renewable resources. On the basis of models that describe the evolution of metabolic pathways and enzymes in nature, we developed a framework to rationally identify enzymes able to catalyze reactions on new substrates that overcomes one of the major bottlenecks in the assembly of a synthetic biological pathway. We verified the framework by implementing a pathway with two novel enzymatic reactions to convert isopentenyl diphosphate into 3-methyl-3-butenol, 3-methyl-2-butenol, and 3-methylbutanol. To overcome competition with native pathways that share the same substrate, we engineered two bifunctional enzymes that redirect metabolic flux toward the synthetic pathway. Taken together, our work demonstrates a new approach to the engineering of novel synthetic pathways in the cell.

Chou, Howard H.

2012-01-01

192

Synthetic pathway for production of five-carbon alcohols from isopentenyl diphosphate.  

PubMed

Synthetic biological pathways could enhance the development of novel processes to produce chemicals from renewable resources. On the basis of models that describe the evolution of metabolic pathways and enzymes in nature, we developed a framework to rationally identify enzymes able to catalyze reactions on new substrates that overcomes one of the major bottlenecks in the assembly of a synthetic biological pathway. We verified the framework by implementing a pathway with two novel enzymatic reactions to convert isopentenyl diphosphate into 3-methyl-3-butenol, 3-methyl-2-butenol, and 3-methylbutanol. To overcome competition with native pathways that share the same substrate, we engineered two bifunctional enzymes that redirect metabolic flux toward the synthetic pathway. Taken together, our work demonstrates a new approach to the engineering of novel synthetic pathways in the cell. PMID:22941086

Chou, Howard H; Keasling, Jay D

2012-11-01

193

Fixation of CO 2 by chrysotile in low-pressure dry and moist carbonation: Ex-situ and in-situ characterizations  

NASA Astrophysics Data System (ADS)

A detailed study of low-pressure gas-solid carbonation of chrysotile in dry and humid environments has been carried out. The evolving structure of chrysotile and its reactivity as a function of temperature (300-1200 °C), humidity (0-10 mol %) and CO 2 partial pressure (20-67 mol %), thermal preconditioning, and alkali metal doping (Li, Na, K, Cs) have been monitored through in-situ X-ray photoelectron spectroscopy, isothermal thermogravimetry/mass spectrometry, ex-situ X-ray powder diffraction, and water and nitrogen adsorption/desorption. Based on chrysotile crystalline structure and its nanofibrilar orderliness, a multistep carbonation mechanism was elaborated to explain the role of water during chrysotile partial amorphisation, formation of periclase, brucite, and hydromagnesite crystalline phases, and surface passivation thereof, during humid carbonation. The weak carbonation reactivity was rationalized in terms of incongruent CO 2 van der Waals molecular diameters with the octahedral-tetrahedral lattice constants of chrysotile. This lack of reactivity appeared to be relatively indifferent to the facilitated water crisscrossing during chrysotile core dehydroxylation/pseudo-amorphisation and surface hydroxylation induced product stabilization during humid carbonation. Thermodynamic stability domains of the species observed at low pressure have been thoroughly discussed on the basis of X-ray powder diffraction patterns and X-ray photoelectron spectroscopy evidence. The highest carbon dioxide uptake occurred at 375 °C in moist atmospheres. On the basis of chrysotile fresh N 2 BET area, nearly 15 atoms out of 100 of the surface chrysotile brucitic Mg moiety have been carbonated at this temperature which was tantamount to the carbonation of about 2.5 at. % of the total brucitic Mg moiety in chrysotile. The carbonation of brucite (Mg(OH) 2) impurities coexisting in chrysotile was minor and estimated to contribute by less than 17.6 at. % of the total converted magnesium. The presence of cesium traces (3 Cs atoms per 100 Mg atoms) was found to boost chrysotile carbonation capacity by a factor 2.7.

Larachi, Faïçal; Daldoul, Insaf; Beaudoin, Georges

2010-06-01

194

Heme oxygenase/carbon monoxide pathway inhibition plays a role in ameliorating fibrosis following splenectomy.  

PubMed

Splenectomy is a recognized therapy for liver cirrhosis with splenomegaly, since it decreases free iron concentration that accompanies the destruction of red blood cells. Heme oxygenase (HO)-1 and its by-products, iron and carbon monoxide (CO), play crucial roles in hepatic fibrosis. The aim of the present study was to determine whether splenectomy in cirrhotic rats induced by bile duct ligation (BDL), through the HO/CO pathway, could slow down the development of liver fibrosis. Male Sprague-Dawley rats were divided randomly into the sham, BDL, splenectomy, Fe, zinc protoporphyrin (Znpp) and cobalt protoporphyrin (Copp) treatment groups, for inhibiting and inducing HO-1 expression. The level of HO-1 was detected by western blot analysis and reverse transcription-polymerase chain reaction. Serum carboxyhemoglobin (COHb), iron and portal vein pressure (PVP) were also quantified. Liver iron was measured by atomic absorption spectrometry with acetylene-air flame atomization. HO-1 and ?-smooth muscle actin (?-SMA) were localized by immunohistochemistry. Liver and spleen iron were visualized by Perls' Prussian blue staining. Hepatic fibrosis was assessed using hematoxylin and eosin (H&E) staining. Enzyme-linked immunosorbent assay (ELISA) was used to detect serum transforming growth factor-?1 (TGF-?1). The results showed that liver, spleen and serum levels of HO-1, COHb and iron were greatly enhanced in the BDL group compared with the sham group; they were reduced following splenectomy and Znpp treatment, but were elevated in the Copp and Fe groups. Hydroxyproline, TGF-?1, ?-SMA, PVP and malonaldehyde levels were lower in the splenectomy and Znpp groups compared to BDL, while higher levels were observed in the Copp and Fe-treated groups. Our study shows that splenectomy reduces iron and CO levels in part by reducing HO-1 expression, and it decreases portal pressure and slightly decreases hepatic fibroproliferation. PMID:23525258

Wang, Qiu-Ming; Duan, Zhi-Jun; Du, Jian-Ling; Guo, Shi-Bin; Sun, Xiao-Yu; Liu, Zhen

2013-05-01

195

Measurement of black carbon at Syowa station, Antarctica: seasonal variation, transport processes and pathways  

NASA Astrophysics Data System (ADS)

Measurement of black carbon (BC) was carried out at Syowa station Antarctica (69° S, 39° E) from February 2004 until January 2007. The BC concentration at Syowa ranged from below detection to 176 ng m-3 during the measurements. Higher BC concentrations were observed mostly under strong wind (blizzard) conditions due to the approach of a cyclone and blocking event. The BC-rich air masses traveled from the lower troposphere of the Atlantic and Indian Oceans to Syowa (Antarctic coast). During the summer (November-February), the BC concentration showed a diurnal variation together with surface wind speed and increased in the katabatic wind from the Antarctic continent. Considering the low BC source strength in the Antarctic continent, the higher BC concentration in the continental air (katabatic wind) might be caused by long range transport of BC via the free troposphere from mid- and low- latitudes. The seasonal variation of BC at Syowa had a maximum in August, while at the other coastal stations (Halley, Neumayer, and Ferraz) and the continental station (Amundsen-Scott), the maximum occurred in October. This difference may result from different transport pathways and scavenging of BC by precipitation during the transport from the source regions. During the austral summer, long-range transport of BC via the free troposphere is likely to make an important contribution to the ambient BC concentration. The BC transport flux indicated that BC injection into the Antarctic region strongly depended on the frequency of storm (blizzard) conditions. The seasonal variation of BC transport flux increased by 290 mg m-2 month-1 in winter-spring when blizzards frequently occurred, whereas the flux decreased to lower than 50 mg m-2 month-1 in the summer with infrequent blizzards.

Hara, K.; Osada, K.; Yabuki, M.; Hayashi, M.; Yamanouchi, T.; Shiobara, M.; Wada, M.

2008-05-01

196

Fixation-off sensitivity.  

PubMed

Fixation-off sensitivity (FOS) is a phenomenon induced by elimination of central vision/fixation, and may either manifest clinically with seizures or only represent an EEG abnormality. FOS is characterized by posterior or generalized epileptiform discharges that consistently occur after closing of the eyes and last as long as the eyes are closed. It is most commonly encountered in patients with idiopathic childhood occipital epilepsies, but may also be observed in cases of symptomatic or cryptogenic focal and generalized epilepsies, as well as in asymptomatic non-epileptic individuals. FOS should be differentiated from pure forms of scotosensitivity, in which EEG discharges or epileptic seizures are elicited by darkness, and from epileptiform discharges triggered by eye closure, which refer to eye closure sensitivity. Although FOS is probably associated with occipital hyperexcitability its intrinsic epileptogenic potential is presumed to be low. PMID:22925838

Brigo, F; Rossini, F; Stefani, A; Nardone, R; Tezzon, F; Fiaschi, A; Manganotti, P; Bongiovanni, L G

2013-02-01

197

Novel posterior fixation keratoprosthesis  

NASA Astrophysics Data System (ADS)

The keratoprosthesis is the last solution for corneally blind patients that cannot benefit from corneal transplants. Keratoprostheses that have been designed to be affixed anteriorly usually necessitate multi-step surgical procedures and are continuously subjected to the extrusion forces generated by the positive intraocular pressure; therefore, clinical results in patients prove inconsistent. We proposed a novel keratoprosthesis concept that utilizes posterior corneal fixation which `a priori' minimizes the risk of aqueous leakage and expulsion. This prosthesis is implanted in a single procedure thereby reducing the number of surgical complications normally associated with anterior fixation devices. In addition, its novel design makes this keratoprosthesis implantable in phakic eyes. With an average follow-up of 13 months (range 3 to 25 months), our results on 21 cases are encouraging. Half of the keratoprostheses were implanted in severe burn cases, with the remainder in cases of pseudo- pemphigus. Good visual results and cosmetic appearance were obtained in 14 of 21 eyes.

Lacombe, Emmanuel

1992-08-01

198

Carbon isotopes and iodine concentrations in a Mississippi River delta core recording land use, sediment transport, and dam building in the river’s drainage basin  

Microsoft Academic Search

Sedimentary material from coastal and nearshore areas in the Mississippi Delta region are comprised of different organic carbon sources with diverse ages that require isotopic and elemental records for resolving the various sources of plant residues. Carbon isotopic (13C, 14C) values were used to differentiate contributions from plants using the C3, C4, and\\/or CAM (crassulacean acid metabolism) carbon fixation pathways.,

Peter H. Santschi; Sarah D. Oktay; Luis Cifuentes

2007-01-01

199

A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime  

NASA Technical Reports Server (NTRS)

A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

Carr, Mary-Elena

1998-01-01

200

Understanding Nitrogen Fixation  

SciTech Connect

The purpose of our program is to explore fundamental chemistry relevant to the discovery of energy efficient methods for the conversion of atmospheric nitrogen (N{sub 2}) into more value-added nitrogen-containing organic molecules. Such transformations are key for domestic energy security and the reduction of fossil fuel dependencies. With DOE support, we have synthesized families of zirconium and hafnium dinitrogen complexes with elongated and activated N-N bonds that exhibit rich N{sub 2} functionalization chemistry. Having elucidated new methods for N-H bond formation from dihydrogen, C-H bonds and Broensted acids, we have since turned our attention to N-C bond construction. These reactions are particularly important for the synthesis of amines, heterocycles and hydrazines with a range of applications in the fine and commodity chemicals industries and as fuels. One recent highlight was the discovery of a new N{sub 2} cleavage reaction upon addition of carbon monoxide which resulted in the synthesis of an important fertilizer, oxamide, from the diatomics with the two strongest bonds in chemistry. Nitrogen-carbon bonds form the backbone of many important organic molecules, especially those used in the fertilizer and pharamaceutical industries. During the past year, we have continued our work in the synthesis of hydrazines of various substitution patterns, many of which are important precursors for heterocycles. In most instances, the direct functionalization of N{sub 2} offers a more efficient synthetic route than traditional organic methods. In addition, we have also discovered a unique CO-induced N{sub 2} bond cleavage reaction that simultaneously cleaves the N-N bond of the metal dinitrogen compound and assembles new C-C bond and two new N-C bonds. Treatment of the CO-functionalized core with weak Broensted acids liberated oxamide, H{sub 2}NC(O)C(O)NH{sub 2}, an important slow release fertilizer that is of interest to replace urea in many applications. The synthesis of ammonia, NH{sub 3}, from its elements, H{sub 2} and N{sub 2}, via the venerable Haber-Bosch process is one of the most significant technological achievements of the past century. Our research program seeks to discover new transition metal reagents and catalysts to disrupt the strong N {triple_bond} N bond in N{sub 2} and create new, fundamental chemical linkages for the construction of molecules with application as fuels, fertilizers and fine chemicals. With DOE support, our group has discovered a mild method for ammonia synthesis in solution as well as new methods for the construction of nitrogen-carbon bonds directly from N{sub 2}. Ideally these achievements will evolve into more efficient nitrogen fixation schemes that circumvent the high energy demands of industrial ammonia synthesis. Industrially, atmospheric nitrogen enters the synthetic cycle by the well-established Haber-Bosch process whereby N{sub 2} is hydrogenated to ammonia at high temperature and pressure. The commercialization of this reaction represents one of the greatest technological achievements of the 20th century as Haber-Bosch ammonia is responsible for supporting approximately 50% of the world's population and serves as the source of half of the nitrogen in the human body. The extreme reaction conditions required for an economical process have significant energy consequences, consuming 1% of the world's energy supply mostly in the form of pollution-intensive coal. Moreover, industrial H{sub 2} synthesis via the water gas shift reaction and the steam reforming of methane is fossil fuel intensive and produces CO{sub 2} as a byproduct. New synthetic methods that promote this thermodynamically favored transformation ({Delta}G{sup o} = -4.1 kcal/mol) under milder conditions or completely obviate it are therefore desirable. Most nitrogen-containing organic molecules are derived from ammonia (and hence rely on the Haber-Bosch and H{sub 2} synthesis processes) and direct synthesis from atmospheric nitrogen could, in principle, be more energy-efficient. This is particularly attractive giv

Paul J. Chirik

2012-05-25

201

Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds.  

National Technical Information Service (NTIS)

The objective of the project is to develop a biochemical pathway for the selective cleavage of C- N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The...

2006-01-01

202

Regulation of Development and Nitrogen Fixation in Anabaena  

SciTech Connect

The nitrogen-fixing filamentous cyanobacterium Anabaena sp. strain PCC 7120 is being used as a simple model of microbial development and pattern formation in a multicellular prokaryotic organism. Anabaena reduces atmospheric nitrogen to ammonia in highly specialized, terminally differentiated cells called heterocysts. Anabaena is an important model system because of the multicellular growth pattern, the suspected antiquity of heterocyst development, and the contribution of fixed nitrogen to the environment. We are especially interested in understanding the molecular signaling pathways and genetic regulation that control heterocyst development. In the presence of an external source of reduced nitrogen, the differentiation of heterocysts is inhibited. When Anabaena is grown on dinitrogen, a one-dimensional developmental pattern of single heterocysts separated by approximately ten vegetative cells is established to form a multicellular organism composed of two interdependent cell types. The goal of this project is to understand the signaling and regulatory pathways that commit a vegetative cell to terminally differentiate into a nitrogen-fixing heterocyst. Several genes identified by us and by others were chosen as entry points into the regulatory network. Our research, which was initially focused on transcriptional regulation by group 2 sigma factors, was expanded to include group 3 sigma factors and their regulators after the complete Anabaena genome sequence became available. Surprisingly, no individual sigma factor is essential for heterocyst development. We have used the isolation of extragenic suppressors to study genetic interactions between key regulatory genes such as patS, hetR, and hetC in signaling and developmental pathways. We identified a hetR R223W mutation as a bypass suppressor of patS overexpression. Strains containing the hetR R223W allele fail to respond to pattern formation signals and overexpression of this allele results in a lethal phenotype because all cells differentiate a few days after nitrogen step-down. Our continued analysis of these genes will provide a better understanding of how a simple prokaryotic organism can perform both photosynthetic carbon fixation and nitrogen fixation simultaneously by separating these processes in different cell types.

James W Golden

2004-08-05

203

Ammonia oxidation coupled to CO2 fixation by archaea and bacteria in an agricultural soil  

PubMed Central

Ammonia oxidation is an essential part of the global nitrogen cycling and was long thought to be driven only by bacteria. Recent findings expanded this pathway also to the archaea. However, most questions concerning the metabolism of ammonia-oxidizing archaea, such as ammonia oxidation and potential CO2 fixation, remain open, especially for terrestrial environments. Here, we investigated the activity of ammonia-oxidizing archaea and bacteria in an agricultural soil by comparison of RNA- and DNA-stable isotope probing (SIP). RNA-SIP demonstrated a highly dynamic and diverse community involved in CO2 fixation and carbon assimilation coupled to ammonia oxidation. DNA-SIP showed growth of the ammonia-oxidizing bacteria but not of archaea. Furthermore, the analysis of labeled RNA found transcripts of the archaeal acetyl-CoA/propionyl-CoA carboxylase (accA/pccB) to be expressed and labeled. These findings strongly suggest that ammonia-oxidizing archaeal groups in soil autotrophically fix CO2 using the 3-hydroxypropionate–4-hydroxybutyrate cycle, one of the two pathways recently identified for CO2 fixation in Crenarchaeota. Catalyzed reporter deposition (CARD)-FISH targeting the gene encoding subunit A of ammonia monooxygenase (amoA) mRNA and 16S rRNA of archaea also revealed ammonia-oxidizing archaea to be numerically relevant among the archaea in this soil. Our results demonstrate a diverse and dynamic contribution of ammonia-oxidizing archaea in soil to nitrification and CO2 assimilation and that their importance to the overall archaeal community might be larger than previously thought.

Pratscher, Jennifer; Dumont, Marc G.; Conrad, Ralf

2011-01-01

204

The fate of new production from N2 fixation  

NASA Astrophysics Data System (ADS)

While we now know that marine N2 fixation is a significant source of new nitrogen (N) in the marine environment, little is known about the fate of this production, despite the importance of diazotrophs to global carbon and nutrient cycles. Specifically, does new production from N2 fixation fuel autotrophic or heterotrophic growth, facilitate carbon (C) export from the euphotic zone, or contribute primarily to microbial productivity and respiration in the euphotic zone? For Trichodesmium, the diazotroph we know the most about, the transfer of recently fixed N2 (and C) appears to be primarily through dissolved pools. The release of N appears to vary among and within populations and, probably as a result of the changing physiological state of cells and populations. The net result of trophic transfers appears to depend on the complexity of the colonizing community and co-occurring organisms. In order to understand the impact of diazotrophy on carbon flow and export in marine systems, we need a better assessment of the trophic flow of elements in Trichodesmium communities dominated by different species, various free and colonial morphologies, and in various defined physiological states. Nitrogen and carbon fixation rates themselves vary by orders of magnitude within and among studies highlighting the difficulty in extrapolating global rates of N2 fixation from direct measurements. Because the stoichiometry of N2 and C fixation does not appear to be in balance with the stoichiometry of particles, and the relationship between C and N2 fixation rates is also variable, it is equally difficult to derive global rates of one from the other. A better understanding of the physiology and physiological ecology of Trichodesmium and other marine diazotrophs is necessary to understand and predict the effects of increased or decreased diazotrophy in the context of the carbon cycle and global change.

Mulholland, M. R.

2006-07-01

205

Activation of the phospholipase C signaling pathway in nerve growth factor-treated neurons by carbon nanotubes.  

PubMed

Low concentrations of carbon nanotubes (CNTs) promoted the number of nerve growth factor (NGF)-treated neurons with neurite outgrowth by activating extracellular signal-regulated kinase (ERK), even when MEK inhibitor was added to the neuron culture medium. We speculated that CNTs may activate ERK through the phospholipase C (PLC) signaling pathway independent of the Ras/Raf/MEK cascade involved in the ERK signaling pathway. CNTs enhanced phosphorylation of PLC-?1 in NGF-treated neurons but failed to increase the number and length of neurites of NGF-treated neurons with neurite outgrowth when a PLC inhibitor, an inositol triphosphate receptor (IP3R) inhibitor, or an inhibitor of protein kinase C (PKC) in the PLC signaling pathway were added to the neuron culture medium. Furthermore, intracellular Ca(++) levels of cells treated with CNTs+NGF were higher than those of cells treated with NGF alone. Although the combination of CNTs and NGF increased the concentration of phosphorylated ERK (p-ERK) in MEK inhibitor-treated neurons, CNTs did not induce phosphorylation of ERK in PLC inhibitor-treated neurons. These data suggest that PKC in the PLC signaling pathway may activate ERK independent of the Ras/Raf/MEK cascade. In summary, we identified a role of PLC signaling in mediating neurite outgrowth of NGF-treated neurons in the presence of CNTs. PMID:23669261

Matsumoto, Kotaro; Shimizu, Norio

2013-08-01

206

A Dynamic Pathway for Stone-Wales Bond Rotation on Carbon Nanotubes through Diamond-Like Bonds  

NASA Technical Reports Server (NTRS)

A new lower energy barrier with a two-step pathway of Stone-Wales (SW) ,ond rotation on carbon nanotubes (CNTs) is found through molecular dynamics (MD) simulations of CNTs under tension. The first step involves going over to a stable sp3-like metastable configuration with half rotated and partially tilted C-C bond. The second step involves going over to the fully rotated C-C bond with the formation of a SW defect in the nanotube. The energy barrier for this two-step dynamic pathway is significantly lower than the previously known static barrier for in-plane rotation of the C-C bond on a tensile strained (> 4%) CNT.

Wei, Chen-Yu; Srivastava, Deepak; Cho, Kyeong-Jae; Menon, Madhu

2003-01-01

207

The putrescine biosynthesis pathway in Lactococcus lactis is transcriptionally regulated by carbon catabolic repression, mediated by CcpA.  

PubMed

Lactococcus lactis is the lactic acid bacterium most widely used by the dairy industry as a starter for the manufacture of fermented products such as cheese and buttermilk. However, some strains produce putrescine from agmatine via the agmatine deiminase (AGDI) pathway. The proteins involved in this pathway, including those necessary for agmatine uptake and conversion into putrescine, are encoded by the aguB, aguD, aguA and aguC genes, which together form an operon. This paper reports the mechanism of regulation of putrescine biosynthesis in L. lactis. It is shown that the aguBDAC operon, which contains a cre site at the promoter of aguB (the first gene of the operon), is transcriptionally regulated by carbon catabolic repression (CCR) mediated by the catabolite control protein CcpA. PMID:23688550

Linares, Daniel M; del Río, Beatriz; Ladero, Victor; Redruello, Begoña; Martín, María Cruz; Fernández, María; Alvarez, Miguel A

2013-07-01

208

Nitrogen fixation apparatus  

DOEpatents

A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

Chen, Hao-Lin (Walnut Creek, CA) [Walnut Creek, CA

1984-01-01

209

Phosphorus limitation of nitrogen fixation by Trichodesmium in the central Atlantic Ocean  

Microsoft Academic Search

Marine fixation of atmospheric nitrogen is believed to be an important source of biologically useful nitrogen to ocean surface waters, stimulating productivity of phytoplankton and so influencing the global carbon cycle. The majority of nitrogen fixation in tropical waters is carried out by the marine cyanobacterium Trichodesmium, which supplies more than half of the new nitrogen used for primary production.

Sergio A. Sañudo-Wilhelmy; Adam B. Kustka; Christopher J. Gobler; David A. Hutchins; Min Yang; Kamazima Lwiza; James Burns; Douglas G. Capone; John A. Raven; Edward J. Carpenter

2001-01-01

210

Physical pathways for carbon transfers between the surface mixed layer and the ocean interior  

NASA Astrophysics Data System (ADS)

Although they are key components of the surface ocean carbon budget, physical processes inducing carbon fluxes across the mixed-layer base, i.e., subduction and obduction, have received much less attention than biological processes. Using a global model analysis of the preindustrial ocean, physical carbon fluxes are quantified and compared to the other carbon fluxes in and out of the surface mixed layer, i.e., air-sea CO2gas exchange and sedimentation of biogenic material. Model-based carbon obduction and subduction are evaluated against independent data-based estimates to the extent that was possible. We find that climatological physical fluxes of dissolved inorganic carbon (DIC) are two orders of magnitude larger than the other carbon fluxes and vary over the globe at smaller spatial scale. At temperate latitudes, the subduction of DIC and to a much lesser extent (<10%) the sinking of particles maintain CO2undersaturation, whereas DIC is obducted back to the surface in the tropical band (75%) and Southern Ocean (25%). At the global scale, these two large counter-balancing fluxes of DIC amount to +275.5 PgC yr-1 for the supply by obduction and -264.5 PgC yr-1 for the removal by subduction which is ˜ 3 to 5 times larger than previous estimates. Moreover, we find that subduction of organic carbon (dissolved and particulate) represents ˜ 20% of the total export of organic carbon: at the global scale, we evaluate that of the 11 PgC yr-1 of organic material lost from the surface every year, 2.1 PgC yr-1 is lost through subduction of organic carbon. Our results emphasize the strong sensitivity of the oceanic carbon cycle to changes in mixed-layer depth, ocean currents, and wind.

Levy, M.; Bopp, L.; Karleskind, P.; Resplandy, L.; Ethe, C.; Pinsard, F.

2013-12-01

211

Definitive Bone Fixation and Reconstruction: Conversion from Temporary External Fixation to Internal Fixation Methods  

Microsoft Academic Search

\\u000a Temporary external fixation is frequently employed in the military combat theater of operations to temporize devastating extremity\\u000a injuries and facilitate transport of the wounded soldier. Multiple civilian and a few military studies have provided helpful\\u000a insight into the staged treatment of these injuries including conversion of temporary external fixation to definitive stabilization\\u000a with internal fixation. Diaphyseal fractures of the long

Craig S. Bartlett; Benjamin Geer; David L. Helfet

212

Nitrogen fixation by a blue-green epiphyte on pelagic sargassum.  

PubMed

Nitrogen fixation by Dichothrix fucicola, an epiphyte on pelagic Sargassum, was measured in May and June 1972 in the western Sargasso Sea and the Gulf Stream. This is the first report of nitrogen fixation by a heterocyst-bearing blue-green alga in the open ocean, and also the first observation of nitrogen fixation in the genus Dichothrix. Cellular carbon/nitrogen ratios suggested that the Dichothrix was nitrogen-starved. In dense aggregations of Sargassum, such as rafts or windrows, the enrichment of surface seawater with combined nitrogen from nitrogen fixation may be pronounced. PMID:17748983

Carpenter, E J

1972-12-15

213

A hypersaline microbial mat from the Pacific Atoll Kiritimati: insights into composition and carbon fixation using biomarker analyses and a 13C-labeling approach.  

PubMed

Modern microbial mats are widely recognized as useful analogs for the study of biogeochemical processes relevant to paleoenvironmental reconstruction in the Precambrian. We combined microscopic observations and investigations of biomarker composition to investigate community structure and function in the upper layers of a thick phototrophic microbial mat system from a hypersaline lake on Kiritimati (Christmas Island) in the Northern Line Islands, Republic of Kiribati. In particular, an exploratory incubation experiment with (13)C-labeled bicarbonate was conducted to pinpoint biomarkers from organisms actively fixing carbon. A high relative abundance of the cyanobacterial taxa Aphanocapsa and Aphanothece was revealed by microscopic observation, and cyanobacterial fatty acids and hydrocarbons showed (13)C-uptake in the labeling experiment. Microscopic observations also revealed purple sulfur bacteria (PSB) in the deeper layers. A cyclic C(19:0) fatty acid and farnesol were attributed to this group that was also actively fixing carbon. Background isotopic values indicate Calvin-Benson cycle-based autotrophy for cycC(19:0) and farnesol-producing PSBs. Biomarkers from sulfate-reducing bacteria (SRB) in the top layer of the mat and their (13)C-uptake patterns indicated a close coupling between SRBs and cyanobacteria. Archaeol, possibly from methanogens, was detected in all layers and was especially abundant near the surface where it contained substantial amounts of (13)C-label. Intact glycosidic tetraether lipids detected in the deepest layer indicated other archaea. Large amounts of ornithine and betaine bearing intact polar lipids could be an indicator of a phosphate-limited ecosystem, where organisms that are able to substitute these for phospholipids may have a competitive advantage. PMID:19476506

Bühring, S I; Smittenberg, R H; Sachse, D; Lipp, J S; Golubic, S; Sachs, J P; Hinrichs, K-U; Summons, R E

2009-06-01

214

Eighth international congress on nitrogen fixation  

SciTech Connect

This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

Not Available

1990-01-01

215

Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501  

PubMed Central

The capacity to fix nitrogen is widely distributed in phyla of Bacteria and Archaea but has long been considered to be absent from the Pseudomonas genus. We report here the complete genome sequencing of nitrogen-fixing root-associated Pseudomonas stutzeri A1501. The genome consists of a single circular chromosome with 4,567,418 bp. Comparative genomics revealed that, among 4,146 protein-encoding genes, 1,977 have orthologs in each of the five other Pseudomonas representative species sequenced to date. The genome contains genes involved in broad utilization of carbon sources, nitrogen fixation, denitrification, degradation of aromatic compounds, biosynthesis of polyhydroxybutyrate, multiple pathways of protection against environmental stress, and other functions that presumably give A1501 an advantage in root colonization. Genetic information on synthesis, maturation, and functioning of nitrogenase is clustered in a 49-kb island, suggesting that this property was acquired by lateral gene transfer. New genes required for the nitrogen fixation process have been identified within the nif island. The genome sequence offers the genetic basis for further study of the evolution of the nitrogen fixation property and identification of rhizosphere competence traits required in the interaction with host plants; moreover, it opens up new perspectives for wider application of root-associated diazotrophs in sustainable agriculture.

Yan, Yongliang; Yang, Jian; Dou, Yuetan; Chen, Ming; Ping, Shuzhen; Peng, Junping; Lu, Wei; Zhang, Wei; Yao, Ziying; Li, Hongquan; Liu, Wei; He, Sheng; Geng, Lizhao; Zhang, Xiaobing; Yang, Fan; Yu, Haiying; Zhan, Yuhua; Li, Danhua; Lin, Zhanglin; Wang, Yiping; Elmerich, Claudine; Lin, Min; Jin, Qi

2008-01-01

216

Dark Fixation of CO2 by Crassulacean Plants  

PubMed Central

Malic acid isolated from Bryophyllum pinnatum (Lamk.) Oken (B. calycinum Salisb.), Bryophyllum tubiflorum Harv., Kalanchoë diagremontiana Hamet et Perrier and Sedum guatamalense Hemsl. after dark 14CO2 fixation was degraded by an in vitro NADP-malic enzyme technique. In the short term (5 to 30 seconds) the malic acid was almost exclusively labeled in the C-4 carboxyl carbon (greater than 90%). The percentage of 14C in the C-4 carboxyl of malic acid declined slowly with time, reaching 70% in B. tubiflorum and 54% in B. pinnatum after 14 hours of exposure to 14CO2. It was found that malic acid-adapted Lactobacillus arabinosus may seriously underestimate the C-4 carboxyl component of label in malic acid-14C. The amount of substrate which the bacteria can completely metabolize was easily exceeded; there was a significant level of randomization of label even when ?-decarboxylation proceeded to completion, and in extended incubation periods, more than 25% of label was removed from malic acid-U-14C. The significance of these findings in relation to pathways of carbohydrate metabolism and malic acid synthesis in Crassulacean acid metabolism is discussed.

Sutton, B. G.; Osmond, C. B.

1972-01-01

217

The cycling and oxidation pathways of organic carbon in a shallow estuary along the Texas Gulf Coast  

NASA Astrophysics Data System (ADS)

The cycling and oxidation pathways of organic carbon were investigated at a single shallow water estuarine site in Trinity Bay, Texas, the uppermost lobe of Galveston Bay, during November 2000. Radio-isotopes were used to estimate sediment mixing and accumulation rates, and benthic chamber and pore water measurements were used to determine sediment-water exchange fluxes of oxygen, nutrients and metals, and infer carbon oxidation rates. Using 7Be and 234Th XS, the sediment-mixing coefficient ( Db) was 4.3 ± 1.8 cm 2 y -1, a value that lies at the lower limit for marine environments, indicating that mixing was not important in these sediments at this time. Sediment accumulation rates ( Sa), estimated using 137Cs and 210Pb XS, were 0.16 ± 0.02 g cm -2 y -1. The supply rate of organic carbon to the sediment-water interface was 30 ± 3.9 mmol C m -2 d -1, of which ˜10% or 2.9 ± 0.44 mmol C m -2 d -1was lost from the system through burial below the 1-cm thick surface mixed layer. Measured fluxes of O 2 were 26 ± 3.8 mmol m -2 d -1 and equated to a carbon oxidation rate of 20 ± 3.3 mmol C m -2 d -1, which is an upper limit due to the potential for oxidation of additional reduced species. Using organic carbon gradients in the surface mixed layer, carbon oxidation was estimated at 2.6 ± 1.1 mmol C m -2 d -1. Independent estimates made using pore water concentration gradients of ammonium and C:N stoichiometry, equaled 2.8 ± 0.46 mmol C m -2 d -1. The flux of DOC out of the sediments (DOC efflux) was 5.6 ± 1.3 mmol C m -2 d -1. In general, while mass balance was achieved indicating the sediments were at steady state during this time, changes in environmental conditions within the bay and the surrounding area, mean this conclusion might not always hold. These results show that the majority of carbon oxidation occurred at the sediment-water interface, via O 2 reduction. This likely results from the high frequency of sediment resuspension events combined with the shallow sediment mixing zone, leaving anaerobic oxidants responsible for only ˜10-15% of the carbon oxidized in these sediments.

Warnken, Kent W.; Santschi, Peter H.; Roberts, Kimberly A.; Gill, Gary A.

2008-01-01

218

Temporal and spatial deployment of carbon dioxide capture and storage technologies across the representative concentration pathways  

Microsoft Academic Search

The Intergovernmental Panel on Climate Change’s (IPCC) Fifth Assessment (to be published in 2013–2014) will to a significant degree be built around four Representative Concentration Pathways (RCPs) that are intended to represent four scenarios of future development of greenhouse gas emissions, land use, and concentrations that span the widest range of potential future atmospheric radiative forcing. Under the very stringent

James J. Dooley; Katherine V. Calvin

2011-01-01

219

Trophic structure and pathways of biogenic carbon flow in the eastern North Water Polynya  

NASA Astrophysics Data System (ADS)

In the eastern North Water, most of the estimated annual new and net production of carbon (C) occurred during the main diatom bloom in 1998. During the bloom, at least 30% of total and new phytoplankton production occurred as dissolved organic carbon (DOC) and was unavailable for short-term assimilation into the herbivorous food web or sinking export. Based on particle interceptor traps and 234Th deficits, 27% of the particulate primary production (PP) sank out of the upper 50 m, with only 7% and 1% of PP reaching the benthos at shallow (?200 m) and deep (?500 m) sites, respectively. Mass balance calculations and grazing estimates agree that ?79% of PP was ingested by pelagic consumers between April and July. During this period, the vertical flux of biogenic silica (BioSi) at 50 m was equivalent to the total BioSi produced, indicating that all of the diatom production was removed from the euphotic zone as intact cells (direct sinking) or empty frustules (grazing or lysis). The estimated flux of empty frustules was consistent with rates of herbivory by the large, dominant copepods and appendicularians during incubations. Since the carbon demand of the dominant planktivorous bird, Alle alle, amounted to ?2% of the biomass synthesized by its main prey, the large copepod Calanus hyperboreus, most of the secondary carbon production was available to pelagic carnivores. Stable isotopes indicated that the biomass of predatory amphipods, polar cod and marine mammals was derived from these herbivores, but corresponding carbon fluxes were not quantified. Our analysis shows that a large fraction of PP in the eastern North Water was ingested by consumers in the upper 50 m, leading to substantial carbon respiration and DOC accumulation in surface waters. An increasingly early and prolonged opening of the Artic Ocean is likely to promote the productivity of the herbivorous food web, but not the short-term efficiency of the particulate, biological CO 2 pump.

Tremblay, Jean-Éric; Hattori, Hiroshi; Michel, Christine; Ringuette, Marc; Mei, Zhi-Ping; Lovejoy, Connie; Fortier, Louis; Hobson, Keith A.; Amiel, David; Cochran, Kirk

2006-10-01

220

Mutations in Alternative Carbon Utilization Pathways in Candida albicans Attenuate Virulence and Confer Pleiotropic Phenotypes  

Microsoft Academic Search

The interaction between Candida albicans and cells of the innate immune system is a key determinant of disease progression. Transcriptional profiling has revealed that C. albicans has a complex response to phagocytosis, much of which is similar to carbon starvation. This suggests that nutrient limitation is a significant stress in vivo, and we have shown that glyoxylate cycle mutants are

M. A. Ramirez; Michael C. Lorenz

2007-01-01

221

Stiffness characteristics of composite hybrid external fixators.  

PubMed

New composite hybrid fixators for fracture stabilization using single or multiple rings with monolateral bars and half-pin fixation may provide clinical advantages such as reduced bulk and easier skin access. However, the mechanical properties of these fixators are difficult to estimate from numerous design parameters. Addressing this problem the following research questions were asked: (1) Do composite hybrid fixators have similar stiffness properties to clinically proven triple-ring fixators; (2) How does the fixation mechanism affect the stiffness properties of external fixators, and, (3) Are there interferences between ring number and fixation method? An experimental study was done on simulated metaphyseal tibial fractures and stiffness of 12 fixators was measured for different loading conditions. The results showed that triple-ring fixators provide approximately 20% stiffer properties than double-ring and single-ring fixators. No influence of ring number on the AP bending properties was found and different fixation methods were associated with large differences in fixator stiffness, whereas significant interferences were found between ring number and fixation method. Although the mechanical properties investigated in the current study cannot predict directly the clinical performance of these fixators, the stiffness data provide useful information for making decisions regarding the treatment of fractures using external fixation. PMID:12461383

Windhagen, Henning; Glöckner, Roland; Bail, Hermann; Kolbeck, Stefan; Raschke, Michael

2002-12-01

222

Autotrophic CO2 Fixation by Chloroflexus aurantiacus: Study of Glyoxylate Formation and Assimilation via the 3-Hydroxypropionate Cycle  

PubMed Central

In the facultative autotrophic organism Chloroflexus aurantiacus, a phototrophic green nonsulfur bacterium, the Calvin cycle does not appear to be operative in autotrophic carbon assimilation. An alternative cyclic pathway, the 3-hydroxypropionate cycle, has been proposed. In this pathway, acetyl coenzyme A (acetyl-CoA) is assumed to be converted to malate, and two CO2 molecules are thereby fixed. Malyl-CoA is supposed to be cleaved to acetyl-CoA, the starting molecule, and glyoxylate, the carbon fixation product. Malyl-CoA cleavage is shown here to be catalyzed by malyl-CoA lyase; this enzyme activity is induced severalfold in autotrophically grown cells. Malate is converted to malyl-CoA via an inducible CoA transferase with succinyl-CoA as a CoA donor. Some enzyme activities involved in the conversion of malonyl-CoA via 3-hydroxypropionate to propionyl-CoA are also induced under autotrophic growth conditions. So far, no clue as to the first step in glyoxylate assimilation has been obtained. One possibility for the assimilation of glyoxylate involves the conversion of glyoxylate to glycine and the subsequent assimilation of glycine. However, such a pathway does not occur, as shown by labeling of whole cells with [1,2-13C2]glycine. Glycine carbon was incorporated only into glycine, serine, and compounds that contained C1 units derived therefrom and not into other cell compounds.

Herter, Sylvia; Farfsing, Jan; Gad'On, Nasser; Rieder, Christoph; Eisenreich, Wolfgang; Bacher, Adelbert; Fuchs, Georg

2001-01-01

223

Molecular Biology of Nitrogen Fixation  

ERIC Educational Resources Information Center

Reports that as a result of our increasing knowledge of the molecular biology of nitrogen fixation it might eventually be possible to increase the biological production of nitrogenous fertilizer from atmospheric nitrogen. (GS)

Shanmugam, K. T.; Valentine, Raymond C.

1975-01-01

224

Polymeric Media for Tritium Fixation.  

National Technical Information Service (NTIS)

The synthesis and leach testing of several polymeric media for tritium fixation are presented. Tritiated bakelite, poly(acrylonitrile) and polystyrene successfully fixed tritium. Tritium leach rates at the tracer level appear to be negligible. Advantages ...

J. A. Franz L. L. Burger

1975-01-01

225

Assessment of biological nitrogen fixation  

Microsoft Academic Search

The four commonly used methods for measuring biological nitrogen fixation (BNF) in plants are: the total nitrogen difference (TND) method, acetylene reduction assay (ARA) technique, xylem-solute (or ureide production) method and the use of15N labelled compounds.

S. K. A. Danso

1995-01-01

226

Mandibulotomy fixation: a laboratory analysis  

Microsoft Academic Search

Purpose: Mandibulotomy is an access osteotomy technique associated with significant complications. Critical evaluation of available fixation systems is required to aid in the selection of the most stable fixation method. This study was designed to provide data on the stability of traditionally used plating configurations and a low-profile 2.0-mm locking plate (mandibular locking plate, Synthes MLP; Synthes Maxillofacial, Paoli, PA).Materials

Stephen L Engroff; Remy H Blanchaert; J. Anthony von Fraunhofer

2003-01-01

227

Organic carbon accumulation and metabolic pathways in sediments of mangrove forests in southern Thailand  

Microsoft Academic Search

Rates of organic carbon accumulation, mineralization and burial in sediments were examined during dry and wet seasons in four mangrove forests of a shallow-water embayment (Ao Sawi) in southern Thailand. Mass sediment accumulation (MAR), estimated from 210Pb and 137Cs profiles, was rapid at all forests, ranging from 2.9 to 7.6kgm?2yr?1; mixed layer sediment thicknesses ranged from 16 to 38cm. Total

D. M Alongi; G Wattayakorn; J Pfitzner; F Tirendi; I Zagorskis; G. J Brunskill; A Davidson; B. F Clough

2001-01-01

228

METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS  

SciTech Connect

The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage pathway. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum.

John J. Kilbane III

2003-12-01

229

Metabolic Reconstruction and Modeling of Nitrogen Fixation in Rhizobium etli  

PubMed Central

Rhizobiaceas are bacteria that fix nitrogen during symbiosis with plants. This symbiotic relationship is crucial for the nitrogen cycle, and understanding symbiotic mechanisms is a scientific challenge with direct applications in agronomy and plant development. Rhizobium etli is a bacteria which provides legumes with ammonia (among other chemical compounds), thereby stimulating plant growth. A genome-scale approach, integrating the biochemical information available for R. etli, constitutes an important step toward understanding the symbiotic relationship and its possible improvement. In this work we present a genome-scale metabolic reconstruction (iOR363) for R. etli CFN42, which includes 387 metabolic and transport reactions across 26 metabolic pathways. This model was used to analyze the physiological capabilities of R. etli during stages of nitrogen fixation. To study the physiological capacities in silico, an objective function was formulated to simulate symbiotic nitrogen fixation. Flux balance analysis (FBA) was performed, and the predicted active metabolic pathways agreed qualitatively with experimental observations. In addition, predictions for the effects of gene deletions during nitrogen fixation in Rhizobia in silico also agreed with reported experimental data. Overall, we present some evidence supporting that FBA of the reconstructed metabolic network for R. etli provides results that are in agreement with physiological observations. Thus, as for other organisms, the reconstructed genome-scale metabolic network provides an important framework which allows us to compare model predictions with experimental measurements and eventually generate hypotheses on ways to improve nitrogen fixation.

Resendis-Antonio, Osbaldo; Reed, Jennifer L; Encarnacion, Sergio; Collado-Vides, Julio; Palsson, Bernhard ?

2007-01-01

230

Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds  

SciTech Connect

The objective of the project is to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. The selective cleavage of the second C-N bond has been challenging, and efforts to overcome that challenge have been the focus of recent research in this project. Enrichment culture experiments succeeded in isolating bacterial cultures that can metabolize 2-aminobiphenyl, but no enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl has been identified. Aniline is very similar to the structure of 2-aminobiphenyl and aniline dioxygenase catalyzes the conversion of aniline to catechol and ammonia. For the remainder of the project the emphasis of research will be to simultaneously express the genes for carbazole dioxygenase and for aniline dioxygenase in the same bacterial host and then to select for derivative cultures capable of using carbazole as the sole source of nitrogen.

John J. Kilbane II

2005-10-01

231

Genetic regulation of nitrogen fixation in rhizobia.  

PubMed Central

This review presents a comparison between the complex genetic regulatory networks that control nitrogen fixation in three representative rhizobial species, Rhizobium meliloti, Bradyrhizobium japonicum, and Azorhizobium caulinodans. Transcription of nitrogen fixation genes (nif and fix genes) in these bacteria is induced primarily by low-oxygen conditions. Low-oxygen sensing and transmission of this signal to the level of nif and fix gene expression involve at least five regulatory proteins, FixL, FixJ, FixK, NifA, and RpoN (sigma 54). The characteristic features of these proteins and their functions within species-specific regulatory pathways are described. Oxygen interferes with the activities of two transcriptional activators, FixJ and NifA. FixJ activity is modulated via phosphorylation-dephosphorylation by the cognate sensor hemoprotein FixL. In addition to the oxygen responsiveness of the NifA protein, synthesis of NifA is oxygen regulated at the level of transcription. This type of control includes FixLJ in R. meliloti and FixLJ-FixK in A. caulinodans or is brought about by autoregulation in B. japonicum. NifA, in concert with sigma 54 RNA polymerase, activates transcription from -24/-12-type promoters associated with nif and fix genes and additional genes that are not directly involved in nitrogen fixation. The FixK proteins constitute a subgroup of the Crp-Fnr family of bacterial regulators. Although the involvement of FixLJ and FixK in nifA regulation is remarkably different in the three rhizobial species discussed here, they constitute a regulatory cascade that uniformly controls the expression of genes (fixNOQP) encoding a distinct cytochrome oxidase complex probably required for bacterial respiration under low-oxygen conditions. In B. japonicum, the FixLJ-FixK cascade also controls genes for nitrate respiration and for one of two sigma 54 proteins. Images

Fischer, H M

1994-01-01

232

METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS  

SciTech Connect

The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project was focused on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate deaminase. The objective of the final phase of the project will be to develop derivative C-N bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments resulted in the isolation of microbial cultures that utilize aromatic amides as sole nitrogen sources, several amidase genes were cloned and were included in directed evolution experiments to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. During the second year of the project (October, 2003-September, 2004) enrichment culture experiments succeeded in isolating a mixed bacterial culture that can utilize 2-aminobiphenyl as a sole nitrogen source, directed evolution experiments were focused on the aniline dioxygenase enzyme that is capable of deaminating aniline, and expression vectors were constructed to enable the expression of genes encoding C-N bond cleaving enzymes in Rhodococcus hosts. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the poisoning, by nitrogen, of catalysts used in the hydrotreating and catalytic cracking of petroleum. Aromatic compounds such as carbazole are representative of the difficult-to-treat organonitrogen compounds most commonly encountered in petroleum. There are two C-N bonds in carbazole and the construction of a metabolic pathway for the removal of nitrogen from carbazole will require enzymes capable cleaving both C-N bonds. A multi-component enzyme, carbazole dioxygenase, which can selectively cleave the first C-N bond has been identified and the genes that encode this enzyme have been cloned, sequenced, and are being expressed in Rhodococcus erythropolis, a bacterial culture that tolerates exposure to petroleum. An enzyme capable of selectively cleaving the second C-N bond in carbazole has not yet been identified, but enrichment culture experiments have recently succeeded in isolating a bacterial culture that is a likely candidate and may possess a suitable enzyme. Research in the near future will verify if a suitable enzyme for the cleavage of the second C-N bond in carbazole has indeed been found, then the genes encoding a suitable enzyme will be identified, cloned, and sequenced. Ultimately genes encoding enzymes for selective cleavage of both C-N bonds in carbazole will be assembled into a new metabolic pathway and the ability of the resulting bacterial culture to remove nitrogen from petroleum will be determined.

John J. Kilbane II

2004-10-01

233

Perspectives on Marine Nitrogen Fixation  

NASA Astrophysics Data System (ADS)

The importance of nitrogen fixation in ocean biogeochemistry has only recently come to be fully appreciated. As biological nitrogen fixation was being uncovered in terrestrial ecosystems (late 1800s), some ocean surveys were mapping the large-scale distribution of important planktonic diazotrophs, such as the cyanobacterium Trichodesmium, unaware of their functional significance. Early marine N biogeochemists speculated that nitrogen fixation was largely confined to the terrestrial realm, with combined nitrogen being transferred to the ocean from land, there to be taken up by phytoplankton or denitrified. Later, A. Redfield invoked nitrogen fixation as a mechanism to prevent N limitation in the sea. Systematic studies of nitrogen fixation started rolling in the 1960s with the introduction of enriched 15N tracer methodology by R. Dugdale and his associates and, subsequently, with the introduction of a simple field assay for this activity. While results from field studies in the 1980s, largely limited to mid-latitudes and marginal tropical and subtropical seas, also indicated a relatively limited role for nitrogen fixation, several lines of geochemical evidence emerged in the late 1990s which suggested otherwise. This prompted a resurgence in field efforts examining this process which in turn provided direct evidence to support the biogeochemical significance of nitrogen fixation in the oligotrophic ocean. Research in this area continues to move rapidly. The infusion of molecular biological methods also provided new tools to explore and appreciate the real diversity of marine diazotrophs. Many current biogeochemical models incorporate nitrogen fixation as an explicit function providing input of new reactive nitrogen into marine ecosystems. However, there are still major puzzles to be solved. Two current and related conundrums are whether denitrification and nitrogen fixation are near balance in the current ocean, and how closely they are coupled. Recent experimental and modeling results suggests diazotrophs, which are not limited by nitrogen availability, may be limited by other macro and micronutrient factors in different ocean basins. Finally, atmospheric N deposition to the ocean is rapidly accelerating and will soon exceed current estimates of oceanic nitrogen fixation.

Capone, D. G.

2008-05-01

234

Specific inhibitors for identifying pathways for methane production from carbon monoxide by a nonadapted anaerobic mixed culture.  

PubMed

Specific inhibitors such as 2-bromoethanesulfonate (BES) and vancomycin were employed in activity batch tests to decipher metabolic pathways that are preferentially used by a mixed anaerobic consortium (sludge from an anaerobic digester) to transform carbon monoxide (CO) into methane (CH4). We first evaluated the inhibitory effect of both BES and vancomycin on the microbial community, as well as the efficiency and stability of vancomycin at 35 °C, over time. The activity tests with CO2-H2, CO, glucose, acetate, formate, propionate, butyrate, methanol, and ethanol showed that vancomycin does not inhibit some Gram-negative bacteria, and 50 mmol/L BES effectively blocks CH4 production in the sludge. However, when sludge was incubated with propionate, butyrate, methanol, or ethanol as the sole energy and carbon source, methanogenesis was only partially inhibited by BES. Separate tests showed that 0.07 mmol/L vancomycin is enough to maintain its inhibitory efficiency and stability in the population for at least 32 days at 35 °C. Using the inhibitors above, it was demonstrated that CO conversion to CH4 is an indirect, 2-step process, in which the CO is converted first to acetate and subsequently to CH4. PMID:24896194

Navarro, Silvia Sancho; Cimpoia, Ruxandra; Bruant, Guillaume; Guiot, Serge R

2014-06-01

235

Carbon isotopic composition of individual Precambrian microfossils  

NASA Technical Reports Server (NTRS)

Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the approximately 850 Ma Bitter Springs Formation, Australia, and the approximately 2100 Ma Gunflint Formation, Canada. The delta 13C(PDB) values from individual microfossils of the Bitter Springs Formation ranged from -21.3 +/- 1.7% to -31.9 +/- 1.2% and the delta 13C(PDB) values from microfossils of the Gunflint Formation ranged from -32.4 +/- 0.7% to -45.4 +/- 1.2%. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

House, C. H.; Schopf, J. W.; McKeegan, K. D.; Coath, C. D.; Harrison, T. M.; Stetter, K. O.

2000-01-01

236

Carbon isotopic composition of individual Precambrian microfossils  

NASA Astrophysics Data System (ADS)

Ion microprobe measurements of carbon isotope ratios were made in 30 specimens representing six fossil genera of microorganisms petrified in stromatolitic chert from the ˜850 Ma Bitter Springs Formation, Australia, and the ˜2100 Ma Gunflint Formation, Canada. The ?13CPDB values from individual microfossils of the Bitter Springs Formation ranged from -21.3 ± 1.7‰ to -31.9 ± 1.2‰, and the ?13CPDB values from microfossils of the Gunflint Formation ranged from -32.4 ± 0.7‰ to -45.4 ± 1.2‰. With the exception of two highly 13C-depleted Gunflint microfossils, the results generally yield values consistent with carbon fixation via either the Calvin cycle or the acetyl-CoA pathway. However, the isotopic results are not consistent with the degree of fractionation expected from either the 3-hydroxypropionate cycle or the reductive tricarboxylic acid cycle, suggesting that the microfossils studied did not use either of these pathways for carbon fixation. The morphologies of the microfossils suggest an affinity to the cyanobacteria, and our carbon isotopic data are consistent with this assignment.

House, Christopher H.; Schopf, J. William; McKeegan, Kevin D.; Coath, Christopher D.; Harrison, T. Mark; Stetter, Karl O.

2000-08-01

237

Nitrogen fixation in boreal peatlands: the effects of increased N deposition on N2-fixation  

NASA Astrophysics Data System (ADS)

Boreal peatlands are of great importance to global carbon and nitrogen cycling. While covering only 3-4 % of the terrestrial surface, they account for 25-30 % of the world's soil C and 9-15 % of the world's soil N. In Western Canada atmospheric dry deposition rates are extremely low: approximately 1 kg N ha-1 yr-1. Though these systems have been functioning as net sinks over the past 11,000 years, natural and anthropogenic disturbances might compromise the historical balance of C and N. Biological N2-fixation has recently been shown to represent a very significant input of N into these systems, contributing to 62% of total N in Western Canada. Interactions between N deposition and biological N2-fixation are as yet, unknown, but the impact of elevated deposition of N-compounds from increased industrial expansion of oil sands mining to peatlands, is concerning. Given that nitrogenase, the enzyme responsible for catalyzing N2-fixation, is energetically costly when active, enhanced inputs of atmospheric N deposition could be a major determinant for enzyme activity and rates of biological N input to these bogs. Understanding interactions between N deposition and N2 fixation in boreal peatlands can aid in predicting the consequences of increased N deposition and setting critical loads. We conducted a field-fertilization experiment in a poor fen in Alberta, Canada, to determine the effects of enhanced N deposition on a dominant fen species Sphagnum angustifolium. The experiment consisted of seven N treatments: Control, 0, 5, 10, 15, 20 and 25 kg N ha-1 y1, n=3. N2-fixation was measured during summer 2012 and 2013 using the acetylene reduction assay (ARA). ARA rates were converted to rates of N2-fixation by calibrating ARA with paired 15N2-incubations. In both 2012 and 2013, with increasing N deposition from 0 kg N ha-1 yr-1 to 25 kg N ha-1 yr-1, rates of N2 fixation decreased, with highest rates in the 0 kg N ha-1 yr-1 treatment mosses (54.2 × 1.40; 48.58 × 7.12 kg N ha-1 yr-1, mean × std err for 2012 and 2013, respectively) followed by progressively lower rates with a low of 5.02 × 0.87 in 2012 and 8.94 × 3.09 in 2013 (mean × std err). As biological N2-fixation is an energetically costly process, up-regulating enzyme activity when N availability is low and down-regulating activity when N deposition is enhanced makes thermodynamic and evolutionary sense. N2-fixation shows to be one of the most early-warning indicators to the early response of boreal peatlands to increased N deposition, and can aid in setting critical loads to protect these historically pristine ecosystems.

Popma, J. M.; Wieder, R.; Lamers, L.; Vile, M. A.

2013-12-01

238

Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways.  

National Technical Information Service (NTIS)

Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detect...

A. S. Burton D. P. Glavin J. E. Elsila J. P. Dworkin S. B. Charnley

2012-01-01

239

NMR-spectroscopic evidence of intermediate-dependent pathways for acetic acid formation from methane and carbon monoxide over a ZnZSM-5 zeolite catalyst.  

PubMed

Two ways: a Zn-modified ZSM-5 zeolite catalyst was developed for the reaction of methane with carbon monoxide to directly produce acetic acid under mild conditions (573-623 K), and two different intermediate-dependent reaction pathways were unambiguously identified for acetic acid formation by in situ solid-state NMR spectroscopy. PMID:22389151

Wang, Xiumei; Qi, Guodong; Xu, Jun; Li, Bojie; Wang, Chao; Deng, Feng

2012-04-16

240

Photosynthetic and dark carbon metabolism in unicellular blue-green algae  

Microsoft Academic Search

0946 091.The kinetics of 14CO2 incorporation into cellular intermediates was used to determine the primary pathway of carbon fixation by four genetically diverse unicellular blue-green algae. In each case label was first detected in 3-phosphoglycerate and then in compounds of the reductive pentose cycle.2.A light to dark transition evoked the same response in all four strains: Immediate cessation of biosynthesis,

R. A. Pelroy; J. A. Bassham

1972-01-01

241

Mineral-assisted pathways in prebiotic synthesis: photoelectrochemical reduction of carbon(+IV) by manganese sulfide.  

PubMed

Photoelectrochemistry on mineral surfaces has the potential to play a central role in the prebiotic syntheses of building blocks for biomolecules. In this study, photoreduction of C(+IV) as bicarbonate is used as a probe to investigate the photoelectrochemical properties of alabandite (MnS) colloidal particles. Our experimental results show that photoreduction occurs and that formate is the initial photoproduct. A quantum efficiency of 4.2% is obtained (pH = 7.5). The quantum efficiency is temperature-independent from 298 to 328 K. In addition to formate, longer chain carbon products are also produced. Ion chromatography shows the presence of acetate and propionate. Infrared spectroscopy and mass spectrometry indicate the formation of longer chain organic molecules that contain oxygenated functional groups. Our results suggest that some prebiotic syntheses could have occurred via photoelectrochemical reactions on semiconducting minerals. PMID:15355106

Zhang, Xiang V; Martin, Scot T; Friend, Cynthia M; Schoonen, Martin A A; Holland, Heinrich D

2004-09-15

242

Femoral Reconstruction Using External Fixation  

PubMed Central

Background. The use of an external fixator for the purpose of distraction osteogenesis has been applied to a wide range of orthopedic problems caused by such diverse etiologies as congenital disease, metabolic conditions, infections, traumatic injuries, and congenital short stature. The purpose of this study was to analyze our experience of utilizing this method in patients undergoing a variety of orthopedic procedures of the femur. Methods. We retrospectively reviewed our experience of using external fixation for femoral reconstruction. Three subgroups were defined based on the primary reconstruction goal lengthening, deformity correction, and repair of nonunion/bone defect. Factors such as leg length discrepancy (LLD), limb alignment, and external fixation time and complications were evaluated for the entire group and the 3 subgroups. Results. There was substantial improvement in the overall LLD, femoral length discrepancy, and limb alignment as measured by mechanical axis deviation (MAD) and lateral distal femoral angle (LDFA) for the entire group as well as the subgroups. Conclusions. The Ilizarov external fixator allows for decreased surgical exposure and preservation of blood supply to bone, avoidance of bone grafting and internal fixation, and simultaneous lengthening and deformity correction, making it a very useful technique for femoral reconstruction.

Palatnik, Yevgeniy; Rozbruch, S. Robert

2011-01-01

243

Lumped pathway metabolic model of organic carbon accumulation and mobilization by the alga Chlamydomonas reinhardtii.  

PubMed

Phototrophic microorganisms have significant potential as bioenergy feedstocks, but the sustainability of large-scale cultivation will require the use of wastewater as a renewable resource. A key barrier to this advancement is a lack of bioprocess understanding that would enable the design and implementation of efficient and resilient mixed community, naturally lit cultivation systems. In this study, a lumped pathway metabolic model (denoted the phototrophic process model or PPM) was developed for mixed phototrophic communities subjected to day/night cycling. State variables included functional biomass (XCPO), stored carbohydrates (XCH), stored lipids (XLI), nitrate (SNO), phosphate (SP), and others. PPM metabolic reactions and stoichiometry were based on Chlamydomonas reinhardtii , but experiments for model calibration and validation were performed in flat panel photobioreactors (PBRs) originally inoculated with biomass from a phototrophic system at a wastewater treatment plant. PBRs were operated continuously as cyclostats to poise cells for intrinsic kinetic parameter estimation in batch studies, which included nutrient-available conditions in light and dark as well as nitrogen-starved and phosphorus-starved conditions in light. The model was calibrated and validated and was shown to be a reasonable predictor of growth, lipid and carbohydrate storage, and lipid and carbohydrate mobilization by a mixed microbial community. PMID:23452258

Guest, Jeremy S; van Loosdrecht, Mark C M; Skerlos, Steven J; Love, Nancy G

2013-04-01

244

An integrated genetic, genomic and systems approach defines gene networks regulated by the interaction of light and carbon signaling pathways in Arabidopsis  

PubMed Central

Background Light and carbon are two important interacting signals affecting plant growth and development. The mechanism(s) and/or genes involved in sensing and/or mediating the signaling pathways involving these interactions are unknown. This study integrates genetic, genomic and systems approaches to identify a genetically perturbed gene network that is regulated by the interaction of carbon and light signaling in Arabidopsis. Results Carbon and light insensitive (cli) mutants were isolated. Microarray data from cli186 is analyzed to identify the genes, biological processes and gene networks affected by the integration of light and carbon pathways. Analysis of this data reveals 966 genes regulated by light and/or carbon signaling in wild-type. In cli186, 216 of these light/carbon regulated genes are misregulated in response to light and/or carbon treatments where 78% are misregulated in response to light and carbon interactions. Analysis of the gene lists show that genes in the biological processes "energy" and "metabolism" are over-represented among the 966 genes regulated by carbon and/or light in wild-type, and the 216 misregulated genes in cli186. To understand connections among carbon and/or light regulated genes in wild-type and the misregulated genes in cli186, the microarray data is interpreted in the context of metabolic and regulatory networks. The network created from the 966 light/carbon regulated genes in wild-type, reveals that cli186 is affected in the light and/or carbon regulation of a network of 60 connected genes, including six transcription factors. One transcription factor, HAT22 appears to be a regulatory "hub" in the cli186 network as it shows regulatory connections linking a metabolic network of genes involved in "amino acid metabolism", "C-compound/carbohydrate metabolism" and "glycolysis/gluconeogenesis". Conclusion The global misregulation of gene networks controlled by light and carbon signaling in cli186 indicates that it represents one of the first Arabidopsis mutants isolated that is specifically disrupted in the integration of both carbon and light signals to control the regulation of metabolic, developmental and regulatory genes. The network analysis of misregulated genes suggests that CLI186 acts to integrate light and carbon signaling interactions and is a master regulator connecting the regulation of a host of downstream metabolic and regulatory processes.

Thum, Karen E; Shin, Michael J; Gutierrez, Rodrigo A; Mukherjee, Indrani; Katari, Manpreet S; Nero, Damion; Shasha, Dennis; Coruzzi, Gloria M

2008-01-01

245

Reaction of benzene with atomic carbon: pathways to fulvenallene and the fulvenallenyl radical in extraterrestrial atmospheres and the interstellar medium.  

PubMed

The reaction of benzene with ground-state atomic carbon, C((3)P), has been investigated using the G3X-K composite quantum chemical method. A suite of novel energetically favorable pathways that lead to previously unconsidered products are identified. Reaction is initiated by barrierless C atom cycloaddition to benzene on the triplet surface, producing a vibrationally excited [C7H6]* adduct that can dissociate to the cycloheptatrienyl radical (+ H) via a relatively loose transition state 4.4 kcal mol(-1) below the reactant energies. This study also identifies that this reaction adduct can isomerize to generate five-membered ring intermediates that can further dissociate to the global C7H5 minima, the fulvenallenyl radical (+ H), or to c-C5H4 and acetylene, with limiting barriers around 20 and 10 kcal mol(-1) below the reactants, respectively. If intersystem crossing to the singlet surface occurs, isomerization pathways that are lower-yet in energy are available leading to the C7H6 minima fulvenallene, with all barriers over 40 kcal mol(-1) below the reactants. From here further barrierless fragmentation to fulvenallenyl + H can proceed at ca. 25 kcal mol(-1) below the reactants. In the reducing atmospheres of planets like Jupiter and satellites like Titan, where benzene and C((3)P) are both expected, it is proposed that fulvenallene and the fulvenallenyl radical would be the dominant products of the C6H6 + C((3)P) reaction. Fulvenallenyl may also be a significant reaction product under collision-free conditions representative of the interstellar medium, although further work is required here to confirm the identity of the C7H5 radical product. PMID:24828689

da Silva, Gabriel

2014-06-01

246

System-based Identification of Toxicity Pathways Associated With Multi-Walled Carbon Nanotube-Induced Pathological Responses  

PubMed Central

The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 µg MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and were used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts.

Snyder-Talkington, Brandi N.; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R.; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L.

2014-01-01

247

NCI-Frederick PHL - Fixatives and Solutions  

Cancer.gov

Services Price List Courier Services & Shipment Procedures Scheduling Contact Information Related Links Establishing an Account PHL Forms PHL Portal Fixatives and Solutions Routine fixatives: 10% Neutral Buffered Formalin (NBF) 37 - 40% Formaldehyde………………………………………1000mL distilled

248

Homogeneous redox catalysis on co(2) fixation.  

National Technical Information Service (NTIS)

The twin problems of global warming and diminishing finite fossil fuels resources have stimulated research into CO2 fixation and utilization. Natural photosynthetic CO2 fixation utilizes sunlight and chlorophyll as the energy source and photocatalyst to g...

E. Fujita

2000-01-01

249

Nitrogen fixation in Clear Lake, California.II. Synoptic studies on the autumn Anabaena bloom  

Microsoft Academic Search

Nitrogen fixation at three stages of an autumnal bloom of Anabaena circinulis was mea- sured after almost simultaneous collection at up to 32 stations in Clear Lake and algal hetcrocysts, phytoplankton cell numbers, NO,-N, NIL-N, dissolved organic-N, POh-P, Fe, primary production, particulate carbon, and chlorophyll a were also measured. Nitrogen fixation was significantly and positively correlated to Anabaena heterocyst numbers

ALEXANDER J. HORNE; J. E. DILLARD; D. K. FUJITA; C. R. GOLDMAN

1972-01-01

250

Characterization of the oxygen tolerance of a hydrogenase linked to a carbon monoxide oxidation pathway in Rubrivivax gelatinosus.  

PubMed

A hydrogenase linked to the carbon monoxide oxidation pathway in Rubrivivax gelatinosus displays tolerance to O2. When either whole-cell or membrane-free partially purified hydrogenase was stirred in full air (21% O2, 79% N2), its H2 evolution activity exhibited a half-life of 20 or 6 h, respectively, as determined by an anaerobic assay using reduced methyl viologen. When the partially purified hydrogenase was stirred in an atmosphere containing either 3.3 or 13% O2 for 15 min and evaluated by a hydrogen-deuterium (H-D) exchange assay, nearly 80 or 60% of its isotopic exchange rate was retained, respectively. When this enzyme suspension was subsequently returned to an anaerobic atmosphere, more than 90% of the H-D exchange activity was recovered, reflecting the reversibility of this hydrogenase toward O2 inactivation. Like most hydrogenases, the CO-linked hydrogenase was extremely sensitive to CO, with 50% inhibition occurring at 3.9 microM dissolved CO. Hydrogen production from the CO-linked hydrogenase was detected when ferredoxins of a prokaryotic source were the immediate electron mediator, provided they were photoreduced by spinach thylakoid membranes containing active water-splitting activity. Based on its appreciable tolerance to O2, potential applications of this hydrogenase are discussed. PMID:12039713

Maness, Pin-Ching; Smolinski, Sharon; Dillon, Anne C; Heben, Michael J; Weaver, Paul F

2002-06-01

251

Carbon Monoxide Signaling in Human Red Blood Cells: Evidence for Pentose Phosphate Pathway Activation and Protein Deglutathionylation  

PubMed Central

Abstract Aims: The biochemistry underlying the physiological, adaptive, and toxic effects of carbon monoxide (CO) is linked to its affinity for reduced transition metals. We investigated CO signaling in the vasculature, where hemoglobin (Hb), the CO most important metal-containing carrier is highly concentrated inside red blood cells (RBCs). Results: By combining NMR, MS, and spectrophotometric techniques, we found that CO treatment of whole blood increases the concentration of reduced glutathione (GSH) in RBC cytosol, which is linked to a significant Hb deglutathionylation. In addition, this process (i) does not activate glycolytic metabolism, (ii) boosts the pentose phosphate pathway (PPP), (iii) increases glutathione reductase activity, and (iv) decreases oxidized glutathione concentration. Moreover, GSH concentration was partially decreased in the presence of 2-deoxyglucose and the PPP antagonist dehydroepiandrosterone. Our MS results show for the first time that, besides Cys93, Hb glutathionylation occurs also at Cys112 of the ?-chain, providing a new potential GSH source hitherto unknown. Innovation: This work provides new insights on the signaling and antioxidant-boosting properties of CO in human blood, identifying Hb as a major source of GSH release and the PPP as a metabolic mechanism supporting Hb deglutathionylation. Conclusions: CO-dependent GSH increase is a new RBC process linking a redox-inactive molecule, CO, to GSH redox signaling. This mechanism may be involved in the adaptive responses aimed to counteract stress conditions in mammalian tissues. Antioxid. Redox Signal. 20, 403–416.

Metere, Alessio; Iorio, Egidio; Scorza, Giuseppe; Camerini, Serena; Casella, Marialuisa; Crescenzi, Marco; Minetti, Maurizio

2014-01-01

252

Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre  

PubMed Central

Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N2-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N2-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200?m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of 15N-labeled ammonium and leucine in our incubation experiments. N2-fixation was detectable throughout the upper 200?m at most stations, with rates ranging from 0.001 to 0.19?nM?N?h?1. N2-fixation in the SPG may account for the production of 8–20% of global oceanic new nitrogen. Interestingly, comparable 15N2-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited.

Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel MM

2012-01-01

253

Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre.  

PubMed

Oceanic subtropical gyres are considered biological deserts because of the extremely low availability of nutrients and thus minimum productivities. The major source of nutrient nitrogen in these ecosystems is N(2)-fixation. The South Pacific Gyre (SPG) is the largest ocean gyre in the world, but measurements of N(2)-fixation therein, or identification of microorganisms involved, are scarce. In the 2006/2007 austral summer, we investigated nitrogen and carbon assimilation at 11 stations throughout the SPG. In the ultra-oligotrophic waters of the SPG, the chlorophyll maxima reached as deep as 200 m. Surface primary production seemed limited by nitrogen, as dissolved inorganic carbon uptake was stimulated upon additions of (15)N-labeled ammonium and leucine in our incubation experiments. N(2)-fixation was detectable throughout the upper 200 m at most stations, with rates ranging from 0.001 to 0.19 nM N h(-1). N(2)-fixation in the SPG may account for the production of 8-20% of global oceanic new nitrogen. Interestingly, comparable (15)N(2)-fixation rates were measured under light and dark conditions. Meanwhile, phylogenetic analyses for the functional gene biomarker nifH and its transcripts could not detect any common photoautotrophic diazotrophs, such as, Trichodesmium, but a prevalence of ?-proteobacteria and the unicellular photoheterotrophic Group A cyanobacteria. The dominance of these likely heterotrophic diazotrophs was further verified by quantitative PCR. Hence, our combined results show that the ultra-oligotrophic SPG harbors a hitherto unknown heterotrophic diazotrophic community, clearly distinct from other oceanic gyres previously visited. PMID:22170429

Halm, Hannah; Lam, Phyllis; Ferdelman, Timothy G; Lavik, Gaute; Dittmar, Thorsten; LaRoche, Julie; D'Hondt, Steven; Kuypers, Marcel M M

2012-06-01

254

Changes in North Atlantic nitrogen fixation controlled by ocean circulation.  

PubMed

In the ocean, the chemical forms of nitrogen that are readily available for biological use (known collectively as 'fixed' nitrogen) fuel the global phytoplankton productivity that exports carbon to the deep ocean. Accordingly, variation in the oceanic fixed nitrogen reservoir has been proposed as a cause of glacial-interglacial changes in atmospheric carbon dioxide concentration. Marine nitrogen fixation, which produces most of the ocean's fixed nitrogen, is thought to be affected by multiple factors, including ocean temperature and the availability of iron and phosphorus. Here we reconstruct changes in North Atlantic nitrogen fixation over the past 160,000?years from the shell-bound nitrogen isotope ratio ((15)N/(14)N) of planktonic foraminifera in Caribbean Sea sediments. The observed changes cannot be explained by reconstructed changes in temperature, the supply of (iron-bearing) dust or water column denitrification. We identify a strong, roughly 23,000-year cycle in nitrogen fixation and suggest that it is a response to orbitally driven changes in equatorial Atlantic upwelling, which imports 'excess' phosphorus (phosphorus in stoichiometric excess of fixed nitrogen) into the tropical North Atlantic surface. In addition, we find that nitrogen fixation was reduced during glacial stages 6 and 4, when North Atlantic Deep Water had shoaled to become glacial North Atlantic intermediate water, which isolated the Atlantic thermocline from excess phosphorus-rich mid-depth waters that today enter from the Southern Ocean. Although modern studies have yielded diverse views of the controls on nitrogen fixation, our palaeobiogeochemical data suggest that excess phosphorus is the master variable in the North Atlantic Ocean and indicate that the variations in its supply over the most recent glacial cycle were dominated by the response of regional ocean circulation to the orbital cycles. PMID:23965620

Straub, Marietta; Sigman, Daniel M; Ren, Haojia; Martínez-García, Alfredo; Meckler, A Nele; Hain, Mathis P; Haug, Gerald H

2013-09-12

255

Tricorrectional bunionectomy with AO screw fixation.  

PubMed

A 16-month preliminary study was performed on 58 patients for corrective surgery of hallux abducto valgus, with AO4 screw fixation. The procedure is a modification of the bi-plane Austin procedure, called a tricorrectional bunionectomy. The authors present the procedure with objective and subjective findings. The principles of bone healing and internal fixation using AO screw fixation are discussed. PMID:2625507

Boggs, S I; Selner, A J; Roth, I E; Bernstein, A L

1989-01-01

256

Methacarn (methanol-Carnoy) fixation  

Microsoft Academic Search

According to chemical data, methanol raises the shrinkage temperature of collagen significantly more than ethanol (86° C versus 70° C). Since increase of shrinkage temperature appears desirable in tissues to be embedded in paraffin, methanol was substituted for ethanol in Carnoy's fluid. This methanol-Carnoy mixture is referred to as methacarn solution. The fixation-embedding procedure was similar to that described in

Holde Puchtler; Faye Sweat Waldrop; Susan N. Meloan; Mary S. Terry; H. M. Conner

1970-01-01

257

Complications of Rigid Internal Fixation  

PubMed Central

Over the past 20 years, there have been many advances in the development of bone fixation systems used in the practice of craniomaxillofacial surgery. As surgical practices have evolved, the complications of each technologic advance have changed accordingly. Interfragmentary instability of interosseous wiring has been replaced by the risk of exposure, infection, and palpability of plate and screw fixation systems. The improved rigidity of plate fixation requires anatomic alignment of fracture fragments. Failure to obtain proper alignment has led to the phenomenon known as “open internal fixation” of fracture fragments without proper reduction. The size of the plates has decreased to minimize palpability and exposure. However limitations in their application have been encountered due to the physiologic forces of the muscles of mastication and bone healing. In the pediatric population, the long-standing presence of plates in the cranial vault resulted in reports of transcranial migration and growth restriction. These findings led to the development of resorbable plating systems, which are associated with self-limited plate palpability and soft tissue inflammatory reactions. Any rigid system including these produces growth restriction in varying amounts. In this discussion, we review the reported complication rates of miniplating and microplating systems as well as absorptive plating systems in elective and traumatic craniofacial surgery.

Campbell, Chris A.; Lin, Kant Y.

2009-01-01

258

[Gerhard Küntscher and intramedullary fixation].  

PubMed

Gerhard Küntscher, a German surgeon, was born in Zwickau in 1900. He graduated from the School of Medicine in Jena in 1926. He is renowned for the development of intramedullary fixation as a solution for fixation of fractures in the long bones. He worked in the Freiburg and Hamburg hospitals, but gained most experience during the Second World War, when he was on the Eastern front. In the period 1943-1944, he was the chief surgeon in the German military hospital in Kemio (Finland). After the war, he worked in hospitals is Schleswig and Hamburg until his retirement in 1965. He introduced the method of percutaneous intramedullary nailing in the femur fractures, as well as the interlocking nail, nail fixation of the pertrochanteric fractures and nails for intramedullary osteotomy. He published over 200 papers and 4 books. In his papers, he was often ahead of his time, and today is considered one of the founders of the concept of intramedullary fixation in fractures. PMID:18088049

Lesi?, Aleksandar; Bumbasirevi?, Marko; Milosevi?, Ivan; Zagorac, Slavisa

2007-01-01

259

Options for acetabular fixation surfaces.  

PubMed

Aseptic loosening is the most common cause for revision total hip arthroplasty (THA). Due to poor long-term results with cemented acetabular components, cementless implants that rely on biologic fixation became popular in the United States for both primary and revision procedures in the early 1980s. Cementless acetabular components used in THA have been reported to have superior radiographic performance compared with cemented fixation, although the optimal method of acetabular fixation remains controversial. Cementless acetabular components require initial implant stability to allow for bone ingrowth and remodeling into the acetabular shell, providing long-term durability of the prosthesis. Many improved implant materials are available to facilitate bone growth and remodeling, including the 3 most common surface treatments; fibermesh, sintered beads, and plasma spray coatings. Recently added to these are porous metal surfaces, which have increased porosity and optimal pore sizes when compared with titanium fibermesh. The most studied of these materials is the titanium fibermesh fixation surface, which has demonstrated a mechanical failure rate of 1% at 10 to 15 years. This technology utilizes the diffusion bonding process to attach fiber metal pads to a titanium substrate using heat and pressure. The sintered bead fixation surface offers a porous coating of various sizes of spherical beads, achieved by the sintering process, and has been shown to provide long-term fixation. While there are less long-term published data regarding the titanium plasma spray surface, its early results have provided evidence of its durability, even in the face of significant osteolysis. The most recently added alternative fixation surface is porous tantalum metal, which offers potentially greater bone ingrowth and bone graft incorporation due to its high porosity (80%) and low modulus of elasticity (3 MPa). Porous tantalum implants have shown early favorable clinical results and have been reported to have excellent bone graft incorporation of the acetabular component based on serial radiograph data at a minimum 1-year follow-up. Tritanium is a porous metal, which has emerged as a promising new surface technology for acetabular shells. While no clinical data are yet available, basic science research has demonstrated enhanced bone ingrowth and mechanical strength. PMID:19023943

Klika, Alison K; Murray, Trevor G; Darwiche, Hussein; Barsoum, Wael K

2007-01-01

260

Life in hot acid: Pathway analyses in extremely thermoacidophilic archaea  

PubMed Central

SUMMARY The extremely thermoacidophilic archaea are a particularly intriguing group of microorganisms that must simultaneously cope with biologically extreme pHs (? 4) and temperatures (Topt ? 60°C) in their natural environments. Their expandi ng biotechnological significance relates to their role in biomining of base and precious metals and their unique mechanisms of survival in hot acid, at both the cellular and biomolecular levels. Recent developments, such as advances in understanding of heavy metal tolerance mechanisms, implementation of a genetic system, and discovery of a new carbon fixation pathway, have been facilitated by availability of genome sequence data and molecular genetic systems. As a result, new insights into the metabolic pathways and physiological features that define extreme thermoacidophily have been obtained, in some cases suggesting prospects for biotechnological opportunities.

Auernik, Kathryne S.; Cooper, Charlotte R.; Kelly, Robert M.

2013-01-01

261

Carbon assimilation pathways in sulfate-reducing bacteria II. Enzymes of a reductive citric acid cycle in the autotrophic Desulfobacter hydrogenophilus  

Microsoft Academic Search

The strict anaerobe Desulfobacter hydrogenophilus is able to grow autotrophically with CO2, H2, and sulfate as sole carbon and energy sources. The generation time at 30°C under autotrophic conditions in a pure mineral medium was 15 h, the growth yield was 8 g cell dry mass per mol sulfate reduced to H2S. Enzymes of the autotrophic CO2 assimilation pathway were

R. Schauder; F. Widdel; G. Fuchs

1987-01-01

262

Metabolite profile analysis reveals functional effects of 28-day vitamin B-6 restriction on one-carbon metabolism and tryptophan catabolic pathways in healthy men and women.  

PubMed

Suboptimal vitamin B-6 status, as reflected by low plasma pyridoxal 5'-phosphate (PLP) concentration, is associated with increased risk of vascular disease. PLP plays many roles, including in one-carbon metabolism for the acquisition and transfer of carbon units and in the transsulfuration pathway. PLP also serves as a coenzyme in the catabolism of tryptophan. We hypothesize that the pattern of these metabolites can provide information reflecting the functional impact of marginal vitamin B-6 deficiency. We report here the concentration of major constituents of one-carbon metabolic processes and the tryptophan catabolic pathway in plasma from 23 healthy men and women before and after a 28-d controlled dietary vitamin B-6 restriction (<0.35 mg/d). liquid chromatography-tandem mass spectrometry analysis of the compounds relevant to one-carbon metabolism showed that vitamin B-6 restriction yielded increased cystathionine (53% pre- and 76% postprandial; P < 0.0001) and serine (12% preprandial; P < 0.05), and lower creatine (40% pre- and postprandial; P < 0.0001), creatinine (9% postprandial; P < 0.05), and dimethylglycine (16% postprandial; P < 0.05) relative to the vitamin B-6-adequate state. In the tryptophan pathway, vitamin B-6 restriction yielded lower kynurenic acid (22% pre- and 20% postprandial; P < 0.01) and higher 3-hydroxykynurenine (39% pre- and 34% postprandial; P < 0.01). Multivariate ANOVA analysis showed a significant global effect of vitamin B-6 restriction and multilevel partial least squares-discriminant analysis supported this conclusion. Thus, plasma concentrations of creatine, cystathionine, kynurenic acid, and 3-hydroxykynurenine jointly reveal effects of vitamin B-6 restriction on the profiles of one-carbon and tryptophan metabolites and serve as biomarkers of functional effects of marginal vitamin B-6 deficiency. PMID:23966327

da Silva, Vanessa R; Rios-Avila, Luisa; Lamers, Yvonne; Ralat, Maria A; Midttun, Øivind; Quinlivan, Eoin P; Garrett, Timothy J; Coats, Bonnie; Shankar, Meena N; Percival, Susan S; Chi, Yueh-Yun; Muller, Keith E; Ueland, Per Magne; Stacpoole, Peter W; Gregory, Jesse F

2013-11-01

263

The Leloir pathway: a mechanistic imperative for three enzymes to change the stereochemical configuration of a single carbon in galactose.  

PubMed

The biological interconversion of galactose and glucose takes place only by way of the Leloir pathway and requires the three enzymes galactokinase, galactose-1-P uridylyltransferase, and UDP-galactose 4-epimerase. The only biological importance of these enzymes appears to be to provide for the interconversion of galactosyl and glucosyl groups. Galactose mutarotase also participates by producing the galactokinase substrate alpha-D-galactose from its beta-anomer. The galacto/gluco configurational change takes place at the level of the nucleotide sugar by an oxidation/reduction mechanism in the active site of the epimerase NAD+ complex. The nucleotide portion of UDP-galactose and UDP-glucose participates in the epimerization process in two ways: 1) by serving as a binding anchor that allows epimerization to take place at glycosyl-C-4 through weak binding of the sugar, and 2) by inducing a conformational change in the epimerase that destabilizes NAD+ and increases its reactivity toward substrates. Reversible hydride transfer is thereby facilitated between NAD+ and carbon-4 of the weakly bound sugars. The structure of the enzyme reveals many details of the binding of NAD+ and inhibitors at the active site. The essential roles of the kinase and transferase are to attach the UDP group to galactose, allowing for its participation in catalysis by the epimerase. The transferase is a Zn/Fe metalloprotein, in which the metal ions stabilize the structure rather than participating in catalysis. The structure is interesting in that it consists of single beta-sheet with 13 antiparallel strands and 1 parallel strand connected by 6 helices. The mechanism of UMP attachment at the active site of the transferase is a double displacement, with the participation of a covalent UMP-His 166-enzyme intermediate in the Escherichia coli enzyme. The evolution of this mechanism appears to have been guided by the principle of economy in the evolution of binding sites. PMID:8647345

Frey, P A

1996-03-01

264

Phosphorus limitation of nitrogen fixation by Trichodesmium in the central Atlantic Ocean  

NASA Astrophysics Data System (ADS)

Marine fixation of atmospheric nitrogen is believed to be an important source of biologically useful nitrogen to ocean surface waters, stimulating productivity of phytoplankton and so influencing the global carbon cycle. The majority of nitrogen fixation in tropical waters is carried out by the marine cyanobacterium Trichodesmium, which supplies more than half of the new nitrogen used for primary production. Although the factors controlling marine nitrogen fixation remain poorly understood, it has been thought that nitrogen fixation is limited by iron availability in the ocean. This was inferred from the high iron requirement estimated for growth of nitrogen fixing organisms and the higher apparent densities of Trichodesmium where aeolian iron inputs are plentiful. Here we report that nitrogen fixation rates in the central Atlantic appear to be independent of both dissolved iron levels in sea water and iron content in Trichodesmium colonies. Nitrogen fixation was, instead, highly correlated to the phosphorus content of Trichodesmium and was enhanced at higher irradiance. Furthermore, our calculations suggest that the structural iron requirement for the growth of nitrogen-fixing organisms is much lower than previously calculated. Although iron deficiency could still potentially limit growth of nitrogen-fixing organisms in regions of low iron availability-for example, in the subtropical North Pacific Ocean-our observations suggest that marine nitrogen fixation is not solely regulated by iron supply.

Sañudo-Wilhelmy, Sergio A.; Kustka, Adam B.; Gobler, Christopher J.; Hutchins, David A.; Yang, Min; Lwiza, Kamazima; Burns, James; Capone, Douglas G.; Raven, John A.; Carpenter, Edward J.

2001-05-01

265

[Screw fixation of craniocervical junction].  

PubMed

In recent years an increase has been observed of the use of screw techniques for the fixation of the craniocervical junction. For clinical use two techniques have been introduced: (1) transarticular screw fixation, and (2) transpedicular screw fixation. In the former the screw is inserted through the C2 lateral mass, the fissure of the C1-C2 joint, and the C1 lateral mass. (2) in the latter the screw is inserted into the C2 pedicle and anchored in C2 vertebral body. Transarticular or pedicle screws can be easily connected to longitudinal elements such as rods or plates, and combined with lateral mass screws of the remaining cervical vertebrae or occipital screws. In comparison to sublaminar wiring or interlaminar clamping the screw techniques: (a) strengthen the stiffness of the construct and speed up fusion, (b) allow fixation in the absence or deficiency of laminae as a result of trauma or laminectomy, and (c) can selectively include only the affected segments. Increased construct stiffness is due to deep anchorage of the screw in bone providing thus a solid grip on the vertebra. Both techniques require preoperative assessment of the course of the vertebral artery using imaging methods. In about 18% of cases abnormal course of the artery precludes screw use. Pedicle screw insertion requires direct control of the medial and superior walls of C2 pedicle with dissector introduced into the vertebral canal, which requires removal of the atlantoaxial ligament. Additional control can be achieved with lateral fluoroscopy. The entry point for transarticular screw is on the lateral mass of the odontoid 2-3 mm laterally to the medial margin of C2 facet and 2-3 mm above the C1/C2 articular fissure. The screw trajectory is 0-10 degrees in horizontal plane and towards the anterior C1 tuberculum in sagittal plane. PMID:10791042

Maciejczak, A; Radek, A

1999-01-01

266

Nitrogen fixation in Pseudomonas stutzeri  

Microsoft Academic Search

A recently developed oxygen gradient system and a complex medium were used to isolate a microaerobically N2-fixing heterotrophic bacterium from the rhizosphere of a “high fixing” Sorghum nutans cultivar. The isolate was identified as nif(+) phenotype of Pseudomonas stutzeri on the basis of cultural, physiological and biochemical characteristics, including DNA\\/DNA hybridization. N2 fixation was demonstrated by assimilation of 15N2 into

A. Krotzky; D. Werner

1987-01-01

267

Fixation of 18O2 during Photorespiration  

PubMed Central

Mass spectrometric techniques were used to trace the incorporation of [18O]oxygen into metabolites of the photorespiratory pathway. Glycolate, glycine, and serine extracted from leaves of the C3 plants, Spinacia oleracea L., Atriplex hastata, and Helianthus annuus which had been exposed to [18O]oxygen at the CO2 compensation point were heavily labeled with 18O. In each case one, and only one of the carboxyl oxygens was labeled. The abundance of 18O in this oxygen of glycolate reached 50 to 70% of that of the oxygen provided after only 5 to 10 seconds exposure to [18O]oxygen. Glycine and serine attained the same final enrichment after 40 and 180 seconds, respectively. This confirms that glycine and serine are synthesized from glycolate. The labeling of photorespiratory intermediates in intact leaves reached a mean of 59% of that of the oxygen provided in the feedings. This indicates that at least 59% of the glycolate photorespired is synthesized with the fixation of molecular oxygen. This estimate is certainly conservative owing to the dilution of labeled oxygen at the site of glycolate synthesis by photosynthetic oxygen. We examined the yield of 18O in glycolate synthesized in vitro by isolated intact spinach chloroplasts in a system which permitted direct sampling of the isotopic composition of the oxygen at the site of synthesis. The isotopic enrichment of glycolate from such experiments was 90 to 95% of that of the oxygen present during the incubation. The carboxyl oxygens of 3-phosphoglycerate also became labeled with 18O in 20- and 40-minute feedings with [18O]oxygen to intact leaves at the CO2 compensation point. Control experiments indicated that this label was probably due to direct synthesis of 3-phosphoglycerate from glycolate during photorespiration. The mean enrichment of 3-phosphoglycerate was 14 ± 4% of that of glycine or serine, its precursors of the photorespiratory pathway, in 10 separate feeding experiments. It is argued that this constant dilution of label indicates a constant stoichiometric balance between photorespiratory and photosynthetic sources of 3-phosphoglycerate at the CO2 compensation point. Oxygen uptake sufficient to account for about half of the rate of 18O fixation into glycine in the intact leaves was observed with intact spinach chloroplasts. Oxygen uptake and production by intact leaves at the CO2 compensation point indicate about 1.9 oxygen exchanged per glycolate photorespired. The fixation of molecular oxygen into glycolate plus the peroxisomal oxidation of glycolate to glyoxylate and the mitochondrial conversion of glycine to serine can account for up to 1.75 oxygen taken up per glycolate. These studies provide new evidence which supports the current formulation of the pathway of photorespiration and its relation to photosynthetic metabolism. The experiments described also suggest new approaches using stable isotope techniques to study the rate of photorespiration and the balance between photorespiration and photosynthesis in vivo.

Berry, Joseph A.; Osmond, C. Barry; Lorimer, George H.

1978-01-01

268

The metabolic significance of octulose phosphates in the photosynthetic carbon reduction cycle in spinach  

Microsoft Academic Search

14C-Labelled octulose phosphates were formed during photosynthetic 14CO2 fixation and were measured in spinach leaves and chloroplasts. Because mono- and bisphosphates of d-glycero-\\u000a d-ido-octulose are the active 8-carbon ketosugar intermediates of the L-type pentose pathway, it was proposed that they may also\\u000a be reactants in a modified Calvin–Benson–Bassham pathway reaction scheme. This investigation therefore initially focussed\\u000a only on the ido-epimer

John F. Williams; John K. MacLeod

2006-01-01

269

First direct measurements of N2 fixation during a Trichodesmium bloom in the eastern Arabian Sea  

NASA Astrophysics Data System (ADS)

We report the first direct estimates of N2 fixation rates measured during the spring, 2009 using the 15N2 gas tracer technique in the eastern Arabian Sea, which is well known for significant loss of nitrogen due to intense denitrification. Carbon uptake rates are also concurrently estimated using the 13C tracer technique. The N2 fixation rates vary from ˜0.1 to 34 mmol N m-2d-1 after correcting for the isotopic under-equilibrium with dissolved air in the samples. These higher N2 fixation rates are consistent with higher chlorophyll a and low ?15N of natural particulate organic nitrogen. Our estimates of N2 fixation is a useful step toward reducing the uncertainty in the nitrogen budget.

Gandhi, Naveen; Singh, Arvind; Prakash, S.; Ramesh, R.; Raman, Mini; Sheshshayee, M. S.; Shetye, Suhas

2011-12-01

270

Fixational eye movements and binocular vision  

PubMed Central

During attempted visual fixation, small involuntary eye movements–called fixational eye movements–continuously change of our gaze’s position. Disagreement between the left and right eye positions during such motions can produce diplopia (double vision). Thus, the ability to properly coordinate the two eyes during gaze fixation is critical for stable perception. For the last 50 years, researchers have studied the binocular characteristics of fixational eye movements. Here we review classical and recent studies on the binocular coordination (i.e., degree of conjugacy) of each fixational eye movement type: microsaccades, drift and tremor, and its perceptual contribution to increasing or reducing binocular disparity. We also discuss how amblyopia and other visual pathologies affect the binocular coordination of fixational eye movements.

Otero-Millan, Jorge; Macknik, Stephen L.; Martinez-Conde, Susana

2014-01-01

271

PERIODATE-LYSINE-PARAFORMALDEHYDE FIXATIVE A NEW FIXATIVE FOR IMMUNOELECTRON MICROSCOPY  

Microsoft Academic Search

A new fixative which primarily stabilizes carbohydrate moieties was developed for immunoelectron microscopy. It contains periodate, lysine and paraformaldehyde. Theoreti- cally, the carbohydrates are oxidized by periodate and cross-linked by lysine. The fixative can preserve antigenicity as well as paraformaldehyde and ultrastructure as well as glutaraldehyde. Using this fixative and the peroxidase-labeled antibody technique, base- ment membrane antigen was localized

PAUL K. NAKANE

272

Do Fixation Cues Ensure Fixation Accuracy in Split-Fovea Studies of Word Recognition?  

ERIC Educational Resources Information Center

Many studies have claimed that hemispheric processing is split precisely at the foveal midline and so place great emphasis on the precise location at which words are fixated. These claims are based on experiments in which a variety of fixation procedures were used to ensure fixation accuracy but the effectiveness of these procedures is unclear. We…

Jordan, Timothy R.; Paterson, Kevin B.; Kurtev, Stoyan; Xu, Mengyun

2009-01-01

273

Nitrogen fixation method and apparatus  

DOEpatents

A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O[sub 2]/cm promotes the formation of vibrationally excited N[sub 2]. Atomic oxygen interacts with vibrationally excited N[sub 2] at a much quicker rate than unexcited N[sub 2], greatly improving the rate at which NO is formed. 1 fig.

Chen, H.L.

1983-08-16

274

Nitrogen fixation method and apparatus  

DOEpatents

A method and apparatus for achieving nitrogen fixation includes a volumetric electric discharge chamber. The volumetric discharge chamber provides an even distribution of an electron beam, and enables the chamber to be maintained at a controlled energy to pressure (E/p) ratio. An E/p ratio of from 5 to 15 kV/atm of O.sub.2 /cm promotes the formation of vibrationally excited N.sub.2. Atomic oxygen interacts with vibrationally excited N.sub.2 at a much quicker rate than unexcited N.sub.2, greatly improving the rate at which NO is formed.

Chen, Hao-Lin (Walnut Creek, CA) [Walnut Creek, CA

1983-01-01

275

Azide binding to carbon monoxide dehydrogenase from Clostridium thermoaceticum  

SciTech Connect

Carbon monoxide dehydrogenase (CODH) plays a central role in a recently discovered pathway of anaerobic CO and CO{sub 2} fixation. In this communication, the EPR properties of a paramagnetic species that results from azide treatment of reduced CODH are explored. Azide, an inhibitor of CO oxidation, was found to dramatically alter the EPR spectrum of center C that is normally observed for untreated samples under reducing conditions. Electron spin echo envelope modulation (ESEEM) measurements show that azide is bound to the new paramagnetic species. 29 refs., 3 figs.

Kumar, M.; Lu, W.P.; Ragsdale, S.W. [Univ. of Nebraska, Lincoln, NE (United States); Smith, A.; McCracken, J. [Michigan State Univ., East Lansing, MI (United States)

1995-03-15

276

Modeling the dynamic regulation of nitrogen fixation in the cyanobacterium Trichodesmium sp.  

PubMed

A physiological, unbalanced model is presented that explicitly describes growth of the marine cyanobacterium Trichodesmium sp. at the expense of N(2) (diazotrophy). The model involves the dynamics of intracellular reserves of carbon and nitrogen and allows the uncoupling of the metabolism of these elements. The results show the transient dynamics of N(2) fixation when combined nitrogen (NO(3)(-), NH(4)(+)) is available and the increased rate of N(2) fixation when combined nitrogen is insufficient to cover the demand. The daily N(2) fixation pattern that emerges from the model agrees with measurements of rates of nitrogenase activity in laboratory cultures of Trichodesmium sp. Model simulations explored the influence of irradiance levels and the length of the light period on fixation activity and cellular carbon and nitrogen stoichiometry. Changes in the cellular C/N ratio resulted from allocations of carbon to different cell compartments as demanded by the growth of the organism. The model shows that carbon availability is a simple and efficient mechanism to regulate the balance of carbon and nitrogen fixed (C/N ratio) in filaments of cells. The lowest C/N ratios were obtained when the light regime closely matched nitrogenase dynamics. PMID:16672460

Rabouille, Sophie; Staal, Marc; Stal, Lucas J; Soetaert, Karline

2006-05-01

277

Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways  

NASA Astrophysics Data System (ADS)

Stable hydrogen, carbon, and nitrogen isotopic ratios (?D, ?13C, and ?15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ?13C and increasing ?D with increasing carbon number in the ?-H, ?-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light ?13C signatures for ?-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-?-amino acids). Higher deuterium enrichments are observed in ?-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

2012-09-01

278

Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways  

NASA Technical Reports Server (NTRS)

Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

2012-01-01

279

Analysis of oxygen sources and reaction pathways of carbon support corrosion at the cathode in PEMFC using oxygen-18 DEMS  

Microsoft Academic Search

Oxygen gas, water used to humidify the gases, and surface oxides originated from the carbon black and catalyst preparation are the three possible oxygen sources contributing to carbon support corrosion (CSC) at the cathode in proton exchange membrane fuel cells (PEMFC). To discriminate among them, oxygen was isotopically labeled by replacing regular water with oxygen-18 (18O) enriched water (H218O, 98%)

Wei Li

2010-01-01

280

Eighth international congress on nitrogen fixation. Final program  

SciTech Connect

This volume contains the proceedings of the Eighth International Congress on Nitrogen Fixation held May 20--26, 1990 in Knoxville, Tennessee. The volume contains abstracts of individual presentations. Sessions were entitled Recent Advances in the Chemistry of Nitrogen Fixation, Plant-microbe Interactions, Limiting Factors of Nitrogen Fixation, Nitrogen Fixation and the Environment, Bacterial Systems, Nitrogen Fixation in Agriculture and Industry, Plant Function, and Nitrogen Fixation and Evolution.

Not Available

1990-12-31

281

PHYSIOLOGY OF NITROGEN FIXATION BY BACILLUS POLYMYXA  

PubMed Central

Grau, F. H. (University of Wisconsin, Madison) and P. W. Wilson. Physiology of nitrogen fixation by Bacillus polymyxa. J. Bacteriol. 83:490–496. 1962.—Of 17 strains of Bacillus polymyxa tested for fixation of molecular nitrogen, 15 fixed considerable quantities (30 to 150 ?g N/ml). Two strains of the closely related B. macerans did not use N2, but possibly other members of this species may do so. Confirmation of fixation was obtained by showing incorporation of N15 into cell material. Both iron and molybdenum are specifically required for fixation; without the addition of these metals to the nitrogen-free medium, the growth rate and the total nitrogen fixed were reduced about 30 to 50%. No requirement for added molybdenum could be shown when ammonia was the nitrogen source, and the absence of iron caused only a slight decrease in growth. Washed-cell suspensions of B. polymyxa containing an active hydrogenase readily incorporated N15 into cell materials when provided with mannitol, glucose, or pyruvate but not when formate was the substrate. Hydrogen is a specific inhibitor of fixation, reducing both the rate and final amount of nitrogen fixed; it did not reduce growth on ammonia. Fixation was strictly anaerobic, 1% oxygen in the gas phase being sufficient to stop fixation. Arsenate is a powerful inhibitor of fixation of N2 by washed-cell suspensions of B. polymyxa, indicating that high-energy phosphate may be significant for this process.

Grau, F. H.; Wilson, P. W.

1962-01-01

282

New staple fixation for an Austin bunionectomy.  

PubMed

There are several methods available for the internal fixation of the Austin bunionectomy. By carefully forming a Kirschner wire into the shape of a staple, fixation of the neck osteotomy is maintained. The method is simple, fast, and reliable, and it requires no additional instrumentation. PMID:1573169

Kaye, J M

1992-01-01

283

Visual fixation in Chiari type II malformation.  

PubMed

Chiari type II malformation is a congenital deformity of the hindbrain. Square wave jerks are horizontal involuntary saccades that interrupt fixation. Cerebellar disorders may be associated with frequent square wave jerks or saccadic oscillations such as ocular flutter. The effects of Chiari type II malformation on visual fixation are unknown. We recorded eye movements using an eye tracker in 21 participants with Chiari type II malformation, aged 8 to 19 years while they fixated a target for 1 minute. Thirty-eight age-matched healthy participants served as controls. Square wave jerks' parameters were similar in the 2 groups. Saccadic oscillations were not seen. Chiari type II malformation is not associated with pathological square wave jerks or abnormal saccadic oscillations. The congenital nature of this deformity may permit compensation that preserves stable visual fixation. Alternatively, the deformity of Chiari type II malformation may spare parts of the cerebellum that usually cause fixation instability when damaged. PMID:19182152

Salman, Michael S; Sharpe, James A; Lillakas, Linda; Dennis, Maureen; Steinbach, Martin J

2009-02-01

284

Carbon-Isotope Fractionations of Autotrophic Bacteria: Relevance to Primary Production and Microbial Evolution in Hot Springs and Hydrothermal Vents  

NASA Astrophysics Data System (ADS)

Terrestrial hot springs and marine hydrothermal vents are often dominated by autotrophic microorganisms. Species of the Bacteria Domain in these environments are known to use different pathways for CO2 fixation. These may include the Calvin cycle, the Acetyl CoA pathway, the reverse TCA cycle, and the 3-HP pathway. Each cycle or pathway may be characterized by distinct patterns of carbon isotope fractionation. This presentation will summarize isotope fractionation patterns associated with known autotrophic bacteria and to use these patterns for interpreting natural isotopic variations. Examples will include hot springs from the Yellowstone National Park and Nevada desert, USA and Kamchatka, Russia, and hydrothermal vents from the East Pacific Rise. An attempt will be made to discuss isotopic variations within a particular pathway in the context of species evolution through horizontal gene transfer.

Zhang, C. L.; Romanek, C. S.; Mills, G.

2004-12-01

285

Studies on carbon flow in Crassulacean acid metabolism during the initial light period.  

PubMed

In the Crassulacean acid metabolism (CAM) plants Kalanchoë tubiflora and Sedum morganianum a shift in the pathways occurs by which external CO2 enters the metabolism during the initial light period (phase II of the diurnal CAM cycle). At the beginning of phase II, CO2 is fixed mainly by the C4 pathway; during late phase II, however, it is fixed mainly via the C3 pathway. The C3 pathway contributes to the phosphoenolpyruvate-carboxylase-mediated CO2 fixation by the provision of three-carbon skeletons. Since the shift in the carbon-flow pathway is delayed after a CO2-free night when malic-acid accumulation in the vacuoles is prevented, it is very likely that the amount of malic acid in the vacuole is integrated in the mechanism which controls CAM during the initial light period. A light-on signal at the beginning of phase II is not required to bring about the shifts in the carbon-flow pathways, as is shown by the reaction of plants to a prolonged dark period. A model of carbon flow during phase II is proposed. PMID:24258414

Fischer, A; Kluge, M

1984-02-01

286

Dark Fixation of CO(2) by Crassulacean Plants: Evidence for a Single Carboxylation Step.  

PubMed

Malic acid isolated from Bryophyllum pinnatum (Lamk.) Oken (B. calycinum Salisb.), Bryophyllum tubiflorum Harv., Kalanchoë diagremontiana Hamet et Perrier and Sedum guatamalense Hemsl. after dark (14)CO(2) fixation was degraded by an in vitro NADP-malic enzyme technique. In the short term (5 to 30 seconds) the malic acid was almost exclusively labeled in the C-4 carboxyl carbon (greater than 90%). The percentage of (14)C in the C-4 carboxyl of malic acid declined slowly with time, reaching 70% in B. tubiflorum and 54% in B. pinnatum after 14 hours of exposure to (14)CO(2). It was found that malic acid-adapted Lactobacillus arabinosus may seriously underestimate the C-4 carboxyl component of label in malic acid-(14)C. The amount of substrate which the bacteria can completely metabolize was easily exceeded; there was a significant level of randomization of label even when beta-decarboxylation proceeded to completion, and in extended incubation periods, more than 25% of label was removed from malic acid-U-(14)C. The significance of these findings in relation to pathways of carbohydrate metabolism and malic acid synthesis in Crassulacean acid metabolism is discussed. PMID:16658174

Sutton, B G; Osmond, C B

1972-09-01

287

Carbon and nitrogen cycling in thermally heated sediments  

NASA Astrophysics Data System (ADS)

Hydrothermally heated sediment environments, such as are found in abundance throughout Yellowstone National Park, host fully functional microbial ecosystems. As with any ecosystem, both sources and sinks of carbon, nitrogen, and a myriad of other nutrients and energy-driving factors must be supplied. While we know microbial communities in hydrothermal environments can be surprisingly diverse, we know little about basic ecological functions such as carbon and nitrogen cycling. Previous work has shown that carbon cycling in one hot spring in Yellowstone National Park [“Bison Pool”] and its associated runoff channel functions as a complex system. Analysis of carbon and nitrogen isotopes in sediments and biofilms across a temperature and chemical gradient at this location revealed that the four best studied carbon fixation pathways [Calvin, reverse tricarboxylic acid, acetyl-CoA, 3-hydroxypropionate cycles] may all be functioning in this system, and nitrogen fixation varies across the chemosynthetic/photosynthetic ecotone [1]. Microcosm experiments using biofilms from this hot spring as inoculae with 13C labeled carbon substrates indicate heterotrophic growth [2]. In addition, metagenomic analysis of environmental DNA has indicated the presence of genes involved in carbon fixation [both phototrophic and autotrophic], and heterotrophy, as well as nitrogen fixation [3]. Studies from other Yellowstone locations have also found genetic evidence for carbon and nitrogen fixation [4, 5]. Of particular interest is the role of individuals in carbon and nitrogen cycling as environmental conditions suitable for chemosynthetic and photosynthetic growth vary. This study explores the diversity of cbbM/cbbL [Calvin cycle], aclB/oor/porA [rTCA cycle], nifH [nitrogen fixation], nirK [nitrite reduction] and amoA [ammonia oxidation] genes across a variety of Yellowstone environments. The transition of genetic diversity within sediments and biofilms is focused on the chemosynthetic/photosynthetic ecotone from a variety of hot springs spanning a range of pH and geochemical conditions. By sampling across this ecotone, changes in carbon and nitrogen fixation as a function of changing community structure become apparent. Environmental DNA was extracted from these samples, and the presence/absence of Bacteria and Archaea determined by PCR. In addition, PCR-directed screens reveal the presence or absence of the aforementioned functional genes. Further, comparison across a broad spectrum of environmental conditions supplies context for phylogenetic analysis of diversity. [1] Havig, J.R., 2009. Geochemistry of Hydrothermal Biofilms: Composition of Biofilms in Siliceous Sinter-Deposting Hot Springs. Doctoral Dissertation, Arizona State University. [2] Meyer-Dombard et al., 2007. Microbial Diversity and SIP Investigations of Streamer Biofilm Communities in Yellowstone. Goldschmidt Geochemical Conference. [3] Raymond et al., 2008. EOS Trans AGU. Abstract B14A-03. [4] Hall et al., 2008. AEM 74:4910-4922. [5] Steunou et al., 2006. PNAS 103:2398-2403.

Meyer-Dombard, D. R.; Burton, M.; Vennelakanti, S.; Havig, J. R.; Shock, E.

2009-12-01

288

The Contemporary Carbon Cycle  

Microsoft Academic Search

The global carbon cycle refers to the exchanges of carbon within and between four major reservoirs: the atmosphere, the oceans, land, and fossil fuels. Carbon may be transferred from one reservoir to another in seconds (e.g., the fixation of atmospheric CO2 into sugar through photosynthesis) or over millennia (e.g., the accumulation of fossil carbon (coal, oil, gas) through deposition and

R. A. Houghton

2003-01-01

289

Fixation of CO2 in Clostridium cellulovorans analyzed by 13C-isotopomer-based target metabolomics.  

PubMed

Clostridium cellulovorans has been one of promising microorganisms to use biomass efficiently; however the basic metabolic pathways have not been completely known. We carried out 13C-isotopomer-based target metabolome analysis, or carbohydrate conversion process analysis, for more profound understanding of metabolic pathways of the bacterium. Our findings that pyruvate?+?oxaloacetate, fumarate, and malate inside and outside cells exhibited 13C incorporation suggest that C. cellulovorans exactly fixed CO2 and partly operated the TCA cycle in a reductive manner. Accompanied with CO2 fixation, the microorganism was also found to produce and secrete lactate. Overall, our study demonstrates that a part of C. cellulovorans metabolic pathways related to glycolysis and the TCA cycle are involved in CO2 fixation. PMID:24103325

Shinohara, Masahiro; Sakuragi, Hiroshi; Morisaka, Hironobu; Miyake, Hideo; Tamaru, Yutaka; Fukusaki, Eiichiro; Kuroda, Kouichi; Ueda, Mitsuyoshi

2013-01-01

290

Oxygen-Poor Microzones as Potential Sites of Microbial N2 Fixation in Nitrogen-Depleted Aerobic Marine Waters  

PubMed Central

The nitrogen-deficient coastal waters of North Carolina contain suspended bacteria potentially able to fix N2. Bioassays aimed at identifying environmental factors controlling the development and proliferation of N2 fixation showed that dissolved organic carbon (as simple sugars and sugar alcohols) and particulate organic carbon (derived from Spartina alterniflora) additions elicited and enhanced N2 fixation (nitrogenase activity) in these waters. Nitrogenase activity occurred in samples containing flocculent, mucilage-covered bacterial aggregates. Cyanobacterium-bacterium aggregates also revealed N2 fixation. In all cases bacterial N2 fixation occurred in association with surficial microenvironments or microzones. Since nitrogenase is oxygen labile, we hypothesized that the aggregates themselves protected their constituent microbes from O2. Microelectrode O2 profiles revealed that aggregates had lower internal O2 tensions than surrounding waters. Tetrazolium salt (2,3,5-triphenyl-3-tetrazolium chloride) reduction revealed that patchy zones existed both within microbes and extracellularly in the mucilage surrounding microbes where free O2 was excluded. Triphenyltetrazolium chloride reduction also strongly inhibited nitrogenase activity. These findings suggest that N2 fixation is mediated by the availability of the appropriate types of reduced microzones. Organic carbon enrichment appears to serve as an energy and structural source for aggregate formation, both of which were required for eliciting N2 fixation responses of these waters. Images

Paerl, Hans W.; Prufert, Leslie E.

1987-01-01

291

Methane Production Pathways in a California Rice Paddy: Isotopic Evidence for Substantial CO2 Reduction as Cause for Isotopically Light Emitted CH4 Carbon  

NASA Astrophysics Data System (ADS)

We report measurements of ? 13C of emitted CH4 and sediment CH4 and CO2 during the 1999 rice-growing season near Maxwell, CA. Two treatments, one with rice straw incorporated from the previous season and one without rice straw were studied. The ? 13C value of emitted CH4 was consistently lighter isotopically (-67‰ to -83‰ throughout the season) in both straw incorporated and straw removed (burned) plots than in fields we have studied in Texas, Kenya, and Japan. Measured isotopic values of the production zone CH4 were compared to a two-point mixing curve representative of isotopic CH4 produced from either pure methyl-group fermentation or CO2 reduction pathways to partition the production pathways and to track seasonal changes in the production processes. Our sediment CH4 and CO2 isotope data indicate that fermentation was rarely the dominant methanogenic pathway - on the contrary CO2 reduction with H2 was more prevalent than fermentation methanogenesis throughout most of the season. The relatively isotopically light CH4 emitted by the paddy fields is also a product of oxidation and stem-transport processes which have isotopic effects of their own. These effects are discussed in context with the methanogenic isotope effects to provide a complete picture of the paddy field CH4 carbon isotope system.

Tyler, S. C.; McMillan, A. M.; Bearden, K.; Chidthaisong, A.; Macalady, J.

2003-12-01

292

Comment: Critical examination of stable isotope analysis as a means for tracing carbon pathways in stream ecosystems  

Microsoft Academic Search

On the basis of a review of current literature, France (1995) questioned the utility of stable isotope analysis (SIA) in de- scribing food webs and understanding the effects of human perturbation in lotic ecosystems. His three main conclusions were (i) ìautotrophic pathways within forested headwaters are much more important to lotic food webs than would be sug- gested by their

Richard R. Doucett; Dave R. Barton; Karin R. A. Guiguer; G. Power; R. J. Drimmie

1996-01-01

293

Stable Carbon Isotope Discrimination by Form IC Rubisco Enzymes of the Extremely Metabolically Versatile Rhodobacter sphaeroides and Ralstonia eutropha}  

NASA Astrophysics Data System (ADS)

Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating biomass stable carbon isotopic compositions (?13C = {[13C/12Csample/13C/12Cstandard] - 1} × 1000). Five different forms of RubisCO (IA, IB, IC, ID, and II) are utilized by algae and autotrophic bacteria reliant on the Calvin-Benson cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs, and their ? values (={[12k/13k] - 1} × 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, explaining the variation in biomass ?13C values of autotrophs utilizing these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides and Ralstonia eutropha. The purpose of this work was to determine the ? values for form IC RubisCO enzymes from R. sphaeroides and R. eutropha. Recombinant form IC RubisCOs were purified by conventional column chromatography procedures. Assay conditions (pH, dissolved inorganic carbon concentration) were tested to determine which parameters were conducive to the high rates of carbon fixation necessary for ? determination. Under standard conditions (pH 8.5 and 5 mM DIC), form IC RubisCO activities were sufficient for ? determination. Experiments are currently being conducted to measure the ? values of these enzymes. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of ?13C values of organisms fixing carbon via the Calvin-Benson cycle. These results are critical for determining the degree to which Calvin cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.

Thomas, P. J.; Boller, A. J.; Zhao, Z.; Tabita, F. R.; Cavanaugh, C. M.; Scott, K. M.

2006-12-01

294

Elementary Flux Mode Analysis of Acetyl-CoA Pathway in Carboxydothermus hydrogenoformans Z-2901.  

PubMed

Carboxydothermus hydrogenoformans is a carboxydotrophic hydrogenogenic bacterium species that produces hydrogen molecule by utilizing carbon monoxide (CO) or pyruvate as a carbon source. To investigate the underlying biochemical mechanism of hydrogen production, an elementary mode analysis of acetyl-CoA pathway was performed to determine the intermediate fluxes by combining linear programming (LP) method available in CellNetAnalyzer software. We hypothesized that addition of enzymes necessary for carbon monoxide fixation and pyruvate dissimilation would enhance the theoretical yield of hydrogen. An in silico gene knockout of pyk, pykC, and mdh genes of modeled acetyl-CoA pathway allows the maximum theoretical hydrogen yield of 47.62?mmol/gCDW/h for 1 mole of carbon monoxide (CO) uptake. The obtained hydrogen yield is comparatively two times greater than the previous experimental data. Therefore, it could be concluded that this elementary flux mode analysis is a crucial way to achieve efficient hydrogen production through acetyl-CoA pathway and act as a model for strain improvement. PMID:24822064

Chinnasamy Perumal, Rajadurai; Selvaraj, Ashok; Ramesh Kumar, Gopal

2014-01-01

295

Elementary Flux Mode Analysis of Acetyl-CoA Pathway in Carboxydothermus hydrogenoformans Z-2901  

PubMed Central

Carboxydothermus hydrogenoformans is a carboxydotrophic hydrogenogenic bacterium species that produces hydrogen molecule by utilizing carbon monoxide (CO) or pyruvate as a carbon source. To investigate the underlying biochemical mechanism of hydrogen production, an elementary mode analysis of acetyl-CoA pathway was performed to determine the intermediate fluxes by combining linear programming (LP) method available in CellNetAnalyzer software. We hypothesized that addition of enzymes necessary for carbon monoxide fixation and pyruvate dissimilation would enhance the theoretical yield of hydrogen. An in silico gene knockout of pyk, pykC, and mdh genes of modeled acetyl-CoA pathway allows the maximum theoretical hydrogen yield of 47.62?mmol/gCDW/h for 1 mole of carbon monoxide (CO) uptake. The obtained hydrogen yield is comparatively two times greater than the previous experimental data. Therefore, it could be concluded that this elementary flux mode analysis is a crucial way to achieve efficient hydrogen production through acetyl-CoA pathway and act as a model for strain improvement.

Chinnasamy Perumal, Rajadurai; Selvaraj, Ashok; Ramesh Kumar, Gopal

2014-01-01

296

Osseous and chondral fixation of polypropylene mesh.  

PubMed

Fixation of polypropylene (Marlex) mesh in the epigastrium and at the iliac crest can be ineffective because of insufficient local fascia; however, two techniques have been described to obtain firm and durable attachment of polypropylene grafts at these sites. Perichondral slips at the costal margin permit very satisfactory attachment with excellent long-term results. Stainless steel wire fixation of the mesh to the iliac crest has satisfied the need for osseous fixation in that area. Long-term repair of difficult and recurrent hernias has been described in three patients for whom other tactics for abdominal wall repairs were not available. PMID:3160250

Merrell, R C; Than-Trong, T

1985-06-01

297

Fixation updates for hallux valgus correction.  

PubMed

Fixation options for hallux valgus correction vary. Although some methods are newer and more advanced, even the older techniques are successful in appropriate situations. Kirschner wires and cerclage wiring have their place in proximal phalanx and first metatarsal osteotomies. They are useful for fusion procedures, depending on patient bone quality. Advancements with staple fixation allow the surgeon to apply compression with this device. One of the most stable forms of fixation is the bone screw. By providing a stable construct with good interfragmentary compression, primary bone healing is facilitated. The more recent use of rigid locking plates has allowed for earlier weight bearing following fusion procedures. PMID:24685192

Ben-Ad, Rotem

2014-04-01

298

Achlorophyllous alga Prototheca zopfii oxidizes n-alkanes with different carbon-chain lengths through a unique subterminal oxidation pathway.  

PubMed

Some Prototheca spp. were previously reported to convert n-hexadecane to 5-hexadecanol and then to 5-hexadecanone through a unique subterminal oxidation pathway. Further analysis of derivatives derived from n-hexadecane indicated that Prototheca zopfii oxidized n-alkanes with C11 to C17 chain lengths at not only the 5th but also the 4th, 3rd and 2nd positions. PMID:24099955

Takimura, Yasushi; Sakuradani, Eiji; Natsume, Yusuke; Miyake, Takashi; Ogawa, Jun; Shimizu, Sakayu

2014-03-01

299

The Leloir pathway: a mechanistic imperative for three enzymes to change the stereochemical configuration of a single carbon in galactose  

Microsoft Academic Search

The biological interconversionof galac- tose and glucose takes place only by way of the Leloir pathway and requires the three enzymes galactoki- nase, galactose- 1-P uridylyltransferase, and UDP- galactose 4-epimerase. The only biological importance of these enzymes appears to be to provide for the interconversion of galactosyl and glucosyl groups. Galactose mutarotase also participatesby producing the galactokinase substrate cc-D-galactose from

PERRY A. FREY

300

Fixation Strategies to Prevent Screw Cut-Out and Malreduction in Proximal Humeral Fracture Fixation  

PubMed Central

Fixation of proximal humerus fractures with precontoured, fixed angle devices has improved operative management of these difficult injuries, particularly in patients with osteoporosis. However, recent data has revealed that fixation with these constructs is not without complications, particularly screw cut-out and loss of reduction. Multiple strategies have been developed to decrease the number of complications. We offer a surgical technique combining suture augmentation of the proximal humerus with locked plate fixation utilizing short screws.

Namdari, Surena; Lipman, Adam J.; Ricchetti, Eric T.; Tjoumakaris, Fotios P.; Huffman, G. Russell

2012-01-01

301

A simple and green pathway toward nitrogen and sulfur dual doped hierarchically porous carbons from ionic liquids for oxygen reduction  

NASA Astrophysics Data System (ADS)

We for the first time demonstrate a simple and green approach to heteroatom (N and S) co-doped hierarchically porous carbons (N-S-HC) with high surface area by using one organic ionic liquid as nitrogen, sulfur and carbon sources and the eutectic salt as templating. The resultant dual-doped N-S-HC catalysts exhibit significantly enhanced electrocatalytic activity, long-term operation stability, and tolerance to crossover effect compared to commercial Pt/C for oxygen reduction reactions (ORR) in alkaline environment. The excellent electrocatalytic performance may be attributed to the synergistic effects, which includes more catalytic sites for ORR provided by N-S heteroatom doping and high electron transfer rate provided by hierarchically porous structure. The DFT calculations reveal that the dual doping of S and N atoms lead to the redistribution of spin and charge densities, which may be responsible for the formation of a large number of carbon atom active sites. This newly developed approach may supply an efficient platform for the synthesis of a series of heteroatom doped carbon materials for fuel cells and other applications.

Cui, Zhentao; Wang, Shuguang; Zhang, Yihe; Cao, Minhua

302

Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use  

Microsoft Academic Search

Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such

Manuel Kleiner; C. Wentrop; C. Lott; Hanno Teeling; Silke Wetzel; Jacque C Young; Y. Chang; Manesh B Shah; Nathan C Verberkmoes; Jan Zarzycki; Georg Fuchs; Stephanie Markert; Kristina Hempel

2012-01-01

303

Autotrophic Microbe Metagenomes and Metabolic Pathways Differentiate Adjacent Red Sea Brine Pools  

PubMed Central

In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens.

Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

2013-01-01

304

Autotrophic microbe metagenomes and metabolic pathways differentiate adjacent Red Sea brine pools.  

PubMed

In the Red Sea, two neighboring deep-sea brine pools, Atlantis II and Discovery, have been studied extensively, and the results have shown that the temperature and concentrations of metal and methane in Atlantis II have increased over the past decades. Therefore, we investigated changes in the microbial community and metabolic pathways. Here, we compared the metagenomes of the two pools to each other and to those of deep-sea water samples. Archaea were generally absent in the Atlantis II metagenome; Bacteria in the metagenome were typically heterotrophic and depended on aromatic compounds and other extracellular organic carbon compounds as indicated by enrichment of the related metabolic pathways. In contrast, autotrophic Archaea capable of CO2 fixation and methane oxidation were identified in Discovery but not in Atlantis II. Our results suggest that hydrothermal conditions and metal precipitation in the Atlantis II pool have resulted in elimination of the autotrophic community and methanogens. PMID:23624511

Wang, Yong; Cao, Huiluo; Zhang, Guishan; Bougouffa, Salim; Lee, On On; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

2013-01-01

305

Influence of amino acids on nitrogen fixation ability and growth of Azospirillum spp.  

PubMed Central

The utilization of amino acids for growth and their effects on nitrogen fixation differ greatly among the several strains of each species of Azospirillum spp. that were examined. A. brasiliense grew poorly or not at all on glutamate, aspartate, serine, or histidine as the sole nitrogen and carbon sources. Nitrogen fixation by most A. brasiliense strains was inhibited only slightly even by 10 mM concentrations of these amino acids. In contrast, A. lipoferum and A. amazonense grew very well on glutamate, aspartate, serine, or histidine as the sole nitrogen and carbon sources; nitrogen fixation, which was measured in the presence of malate or sucrose, was severely inhibited by these amino acids. It was concluded that growth on histidine as the sole source of nitrogen, carbon, and energy may be used for the taxonomic characterization of Azospirillum spp. and for the selective isolation of A. lipoferum. The different utilization of various amino acids by Azospirillum spp. may be important for their establishment in the rhizosphere and for their associative nitrogen fixation with plants. The physiological basis for the different utilization of glutamate by Azospirillum spp. was investigated further. A. brasiliense and A. lipoferum exhibited a high affinity for glutamate uptake (Km values for uptake were 8 and 40 microM, respectively); the Vmax was 6 times higher in A. lipoferum than in A. brasiliense. At high substrate concentrations (10 mM), the nonsaturable component of glutamate uptake was most active in A. lipoferum and A. amazonense.(ABSTRACT TRUNCATED AT 250 WORDS)

Hartmann, A; Fu, H A; Burris, R H

1988-01-01

306

Malate-mediated carbon catabolite repression in Bacillus subtilis involves the HPrK/CcpA pathway.  

PubMed

Most organisms can choose their preferred carbon source from a mixture of nutrients. This process is called carbon catabolite repression. The Gram-positive bacterium Bacillus subtilis uses glucose as the preferred source of carbon and energy. Glucose-mediated catabolite repression is caused by binding of the CcpA transcription factor to the promoter regions of catabolic operons. CcpA binds DNA upon interaction with its cofactors HPr(Ser-P) and Crh(Ser-P). The formation of the cofactors is catalyzed by the metabolite-activated HPr kinase/phosphorylase. Recently, it has been shown that malate is a second preferred carbon source for B. subtilis that also causes catabolite repression. In this work, we addressed the mechanism by which malate causes catabolite repression. Genetic analyses revealed that malate-dependent catabolite repression requires CcpA and its cofactors. Moreover, we demonstrate that HPr(Ser-P) is present in malate-grown cells and that CcpA and HPr interact in vivo in the presence of glucose or malate but not in the absence of a repressing carbon source. The formation of the cofactor HPr(Ser-P) could be attributed to the concentrations of ATP and fructose 1,6-bisphosphate in cells growing with malate. Both metabolites are available at concentrations that are sufficient to stimulate HPr kinase activity. The adaptation of cells to environmental changes requires dynamic metabolic and regulatory adjustments. The repression strength of target promoters was similar to that observed in steady-state growth conditions, although it took somewhat longer to reach the second steady-state of expression when cells were shifted to malate. PMID:22001508

Meyer, Frederik M; Jules, Matthieu; Mehne, Felix M P; Le Coq, Dominique; Landmann, Jens J; Görke, Boris; Aymerich, Stéphane; Stülke, Jörg

2011-12-01

307

A simple and inexpensive external fixator.  

PubMed

A simple and inexpensive external fixator has been designed. It is constructed of galvanized iron pipe and mild steel bolts and nuts. It can easily be manufactured in a hospital workshop with a minimum of tools. PMID:3267638

Noor, M A

1988-11-01

308

Bicondylar tibial fractures: Internal or external fixation?  

PubMed Central

Bicondylar fractures of the tibia, representing the Schatzker V and VI fractures represent a challenging problem. Any treatment protocol should aim at restoring articular congruity and the metaphyseo-diaphsyeal dissociation (MDD)—both of these are equally important to long-term outcome. Both internal and external fixations have their proponents, and each method of treatment is associated with its unique features and complications. We review the initial and definitive management of these injuries, and the advantages and disadvantages of each method of definitive fixation. We suggest the use of a protocol for definitive management, using either internal or external fixation as deemed appropriate. This protocol is based on the fracture configuration, local soft tissue status and patient condition. In a nutshell, if the fracture pattern and soft tissue status are amenable plate fixation (single or double) is performed, otherwise limited open reduction and articular surface reconstruction with screws and circular frame is performed.

Kumar, Gunasekaran; Peterson, Nicholas; Narayan, Badri

2011-01-01

309

External fixation of open humerus fractures.  

PubMed

Fifteen patients with open shaft of humerus fractures were treated with a monolateral external fixator. Nine patients presented with nerve palsies. Two radial nerves were disrupted and required grafting. Of the seven others, six spontaneously recovered and one brachial plexus partially improved. All fractures healed. The average duration of external fixation was 21 weeks. Four patients required additional procedures prior to healing (external fixator reapplication-2, plating and bone grafting-2). Two of these four experienced breakage of 4.5 mm external fixation pins. Eight patients developed pin tract infections, which all resolved with local care and antibiotics. Thirteen patients were contacted at an average of 63 months after injury. Eleven reported they were satisfied with their result, nine had no functional limits, and eight reported no pain. PMID:10847515

Marsh, J L; Mahoney, C R; Steinbronn, D

1999-01-01

310

Dynesys fixation for lumbar spine degeneration  

Microsoft Academic Search

The dynamic fixation system Dynesys is utilized in the last 10 years for treatment of degenerative segmental disease of the\\u000a lumbar spine. Dynesys is a semi-rigid fixation system that allows minimal lengthening and shortening between two segmental\\u000a pedicle screws as opposed to a rigid metal bar. Thus, the system is regarded to maintain stability and near physiological\\u000a motion patterns of the

Matthias Bothmann; Erich Kast; Gerald Jens Boldt; Joachim Oberle

2008-01-01

311

Open pisiform fracture: excision or internal fixation?  

PubMed

A 53-year-old man presented with an open fracture of the pisiform after a fall on his left wrist. Treatment of the patient presented a dilemma between excision of the proximal fragment and internal fixation. The patient underwent internal fixation with a 2.5 cortical screw. At 6 months follow-up the fracture appeared fully consolidated with full functional recovery of the wrist. PMID:23307459

Agathangelidis, Filon; Boutsiadis, Achilleas; Ditsios, Konstantinos

2013-01-01

312

Dinitrogen fixation in the Indian Ocean  

NASA Astrophysics Data System (ADS)

Several lines of geochemical evidence suggest that biological dinitrogen (N2) fixation is a quantitatively important process in the marine nitrogen (N) cycle. However, global and basin-scale rates of N2 fixation remain poorly constrained due to spatial and temporal under-sampling; this is particularly the case in the Indian Ocean (IO). Recent and multiple lines of evidence also suggest that N2 fixation and denitrification may be more closely coupled in space than previously suggested. In the Arabian Sea's (AS) oxygen minimum zone (OMZ), isotopic evidence and N2 supersaturation suggests N2 fixation is a significant process, and new analyses using a nutrient tracer, P*, suggests substantial N2 fixation in surface waters downstream of the AS OMZ. However, despite the geochemical inferences regarding the location and magnitude of N2 fixation in the AS, and the importance of this basin in removing fixed N from the ocean, observations of diazotrophic organisms supporting these conjectures are sparse, and rate measurements are few. The limited observational data available suggest the presence of a diverse group of diazotrophs, including Trichodesmium, cyanobacterial symbionts, and coccoid cyanobacteria. Specific controls on N2 fixation likely vary across the basin in response to external forcing (e.g., seasonal monsoons and upwelling) and inputs (e.g., aeolian and riverine fluxes). To better model the N cycle under current and future (and by extension, past) oceanic conditions, we need a better understanding of where N2 fixation occurs with respect to the OMZ, at what rates, and the physiological and environmental controls on diazotrophy in the IO.

Mulholland, Margaret R.; Capone, Douglas G.

313

Regulation of carbon and electron flow in Propionispira arboris: Relationship of catabolic enzyme levels to carbon substrates fermented during propionate formation via the methylmalony coenzyme a pathway  

SciTech Connect

A detailed study of the glucose fermentation pathway and the modulation of catabolic oxidoreductase activities by energy sources (i.e., glucose versus lactate of fumarate) in Propionispira arboris was performed. {sup 14}C radiotracer data show the CO{sub 2} produced from pyruvate oxidation comes exclusively from the C-3 and C-4 positions of glucose. Significant specific activities of glyceraldehyde-3-phosphate dehydrogenase and fructose-1,6-bisphosphate aldolase were detected, which substantiates the utilization of the Embden-Meyerhoff-Parnas path for glucose metabolism. The methylmalonyl coenzyme A pathway for pyruvate reduction to propionate was established by detection of significant activities of methylmalonyl coenzyme A transcarboxylase, malate dehydrogenase, and fumarate reductase in cell-free extracts and by {sup 13}C nuclear magnetic resonance spectroscpic demonstation of randomization of label from (2-{sup 13}C)pyruvate into positions 2 and 3 of propionate. The specific activity of pyruvate-ferredoxin oxidoreductase, malate dehydrogenase, fumarate reductase, and transcarboxylase varied significantly in cells grown on different energy sources. D-Lactate dehydrogenase (non-NADH linked) was present in cells of P. arboris grown on lactate but not in cells grown on glucose or fumarate. These results indicate that growth substrates regulate synthesis of enzymes specific for the methylmalonyl coenzyme A path initial substrate transformation.

Thompson, T.E. (Univ. of Wisconsin, Madison (USA)); Zeikus, J.G. (Michigan State Univ., East Lansing (USA))

1988-09-01

314

Subduction-Zone Metamorphic Pathway for Deep Carbon Cycling: Evidence from the Italian Alps and the Tianshan  

NASA Astrophysics Data System (ADS)

Depending on the magnitude of the poorly constrained C flux in ultramafic rocks, on a global basis, sediments and altered oceanic crust (AOC) together deliver 70-95% of the C currently entering subduction zones. We are investigating extents of retention and metamorphic release of C in deeply subducted AOC and carbonate-rich sediment represented by HP/UHP meta-ophiolitic and metasedimentary rocks in the Italian Alps and in the Tianshan. Study of metapelite devolatilization in the same W. Alps suite (Bebout et al., 2013, Chem. Geol.) provides a geochemical framework for study of C behavior along prograde P-T paths similar to those experienced in forearcs of most modern subduction margins. Study of veins in the Tianshan affords examination of C mobility in UHP fluids, in later stages as metabasaltic rocks were fragmented in the subduction channel. Our results for sediments and AOC indicate impressive retention of oxidized C (carbonate) and reduced C (variably metamorphosed organic matter) to depths approaching those beneath arc volcanic fronts. In metasedimentary rocks, extensive isotopic exchange between the oxidized and reduced C resulted in shifts in both reservoirs toward upper mantle compositions. Much of the carbonate in metabasalts has C and O isotopic compositions overlapping with those for carbonate in AOC, with some HP/UHP metamorphic veins showing greater influence of organic C signatures from metasedimentary rocks. Calculations of prograde devolatilization histories using Perple-X demonstrate that, in most forearcs, very little decarbonation occurs in the more carbonate-rich rocks unless they are flushed by H2O-rich fluids from an external source, for example, from the hydrated ultramafic section of subducting slabs (cf. Gorman et al., 2006; G3) or from more nearby rocks experiencing dehydration (e.g., metapelites). A comparison of the most recently published thermal models for modern subduction zones (van Keken et al., 2011, JGR) with calculated and experimentally determined phase relations indicates that significant C loss during devolatilization (and partial melting) should occur as subducting sections traverse depths beneath arcs. The extent of C mobility due to carbonate dissolution remains uncertain. On a global basis, imbalance between subducted C input and C return flux by magmatism (excluding ultramafic inputs, ~40×20% of subducted C return via arcs and ~80×20% by all magmatism; Bebout, 2013, Treat. Geochem.) indicates net modern C return to the mantle, perhaps a reversal of Archean net outgassing (despite more rapid subduction). Global C cycle models predict that relatively small (and geologically plausible) change in the subduction/volcanic C flux could significantly affect atmospheric CO2 levels and thus global climate.

Bebout, G. E.; Collins, N.; Cook-Kollars, J.; Angiboust, S.; Agard, P.; Scambelluri, M.; John, T.; Kump, L. R.

2013-12-01

315

Diel nitrogen fixation pattern of Trichodesmium: the interactive control of light and Ni  

PubMed Central

Trichodesmium, a nonheterocystous cyanobacterium widely abundant in the surface water of the tropical and subtropical ocean, fixes dinitrogen under high light conditions while concurrently undergoing photosynthesis. The new production considerably influences the cycling of nitrogen and carbon in the ocean. Here, we investigated how light intensity and nickel (Ni) availability interplay to control daily rates and diel patterns of N2 fixation in Trichodesmium. We found that increasing Ni concentration increased N2 fixation rates by up to 30-fold in the high light treatment. Cultures subjected to high Ni and light levels fixed nitrogen throughout most of the 24 H light:dark regime with the highest rate coinciding with the end of the 12 H light period. Our study demonstrates the importance of Ni on nitrogen fixation rates for Trichodesmium under high light conditions.

Rodriguez, Irene B.; Ho, Tung-Yuan

2014-01-01

316

Direct nitrogen fixation at the edges of graphene nanoplatelets as efficient electrocatalysts for energy conversion  

PubMed Central

Nitrogen fixation is essential for the synthesis of many important chemicals (e.g., fertilizers, explosives) and basic building blocks for all forms of life (e.g., nucleotides for DNA and RNA, amino acids for proteins). However, direct nitrogen fixation is challenging as nitrogen (N2) does not easily react with other chemicals. By dry ball-milling graphite with N2, we have discovered a simple, but versatile, scalable and eco-friendly, approach to direct fixation of N2 at the edges of graphene nanoplatelets (GnPs). The mechanochemical cracking of graphitic C?C bonds generated active carbon species that react directly with N2 to form five- and six-membered aromatic rings at the broken edges, leading to solution-processable edge-nitrogenated graphene nanoplatelets (NGnPs) with superb catalytic performance in both dye-sensitized solar cells and fuel cells to replace conventional Pt-based catalysts for energy conversion.

Jeon, In-Yup; Choi, Hyun-Jung; Ju, Myung Jong; Choi, In Taek; Lim, Kimin; Ko, Jaejung; Kim, Hwan Kyu; Kim, Jae Cheon; Lee, Jae-Joon; Shin, Dongbin; Jung, Sun-Min; Seo, Jeong-Min; Kim, Min-Jung; Park, Noejung; Dai, Liming; Baek, Jong-Beom

2013-01-01

317

Microwave energy fixation for electron microscopy.  

PubMed Central

We have demonstrated that microwave energy (MW) can be used in conjunction with chemical cross-linking agents in order to rapidly fix cell suspensions and tissue blocks for electron microscopy in 7-9 seconds. The optimal MW fixation method involved immersing tissues up to 1 cu cm in dilute aldehyde fixation and immediately irradiating the specimens in a conventional microwave oven for 9 seconds to 50 C. Ultrastructural preservation of samples irradiated by MW energy was comparable to that of the control samples immersed in aldehyde fixative for 2 hours at 25 C. Stereologic analysis showed that tissue blocks fixed by the MW fixation method did not cause organelles such as liver mitochondria and salivary gland granules to shrink or to swell. Potential applications for this new fixation technology include the investigation of rapid intracellular processes (eg, vesicular transport) and preservation of proteins that are difficult to demonstrate with routine fixation methods (eg, antigens and enzymes). Images Figure 4 Figure 5 Figure 2 Figure 3 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11

Login, G. R.; Dvorak, A. M.

1985-01-01

318

Toll like receptor 2 knock-out attenuates carbon tetrachloride (CCl4)-induced liver fibrosis by downregulating MAPK and NF-?B signaling pathways.  

PubMed

Innate immune signaling associated with Toll-like receptors (TLRs) is a key pathway involved in the progression of liver fibrosis. In this study, we reported that TLR2 is required for hepatic fibrogenesis induced by carbon tetrachloride (CCl4). After CCl4 treatment, TLR2(-/-) mice had reduced liver enzyme levels, diminished collagen deposition, decreased inflammatory infiltration and impaired activation of hepatic stellate cells (HSCs) than wild type (WT) mice. Furthermore, after CCl4 treatment, TLR2(-/-) mice demonstrated downregulated expression of profibrotic and proinflammatory genes and impaired mitogen-activated protein kinases (MAPK) and nuclear factor kappa B (NF-?B) activation than WT mice. Collectively, our data indicate that TLR2 deficiency protects against CCl4-induced liver fibrosis. PMID:24815695

Ji, Lingling; Xue, Ruyi; Tang, Wenqing; Wu, Weibin; Hu, Tingting; Liu, Xijun; Peng, Xiaomin; Gu, Jianxin; Chen, She; Zhang, Si

2014-06-01

319

Methane transformation to carbon and hydrogen on Pd(100): Pathways and energetics from density functional theory calculations  

NASA Astrophysics Data System (ADS)

Density functional theory with gradient corrections has been employed to study the reaction pathways and the reaction energetics for the transformations of CH4 to C and H on a Pd(100) surface. On examination of transition state structures identified in each elementary reaction, a clear relationship between the valencies of the CHx fragments and the locations of the transition states emerges. The higher the valency of the CHx fragment, the higher the coordination number of the CHx with the surface atoms. The calculated reaction energetics are in good agreement with the experiments. In addition, calculation results are also used to illustrate an interesting issue concerning the CH3 stability on Pd surfaces.

Zhang, C. J.; Hu, P.

2002-01-01

320

Contribution of dinitrogen fixation to bacterial and primary productivity in the Gulf of Aqaba (Red Sea)  

NASA Astrophysics Data System (ADS)

We evaluated the seasonal contribution of heterotrophic and autotrophic diazotrophy to the total dinitrogen (N2) fixation in a representative pelagic station in the northern Gulf of Aqaba in early spring when the water column was mixed and during summer under full thermal stratification. N2 fixation rates were low during the mixed period (˜ 0.1 nmol N L-1 d-1) and were significantly coupled with both primary and bacterial productivity. During the stratified period N2 fixation rates were four-fold higher (˜ 0.4 nmol N L-1 d-1) and were significantly correlated solely with bacterial productivity. Furthermore, while experimental enrichment of seawater by phosphorus (P) enhanced bacterial productivity and N2 fixation rates during both seasons primary productivity was stimulated by P only in the early spring. Metatranscriptomic analyses from the stratified period identified the major diazotrophic contributors as related to heterotrophic prokaryotes from the Euryarchaeota and Desulfobacterales (Deltaproteobacteria) or Chlorobiales (Chlorobia). Moreover, during this season, experimental amendments to seawater applying a combination of the photosynthetic inhibitor 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and a mixture of amino acids increased both bacterial productivity and N2 fixation rates. Our findings from the northern Gulf of Aqaba indicate a~shift in the diazotrophic community from phototrophic and heterotrophic populations, including small blooms of the cyanobacterium Trichodesmium, in winter/early spring, to predominantly heterotrophic diazotrophs in summer that may be both P and carbon limited as the additions of P and amino acids illustrated.

Rahav, E.; Herut, B.; Mulholland, M. R.; Voß, B.; Stazic, D.; Steglich, C.; Hess, W. R.; Berman-Frank, I.

2013-06-01

321

Single-walled carbon nanotube exposure induces membrane rearrangement and suppression of receptor-mediated signalling pathways in model mast cells.  

PubMed

Carbon nanotubes (CNT) are environmental challenges to the respiratory and gastrointestinal mucosa, and to the dermal immune system. Mast cells (MC) are pro-inflammatory immunocytes that reside at these interfaces with the environment. Mast cells are sources of pro-inflammatory mediators (histamine, serotonin, matrix-active proteases, eicosanoids, prostanoids, cytokines and chemokines), which are released in a calcium-dependent manner following immunological challenge or physico-chemical stimulation. Since C-60 fullerenes, which share geometry with CNT, are suppressive of mast cell-driven inflammatory responses, we explored the effects of unmodified SWCNT aggregates on mast cell signaling pathways, phenotype and pro-inflammatory function. We noted SWCNT suppression of antigen-induced signalling pathways and pro-inflammatory degranulation responses. Mast cells recognize unmodified SWCNT by remodeling the plasma membrane, disaggregating the cortical actin cytoskeleton and relocalizing clathrin. Clathrin was also identified as a component of an affinity-purified 'interactome' isolated from MC using an SWCNT affinity matrix for mast cell lysates. Together, these data are consistent with the ability of SWCNT to suppress mast cell pro-inflammatory function via a novel recognition mechanism. PMID:24910985

Umemoto, Eric Y; Speck, Mark; Shimoda, Lori M N; Kahue, Kara; Sung, Carl; Stokes, Alexander J; Turner, Helen

2014-08-17

322

Genetic evidence of a major role for glucose-6-phosphate dehydrogenase in nitrogen fixation and dark growth of the cyanobacterium Nostoc sp. strain ATCC 29133.  

PubMed Central

Heterocysts, sites of nitrogen fixation in certain filamentous cyanobacteria, are limited to a heterotrophic metabolism, rather than the photoautotrophic metabolism characteristic of cyanobacterial vegetative cells. The metabolic route of carbon catabolism in the supply of reductant to nitrogenase and for respiratory electron transport in heterocysts is unresolved. The gene (zwf) encoding glucose-6-phosphate dehydrogenase (G6PD), the initial enzyme of the oxidative pentose phosphate pathway, was inactivated in the heterocyst-forming, facultatively heterotrophic cyanobacterium, Nostoc sp. strain ATCC 29133. The zwf mutant strain had less than 5% of the wild-type apparent G6PD activity, while retaining wild-type rates of photoautotrophic growth with NH4+ and of dark O2 uptake, but it failed to grow either under N2-fixing conditions or in the dark with organic carbon sources. A wild-type copy of zwf in trans in the zwf mutant strain restored only 25% of the G6PD specific activity, but the defective N2 fixation and dark growth phenotypes were nearly completely complemented. Transcript analysis established that zwf is in an operon also containing genes encoding two other enzymes of the oxidative pentose phosphate cycle, fructose-1,6-bisphosphatase and transaldolase, as well as a previously undescribed gene (designated opcA) that is cotranscribed with zwf. Inactivation of opcA yielded a growth phenotype identical to that of the zwf mutant, including a 98% decrease, relative to the wild type, in apparent G6PD specific activity. The growth phenotype and lesion of G6PD activity in the opcA mutant were complemented in trans with a wild-type copy of opcA. In addition, placement in trans of a multicopy plasmid containing the wild-type copies of both zwf and opcA in the zwf mutant resulted in an approximately 20-fold stimulation of G6PD activity, relative to the wild type, complete restoration of nitrogenase activity, and a slight stimulation of N2-dependent photoautotrophic growth and fructose-supported dark growth. These results unequivocally establish that G6PD, and most likely the oxidative pentose phosphate pathway, represents the essential catabolic route for providing reductant for nitrogen fixation and respiration in differentiated heterocysts and for dark growth of vegetative cells. Moreover, the opcA gene product is involved by an as yet unknown mechanism in G6PD synthesis or catalytic activity.

Summers, M L; Wallis, J G; Campbell, E L; Meeks, J C

1995-01-01

323

Quantum Chemistry Study of Cycloaddition Pathways for the Reaction of o-Benzyne with Fullerenes and Carbon Nanotubes  

NASA Technical Reports Server (NTRS)

Functionalization of fullerenes via the [2+2] cycloaddition reaction with o-benzyne has been demonstrated in the laboratory. In contrast, [2+4) cycloaddition products are formed when benzyne reacts with planar polycyclic aromatic hydrocarbons. Using density functional theory (DFT) calculations with Becke's hybrid functional and small contracted gaussian basis sets, we are able to reproduce these product preferences. The objective of this work is to explore the functionalization of carbon nanotubes. We have studied o-benzyne cycloaddition products with a [14,0] single-walled nanotube. We find both the [2+2] and [2+4] adducts to be stable, with the latter product being somewhat favored.

Jaffe, Richard; Han, Jie; Langhoff, Stephen R. (Technical Monitor)

1997-01-01

324

Fixational saccades reflect volitional action preparation.  

PubMed

Human volitional actions are preceded by preparatory processes, a critical mental process of cognitive control for future behavior. Volitional action preparation is regulated by large-scale neural circuits including the cerebral cortex and the basal ganglia. Because volitional action preparation is a covert process, the network dynamics of such neural circuits have been examined by neuroimaging and recording event-related potentials. Here, we examined whether such covert processes can be measured by the overt responses of fixational saccades (including microsaccades), the largest miniature eye movements that occur during eye fixation. We analyzed fixational saccades while adult humans maintained fixation on a central visual stimulus as they prepared to generate a volitional saccade in response to peripheral stimulus appearance. We used the antisaccade paradigm, in which subjects generate a saccade toward the opposite direction of a peripheral stimulus. Appropriate antisaccade performance requires the following two aspects of volitional control: 1) facilitation of saccades away from the stimulus and 2) suppression of inappropriate saccades toward the stimulus. We found that fixational saccades that occurred before stimulus appearance reflected the dual preparatory states of saccade facilitation and suppression and correlated with behavioral outcome (i.e., whether subjects succeeded or failed to cancel inappropriate saccades toward the stimulus). Moreover, fixational saccades explained a large proportion of individual differences in behavioral performance (poor/excellent) across subjects. These results suggest that fixational saccades predict the outcome of future volitional actions and may be used as a potential biomarker to detect people with difficulties in volitional action preparation. PMID:23636719

Watanabe, Masayuki; Matsuo, Yuka; Zha, Ling; Munoz, Douglas P; Kobayashi, Yasushi

2013-07-01

325

Nitrogen Fixation in Denitrified Marine Waters  

PubMed Central

Nitrogen fixation is an essential process that biologically transforms atmospheric dinitrogen gas to ammonia, therefore compensating for nitrogen losses occurring via denitrification and anammox. Currently, inputs and losses of nitrogen to the ocean resulting from these processes are thought to be spatially separated: nitrogen fixation takes place primarily in open ocean environments (mainly through diazotrophic cyanobacteria), whereas nitrogen losses occur in oxygen-depleted intermediate waters and sediments (mostly via denitrifying and anammox bacteria). Here we report on rates of nitrogen fixation obtained during two oceanographic cruises in 2005 and 2007 in the eastern tropical South Pacific (ETSP), a region characterized by the presence of coastal upwelling and a major permanent oxygen minimum zone (OMZ). Our results show significant rates of nitrogen fixation in the water column; however, integrated rates from the surface down to 120 m varied by ?30 fold between cruises (7.5±4.6 versus 190±82.3 µmol m?2 d?1). Moreover, rates were measured down to 400 m depth in 2007, indicating that the contribution to the integrated rates of the subsurface oxygen-deficient layer was ?5 times higher (574±294 µmol m?2 d?1) than the oxic euphotic layer (48±68 µmol m?2 d?1). Concurrent molecular measurements detected the dinitrogenase reductase gene nifH in surface and subsurface waters. Phylogenetic analysis of the nifH sequences showed the presence of a diverse diazotrophic community at the time of the highest measured nitrogen fixation rates. Our results thus demonstrate the occurrence of nitrogen fixation in nutrient-rich coastal upwelling systems and, importantly, within the underlying OMZ. They also suggest that nitrogen fixation is a widespread process that can sporadically provide a supplementary source of fixed nitrogen in these regions.

Fernandez, Camila; Farias, Laura; Ulloa, Osvaldo

2011-01-01

326

Minimal internal fixation of tibial fractures.  

PubMed

Flexible wire and small pins cause minimal disturbance of osseous blood supply, and introduce minimal foreign material into the wound. Supplemental support by a plaster cast or by traction is required, but the external support can generally be discontinued early for joint mobilization. Several simple auxillary fixation devices extend the usefulness of wire fixation. Removal of metal is not required. Many common fractures of the tibia are amenable to this method of minimal internal fixation. In the diaphysis, long oblique fractures are the most suitable for this application; the firmness of their fixation by cerclage is augmented by muscle pull. Rotation is effectively controlled by a plate which is L-shaped in cross section, and is held in position by cerclage. In the metaphysis, articular fractures of the knee and ankle are securely fixed by a flattened loop of wire and two washers (wire-washer set), supplemented sometimes by pins or hand-made staples. Two pins alone provide excellent fixation of the medial malleolus. A single pin, or a single wire loop through drill holes, may be sufficient to impart stability to an unstable tibial fracture. A key-type graft of iliac bone, maintained by crossed wire loops through cortical drill holes, is effective in the tibial diaphysis. Autogenous iliac cancellous chips provide minimal and effective internal fixation for an infected ununited fracture of the tibia. The surgical instrument most important for making wire fixation highly successful is a tightener-twister which protects wire loops from excessive strain during application, and permits twisting at a predetermined and therefore reproducible tension. Other special and ordinary instruments are valuable assets. PMID:1093765

Rhinelander, F W

1975-01-01

327

Carbon isotopic composition, methanogenic pathway, and fraction of CH4 oxidized in a rice field flooded year-round  

NASA Astrophysics Data System (ADS)

Values of ?13C were investigated of CH4 trapped in the soil pore water and floodwater of and emitted from a rice field under continuous flooding throughout the fallow and following rice seasons, and CH4 produced via different pathways and fraction of CH4 oxidized was calculated by using the isotopic data. Pore water CH4 was relatively 13C depleted, with ?13C values about -65‰ over the season except between July and August (around -55‰). Also, hydrogenotrophic methanogenesis was very important (around 50%) for most of the season, while acetoclastic methanogenesis dominated (about 70%) only between July and August. Floodwater CH4 was heavier in ?13C value (from -50‰ to -34‰) than pore water CH4 (from -68‰ to -54‰) over the season, demonstrating that it is highly influenced by methanotrophy. The ?13C value of emitted CH4was negatively correlated with flux in temporal variation (P <0.05), and it was more positive in the fallow season (between -56‰ and -44‰) than in the rice season (between -68‰ and -48‰). This indicates that plant-mediated CH4 transport is probably a more important pathway and causes less CH4 oxidation during the rice season than during the fallow season, which is further confirmed by the fraction of CH4 oxidized being generally greater in the fallow season (60%-90%) than in the rice season (10%-80%). These findings suggest a low contribution of acetoclastic methanogenesis and a high fraction of CH4 being oxidized in the field, especially in the fallow season.

Zhang, Guangbin; Zhang, Xiaoyan; Ji, Yang; Ma, Jing; Xu, Hua; Cai, Zucong

2011-12-01

328

Reduction of furan derivatives by overexpressing NADH-dependent Adh1 improves ethanol fermentation using xylose as sole carbon source with Saccharomyces cerevisiae harboring XR-XDH pathway.  

PubMed

Several alcohol dehydrogenase (ADH)-related genes have been identified as enzymes for reducing levels of toxic compounds, such as, furfural and/or 5-hydroxymethylfurfural (5-HMF), in hydrolysates of pretreated lignocelluloses. To date, overexpression of these ADH genes in yeast cells have aided ethanol production from glucose or glucose/xylose mixture in the presence of furfural or 5-HMF. However, the effects of these ADH isozymes on ethanol production from xylose as a sole carbon source remain uncertain. We showed that overexpression of mutant NADH-dependent ADH1 derived from TMB3000 strain in the recombinant Saccharomyces cerevisiae, into which xylose reductase (XR) and xylitol dehydrogenase (XDH) pathway of Pichia stipitis has been introduced, improved ethanol production from xylose as a sole carbon source in the presence of 5-HMF. Enhanced furan-reducing activity is able to regenerate NAD(+) to relieve redox imbalance, resulting in increased ethanol yield arising from decreased xylitol accumulation. In addition, we found that overexpression of wild-type ADH1 prevented the more severe inhibitory effects of furfural in xylose fermentation as well as overexpression of TMB3000-derived mutant. After 120 h of fermentation, the recombinant strains overexpressing wild-type and mutant ADH1 completely consumed 50 g/L xylose in the presence of 40 mM furfural and most efficiently produced ethanol (15.70 g/L and 15.24 g/L) when compared with any other test conditions. This is the first report describing the improvement of ethanol production from xylose as the sole carbon source in the presence of furan derivatives with xylose-utilizing recombinant yeast strains via the overexpression of ADH-related genes. PMID:23001007

Ishii, Jun; Yoshimura, Kazuya; Hasunuma, Tomohisa; Kondo, Akihiko

2013-03-01

329

The importance of regulation of nitrogen fixation  

NASA Astrophysics Data System (ADS)

I am not a proponent of including more detail in models simply because it makes them more realistic. More complexity increases the difficulty of model interpretation, so it only makes sense to include complexity if its benefit exceeds its costs. Biological nitrogen (N) fixation (BNF) is one process for which I feel the benefits of including greater complexity far outweigh the costs. I don't think that just because I work on BNF; I work on BNF because I think that. BNF, a microbial process carried out by free-living and symbiotic microbes, is the dominant N input to many ecosystems, the primary mechanism by which N deficiency can feed back to N inputs, and a main mechanism by which N surplus can develop. The dynamics of BNF, therefore, have huge implications for the rate of carbon uptake and the extent of CO2 fertilization, as well as N export to waterways and N2O emissions to the atmosphere. Unfortunately, there are serious deficiencies in our understanding of BNF. One main deficiency in our understanding is the extent to which various symbiotic N fixing organisms respond to imbalanced nutrition. Theory suggests that these responses, which I will call "strategies," have fundamental consequences for N fixer niches and ecosystem-level N and C cycling. Organisms that fix N regardless of whether they need it, a strategy that I will call "obligate," occupy post-disturbance niches and rapidly lead to N surplus. On the contrary, organisms that only fix as much N as they need, a "facultative" strategy, can occupy a wider range of successional niches, do not produce surplus N, and respond more rapidly to increased atmospheric CO2. In this talk I will show new results showing that consideration of these strategies could on its own explain the latitudinal distribution of symbiotic N fixing trees in North America. Specifically, the transition in N-fixing tree abundance from ~10% of basal area south of 35° latitude to ~1% of basal area north of 35° latitude that we observe from systematic forest inventory data can be explained by a concomitant switch from predominantly facultative N-fixing trees to predominantly obligate N-fixing trees. This transition in the dominant N-fixing strategy would have important consequences for the rate at which CO2 fertilization can occur and the extent of N surplus in different biomes. These theoretical and forest inventory results suggest that greater knowledge of BNF strategies would greatly increase our understanding of the distribution of N fixers and ecosystem responses to global change. I will finish the talk with a brief literature synthesis that attempts to draw generalizations about BNF strategies. With the limited data available, actinorhizal symbioses in temperate environments appear to be obligate but rhizobial symbioses appear to employ different strategies in different environments. From these results it is unclear whether the strategy is more strongly influenced by the microbes, the plants, or the environments in which the symbiosis has evolved; answering this question would point toward the best ways to incorporate N fixation into global ecosystem models.

Menge, D. N.

2012-12-01

330

Intramedullary fixation for pediatric unstable forearm fractures.  

PubMed

Forty-nine children with diaphyseal both-bone forearm fractures were treated with either both-bone intramedullary wire fixation (24), single ulnar intramedullary wire fixation (22), or single radial intramedullary wire fixation (3). Six fractures were open and 43 were closed. A limited open approach to one or both bones was necessary for insertion of the intramedullary wire in 10 of 43 closed fractures. All both-bone and single radial intramedullary wire fixations healed with less than 5 degrees angulation. Progressive reangulation of the nonfixed radial fracture after an initial satisfactory reduction was seen in seven of the 22 fractures treated with single ulnar intramedullary wire fixation. In four patients, the reangulation was controlled by a change of cast and molding of the fracture and was between 8 degrees and 12 degrees at union. In two other patients a second operative procedure was required to reduce and internally fix the radius. One fracture healed with a radial angulation of 25 degrees. Three fractures in older patients showed late reangulation after early removal of intramedullary wires at 5 weeks. The results of the current study suggest that the radius and ulna should be stabilized with intramedullary wires and that the wires should be buried to reduce the need for early removal. PMID:12218490

Lee, S; Nicol, R O; Stott, N S

2002-09-01

331

Visuomotor transformation for interception: catching while fixating.  

PubMed

Catching a ball involves a dynamic transformation of visual information about ball motion into motor commands for moving the hand to the right place at the right time. We previously formulated a neural model for this transformation to account for the consistent leftward movement biases observed in our catching experiments. According to the model, these biases arise within the representation of target motion as well as within the transformation from a gaze-centered to a body-centered movement command. Here, we examine the validity of the latter aspect of our model in a catching task involving gaze fixation. Gaze fixation should systematically influence biases in catching movements, because in the model movement commands are only generated in the direction perpendicular to the gaze direction. Twelve participants caught balls while gazing at a fixation point positioned either straight ahead or 14 degrees to the right. Four participants were excluded because they could not adequately maintain fixation. We again observed a consistent leftward movement bias, but the catching movements were unaffected by fixation direction. This result refutes our proposal that the leftward bias partly arises within the visuomotor transformation, and suggests instead that the bias predominantly arises within the early representation of target motion, specifically through an imbalance in the represented radial and azimuthal target motion. PMID:19543722

Dessing, Joost C; Oostwoud Wijdenes, Leonie; Peper, C E; Beek, Peter J

2009-07-01

332

The Fixation and Saccade P3  

PubMed Central

Although most instances of object recognition during natural viewing occur in the presence of saccades, the neural correlates of objection recognition have almost exclusively been examined during fixation. Recent studies have indicated that there are post-saccadic modulations of neural activity immediately following eye movement landing; however, whether post-saccadic modulations affect relatively late occurring cognitive components such as the P3 has not been explored. The P3 as conventionally measured at fixation is commonly used in brain computer interfaces, hence characterizing the post-saccadic P3 could aid in the development of improved brain computer interfaces that allow for eye movements. In this study, the P3 observed after saccadic landing was compared to the P3 measured at fixation. No significant differences in P3 start time, temporal persistence, or amplitude were found between fixation and saccade trials. Importantly, sensory neural responses canceled in the target minus distracter comparisons used to identify the P3. Our results indicate that relatively late occurring cognitive neural components such as the P3 are likely less sensitive to post saccadic modulations than sensory neural components and other neural activity occurring shortly after eye movement landing. Furthermore, due to the similarity of the fixation and saccade P3, we conclude that the P3 following saccadic landing could possibly be used as a viable signal in brain computer interfaces allowing for eye movements.

Dandekar, Sangita; Ding, Jian; Privitera, Claudio; Carney, Thom; Klein, Stanley A.

2012-01-01

333

Electron microscopy of endocytic pathways.  

PubMed

Detailed insight into the fine structure and 3D-architecture of the complex and dynamic compartments of the endocytic system is essential for a morpho-functional analysis of retrograde traffic from the cell surface to different intracellular destinations. Here, we describe a cytochemical approach for electron microscopic exploration of endocytic pathways with the use of wheat germ agglutinin (WGA) in combination with either conventional chemical fixation or ultrafast physical fixation of the cells by high pressure-freezing. Horseradish peroxidase-labeled WGA endocytozed by human hepatoma cells for various periods of time served as a marker. Its intracellular routes were visualized by means of diaminobenzidine oxidation either done conventionally after chemical fixation or in living cells prior to physical fixation. The latter protocol permits the combination of peroxidase-catalyzed cytochemistry with high pressure-freezing (HPF), which is state of the art for ultrastructural studies of complex and dynamic organelles at high spatial and temporal resolutions. The technique yields distinct cytochemical reactions and excellently preserved fine structures well qualified for detailed electron microscopic and 3D-studies of the complex endocytic architectures. PMID:23027016

Ranftler, Carmen; Auinger, Peter; Meisslitzer-Ruppitsch, Claudia; Ellinger, Adolf; Neumüller, Josef; Pavelka, Margit

2013-01-01

334

Drought effects on carbon and nitrogen metabolism of pea nodules can be mimicked by paraquat: evidence for the occurrence of two regulation pathways under oxidative stresses  

Microsoft Academic Search

Biological nitrogen fixation (BNF) is dramatically af- fected by environmental constraints such as water stress or heavy metals. It has been reported that these stresses induce the over-production of reactive oxygen species (ROS) and, in turn, oxidative stress that may be responsible for the above-mentioned BNF decline at the molecular level. Oxidative stress, occurring under dif- ferent environmental stresses, has

Daniel Marino; Esther M. Gonzalez; Cesar Arrese-Igor

2006-01-01

335

Hydrologic Control on Bacterial Nitrogen Fixation in the Holocene Black Sea  

NASA Astrophysics Data System (ADS)

Stratified oceans of the Phanerozoic Oceanic Anoxic Events apparently were dominated by bacterial nitrogen fixation. Decreased marine N:P nutrient ratios resulting from increased denitrification and decreased phosphate burial efficiency under anoxic waters drove this nutrient regime. This model is upheld by the presence of cyanobacterial hopanoid biomarkers in sedimentary records and ?15N values indicative of nitrogen fixation. However, in the largest modern redox-stratified marine basin, the Black Sea, bacterial nitrogen fixation seems to be only a minor contributor to the nitrogen cycle. In this study, we use geochemical proxies to evaluate the role of bacterial nitrogen fixation during the deposition of the Holocene Black Sea sapropel, starting 7.8 ka. We report compound-specific nitrogen and carbon stable isotope values of pyropheophytin a, a chlorophyll degradation product, and bacteriochlorophyll e produced by green sulfur bacteria. We also present the surprising finding of scytonemin, a pigment produced only by filamentous cyanobacteria exposed to ultraviolet radiation, in certain intervals in these sediments. In the Holocene, nitrogen fixation in the Black Sea is most prominent during times of reduced river water influx. This directly decreases the external flux of nitrate into the surface waters. Reduced freshwater influx also decreases the volume of low salinity water dispersed around the sea by the Rim Current, allowing the chemocline to shoal along the margins. Previous geochemical studies have described this changing chemocline geometry. The exposure of shallow water sediments to anoxic waters further stimulates nitrogen fixation by releasing more phosphorus to the system. Nitrogen fixation is recorded in the sediments as bulk and compound-specific pyropheophytin a ?15N values near 0 ‰ and -5 ‰, respectively. We have also detected scytonemin in two intervals characterized by especially low ?15N values. This compound suggests abundant filamentous cyanobacteria were living at the sea surface, a marked ecological shift from modern phytoplankton distributions. These data support the hypothesis that bacterial nitrogen fixation, at times, contributed significantly to the Black Sea nitrogen cycle. Interestingly, nitrogen fixation did not dominate the entire time period of sapropel sedimentation and stable stratification. Normal marine ?15N values coincide with periods of Black Sea level high stand and a deeper marginal chemocline.

Fulton, J. M.; Arthur, M. A.; Freeman, K. H.

2008-12-01

336

Thermus oshimai JL-2 and T. thermophilus JL-18 genome analysis illuminates pathways for carbon, nitrogen, and sulfur cycling.  

PubMed

The complete genomes of Thermus oshimai JL-2 and T. thermophilus JL-18 each consist of a circular chromosome, 2.07 Mb and 1.9 Mb, respectively, and two plasmids ranging from 0.27 Mb to 57.2 kb. Comparison of the T. thermophilus JL-18 chromosome with those from other strains of T. thermophilus revealed a high degree of synteny, whereas the megaplasmids from the same strains were highly plastic. The T. oshimai JL-2 chromosome and megaplasmids shared little or no synteny with other sequenced Thermus strains. Phylogenomic analyses using a concatenated set of conserved proteins confirmed the phylogenetic and taxonomic assignments based on 16S rRNA phylogenetics. Both chromosomes encode a complete glycolysis, tricarboxylic acid (TCA) cycle, and pentose phosphate pathway plus glucosidases, glycosidases, proteases, and peptidases, highlighting highly versatile heterotrophic capabilities. Megaplasmids of both strains contained a gene cluster encoding enzymes predicted to catalyze the sequential reduction of nitrate to nitrous oxide; however, the nitrous oxide reductase required for the terminal step in denitrification was absent, consistent with their incomplete denitrification phenotypes. A sox gene cluster was identified in both chromosomes, suggesting a mode of chemolithotrophy. In addition, nrf and psr gene clusters in T. oshmai JL-2 suggest respiratory nitrite ammonification and polysulfide reduction as possible modes of anaerobic respiration. PMID:24019992

Murugapiran, Senthil K; Huntemann, Marcel; Wei, Chia-Lin; Han, James; Detter, J C; Han, Cliff; Erkkila, Tracy H; Teshima, Hazuki; Chen, Amy; Kyrpides, Nikos; Mavrommatis, Konstantinos; Markowitz, Victor; Szeto, Ernest; Ivanova, Natalia; Pagani, Ioanna; Pati, Amrita; Goodwin, Lynne; Peters, Lin; Pitluck, Sam; Lam, Jenny; McDonald, Austin I; Dodsworth, Jeremy A; Woyke, Tanja; Hedlund, Brian P

2013-01-01

337

Thermus oshimai JL-2 and T. thermophilus JL-18 genome analysis illuminates pathways for carbon, nitrogen, and sulfur cycling  

PubMed Central

The complete genomes of Thermus oshimai JL-2 and T. thermophilus JL-18 each consist of a circular chromosome, 2.07 Mb and 1.9 Mb, respectively, and two plasmids ranging from 0.27 Mb to 57.2 kb. Comparison of the T. thermophilus JL-18 chromosome with those from other strains of T. thermophilus revealed a high degree of synteny, whereas the megaplasmids from the same strains were highly plastic. The T. oshimai JL-2 chromosome and megaplasmids shared little or no synteny with other sequenced Thermus strains. Phylogenomic analyses using a concatenated set of conserved proteins confirmed the phylogenetic and taxonomic assignments based on 16S rRNA phylogenetics. Both chromosomes encode a complete glycolysis, tricarboxylic acid (TCA) cycle, and pentose phosphate pathway plus glucosidases, glycosidases, proteases, and peptidases, highlighting highly versatile heterotrophic capabilities. Megaplasmids of both strains contained a gene cluster encoding enzymes predicted to catalyze the sequential reduction of nitrate to nitrous oxide; however, the nitrous oxide reductase required for the terminal step in denitrification was absent, consistent with their incomplete denitrification phenotypes. A sox gene cluster was identified in both chromosomes, suggesting a mode of chemolithotrophy. In addition, nrf and psr gene clusters in T. oshmai JL-2 suggest respiratory nitrite ammonification and polysulfide reduction as possible modes of anaerobic respiration.

Murugapiran, Senthil K.; Huntemann, Marcel; Wei, Chia-Lin; Han, James; Detter, J. C.; Han, Cliff; Erkkila, Tracy H.; Teshima, Hazuki; Chen, Amy; Kyrpides, Nikos; Mavrommatis, Konstantinos; Markowitz, Victor; Szeto, Ernest; Ivanova, Natalia; Pagani, Ioanna; Pati, Amrita; Goodwin, Lynne; Peters, Lin; Pitluck, Sam; Lam, Jenny; McDonald, Austin I.; Dodsworth, Jeremy A.; Woyke, Tanja; Hedlund, Brian P.

2013-01-01

338

Remodulation of central carbon metabolic pathway in response to arsenite exposure in Rhodococcus sp. strain NAU-1.  

PubMed

Arsenite-tolerant bacteria were isolated from an organic farm of Navsari Agricultural University (NAU), Gujarat, India (Latitude: 20°55'39.04?N; Longitude: 72°54'6.34?E). One of the isolates, NAU-1 (aerobic, Gram-positive, non-motile, coccobacilli), was hyper-tolerant to arsenite (As(III), 23?mM) and arsenate (As(V), 180?mM). 16S rRNA gene of NAU-1 was 99% similar to the 16S rRNA genes of Rhodococcus (Accession No. HQ659188). Assays confirmed the presence of membrane bound arsenite oxidase and cytoplasmic arsenate reductase in NAU-1. Genes for arsenite transporters (arsB and ACR3(1)) and arsenite oxidase gene (aoxB) were confirmed by PCR. Arsenite oxidation and arsenite efflux genes help the bacteria to tolerate arsenite. Specific activities of antioxidant enzymes (catalase, ascorbate peroxidase, superoxide dismutase and glutathione S-transferase) increased in dose-dependent manner with arsenite, whereas glutathione reductase activity decreased with increase in As(III) concentration. Metabolic studies revealed that Rhodococcus NAU-1 produces excess of gluconic and succinic acids, and also activities of glucose dehydrogenase, phosphoenol pyruvate carboxylase and isocitrate lyase were increased, to cope with the inhibited activities of glucose-6-phosphate dehydrogenase, pyruvate dehydrogenase and ?-ketoglutarate dehydrogenase enzymes respectively, in the presence of As(III). Enzyme assays revealed the increase in direct oxidative and glyoxylate pathway in Rhodococcus NAU-1 in the presence of As(III). PMID:23062201

Jain, Raina; Adhikary, Hemanta; Jha, Sanjay; Jha, Anamika; Kumar, G Naresh

2012-11-01

339

Modeling of 137Cs fixation in soils  

NASA Astrophysics Data System (ADS)

The analysis of existing models of 137Cs fixation in soils is presented. It is argued that the most adequate description of the experimental data is provided by the diffusion model. The main advantages of this model are the low number of parameters and the possibility to predict long-term trends in 137Cs fixation on the basis of the results of short-term laboratory experiments. According to the diffusion model, the content of exchangeable radiocesium in different soils reaches a quasi-equilibrium state in a period from several months to several years; after this, the radiocesium mobility in the soils remains stable for a long time. However, the analysis of the main forms of stable and radioactive Cs in soils shows that there may be a second stage of 137Cs fixation leading to a gradual decrease in its mobility with a characteristic time of several decades.

Bulgakov, A. A.

2009-06-01

340

Rapid two-temperature formalin fixation.  

PubMed

Formalin fixation is a mainstay of modern histopathologic analysis, yet the practice is poorly standardized and a significant potential source of preanalytical errors. Concerns of workflow and turnaround time drive interest in developing shorter fixation protocols, but rapid protocols can lead to poor histomorphology or inadequate downstream assay results. Additionally, assays such as immunohistochemistry for phosphorylated epitopes have historically been challenging in the context of formalin-fixed tissue, indicating that there may be room for improvement in this process that is fundamental to the practice of anatomic pathology. With these issues in mind, we studied basic formalin biochemistry to develop a novel formalin fixation protocol that involves a pre-incubation in subambient temperature formalin prior to a brief exposure to heated formalin. This new protocol is more rapid than standard protocols yet preserves histomorphology and yields tissue that is compatible with an expanded set of downstream clinical and research assays, including immunohistochemistry for phosphorylated epitopes. PMID:23349806

Chafin, David; Theiss, Abbey; Roberts, Esteban; Borlee, Grace; Otter, Michael; Baird, Geoffrey S

2013-01-01

341

LCP external fixation - External application of an internal fixator: two cases and a review of the literature  

PubMed Central

The locking compression plate (LCP) is an angle-stable fixator intended for intracorporeal application. In selected cases, it can be applied externally in an extracorporeal location to function as a monolateral external fixator. We describe one patient with Schatzker V tibial plateau fracture and one patient with Gustillo IIIB open tibia shaft fracture treated initially with traditional external fixation for whom exchange fixation with externally applied LCPs was performed. The first case went on to bony union while the second case required bone grafting for delayed union. Both patients found that the LCP external fixators facilitated mobilization and were more manageable and aesthetically acceptable than traditional bar-Schanz pin fixators.

2010-01-01

342

Mass-spectrometric evidence for the double-carboxylation pathway of malate synthesis by Crassulacean acid metabolism plants in light.  

PubMed

Phyllodia of the Crassulacean acid metabolism (CAM) plant Kalanchoë tubiflora were allowed to fix (13)CO2 in light and darkness during phase IV of the diurnal CAM cycle, and during prolongation of the regular light period. After (13)CO2 fixation in darkness, only singly labelled [(13)C]malate molecules were found. Fixation of (13)CO2 under illumination, however, produced singly labelled malate as well as malate molecules which carried label in two, three or four carbon atoms. When the irradiance during (13)CO2 fixation was increased, the proportion of singly labelled malate decreased in favour of plurally labelled malate. The irradiance, however, did not change either the ratio of labelled to unlabelled malate molecules found in the tissue after the (13)CO2 application, or the magnitude of malate accumulation during the treatment with label. The ability of the tissue to store malate and the labelling pattern changed throughout the duration of the prolonged light period. The results indicate that malate synthesis by CAM plants in light can proceed via a pathway containing two carboxylation steps, namely ribulose-1,5-bisphosphate-carboxylase/oxygenase (EC 4.1.1.39) and phosphoenolpyruvate carboxylase (EC 4.1.1.31) which operate in series and share common intermediates. It can be concluded that, in light, phosphoenolpyruvate carboxylase can also synthesize malate independently of the proceeding carboxylation step by ribulose-1,5-bisphosphate carboxylase/oxygenase. PMID:24241864

Ritz, D; Kluge, M; Veith, H J

1986-02-01

343

Cupid fixation for repositioning subluxated intraocular lens.  

PubMed

We describe the cupid fixation technique, which allows safe repositioning of a subluxated intraocular lens (IOL). Under subconjunctival anesthesia, the body of the subluxated IOL is perforated with a 10-0 polypropylene suture on a straight needle. The IOL is then centered and fixated at the sclera overlying the ciliary sulcus; the knot is tied beneath a previously created limbal intrascleral pocket. No intraoperative complications occurred in 24 cases in which the technique was performed, and successful IOL centration was achieved. PMID:21855756

Domingues, Manuel; Brito, Pedro; Falcão, Manuel; Monteiro, Tiago; Falcão-Reis, Fernando

2011-09-01

344

Scleral fixation of a foldable intraocular lens.  

PubMed

Scleral fixation has become more popular and is now performed by surgeons all over the world. At present, there are no available foldable intraocular lenses (IOLs) with holes that would enable tying a suture on to their haptic. We describe a method for using an available 3-piece acrylic foldable IOL with PMMA haptics for scleral fixation. This enables surgeons to benefit from the advantages of a small incision in cases when there is no need to exchange a previously implanted rigid IOL. PMID:12027112

Michaeli-Cohen, Adi; Rootman, David S

2002-01-01

345

EST-analysis of the thermo-acidophilic red microalga Galdieria sulphuraria reveals potential for lipid A biosynthesis and unveils the pathway of carbon export from rhodoplasts.  

PubMed

When we think of extremophiles, organisms adapted to extreme environments, prokaryotes come to mind first. However, the unicellular red micro-alga Galdieria sulphuraria (Cyanidiales) is a eukaryote that can represent up to 90% of the biomass in extreme habitats such as hot sulfur springs with pH values of 0-4 and temperatures of up to 56 degrees C. This red alga thrives autotrophically as well as heterotrophically on more than 50 different carbon sources, including a number of rare sugars and sugar alcohols. This biochemical versatility suggests a large repertoire of metabolic enzymes, rivaled by few organisms and a potentially rich source of thermo-stable enzymes for biotechnology. The temperatures under which this organism carries out photosynthesis are at the high end of the range for this process, making G. sulphuraria a valuable model for physical studies on the photosynthetic apparatus. In addition, the gene sequences of this living fossil reveal much about the evolution of modern eukaryotes. Finally, the alga tolerates high concentrations of toxic metal ions such as cadmium, mercury, aluminum, and nickel, suggesting potential application in bioremediation. To begin to explore the unique biology of G. sulphuraria , 5270 expressed sequence tags from two different cDNA libraries have been sequenced and annotated. Particular emphasis has been placed on the reconstruction of metabolic pathways present in this organism. For example, we provide evidence for (i) a complete pathway for lipid A biosynthesis; (ii) export of triose-phosphates from rhodoplasts; (iii) and absence of eukaryotic hexokinases. Sequence data and additional information are available at http://genomics.msu.edu/galdieria. PMID:15604662

Weber, Andreas P M; Oesterhelt, Christine; Gross, Wolfgang; Bräutigam, Andrea; Imboden, Lori A; Krassovskaya, Inga; Linka, Nicole; Truchina, Julia; Schneidereit, Jörg; Voll, Hildegard; Voll, Lars M; Zimmermann, Marc; Jamai, Aziz; Riekhof, Wayne R; Yu, Bin; Garavito, R Michael; Benning, Christoph

2004-05-01

346

Increase in cell motility by carbon ion irradiation via the Rho signaling pathway and its inhibition by the ROCK inhibitor Y-27632 in lung adenocarcinoma A549 cells.  

PubMed

This study aimed to investigate the effect of carbon ion (C-ion) irradiation on cell motility through the ras homolog gene family member (Rho) signaling pathway in the human lung adenocarcinoma cell line A549. Cell motility was assessed by a wound-healing assay, and the formation of cell protrusions was evaluated by F-actin staining. Cell viability was examined by the WST-1 assay. The expression of myosin light chain 2 (MLC2) and the phosphorylation of MLC2 at Ser19 (P-MLC2-S19) were analyzed by Western blot. At 48 h after irradiation, the wound-healing assay demonstrated that migration was significantly greater in cells irradiated with C-ion (2 or 8 Gy) than in unirradiated cells. Similarly, F-actin staining showed that the formation of protrusions was significantly increased in cells irradiated with C-ion (2 or 8 Gy) compared with unirradiated cells. The observed increase in cell motility due to C-ion irradiation was similar to that observed due to X-ray irradiation. Western-blot analysis showed that C-ion irradiation (8 Gy) increased P-MLC2-S19 expression compared with in unirradiated controls, while total MLC2 expression was unchanged. Exposure to a non-toxic concentration of Y-27632, a specific inhibitor of Rho-associated coiled-coil-forming protein kinase (ROCK), reduced the expression of P-MLC2-S19 after C-ion irradiation (8 Gy), resulting in a significant reduction in migration. These data suggest that C-ion irradiation increases cell motility in A549 cells via the Rho signaling pathway and that ROCK inhibition reduces that effect. PMID:24659807

Murata, Kazutoshi; Noda, Shin-Ei; Oike, Takahiro; Takahashi, Akihisa; Yoshida, Yukari; Suzuki, Yoshiyuki; Ohno, Tatsuya; Funayama, Tomoo; Kobayashi, Yasuhiko; Takahashi, Takeo; Nakano, Takashi

2014-07-01

347

Epithelial-mesenchymal transition involved in pulmonary fibrosis induced by multi-walled carbon nanotubes via TGF-beta/Smad signaling pathway.  

PubMed

Multi-walled carbon nanotubes (MWCNT) are a typical nanomaterial with a wide spectrum of commercial applications. Inhalation exposure to MWCNT has been linked with lung fibrosis and mesothelioma-like lesions commonly seen with asbestos. In this study, we examined the pulmonary fibrosis response to different length of MWCNT including short MWCNT (S-MWCNT, length=350-700nm) and long MWCNT (L-MWCNT, length=5-15?m) and investigated whether the epithelial-mesenchymal transition (EMT) occurred during MWCNT-induced pulmonary fibrosis. C57Bl/6J male mice were intratracheally instilled with S-MWCNT or L-WCNT by a single dose of 60?g per mouse, and the progress of pulmonary fibrosis was evaluated at 7, 28 and 56 days post-exposure. The in vivo data showed that only L-MWCNT increased collagen deposition and pulmonary fibrosis significantly, and approximately 20% of pro-surfactant protein-C positive epithelial cells transdifferentiated to fibroblasts at 56 days, suggesting the occurrence of EMT. In order to understand the mechanism, we used human pulmonary epithelial cell line A549 to investigate the role of TGF-?/p-Smad2 signaling pathway in EMT. Our results showed that L-MWCNT downregulated E-cadherin and upregulated ?-smooth muscle actin (?-SMA) protein expression in A549 cells. Taken together, both in vivo and in vitro study demonstrated that respiratory exposure to MWCNT induced length dependent pulmonary fibrosis and epithelial-derived fibroblasts via TGF-?/Smad pathway. PMID:24530353

Chen, Tian; Nie, Haiyu; Gao, Xin; Yang, Jinglin; Pu, Ji; Chen, Zhangjian; Cui, Xiaoxing; Wang, Yun; Wang, Haifang; Jia, Guang

2014-04-21

348

Physical forcing of nitrogen fixation and diazotroph community structure in the North Pacific subtropical gyre  

NASA Astrophysics Data System (ADS)

Dinitrogen (N2) fixing microorganisms (termed diazotrophs) exert important control on the ocean carbon cycle. However, despite increased awareness on the roles of these microorganisms in ocean biogeochemistry and ecology, the processes controlling variability in diazotroph distributions, abundances, and activities remain largely unknown. In this study, we examine 3 years (2004-2007) of approximately monthly measurements of upper ocean diazotroph community structure and rates of N2 fixation at Station ALOHA (22°45'N, 158°W), the field site for the Hawaii Ocean Time-series program in the central North Pacific subtropical gyre (NPSG). The structure of the N2-fixing microorganism assemblage varied widely in time with unicellular N2-fixing microorganisms frequently dominating diazotroph abundances in the late winter and early spring, while filamentous microorganisms (specifically various heterocyst-forming cyanobacteria and Trichodesmium spp.) fluctuated episodically during the summer. On average, a large fraction (˜80%) of the daily N2 fixation was partitioned into the biomass of <10 ?m microorganisms. Rates of N2 fixation were variable in time, with peak N2 fixation frequently coinciding with periods when heterocystous N2-fixing cyanobacteria were abundant. During the summer months when sea surface temperatures exceeded 25.2°C and concentrations of nitrate plus nitrite were at their annual minimum, rates of N2 fixation often increased during periods of positive sea surface height anomalies, as reflected in satellite altimetry. Our results suggest mesoscale physical forcing may comprise an important control on variability in N2 fixation and diazotroph community structure in the NPSG.

Church, Matthew J.; Mahaffey, Claire; Letelier, Ricardo M.; Lukas, Roger; Zehr, Jonathan P.; Karl, David M.

2009-06-01

349

Nitrite fixation by humic substances: Nitrogen-15 nuclear magnetic resonance evidence for potential intermediates in chemodenitrification  

USGS Publications Warehouse

Studies have suggested that NO2/-, produced during nitrification and denitrification, can become incorporated into soil organic matter and, in one of the processes associated with chemodenitrification, react with organic matter to form trace N gases, including N2O. To gain an understanding of the nitrosation chemistry on a molecular level, soil and aquatic humic substances were reacted with 15N-labeled NaNO2, and analyzed by liquid phase 15N and 13C nuclear magnetic resonance (NMR). The International Humic Substances Society (IHSS) Pahokee peat and peat humic acid were also reacted with Na15NO2 and analyzed by solid-state 15N NMR. In Suwannee River, Armadale, and Laurentian fulvic acids, phenolic rings and activated methylene groups underwent nitrosation to form nitrosophenols (quinone monoximes) and ketoximes, respectively. The oximes underwent Beckmann rearrangements to 2??amides, and Beckmann fragmentations to nitriles. The nitriles in turn underwent hydrolysis to 1??amides. Peaks tentatively identified as imine, indophenol, or azoxybenzene nitrogens were clearly present in spectra of samples nitrosated at pH 6 but diminished at pH 3. The 15N NMR spectrum of the peat humic acid exhibited peaks corresponding with N-nitroso groups in addition to nitrosophenols, ketoximes, and secondary Beckmann reaction products. Formation of N-nitroso groups was more significant in the whole peat compared with the peat humic acid. Carbon-13 NMR analyses also indicated the occurrence of nitrosative demethoxylation in peat and soil humic acids. Reaction of 15N-NH3 fixated fulvic acid with unlabeled NO2/- resulted in nitrosative deamination of aminohydroquinone N, suggesting a previously unrecognized pathway for production of N2 gas in soils fertilized with NH3.Studies have suggested that NO2-, produced during nitrification and denitrification, can become incorporated into soil organic matter and, in one of the processes associated with chemodenitrification, react with organic matter to form trace N gases, including N2O. To gain an understanding of the nitrosation chemistry on a molecular level, soil and aquatic humic substances were reacted with 15N-labeled NaNO2, and analyzed by liquid phase 15N and 13C nuclear magnetic resonance (NMR). The International Humic Substances Society (IHSS) Pahokee peat and peat humic acid were also reacted with Na15NO2 and analyzed by solid-state 15N NMR. In Suwannee River, Armadale, and Laurentian fulvic acids, phenolic rings and activated methylene groups underwent nitrosation to form nitrosophenols (quinone monoximes) and ketoximes, respectively. The oximes underwent Beckmann rearrangements to 2?? amides, and Beckmann fragmentations to nitriles. The nitriles in turn underwent hydrolysis to 1?? amides. Peaks tentatively identified as imine, indophenol, or azoxybenzene nitrogens were dearly present in spectra of samples nitrosated at pH 6 but diminished at pH 3. The 15N NMR spectrum of the peat humic acid exhibited peaks corresponding with N-nitroso groups in addition to nitrosophenols, ketoximes, and secondary Beckmann reaction products. Formation of N-nitroso groups was more significant in the whole peat compared with the peat humic acid. Carbon-13 NMR analyses also indicated the occurrence of nitrosative demethoxylation in peat and soil humic acids. Reaction of 15N-NH3 fixated fulvic acids with unlabeled NO2- resulted in nitrosative deamination of aminohydroquinone N, suggesting a previously unrecognized pathway for production of N2 gas in soils fertilized with NH3.

Thorn, K. A.; Mikita, M. A.

2000-01-01

350

Dynamics of Photosynthetic CO 2 Fixation: Control, Regulation and Productivity  

Microsoft Academic Search

Biotechnology is providing the tools to dissect complex interacting pathways in plants and also the means to alter plant traits based on understanding these interactions. There has been a concerted and systematic effort to apply these techniques to alter the levels of enzymes involved in the photosynthetic carbon reduction cycle. This has been informative in locating those reactions of the

Steven Gutteridge; Douglas B. Jordan

351

Enhancement of Nitrogen Fixation with Bradyrhizobium japonicum Mutants.  

National Technical Information Service (NTIS)

The objects of the invention are: to provide improved bacterial strains for inoculating leguminous crops to increase symbiotic fixation of atmospheric nitrogen; to enhance the potential of soybeans and other leguminous plants for symbiotic fixation of atm...

L. D. Kuykendall W. J. Hunter

1989-01-01

352

DOC sources and DOC transport pathways in a small headwater catchment as revealed by carbon isotope fluctuation during storm events  

NASA Astrophysics Data System (ADS)

Monitoring the isotopic composition (?13CDOC) of dissolved organic carbon (DOC) during flood events can be helpful for locating DOC sources in catchments and quantifying their relative contribution to stream DOC flux. High-resolution (< hourly basis) ?13CDOC data were obtained during six successive storm events occurring during the high-flow period in a small headwater catchment in western France. Intra-storm ?13CDOC values exhibit a marked temporal variability, with some storms showing large variations (> 2 ‰), and others yielding a very restricted range of values (< 1 ‰). Comparison of these results with previously published data shows that the range of intra-storm ?13CDOC values closely reflects the temporal and spatial variation in ?13CDOC observed in the riparian soils of this catchment during the same period. Using ?13CDOC data in conjunction with hydrometric monitoring and an end-member mixing approach (EMMA), we show that (i) > 80% of the stream DOC flux flows through the most superficial soil horizons of the riparian domain and (ii) the riparian soil DOC flux is comprised of DOC coming ultimately from both riparian and upland domains. Based on its ?13C fingerprint, we find that the upland DOC contribution decreases from ca.~30% of the stream DOC flux at the beginning of the high-flow period to < 10% later in this period. Overall, upland domains contribute significantly to stream DOC export, but act as a size-limited reservoir, whereas soils in the wetland domains act as a near-infinite reservoir. Through this study, we show that ?13CDOC provides a powerful tool for tracing DOC sources and DOC transport mechanisms in headwater catchments, having a high-resolution assessment of temporal and spatial variability.

Lambert, T.; Pierson-Wickmann, A.-C.; Gruau, G.; Jaffrezic, A.; Petitjean, P.; Thibault, J. N.; Jeanneau, L.

2014-06-01

353

Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway  

PubMed Central

Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed by expression in E. coli and purification of Phn-polypeptides. PhnG, PhnH, PhnI, PhnJ, and PhnK copurify as a protein complex by ion-exchange, size-exclusion, and affinity chromatography. The five polypeptides also comigrate in native-PAGE. Cross-linking of the purified protein complex reveals a close proximity of PhnG, PhnI, PhnJ, and PhnK, as these subunits disappear concomitant with the formation of large cross-linked protein complexes. Two molecular forms are identified, a major form of molecular mass of approximately 260 kDa, a minor form of approximately 640 kDa. The stoichiometry of the protein complex is suggested to be PhnG4H2I2J2K. Deletion of individual phn genes reveals that a strain harboring plasmid-borne phnGHIJ produces a protein complex consisting of PhnG, PhnH, PhnI, and PhnJ, whereas a strain harboring plasmid-borne phnGIJK produces a protein complex consisting of PhnG and PhnI. We conclude that phnGHIJK specify a soluble multisubunit protein complex essential for organophosphonate utilization.

Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.; Nabi, Mariah; Stougaard, Jens; Zechel, David L.; Hove-Jensen, Bjarne

2011-01-01

354

Stability with unilateral external fixation in the tibia.  

PubMed

Unilateral external fixation can be used in the provisional or definitive treatment of tibial fractures. A properly applied fixator allows bony and soft tissue stability, whereas an improperly applied fixator achieves neither and can be a hindrance. The principles for the successful application of monolateral external fixation, including the rationale for choosing this type of device, the assembly of its components and deciding on planes of application, are discussed in this article. PMID:18427910

Giotakis, N; Narayan, B

2007-04-01

355

Effect of Fusicoccin on Dark 14CO2 Fixation by Vicia faba Guard Cell Protoplasts 1  

PubMed Central

When Vicia faba guard cell protoplasts were treated with fusicoccin, dark 14CO2 fixation rates increased by as much as 8-fold. Rate increase was saturated with less than 1 micromolar fusicoccin. Even after 6 minutes of dark 14CO2 fixation, more than 95% of the incorporated radioactivity was in stable products derived from carboxylation of phosphoenolpyruvate (about 50% and 30% in malate and aspartate, respectively). The relative distribution of 14C among products and in the C-4 position of malate (initially more than 90% of [14C]malate) was independent of fusicoccin concentration. After incubation in the dark, malate content was higher in protoplasts treated with fusicoccin. A positive correlation was observed between the amounts of 14CO2 fixed and malate content. It was concluded that (a) fusicoccin causes an increase in the rate of dark 14CO2 fixation without alteration of the relative fluxes through pathways by which it is metabolized, (b) fusicoccin causes an increase in malate synthesis, and (c) dark 14CO2 fixation and malate synthesis are mediated by phosphoenolpyruvate carboxylase.

Brown, Peter H.; Outlaw, William H.

1982-01-01

356

Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change  

PubMed Central

Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of “new” nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review.

Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

2014-01-01

357

Benthic N2 fixation in coral reefs and the potential effects of human-induced environmental change.  

PubMed

Tropical coral reefs are among the most productive and diverse ecosystems, despite being surrounded by ocean waters where nutrients are in short supply. Benthic dinitrogen (N2) fixation is a significant internal source of "new" nitrogen (N) in reef ecosystems, but related information appears to be sparse. Here, we review the current state (and gaps) of knowledge on N2 fixation associated with coral reef organisms and their ecosystems. By summarizing the existing literature, we show that benthic N2 fixation is an omnipresent process in tropical reef environments. Highest N2 fixation rates are detected in reef-associated cyanobacterial mats and sea grass meadows, clearly showing the significance of these functional groups, if present, to the input of new N in reef ecosystems. Nonetheless, key benthic organisms such as hard corals also importantly contribute to benthic N2 fixation in the reef. Given the usually high coral coverage of healthy reef systems, these results indicate that benthic symbiotic associations may be more important than previously thought. In fact, mutualisms between carbon (C) and N2 fixers have likely evolved that may enable reef communities to mitigate N limitation. We then explore the potential effects of the increasing human interferences on the process of benthic reef N2 fixation via changes in diazotrophic populations, enzymatic activities, or availability of benthic substrates favorable to these microorganisms. Current knowledge indicates positive effects of ocean acidification, warming, and deoxygenation and negative effects of increased ultraviolet radiation on the amount of N fixed in coral reefs. Eutrophication may either boost or suppress N2 fixation, depending on the nutrient becoming limiting. As N2 fixation appears to play a fundamental role in nutrient-limited reef ecosystems, these assumptions need to be expanded and confirmed by future research efforts addressing the knowledge gaps identified in this review. PMID:24967086

Cardini, Ulisse; Bednarz, Vanessa N; Foster, Rachel A; Wild, Christian

2014-05-01

358

Nonunion after primary treatment of tibia fractures with external fixation  

Microsoft Academic Search

The authors retrospectively reviewed 207 fractures of tibial diaphysis, treated primarily with external fixation without bone grafting. Forty-two fractures (20.3%) resulted in nonunion and required reoperation. Parameters analyzed for their significance for nonunion included, soft tissue damage, energy of injury, method of fracture reduction, type of external fixation frame, supplemental interfragmentary screw fixation, dynamization at the fracture site, and postoperative

N. Papaioannou; D. Mastrokalos; P. J. Papagelopoulos; M. Tyllianakis; J. Athanassopoulos; P. A. Nikiforidis

2001-01-01

359

The biomechanics of wire fixation in the Ilizarov system  

Microsoft Academic Search

The purpose of this study was to establish the optimal fixation of tensioned wires to the frame construct in the Ilizarov system. The usual torque to which the fixation bolts were tightened in clinical practice was established by serial testing of orthopaedic surgeons’ work in our unit.The force required to produce wire slippage from the different types of wire fixation

M. M. Mullins; A. W. Davidson; David Goodier; M. Barry

2003-01-01

360

Femoral lengthening with a rail external fixator: tips and tricks  

PubMed Central

Lengthening the femur with an external fixator is commonly practised for a wide variety of pathologies. This technical report includes tips derived from observation and experience in a busy limb reconstruction unit. It focuses on the use of a rail fixator, although some of the descriptions are applicable to lengthening by circular fixators.

2010-01-01

361

Unfixing Design Fixation: From Cause to Computer Simulation  

ERIC Educational Resources Information Center

This paper argues that design fixation, in part, entails fixation at the level of meta-representation, the representation of the relation between a representation and its reference. In this paper, we present a mathematical model that mimics the idea of how fixation can occur at the meta-representation level. In this model, new abstract concepts…

Dong, Andy; Sarkar, Somwrita

2011-01-01

362

Aerobic nitrogen fixation by the marine non-heterocystous cyanobacterium Trichodesmium (Oscillatoria) spp.: Its protective mechanism against oxygen  

Microsoft Academic Search

Nitrogen fixation (acetylene reduction) by the marine non-heterocystous cyanobacteria, Trichodesmium thiebautii and T. erythraeum, is sensitive to oxygen. Its sensitivity to oxygen was intensified when the colonies of T. thiebautii were disintegrated, but the separate trichomes yielded still retained the capacity for light dependent acetylene reduction. Trichodesmium colonies evolved hydrogen under argon in the light. The addition of carbon monoxide

T. Saino; A. Hattori

1982-01-01

363

Effects of nodular extracts of Alnus glutinosa (L.) Gaertn. on nitrogen fixation (Acetylene reduction assay) and denitrification in different soils  

Microsoft Academic Search

European alder (Alnus glutinosa (L.) Gaertn) nodules were maintained under conditions that allow their exudation (water stress). The effect of this nodular extracts colected on free nitrogen fixation (acetylene reduction assay (ARA)) and denitrification, was evaluated in three soils of significatively different physico-chemical characteristics. The comparisons with controls having different concentrations of glucose as carbon source suggest that, in the

F. J. Gutiérrez Mañero; J. M. Pozuelo González; J. A. Lucas; A. Probanza

364

Biomechanical evaluation of rotator cuff fixation methods  

Microsoft Academic Search

Initial fixation strength and failure mode for various rotator cuff reattachment techniques (variations of the McLaughlin technique) were evaluated. Repair methods included standard suture (control), reinforced suture [expanded polytetrafluoroethylene (PTFE) patch and polydioxanone (PDS) tape augmentation] and stapling (nonarthroscopic and arthroscopic soft-tissue staples). The average strength of intact rotator cuff tissue (su praspinatus tendon) was also determined. The different rotator

E. Paul France; Lonnie E. Paulos; Chris D. Harner; Chris B. Straight

1989-01-01

365

Augmentation of implant fixation in osteoporotic bone.  

PubMed

Osteoporosis presents a dilemma for the orthopedic surgeon. Screw fixation within the bone is crucial for mechanical stabilization, maintenance of reduction, and ultimately, fracture healing. For the patient, soft bones and physiological fragility usually benefit from immediate weight bearing and mobility to avoid further disuse osteoporosis, deconditioning, and immobility. For implant companies, traditional screws, plates, and nails function for simple fractures and compliant patients. Locked plating has improved screw purchase in osteoporotic bone and has expanded fracture fixation capabilities but is not the panacea for all fractures. For orthopedic surgeons, traditional surgical augmentation for osteoporosis consisting of dual plating, augmentation with polymethyl methacrylate, joint replacement, and now locked plating are beneficial. In order to advance orthopedic care in the expanding population of elderly osteoporotic patients, modern solutions utilizing the dual properties of secure fixation and relatively flexible implants are required. Endosteal substitution, extraosteal substitution, and combined nail/plate combinations are methods of utilizing traditional implants in a nontraditional way. Nonsurgical augmentation of fracture fixation is also paramount. PMID:23054960

Jones, Clifford B

2012-12-01

366

Binocular Fixation in the Newborn Baby  

ERIC Educational Resources Information Center

Three experiments are reported in which 15 babies were presented with visual stimuli which varied in shape and distance from the eye. Results indicated that the majority of subjects binocularly fixated all three stimuli and it was concluded that the newborn baby has the basic requirements for binocular vision. (Author/GO)

Slater, Alan M.; Findlay, John M.

1975-01-01

367

The threonine degradation pathway of the Trypanosoma brucei procyclic form: the main carbon source for lipid biosynthesis is under metabolic control  

PubMed Central

The Trypanosoma brucei procyclic form resides within the digestive tract of its insect vector, where it exploits amino acids as carbon sources. Threonine is the amino acid most rapidly consumed by this parasite, however its role is poorly understood. Here, we show that the procyclic trypanosomes grown in rich medium only use glucose and threonine for lipid biosynthesis, with threonine's contribution being ??2.5 times higher than that of glucose. A combination of reverse genetics and NMR analysis of excreted end-products from threonine and glucose metabolism, shows that acetate, which feeds lipid biosynthesis, is also produced primarily from threonine. Interestingly, the first enzymatic step of the threonine degradation pathway, threonine dehydrogenase (TDH, EC 1.1.1.103), is under metabolic control and plays a key role in the rate of catabolism. Indeed, a trypanosome mutant deleted for the phosphoenolpyruvate decarboxylase gene (PEPCK, EC 4.1.1.49) shows a 1.7-fold and twofold decrease of TDH protein level and activity, respectively, associated with a 1.8-fold reduction in threonine-derived acetate production. We conclude that TDH expression is under control and can be downregulated in response to metabolic perturbations, such as in the PEPCK mutant in which the glycolytic metabolic flux was redirected towards acetate production.

Millerioux, Yoann; Ebikeme, Charles; Biran, Marc; Morand, Pauline; Bouyssou, Guillaume; Vincent, Isabel M; Mazet, Muriel; Riviere, Loic; Franconi, Jean-Michel; Burchmore, Richard J S; Moreau, Patrick; Barrett, Michael P; Bringaud, Frederic

2013-01-01

368

Water flow pathway and the organic carbon discharge during rain storm events in a coniferous forested head watershed, Tokyo, central Japan  

NASA Astrophysics Data System (ADS)

The current intense discussion of the green house effect, that has been one of the main focuses on the carbon cycle in environmental systems of the earth, seems to be weakened the importance related to the effect of carbonic materials on substance movement in the aquatic environments; though it has just begun to be referred recently. Because dissolved organic carbon (DOC) in stream flows believes to play a main role of the carbon cycle in the fresh water environment, seasonal changes in DOC discharge were investigated in catchments with various scale and land use, especially in forested catchments which are one of the important sources of DOC. In order to understand the fundamental characteristics of the discharge of dissolved organic materials, stream flows, DOC, and fulvic acid like materials (FA) included in stream flows were measured in a coniferous forested head watershed. The watershed is located at the southeast edge of the Kanto mountain and is 40 km west of Tokyo with the elevation from 720 to 820 m and mean slope gradient of 38 degrees. Geology of the watershed is underlain by the sequence of mud and sand stones in Jurassic and the soil in the watershed is Cambisol (Inceptisols). The watershed composes of a dense cypress and cedar forest of 45 years old with poor understory vegetation. Observations were carried out for 6 rain storms of which the total precipitations ranged between 16.2 and 117.4 mm. The magnitude of the storms was classified into small, middle, and big events on the basis of the total precipitation of around 20, 40, and more than 70 mm. Stream flows were collected during the storm events by 1 hour interval and were passed through the 0.45 ?m filters, and then the DOC concentrations in the flows were measured with a total organic carbon analyzer. The relative concentrations of fulvic acid (FA) in the flows were monitored with three dimensional excitations emission matrix fluorescence spectroscopy, because fulvic acid shows distinctive fluorescence peaks at around the excitation wave length of 340 nm and emission wave length of 440 nm. The timing of the peaks in DOC and FA occurred simultaneously or within 30 minutes prior to those in the stream flows. The relationship between DOC and stream flow showed linear correlations with various gradients in each event. However, the relationship between FA and stream flow showed the linear correlations only for the small and middle events and clockwise hysteresis relations occurred in the big storm events. The relationship between DOC and FA showed the linear correlations both for the extracted water of the shallow soil and for stream base flow composed mostly of groundwater discharge. However, the relationship in the storm flow closely distributed at that in the extracted water of the shallow soil. This thing reveals that DOC and FA were mainly flashed out from the shallow soil during the rain storm events. The quick rising and recession of the fulvic acid was likely provided by quick rain water discharge through the surface or near surface of the slope. However, the overland flow were rare in the watershed during the rain storms. This indicates that the rapid shallow subsurface flow, passed mainly through preferential flow pathways at the slope surface within the loose litter and root-permeated zone, was the main cause of the difference in discharge regimes between DOC and FA. The shallow subsurface flow may have flushed the FA in the near-surface of the soil, and then the relatively predominant discharge of DOC must have been caused during the big rain storm event.

Moriizumi, Mihoko; Terajima, Tomomi

2010-05-01

369

Tacks: a new technique for craniofacial fixation.  

PubMed

Biodegradable fixation in craniofacial surgery provides secure fixation while eliminating much of the concern over intracranial migration of metallic plates and screws. One limitation of present biodegradable systems, however, is the need for tapping the drill hole before screw insertion. Herein, a new method of rigid, biodegradable fixation with tacks (Macrapore, Inc., San Diego, CA) is described. The tacks are made of a 70:30 ratio of the L and DL form of polylactic acid (L,DL-PLA). Degradation times range from 18 to 36 months. Newer prototypes are nearly developed for more rapid dissolution times. From April 1999 to February 2000, tack fixation has been applied in 100 patients (51 males, 49 females aged 3 months to 61 years). Indications for operation were craniosynostosis (n = 33); craniofacial trauma or post-traumatic deformities (n = 11); cleft lip and palate (n = 13); craniofacial syndromes (n = 18); other diagnoses (n = 11). Patients underwent fronto-orbital advancement with cranial reshaping; monobloc osteotomy, open reduction-internal fixation of fractures; hypertelorbitism repair; cranioplasty; stabilization of grafts; major cranial reconstruction; zygomatic advancement; alveolar cleft repair; and iliac bone graft donor site protection. Tacks were also used for temporalis muscle and lateral canthal suspension. Follow-up ranged from 16 to 28 months. Complications occurred in 7 patients, 4 of whom had infections and during debridement had biodegradable implants removed. None of the complications appeared to be related to the use of tacks. The tacks are carried in a specially designed holder and may be placed by hand or with the light tap of a mallet on the tack driver. An automatic driver has been developed. Overall, the performance of the tacks has been excellent. They are easily handled by the nursing personnel and rapidly inserted by the surgeon. Stability appears to be excellent. At this time, it is probably preferable to employ tap and screws for orthognathic surgery or other osteotomies with substantial load bearing. PMID:11711829

Cohen, S R; Holmes, R E; Amis, P; Fitchner, H; Shusterman, E M

2001-11-01

370

Environmental forcing of nitrogen fixation in the eastern tropical and sub-tropical North Atlantic Ocean.  

PubMed

During the winter of 2006 we measured nifH gene abundances, dinitrogen (N(2)) fixation rates and carbon fixation rates in the eastern tropical and sub-tropical North Atlantic Ocean. The dominant diazotrophic phylotypes were filamentous cyanobacteria, which may include Trichodesmium and Katagnymene, with up to 10(6) L(-1)nifH gene copies, unicellular group A cyanobacteria with up to 10(5) L(-1)nifH gene copies and gamma A proteobacteria with up to 10(4) L(-1)nifH gene copies. N(2) fixation rates were low and ranged between 0.032-1.28 nmol N L(-1) d(-1) with a mean of 0.30 ± 0.29 nmol N L(-1) d(-1) (1?, n = 65). CO(2)-fixation rates, representing primary production, appeared to be nitrogen limited as suggested by low dissolved inorganic nitrogen to phosphate ratios (DIN:DIP) of about 2 ± 3.2 in surface waters. Nevertheless, N(2) fixation rates contributed only 0.55 ± 0.87% (range 0.03-5.24%) of the N required for primary production. Boosted regression trees analysis (BRT) showed that the distribution of the gamma A proteobacteria and filamentous cyanobacteria nifH genes was mainly predicted by the distribution of Prochlorococcus, Synechococcus, picoeukaryotes and heterotrophic bacteria. In addition, BRT indicated that multiple a-biotic environmental variables including nutrients DIN, dissolved organic nitrogen (DON) and DIP, trace metals like dissolved aluminum (DAl), as a proxy of dust inputs, dissolved iron (DFe) and Fe-binding ligands as well as oxygen and temperature influenced N(2) fixation rates and the distribution of the dominant diazotrophic phylotypes. Our results suggest that lower predicted oxygen concentrations and higher temperatures due to climate warming may increase N(2) fixation rates. However, the balance between a decreased supply of DIP and DFe from deep waters as a result of more pronounced stratification and an enhanced supply of these nutrients with a predicted increase in deposition of Saharan dust may ultimately determine the consequences of climate warming for N(2) fixation in the North Atlantic. PMID:22174940

Rijkenberg, Micha J A; Langlois, Rebecca J; Mills, Matthew M; Patey, Matthew D; Hill, Polly G; Nielsdóttir, Maria C; Compton, Tanya J; Laroche, Julie; Achterberg, Eric P

2011-01-01

371

Environmental Forcing of Nitrogen Fixation in the Eastern Tropical and Sub-Tropical North Atlantic Ocean  

PubMed Central

During the winter of 2006 we measured nifH gene abundances, dinitrogen (N2) fixation rates and carbon fixation rates in the eastern tropical and sub-tropical North Atlantic Ocean. The dominant diazotrophic phylotypes were filamentous cyanobacteria, which may include Trichodesmium and Katagnymene, with up to 106 L?1 nifH gene copies, unicellular group A cyanobacteria with up to 105 L?1 nifH gene copies and gamma A proteobacteria with up to 104 L?1 nifH gene copies. N2 fixation rates were low and ranged between 0.032–1.28 nmol N L?1 d?1 with a mean of 0.30±0.29 nmol N L?1 d?1 (1?, n?=?65). CO2-fixation rates, representing primary production, appeared to be nitrogen limited as suggested by low dissolved inorganic nitrogen to phosphate ratios (DIN:DIP) of about 2±3.2 in surface waters. Nevertheless, N2 fixation rates contributed only 0.55±0.87% (range 0.03–5.24%) of the N required for primary production. Boosted regression trees analysis (BRT) showed that the distribution of the gamma A proteobacteria and filamentous cyanobacteria nifH genes was mainly predicted by the distribution of Prochlorococcus, Synechococcus, picoeukaryotes and heterotrophic bacteria. In addition, BRT indicated that multiple a-biotic environmental variables including nutrients DIN, dissolved organic nitrogen (DON) and DIP, trace metals like dissolved aluminum (DAl), as a proxy of dust inputs, dissolved iron (DFe) and Fe-binding ligands as well as oxygen and temperature influenced N2 fixation rates and the distribution of the dominant diazotrophic phylotypes. Our results suggest that lower predicted oxygen concentrations and higher temperatures due to climate warming may increase N2 fixation rates. However, the balance between a decreased supply of DIP and DFe from deep waters as a result of more pronounced stratification and an enhanced supply of these nutrients with a predicted increase in deposition of Saharan dust may ultimately determine the consequences of climate warming for N2 fixation in the North Atlantic.

Rijkenberg, Micha J. A.; Langlois, Rebecca J.; Mills, Matthew M.; Patey, Matthew D.; Hill, Polly G.; Nielsdottir, Maria C.; Compton, Tanya J.; LaRoche, Julie; Achterberg, Eric P.

2011-01-01

372

ORV Arthroscopic Reduction and Internal Fixation of Tibial Eminence Fractures  

PubMed Central

Tibial eminence fractures are an uncommon but well-described avulsion of the anterior cruciate ligament. Treatment principles are based on the amount and pattern of fracture displacement. Management has evolved from closed reduction and immobilization to arthroscopic reduction and internal fixation followed by early rehabilitation. Various fixation methods have evolved, ranging from arthroscopic reduction and percutaneous screw fixation to arthroscopic suture repair. We present a technique for arthroscopic reduction and internal fixation using a cannulated drill bit and high-strength suture. This technique facilitates anatomic reduction with uncomplicated tunnel placement and suture passing in an effort to allow strong fixation and early rehabilitation.

Myer, Daniel M.; Purnell, Gregory J.; Caldwell, Paul E.; Pearson, Sara E.

2013-01-01

373

Assessment of visual fixation in vegetative and minimally conscious states  

PubMed Central

Background Visual fixation plays a key role in the differentiation between vegetative state/unresponsive wakefulness (VS/UWS) syndrome and minimally conscious state (MCS). However, the use of different stimuli changes the frequency of visual fixation occured in patients, thereby possibly affecting the accuracy of the diagnosis. In order to establish a standardized assessment of visual fixation in patients in disorders of consciousness (DOC), we compared the frequency of visual fixation elicited by mirror,a ball and a light. Method Visual fixation was assessed in eighty-one post-comatose patients diagnosed with a MCS or VS/UWS. Occurrence of